Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
Unknown	0	broad.mit.edu	37	1	1314474	1314474	+	IGR	DEL	G	-	-	rs140152449		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1314474delG								AURKAIP1 (3656 upstream) : CCNL2 (6617 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	1318117	1318117	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1318117delC								AURKAIP1 (7299 upstream) : CCNL2 (2974 downstream)																																			---	---	---	---
CDK11B	984	broad.mit.edu	37	1	1649524	1649524	+	Intron	DEL	C	-	-	rs145293760	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1649524delC	uc001agv.1	-						CDK11B_uc001ags.1_5'Flank|CDK11B_uc001agt.1_5'Flank|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron|CDK11A_uc009vkr.2_Intron|CDK11A_uc009vks.2_Intron|CDK11A_uc010nys.1_Intron|CDK11A_uc010nyt.1_Intron|CDK11A_uc010nyu.1_Intron|CDK11A_uc009vkt.1_Intron|CDK11A_uc009vku.1_Intron|CDK11A_uc009vkv.1_Intron|CDK11A_uc001aht.1_Intron|CDK11B_uc001ahu.1_Intron|CDK11B_uc001ahv.1_Intron|CDK11B_uc001ahw.1_Intron	NM_033486	NP_277021			cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1																		---	---	---	---
GNB1	2782	broad.mit.edu	37	1	1760333	1760334	+	Intron	INS	-	AC	AC	rs146936443	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1760333_1760334insAC	uc001aif.2	-						GNB1_uc009vky.2_Intron	NM_002074	NP_002065			guanine nucleotide-binding protein, beta-1						cellular response to glucagon stimulus|energy reserve metabolic process|muscarinic acetylcholine receptor signaling pathway|platelet activation|Ras protein signal transduction|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|GTPase binding|signal transducer activity				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	1832582	1832582	+	IGR	DEL	G	-	-	rs4996032	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1832582delG								GNB1 (10087 upstream) : CALML6 (13684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	4234799	4234800	+	IGR	INS	-	G	G	rs148285886	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4234799_4234800insG								LOC100133612 (400922 upstream) : LOC284661 (237311 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	4391795	4391796	+	IGR	INS	-	AT	AT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4391795_4391796insAT								LOC100133612 (557918 upstream) : LOC284661 (80315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5748864	5748865	+	IGR	INS	-	TG	TG	rs149503745	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5748864_5748865insTG								AJAP1 (905014 upstream) : NPHP4 (174005 downstream)																																			---	---	---	---
VAMP3	9341	broad.mit.edu	37	1	7840718	7840718	+	3'UTR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7840718delA	uc001aol.2	+	5						NM_004781	NP_004772			vesicle-associated membrane protein 3						cellular membrane fusion|positive regulation of receptor recycling|protein complex assembly|protein transport|retrograde transport, endosome to Golgi|substrate adhesion-dependent cell spreading|vesicle docking involved in exocytosis	cell junction|clathrin-coated vesicle|integral to membrane|recycling endosome|synapse|synaptosome	protein binding				0	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;6.33e-69)|GBM - Glioblastoma multiforme(8;2.07e-34)|Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.38e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000805)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	11482148	11482148	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11482148delA								UBIAD1 (133658 upstream) : PTCHD2 (57147 downstream)																																			---	---	---	---
TNFRSF1B	7133	broad.mit.edu	37	1	12269191	12269192	+	3'UTR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12269191_12269192delTG	uc001att.2	+	10					TNFRSF1B_uc001atu.2_3'UTR|TNFRSF1B_uc009vnk.2_RNA	NM_001066	NP_001057			tumor necrosis factor receptor 2 precursor						apoptosis	extracellular region|integral to membrane|membrane raft|plasma membrane	tumor necrosis factor receptor activity			liver(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)|Infliximab(DB00065)											OREG0013109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	1	14744981	14744981	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14744981delG								PRDM2 (593409 upstream) : KAZ (180232 downstream)																																			---	---	---	---
FHAD1	114827	broad.mit.edu	37	1	15606050	15606051	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15606050_15606051insA	uc001awb.2	+						FHAD1_uc001awa.1_Intron	NM_052929	NP_443161			forkhead-associated (FHA) phosphopeptide binding											skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	16871456	16871456	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16871456delT								CROCCL2 (52260 upstream) : NBPF1 (18956 downstream)																																			---	---	---	---
NBPF1	55672	broad.mit.edu	37	1	16926227	16926228	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16926227_16926228insT	uc009vos.1	-						NBPF1_uc001aza.3_RNA	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)														---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17106515	17106516	+	Intron	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17106515_17106516delAC	uc009voy.1	+											Homo sapiens mRNA for KIAA0445 protein, partial cds.						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	17794711	17794711	+	IGR	DEL	T	-	-	rs112454854		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17794711delT								RCC2 (28491 upstream) : ARHGEF10L (71619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	18427834	18427857	+	IGR	DEL	TTCCTTCCTTCCTTTCTTCCTTTC	-	-	rs66701517		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18427834_18427857delTTCCTTCCTTCCTTTCTTCCTTTC								ACTL8 (274278 upstream) : IGSF21 (6383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	18713687	18713687	+	IGR	DEL	A	-	-	rs112212307		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18713687delA								IGSF21 (8711 upstream) : KLHDC7A (93737 downstream)																																			---	---	---	---
ALDH4A1	8659	broad.mit.edu	37	1	19218526	19218526	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19218526delA	uc001bbb.2	-						ALDH4A1_uc010ocu.1_5'Flank|ALDH4A1_uc001bbc.2_Intron	NM_170726	NP_733844			aldehyde dehydrogenase 4A1 isoform a precursor						proline biosynthetic process|proline catabolic process	mitochondrial matrix	1-pyrroline-5-carboxylate dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|electron carrier activity				0		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00479)|BRCA - Breast invasive adenocarcinoma(304;3.67e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	NADH(DB00157)													---	---	---	---
PAFAH2	5051	broad.mit.edu	37	1	26293522	26293523	+	Intron	INS	-	A	A	rs71579215		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26293522_26293523insA	uc001bld.3	-						PAFAH2_uc001ble.3_Intron	NM_000437	NP_000428			platelet-activating factor acetylhydrolase 2						lipid catabolic process	cytoplasm	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding			ovary(2)	2		Colorectal(325;3.47e-05)|Lung NSC(340;6.23e-05)|all_lung(284;9.48e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-25)|Colorectal(126;3.57e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00717)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
EXTL1	2134	broad.mit.edu	37	1	26356821	26356822	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26356821_26356822insT	uc001blf.2	+							NM_004455	NP_004446			exostoses-like 1						skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	26535896	26535896	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26535896delT								CATSPER4 (6864 upstream) : CCDC21 (24797 downstream)																																			---	---	---	---
TRNP1	388610	broad.mit.edu	37	1	27324720	27324721	+	Intron	DEL	AG	-	-	rs35905510		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27324720_27324721delAG	uc001bnj.3	+							NM_001013642	NP_001013664			TMF regulated nuclear protein						cell cycle	nucleus					0																		---	---	---	---
RPA2	6118	broad.mit.edu	37	1	28230677	28230677	+	Intron	DEL	A	-	-	rs113123980		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28230677delA	uc001bpe.1	-						RPA2_uc001bpd.1_Intron|RPA2_uc010ofp.1_Intron	NM_002946	NP_002937			replication protein A2, 32kDa						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|regulation of double-strand break repair via homologous recombination|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor A complex|PML body	protein phosphatase binding|single-stranded DNA binding			skin(1)	1		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)									Direct_reversal_of_damage|NER					---	---	---	---
EYA3	2140	broad.mit.edu	37	1	28342198	28342198	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28342198delT	uc001bpi.1	-						EYA3_uc010ofs.1_Intron|EYA3_uc010oft.1_Intron|EYA3_uc001bpj.2_Intron|EYA3_uc001bpk.1_Intron|EYA3_uc010ofu.1_Intron	NM_001990	NP_001981			eyes absent 3						anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity			ovary(2)|skin(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
EPB41	2035	broad.mit.edu	37	1	29237287	29237287	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29237287delT	uc001bri.1	+						EPB41_uc001brg.1_Intron|EPB41_uc001brh.1_Intron|EPB41_uc001brj.1_Intron	NM_203343	NP_976218			erythrocyte membrane protein band 4.1						blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	30569697	30569700	+	IGR	DEL	CAAT	-	-	rs147822423		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30569697_30569700delCAAT								PTPRU (916382 upstream) : MATN1 (614426 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	30874814	30874815	+	IGR	INS	-	TC	TC	rs146527245		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30874814_30874815insTC								None (None upstream) : MATN1 (309311 downstream)																																			---	---	---	---
GRIK3	2899	broad.mit.edu	37	1	37422217	37422218	+	Intron	DEL	GA	-	-	rs147151193		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37422217_37422218delGA	uc001caz.2	-						GRIK3_uc001cba.1_Intron	NM_000831	NP_000822			glutamate receptor, ionotropic, kainate 3						negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	37573993	37573995	+	IGR	DEL	TGG	-	-	rs142917717		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37573993_37573995delTGG								GRIK3 (74149 upstream) : ZC3H12A (366124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	37733797	37733798	+	IGR	INS	-	T	T	rs67205097		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37733797_37733798insT								GRIK3 (233953 upstream) : ZC3H12A (206321 downstream)																																			---	---	---	---
RSPO1	284654	broad.mit.edu	37	1	38078171	38078172	+	3'UTR	INS	-	GT	GT	rs139353088	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38078171_38078172insGT	uc001cbl.1	-	8					RSPO1_uc001cbm.1_3'UTR|RSPO1_uc009vvf.1_3'UTR|RSPO1_uc009vvg.1_3'UTR	NM_001038633	NP_001033722			R-spondin1 precursor						positive regulation of canonical Wnt receptor signaling pathway|regulation of receptor internalization		heparin binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	39428137	39428140	+	IGR	DEL	TCTC	-	-	rs80293518		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39428137_39428140delTCTC								RHBDL2 (20681 upstream) : AKIRIN1 (28776 downstream)																																			---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39664486	39664487	+	Intron	DEL	CT	-	-	rs149299832		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39664486_39664487delCT	uc010ois.1	+						MACF1_uc001cda.1_Intron	NM_012090	NP_036222			microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	41245790	41245791	+	IGR	INS	-	AC	AC	rs3070198		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41245790_41245791insAC								NFYC (8517 upstream) : KCNQ4 (3893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	41821298	41821298	+	IGR	DEL	G	-	-	rs11362319		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41821298delG								SCMH1 (113510 upstream) : EDN2 (123151 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	47980312	47980312	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47980312delT								FOXD2 (73950 upstream) : SKINTL (587075 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	48043605	48043606	+	IGR	INS	-	G	G	rs146123968	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48043605_48043606insG								FOXD2 (137243 upstream) : SKINTL (523781 downstream)																																			---	---	---	---
C8B	732	broad.mit.edu	37	1	57405689	57405690	+	Intron	DEL	GT	-	-	rs35178964		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57405689_57405690delGT	uc001cyp.2	-						C8B_uc010oon.1_Intron|C8B_uc010ooo.1_Intron	NM_000066	NP_000057			complement component 8, beta polypeptide						complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	59438329	59438329	+	IGR	DEL	T	-	-	rs72458607		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59438329delT								JUN (188544 upstream) : LOC729467 (159281 downstream)																																			---	---	---	---
NFIA	4774	broad.mit.edu	37	1	61627083	61627083	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61627083delC	uc001czw.2	+						NFIA_uc001czy.2_Intron|NFIA_uc010oos.1_Intron|NFIA_uc001czv.2_Intron	NM_001134673	NP_001128145			nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	64175206	64175207	+	IGR	DEL	AA	-	-	rs9970270		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64175206_64175207delAA								PGM1 (49292 upstream) : ROR1 (64483 downstream)																																			---	---	---	---
IL23R	149233	broad.mit.edu	37	1	67672589	67672589	+	Intron	DEL	C	-	-	rs111876012		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67672589delC	uc001ddo.2	+						IL23R_uc009waz.2_Intron|IL23R_uc001ddp.2_Intron|IL23R_uc010opi.1_Intron|IL23R_uc010opj.1_Intron|IL23R_uc010opk.1_Intron|IL23R_uc010opl.1_Intron|IL23R_uc010opm.1_Intron|IL23R_uc001ddq.2_Intron|IL23R_uc010opn.1_Intron|IL23R_uc001ddr.2_Intron|IL23R_uc010opo.1_Intron|IL23R_uc010opp.1_Intron|IL23R_uc010opq.1_Intron|IL23R_uc010opr.1_Intron|IL23R_uc010ops.1_Intron|IL23R_uc010opt.1_Intron|IL23R_uc010opu.1_Intron|IL23R_uc010opv.1_Intron|IL23R_uc010opw.1_Intron|IL23R_uc010opx.1_Intron|IL23R_uc010opy.1_Intron|IL23R_uc010opz.1_Intron|IL23R_uc010oqa.1_Intron|IL23R_uc010oqb.1_Intron|IL23R_uc010oqc.1_Intron|IL23R_uc010oqd.1_Intron|IL23R_uc010oqe.1_Intron|IL23R_uc010oqf.1_Intron|IL23R_uc010oqg.1_Intron|IL23R_uc010oqh.1_Intron|IL23R_uc001dds.2_5'Flank|IL23R_uc001ddt.2_5'Flank	NM_144701	NP_653302			interleukin 23 receptor precursor						inflammatory response|negative regulation of interleukin-10 production|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of interleukin-12 production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|response to interferon-gamma|response to lipopolysaccharide	interleukin-23 receptor complex	receptor activity				0																		---	---	---	---
IL12RB2	3595	broad.mit.edu	37	1	67833171	67833174	+	Intron	DEL	CAAA	-	-	rs113892136	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67833171_67833174delCAAA	uc001ddu.2	+						IL12RB2_uc010oqi.1_Intron|IL12RB2_uc010oqj.1_Intron|IL12RB2_uc010oqk.1_Intron|IL12RB2_uc010oql.1_Intron|IL12RB2_uc010oqm.1_Intron|IL12RB2_uc010oqn.1_Intron	NM_001559	NP_001550			interleukin 12 receptor, beta 2 precursor						positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	72937015	72937015	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72937015delA								NEGR1 (188610 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	87318083	87318084	+	IGR	INS	-	T	T	rs140207258		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87318083_87318084insT								SH3GLB1 (104217 upstream) : SEP15 (10046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	98717794	98717794	+	IGR	DEL	A	-	-	rs34976104		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98717794delA								MIR137 (206067 upstream) : SNX7 (409442 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	98909663	98909664	+	IGR	INS	-	TG	TG	rs147077621	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98909663_98909664insTG								MIR137 (397936 upstream) : SNX7 (217572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	104580462	104580463	+	IGR	INS	-	TT	TT	rs112660479		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104580462_104580463insTT								AMY1A (373290 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	111099925	111099926	+	IGR	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111099925_111099926delTT								KCNA10 (38128 upstream) : KCNA2 (36277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	112910947	112910947	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112910947delG								KCND3 (379170 upstream) : CTTNBP2NL (27853 downstream)																																			---	---	---	---
ST7L	54879	broad.mit.edu	37	1	113067471	113067471	+	3'UTR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113067471delA	uc001ecd.2	-	15					ST7L_uc009wgh.2_RNA|ST7L_uc001ecc.2_3'UTR|ST7L_uc010owg.1_3'UTR|ST7L_uc010owh.1_3'UTR|ST7L_uc001ece.2_3'UTR|ST7L_uc001ecf.2_3'UTR|ST7L_uc001ecg.2_RNA	NM_017744	NP_060214			suppression of tumorigenicity 7-like isoform 1						negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	113856579	113856579	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113856579delA								LRIG2 (189237 upstream) : MAGI3 (76896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	118302493	118302493	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118302493delA								FAM46C (131483 upstream) : GDAP2 (103615 downstream)																																			---	---	---	---
SPAG17	200162	broad.mit.edu	37	1	118562532	118562532	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118562532delT	uc001ehk.2	-							NM_206996	NP_996879			sperm associated antigen 17							cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	119846018	119846021	+	IGR	DEL	ACAC	-	-	rs111998986		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119846018_119846021delACAC								WARS2 (162723 upstream) : HAO2 (65381 downstream)																																			---	---	---	---
ZNF697	90874	broad.mit.edu	37	1	120188945	120188946	+	Intron	INS	-	AC	AC	rs71586687		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120188945_120188946insAC	uc001ehy.1	-							NM_001080470	NP_001073939			zinc finger protein 697						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	120917198	120917198	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120917198delT								HIST2H2BA (2356 upstream) : FCGR1B (9711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142611721	142611721	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142611721delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143161518	143161519	+	Intron	INS	-	C	C	rs78859366		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143161518_143161519insC	uc001eiw.1	+						uc001ejf.1_Intron|hsa-mir-3118-2|MI0014132_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143498060	143498060	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143498060delT								None (None upstream) : LOC100286793 (149579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143969614	143969614	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143969614delT	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	144045995	144045996	+	Intron	INS	-	CC	CC	rs147099033	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144045995_144045996insCC	uc010oxm.1	+						uc001eju.1_5'Flank					SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																														---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144681820	144681820	+	Intron	DEL	A	-	-	rs66486087		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144681820delA	uc009wig.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF9_uc009wii.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144853333	144853334	+	Intron	INS	-	AA	AA	rs149112816		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144853333_144853334insAA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144880206	144880206	+	Intron	DEL	C	-	-	rs5777486		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144880206delC	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	145036848	145036849	+	Intron	INS	-	A	A	rs145092781		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145036848_145036849insA	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145057178	145057179	+	Intron	INS	-	AGA	AGA	rs3978504		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145057178_145057179insAGA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145058407	145058408	+	Intron	INS	-	A	A	rs146890997		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145058407_145058408insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145077797	145077797	+	Intron	DEL	A	-	-	rs67787455		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145077797delA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_5'Flank|PDE4DIP_uc001emh.2_5'Flank|PDE4DIP_uc001emk.2_5'Flank					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	146471954	146471954	+	IGR	DEL	A	-	-	rs67168403		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146471954delA								NBPF10 (47859 upstream) : LOC728989 (18941 downstream)																																			---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	147920977	147920977	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147920977delT	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eql.2_Intron|FLJ39739_uc001eqn.2_Intron|FLJ39739_uc009wjx.1_Intron|FLJ39739_uc009wjy.1_Intron|FLJ39739_uc009wjz.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	148220984	148220985	+	Intron	INS	-	T	T	rs140662096		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148220984_148220985insT	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	149688815	149688815	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149688815delG								HIST2H2BF (289586 upstream) : FCGR1A (65435 downstream)																																			---	---	---	---
SETDB1	9869	broad.mit.edu	37	1	150897173	150897174	+	5'Flank	DEL	AA	-	-	rs148668467		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150897173_150897174delAA	uc001evu.2	+						SETDB1_uc009wmf.2_5'Flank|SETDB1_uc001evv.2_5'Flank|SETDB1_uc001evw.3_5'Flank|SETDB1_uc009wmg.1_5'Flank	NM_001145415	NP_001138887			SET domain, bifurcated 1 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
GABPB2	126626	broad.mit.edu	37	1	151079397	151079397	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151079397delT	uc001ewr.2	+						GABPB2_uc001ews.2_Intron|GABPB2_uc001ewt.2_Intron	NM_144618	NP_653219			GA repeat binding protein, beta 2						positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	protein heterodimerization activity|transcription regulatory region DNA binding				0				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	151349883	151349883	+	IGR	DEL	A	-	-	rs112322061		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151349883delA								SELENBP1 (4719 upstream) : PSMB4 (22158 downstream)																																			---	---	---	---
C1orf230	284485	broad.mit.edu	37	1	151700189	151700190	+	Intron	INS	-	CTG	CTG	rs146466255	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151700189_151700190insCTG	uc010pdj.1	+						C1orf230_uc001eyu.2_Intron	NM_001144956	NP_001138428			RIIa domain-containing protein						signal transduction		cAMP-dependent protein kinase regulator activity				0																		---	---	---	---
RORC	6097	broad.mit.edu	37	1	151789608	151789609	+	Intron	DEL	GC	-	-	rs71093213		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151789608_151789609delGC	uc001ezh.2	-						RORC_uc001ezg.2_Intron|RORC_uc010pdo.1_Intron|RORC_uc010pdp.1_Intron	NM_005060	NP_005051			RAR-related orphan receptor C isoform a						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
LCE1E	353135	broad.mit.edu	37	1	152760543	152760544	+	3'UTR	INS	-	T	T	rs144043608	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152760543_152760544insT	uc001fan.2	+	2						NM_178353	NP_848130			late cornified envelope 1E						keratinization						0	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	154346391	154346392	+	IGR	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154346391_154346392delTT								ATP8B2 (22612 upstream) : IL6R (31277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	154677252	154677253	+	IGR	INS	-	T	T	rs10706747		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154677252_154677253insT								ADAR (76815 upstream) : KCNN3 (2664 downstream)																																			---	---	---	---
KCNN3	3782	broad.mit.edu	37	1	154686656	154686658	+	Intron	DEL	GTG	-	-	rs138099065		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154686656_154686658delGTG	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron	NM_002249	NP_002240			small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)															---	---	---	---
DAP3	7818	broad.mit.edu	37	1	155697260	155697260	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155697260delA	uc001flq.2	+						DAP3_uc001flr.2_Intron|DAP3_uc001fls.2_Intron|DAP3_uc010pgl.1_Intron|DAP3_uc001flt.2_Intron|DAP3_uc001flu.2_Intron|DAP3_uc010pgm.1_Intron	NM_033657	NP_387506			death-associated protein 3						induction of apoptosis by extracellular signals	mitochondrial ribosome|nucleolus|small ribosomal subunit	protein binding			ovary(1)	1	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)																	---	---	---	---
RIT1	6016	broad.mit.edu	37	1	155880760	155880761	+	Intron	INS	-	A	A	rs72508348		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155880760_155880761insA	uc001fmh.1	-						RIT1_uc010pgr.1_Intron	NM_006912	NP_008843			Ras-like without CAAX 1						nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			breast(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	157622662	157622662	+	IGR	DEL	A	-	-	rs76874733		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157622662delA								FCRL4 (54792 upstream) : FCRL3 (23616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	159659445	159659445	+	IGR	DEL	T	-	-	rs113669129		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159659445delT								APCS (100785 upstream) : CRP (22635 downstream)																																			---	---	---	---
KCNJ10	3766	broad.mit.edu	37	1	160039060	160039060	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160039060delT	uc001fuw.1	-							NM_002241	NP_002232			potassium inwardly-rectifying channel, subfamily							integral to plasma membrane	ATP binding|ATP-activated inward rectifier potassium channel activity			ovary(1)	1	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---
SLAMF7	57823	broad.mit.edu	37	1	160717693	160717694	+	Intron	INS	-	T	T	rs141817605	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160717693_160717694insT	uc001fwq.2	+						SLAMF7_uc010pjn.1_Intron|SLAMF7_uc001fws.2_Intron|SLAMF7_uc001fwr.2_Intron|SLAMF7_uc010pjo.1_Intron|SLAMF7_uc010pjp.1_Intron|SLAMF7_uc010pjq.1_Intron|SLAMF7_uc010pjr.1_Intron	NM_021181	NP_067004			SLAM family member 7						cell adhesion|natural killer cell activation|natural killer cell mediated cytotoxicity	integral to membrane	receptor activity			skin(2)|ovary(1)	3	all_cancers(52;2.63e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)															---	---	---	---
CD244	51744	broad.mit.edu	37	1	160826688	160826688	+	Intron	DEL	A	-	-	rs112454386		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160826688delA	uc009wtq.2	-						CD244_uc001fxa.2_Intron|CD244_uc009wtp.2_Intron|CD244_uc009wtr.2_Intron|CD244_uc010pjt.1_Intron	NM_016382	NP_057466			CD244 natural killer cell receptor 2B4						blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)															---	---	---	---
ITLN1	55600	broad.mit.edu	37	1	160853940	160853940	+	Intron	DEL	A	-	-	rs71956244		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160853940delA	uc001fxc.2	-							NM_017625	NP_060095			intelectin precursor						positive regulation of glucose import|positive regulation of protein phosphorylation|response to nematode|signal transduction	anchored to membrane|brush border membrane|extracellular region|membrane raft	receptor binding|sugar binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)	7	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	164413488	164413491	+	IGR	DEL	CACG	-	-	rs57542461		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164413488_164413491delCACG								None (None upstream) : PBX1 (115311 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	164902221	164902221	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164902221delA								PBX1 (47921 upstream) : LMX1A (268884 downstream)																																			---	---	---	---
TBX19	9095	broad.mit.edu	37	1	168262523	168262524	+	Intron	INS	-	TGTT	TGTT	rs140890330	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168262523_168262524insTGTT	uc001gfl.2	+						TBX19_uc001gfj.3_Intron	NM_005149	NP_005140			T-box 19						anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	169016602	169016602	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169016602delG								MGC4473 (254482 upstream) : ATP1B1 (59345 downstream)																																			---	---	---	---
C1orf114	57821	broad.mit.edu	37	1	169421345	169421345	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169421345delA	uc009wvq.1	-						uc001ggd.2_Intron	NM_021179	NP_067002			hypothetical protein LOC57821												0	all_hematologic(923;0.208)																	---	---	---	---
KIFAP3	22920	broad.mit.edu	37	1	169967535	169967544	+	Intron	DEL	ATATATACAC	-	-	rs72222577		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169967535_169967544delATATATACAC	uc001ggv.2	-						KIFAP3_uc010plx.1_Intron	NM_014970	NP_055785			kinesin-associated protein 3						blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
C1orf129	80133	broad.mit.edu	37	1	170936923	170936924	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170936923_170936924insT	uc001ghg.2	+						C1orf129_uc009wvy.2_Intron|C1orf129_uc010plz.1_Intron	NM_025063	NP_079339			hypothetical protein LOC80133 isoform 2								binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
DNM3	26052	broad.mit.edu	37	1	171861302	171861303	+	Intron	DEL	TG	-	-	rs148026824		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171861302_171861303delTG	uc001gie.2	+						DNM3_uc001gid.3_Intron|DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384			dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1																		---	---	---	---
GAS5	60674	broad.mit.edu	37	1	173836247	173836248	+	RNA	INS	-	A	A	rs145452199	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173836247_173836248insA	uc001gji.2	-	1		c.1_2insT			GAS5_uc001gjj.2_Intron|GAS5_uc001gjk.2_Intron|SNORD81_uc009wwi.1_5'Flank|SNORD47_uc001gjl.2_5'Flank|SNORD80_uc009wwj.1_5'Flank|SNORD79_uc009wwk.1_5'Flank|SNORD78_uc009wwl.2_5'Flank|SNORD44_uc001gjn.1_5'Flank|SNORD77_uc009wwm.1_5'Flank|SNORD76_uc009wwn.1_5'Flank|SNORD75_uc009wwo.1_5'Flank|ZBTB37_uc001gjp.1_5'Flank|ZBTB37_uc001gjq.3_5'Flank|ZBTB37_uc009wwp.1_5'Flank|ZBTB37_uc001gjr.2_5'Flank					Homo sapiens mRNA; cDNA DKFZp564D0164 (from clone DKFZp564D0164).												0																		---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174851969	174851969	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174851969delT	uc001gjx.2	+						RABGAP1L_uc001gkb.3_Intron|RABGAP1L_uc001gkc.3_Intron|RABGAP1L_uc001gkd.3_Intron|RABGAP1L_uc001gke.3_Intron|RABGAP1L_uc001gkf.2_Intron|RABGAP1L_uc001gkg.2_Intron|RABGAP1L_uc001gkh.3_Intron	NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	175248755	175248756	+	IGR	DEL	GT	-	-	rs5778844		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175248755_175248756delGT								KIAA0040 (86526 upstream) : TNR (43179 downstream)																																			---	---	---	---
ASTN1	460	broad.mit.edu	37	1	177013312	177013313	+	Intron	INS	-	ACAC	ACAC	rs143451178	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177013312_177013313insACAC	uc001glc.2	-						ASTN1_uc001glb.1_Intron|ASTN1_uc001gld.1_Intron|ASTN1_uc009wwx.1_Intron	NM_004319	NP_004310			astrotactin isoform 1						cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15																		---	---	---	---
SOAT1	6646	broad.mit.edu	37	1	179293934	179293937	+	Intron	DEL	GTTT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179293934_179293937delGTTT	uc001gml.2	+						SOAT1_uc010pni.1_Intron|SOAT1_uc001gmm.2_Intron|SOAT1_uc010pnj.1_Intron|SOAT1_uc010pnk.1_Intron	NM_003101	NP_003092			sterol O-acyltransferase 1						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)													---	---	---	---
ACBD6	84320	broad.mit.edu	37	1	180415305	180415305	+	Intron	DEL	T	-	-	rs72441323		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180415305delT	uc001gog.2	-							NM_032360	NP_115736			acyl-coenzyme A binding domain containing 6							cytoplasm|nucleus	fatty-acyl-CoA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	180503904	180503905	+	IGR	INS	-	T	T	rs147619519		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180503904_180503905insT								ACBD6 (31882 upstream) : XPR1 (97241 downstream)																																			---	---	---	---
GLUL	2752	broad.mit.edu	37	1	182358541	182358544	+	Intron	DEL	TTTT	-	-	rs10535077		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182358541_182358544delTTTT	uc001gpa.1	-						GLUL_uc001gpb.1_Intron|GLUL_uc001gpc.1_Intron|GLUL_uc001gpd.1_Intron	NM_001033056	NP_001028228			glutamine synthetase						cell proliferation|glutamine biosynthetic process|neurotransmitter uptake	cytosol|Golgi apparatus|mitochondrion	ATP binding|glutamate decarboxylase activity|glutamate-ammonia ligase activity|identical protein binding				0					Asparaginase(DB00023)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)|L-Methionine(DB00134)													---	---	---	---
C1orf14	81626	broad.mit.edu	37	1	182894070	182894071	+	Intron	INS	-	AAGAAAGA	AAGAAAGA	rs139121410	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182894070_182894071insAAGAAAGA	uc001gpu.2	-						C1orf14_uc001gpv.2_Intron|C1orf14_uc010pnz.1_Intron|C1orf14_uc001gpw.2_Intron	NM_030933	NP_112195			chromosome 1 open reading frame 14												0				Colorectal(1306;1.64e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00267)														---	---	---	---
GLT25D2	23127	broad.mit.edu	37	1	184006890	184006891	+	5'Flank	INS	-	GA	GA	rs145188965	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184006890_184006891insGA	uc001gqr.2	-						GLT25D2_uc010poj.1_5'Flank|GLT25D2_uc001gqs.2_5'Flank	NM_015101	NP_055916			glycosyltransferase 25 domain containing 2						lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity			ovary(1)|breast(1)	2																		---	---	---	---
FAM129A	116496	broad.mit.edu	37	1	184871436	184871436	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184871436delC	uc001gra.2	-						FAM129A_uc009wyh.1_Intron|FAM129A_uc009wyi.1_Intron	NM_052966	NP_443198			niban protein isoform 2						negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	188938025	188938025	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188938025delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191824788	191824788	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191824788delT								None (None upstream) : RGS18 (302804 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	195570610	195570610	+	IGR	DEL	T	-	-	rs66533870		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195570610delT								None (None upstream) : KCNT2 (624303 downstream)																																			---	---	---	---
ASPM	259266	broad.mit.edu	37	1	197097473	197097474	+	Intron	INS	-	A	A	rs80274477		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197097473_197097474insA	uc001gtu.2	-						ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606			asp (abnormal spindle)-like, microcephaly						mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	198436903	198436912	+	IGR	DEL	TGTGTGTTTG	-	-	rs35361926	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198436903_198436912delTGTGTGTTTG								NEK7 (145357 upstream) : ATP6V1G3 (55444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	199943831	199943831	+	IGR	DEL	A	-	-	rs34571772		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199943831delA								None (None upstream) : NR5A2 (52939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	203334016	203334016	+	IGR	DEL	A	-	-	rs11332639		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203334016delA								FMOD (13727 upstream) : PRELP (110867 downstream)																																			---	---	---	---
NFASC	23114	broad.mit.edu	37	1	204902875	204902875	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204902875delA	uc001hbj.2	+						NFASC_uc001hbh.2_Intron|NFASC_uc010pqz.1_Intron|NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron|NFASC_uc009xbg.1_Intron	NM_001005388	NP_001005388			neurofascin isoform 1 precursor						axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)															---	---	---	---
LEMD1	93273	broad.mit.edu	37	1	205377203	205377204	+	Intron	DEL	AA	-	-	rs148565405		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205377203_205377204delAA	uc001hcj.1	-						LEMD1_uc001hci.1_Intron|LEMD1_uc001hck.1_Intron|LEMD1_uc001hcl.1_Intron|LEMD1_uc001hcm.1_Intron|LEMD1_uc001hcn.1_Intron					RecName: Full=LEM domain-containing protein 1;          Short=LEMP-1; AltName: Full=Cancer/testis antigen 50;          Short=CT50;							integral to membrane|nuclear envelope					0	Breast(84;0.247)		BRCA - Breast invasive adenocarcinoma(75;0.0938)															---	---	---	---
CDK18	5129	broad.mit.edu	37	1	205473728	205473729	+	5'UTR	INS	-	TCC	TCC	rs143735528	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205473728_205473729insTCC	uc001hcr.2	+	1					CDK18_uc009xbk.1_RNA|CDK18_uc009xbl.1_RNA|CDK18_uc010pri.1_5'UTR|CDK18_uc001hcp.2_5'UTR|CDK18_uc001hcq.2_5'UTR|CDK18_uc010prj.1_5'UTR	NM_212503	NP_997668			PCTAIRE protein kinase 3 isoform a								ATP binding|cyclin-dependent protein kinase activity|protein binding|signal transducer activity			stomach(2)	2																		---	---	---	---
FAIM3	9214	broad.mit.edu	37	1	207097912	207097913	+	5'Flank	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207097912_207097913delGT	uc001hey.2	-						FAIM3_uc010prz.1_5'Flank|FAIM3_uc010psa.1_5'Flank|FAIM3_uc010psb.1_5'Flank	NM_005449	NP_005440			Fas apoptotic inhibitory molecule 3 isoform a						anti-apoptosis|cellular defense response	integral to membrane				central_nervous_system(1)	1	Breast(84;0.201)																	---	---	---	---
ATF3	467	broad.mit.edu	37	1	212761987	212761989	+	Intron	DEL	AAA	-	-	rs72073183		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212761987_212761989delAAA	uc001hjf.2	+							NM_001030287	NP_001025458			activating transcription factor 3 isoform 1							nucleolus	identical protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00628)|all cancers(67;0.0097)|GBM - Glioblastoma multiforme(131;0.0388)|Epithelial(68;0.0933)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	214741625	214741626	+	IGR	INS	-	AAC	AAC	rs149466620	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214741625_214741626insAAC								PTPN14 (16983 upstream) : CENPF (34906 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	215072449	215072449	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215072449delT								CENPF (234537 upstream) : KCNK2 (106436 downstream)																																			---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	216780748	216780749	+	Intron	INS	-	C	C	rs147901555	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216780748_216780749insC	uc001hkw.1	-						ESRRG_uc001hky.1_Intron|ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron|ESRRG_uc001hkx.1_Intron|ESRRG_uc009xdo.1_Intron|ESRRG_uc001hle.1_Intron	NM_001438	NP_001429			estrogen-related receptor gamma isoform 1						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	219507869	219507870	+	IGR	DEL	GT	-	-	rs72141319		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219507869_219507870delGT								LYPLAL1 (121663 upstream) : SLC30A10 (350899 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	222156525	222156526	+	IGR	INS	-	GT	GT	rs138149258	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222156525_222156526insGT								DUSP10 (241064 upstream) : HHIPL2 (539076 downstream)																																			---	---	---	---
FAM177B	400823	broad.mit.edu	37	1	222917815	222917815	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222917815delA	uc001hnt.2	+						uc001hnr.1_Intron|FAM177B_uc009xeb.2_Intron	NM_207468	NP_997351			hypothetical protein LOC400823											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	223002788	223002788	+	IGR	DEL	G	-	-	rs78985181		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223002788delG								FAM177B (78787 upstream) : DISP1 (98995 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	223373262	223373263	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223373262_223373263insT								TLR5 (56638 upstream) : SUSD4 (20900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	223389048	223389049	+	IGR	INS	-	G	G	rs141456611	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223389048_223389049insG								TLR5 (72424 upstream) : SUSD4 (5114 downstream)																																			---	---	---	---
PSEN2	5664	broad.mit.edu	37	1	227068243	227068246	+	Intron	DEL	GACA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227068243_227068246delGACA	uc009xeo.1	+						PSEN2_uc009xep.1_Intron|PSEN2_uc001hqk.2_Intron	NM_000447	NP_000438			presenilin 2 isoform 1						amyloid precursor protein catabolic process|anti-apoptosis|apoptosis|beta-amyloid metabolic process|calcium ion transport|induction of apoptosis by extracellular signals|intracellular signal transduction|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear inner membrane|perinuclear region of cytoplasm|Z disc	aspartic-type endopeptidase activity|protein binding			lung(2)	2		Prostate(94;0.0771)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	227175968	227175970	+	IGR	DEL	TCT	-	-	rs10586161		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227175968_227175970delTCT								CABC1 (722 upstream) : CDC42BPA (1597 downstream)																																			---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227177883	227177884	+	3'UTR	INS	-	ACA	ACA	rs143046609	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227177883_227177884insACA	uc001hqr.2	-	36					CDC42BPA_uc001hqq.2_3'UTR|CDC42BPA_uc001hqs.2_3'UTR|CDC42BPA_uc009xes.2_3'UTR|CDC42BPA_uc010pvs.1_3'UTR|CDC42BPA_uc001hqp.2_3'UTR	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	229330777	229330778	+	IGR	DEL	AT	-	-	rs145588423		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229330777_229330778delAT								RHOU (448368 upstream) : RAB4A (76101 downstream)																																			---	---	---	---
GALNT2	2590	broad.mit.edu	37	1	230258362	230258363	+	Intron	DEL	TG	-	-	rs5781568		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230258362_230258363delTG	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472			polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	233021862	233021866	+	IGR	DEL	TCCTC	-	-	rs71731132		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233021862_233021866delTCCTC								KIAA1383 (75770 upstream) : C1orf57 (64504 downstream)																																			---	---	---	---
PCNXL2	80003	broad.mit.edu	37	1	233431748	233431748	+	5'Flank	DEL	C	-	-	rs1294350		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233431748delC	uc001hvl.2	-							NM_014801	NP_055616			pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	234635298	234635299	+	IGR	INS	-	T	T	rs143797222	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234635298_234635299insT								TARBP1 (20449 upstream) : IRF2BP2 (104718 downstream)																																	OREG0014332	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
GNG4	2786	broad.mit.edu	37	1	235759492	235759493	+	Intron	INS	-	AAAC	AAAC	rs141835628	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235759492_235759493insAAAC	uc001hxe.3	-						GNG4_uc009xfz.2_Intron|GNG4_uc001hxh.3_Intron	NM_001098722	NP_001092192			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|negative regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00168)|Prostate(94;0.0776)|Acute lymphoblastic leukemia(190;0.23)	OV - Ovarian serous cystadenocarcinoma(106;0.000882)															---	---	---	---
NID1	4811	broad.mit.edu	37	1	236215904	236215904	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236215904delA	uc001hxo.2	-						NID1_uc009xgd.2_Intron	NM_002508	NP_002499			nidogen 1 precursor						cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	239525866	239525867	+	IGR	DEL	CA	-	-	rs140894770		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239525866_239525867delCA								LOC339535 (876549 upstream) : CHRM3 (23998 downstream)																																			---	---	---	---
CHRM3	1131	broad.mit.edu	37	1	239971119	239971124	+	Intron	DEL	CACACA	-	-	rs58021604	byFrequency	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239971119_239971124delCACACA	uc001hyp.2	+						CHRM3_uc001hyo.1_Intron	NM_000740	NP_000731			cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)													---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240487993	240487996	+	Intron	DEL	GAGG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240487993_240487996delGAGG	uc010pyd.1	+						FMN2_uc010pye.1_Intron|FMN2_uc010pyf.1_Intron|FMN2_uc010pyg.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240523413	240523413	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240523413delA	uc010pyd.1	+						FMN2_uc010pye.1_Intron|FMN2_uc010pyf.1_Intron|FMN2_uc010pyg.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240603131	240603131	+	Intron	DEL	T	-	-	rs34554272		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240603131delT	uc010pyd.1	+						FMN2_uc010pye.1_Intron|FMN2_uc010pyg.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	242958622	242958625	+	IGR	DEL	TGTG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242958622_242958625delTGTG								PLD5 (270624 upstream) : CEP170 (329106 downstream)																																			---	---	---	---
CEP170	9859	broad.mit.edu	37	1	243383711	243383712	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243383711_243383712insA	uc001hzs.2	-						CEP170_uc001hzt.2_Intron|CEP170_uc001hzu.2_Intron	NM_014812	NP_055627			centrosomal protein 170kDa isoform alpha							centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	244300432	244300433	+	IGR	INS	-	TG	TG	rs139147257	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244300432_244300433insTG								ZNF238 (79656 upstream) : C1orf100 (215504 downstream)																																			---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245671843	245671843	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245671843delT	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron|KIF26B_uc001ibg.1_5'Flank	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	246023449	246023454	+	Intron	DEL	CAGTGC	-	-	rs68052983		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246023449_246023454delCAGTGC	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron|SMYD3_uc001ibi.2_Intron|SMYD3_uc001ibj.2_Intron	NM_022743	NP_073580			SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	246489707	246489707	+	Intron	DEL	A	-	-	rs66465718		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246489707delA	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron	NM_022743	NP_073580			SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	248552409	248552409	+	IGR	DEL	A	-	-	rs33983054		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248552409delA								OR2T6 (573 upstream) : OR2T1 (16887 downstream)																																			---	---	---	---
SH3BP5L	80851	broad.mit.edu	37	1	249117442	249117443	+	Intron	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249117442_249117443delAC	uc001iew.1	-						SH3BP5L_uc001iev.1_Intron	NM_030645	NP_085148			SH3-binding domain protein 5-like												0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	907829	907830	+	5'Flank	INS	-	CTC	CTC	rs143845234	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:907829_907830insCTC	uc010ewg.2	-						uc010ewh.1_5'Flank					Homo sapiens cDNA FLJ46162 fis, clone TESTI4002520.																														---	---	---	---
SNTG2	54221	broad.mit.edu	37	2	997861	997861	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:997861delG	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841			syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)														---	---	---	---
SNTG2	54221	broad.mit.edu	37	2	1097303	1097304	+	Intron	INS	-	C	C	rs72532429		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1097303_1097304insC	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841			syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	1600706	1600707	+	IGR	DEL	GC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1600706_1600707delGC								TPO (54208 upstream) : PXDN (34953 downstream)																																			---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	1870219	1870232	+	Intron	DEL	AGAGAGAGAGAGGC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1870219_1870232delAGAGAGAGAGAGGC	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	3128633	3128633	+	Intron	DEL	T	-	-	rs11440145		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3128633delT	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	4052867	4052867	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4052867delA								ALLC (302609 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	4154503	4154505	+	IGR	DEL	AAC	-	-	rs67243384		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4154503_4154505delAAC								ALLC (404245 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	4647764	4647765	+	IGR	INS	-	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4647764_4647765insC								ALLC (897506 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7641881	7641882	+	IGR	DEL	AC	-	-	rs13028717		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7641881_7641882delAC								RNF144A (457574 upstream) : LOC339788 (420676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7866299	7866300	+	IGR	INS	-	GT	GT	rs139124632	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7866299_7866300insGT								RNF144A (681992 upstream) : LOC339788 (196258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	8441802	8441803	+	Intron	INS	-	C	C	rs150190021	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8441802_8441803insC	uc010eww.1	-						uc002qyy.1_Intron					Homo sapiens cDNA FLJ45673 fis, clone D9OST2003989.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	8542619	8542623	+	IGR	DEL	ATGGC	-	-	rs147833975		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8542619_8542623delATGGC								LOC339788 (425642 upstream) : ID2 (276717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	8575070	8575071	+	IGR	INS	-	T	T	rs147578619	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8575070_8575071insT								LOC339788 (458093 upstream) : ID2 (244269 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	9805862	9805862	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9805862delA								YWHAQ (34756 upstream) : TAF1B (177709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13883003	13883004	+	Intron	INS	-	T	T	rs147323203	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13883003_13883004insT	uc002rbx.1	+											full-length cDNA clone CS0DC027YN23 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	14009063	14009066	+	IGR	DEL	TCTC	-	-	rs137959427		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14009063_14009066delTCTC								None (None upstream) : FAM84A (763790 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	15303922	15303922	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15303922delT								FAM84A (512989 upstream) : NBAS (3110 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	15826410	15826411	+	IGR	INS	-	AAG	AAG	rs140154223	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15826410_15826411insAAG								DDX1 (55186 upstream) : MYCNOS (253609 downstream)																																			---	---	---	---
FAM49A	81553	broad.mit.edu	37	2	16787651	16787654	+	Intron	DEL	TCTC	-	-	rs71983601		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16787651_16787654delTCTC	uc010exm.1	-						FAM49A_uc002rck.1_Intron	NM_030797	NP_110424			family with sequence similarity 49, member A							intracellular					0	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)															---	---	---	---
FAM49A	81553	broad.mit.edu	37	2	16809431	16809432	+	Intron	INS	-	AAC	AAC	rs142875440	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16809431_16809432insAAC	uc002rck.1	-							NM_030797	NP_110424			family with sequence similarity 49, member A							intracellular					0	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	19524021	19524022	+	IGR	INS	-	GA	GA	rs148916823	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19524021_19524022insGA								NT5C1B (753183 upstream) : OSR1 (27225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	21394368	21394369	+	IGR	INS	-	AAG	AAG	rs138475395	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21394368_21394369insAAG								APOB (127423 upstream) : None (None downstream)																																			---	---	---	---
ATAD2B	54454	broad.mit.edu	37	2	24110911	24110912	+	Intron	INS	-	A	A	rs145193037	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24110911_24110912insA	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc010exx.1_Intron	NM_017552	NP_060022			ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
ADCY3	109	broad.mit.edu	37	2	25049617	25049618	+	Intron	DEL	TA	-	-	rs72039465		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25049617_25049618delTA	uc002rfs.3	-						ADCY3_uc002rfr.3_Intron|ADCY3_uc010ykm.1_Intron	NM_004036	NP_004027			adenylate cyclase 3						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)															OREG0014498	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	2	26122142	26122142	+	IGR	DEL	A	-	-	rs71399332		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26122142delA								ASXL2 (20830 upstream) : KIF3C (27313 downstream)																																			---	---	---	---
MRPL33	9553	broad.mit.edu	37	2	28001306	28001307	+	Intron	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28001306_28001307delGT	uc002rlm.1	+						MRPL33_uc002rln.1_Intron	NM_004891	NP_004882			mitochondrial ribosomal protein L33 isoform a						translation	mitochondrion|ribosome	structural constituent of ribosome				0	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	28689025	28689034	+	IGR	DEL	TCTCTCTCTG	-	-	rs66842736		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28689025_28689034delTCTCTCTCTG								FOSL2 (51511 upstream) : PLB1 (29948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	28876254	28876255	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28876254_28876255insA								PLB1 (9641 upstream) : PPP1CB (98357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	28882219	28882220	+	IGR	INS	-	TAGT	TAGT	rs140259371	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28882219_28882220insTAGT								PLB1 (15606 upstream) : PPP1CB (92392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	32063600	32063601	+	IGR	INS	-	A	A	rs113328065		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32063600_32063601insA								SRD5A2 (257560 upstream) : MEMO1 (29295 downstream)																																			---	---	---	---
SLC30A6	55676	broad.mit.edu	37	2	32410425	32410425	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32410425delA	uc002roe.1	+						SLC30A6_uc002rof.1_Intron|SLC30A6_uc010ymw.1_Intron|SLC30A6_uc010ezr.1_Intron|SLC30A6_uc002rog.1_Intron|SLC30A6_uc010ezs.1_Intron|SLC30A6_uc002roh.1_Intron	NM_017964	NP_060434			solute carrier family 30 (zinc transporter),							Golgi membrane|integral to membrane	zinc ion transmembrane transporter activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)																	---	---	---	---
TTC27	55622	broad.mit.edu	37	2	32942617	32942617	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32942617delT	uc002rom.2	+						TTC27_uc010ymx.1_Intron	NM_017735	NP_060205			tetratricopeptide repeat domain 27								protein binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	34375046	34375047	+	IGR	DEL	AA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34375046_34375047delAA								MYADML (421762 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	35012289	35012290	+	IGR	INS	-	A	A	rs148478573	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35012289_35012290insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	35249982	35249983	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35249982_35249983insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	35836479	35836479	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35836479delT								None (None upstream) : CRIM1 (746918 downstream)																																			---	---	---	---
VIT	5212	broad.mit.edu	37	2	37031975	37031976	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37031975_37031976insA	uc002rpl.2	+						VIT_uc002rpm.2_Intron|VIT_uc010ezv.2_Intron|VIT_uc010ezw.2_Intron	NM_053276	NP_444506			vitrin							proteinaceous extracellular matrix				ovary(1)|pancreas(1)	2		all_hematologic(82;0.248)																---	---	---	---
FAM82A1	151393	broad.mit.edu	37	2	38205920	38205921	+	Intron	INS	-	AGAT	AGAT	rs142578591	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38205920_38205921insAGAT	uc002rql.2	+						FAM82A1_uc002rqn.1_Intron|FAM82A1_uc002rqk.1_Intron|FAM82A1_uc002rqm.2_Intron	NM_144713	NP_653314			family with sequence similarity 82, member A1							cytoplasm|integral to membrane|microtubule|spindle pole	binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	38737469	38737469	+	IGR	DEL	A	-	-	rs138905828		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38737469delA								ATL2 (133037 upstream) : HNRPLL (52859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	39685610	39685611	+	Intron	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39685610_39685611delAC	uc002rrq.2	+						uc002rrr.1_Intron					Homo sapiens cDNA FLJ33477 fis, clone BRAMY2002604.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	40062164	40062164	+	IGR	DEL	T	-	-	rs71404257		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40062164delT								THUMPD2 (55748 upstream) : SLC8A1 (277123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42631441	42631443	+	IGR	DEL	GAA	-	-	rs71949482		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42631441_42631443delGAA								COX7A2L (35291 upstream) : KCNG3 (37716 downstream)																																			---	---	---	---
THADA	63892	broad.mit.edu	37	2	43793963	43793964	+	Intron	INS	-	AA	AA			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43793963_43793964insAA	uc002rsw.3	-						THADA_uc010far.2_Intron|THADA_uc002rsx.3_Intron|THADA_uc002rsy.3_Intron|THADA_uc010fas.1_Intron|THADA_uc002rsz.2_Intron|THADA_uc010fat.1_Intron|THADA_uc002rta.2_Intron|THADA_uc002rtb.1_Intron|THADA_uc002rtc.3_Intron|THADA_uc002rtd.2_Intron	NM_001083953	NP_001077422			thyroid adenoma associated								binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	44301379	44301380	+	IGR	DEL	CA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44301379_44301380delCA								LRPPRC (78235 upstream) : PPM1B (94620 downstream)																																			---	---	---	---
SRBD1	55133	broad.mit.edu	37	2	45839002	45839002	+	5'Flank	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45839002delT	uc002rus.2	-							NM_018079	NP_060549			S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	47494753	47494753	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47494753delA	uc002rvu.1	-											Homo sapiens cDNA FLJ37024 fis, clone BRACE2010837.									p.?(1)																					---	---	---	---
Unknown	0	broad.mit.edu	37	2	52625078	52625079	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52625078_52625079insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	52880061	52880061	+	IGR	DEL	G	-	-	rs138682273	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52880061delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	52923066	52923067	+	IGR	INS	-	T	T	rs113477785		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52923066_52923067insT								None (None upstream) : ASB3 (974051 downstream)																																			---	---	---	---
MTIF2	4528	broad.mit.edu	37	2	55483020	55483021	+	Intron	INS	-	T	T	rs2589094	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55483020_55483021insT	uc002ryn.2	-						MTIF2_uc010yox.1_Intron|MTIF2_uc002ryo.2_Intron	NM_001005369	NP_001005369			mitochondrial translational initiation factor 2						regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity			ovary(1)	1																		---	---	---	---
MTIF2	4528	broad.mit.edu	37	2	55486116	55486116	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55486116delA	uc002ryn.2	-						MTIF2_uc010yox.1_Intron|MTIF2_uc002ryo.2_Intron	NM_001005369	NP_001005369			mitochondrial translational initiation factor 2						regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	55943594	55943595	+	IGR	INS	-	TT	TT	rs13007405		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55943594_55943595insTT								PNPT1 (22583 upstream) : EFEMP1 (149508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	58745069	58745069	+	5'Flank	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58745069delT	uc002rzy.2	+											Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	59875234	59875235	+	IGR	INS	-	AAC	AAC	rs150769941	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59875234_59875235insAAC								None (None upstream) : BCL11A (803068 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	60163598	60163599	+	IGR	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60163598_60163599delGT								None (None upstream) : BCL11A (514704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	61837546	61837546	+	IGR	DEL	A	-	-	rs79307601		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61837546delA								XPO1 (72128 upstream) : FAM161A (214439 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	62409466	62409467	+	IGR	DEL	TG	-	-	rs111385932		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62409466_62409467delTG								COMMD1 (46262 upstream) : B3GNT2 (13795 downstream)																																			---	---	---	---
C2orf86	51057	broad.mit.edu	37	2	63480559	63480559	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63480559delA	uc002sch.2	-						C2orf86_uc002sce.2_Intron|C2orf86_uc002scf.2_Intron|C2orf86_uc010ypu.1_Intron|C2orf86_uc002scg.2_Intron	NM_015910	NP_056994			hypothetical protein LOC51057 isoform 2						cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	63995474	63995474	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63995474delT								LOC388955 (145315 upstream) : UGP2 (72624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	66556894	66556895	+	IGR	INS	-	A	A	rs150147317	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66556894_66556895insA								SPRED2 (897238 upstream) : MEIS1 (105637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	66637037	66637038	+	IGR	INS	-	G	G	rs36021620	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66637037_66637038insG								SPRED2 (977381 upstream) : MEIS1 (25494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	66850949	66850950	+	IGR	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66850949_66850950delTT								MEIS1 (51059 upstream) : ETAA1 (773492 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	67977367	67977368	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67977367_67977368insT								ETAA1 (339834 upstream) : C1D (291965 downstream)																																			---	---	---	---
CNRIP1	25927	broad.mit.edu	37	2	68513450	68513451	+	Intron	DEL	AC	-	-	rs141266342		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68513450_68513451delAC	uc002sej.3	-							NM_001111101	NP_001104571			cannabinoid receptor interacting protein 1								protein binding			liver(1)	1																		---	---	---	---
AAK1	22848	broad.mit.edu	37	2	69823354	69823354	+	Intron	DEL	T	-	-	rs11373852		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69823354delT	uc002sfp.2	-						AAK1_uc010fdk.2_Intron|AAK1_uc010yqm.1_Intron|AAK1_uc010fdm.1_Intron	NM_014911	NP_055726			AP2 associated kinase 1							coated pit|mitochondrion|plasma membrane	ATP binding|protein serine/threonine kinase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	70628006	70628006	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70628006delT								FAM136A (98786 upstream) : TGFA (46413 downstream)																																			---	---	---	---
CLEC4F	165530	broad.mit.edu	37	2	71046116	71046117	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71046116_71046117insA	uc002shf.2	-						CLEC4F_uc010yqv.1_Intron	NM_173535	NP_775806			C-type lectin, superfamily member 13						endocytosis	integral to membrane	receptor activity|sugar binding			ovary(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	73362426	73362427	+	IGR	INS	-	AAGG	AAGG			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73362426_73362427insAAGG								RAB11FIP5 (22280 upstream) : NOTO (66959 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	73524112	73524113	+	IGR	DEL	GT	-	-	rs67009065		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73524112_73524113delGT								EGR4 (3283 upstream) : ALMS1 (88773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	75478857	75478858	+	IGR	INS	-	ACAACTTT	ACAACTTT	rs142821201	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75478857_75478858insACAACTTT								TACR1 (52212 upstream) : FAM176A (240586 downstream)																																			---	---	---	---
LRRTM4	80059	broad.mit.edu	37	2	77048030	77048045	+	Intron	DEL	TGGAGGCTGTGAAAAT	-	-	rs67078023		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77048030_77048045delTGGAGGCTGTGAAAAT	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217			leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	78026741	78026742	+	IGR	INS	-	TTTG	TTTG	rs150392770	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78026741_78026742insTTTG								LRRTM4 (277239 upstream) : SNAR-H (155291 downstream)																																			---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80673732	80673733	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80673732_80673733insA	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	82395115	82395115	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82395115delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	82638215	82638216	+	IGR	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82638215_82638216delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	82714428	82714429	+	IGR	DEL	GT	-	-	rs111718419		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82714428_82714429delGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	85116934	85116934	+	IGR	DEL	A	-	-	rs35890132		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85116934delA								C2orf89 (8682 upstream) : TMSB10 (15829 downstream)																																			---	---	---	---
REEP1	65055	broad.mit.edu	37	2	86450859	86450860	+	Intron	DEL	TC	-	-	rs72394387		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86450859_86450860delTC	uc002srh.3	-						REEP1_uc010ytg.1_Intron|REEP1_uc010yth.1_Intron|REEP1_uc010yti.1_Intron	NM_022912	NP_075063			receptor accessory protein 1 isoform 2						cell death|protein insertion into membrane	integral to membrane|mitochondrial membrane	olfactory receptor binding				0																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87051304	87051311	+	Intron	DEL	CAATGCTT	-	-	rs5832696		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87051304_87051311delCAATGCTT	uc002srs.3	+						CD8B_uc002srw.2_Intron|CD8B_uc002srx.2_Intron|CD8B_uc002sry.2_Intron|CD8B_uc010fgt.2_Intron					SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87644152	87644152	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87644152delG	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
SMYD1	150572	broad.mit.edu	37	2	88383630	88383630	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88383630delA	uc002ssr.2	+						SMYD1_uc002ssq.1_Intron	NM_198274	NP_938015			SET and MYND domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	88538384	88538385	+	IGR	INS	-	GGGA	GGGA	rs150519519	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88538384_88538385insGGGA								THNSL2 (52239 upstream) : FOXI3 (209341 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	89871291	89871292	+	IGR	INS	-	ATTCC	ATTCC			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89871291_89871292insATTCC								FLJ40330 (765166 upstream) : None (None downstream)																																			---	---	---	---
LOC654342	654342	broad.mit.edu	37	2	91847507	91847508	+	Intron	INS	-	GG	GG	rs138679921	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91847507_91847508insGG	uc002sts.3	-						LOC654342_uc002stt.2_Intron|LOC654342_uc010yub.1_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	91919175	91919176	+	IGR	INS	-	G	G	rs143021810	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91919175_91919176insG								LOC654342 (71200 upstream) : GGT8P (44192 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	95678522	95678523	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95678522_95678523insA								TEKT4 (135954 upstream) : MAL (12956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	95959984	95959985	+	IGR	DEL	CT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95959984_95959985delCT								PROM2 (2931 upstream) : KCNIP3 (3087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	96084833	96084833	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96084833delC								FAHD2A (5955 upstream) : TRIM43 (172933 downstream)																																			---	---	---	---
TRIM43	129868	broad.mit.edu	37	2	96265407	96265408	+	3'UTR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96265407_96265408insT	uc002suv.2	+	7						NM_138800	NP_620155			tripartite motif-containing 43							intracellular	zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	96631529	96631530	+	Intron	DEL	AT	-	-	rs145122711		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96631529_96631530delAT	uc010yug.1	-											Homo sapiens cDNA FLJ54441 complete cds, highly similar to Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA.																														---	---	---	---
ANKRD36	375248	broad.mit.edu	37	2	97819021	97819022	+	Intron	INS	-	A	A	rs142216424	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97819021_97819022insA	uc010yva.1	+						ANKRD36_uc010yuz.1_Intron|ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron	NM_001164315	NP_001157787			ankyrin repeat domain 36												0																		---	---	---	---
ZAP70	7535	broad.mit.edu	37	2	98346999	98347000	+	Intron	DEL	GC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98346999_98347000delGC	uc002syd.1	+						ZAP70_uc010yvf.1_Intron|ZAP70_uc002sye.1_Intron	NM_001079	NP_001070			zeta-chain associated protein kinase 70kDa						immune response|intracellular protein kinase cascade|positive thymic T cell selection|T cell receptor signaling pathway	cytosol|T cell receptor complex	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6																		---	---	---	---
TSGA10	80705	broad.mit.edu	37	2	99748503	99748504	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99748503_99748504insT	uc002szh.3	-						TSGA10_uc002szi.3_Intron|TSGA10_uc010fin.1_Intron|TSGA10_uc010yvn.1_Intron|TSGA10_uc002szj.1_Intron	NM_182911	NP_878915			testis specific, 10						spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
EIF5B	9669	broad.mit.edu	37	2	99977163	99977172	+	Intron	DEL	AGGAATGTAA	-	-	rs72036435		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99977163_99977172delAGGAATGTAA	uc002tab.2	+							NM_015904	NP_056988			eukaryotic translation initiation factor 5B						regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			ovary(2)|pancreas(1)	3																		---	---	---	---
AFF3	3899	broad.mit.edu	37	2	100483786	100483787	+	Intron	DEL	GG	-	-	rs71877014		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100483786_100483787delGG	uc002tag.2	-						AFF3_uc002taf.2_Intron|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Intron|AFF3_uc002tah.1_Intron|AFF3_uc010fir.1_Intron	NM_002285	NP_002276			AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	100797751	100797752	+	IGR	INS	-	TG	TG	rs141966280	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100797751_100797752insTG								AFF3 (38714 upstream) : LONRF2 (92002 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	101116759	101116760	+	IGR	INS	-	A	A	rs138485951	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101116759_101116760insA								NMS (17017 upstream) : PDCL3 (62658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	102224117	102224118	+	IGR	INS	-	T	T	rs142441167	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102224117_102224118insT								RFX8 (132952 upstream) : MAP4K4 (90370 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	106519402	106519403	+	IGR	INS	-	CA	CA	rs147815882	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106519402_106519403insCA								NCK2 (8676 upstream) : C2orf40 (162710 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	108086665	108086666	+	IGR	INS	-	CG	CG	rs146690844	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108086665_108086666insCG								ST6GAL2 (583102 upstream) : LOC729121 (352854 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	108178241	108178241	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108178241delA								ST6GAL2 (674678 upstream) : LOC729121 (261279 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	108691117	108691117	+	IGR	DEL	A	-	-	rs76469001		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108691117delA								SLC5A7 (60678 upstream) : SULT1C3 (172534 downstream)																																			---	---	---	---
LIMS1	3987	broad.mit.edu	37	2	109153850	109153850	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109153850delG	uc002tef.2	+							NM_004987	NP_004978			LIM and senescent cell antigen-like domains 1						cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	113103847	113103848	+	IGR	INS	-	CAT	CAT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103847_113103848insCAT								ZC3H6 (6207 upstream) : RGPD8 (22118 downstream)																																			---	---	---	---
IL1F6	27179	broad.mit.edu	37	2	113764887	113764887	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113764887delT	uc010yxr.1	+							NM_014440	NP_055255			interleukin 1 family, member 6 (epsilon)						immune response|inflammatory response	extracellular space	cytokine activity|interleukin-1 receptor binding				0																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	115491778	115491779	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115491778_115491779insT	uc002tla.1	+						DPP10_uc002tlb.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	115829747	115829748	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115829747_115829748insT	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	116403685	116403686	+	Intron	DEL	CA	-	-	rs7602921		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116403685_116403686delCA	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	116630963	116630963	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116630963delT								DPP10 (29027 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119830730	119830741	+	IGR	DEL	GGAGGGAGGAGA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119830730_119830741delGGAGGGAGGAGA								MARCO (78494 upstream) : C1QL2 (83078 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	124339726	124339729	+	IGR	DEL	TGTG	-	-	rs10537298		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124339726_124339729delTGTG								None (None upstream) : CNTNAP5 (443135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126520471	126520472	+	IGR	DEL	GA	-	-	rs113721856	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126520471_126520472delGA								CNTNAP5 (847610 upstream) : GYPC (893212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	127474297	127474298	+	IGR	INS	-	C	C	rs147915348		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127474297_127474298insC								GYPC (20052 upstream) : BIN1 (331309 downstream)																																			---	---	---	---
MYO7B	4648	broad.mit.edu	37	2	128304338	128304341	+	Intron	DEL	TCCA	-	-	rs71692572		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128304338_128304341delTCCA	uc002top.2	+							NM_001080527	NP_001073996			myosin VIIB							apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)														---	---	---	---
SAP130	79595	broad.mit.edu	37	2	128705338	128705339	+	Intron	INS	-	TG	TG	rs147211610	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128705338_128705339insTG	uc002tpp.2	-						SAP130_uc002tpn.2_Intron|SAP130_uc002tpo.2_Intron|SAP130_uc010fmd.2_Intron	NM_024545	NP_078821			Sin3A-associated protein, 130kDa isoform b						histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	129845078	129845078	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129845078delT								HS6ST1 (768907 upstream) : LOC389033 (835357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	130186661	130186670	+	IGR	DEL	TTTTCTTTTC	-	-	rs112853477		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130186661_130186670delTTTTCTTTTC								None (None upstream) : LOC389033 (493765 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	130207323	130207323	+	IGR	DEL	A	-	-	rs112309812		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130207323delA								None (None upstream) : LOC389033 (473112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133149969	133149970	+	IGR	DEL	AA	-	-	rs72121121		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133149969_133149970delAA								NCRNA00164 (134427 upstream) : GPR39 (24177 downstream)																																			---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	134200166	134200166	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134200166delC	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|NCKAP5_uc002ttt.1_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
TMEM163	81615	broad.mit.edu	37	2	135296203	135296204	+	Intron	DEL	AT	-	-	rs144088272		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135296203_135296204delAT	uc002ttx.2	-						TMEM163_uc002tty.2_Intron	NM_030923	NP_112185			transmembrane protein 163							integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)														---	---	---	---
RAB3GAP1	22930	broad.mit.edu	37	2	135875129	135875131	+	Intron	DEL	CTT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135875129_135875131delCTT	uc002tuj.2	+						RAB3GAP1_uc010fnf.2_Intron|RAB3GAP1_uc010fng.2_Intron|RAB3GAP1_uc010fnh.1_Intron	NM_012233	NP_036365			RAB3 GTPase-activating protein							centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	136813160	136813160	+	IGR	DEL	G	-	-	rs34229667		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136813160delG								DARS (69938 upstream) : CXCR4 (58760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	136856441	136856442	+	IGR	DEL	TG	-	-	rs151096182		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136856441_136856442delTG								DARS (113219 upstream) : CXCR4 (15478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	150336534	150336534	+	IGR	DEL	T	-	-	rs111657029		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150336534delT								LYPD6 (6397 upstream) : MMADHC (89616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	151900391	151900402	+	IGR	DEL	AAAAACAAAAAC	-	-	rs67803515		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151900391_151900402delAAAAACAAAAAC								RND3 (556211 upstream) : RBM43 (204327 downstream)																																			---	---	---	---
STAM2	10254	broad.mit.edu	37	2	153026232	153026232	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153026232delT	uc002tyc.3	-						STAM2_uc010foa.1_Intron|STAM2_uc002tyd.2_Intron	NM_005843	NP_005834			signal transducing adaptor molecule 2						cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.22)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	153904396	153904397	+	IGR	INS	-	AC	AC	rs140528368	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153904396_153904397insAC								ARL6IP6 (286629 upstream) : RPRM (429455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	154373886	154373886	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154373886delT								RPRM (38564 upstream) : GALNT13 (354540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	154705008	154705011	+	IGR	DEL	AATT	-	-	rs66483025		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154705008_154705011delAATT								RPRM (369686 upstream) : GALNT13 (23415 downstream)																																			---	---	---	---
ACVR1	90	broad.mit.edu	37	2	158710711	158710712	+	Intron	INS	-	A	A	rs72150265		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158710711_158710712insA	uc002tzn.3	-						ACVR1_uc010fog.2_Intron	NM_001105	NP_001096			activin A receptor, type I precursor						BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)													---	---	---	---
COBLL1	22837	broad.mit.edu	37	2	165563660	165563661	+	Intron	INS	-	T	T	rs113167912		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165563660_165563661insT	uc010zcw.1	-						COBLL1_uc002ucp.2_Intron|COBLL1_uc002ucq.2_Intron|COBLL1_uc010zcx.1_Intron|COBLL1_uc002ucs.1_Intron|COBLL1_uc002uco.2_Intron	NM_014900	NP_055715			COBL-like 1											ovary(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	167010934	167010935	+	Intron	INS	-	AC	AC			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167010934_167010935insAC	uc002udp.2	+											Homo sapiens, clone IMAGE:3681561, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	167260449	167260450	+	IGR	INS	-	A	A	rs74736969		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167260449_167260450insA								SCN9A (27952 upstream) : SCN7A (1089 downstream)																																			---	---	---	---
SCN7A	6332	broad.mit.edu	37	2	167289955	167289955	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167289955delA	uc002udu.1	-						SCN7A_uc010fpm.1_Intron	NM_002976	NP_002967			sodium channel, voltage-gated, type VII, alpha						muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			large_intestine(1)	1																		---	---	---	---
MYO3B	140469	broad.mit.edu	37	2	171332583	171332584	+	Intron	INS	-	C	C	rs141545520	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171332583_171332584insC	uc002ufy.2	+						MYO3B_uc002ufv.2_Intron|MYO3B_uc010fqb.1_Intron|MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482			myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19																		---	---	---	---
MYO3B	140469	broad.mit.edu	37	2	171368738	171368739	+	Intron	INS	-	A	A	rs139500531	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171368738_171368739insA	uc002ufy.2	+						MYO3B_uc002ufv.2_Intron|MYO3B_uc010fqb.1_Intron|MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482			myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19																		---	---	---	---
GORASP2	26003	broad.mit.edu	37	2	171791770	171791770	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171791770delT	uc002ugk.2	+						GORASP2_uc002ugj.2_Intron|GORASP2_uc010zdl.1_Intron|GORASP2_uc010zdm.1_Intron	NM_015530	NP_056345			golgi reassembly stacking protein 2							Golgi membrane				breast(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	175133860	175133860	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175133860delA								OLA1 (20495 upstream) : SP9 (65961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	177436930	177436930	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177436930delT								MTX2 (234179 upstream) : MIR1246 (28778 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	182279392	182279392	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182279392delA								UBE2E3 (351242 upstream) : ITGA4 (42227 downstream)																																			---	---	---	---
ITGA4	3676	broad.mit.edu	37	2	182358659	182358659	+	Intron	DEL	A	-	-	rs11363527		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182358659delA	uc002unu.2	+							NM_000885	NP_000876			integrin alpha 4 precursor						blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)													---	---	---	---
ANKRD44	91526	broad.mit.edu	37	2	198081593	198081594	+	Intron	INS	-	ACACACACAC	ACACACACAC	rs149197156	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198081593_198081594insACACACACAC	uc002uuc.2	-						ANKRD44_uc002uub.2_Intron|ANKRD44_uc010zgw.1_Intron|ANKRD44_uc002uud.1_Intron	NM_153697	NP_710181			ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)															---	---	---	---
SPATS2L	26010	broad.mit.edu	37	2	201199695	201199695	+	Intron	DEL	C	-	-	rs58137520	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201199695delC	uc002uvn.3	+						SPATS2L_uc010fst.2_Intron|SPATS2L_uc002uvo.3_Intron|SPATS2L_uc002uvp.3_Intron|SPATS2L_uc002uvq.3_Intron|SPATS2L_uc002uvr.3_Intron|SPATS2L_uc010zhc.1_Intron	NM_015535	NP_056350			SPATS2-like protein isoform a							cytoplasm|nucleolus				ovary(2)|pancreas(1)	3																		---	---	---	---
MPP4	58538	broad.mit.edu	37	2	202516685	202516686	+	Intron	INS	-	AAAC	AAAC	rs143236639	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202516685_202516686insAAAC	uc002uyk.3	-						MPP4_uc002uyi.3_Intron|MPP4_uc010ftj.2_Intron|MPP4_uc010zhq.1_Intron|MPP4_uc010zhr.1_Intron|MPP4_uc010zhs.1_Intron|MPP4_uc002uyj.3_Intron|MPP4_uc010zht.1_Intron|MPP4_uc002uyl.3_RNA|MPP4_uc010ftk.2_Intron	NM_033066	NP_149055			membrane protein, palmitoylated 4							cytoplasm	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	207207532	207207533	+	IGR	INS	-	C	C	rs142035548	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207207532_207207533insC								ZDBF2 (28384 upstream) : ADAM23 (100835 downstream)																																			---	---	---	---
KLF7	8609	broad.mit.edu	37	2	208010539	208010540	+	Intron	DEL	CA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208010539_208010540delCA	uc002vbz.1	-						KLF7_uc002vca.1_Intron	NM_003709	NP_003700			Kruppel-like factor 7 (ubiquitous)						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			central_nervous_system(1)|skin(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	215704100	215704100	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215704100delA								BARD1 (29672 upstream) : ABCA12 (92167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	216439016	216439016	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216439016delT								FN1 (138225 upstream) : MREG (368299 downstream)																																			---	---	---	---
MREG	55686	broad.mit.edu	37	2	216860606	216860607	+	Intron	INS	-	A	A	rs149205736		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216860606_216860607insA	uc002vfo.2	-						MREG_uc002vfq.2_Intron	NM_018000	NP_060470			whn-dependent transcript 2							apical plasma membrane					0		Renal(323;0.0328)		Epithelial(149;4.64e-07)|all cancers(144;5.56e-05)|LUSC - Lung squamous cell carcinoma(224;0.00832)|Lung(261;0.0111)														---	---	---	---
MARCH4	57574	broad.mit.edu	37	2	217217506	217217506	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217217506delT	uc002vgb.2	-							NM_020814	NP_065865			membrane-associated ring finger (C3HC4) 4							Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)														---	---	---	---
SMARCAL1	50485	broad.mit.edu	37	2	217282652	217282653	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217282652_217282653insT	uc002vgc.3	+						SMARCAL1_uc010fvf.2_Intron|SMARCAL1_uc002vgd.3_Intron|SMARCAL1_uc010fvg.2_Intron	NM_014140	NP_054859			SWI/SNF-related matrix-associated						chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)										Schimke_Immuno-Osseous_Dysplasia				---	---	---	---
PNKD	25953	broad.mit.edu	37	2	219141364	219141365	+	Intron	INS	-	C	C	rs146501309	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219141364_219141365insC	uc002vhn.2	+						TMBIM1_uc002vhp.1_Intron|TMBIM1_uc010zjz.1_Intron|TMBIM1_uc010zka.1_Intron|TMBIM1_uc002vho.1_Intron	NM_015488	NP_056303			myofibrillogenesis regulator 1 isoform 1							membrane|mitochondrion|nucleus	hydroxyacylglutathione hydrolase activity|zinc ion binding				0		Renal(207;0.0474)		Epithelial(149;7.33e-07)|all cancers(144;0.000133)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
SLC11A1	6556	broad.mit.edu	37	2	219246649	219246650	+	5'Flank	INS	-	GT	GT	rs149405973	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219246649_219246650insGT	uc002vhv.2	+						SLC11A1_uc010zkb.1_5'Flank|SLC11A1_uc010fvp.1_5'Flank|SLC11A1_uc010fvq.1_5'Flank|SLC11A1_uc010zkc.1_5'Flank|SLC11A1_uc002vhu.1_5'Flank|SLC11A1_uc002vhw.2_5'Flank	NM_000578	NP_000569			natural resistance-associated macrophage protein						activation of protein kinase activity|antigen processing and presentation of peptide antigen|cadmium ion transmembrane transport|cellular cadmium ion homeostasis|cellular iron ion homeostasis|defense response to Gram-negative bacterium|defense response to protozoan|divalent metal ion export|inflammatory response|interleukin-2 production|interleukin-3 production|iron ion transport|L-arginine import|macrophage activation|MHC class II biosynthetic process|mRNA stabilization|multicellular organismal iron ion homeostasis|negative regulation of cytokine production|nitrite transport|phagocytosis|positive regulation of dendritic cell antigen processing and presentation|positive regulation of interferon-gamma production|positive regulation of phagocytosis|positive regulation of T-helper 1 type immune response|positive regulation of transcription from RNA polymerase II promoter|respiratory burst|response to interferon-gamma|response to lipopolysaccharide|T cell cytokine production|T cell proliferation involved in immune response|vacuolar acidification|wound healing	integral to plasma membrane|late endosome membrane|lysosome|phagocytic vesicle membrane|tertiary granule membrane	manganese ion transmembrane transporter activity|metal ion:hydrogen antiporter activity|protein homodimerization activity			ovary(3)|central_nervous_system(1)	4		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
USP37	57695	broad.mit.edu	37	2	219352921	219352921	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219352921delG	uc002vie.2	-						USP37_uc010fvs.1_Intron|USP37_uc010zkf.1_Intron|USP37_uc002vif.2_Intron|USP37_uc002vig.2_Intron	NM_020935	NP_065986			ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	221688345	221688347	+	IGR	DEL	CCT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:221688345_221688347delCCT								None (None upstream) : EPHA4 (594402 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	224528158	224528159	+	IGR	DEL	AC	-	-	rs143313610		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224528158_224528159delAC								SCG2 (61037 upstream) : AP1S3 (91889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	228811038	228811039	+	IGR	INS	-	TT	TT	rs146897473	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228811038_228811039insTT								WDR69 (22012 upstream) : SPHKAP (33631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	229706691	229706691	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229706691delT								SPHKAP (660330 upstream) : PID1 (181999 downstream)																																			---	---	---	---
SP100	6672	broad.mit.edu	37	2	231282534	231282535	+	Intron	INS	-	T	T	rs146449542	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231282534_231282535insT	uc002vqt.2	+						SP100_uc002vqs.2_Intron|SP100_uc002vqu.1_Intron|SP100_uc010zmb.1_Intron|SP100_uc002vqq.1_Intron|SP100_uc002vqr.1_Intron|SP100_uc010zmc.1_Intron|SP100_uc002vqv.1_Intron	NM_003113	NP_003104			nuclear antigen Sp100 isoform 2						DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|interspecies interaction between organisms|negative regulation of cellular component movement|negative regulation of DNA binding|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of transcription, DNA-dependent|negative regulation of viral transcription|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|response to cytokine stimulus|response to retinoic acid|response to type I interferon	cytoplasm|nuclear periphery|nucleolus|PML body	chromo shadow domain binding|DNA binding|identical protein binding|kinase binding|protein homodimerization activity|transcription coactivator activity|transcription corepressor activity|transcription factor binding			ovary(4)|central_nervous_system(1)	5		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)														---	---	---	---
C2orf57	165100	broad.mit.edu	37	2	232454628	232454628	+	5'Flank	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232454628delA	uc002vrz.2	+							NM_152614	NP_689827			hypothetical protein LOC165100											ovary(1)	1		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)														---	---	---	---
PTMA	5757	broad.mit.edu	37	2	232570390	232570390	+	5'Flank	DEL	T	-	-	rs66644995		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232570390delT	uc002vsc.3	+						PTMA_uc002vsb.3_5'Flank	NM_001099285	NP_001092755			prothymosin, alpha isoform 1						transcription, DNA-dependent	nucleus					0		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)														---	---	---	---
PDE6D	5147	broad.mit.edu	37	2	232616951	232616951	+	Intron	DEL	A	-	-	rs67071088		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232616951delA	uc002vse.1	-						PDE6D_uc002vsf.1_Intron	NM_002601	NP_002592			phosphodiesterase 6D						regulation of GTP catabolic process|response to stimulus|visual perception		3',5'-cyclic-nucleotide phosphodiesterase activity|GTPase inhibitor activity|protein binding				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.142)		Epithelial(121;2.19e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00145)|LUSC - Lung squamous cell carcinoma(224;0.0125)|Lung(119;0.0154)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	235453418	235453419	+	IGR	INS	-	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235453418_235453419insG								ARL4C (47725 upstream) : SH3BP4 (407209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	235676899	235676900	+	IGR	DEL	TC	-	-	rs10536936		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235676899_235676900delTC								ARL4C (271206 upstream) : SH3BP4 (183728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	236354135	236354136	+	IGR	INS	-	C	C	rs147499193	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236354135_236354136insC								SH3BP4 (389779 upstream) : AGAP1 (48600 downstream)																																			---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236471501	236471501	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236471501delG	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	237643196	237643201	+	IGR	DEL	ACAGAG	-	-	rs143864557		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237643196_237643201delACAGAG								CXCR7 (152204 upstream) : COPS8 (350883 downstream)																																			---	---	---	---
RAMP1	10267	broad.mit.edu	37	2	238819026	238819027	+	Intron	DEL	CA	-	-	rs72032256		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238819026_238819027delCA	uc002vxj.2	+							NM_005855	NP_005846			receptor activity-modifying protein 1 precursor						intracellular protein transport|regulation of G-protein coupled receptor protein signaling pathway	integral to plasma membrane	protein transporter activity				0		Breast(86;0.000596)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;9.56e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.49e-11)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.49e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00013)|Lung(119;0.0119)|LUSC - Lung squamous cell carcinoma(224;0.0288)	Pramlintide(DB01278)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	239451577	239451578	+	Intron	INS	-	A	A	rs146479456	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239451577_239451578insA	uc002vyi.1	-											Homo sapiens cDNA FLJ32814 fis, clone TESTI2002806.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	240866032	240866033	+	IGR	INS	-	A	A	rs148991868	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240866032_240866033insA								HDAC4 (542686 upstream) : NDUFA10 (34125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	1937598	1937598	+	IGR	DEL	A	-	-	rs36116622		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1937598delA								CNTN6 (492321 upstream) : CNTN4 (202952 downstream)																																			---	---	---	---
VGLL4	9686	broad.mit.edu	37	3	11752573	11752573	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11752573delA	uc003bwf.2	-						VGLL4_uc003bwg.2_Intron	NM_014667	NP_055482			vestigial like 4 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)														---	---	---	---
SYN2	6854	broad.mit.edu	37	3	12188694	12188705	+	Intron	DEL	TGTGTGTGTGTA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12188694_12188705delTGTGTGTGTGTA	uc003bwm.2	+						SYN2_uc003bwl.1_Intron	NM_133625	NP_598328			synapsin II isoform IIa						neurotransmitter secretion	synaptic vesicle	ATP binding|ligase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	12740811	12740814	+	IGR	DEL	TGTG	-	-	rs149679157		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12740811_12740814delTGTG								RAF1 (35111 upstream) : TMEM40 (34578 downstream)																																			---	---	---	---
WNT7A	7476	broad.mit.edu	37	3	13916782	13916782	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13916782delC	uc003bye.1	-							NM_004625	NP_004616			wingless-type MMTV integration site family,						activation of JUN kinase activity|anterior/posterior pattern formation|canonical Wnt receptor signaling pathway|cell proliferation in forebrain|cellular response to transforming growth factor beta stimulus|central nervous system vasculogenesis|cerebellar granule cell differentiation|dorsal/ventral pattern formation|embryonic axis specification|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic leg morphogenesis|lens fiber cell development|negative regulation of neurogenesis|palate development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of JNK cascade|positive regulation of synaptogenesis|positive regulation of transcription from RNA polymerase II promoter|regulation of axon diameter|satellite cell activation|satellite cell maintenance involved in skeletal muscle regeneration|sex differentiation|uterus development|Wnt receptor signaling pathway involved in wound healing, spreading of epidermal cells|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled binding|receptor agonist activity|signal transducer activity			ovary(2)|breast(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	14815064	14815065	+	IGR	INS	-	G	G	rs147276415	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14815064_14815065insG								C3orf20 (524 upstream) : FGD5 (45404 downstream)																																			---	---	---	---
GALNTL2	117248	broad.mit.edu	37	3	16131204	16131204	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16131204delA	uc003caq.3	+							NM_054110	NP_473451			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	26902051	26902051	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:26902051delT								LRRC3B (149788 upstream) : NEK10 (250344 downstream)																																			---	---	---	---
CMC1	152100	broad.mit.edu	37	3	28297213	28297214	+	Intron	INS	-	AC	AC	rs61656388		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28297213_28297214insAC	uc003cea.2	+							NM_182523	NP_872329			COX assembly mitochondrial protein homolog							mitochondrion	metal ion binding				0																		---	---	---	---
GADL1	339896	broad.mit.edu	37	3	30792943	30792944	+	Intron	INS	-	C	C	rs140996573	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30792943_30792944insC	uc003cep.2	-							NM_207359	NP_997242			glutamate decarboxylase-like 1						carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	32125197	32125197	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32125197delT								ZNF860 (92077 upstream) : GPD1L (22947 downstream)																																			---	---	---	---
CNOT10	25904	broad.mit.edu	37	3	32805144	32805145	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32805144_32805145insA	uc003cfc.1	+						CNOT10_uc003cfd.1_Intron|CNOT10_uc003cfe.1_Intron|CNOT10_uc010hfv.1_Intron|CNOT10_uc011axj.1_Intron|CNOT10_uc010hfw.1_Intron	NM_015442	NP_056257			CCR4-NOT transcription complex, subunit 10						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	39464291	39464292	+	IGR	INS	-	AG	AG	rs142837880	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39464291_39464292insAG								RPSA (10261 upstream) : MOBP (44778 downstream)																																			---	---	---	---
MOBP	4336	broad.mit.edu	37	3	39550042	39550043	+	Intron	INS	-	T	T	rs147983002		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39550042_39550043insT	uc010hht.2	+						MOBP_uc003cju.2_Intron|MOBP_uc003cjv.2_Intron|MOBP_uc003cjw.2_Intron|MOBP_uc003cjx.2_Intron|MOBP_uc003cjy.2_Intron	NM_182935	NP_891980			myelin-associated oligodendrocyte basic protein						nervous system development	nucleolus|perinuclear region of cytoplasm|soluble fraction				ovary(1)|central_nervous_system(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.082)|Kidney(284;0.0998)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	39689109	39689109	+	IGR	DEL	A	-	-	rs10707824		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39689109delA								MOBP (121254 upstream) : MYRIP (162194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	40418595	40418595	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40418595delG								EIF1B (64682 upstream) : ENTPD3 (10078 downstream)																																			---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41917458	41917458	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41917458delA	uc003ckv.3	-						ULK4_uc003ckw.2_Intron	NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
TRAK1	22906	broad.mit.edu	37	3	42175708	42175712	+	Intron	DEL	CTCCT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42175708_42175712delCTCCT	uc003cky.2	+						TRAK1_uc011azh.1_Intron|TRAK1_uc011azi.1_Intron	NM_001042646	NP_001036111			OGT(O-Glc-NAc transferase)-interacting protein						endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus				ovary(1)	1																		---	---	---	---
TRAK1	22906	broad.mit.edu	37	3	42189516	42189517	+	Intron	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42189516_42189517delAC	uc003cky.2	+						TRAK1_uc011azh.1_Intron|TRAK1_uc011azi.1_Intron|TRAK1_uc003ckz.3_5'Flank|TRAK1_uc011azj.1_5'Flank	NM_001042646	NP_001036111			OGT(O-Glc-NAc transferase)-interacting protein						endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus				ovary(1)	1																		---	---	---	---
VIPR1	7433	broad.mit.edu	37	3	42554479	42554491	+	Intron	DEL	GATCCCTGGCCAG	-	-	rs111432380		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42554479_42554491delGATCCCTGGCCAG	uc003clf.2	+						VIPR1_uc011azl.1_Intron|VIPR1_uc011azm.1_Intron|VIPR1_uc011azn.1_Intron	NM_004624	NP_004615			vasoactive intestinal peptide receptor 1						digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|muscle contraction|positive regulation of cell proliferation|synaptic transmission	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.241)														---	---	---	---
HHATL	57467	broad.mit.edu	37	3	42741499	42741500	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42741499_42741500delTG	uc003clw.2	-						HHATL_uc003clx.2_Intron	NM_020707	NP_065758			hedgehog acyltransferase-like						negative regulation of N-terminal protein palmitoylation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm				ovary(3)	3				KIRC - Kidney renal clear cell carcinoma(284;0.215)														---	---	---	---
QRICH1	54870	broad.mit.edu	37	3	49107472	49107472	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49107472delT	uc010hkq.2	-						QRICH1_uc003cvu.2_Intron|QRICH1_uc003cvv.2_Intron	NM_198880	NP_942581			glutamine-rich 1											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	55140492	55140493	+	IGR	DEL	CT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55140492_55140493delCT								CACNA2D3 (31910 upstream) : WNT5A (359251 downstream)																																			---	---	---	---
ERC2	26059	broad.mit.edu	37	3	55664984	55664984	+	Intron	DEL	A	-	-	rs11337338		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55664984delA	uc003dhr.1	-						ERC2_uc003dhq.1_Intron	NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
C3orf63	23272	broad.mit.edu	37	3	56677291	56677291	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56677291delA	uc003did.3	-						C3orf63_uc003dic.3_Intron|C3orf63_uc003die.3_Intron	NM_015224	NP_056039			retinoblastoma-associated protein 140 isoform b											ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)														---	---	---	---
ARHGEF3	50650	broad.mit.edu	37	3	56974725	56974726	+	Intron	INS	-	A	A	rs141111818	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56974725_56974726insA	uc003dih.2	-							NM_001128615	NP_001122087			Rho guanine nucleotide exchange factor 3 isoform						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)														---	---	---	---
IL17RD	54756	broad.mit.edu	37	3	57202692	57202693	+	Intron	INS	-	TTCT	TTCT	rs142828859	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57202692_57202693insTTCT	uc010hna.2	-						IL17RD_uc011bex.1_Intron	NM_017563	NP_060033			interleukin 17 receptor D precursor							Golgi membrane|integral to membrane|plasma membrane	receptor activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	59196050	59196051	+	IGR	INS	-	T	T	rs147283940	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59196050_59196051insT								C3orf67 (160292 upstream) : FHIT (538987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	59423939	59423940	+	IGR	INS	-	A	A	rs138842864	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59423939_59423940insA								C3orf67 (388181 upstream) : FHIT (311098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	59496029	59496030	+	IGR	DEL	TC	-	-	rs34646348		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59496029_59496030delTC								C3orf67 (460271 upstream) : FHIT (239008 downstream)																																			---	---	---	---
FHIT	2272	broad.mit.edu	37	3	60034782	60034782	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:60034782delT	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
FHIT	2272	broad.mit.edu	37	3	61014562	61014562	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61014562delA	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
Unknown	0	broad.mit.edu	37	3	64224162	64224162	+	IGR	DEL	A	-	-	rs11325740		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64224162delA								PRICKLE2 (13031 upstream) : ADAMTS9 (277171 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	64342460	64342461	+	IGR	INS	-	CCA	CCA	rs143617197	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64342460_64342461insCCA								PRICKLE2 (131329 upstream) : ADAMTS9 (158872 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	65260357	65260357	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65260357delG								ADAMTS9 (586992 upstream) : MAGI1 (79550 downstream)																																			---	---	---	---
FOXP1	27086	broad.mit.edu	37	3	71374638	71374639	+	Intron	INS	-	A	A	rs140767708	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71374638_71374639insA	uc003dop.2	-						FOXP1_uc003don.2_Intron|FOXP1_uc003doo.2_Intron|FOXP1_uc003doq.1_Intron|FOXP1_uc003dos.2_Intron	NM_032682	NP_116071			forkhead box P1 isoform 1						cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)				T	PAX5	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	3	71933926	71933928	+	IGR	DEL	ACA	-	-	rs72196905		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71933926_71933928delACA								PROK2 (99569 upstream) : RYBP (489823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75591977	75591978	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75591977_75591978insT								FAM86D (107711 upstream) : MIR1324 (87936 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75739615	75739615	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75739615delG								MIR1324 (59606 upstream) : ZNF717 (19179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75872248	75872248	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75872248delT								ZNF717 (37578 upstream) : None (None downstream)																																			---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78717663	78717663	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78717663delG	uc003dqe.2	-	12	1809	c.1601delC	c.(1600-1602)GCAfs	p.A534fs	ROBO1_uc003dqb.2_Frame_Shift_Del_p.A495fs|ROBO1_uc003dqc.2_Frame_Shift_Del_p.A498fs|ROBO1_uc003dqd.2_Frame_Shift_Del_p.A498fs|ROBO1_uc010hoh.2_5'UTR|ROBO1_uc011bgl.1_Frame_Shift_Del_p.A106fs|ROBO1_uc003dqf.1_Frame_Shift_Del_p.A213fs	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	534	Extracellular (Potential).|Ig-like C2-type 5.				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	86546759	86546760	+	IGR	INS	-	A	A	rs145122715	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86546759_86546760insA								CADM2 (428811 upstream) : VGLL3 (440365 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	87308747	87308748	+	IGR	DEL	AT	-	-	rs63500560		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87308747_87308748delAT								CHMP2B (4050 upstream) : POU1F1 (35 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	88345237	88345239	+	IGR	DEL	TGT	-	-	rs71619575		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88345237_88345239delTGT								C3orf38 (138124 upstream) : EPHA3 (811435 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	89771177	89771178	+	IGR	INS	-	T	T	rs11343371		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89771177_89771178insT								EPHA3 (239895 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	94924837	94924840	+	IGR	DEL	TGTG	-	-	rs71649036		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94924837_94924840delTGTG								LOC255025 (29758 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	95969005	95969006	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95969005_95969006delTG								None (None upstream) : EPHA6 (564419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	96212563	96212564	+	IGR	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96212563_96212564delAC								None (None upstream) : EPHA6 (320861 downstream)																																			---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	97063926	97063926	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97063926delA	uc010how.1	+							NM_001080448	NP_001073917			EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	99259796	99259796	+	IGR	DEL	C	-	-	rs78530037	byFrequency;by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99259796delC								DCBLD2 (639263 upstream) : COL8A1 (97658 downstream)																																			---	---	---	---
COL8A1	1295	broad.mit.edu	37	3	99434549	99434549	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99434549delT	uc003dtg.1	+						COL8A1_uc003dth.1_Intron	NM_001850	NP_001841			alpha 1 type VIII collagen precursor						angiogenesis|cell adhesion	basement membrane|collagen type VIII					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	103659832	103659833	+	Intron	INS	-	TG	TG	rs138969687	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103659832_103659833insTG	uc003dvu.2	+											Homo sapiens cDNA clone IMAGE:6614812, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	104103058	104103058	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104103058delA								None (None upstream) : ALCAM (982655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	104532038	104532038	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104532038delC								None (None upstream) : ALCAM (553675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	106502874	106502874	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106502874delA								CBLB (914608 upstream) : LOC100302640 (52786 downstream)																																			---	---	---	---
TRAT1	50852	broad.mit.edu	37	3	108554227	108554227	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108554227delT	uc003dxi.1	+						TRAT1_uc010hpx.1_Intron	NM_016388	NP_057472			T-cell receptor interacting molecule						cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	109008543	109008544	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109008543_109008544insA								C3orf66 (104436 upstream) : DPPA2 (4092 downstream)																																			---	---	---	---
TMPRSS7	344805	broad.mit.edu	37	3	111760848	111760848	+	Frame_Shift_Del	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111760848delA	uc010hqb.2	+	2	214	c.44delA	c.(43-45)CAAfs	p.Q15fs	TMPRSS7_uc011bhr.1_5'UTR	NM_001042575	NP_001036040	Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	127	Extracellular (Potential).				proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2																		---	---	---	---
C3orf52	79669	broad.mit.edu	37	3	111804803	111804803	+	5'Flank	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111804803delG	uc003dyq.3	+						C3orf52_uc011bhs.1_5'Flank|C3orf52_uc011bht.1_5'Flank	NM_024616	NP_078892			TPA-induced transmembrane protein							endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	116324377	116324378	+	IGR	INS	-	T	T	rs142815827	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116324377_116324378insT								LSAMP (800359 upstream) : LOC285194 (104257 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	118417756	118417756	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118417756delA	uc011biu.1	-											Homo sapiens clone HA_003061 mRNA sequence.																														---	---	---	---
KTELC1	56983	broad.mit.edu	37	3	119194802	119194813	+	Intron	DEL	CACACACACACA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119194802_119194813delCACACACACACA	uc003ecm.2	+						KTELC1_uc011biz.1_Intron|KTELC1_uc011bja.1_Intron	NM_152305	NP_689518			KTEL (Lys-Tyr-Glu-Leu) containing 1 precursor							endoplasmic reticulum lumen	UDP-glucosyltransferase activity				0				GBM - Glioblastoma multiforme(114;0.233)														---	---	---	---
GPR156	165829	broad.mit.edu	37	3	119896647	119896648	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119896647_119896648insA	uc011bjf.1	-						GPR156_uc011bjg.1_Intron	NM_153002	NP_694547			G protein-coupled receptor 156							integral to membrane|plasma membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.19)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	120108334	120108334	+	IGR	DEL	A	-	-	rs113149936		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120108334delA								LRRC58 (40148 upstream) : FSTL1 (4728 downstream)																																			---	---	---	---
CASR	846	broad.mit.edu	37	3	121941685	121941686	+	Intron	INS	-	A	A	rs142807752	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121941685_121941686insA	uc003eev.3	+						CASR_uc003eew.3_Intron	NM_000388	NP_000379			calcium-sensing receptor precursor						anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	122993046	122993046	+	IGR	DEL	T	-	-	rs11328918		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122993046delT								SEC22A (66 upstream) : ADCY5 (10353 downstream)																																			---	---	---	---
ZNF148	7707	broad.mit.edu	37	3	124999619	124999620	+	Intron	INS	-	G	G	rs34093385		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124999619_124999620insG	uc003ehx.3	-						SLC12A8_uc003ehw.3_5'Flank|ZNF148_uc003ehz.3_Intron|ZNF148_uc010hsa.2_Intron|ZNF148_uc003eia.3_Intron|ZNF148_uc003ehy.2_Intron	NM_021964	NP_068799			zinc finger protein 148						cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	125977903	125977903	+	IGR	DEL	C	-	-	rs79855708		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125977903delC								ALDH1L1 (78418 upstream) : KLF15 (83575 downstream)																																			---	---	---	---
EEFSEC	60678	broad.mit.edu	37	3	128123861	128123861	+	Intron	DEL	T	-	-	rs72117185		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128123861delT	uc003eki.2	+						EEFSEC_uc003ekj.2_Intron	NM_021937	NP_068756			eukaryotic elongation factor,							cytoplasm|nucleus	GTP binding|GTPase activity|translation elongation factor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	129062429	129062430	+	IGR	INS	-	C	C	rs148022941	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129062429_129062430insC								C3orf47 (19017 upstream) : RPL32P3 (39248 downstream)																																			---	---	---	---
TMCC1	23023	broad.mit.edu	37	3	129542470	129542471	+	Intron	INS	-	AAAC	AAAC	rs146057192	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129542470_129542471insAAAC	uc003emz.3	-						TMCC1_uc010htg.2_Intron	NM_001017395	NP_001017395			transmembrane and coiled-coil domain family 1							integral to membrane				skin(1)	1																		---	---	---	---
CPNE4	131034	broad.mit.edu	37	3	131417524	131417524	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131417524delG	uc003eok.2	-						CPNE4_uc011blq.1_Intron|CPNE4_uc003eol.2_Intron|CPNE4_uc003eom.2_Intron	NM_130808	NP_570720			copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
NCRNA00119	348808	broad.mit.edu	37	3	132511270	132511270	+	Intron	DEL	T	-	-	rs67784360		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132511270delT	uc003epg.1	+							NR_002811				Homo sapiens cDNA clone IMAGE:4826885.												0																		---	---	---	---
TF	7018	broad.mit.edu	37	3	133452712	133452712	+	Intron	DEL	A	-	-	rs144480920		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133452712delA	uc003epu.1	+							NM_001063	NP_001054			transferrin precursor						cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	133645882	133645882	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133645882delC								RAB6B (31191 upstream) : C3orf36 (1108 downstream)																																			---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134701660	134701660	+	Intron	DEL	A	-	-	rs11355419		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134701660delA	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron	NM_004441	NP_004432			ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	135658471	135658471	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135658471delT								EPHB1 (679166 upstream) : PPP2R3A (26096 downstream)																																			---	---	---	---
IL20RB	53833	broad.mit.edu	37	3	136712853	136712853	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136712853delA	uc003eri.1	+						IL20RB_uc003erj.1_Intron|IL20RB_uc010hud.1_Intron	NM_144717	NP_653318			interleukin 20 receptor beta precursor							integral to membrane	receptor activity			ovary(1)	1																		---	---	---	---
PIK3CB	5291	broad.mit.edu	37	3	138466999	138467000	+	Intron	DEL	AC	-	-	rs150799736		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138466999_138467000delAC	uc011bmq.1	-							NM_006219	NP_006210			catalytic phosphatidylinositol 3-kinase beta						activation of MAPK activity|chemotaxis|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(2)|ovary(1)|lung(1)|skin(1)	5																		---	---	---	---
NMNAT3	349565	broad.mit.edu	37	3	139319149	139319149	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139319149delT	uc003etj.2	-						NMNAT3_uc003etk.2_Intron|NMNAT3_uc003etl.2_Intron|NMNAT3_uc010hul.2_Intron	NM_178177	NP_835471			nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	cytosol|mitochondrion	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	139423948	139423948	+	IGR	DEL	T	-	-	rs78003654		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139423948delT								NMNAT3 (27108 upstream) : CLSTN2 (230079 downstream)																																			---	---	---	---
CLSTN2	64084	broad.mit.edu	37	3	139895091	139895091	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139895091delT	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414			calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7															HNSCC(16;0.037)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	140523815	140523815	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140523815delT								TRIM42 (103824 upstream) : SLC25A36 (136847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	141336833	141336834	+	IGR	DEL	AG	-	-	rs10589233		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141336833_141336834delAG								RASA2 (5636 upstream) : RNF7 (120217 downstream)																																			---	---	---	---
ATP1B3	483	broad.mit.edu	37	3	141621076	141621076	+	Intron	DEL	G	-	-	rs11354636		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141621076delG	uc003eug.1	+						ATP1B3_uc011bne.1_Intron|ATP1B3_uc003euh.1_Intron	NM_001679	NP_001670			Na+/K+ -ATPase beta 3 subunit						ATP biosynthetic process|blood coagulation|leukocyte migration	melanosome|sodium:potassium-exchanging ATPase complex	protein binding|sodium:potassium-exchanging ATPase activity				0																		---	---	---	---
XRN1	54464	broad.mit.edu	37	3	142089972	142089972	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142089972delA	uc003eus.2	-						XRN1_uc010huu.2_Intron|XRN1_uc003eut.2_Intron|XRN1_uc003euu.2_Intron	NM_019001	NP_061874			5'-3' exoribonuclease 1 isoform a						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	142796835	142796835	+	IGR	DEL	T	-	-	rs67482721		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142796835delT								SR140 (17268 upstream) : CHST2 (41833 downstream)																																			---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143186569	143186570	+	Intron	INS	-	AG	AG	rs138399078	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143186569_143186570insAG	uc003evn.2	-							NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	147802194	147802195	+	IGR	INS	-	TTTG	TTTG	rs148441296	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147802194_147802195insTTTG								ZIC1 (667690 upstream) : AGTR1 (613463 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	147810801	147810801	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147810801delT								ZIC1 (676297 upstream) : AGTR1 (604857 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	149104659	149104660	+	IGR	DEL	GT	-	-	rs72258262		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149104659_149104660delGT								TM4SF1 (9091 upstream) : TM4SF4 (87774 downstream)																																			---	---	---	---
RNF13	11342	broad.mit.edu	37	3	149573907	149573907	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149573907delA	uc003exn.3	+						RNF13_uc003exp.3_Intron	NM_007282	NP_009213			ring finger protein 13						protein autoubiquitination	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane|nuclear inner membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)															---	---	---	---
MED12L	116931	broad.mit.edu	37	3	150807207	150807208	+	Intron	INS	-	T	T	rs113233330		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150807207_150807208insT	uc003eyp.2	+						MED12L_uc011bnz.1_Intron|MED12L_uc003eym.1_Intron|MED12L_uc003eyn.2_Intron|MED12L_uc003eyo.2_Intron	NM_053002	NP_443728			mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	151198956	151198978	+	IGR	DEL	CAGACCCTTGCATCCCAGGGAAT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151198956_151198978delCAGACCCTTGCATCCCAGGGAAT								IGSF10 (22459 upstream) : AADACL2 (252726 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	151245577	151245577	+	IGR	DEL	T	-	-	rs72254722		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151245577delT								IGSF10 (69080 upstream) : AADACL2 (206127 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	152390101	152390102	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152390101_152390102insA								MBNL1 (206533 upstream) : P2RY1 (162634 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	157353900	157353902	+	IGR	DEL	CAT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157353900_157353902delCAT								C3orf55 (34881 upstream) : SHOX2 (459899 downstream)																																			---	---	---	---
SCHIP1	29970	broad.mit.edu	37	3	159399080	159399080	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159399080delA	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron	NM_014575	NP_055390			schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)															---	---	---	---
SCHIP1	29970	broad.mit.edu	37	3	159402038	159402038	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159402038delC	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron	NM_014575	NP_055390			schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)															---	---	---	---
SCHIP1	29970	broad.mit.edu	37	3	159491654	159491654	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159491654delC	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron|SCHIP1_uc010hvz.1_Intron	NM_014575	NP_055390			schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	159653702	159653702	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159653702delT	uc003fcw.1	-											Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																														---	---	---	---
PPM1L	151742	broad.mit.edu	37	3	160598818	160598818	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160598818delT	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338			protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	161429607	161429607	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161429607delA								OTOL1 (207879 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	161742994	161743009	+	IGR	DEL	TGTGTGTGTGTGTGTG	-	-	rs142400847		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161742994_161743009delTGTGTGTGTGTGTGTG								OTOL1 (521266 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	164595022	164595023	+	IGR	DEL	CT	-	-	rs150695451		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164595022_164595023delCT								MIR720 (535784 upstream) : SI (101664 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	165023852	165023853	+	IGR	INS	-	T	T	rs142817132	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165023852_165023853insT								SLITRK3 (109383 upstream) : BCHE (466841 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166387605	166387608	+	IGR	DEL	TTAA	-	-	rs10573771		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166387605_166387608delTTAA								BCHE (832352 upstream) : ZBBX (570473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	167938504	167938505	+	IGR	DEL	AC	-	-	rs113975227		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167938504_167938505delAC								GOLIM4 (125087 upstream) : MIR551B (331137 downstream)																																			---	---	---	---
CLDN11	5010	broad.mit.edu	37	3	170323906	170323906	+	Intron	DEL	T	-	-	rs33963145		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170323906delT	uc011bpt.1	+						uc003fha.1_Intron	NM_005602	NP_005593			claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---
CLDN11	5010	broad.mit.edu	37	3	170492434	170492435	+	Intron	INS	-	CA	CA	rs144643736	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170492434_170492435insCA	uc011bpt.1	+							NM_005602	NP_005593			claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	170591726	170591726	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170591726delA								RPL22L1 (3681 upstream) : EIF5A2 (14479 downstream)																																			---	---	---	---
FNDC3B	64778	broad.mit.edu	37	3	172014497	172014498	+	Intron	INS	-	G	G	rs138485698	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172014497_172014498insG	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron	NM_022763	NP_073600			fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)														---	---	---	---
SPATA16	83893	broad.mit.edu	37	3	172747207	172747207	+	Intron	DEL	G	-	-	rs66777691		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172747207delG	uc003fin.3	-							NM_031955	NP_114161			spermatogenesis associated 16						cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)															---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	174863473	174863474	+	Intron	INS	-	T	T	rs141998911	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174863473_174863474insT	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	179257030	179257030	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179257030delA								GNB4 (87659 upstream) : ACTL6A (23678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	181483740	181483740	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181483740delA								SOX2OT (24737 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	185711385	185711385	+	IGR	DEL	T	-	-	rs117349521	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185711385delT								TRA2B (55461 upstream) : ETV5 (52723 downstream)																																			---	---	---	---
LPP	4026	broad.mit.edu	37	3	188267185	188267188	+	Intron	DEL	TGTT	-	-	rs112386993		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188267185_188267188delTGTT	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
Unknown	0	broad.mit.edu	37	3	197378788	197378789	+	IGR	INS	-	G	G	rs112801621		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197378788_197378789insG								LOC220729 (24036 upstream) : KIAA0226 (19470 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	37976	37977	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37976_37977insT								None (None upstream) : ZNF595 (15250 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	1480375	1480375	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1480375delA								CRIPAK (90593 upstream) : FAM53A (161234 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	2761925	2761926	+	IGR	INS	-	CTCT	CTCT	rs114661679	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2761925_2761926insCTCT								TNIP2 (3822 upstream) : SH3BP2 (32824 downstream)																																			---	---	---	---
DOK7	285489	broad.mit.edu	37	4	3491972	3491973	+	Intron	INS	-	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3491972_3491973insC	uc003ghd.2	+						DOK7_uc003ghe.2_Intron|DOK7_uc003ghf.2_Intron|DOK7_uc003ghg.1_5'Flank	NM_173660	NP_775931			downstream of tyrosine kinase 7 isoform 1						positive regulation of protein tyrosine kinase activity	cell junction|synapse	insulin receptor binding|protein kinase binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3549845	3549846	+	IGR	DEL	TT	-	-	rs74903853		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3549845_3549846delTT								LRPAP1 (15621 upstream) : ADRA2C (218229 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3737011	3737011	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3737011delG								LRPAP1 (202787 upstream) : ADRA2C (31064 downstream)																																			---	---	---	---
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	-	-	rs111245977		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4228274_4228282delCCACAGCAG	uc003ghp.1	-	1	340_348	c.310_318delCTGCTGTGG	c.(310-318)CTGCTGTGGdel	p.LLW104del		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104_106	Helical; (Potential).				biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)														---	---	---	---
JAKMIP1	152789	broad.mit.edu	37	4	6163280	6163281	+	Intron	INS	-	A	A	rs34013600		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6163280_6163281insA	uc003giu.3	-						JAKMIP1_uc010idb.1_Intron|JAKMIP1_uc010idc.1_Intron|JAKMIP1_uc010idd.1_Intron|JAKMIP1_uc011bwc.1_Intron|JAKMIP1_uc003giv.3_Intron|JAKMIP1_uc010ide.2_Intron	NM_144720	NP_653321			janus kinase and microtubule interacting protein						protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4																		---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7221561	7221562	+	Intron	INS	-	C	C	rs139615340	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7221561_7221562insC	uc003gkb.3	+							NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7423342	7423342	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7423342delA	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7450332	7450335	+	Intron	DEL	CCTT	-	-	rs10531260		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7450332_7450335delCCTT	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	8729243	8729243	+	IGR	DEL	A	-	-	rs67984746		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8729243delA								CPZ (107757 upstream) : HMX1 (139530 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13509934	13509934	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13509934delT								RAB28 (23945 upstream) : NKX3-2 (32520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	13819484	13819484	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13819484delT	uc003gna.1	+											Homo sapiens cDNA FLJ34570 fis, clone KIDNE2008072.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	15110637	15110637	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15110637delA								CPEB2 (38863 upstream) : C1QTNF7 (230923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	15184739	15184739	+	IGR	DEL	T	-	-	rs34759351		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15184739delT								CPEB2 (112965 upstream) : C1QTNF7 (156821 downstream)																																			---	---	---	---
TAPT1	202018	broad.mit.edu	37	4	16168615	16168616	+	Intron	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16168615_16168616delTT	uc010ied.1	-						TAPT1_uc011bxd.1_Intron|TAPT1_uc011bxe.1_Intron	NM_153365	NP_699196			transmembrane anterior posterior transformation							integral to membrane	growth hormone-releasing hormone receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	16304664	16304665	+	IGR	INS	-	AGAGAGCT	AGAGAGCT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16304664_16304665insAGAGAGCT								FLJ39653 (44854 upstream) : LDB2 (198502 downstream)																																			---	---	---	---
LDB2	9079	broad.mit.edu	37	4	16511048	16511048	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16511048delA	uc003goz.2	-						LDB2_uc003gpa.2_Intron|LDB2_uc003gpb.2_Intron|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Intron|LDB2_uc003goy.2_Intron|LDB2_uc011bxi.1_Intron	NM_001290	NP_001281			LIM domain binding 2 isoform a								LIM domain binding|transcription cofactor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	22148788	22148788	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22148788delG								KCNIP4 (198414 upstream) : GPR125 (240211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	22620606	22620606	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22620606delT								GPR125 (102934 upstream) : GBA3 (73942 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	24126292	24126293	+	IGR	INS	-	T	T	rs111567752		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24126292_24126293insT								PPARGC1A (234592 upstream) : MIR573 (395522 downstream)																																			---	---	---	---
PI4K2B	55300	broad.mit.edu	37	4	25277301	25277302	+	Intron	INS	-	A	A	rs149897640	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25277301_25277302insA	uc003grk.2	+						PI4K2B_uc011bxs.1_Intron	NM_018323	NP_060793			phosphatidylinositol 4-kinase type 2 beta							cytoplasm|membrane	1-phosphatidylinositol 4-kinase activity|ATP binding			ovary(2)|skin(2)	4		Breast(46;0.173)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	26844157	26844158	+	IGR	INS	-	TCCC	TCCC	rs143365108		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26844157_26844158insTCCC								TBC1D19 (87242 upstream) : STIM2 (18206 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	27535943	27535944	+	IGR	DEL	AT	-	-	rs72050533		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27535943_27535944delAT								STIM2 (510135 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	27975577	27975577	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27975577delT								STIM2 (949769 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	33860189	33860189	+	IGR	DEL	G	-	-	rs111479250		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33860189delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	35602873	35602873	+	IGR	DEL	A	-	-	rs138302356		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:35602873delA								None (None upstream) : ARAP2 (346971 downstream)																																			---	---	---	---
RELL1	768211	broad.mit.edu	37	4	37607788	37607788	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37607788delA	uc003gsz.2	-							NM_001085399	NP_001078868			receptor expressed in lymphoid tissues like 1							cytoplasm|integral to membrane|microtubule cytoskeleton|plasma membrane					0																		---	---	---	---
PGM2	55276	broad.mit.edu	37	4	37853939	37853940	+	Intron	INS	-	A	A	rs138094524	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37853939_37853940insA	uc011byb.1	+						PGM2_uc011byc.1_Intron	NM_018290	NP_060760			phosphoglucomutase 2						glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity|phosphopentomutase activity			ovary(1)	1																		---	---	---	---
LIMCH1	22998	broad.mit.edu	37	4	41539606	41539606	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41539606delT	uc003gvu.3	+						LIMCH1_uc003gvt.1_Intron|LIMCH1_uc003gvv.3_Intron|LIMCH1_uc003gvw.3_Intron|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Intron|LIMCH1_uc003gvy.3_Intron|LIMCH1_uc003gwa.3_5'Flank|LIMCH1_uc003gvz.3_5'Flank	NM_014988	NP_055803			LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	44996441	44996442	+	IGR	INS	-	G	G	rs141086644	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44996441_44996442insG								GNPDA2 (267829 upstream) : None (None downstream)																																			---	---	---	---
TEC	7006	broad.mit.edu	37	4	48235656	48235657	+	Intron	INS	-	A	A	rs146730961	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48235656_48235657insA	uc003gxz.2	-							NM_003215	NP_003206			tec protein tyrosine kinase						intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	49533879	49533880	+	IGR	INS	-	A	A	rs142139508		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49533879_49533880insA								CWH43 (469786 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	56141659	56141659	+	IGR	DEL	A	-	-	rs72044642		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56141659delA								KDR (149897 upstream) : SRD5A3 (70750 downstream)																																			---	---	---	---
SRP72	6731	broad.mit.edu	37	4	57332913	57332913	+	5'Flank	DEL	A	-	-	rs76441394	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57332913delA	uc003hbv.2	+						SRP72_uc010ihe.2_5'Flank	NM_006947	NP_008878			signal recognition particle 72kDa						response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|nucleolus|plasma membrane|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding			ovary(1)	1	Glioma(25;0.08)|all_neural(26;0.101)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	63459036	63459037	+	IGR	DEL	GA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63459036_63459037delGA								LPHN3 (520869 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65541111	65541112	+	IGR	INS	-	AA	AA	rs146542378	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65541111_65541112insAA								TECRL (265933 upstream) : EPHA5 (644170 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	72866394	72866395	+	IGR	INS	-	C	C	rs141625795	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72866394_72866395insC								GC (196636 upstream) : NPFFR2 (31126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	74784071	74784072	+	IGR	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74784071_74784072delGT								CXCL1 (47118 upstream) : PF4 (62724 downstream)																																			---	---	---	---
SHROOM3	57619	broad.mit.edu	37	4	77456049	77456050	+	Intron	INS	-	C	C	rs140096838	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77456049_77456050insC	uc011cbx.1	+							NM_020859	NP_065910			shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)															---	---	---	---
CCNG2	901	broad.mit.edu	37	4	78089832	78089833	+	3'UTR	DEL	AG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78089832_78089833delAG	uc003hkq.3	+	8					CCNG2_uc003hkn.3_3'UTR|CCNG2_uc003hkp.3_3'UTR	NM_004354	NP_004345			cyclin G2						cell cycle checkpoint|cell division|mitosis	cytoplasm				ovary(2)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	78119839	78119840	+	IGR	INS	-	A	A	rs142941561	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78119839_78119840insA								CCNG2 (28629 upstream) : CXCL13 (313067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	82565636	82565636	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82565636delA								RASGEF1B (172575 upstream) : HNRNPD (708831 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	84414044	84414044	+	IGR	DEL	T	-	-	rs71668654		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84414044delT								FAM175A (7754 upstream) : AGPAT9 (43217 downstream)																																			---	---	---	---
AFF1	4299	broad.mit.edu	37	4	88058643	88058644	+	3'UTR	INS	-	T	T	rs151031082	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88058643_88058644insT	uc003hqj.3	+	20					AFF1_uc011ccz.1_3'UTR|AFF1_uc003hqk.3_3'UTR|AFF1_uc011cda.1_3'UTR	NM_005935	NP_005926			myeloid/lymphoid or mixed-lineage leukemia							nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)														---	---	---	---
PDLIM5	10611	broad.mit.edu	37	4	95587726	95587729	+	3'UTR	DEL	TTTG	-	-	rs34068251		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95587726_95587729delTTTG	uc003hti.2	+	13					PDLIM5_uc003hth.2_3'UTR|PDLIM5_uc003htj.2_3'UTR|PDLIM5_uc003htk.2_3'UTR|PDLIM5_uc011cdy.1_3'UTR|PDLIM5_uc003htl.2_3'UTR	NM_006457	NP_006448			PDZ and LIM domain 5 isoform a						regulation of dendritic spine morphogenesis|regulation of synaptogenesis	actin cytoskeleton|cell junction|cytosol|postsynaptic density|postsynaptic membrane|synaptosome	actin binding|actinin binding|protein kinase C binding|zinc ion binding			ovary(1)|skin(1)	2		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	98446994	98446994	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98446994delT								None (None upstream) : C4orf37 (33040 downstream)																																			---	---	---	---
C4orf37	285555	broad.mit.edu	37	4	99042524	99042525	+	Intron	INS	-	CT	CT	rs141904281	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99042524_99042525insCT	uc003htt.1	-							NM_174952	NP_777612			hypothetical protein LOC285555												0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	99094383	99094384	+	IGR	INS	-	GAAAAA	GAAAAA			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99094383_99094384insGAAAAA								C4orf37 (29992 upstream) : RAP1GDS1 (88143 downstream)																																			---	---	---	---
DAPP1	27071	broad.mit.edu	37	4	100784876	100784876	+	Intron	DEL	T	-	-	rs71913814		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100784876delT	uc003hvf.3	+						DAPP1_uc011cek.1_Intron|DAPP1_uc010ilh.2_Intron	NM_014395	NP_055210			dual adaptor of phosphotyrosine and						signal transduction	cytoplasm|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|protein tyrosine phosphatase activity				0				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)														---	---	---	---
MANBA	4126	broad.mit.edu	37	4	103653070	103653071	+	Intron	INS	-	T	T	rs145485699	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103653070_103653071insT	uc003hwg.2	-						MANBA_uc011ces.1_Intron	NM_005908	NP_005899			mannosidase, beta A, lysosomal precursor						carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	104851978	104851979	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104851978_104851979insT								TACR3 (211005 upstream) : CXXC4 (541366 downstream)																																			---	---	---	---
HADH	3033	broad.mit.edu	37	4	108918814	108918814	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108918814delT	uc003hyq.2	+						HADH_uc010ilx.2_Intron|HADH_uc010ily.2_Intron	NM_005327	NP_005318			L-3-hydroxyacyl-Coenzyme A dehydrogenase						fatty acid beta-oxidation	mitochondrial matrix	3-hydroxyacyl-CoA dehydrogenase activity|NAD+ binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)	NADH(DB00157)													---	---	---	---
CFI	3426	broad.mit.edu	37	4	110664367	110664367	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110664367delT	uc003hzr.3	-						CFI_uc003hzq.2_Intron|CFI_uc011cft.1_Intron|CFI_uc003hzs.3_Intron	NM_000204	NP_000195			complement factor I preproprotein						complement activation, classical pathway|innate immune response|proteolysis	extracellular space|membrane	scavenger receptor activity|serine-type endopeptidase activity				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)														---	---	---	---
ENPEP	2028	broad.mit.edu	37	4	111443346	111443346	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111443346delT	uc003iab.3	+							NM_001977	NP_001968			glutamyl aminopeptidase						cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	112049184	112049185	+	IGR	DEL	TT	-	-	rs4033333		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:112049184_112049185delTT								MIR297 (267381 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	113042261	113042261	+	IGR	DEL	A	-	-	rs111925135		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113042261delA								None (None upstream) : C4orf32 (24292 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	113141575	113141575	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113141575delA								C4orf32 (31049 upstream) : AP1AR (11320 downstream)																																			---	---	---	---
ALPK1	80216	broad.mit.edu	37	4	113322865	113322865	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113322865delT	uc003iap.3	+						ALPK1_uc011cfw.1_Intron|ALPK1_uc003ian.3_Intron|ALPK1_uc011cfx.1_Intron|ALPK1_uc003iao.3_Intron|ALPK1_uc003iaq.2_Intron|ALPK1_uc010imo.2_Intron	NM_025144	NP_079420			alpha-kinase 1								ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)														---	---	---	---
NDST4	64579	broad.mit.edu	37	4	115881330	115881331	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115881330_115881331insA	uc003ibu.2	-						NDST4_uc010imw.2_Intron	NM_022569	NP_072091			heparan sulfate N-deacetylase/N-sulfotransferase							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	116497731	116497732	+	IGR	INS	-	ACACAC	ACACAC	rs146164860	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:116497731_116497732insACACAC								NDST4 (462699 upstream) : MIR1973 (723149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	119508961	119508962	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119508961_119508962delTG								CEP170L (33604 upstream) : METTL14 (97612 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	123080730	123080731	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123080730_123080731insT								TRPC3 (207821 upstream) : KIAA1109 (11027 downstream)																																			---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126281151	126281151	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126281151delT	uc003ifj.3	+							NM_024582	NP_078858			FAT tumor suppressor homolog 4 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126409301	126409301	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126409301delG	uc003ifj.3	+						FAT4_uc011cgp.1_Intron|FAT4_uc003ifi.1_Intron	NM_024582	NP_078858			FAT tumor suppressor homolog 4 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	126837606	126837607	+	IGR	INS	-	T	T	rs11454787		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126837606_126837607insT								MIR2054 (409144 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	127484293	127484293	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:127484293delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	127666800	127666801	+	IGR	DEL	AG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:127666800_127666801delAG								None (None upstream) : INTU (887319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	128972516	128972516	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128972516delT								C4orf29 (15042 upstream) : LARP1B (9987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	130986568	130986569	+	IGR	DEL	TG	-	-	rs111663699		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130986568_130986569delTG								C4orf33 (952726 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	133544740	133544741	+	IGR	INS	-	A	A	rs144989054	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133544740_133544741insA								None (None upstream) : PCDH10 (525729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	134826680	134826680	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134826680delT								PCDH10 (713949 upstream) : PABPC4L (290811 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	136759759	136759759	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136759759delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137713580	137713580	+	IGR	DEL	T	-	-	rs113263135		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137713580delT								None (None upstream) : PCDH18 (726496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	138897054	138897056	+	IGR	DEL	TTG	-	-	rs10617580		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138897054_138897056delTTG								PCDH18 (443406 upstream) : SLC7A11 (188192 downstream)																																			---	---	---	---
ELF2	1998	broad.mit.edu	37	4	140073494	140073494	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140073494delT	uc003ihq.2	-											Homo sapiens ets family transcription factor ELF2A (ELF2) mRNA, complete cds, alternatively spliced.						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	cytoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2	all_hematologic(180;0.162)																	---	---	---	---
MAML3	55534	broad.mit.edu	37	4	140862679	140862681	+	Intron	DEL	TGT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140862679_140862681delTGT	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187			mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	141702916	141702916	+	IGR	DEL	T	-	-	rs112134130		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141702916delT								TBC1D9 (25445 upstream) : RNF150 (83809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	142893978	142893978	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142893978delG								IL15 (239367 upstream) : INPP4B (55206 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	143813449	143813450	+	IGR	INS	-	G	G	rs146904163	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143813449_143813450insG								INPP4B (45845 upstream) : USP38 (292620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	143843742	143843743	+	IGR	INS	-	A	A	rs35943592		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143843742_143843743insA								INPP4B (76138 upstream) : USP38 (262327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	145816369	145816369	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145816369delT								HHIP (156488 upstream) : ANAPC10 (99945 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	147957711	147957712	+	IGR	INS	-	T	T	rs145157725		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147957711_147957712insT								TTC29 (90677 upstream) : MIR548G (308069 downstream)																																			---	---	---	---
TRIM2	23321	broad.mit.edu	37	4	154098799	154098799	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154098799delA	uc003ing.2	+							NM_001130067	NP_001123539			tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)														---	---	---	---
GUCY1A3	2982	broad.mit.edu	37	4	156594667	156594667	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156594667delC	uc003iov.2	+						GUCY1A3_uc003iou.2_Intron|GUCY1A3_uc010iqc.2_Intron|GUCY1A3_uc003iow.2_Intron|GUCY1A3_uc010iqd.2_Intron|GUCY1A3_uc003iox.2_Intron|GUCY1A3_uc003ioz.2_Intron|GUCY1A3_uc003ioy.2_Intron|GUCY1A3_uc010iqe.2_Intron|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Intron	NM_000856	NP_000847			guanylate cyclase 1, soluble, alpha 3 isoform A						blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	165406494	165406494	+	IGR	DEL	T	-	-	rs10719045		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165406494delT								MARCH1 (101292 upstream) : TRIM61 (469106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	165838613	165838613	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165838613delA								MARCH1 (533411 upstream) : TRIM61 (36987 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	168437510	168437510	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168437510delG								SPOCK3 (281769 upstream) : ANXA10 (576197 downstream)																																			---	---	---	---
PALLD	23022	broad.mit.edu	37	4	169594975	169594975	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169594975delT	uc011cjx.1	+						PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron	NM_016081	NP_057165			palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)										Pancreatic_Cancer_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	4	171090899	171090899	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171090899delT								AADAT (79527 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	172667456	172667457	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:172667456_172667457delTG								None (None upstream) : GALNTL6 (67118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	180472244	180472244	+	IGR	DEL	G	-	-	rs140175358		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180472244delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	180835137	180835138	+	IGR	DEL	TC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180835137_180835138delTC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	181836165	181836165	+	IGR	DEL	A	-	-	rs11315999		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181836165delA								None (None upstream) : None (None downstream)																																			---	---	---	---
SORBS2	8470	broad.mit.edu	37	4	186824958	186824958	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186824958delA	uc003iyl.2	-						SORBS2_uc003iym.2_Intron|SORBS2_uc011cky.1_Intron	NM_021069	NP_066547			sorbin and SH3 domain containing 2 isoform 2							actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)														---	---	---	---
FAT1	2195	broad.mit.edu	37	4	187525941	187525942	+	Intron	INS	-	GAT	GAT	rs2637776		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187525941_187525942insGAT	uc003izf.2	-							NM_005245	NP_005236			FAT tumor suppressor 1 precursor						actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12															HNSCC(5;0.00058)			---	---	---	---
TRIML1	339976	broad.mit.edu	37	4	189060417	189060417	+	5'Flank	DEL	G	-	-	rs78785695		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189060417delG	uc003izm.1	+							NM_178556	NP_848651			tripartite motif family-like 1						multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	189322088	189322088	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189322088delT	uc003izo.1	+											Homo sapiens cDNA FLJ38649 fis, clone HHDPC2007302.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	190339482	190339482	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190339482delT								None (None upstream) : FRG1 (522492 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190594412	190594413	+	IGR	INS	-	A	A	rs140670678		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190594412_190594413insA								None (None upstream) : FRG1 (267561 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190599335	190599336	+	IGR	INS	-	CTGT	CTGT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190599335_190599336insCTGT								None (None upstream) : FRG1 (262638 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190600225	190600227	+	IGR	DEL	GAG	-	-	rs149213799		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190600225_190600227delGAG								None (None upstream) : FRG1 (261747 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190840614	190840614	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190840614delT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	1707284	1707284	+	IGR	DEL	T	-	-	rs60933725		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1707284delT								LOC728613 (73164 upstream) : MRPL36 (91216 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1872635	1872636	+	IGR	DEL	TA	-	-	rs111841820		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1872635_1872636delTA								NDUFS6 (56472 upstream) : IRX4 (4905 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2099097	2099097	+	IGR	DEL	G	-	-	rs111828254		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2099097delG								IRX4 (216217 upstream) : IRX2 (647184 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2115418	2115418	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2115418delT								IRX4 (232538 upstream) : IRX2 (630863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2196794	2196795	+	IGR	INS	-	T	T	rs34982584		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2196794_2196795insT								IRX4 (313914 upstream) : IRX2 (549486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2531556	2531557	+	IGR	DEL	CA	-	-	rs72185116		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2531556_2531557delCA								IRX4 (648676 upstream) : IRX2 (214724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3420839	3420839	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3420839delC	uc003jdd.2	-											Homo sapiens cDNA clone IMAGE:4823480.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	4331141	4331141	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4331141delA								IRX1 (729625 upstream) : LOC340094 (703331 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4824043	4824044	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4824043_4824044delTG								None (None upstream) : LOC340094 (210428 downstream)																																			---	---	---	---
FASTKD3	79072	broad.mit.edu	37	5	7868314	7868316	+	Intron	DEL	AAA	-	-	rs141709156		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7868314_7868316delAAA	uc003jeb.2	-						FASTKD3_uc011cmp.1_5'Flank|FASTKD3_uc003jec.2_Intron|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jed.2_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	NM_024091	NP_076996			FAST kinase domains 3						apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|breast(1)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	7962984	7962984	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7962984delA								MTRR (61751 upstream) : None (None downstream)																																			---	---	---	---
DAP	1611	broad.mit.edu	37	5	10708555	10708556	+	Intron	DEL	AC	-	-	rs34710292		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10708555_10708556delAC	uc003jez.3	-						DAP_uc011cmw.1_Intron	NM_004394	NP_004385			death-associated protein						activation of caspase activity|cellular response to amino acid starvation|induction of apoptosis by extracellular signals|negative regulation of autophagy|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent		death domain binding				0		Ovarian(839;1.34e-05)|Breast(839;0.0634)|Lung NSC(810;0.0804)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	18347905	18347906	+	IGR	INS	-	T	T	rs112583933		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18347905_18347906insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	19276649	19276650	+	IGR	DEL	AA	-	-	rs141006431		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19276649_19276650delAA								None (None upstream) : CDH18 (196507 downstream)																																			---	---	---	---
CDH18	1016	broad.mit.edu	37	5	19921640	19921640	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19921640delA	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925			cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	21679157	21679157	+	Intron	DEL	T	-	-	rs79041890		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21679157delT	uc003jgj.2	+											Homo sapiens, clone IMAGE:5171606, mRNA.																														---	---	---	---
CDH12	1010	broad.mit.edu	37	5	21864291	21864293	+	Intron	DEL	TAT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21864291_21864293delTAT	uc010iuc.2	-						CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Intron	NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	23222436	23222437	+	IGR	INS	-	AC	AC	rs140021646	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23222436_23222437insAC								CDH12 (368705 upstream) : PRDM9 (285287 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	23300962	23300963	+	IGR	DEL	CA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23300962_23300963delCA								CDH12 (447231 upstream) : PRDM9 (206761 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	25527563	25527564	+	IGR	INS	-	AAGG	AAGG			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25527563_25527564insAAGG								CDH10 (882652 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	29739901	29739902	+	IGR	INS	-	AA	AA			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29739901_29739902insAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	31325429	31325432	+	IGR	DEL	ACAC	-	-	rs141323813		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31325429_31325432delACAC								CDH6 (192 upstream) : RNASEN (75170 downstream)																																			---	---	---	---
RNASEN	29102	broad.mit.edu	37	5	31449242	31449242	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31449242delA	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron|RNASEN_uc003jhi.2_Intron	NM_013235	NP_037367			ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0																		---	---	---	---
C5orf22	55322	broad.mit.edu	37	5	31549574	31549574	+	Intron	DEL	T	-	-	rs113327723		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31549574delT	uc003jhj.3	+						C5orf22_uc011cnw.1_Intron|C5orf22_uc003jhk.3_Intron|C5orf22_uc010iuj.2_Intron	NM_018356	NP_060826			hypothetical protein LOC55322											ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	32704477	32704478	+	IGR	DEL	TG	-	-	rs34519459		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32704477_32704478delTG								SUB1 (100292 upstream) : NPR3 (6282 downstream)																																			---	---	---	---
TARS	6897	broad.mit.edu	37	5	33454858	33454859	+	Intron	INS	-	TT	TT	rs142855087	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33454858_33454859insTT	uc003jhy.2	+						TARS_uc011cob.1_Intron|TARS_uc010iup.1_Intron|TARS_uc011coc.1_Intron|TARS_uc003jhz.2_Intron|TARS_uc011cod.1_Intron	NM_152295	NP_689508			threonyl-tRNA synthetase						threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)													---	---	---	---
ADAMTS12	81792	broad.mit.edu	37	5	33601212	33601213	+	Intron	DEL	GT	-	-	rs72408319		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33601212_33601213delGT	uc003jia.1	-						ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9															HNSCC(64;0.19)			---	---	---	---
AGXT2	64902	broad.mit.edu	37	5	35001480	35001480	+	Intron	DEL	T	-	-	rs5867261		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35001480delT	uc003jjf.2	-						AGXT2_uc003jje.1_Intron|AGXT2_uc011com.1_Intron	NM_031900	NP_114106			alanine-glyoxylate aminotransferase 2 precursor						glyoxylate metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	mitochondrial matrix	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity|alanine-glyoxylate transaminase activity|pyridoxal phosphate binding			ovary(3)|skin(1)	4	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)													---	---	---	---
PRLR	5618	broad.mit.edu	37	5	35167241	35167248	+	Intron	DEL	ATCTATCT	-	-	rs145286858		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35167241_35167248delATCTATCT	uc003jjm.2	-							NM_000949	NP_000940			prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	35368922	35368923	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35368922_35368923insA								PRLR (138128 upstream) : SPEF2 (249066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	35576095	35576095	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35576095delA								PRLR (345301 upstream) : SPEF2 (41894 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	35849108	35849109	+	IGR	INS	-	AAAT	AAAT	rs144827487	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35849108_35849109insAAAT								SPEF2 (34396 upstream) : IL7R (7882 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	36372906	36372906	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36372906delT								RANBP3L (70895 upstream) : SLC1A3 (233551 downstream)																																			---	---	---	---
WDR70	55100	broad.mit.edu	37	5	37564791	37564791	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37564791delA	uc003jkv.2	+						WDR70_uc010iva.1_Intron	NM_018034	NP_060504			WD repeat domain 70											ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	38063171	38063172	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38063171_38063172insT								GDNF (223389 upstream) : EGFLAM (195361 downstream)																																			---	---	---	---
EGFLAM	133584	broad.mit.edu	37	5	38371726	38371727	+	Intron	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38371726_38371727delAC	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron	NM_152403	NP_689616			EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)																	---	---	---	---
EGFLAM	133584	broad.mit.edu	37	5	38372247	38372248	+	Intron	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38372247_38372248delTT	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron	NM_152403	NP_689616			EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)																	---	---	---	---
RICTOR	253260	broad.mit.edu	37	5	38986179	38986179	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38986179delC	uc003jlp.2	-						RICTOR_uc003jlo.2_Intron|RICTOR_uc010ivf.2_Intron|RICTOR_uc003jlq.1_Intron|RICTOR_uc011cpk.1_Intron	NM_152756	NP_689969			rapamycin-insensitive companion of mTOR						actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	40550724	40550724	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40550724delT								None (None upstream) : PTGER4 (129308 downstream)																																			---	---	---	---
C6	729	broad.mit.edu	37	5	41177017	41177017	+	Intron	DEL	G	-	-	rs5867542		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41177017delG	uc003jmk.2	-						C6_uc003jml.1_Intron	NM_000065	NP_000056			complement component 6 precursor						complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)																---	---	---	---
PLCXD3	345557	broad.mit.edu	37	5	41375263	41375264	+	Intron	INS	-	AG	AG	rs147961836	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41375263_41375264insAG	uc003jmm.1	-							NM_001005473	NP_001005473			phosphatidylinositol-specific phospholipase C, X						intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
GHR	2690	broad.mit.edu	37	5	42583115	42583116	+	Intron	INS	-	ATAGCCT	ATAGCCT	rs143486498	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42583115_42583116insATAGCCT	uc003jmt.2	+						GHR_uc011cpq.1_Intron	NM_000163	NP_000154			growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)													---	---	---	---
GHR	2690	broad.mit.edu	37	5	42610769	42610770	+	Intron	DEL	AA	-	-	rs112288959		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42610769_42610770delAA	uc003jmt.2	+						GHR_uc011cpq.1_Intron	NM_000163	NP_000154			growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)													---	---	---	---
CCDC152	100129792	broad.mit.edu	37	5	42781654	42781659	+	Intron	DEL	CGCGCA	-	-	rs67699328		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42781654_42781659delCGCGCA	uc003jmx.3	+						CCDC152_uc011cpr.1_Intron	NM_001134848	NP_001128320			coiled-coil domain containing 152												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	44589167	44589167	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44589167delT								FGF10 (200383 upstream) : MRPS30 (219860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	49484893	49484893	+	IGR	DEL	T	-	-	rs35857687		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49484893delT								None (None upstream) : EMB (207140 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	52432371	52432372	+	IGR	INS	-	A	A	rs142446159	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52432371_52432372insA								MOCS2 (26773 upstream) : FST (344223 downstream)																																			---	---	---	---
ARL15	54622	broad.mit.edu	37	5	53295024	53295024	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53295024delT	uc003jpg.1	-						ARL15_uc010ivs.1_Intron	NM_019087	NP_061960			ADP-ribosylation factor-like 15								GTP binding			ovary(1)	1		Lung NSC(810;0.000779)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	55225268	55225269	+	IGR	INS	-	GTCC	GTCC	rs141331600	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55225268_55225269insGTCC								IL31RA (6591 upstream) : IL6ST (11426 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	55305918	55305921	+	IGR	DEL	ACAC	-	-	rs113073768		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55305918_55305921delACAC								IL6ST (15155 upstream) : ANKRD55 (89587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	55365354	55365354	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55365354delT								IL6ST (74591 upstream) : ANKRD55 (30154 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	56436986	56436989	+	IGR	DEL	TGTG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56436986_56436989delTGTG								MIER3 (169485 upstream) : GPBP1 (32786 downstream)																																			---	---	---	---
GPBP1	65056	broad.mit.edu	37	5	56552097	56552097	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56552097delA	uc003jrh.3	+						GPBP1_uc010iwg.2_Intron|GPBP1_uc003jri.3_Intron|GPBP1_uc003jrj.3_Intron|GPBP1_uc003jrk.3_Intron|GPBP1_uc003jrl.3_Intron	NM_022913	NP_075064			GC-rich promoter binding protein 1 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			large_intestine(1)|central_nervous_system(1)	2		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	57275901	57275902	+	IGR	INS	-	AC	AC	rs34889483		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57275901_57275902insAC								ACTBL2 (497265 upstream) : PLK2 (473910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	62494357	62494358	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62494357_62494358insA								ISCA1P1 (421187 upstream) : HTR1A (761921 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	62792051	62792054	+	IGR	DEL	AAAC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62792051_62792054delAAAC								ISCA1P1 (718881 upstream) : HTR1A (464225 downstream)																																			---	---	---	---
ADAMTS6	11174	broad.mit.edu	37	5	64778567	64778567	+	5'Flank	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64778567delA	uc003jtp.2	-						ADAMTS6_uc003jtq.2_5'Flank	NM_197941	NP_922932			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	73669547	73669548	+	IGR	INS	-	CAC	CAC	rs113041204		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73669547_73669548insCAC								RGNEF (432134 upstream) : ENC1 (253687 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	73863583	73863583	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73863583delA								RGNEF (626170 upstream) : ENC1 (59652 downstream)																																			---	---	---	---
PDE8B	8622	broad.mit.edu	37	5	76558017	76558018	+	Intron	INS	-	A	A	rs147991619	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76558017_76558018insA	uc003kfa.2	+						PDE8B_uc003kfb.2_Intron|PDE8B_uc003kfc.2_Intron|PDE8B_uc003kfd.2_Intron|PDE8B_uc003kfe.2_Intron	NM_003719	NP_003710			phosphodiesterase 8B isoform 1						cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity				0		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	76812420	76812421	+	IGR	INS	-	C	C	rs145747584	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76812420_76812421insC								WDR41 (24088 upstream) : OTP (112117 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	81879258	81879258	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81879258delA								ATP6AP1L (265112 upstream) : TMEM167A (469409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	88346373	88346373	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88346373delC								MEF2C (146504 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	95854770	95854771	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95854770_95854771insA								PCSK1 (85818 upstream) : CAST (143006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	95984421	95984422	+	IGR	INS	-	GTGT	GTGT	rs138871439	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95984421_95984422insGTGT								PCSK1 (215469 upstream) : CAST (13355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	100536468	100536468	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:100536468delA								ST8SIA4 (297481 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	101479879	101479882	+	IGR	DEL	TGAT	-	-	rs144812390		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101479879_101479882delTGAT								None (None upstream) : SLCO4C1 (89812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	102053652	102053653	+	IGR	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102053652_102053653delAC								SLCO6A1 (218932 upstream) : PAM (147874 downstream)																																			---	---	---	---
PJA2	9867	broad.mit.edu	37	5	108699553	108699553	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108699553delA	uc003kos.3	-							NM_014819	NP_055634			praja 2, RING-H2 motif containing						long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)														---	---	---	---
MCC	4163	broad.mit.edu	37	5	112712279	112712280	+	Intron	INS	-	AA	AA			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112712279_112712280insAA	uc003kql.3	-						MCC_uc003kqk.3_Intron	NM_001085377	NP_001078846			mutated in colorectal cancers isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)														---	---	---	---
YTHDC2	64848	broad.mit.edu	37	5	112847519	112847520	+	5'Flank	INS	-	GGA	GGA	rs138188026	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112847519_112847520insGGA	uc003kqn.2	+						YTHDC2_uc010jce.1_5'Flank|YTHDC2_uc010jcf.1_5'Flank	NM_022828	NP_073739			YTH domain containing 2								ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	114520185	114520185	+	IGR	DEL	G	-	-	rs5870642		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114520185delG								TRIM36 (3942 upstream) : PGGT1B (26343 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	116159129	116159129	+	IGR	DEL	T	-	-	rs141210197		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116159129delT								SEMA6A (248578 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	119075686	119075687	+	IGR	DEL	GT	-	-	rs72106659		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119075686_119075687delGT								FAM170A (104170 upstream) : PRR16 (724332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	119549222	119549223	+	IGR	INS	-	AC	AC	rs143695703	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119549222_119549223insAC								FAM170A (577706 upstream) : PRR16 (250796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	122831528	122831528	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122831528delT								CEP120 (72276 upstream) : CSNK1G3 (16265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	123240671	123240671	+	IGR	DEL	C	-	-	rs11305776		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123240671delC								CSNK1G3 (288209 upstream) : ZNF608 (731939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	125987648	125987651	+	IGR	DEL	AAGG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125987648_125987651delAAGG								C5orf48 (15674 upstream) : LMNB1 (125182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	135769959	135769959	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135769959delA								TRPC7 (76886 upstream) : SPOCK1 (541029 downstream)																																			---	---	---	---
FGF1	2246	broad.mit.edu	37	5	141982284	141982285	+	Intron	DEL	TT	-	-	rs79833552		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141982284_141982285delTT	uc003lmm.2	-						FGF1_uc011dbi.1_Intron|FGF1_uc003lmn.3_Intron|FGF1_uc003lmp.3_Intron|FGF1_uc003lmq.2_Intron|FGF1_uc010jgj.2_Intron|FGF1_uc003lmr.2_Intron|FGF1_uc003lms.3_Intron	NM_001144892	NP_001138364			fibroblast growth factor 1 (acidic) isoform 1						angiogenesis|cellular response to heat|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of angiogenesis|positive regulation of cell division|positive regulation of cell migration|positive regulation of cholesterol biosynthetic process|positive regulation of intracellular protein kinase cascade|positive regulation of transcription from RNA polymerase II promoter	cell cortex|cytosol|extracellular space	fibroblast growth factor receptor binding|growth factor activity|heparin binding|S100 alpha binding				0		all_neural(839;0.0416)|Ovarian(839;0.0955)|all_hematologic(541;0.1)|Prostate(461;0.157)|Lung NSC(810;0.21)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00032)	Pentosan Polysulfate(DB00686)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	142124896	142124897	+	IGR	DEL	AA	-	-	rs11320302		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142124896_142124897delAA								FGF1 (47261 upstream) : ARHGAP26 (25395 downstream)																																	OREG0003872	type=REGULATORY REGION|Gene=AL833138|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
Unknown	0	broad.mit.edu	37	5	143861779	143861780	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143861779_143861780insT								KCTD16 (4835 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	145938822	145938823	+	IGR	INS	-	A	A	rs140233468	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145938822_145938823insA								GPR151 (43146 upstream) : PPP2R2B (30247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	147304238	147304239	+	IGR	INS	-	A	A	rs144552832	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147304238_147304239insA								C5orf46 (18137 upstream) : SPINK5 (139296 downstream)																																			---	---	---	---
GLRA1	2741	broad.mit.edu	37	5	151243700	151243701	+	Intron	INS	-	TGTG	TGTG	rs144811129	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151243700_151243701insTGTG	uc003lut.2	-						GLRA1_uc003lur.2_Intron|GLRA1_uc003lus.2_Intron	NM_001146040	NP_001139512			glycine receptor, alpha 1 isoform 1 precursor						muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)													---	---	---	---
SGCD	6444	broad.mit.edu	37	5	156007589	156007589	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156007589delT	uc003lwd.3	+						SGCD_uc003lwa.1_Intron|SGCD_uc003lwb.2_Intron|SGCD_uc003lwc.3_Intron	NM_001128209	NP_001121681			delta-sarcoglycan isoform 3						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
ATP10B	23120	broad.mit.edu	37	5	160111858	160111858	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160111858delA	uc003lym.1	-						ATP10B_uc003lyp.2_Intron|ATP10B_uc011deg.1_Intron|ATP10B_uc003lyo.2_Frame_Shift_Del_p.C124fs	NM_025153	NP_079429			ATPase, class V, type 10B						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
GABRB2	2561	broad.mit.edu	37	5	160897078	160897078	+	Intron	DEL	T	-	-	rs34680755		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160897078delT	uc003lys.1	-						GABRB2_uc011deh.1_Intron|GABRB2_uc003lyr.1_Intron|GABRB2_uc003lyt.1_Intron|GABRB2_uc010jiu.1_Intron|GABRB2_uc011dei.1_Intron	NM_021911	NP_068711			gamma-aminobutyric acid (GABA) A receptor, beta						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
GABRA1	2554	broad.mit.edu	37	5	161319677	161319680	+	Intron	DEL	AAAC	-	-	rs72344875		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161319677_161319680delAAAC	uc010jiw.2	+						GABRA1_uc010jix.2_Intron|GABRA1_uc010jiy.2_Intron|GABRA1_uc003lyx.3_Intron|GABRA1_uc010jiz.2_Intron|GABRA1_uc010jja.2_Intron|GABRA1_uc010jjb.2_Intron	NM_000806	NP_000797			gamma-aminobutyric acid (GABA) A receptor, alpha						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	163608639	163608639	+	IGR	DEL	C	-	-	rs142443451		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:163608639delC								MAT2B (662306 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	165421082	165421082	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165421082delA								None (None upstream) : None (None downstream)																																			---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	167401136	167401138	+	Intron	DEL	GAA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167401136_167401138delGAA	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	169514230	169514231	+	IGR	DEL	TC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169514230_169514231delTC								DOCK2 (3846 upstream) : FOXI1 (18686 downstream)																																			---	---	---	---
KCNIP1	30820	broad.mit.edu	37	5	169960192	169960193	+	Intron	INS	-	GT	GT	rs149514034	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169960192_169960193insGT	uc003mas.2	+						KCNIP1_uc003map.2_Intron|KCNIP1_uc003mat.2_Intron|KCNIP1_uc010jjp.2_Intron|KCNIP1_uc010jjq.2_Intron	NM_001034837	NP_001030009			Kv channel interacting protein 1 isoform 1						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
ZNF346	23567	broad.mit.edu	37	5	176465878	176465879	+	Intron	DEL	TG	-	-	rs141598634	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176465878_176465879delTG	uc003mfi.2	+						ZNF346_uc011dfr.1_Intron|ZNF346_uc011dfs.1_Intron|ZNF346_uc003mfj.2_Intron|ZNF346_uc003mfk.1_Intron|ZNF346_uc011dft.1_Intron	NM_012279	NP_036411			zinc finger protein 346							cytoplasm|nucleolus	double-stranded RNA binding|zinc ion binding				0	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
COL23A1	91522	broad.mit.edu	37	5	178007467	178007467	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178007467delT	uc003mje.2	-							NM_173465	NP_775736			collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	178278983	178278984	+	IGR	INS	-	A	A	rs71587702		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178278983_178278984insA								AACSL (33547 upstream) : ZNF354B (7970 downstream)																																			---	---	---	---
RASGEF1C	255426	broad.mit.edu	37	5	179548318	179548319	+	Intron	INS	-	TT	TT	rs34192976		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179548318_179548319insTT	uc003mlq.2	-						RASGEF1C_uc003mlr.2_Intron|RASGEF1C_uc003mlp.3_Intron	NM_175062	NP_778232			RasGEF domain family, member 1C						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	179827889	179827889	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179827889delA								GFPT2 (47574 upstream) : CNOT6 (93528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	1111832	1111833	+	IGR	DEL	GT	-	-	rs150054317		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1111832_1111833delGT								LOC285768 (10265 upstream) : FOXQ1 (200842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	4648124	4648125	+	IGR	INS	-	GA	GA	rs151311447	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4648124_4648125insGA								PECI (512293 upstream) : CDYL (58268 downstream)																																			---	---	---	---
NEDD9	4739	broad.mit.edu	37	6	11381032	11381034	+	Intron	DEL	TCT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11381032_11381034delTCT	uc010joz.2	-						NEDD9_uc003mzw.3_Intron	NM_001142393	NP_001135865			neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	11878658	11878658	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11878658delT								C6orf105 (99378 upstream) : HIVEP1 (134066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	12471890	12471891	+	IGR	INS	-	GGATT	GGATT	rs150421525	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12471890_12471891insGGATT								EDN1 (174464 upstream) : PHACTR1 (244997 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	16906287	16906288	+	IGR	DEL	AG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16906287_16906288delAG								ATXN1 (144566 upstream) : RBM24 (375521 downstream)																																			---	---	---	---
E2F3	1871	broad.mit.edu	37	6	20460496	20460496	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20460496delT	uc003nda.2	+						E2F3_uc003ncz.2_Intron	NM_001949	NP_001940			E2F transcription factor 3						G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|transcription initiation from RNA polymerase II promoter	transcription factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)															---	---	---	---
CDKAL1	54901	broad.mit.edu	37	6	20862867	20862868	+	Intron	DEL	TG	-	-	rs138991028		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20862867_20862868delTG	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron	NM_017774	NP_060244			CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	22998936	22998936	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22998936delT								HDGFL1 (428187 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	25243245	25243245	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25243245delC								CMAH (76452 upstream) : LRRC16A (36403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	29735549	29735549	+	IGR	DEL	T	-	-	rs141196980		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29735549delT								IFITM4P (16624 upstream) : HCG4 (23260 downstream)																																			---	---	---	---
DDR1	780	broad.mit.edu	37	6	30862041	30862041	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30862041delA	uc003nrr.2	+						DDR1_uc010jse.2_Intron|DDR1_uc003nrq.2_Intron|DDR1_uc003nrs.2_Intron|DDR1_uc003nrt.2_Intron|DDR1_uc011dms.1_Intron|DDR1_uc003nru.2_Intron|DDR1_uc003nrv.2_Intron|DDR1_uc003nrw.1_Intron|DDR1_uc003nry.1_Intron|DDR1_uc003nrx.1_Intron|DDR1_uc003nrz.1_5'Flank	NM_013993	NP_054699			discoidin domain receptor family, member 1						cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular region|integral to plasma membrane	ATP binding|protein binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|central_nervous_system(3)|large_intestine(1)|ovary(1)	9					Imatinib(DB00619)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	33208505	33208508	+	IGR	DEL	TGTG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33208505_33208508delTGTG								RING1 (28007 upstream) : VPS52 (9541 downstream)																																			---	---	---	---
ANKS1A	23294	broad.mit.edu	37	6	34976014	34976015	+	Intron	INS	-	A	A	rs147558928	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34976014_34976015insA	uc003ojx.3	+						ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Intron|ANKS1A_uc010jvp.1_Intron	NM_015245	NP_056060			ankyrin repeat and sterile alpha motif domain							cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
CLPS	1208	broad.mit.edu	37	6	35766317	35766318	+	5'Flank	INS	-	TC	TC	rs140155385	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35766317_35766318insTC	uc003ole.1	-						CLPS_uc003olf.1_5'Flank	NM_001832	NP_001823			colipase preproprotein						lipid catabolic process|lipid digestion|retinoid metabolic process|steroid metabolic process	extracellular region					0																		---	---	---	---
NFYA	4800	broad.mit.edu	37	6	41045538	41045538	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41045538delT	uc003opo.2	+						NFYA_uc003opp.2_Intron|NFYA_uc003opq.2_Intron	NM_002505	NP_002496			nuclear transcription factor Y, alpha isoform 1						transcription from RNA polymerase II promoter	CCAAT-binding factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(28;0.0418)|Colorectal(47;0.196)																	---	---	---	---
USP49	25862	broad.mit.edu	37	6	41830969	41830969	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41830969delA	uc003ori.2	-							NM_018561	NP_061031			ubiquitin thioesterase 49						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
TRERF1	55809	broad.mit.edu	37	6	42399636	42399636	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42399636delA	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037			transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	53351568	53351569	+	IGR	INS	-	T	T	rs139807153	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53351568_53351569insT								ELOVL5 (137626 upstream) : GCLC (10571 downstream)																																			---	---	---	---
DST	667	broad.mit.edu	37	6	56734788	56734789	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56734788_56734789insT	uc003pdf.2	-							NM_001144769	NP_001138241			dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)															---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57214697	57214698	+	Intron	INS	-	AA	AA	rs139359852	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57214697_57214698insAA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57245913	57245914	+	Intron	INS	-	C	C	rs146133879	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57245913_57245914insC	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57274966	57274967	+	Intron	INS	-	A	A	rs142189795	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57274966_57274967insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57323955	57323956	+	Intron	INS	-	T	T	rs150464138		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57323955_57323956insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57358075	57358076	+	Intron	INS	-	TC	TC	rs147835952	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57358075_57358076insTC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57369651	57369651	+	Intron	DEL	T	-	-	rs67817875		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57369651delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57379271	57379271	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57379271delA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57391533	57391534	+	Intron	INS	-	A	A	rs66613378		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57391533_57391534insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57403115	57403118	+	Intron	DEL	TTTT	-	-	rs71654115		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57403115_57403118delTTTT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57409250	57409251	+	Intron	INS	-	A	A	rs28431347		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57409250_57409251insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57434691	57434692	+	Intron	INS	-	CA	CA	rs141625561		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57434691_57434692insCA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57540010	57540010	+	IGR	DEL	C	-	-	rs66493514		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57540010delC								PRIM2 (26635 upstream) : GUSBL2 (706149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57564637	57564638	+	IGR	INS	-	G	G	rs145275344		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57564637_57564638insG								PRIM2 (51262 upstream) : GUSBL2 (681521 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57595085	57595086	+	IGR	INS	-	TCCTGTCTGGCT	TCCTGTCTGGCT	rs146299071	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57595085_57595086insTCCTGTCTGGCT								PRIM2 (81710 upstream) : GUSBL2 (651073 downstream)																																			---	---	---	---
KHDRBS2	202559	broad.mit.edu	37	6	62926601	62926602	+	Intron	INS	-	T	T	rs113920609		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62926601_62926602insT	uc003peg.2	-							NM_152688	NP_689901			KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	73287286	73287286	+	IGR	DEL	G	-	-	rs34721718		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73287286delG								RIMS1 (174779 upstream) : KCNQ5 (44285 downstream)																																			---	---	---	---
KCNQ5	56479	broad.mit.edu	37	6	73393481	73393482	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73393481_73393482insA	uc003pgk.2	+						KCNQ5_uc003pgj.3_Intron|KCNQ5_uc011dyh.1_Intron|KCNQ5_uc011dyi.1_Intron|KCNQ5_uc010kat.2_Intron|KCNQ5_uc011dyj.1_Intron|KCNQ5_uc011dyk.1_Intron	NM_019842	NP_062816			potassium voltage-gated channel, KQT-like						protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)														---	---	---	---
ME1	4199	broad.mit.edu	37	6	84132916	84132916	+	Intron	DEL	T	-	-	rs145125628		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84132916delT	uc003pjy.2	-						ME1_uc011dzb.1_Intron|ME1_uc011dzc.1_Intron	NM_002395	NP_002386			cytosolic malic enzyme 1						carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)													---	---	---	---
NT5E	4907	broad.mit.edu	37	6	86193587	86193587	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86193587delA	uc003pko.3	+						NT5E_uc010kbr.2_Intron	NM_002526	NP_002517			5' nucleotidase, ecto precursor						DNA metabolic process|purine base metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	5'-nucleotidase activity|nucleotide binding			ovary(3)|central_nervous_system(1)	4		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Pentoxifylline(DB00806)													---	---	---	---
ORC3L	23595	broad.mit.edu	37	6	88311390	88311390	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88311390delA	uc003pmh.2	+						ORC3L_uc011dzl.1_Intron|ORC3L_uc011dzm.1_Intron|ORC3L_uc011dzn.1_Intron|ORC3L_uc003pmg.2_Intron|ORC3L_uc003pmi.2_Intron|ORC3L_uc011dzo.1_Intron|ORC3L_uc011dzp.1_Intron	NM_012381	NP_036513			origin recognition complex, subunit 3 isoform 2						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	92906799	92906799	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92906799delC								None (None upstream) : None (None downstream)																																			---	---	---	---
KLHL32	114792	broad.mit.edu	37	6	97460553	97460553	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97460553delT	uc010kcm.1	+						KLHL32_uc003poy.2_Intron|KLHL32_uc011ead.1_Intron|KLHL32_uc003poz.2_Intron|KLHL32_uc011eae.1_Intron|KLHL32_uc003ppa.2_Intron	NM_052904	NP_443136			kelch-like 32											ovary(3)|skin(1)	4		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	106072783	106072783	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106072783delG								PREP (221814 upstream) : PRDM1 (461412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	106256307	106256308	+	IGR	INS	-	ACAC	ACAC	rs143082814	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106256307_106256308insACAC								PREP (405338 upstream) : PRDM1 (277887 downstream)																																			---	---	---	---
LACE1	246269	broad.mit.edu	37	6	108674358	108674358	+	Intron	DEL	T	-	-	rs35734578		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108674358delT	uc003psj.2	+							NM_145315	NP_660358			lactation elevated 1								ATP binding			central_nervous_system(1)	1		all_cancers(87;1.5e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;6.79e-05)|Colorectal(196;0.0294)|all_lung(197;0.0486)|Lung SC(18;0.152)		BRCA - Breast invasive adenocarcinoma(108;0.00179)|Epithelial(106;0.0024)|all cancers(137;0.00379)|OV - Ovarian serous cystadenocarcinoma(136;0.0118)														---	---	---	---
LACE1	246269	broad.mit.edu	37	6	108833156	108833156	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108833156delG	uc003psj.2	+							NM_145315	NP_660358			lactation elevated 1								ATP binding			central_nervous_system(1)	1		all_cancers(87;1.5e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;6.79e-05)|Colorectal(196;0.0294)|all_lung(197;0.0486)|Lung SC(18;0.152)		BRCA - Breast invasive adenocarcinoma(108;0.00179)|Epithelial(106;0.0024)|all cancers(137;0.00379)|OV - Ovarian serous cystadenocarcinoma(136;0.0118)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	114785205	114785205	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114785205delT								HS3ST5 (121665 upstream) : None (None downstream)																																			---	---	---	---
RWDD1	51389	broad.mit.edu	37	6	116912262	116912262	+	Intron	DEL	A	-	-	rs78170063		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116912262delA	uc003pxd.2	+						RWDD1_uc003pxb.2_Intron|RWDD1_uc003pxc.2_Intron	NM_015952	NP_057036			RWD domain containing 1 isoform a								protein binding			ovary(2)|central_nervous_system(1)	3		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.0312)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)|Epithelial(106;0.161)														---	---	---	---
SLC35F1	222553	broad.mit.edu	37	6	118625150	118625150	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118625150delA	uc003pxx.3	+						SLC35F1_uc003pxy.1_Intron	NM_001029858	NP_001025029			solute carrier family 35, member F1						transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)														---	---	---	---
FAM184A	79632	broad.mit.edu	37	6	119467562	119467563	+	Intron	INS	-	GT	GT	rs71860695		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119467562_119467563insGT	uc003pyk.3	-						FAM184A_uc003pyl.3_Intron	NM_001100411	NP_001093881			hypothetical protein LOC79632 isoform 2											ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	132089792	132089793	+	IGR	INS	-	CCAGCAATGTGAAGTGC	CCAGCAATGTGAAGTGC	rs149556651	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132089792_132089793insCCAGCAATGTGAAGTGC								ENPP3 (21243 upstream) : ENPP1 (39363 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	132922298	132922299	+	IGR	INS	-	GGAG	GGAG	rs146650063		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132922298_132922299insGGAG								TAAR5 (11421 upstream) : TAAR2 (15990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	133501565	133501565	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133501565delT								LOC285735 (73855 upstream) : EYA4 (60171 downstream)																																			---	---	---	---
SGK1	6446	broad.mit.edu	37	6	134492496	134492497	+	Intron	INS	-	TG	TG	rs141268381	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134492496_134492497insTG	uc003qen.3	-						SGK1_uc003qeo.3_Intron|SGK1_uc011ect.1_Intron|SGK1_uc011ecu.1_Intron|SGK1_uc011ecv.1_Intron|SGK1_uc011ecw.1_Intron	NM_005627	NP_005618			serum/glucocorticoid regulated kinase 1 isoform						apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	135550794	135550795	+	IGR	DEL	AG	-	-	rs113182371		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135550794_135550795delAG								MYB (10481 upstream) : MIR548A2 (9503 downstream)																																			---	---	---	---
PERP	64065	broad.mit.edu	37	6	138428040	138428041	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138428040_138428041insT	uc003qht.2	-							NM_022121	NP_071404			PERP, TP53 apoptosis effector						apoptosis|cell adhesion	desmosome|Golgi apparatus|integral to membrane|nucleus					0	Breast(32;0.0799)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000878)|OV - Ovarian serous cystadenocarcinoma(155;0.000997)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	139387660	139387669	+	IGR	DEL	TTTTTTTTTT	-	-	rs72074315		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139387660_139387669delTTTTTTTTTT								C6orf115 (23221 upstream) : HECA (68580 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	141717413	141717413	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:141717413delA								None (None upstream) : NMBR (679333 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	143859230	143859231	+	IGR	INS	-	ACAC	ACAC	rs142062030	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143859230_143859231insACAC								FUCA2 (26367 upstream) : LOC285740 (16236 downstream)																																			---	---	---	---
PLAGL1	5325	broad.mit.edu	37	6	144338511	144338511	+	Intron	DEL	A	-	-	rs60420134		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144338511delA	uc003qkj.2	-						PLAGL1_uc003qki.2_Intron|PLAGL1_uc003qkk.2_Intron|PLAGL1_uc003qkl.2_Intron|PLAGL1_uc003qkm.2_Intron|PLAGL1_uc010khn.2_Intron|PLAGL1_uc003qkn.2_Intron|PLAGL1_uc003qko.2_Intron|PLAGL1_uc003qkp.2_Intron	NM_002656	NP_002647			pleiomorphic adenoma gene-like 1 isoform 1						cell cycle arrest|induction of apoptosis|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(155;5.74e-07)|GBM - Glioblastoma multiforme(68;0.0885)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	148584850	148584851	+	IGR	INS	-	A	A	rs143414458	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148584850_148584851insA								SAMD5 (693693 upstream) : SASH1 (78878 downstream)																																			---	---	---	---
KATNA1	11104	broad.mit.edu	37	6	149959854	149959854	+	5'Flank	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149959854delA	uc003qmr.1	-						KATNA1_uc003qms.2_Intron|KATNA1_uc003qmt.2_Intron|KATNA1_uc011eed.1_5'Flank	NM_007044	NP_008975			katanin p60 subunit A 1						cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)														---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152040461	152040462	+	Intron	DEL	AG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152040461_152040462delAG	uc003qom.3	+							NM_001122742	NP_001116214			estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152959703	152959704	+	5'Flank	INS	-	TTTG	TTTG	rs146825346	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152959703_152959704insTTTG	uc010kiw.2	-						SYNE1_uc003qot.3_5'Flank|SYNE1_uc003qou.3_5'Flank|SYNE1_uc010kjb.1_5'Flank	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	6	153190282	153190282	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153190282delA								VIP (109384 upstream) : FBXO5 (101378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	153612552	153612552	+	IGR	DEL	C	-	-	rs11357825		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153612552delC								RGS17 (160163 upstream) : OPRM1 (719084 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	156734003	156734003	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156734003delA								MIR1202 (465990 upstream) : ARID1B (365083 downstream)																																			---	---	---	---
ARID1B	57492	broad.mit.edu	37	6	157464571	157464572	+	Intron	INS	-	GG	GG	rs139635777	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157464571_157464572insGG	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron|ARID1B_uc003qqq.1_Intron	NM_017519	NP_059989			AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	161259984	161259984	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161259984delT								PLG (85639 upstream) : MAP3K4 (152838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	164465549	164465550	+	IGR	INS	-	A	A	rs146920969	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164465549_164465550insA								QKI (470657 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	168592177	168592177	+	IGR	DEL	T	-	-	rs71835213		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168592177delT								FRMD1 (112338 upstream) : DACT2 (115409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	170533683	170533683	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170533683delG								C6orf208 (330714 upstream) : LOC154449 (29739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85390	85393	+	IGR	DEL	TGTG	-	-	rs111360758		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85390_85393delTGTG								None (None upstream) : FAM20C (107576 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118306	118306	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118306delG								None (None upstream) : FAM20C (74663 downstream)																																			---	---	---	---
PRKAR1B	5575	broad.mit.edu	37	7	638940	638940	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:638940delT	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron|PRKAR1B_uc003six.1_Intron	NM_002735	NP_002726			protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	1253470	1253471	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1253470_1253471insA								ZFAND2A (53615 upstream) : UNCX (19183 downstream)																																			---	---	---	---
INTS1	26173	broad.mit.edu	37	7	1546840	1546840	+	5'Flank	DEL	T	-	-	rs111819550		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1546840delT	uc003skn.2	-						INTS1_uc003skq.2_5'Flank	NM_001080453	NP_001073922			integrator complex subunit 1						snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	1633778	1633781	+	IGR	DEL	ATCC	-	-	rs58448977		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1633778_1633781delATCC								KIAA1908 (4519 upstream) : TFAMP1 (20325 downstream)																																			---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	1863992	1863993	+	Intron	DEL	TT	-	-	rs111246669		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1863992_1863993delTT	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc003sld.1_Intron	NM_001013836	NP_001013858			MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
RNF216L	441191	broad.mit.edu	37	7	5016535	5016535	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5016535delT	uc003snp.3	+						RNF216L_uc003snq.3_Intron|RNF216L_uc010ksr.2_Intron|RNF216L_uc011jwe.1_Intron	NR_023384				Homo sapiens cDNA FLJ42538 fis, clone BRACE3004113.												0																		---	---	---	---
ICA1	3382	broad.mit.edu	37	7	8207656	8207657	+	Intron	INS	-	AG	AG	rs149474890	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8207656_8207657insAG	uc003srm.2	-						ICA1_uc010ktr.2_Intron|ICA1_uc003srl.2_Intron|ICA1_uc003srn.3_Intron|ICA1_uc003srp.3_Intron|ICA1_uc010kts.2_Intron|ICA1_uc003srq.2_Intron|ICA1_uc003srr.2_Intron|ICA1_uc003sro.3_Intron|ICA1_uc011jxg.1_Intron|ICA1_uc003srs.1_Intron	NM_022307	NP_071682			islet cell autoantigen 1						neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	10350716	10350717	+	IGR	INS	-	A	A	rs146940916	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10350716_10350717insA								PER4 (675269 upstream) : NDUFA4 (622098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	10733076	10733076	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10733076delG								None (None upstream) : NDUFA4 (239739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	11340657	11340658	+	Intron	DEL	GA	-	-	rs55633292	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11340657_11340658delGA	uc003ssb.2	+											Homo sapiens cDNA clone IMAGE:4830466.																														---	---	---	---
ISPD	729920	broad.mit.edu	37	7	16317860	16317860	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16317860delA	uc010ktx.2	-						ISPD_uc010kty.2_Intron	NM_001101426	NP_001094896			notch1-induced protein isoform a						isoprenoid biosynthetic process		nucleotidyltransferase activity			ovary(1)	1															Multiple Myeloma(15;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	17823354	17823356	+	IGR	DEL	TTG	-	-	rs35160605		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17823354_17823356delTTG								AHR (437579 upstream) : SNX13 (7030 downstream)																																			---	---	---	---
HDAC9	9734	broad.mit.edu	37	7	18178150	18178151	+	Intron	INS	-	GT	GT	rs148233307	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18178150_18178151insGT	uc011jya.1	+							NM_014707	NP_055522			histone deacetylase 9 isoform 3						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	22121569	22121570	+	IGR	INS	-	T	T	rs149868516	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22121569_22121570insT								CDCA7L (136027 upstream) : RAPGEF5 (36339 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	24345607	24345607	+	IGR	DEL	A	-	-	rs74437262	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24345607delA								NPY (14130 upstream) : MPP6 (267478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	35586437	35586437	+	IGR	DEL	T	-	-	rs34284878		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35586437delT								TBX20 (293195 upstream) : HERPUD2 (85835 downstream)																																			---	---	---	---
ELMO1	9844	broad.mit.edu	37	7	37375834	37375834	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37375834delA	uc003tfk.1	-						ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615			engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
TXNDC3	51314	broad.mit.edu	37	7	37886770	37886775	+	5'Flank	DEL	GAAGAG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37886770_37886775delGAAGAG	uc003tfn.2	+							NM_016616	NP_057700			thioredoxin domain containing 3						cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3														Kartagener_syndrome				---	---	---	---
POU6F2	11281	broad.mit.edu	37	7	39352656	39352656	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39352656delC	uc003thb.1	+						POU6F2_uc010kxo.2_Intron	NM_007252	NP_009183			POU class 6 homeobox 2 isoform 1						central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	41643867	41643867	+	IGR	DEL	T	-	-	rs34764201		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41643867delT								C7orf10 (743510 upstream) : INHBA (84736 downstream)																																			---	---	---	---
INHBA	3624	broad.mit.edu	37	7	41740685	41740686	+	5'Flank	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41740685_41740686insT	uc003thq.2	-						LOC285954_uc003tht.3_Intron|INHBA_uc003thr.2_Intron|LOC285954_uc003ths.2_Intron	NM_002192	NP_002183			inhibin beta A precursor						cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6															TSP Lung(11;0.080)			---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43357409	43357410	+	Intron	DEL	TG	-	-	rs112953001		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43357409_43357410delTG	uc003tid.1	+						HECW1_uc011kbi.1_Intron|HECW1_uc003tie.1_Intron	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43585435	43585436	+	Intron	INS	-	A	A	rs144757376	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43585435_43585436insA	uc003tid.1	+						HECW1_uc011kbi.1_Intron	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43595514	43595515	+	Intron	INS	-	A	A	rs137982471	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43595514_43595515insA	uc003tid.1	+						HECW1_uc011kbi.1_Intron	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	44782788	44782788	+	IGR	DEL	T	-	-	rs67170241		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44782788delT								OGDH (34120 upstream) : ZMIZ2 (5392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	45398144	45398145	+	IGR	DEL	AG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45398144_45398145delAG								RAMP3 (174297 upstream) : ADCY1 (215594 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	46843453	46843453	+	IGR	DEL	T	-	-	rs112536987		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46843453delT								IGFBP3 (882582 upstream) : TNS3 (471300 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	46984689	46984690	+	IGR	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46984689_46984690delGT								None (None upstream) : TNS3 (330063 downstream)																																			---	---	---	---
TNS3	64759	broad.mit.edu	37	7	47522085	47522086	+	Intron	INS	-	A	A	rs142172121	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47522085_47522086insA	uc003tnv.2	-						TNS3_uc003tnw.2_Intron|TNS3_uc010kyo.1_Intron	NM_022748	NP_073585			tensin 3							focal adhesion	protein binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	49218703	49218706	+	IGR	DEL	ACTT	-	-	rs72315075		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49218703_49218706delACTT								CDC14C (251654 upstream) : VWC2 (594551 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52404188	52404188	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52404188delA								None (None upstream) : POM121L12 (699161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53555527	53555527	+	IGR	DEL	T	-	-	rs4579480		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53555527delT								POM121L12 (450910 upstream) : HPVC1 (713390 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56417434	56417435	+	IGR	DEL	TA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56417434_56417435delTA								PSPH (233344 upstream) : DKFZp434L192 (146481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56457347	56457348	+	IGR	INS	-	A	A	rs77614823		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56457347_56457348insA								PSPH (273257 upstream) : DKFZp434L192 (106568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57545110	57545111	+	IGR	INS	-	CT	CT	rs143187456	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57545110_57545111insCT								ZNF716 (11845 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57581934	57581934	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57581934delA								ZNF716 (48669 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57608535	57608536	+	IGR	INS	-	T	T	rs147153132	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57608535_57608536insT								ZNF716 (75270 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57610458	57610458	+	IGR	DEL	T	-	-	rs113461940		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57610458delT								ZNF716 (77193 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57613049	57613049	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57613049delT								ZNF716 (79784 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57619572	57619575	+	IGR	DEL	CAAA	-	-	rs111838531		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57619572_57619575delCAAA								ZNF716 (86307 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57663405	57663405	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57663405delT								ZNF716 (130140 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57701331	57701331	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57701331delT								ZNF716 (168066 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57929464	57929464	+	IGR	DEL	G	-	-	rs76511107		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57929464delG								ZNF716 (396199 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57989291	57989291	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57989291delA								ZNF716 (456026 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61082438	61082438	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61082438delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61090873	61090873	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61090873delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61750494	61750495	+	IGR	INS	-	A	A	rs139756826		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61750494_61750495insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61785748	61785749	+	IGR	INS	-	A	A	rs140519983		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61785748_61785749insA								None (None upstream) : LOC643955 (965923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61845525	61845526	+	IGR	INS	-	G	G	rs145105142		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61845525_61845526insG								None (None upstream) : LOC643955 (906146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61879136	61879137	+	IGR	INS	-	TT	TT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61879136_61879137insTT								None (None upstream) : LOC643955 (872535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61967310	61967310	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61967310delA								None (None upstream) : LOC643955 (784362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64336508	64336508	+	Intron	DEL	C	-	-	rs34320925		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64336508delC	uc003ttk.1	+											Homo sapiens cDNA FLJ40383 fis, clone TESTI2035793.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	64555301	64555301	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64555301delC								ZNF117 (88180 upstream) : INTS4L1 (46302 downstream)																																			---	---	---	---
ZNF92	168374	broad.mit.edu	37	7	64843346	64843346	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64843346delA	uc003ttz.2	+						ZNF92_uc003tua.2_Intron|ZNF92_uc010kzu.2_Intron|ZNF92_uc003tub.2_Intron	NM_152626	NP_689839			zinc finger protein 92 isoform 2							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(55;0.159)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	64957994	64957994	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64957994delT								ZNF92 (91997 upstream) : INTS4L2 (154783 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65269753	65269754	+	IGR	INS	-	GTCTCGAAAAC	GTCTCGAAAAC	rs148869971	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65269753_65269754insGTCTCGAAAAC								CCT6P1 (41092 upstream) : VKORC1L1 (68503 downstream)																																			---	---	---	---
GUSB	2990	broad.mit.edu	37	7	65426990	65426990	+	Intron	DEL	A	-	-	rs11287621		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65426990delA	uc003tun.2	-						GUSB_uc011kdt.1_Intron	NM_000181	NP_000172			glucuronidase, beta precursor						glycosaminoglycan catabolic process	lysosome	beta-glucuronidase activity|cation binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	68284559	68284560	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68284559_68284560insT								None (None upstream) : AUTS2 (779345 downstream)																																			---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	70018684	70018684	+	Intron	DEL	T	-	-	rs111723309		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70018684delT	uc003tvw.3	+						AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
WBSCR17	64409	broad.mit.edu	37	7	71078778	71078779	+	Intron	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71078778_71078779delTT	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924			UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)																---	---	---	---
CALN1	83698	broad.mit.edu	37	7	71390227	71390228	+	Intron	DEL	GA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71390227_71390228delGA	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440			calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)																---	---	---	---
CALN1	83698	broad.mit.edu	37	7	71498481	71498482	+	Intron	INS	-	T	T	rs144013228	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71498481_71498482insT	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440			calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)																---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73230190	73230191	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73230190_73230191insT	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	73680557	73680557	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73680557delT								RFC2 (11819 upstream) : CLIP2 (23248 downstream)																																			---	---	---	---
POR	5447	broad.mit.edu	37	7	75563286	75563287	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75563286_75563287insT	uc003udy.2	+							NM_000941	NP_000932			cytochrome P450 reductase						cellular organofluorine metabolic process|positive regulation of monooxygenase activity	endoplasmic reticulum membrane	iron ion binding|NADPH-hemoprotein reductase activity			central_nervous_system(1)	1					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Lipoic Acid(DB00166)|Menadione(DB00170)|Methoxyflurane(DB01028)|Mitomycin(DB00305)|Nilutamide(DB00665)													---	---	---	---
PMS2L11	441263	broad.mit.edu	37	7	76626477	76626478	+	Intron	INS	-	GT	GT	rs141618293	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76626477_76626478insGT	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0																		---	---	---	---
PMS2L11	441263	broad.mit.edu	37	7	76628308	76628309	+	Intron	INS	-	G	G	rs76838144		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76628308_76628309insG	uc003ufw.3	+						PMS2L11_uc011kgn.1_Intron	NR_023383				Homo sapiens cDNA FLJ59034 complete cds, moderately similar to Protein deltex-2.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	77102076	77102077	+	IGR	INS	-	AG	AG	rs139070690	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77102076_77102077insAG								PION (56359 upstream) : PTPN12 (64696 downstream)																																			---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78299097	78299097	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78299097delT	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	79386862	79386862	+	IGR	DEL	T	-	-	rs145086141		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79386862delT								MAGI2 (303972 upstream) : GNAI1 (377278 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	83868036	83868036	+	IGR	DEL	T	-	-	rs141779034		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83868036delT								SEMA3A (43819 upstream) : SEMA3D (756838 downstream)																																			---	---	---	---
CYP51A1	1595	broad.mit.edu	37	7	91799383	91799384	+	Intron	INS	-	A	A	rs139004565	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91799383_91799384insA	uc003uln.3	-						uc003ulo.1_Intron|LOC401387_uc011kho.1_Intron	NM_001146152	NP_001139624			cytochrome P450, family 51, subfamily A,						cholesterol biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|sterol 14-demethylase activity				0	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		Fluconazole(DB00196)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Miconazole(DB01110)|Terconazole(DB00251)													---	---	---	---
GATAD1	57798	broad.mit.edu	37	7	92086476	92086476	+	3'UTR	DEL	A	-	-	rs147768913		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92086476delA	uc003ulx.1	+	5					GATAD1_uc011khq.1_Intron	NM_021167	NP_066990			GATA zinc finger domain containing 1								sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(62;1.63e-10)|all_epithelial(64;8.33e-10)|Breast(17;0.00311)|all_lung(186;0.0498)|Lung NSC(181;0.0676)		STAD - Stomach adenocarcinoma(171;4.51e-05)|GBM - Glioblastoma multiforme(5;8.83e-05)|all cancers(6;0.000136)|Lung(22;0.123)|Epithelial(20;0.179)|LUSC - Lung squamous cell carcinoma(200;0.225)															---	---	---	---
HEPACAM2	253012	broad.mit.edu	37	7	92847190	92847191	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92847190_92847191delTG	uc003umm.2	-						HEPACAM2_uc003uml.2_Intron|HEPACAM2_uc010lff.2_Intron|HEPACAM2_uc011khy.1_Intron	NM_001039372	NP_001034461			HEPACAM family member 2 isoform 1							integral to membrane				ovary(3)|breast(1)|kidney(1)	5																		---	---	---	---
BAIAP2L1	55971	broad.mit.edu	37	7	97998117	97998118	+	Intron	INS	-	T	T	rs13309825		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97998117_97998118insT	uc003upj.2	-							NM_018842	NP_061330			BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	98081270	98081271	+	IGR	INS	-	A	A	rs142948997		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98081270_98081271insA								BAIAP2L1 (50843 upstream) : NPTX2 (165326 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	100618904	100618905	+	IGR	INS	-	T	T	rs142129470	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100618904_100618905insT								ACHE (124365 upstream) : MUC12 (29170 downstream)																																			---	---	---	---
EMID2	136227	broad.mit.edu	37	7	101040783	101040787	+	Intron	DEL	CCTTC	-	-	rs116754138	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101040783_101040787delCCTTC	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714			EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)																	---	---	---	---
EMID2	136227	broad.mit.edu	37	7	101071961	101071962	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101071961_101071962delTG	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714			EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	101442715	101442718	+	IGR	DEL	CAAA	-	-	rs34896709		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101442715_101442718delCAAA								MYL10 (170139 upstream) : CUX1 (16574 downstream)																																			---	---	---	---
POLR2J3	548644	broad.mit.edu	37	7	102205146	102205147	+	Intron	DEL	TC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102205146_102205147delTC	uc011kkw.1	-						UPK3BL_uc003uzy.2_Intron|POLR2J3_uc003uzw.2_Intron	NM_001097615	NP_001091084			polymerase (RNA) II (DNA directed) polypeptide							nucleus	DNA binding|DNA-directed RNA polymerase activity|protein dimerization activity				0																		---	---	---	---
ATXN7L1	222255	broad.mit.edu	37	7	105459892	105459892	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105459892delA	uc003vde.2	-						ATXN7L1_uc003vdi.2_Intron	NM_020725	NP_065776			ataxin 7-like 1 isoform 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	106130327	106130328	+	RNA	INS	-	T	T	rs148040204	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106130327_106130328insT	uc003vds.2	-	5		c.542_543insA								Homo sapiens full length insert cDNA clone ZC44D09.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	106242367	106242367	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106242367delA	uc003vds.2	-											Homo sapiens full length insert cDNA clone ZC44D09.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	108201712	108201713	+	IGR	INS	-	T	T	rs79804279		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108201712_108201713insT								PNPLA8 (33107 upstream) : THAP5 (960 downstream)																																			---	---	---	---
DOCK4	9732	broad.mit.edu	37	7	111429137	111429138	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111429137_111429138insT	uc003vfx.2	-						DOCK4_uc011kmm.1_5'Flank|DOCK4_uc003vfw.2_Intron|DOCK4_uc003vfy.2_Intron	NM_014705	NP_055520			dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)																---	---	---	---
DOCK4	9732	broad.mit.edu	37	7	111760188	111760188	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111760188delT	uc003vfx.2	-						DOCK4_uc003vfy.2_Intron|DOCK4_uc003vga.1_Intron|DOCK4_uc010ljt.1_Intron	NM_014705	NP_055520			dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	112636470	112636470	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112636470delA								C7orf60 (56538 upstream) : GPR85 (83998 downstream)																																			---	---	---	---
FOXP2	93986	broad.mit.edu	37	7	114202753	114202753	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114202753delA	uc003vhb.2	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgz.2_Intron|FOXP2_uc003vha.2_Intron|FOXP2_uc011kmu.1_Intron|FOXP2_uc011kmv.1_Intron|FOXP2_uc003vgt.1_Intron|FOXP2_uc003vgv.1_Intron|FOXP2_uc003vgw.2_Intron|FOXP2_uc003vgx.2_Intron|FOXP2_uc003vhd.2_Intron|FOXP2_uc003vhc.2_Intron	NM_014491	NP_055306			forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	114507430	114507431	+	IGR	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114507430_114507431delAC								FOXP2 (176338 upstream) : MDFIC (54778 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	121220518	121220519	+	IGR	INS	-	AAAGAG	AAAGAG	rs138996157	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121220518_121220519insAAAGAG								FAM3C (184096 upstream) : PTPRZ1 (292640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	123723067	123723067	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123723067delT	uc011koc.1	+											Homo sapiens disrupted in Rett 1 mRNA sequence.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	124289978	124289978	+	IGR	DEL	A	-	-	rs112372667		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124289978delA								TMEM229A (616455 upstream) : GPR37 (96138 downstream)																																			---	---	---	---
TSPAN33	340348	broad.mit.edu	37	7	128785483	128785483	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128785483delT	uc003vop.1	+							NM_178562	NP_848657			tetraspanin 33							integral to membrane				ovary(1)	1																		---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	131992055	131992055	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131992055delT	uc003vra.3	-							NM_020911	NP_065962			plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	132258397	132258398	+	Intron	INS	-	ACAGGAAGGC	ACAGGAAGGC	rs144885725	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132258397_132258398insACAGGAAGGC	uc003vra.3	-						PLXNA4_uc003vrc.2_Intron|PLXNA4_uc003vrb.2_Intron	NM_020911	NP_065962			plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133445737	133445737	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133445737delA	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133672108	133672108	+	Intron	DEL	G	-	-	rs78114783		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133672108delG	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron|EXOC4_uc011kpq.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	135959845	135959848	+	IGR	DEL	TCTT	-	-	rs148703536		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135959845_135959848delTCTT								LUZP6 (297641 upstream) : CHRM2 (593551 downstream)																																			---	---	---	---
PTN	5764	broad.mit.edu	37	7	137015925	137015926	+	Intron	INS	-	AGTC	AGTC	rs147307837	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137015925_137015926insAGTC	uc003vtq.2	-						PTN_uc010lmx.2_Intron|PTN_uc003vtr.1_Intron	NM_002825	NP_002816			pleiotrophin						nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2																		---	---	---	---
TRIM24	8805	broad.mit.edu	37	7	138197375	138197389	+	Intron	DEL	GGCTGGAACTGGAGA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138197375_138197389delGGCTGGAACTGGAGA	uc003vuc.2	+						TRIM24_uc003vub.2_Intron	NM_015905	NP_056989			transcriptional intermediary factor 1 alpha						cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8																		---	---	---	---
HIPK2	28996	broad.mit.edu	37	7	139451742	139451742	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139451742delG	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron	NM_022740	NP_073577			homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	144078307	144078307	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144078307delT								ARHGEF5 (583 upstream) : NOBOX (17734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	144845685	144845686	+	IGR	INS	-	TTTACAAATTGT	TTTACAAATTGT	rs139776246	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144845685_144845686insTTTACAAATTGT								TPK1 (312539 upstream) : CNTNAP2 (967767 downstream)																																			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	146661953	146661953	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146661953delA	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147937943	147937943	+	Intron	DEL	C	-	-	rs5888314		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147937943delC	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	148375038	148375045	+	IGR	DEL	AAGGAAGG	-	-	rs75124216		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148375038_148375045delAAGGAAGG								C7orf33 (62087 upstream) : CUL1 (19961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	151245218	151245218	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151245218delT								RHEB (28208 upstream) : PRKAG2 (7985 downstream)																																			---	---	---	---
PRKAG2	51422	broad.mit.edu	37	7	151285106	151285106	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151285106delA	uc003wkk.2	-						PRKAG2_uc003wki.2_Intron|PRKAG2_uc011kvl.1_Intron|PRKAG2_uc003wkj.2_Intron|PRKAG2_uc003wkl.2_Intron|PRKAG2_uc010lqe.1_Intron	NM_016203	NP_057287			AMP-activated protein kinase gamma2 subunit						ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	152796560	152796561	+	IGR	INS	-	CA	CA	rs140752113		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152796560_152796561insCA								ACTR3B (244097 upstream) : DPP6 (787858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155585184	155585184	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155585184delT								RBM33 (11005 upstream) : SHH (7552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	156881484	156881484	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156881484delT								MNX1 (78137 upstream) : UBE3C (50171 downstream)																																			---	---	---	---
NCAPG2	54892	broad.mit.edu	37	7	158460937	158460938	+	Intron	INS	-	G	G	rs72314493		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158460937_158460938insG	uc003wnv.1	-						NCAPG2_uc010lqu.1_Intron|NCAPG2_uc003wnw.1_Intron|NCAPG2_uc003wnx.1_Intron|NCAPG2_uc011kwe.1_Intron|NCAPG2_uc011kwc.1_5'Flank	NM_017760	NP_060230			leucine zipper protein 5						cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)														---	---	---	---
ESYT2	57488	broad.mit.edu	37	7	158574830	158574831	+	Intron	INS	-	TA	TA	rs150178834		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158574830_158574831insTA	uc003wob.1	-						ESYT2_uc003woc.1_Intron|ESYT2_uc003wod.1_Intron	NM_020728	NP_065779			family with sequence similarity 62 (C2 domain							integral to membrane|plasma membrane				central_nervous_system(2)|kidney(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	2262794	2262794	+	IGR	DEL	T	-	-	rs79274177		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2262794delT								MYOM2 (169415 upstream) : CSMD1 (530082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	6097906	6097906	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6097906delA								None (None upstream) : MCPH1 (166215 downstream)																																			---	---	---	---
XKR6	286046	broad.mit.edu	37	8	10945767	10945768	+	Intron	INS	-	A	A	rs140135498	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10945767_10945768insA	uc003wtk.1	-							NM_173683	NP_775954			XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)														---	---	---	---
XKR6	286046	broad.mit.edu	37	8	11002552	11002553	+	Intron	INS	-	AGGGAGGGAGGG	AGGGAGGGAGGG	rs139739480	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11002552_11002553insAGGGAGGGAGGG	uc003wtk.1	-							NM_173683	NP_775954			XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|skin(1)	2				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	12431520	12431520	+	Intron	DEL	A	-	-	rs113159264		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12431520delA	uc003wvy.3	-						uc003wwa.2_5'Flank					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	15368787	15368790	+	IGR	DEL	AGGG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15368787_15368790delAGGG								SGCZ (272995 upstream) : TUSC3 (28940 downstream)																																			---	---	---	---
MTUS1	57509	broad.mit.edu	37	8	17549214	17549214	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17549214delT	uc003wxv.2	-						MTUS1_uc003wxt.2_Intron|MTUS1_uc011kyg.1_Intron|MTUS1_uc010lsy.2_Intron|MTUS1_uc003wxw.2_Intron|MTUS1_uc003wxs.2_Intron	NM_001001924	NP_001001924			mitochondrial tumor suppressor 1 isoform 1							Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)														---	---	---	---
MTUS1	57509	broad.mit.edu	37	8	17657448	17657449	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17657448_17657449insA	uc003wxv.2	-						MTUS1_uc003wxw.2_Intron|MTUS1_uc010lsz.2_Intron	NM_001001924	NP_001001924			mitochondrial tumor suppressor 1 isoform 1							Golgi apparatus|microtubule|microtubule organizing center|mitochondrion|nucleus|plasma membrane|spindle				ovary(1)|skin(1)	2				Colorectal(111;0.0778)														---	---	---	---
PSD3	23362	broad.mit.edu	37	8	18402988	18402988	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18402988delA	uc003wza.2	-						PSD3_uc003wyx.3_Intron|PSD3_uc003wyy.2_Intron|PSD3_uc003wyz.2_Intron	NM_015310	NP_056125			ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	20877186	20877186	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20877186delA								LZTS1 (764383 upstream) : GFRA2 (672344 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	23983752	23983752	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23983752delT								STC1 (271432 upstream) : ADAM28 (167828 downstream)																																			---	---	---	---
DOCK5	80005	broad.mit.edu	37	8	25123737	25123738	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25123737_25123738insT	uc003xeg.2	+						DOCK5_uc010luf.1_Intron|DOCK5_uc003xef.2_Intron	NM_024940	NP_079216			dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	26868181	26868181	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26868181delT								ADRA1A (145259 upstream) : MIR548H-4 (38189 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	28135824	28135824	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28135824delA								ELP3 (87157 upstream) : PNOC (38825 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	28493233	28493234	+	IGR	DEL	CA	-	-	rs113242979		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28493233_28493234delCA								FZD3 (71274 upstream) : EXTL3 (65919 downstream)																																			---	---	---	---
INTS9	55756	broad.mit.edu	37	8	28678421	28678421	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28678421delA	uc003xha.2	-						INTS9_uc011lav.1_Intron|INTS9_uc011law.1_Intron|INTS9_uc011lax.1_Intron|INTS9_uc010lvc.2_Intron|INTS9_uc003xhb.2_Intron	NM_018250	NP_060720			integrator complex subunit 9 isoform 1						snRNA processing	integrator complex	protein binding			central_nervous_system(1)|pancreas(1)	2		Ovarian(32;0.0439)		KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.152)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	33062702	33062702	+	IGR	DEL	T	-	-	rs34005592		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33062702delT								NRG1 (440144 upstream) : FUT10 (165644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	38346253	38346254	+	IGR	DEL	AC	-	-	rs111907565		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38346253_38346254delAC								FGFR1 (19901 upstream) : C8orf86 (22098 downstream)																																			---	---	---	---
TACC1	6867	broad.mit.edu	37	8	38638651	38638651	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38638651delC	uc011lbz.1	+						TACC1_uc011lby.1_Intron|TACC1_uc003xma.2_Intron|TACC1_uc003xlz.2_Intron|TACC1_uc003xmc.3_Intron|TACC1_uc003xmb.3_Intron|TACC1_uc003xme.1_Intron|TACC1_uc003xmd.1_Intron|TACC1_uc010lwo.1_Intron	NM_006283	NP_006274			transforming, acidic coiled-coil containing						cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)															---	---	---	---
ADAM18	8749	broad.mit.edu	37	8	39524435	39524436	+	Intron	DEL	TT	-	-	rs6474165	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39524435_39524436delTT	uc003xni.2	+						ADAM18_uc010lww.2_Intron|ADAM18_uc010lwx.2_Intron	NM_014237	NP_055052			a disintegrin and metalloprotease domain 18						cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	49216315	49216316	+	IGR	INS	-	G	G	rs150831001	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49216315_49216316insG								UBE2V2 (241863 upstream) : EFCAB1 (407035 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	49354255	49354256	+	IGR	INS	-	TG	TG	rs146428627	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49354255_49354256insTG								UBE2V2 (379803 upstream) : EFCAB1 (269095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	49725553	49725554	+	IGR	DEL	AC	-	-	rs33963669		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49725553_49725554delAC								EFCAB1 (77683 upstream) : SNAI2 (104685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	61910494	61910495	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61910494_61910495delTG								CHD7 (131031 upstream) : CLVS1 (290030 downstream)																																			---	---	---	---
CPA6	57094	broad.mit.edu	37	8	68347033	68347034	+	Intron	INS	-	G	G	rs145708892	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68347033_68347034insG	uc003xxq.3	-						CPA6_uc003xxr.3_Intron	NM_020361	NP_065094			carboxypeptidase A6 isoform 1 precursor						proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	81168752	81168752	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81168752delA								TPD52 (84916 upstream) : ZBTB10 (229102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	82143351	82143351	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82143351delC								PAG1 (119048 upstream) : FABP5 (49434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	96287842	96287845	+	IGR	DEL	CTCC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96287842_96287845delCTCC								C8orf37 (6405 upstream) : GDF6 (866715 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	97212566	97212566	+	IGR	DEL	A	-	-	rs77884243		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97212566delA								GDF6 (39546 upstream) : UQCRB (26744 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	99191955	99191956	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99191955_99191956delTG								POP1 (19887 upstream) : NIPAL2 (12431 downstream)																																			---	---	---	---
VPS13B	157680	broad.mit.edu	37	8	100152915	100152916	+	Intron	INS	-	CCT	CCT	rs144438049	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100152915_100152916insCCT	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron|VPS13B_uc003yit.2_Intron|VPS13B_uc003yiu.1_Intron|VPS13B_uc003yix.1_Intron	NM_017890	NP_060360			vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---
KLF10	7071	broad.mit.edu	37	8	103670754	103670755	+	5'Flank	DEL	AC	-	-	rs34889681		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103670754_103670755delAC	uc011lhk.1	-							NM_005655	NP_005646			Kruppel-like factor 10 isoform a						cell proliferation|cell-cell signaling|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|skeletal system development|transforming growth factor beta receptor signaling pathway	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)															---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106568954	106568954	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106568954delC	uc003ymd.2	+							NM_012082	NP_036214			zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106638200	106638201	+	Intron	DEL	AA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106638200_106638201delAA	uc003ymd.2	+							NM_012082	NP_036214			zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
OXR1	55074	broad.mit.edu	37	8	107552882	107552882	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107552882delG	uc011lht.1	+						OXR1_uc003ymf.2_Intron	NM_018002	NP_060472			oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	116298223	116298224	+	IGR	DEL	CA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116298223_116298224delCA								None (None upstream) : TRPS1 (122501 downstream)																																			---	---	---	---
SLC30A8	169026	broad.mit.edu	37	8	118168284	118168284	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118168284delT	uc003yoh.2	+						SLC30A8_uc010mcz.2_Intron|SLC30A8_uc011lia.1_Intron|SLC30A8_uc003yog.2_Intron	NM_173851	NP_776250			solute carrier family 30 member 8						insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)															---	---	---	---
DSCC1	79075	broad.mit.edu	37	8	120847254	120847255	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120847254_120847255insA	uc003yov.2	-						TAF2_uc003you.2_5'Flank	NM_024094	NP_076999			defective in sister chromatid cohesion 1						DNA replication|maintenance of mitotic sister chromatid cohesion|post-translational protein acetylation|regulation of DNA replication	chromatin|chromosome, centromeric region|nucleoplasm	DNA binding|protein binding			pancreas(1)	1	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	122330711	122330712	+	IGR	DEL	TT	-	-	rs138971567		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122330711_122330712delTT								SNTB1 (506402 upstream) : HAS2 (294559 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	125453917	125453917	+	IGR	DEL	A	-	-	rs74801061		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125453917delA								TMEM65 (68977 upstream) : TRMT12 (9131 downstream)																																			---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125574756	125574757	+	Intron	DEL	CT	-	-	rs72414910		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125574756_125574757delCT	uc003yrk.2	-						NDUFB9_uc011lim.1_Intron|MTSS1_uc011lin.1_Intron|MTSS1_uc011lio.1_Intron|MTSS1_uc003yri.2_Intron|MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566			metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	125877753	125877754	+	IGR	DEL	TT	-	-	rs71289702		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125877753_125877754delTT								MTSS1 (137023 upstream) : LOC157381 (74130 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	125895609	125895610	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125895609_125895610insT								MTSS1 (154879 upstream) : LOC157381 (56274 downstream)																																			---	---	---	---
NSMCE2	286053	broad.mit.edu	37	8	126259576	126259576	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126259576delA	uc003yrw.2	+							NM_173685	NP_775956			non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)															---	---	---	---
ASAP1	50807	broad.mit.edu	37	8	131214134	131214134	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131214134delT	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952			development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	133132630	133132630	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133132630delT								HHLA1 (15118 upstream) : KCNQ3 (8627 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134727695	134727695	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134727695delT								ST3GAL1 (143512 upstream) : ZFAT (762338 downstream)																																			---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	140890476	140890476	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140890476delT	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141097037	141097037	+	Intron	DEL	A	-	-	rs111733551		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141097037delA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
TSNARE1	203062	broad.mit.edu	37	8	143337251	143337252	+	Intron	INS	-	CAT	CAT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143337251_143337252insCAT	uc003ywk.2	-						TSNARE1_uc011lju.1_Intron|TSNARE1_uc003ywj.2_Intron	NM_145003	NP_659440			t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	144474196	144474199	+	IGR	DEL	TCAT	-	-	rs36189950		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144474196_144474199delTCAT								RHPN1 (7807 upstream) : MAFA (37316 downstream)																																			---	---	---	---
RCL1	10171	broad.mit.edu	37	9	4882866	4882867	+	Intron	DEL	CA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4882866_4882867delCA	uc003ziv.1	+											Homo sapiens cDNA FLJ11677 fis, clone HEMBA1004778.						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	14555017	14555017	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14555017delG								NFIB (241072 upstream) : ZDHHC21 (464 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	23484417	23484417	+	IGR	DEL	T	-	-	rs112590327		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:23484417delT								None (None upstream) : ELAVL2 (205688 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	30399418	30399418	+	IGR	DEL	A	-	-	rs111796455		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30399418delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	30547539	30547540	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30547539_30547540insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32018896	32018896	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32018896delC								None (None upstream) : ACO1 (365705 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32339305	32339306	+	IGR	INS	-	T	T	rs145635303	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32339305_32339306insT								None (None upstream) : ACO1 (45295 downstream)																																			---	---	---	---
APTX	54840	broad.mit.edu	37	9	33009817	33009817	+	Intron	DEL	A	-	-	rs144049979		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33009817delA	uc003zrz.2	-							NM_175071	NP_778241			aprataxin isoform d						cell death|double-strand break repair|regulation of protein stability|response to hydrogen peroxide|single strand break repair	chromatin|nucleolus|nucleoplasm	chromatin binding|damaged DNA binding|DNA 5'-adenosine monophosphate hydrolase activity|double-stranded DNA binding|double-stranded RNA binding|phosphoglycolate phosphatase activity|phosphoprotein binding|polynucleotide 3'-phosphatase activity|protein N-terminus binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0302)	GBM - Glioblastoma multiforme(74;0.105)									Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
SMU1	55234	broad.mit.edu	37	9	33074431	33074432	+	Intron	INS	-	AC	AC			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33074431_33074432insAC	uc003zsf.1	-						SMU1_uc010mjo.1_Intron|SMU1_uc010mjp.1_Intron|SMU1_uc011lnu.1_Intron	NM_018225	NP_060695			smu-1 suppressor of mec-8 and unc-52 homolog							cytoplasm|nucleus				ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.11)														---	---	---	---
DNAI1	27019	broad.mit.edu	37	9	34496187	34496187	+	Intron	DEL	G	-	-	rs60676589		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34496187delG	uc003zum.2	+							NM_012144	NP_036276			dynein, axonemal, intermediate chain 1						cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)										Kartagener_syndrome				---	---	---	---
IL11RA	3590	broad.mit.edu	37	9	34654992	34654993	+	Intron	DEL	GT	-	-	rs3840738		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34654992_34654993delGT	uc003zvi.2	+						IL11RA_uc011loq.1_Intron|IL11RA_uc003zvj.2_Intron|IL11RA_uc003zvk.2_Intron|IL11RA_uc010mke.2_Intron|IL11RA_uc003zvl.2_Intron	NM_004512	NP_004503			interleukin 11 receptor, alpha isoform 1							integral to plasma membrane	cytokine receptor activity			skin(1)	1	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.174)	Oprelvekin(DB00038)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	34751208	34751208	+	IGR	DEL	A	-	-	rs148290496		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34751208delA								C9orf144B (21673 upstream) : C9orf144 (79057 downstream)																																			---	---	---	---
UNC13B	10497	broad.mit.edu	37	9	35346925	35346925	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35346925delT	uc003zwq.2	+						UNC13B_uc010mkl.1_Intron|UNC13B_uc003zwr.2_Intron	NM_006377	NP_006368			UNC13 (C. elegans)-like						excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
CLTA	1211	broad.mit.edu	37	9	36198700	36198700	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36198700delA	uc003zzc.2	+						CLTA_uc003zzd.2_Intron|CLTA_uc003zze.2_Intron|CLTA_uc011lpk.1_Intron|CLTA_uc003zzf.1_Intron	NM_007096	NP_009027			clathrin, light polypeptide A isoform b						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol	structural molecule activity			central_nervous_system(1)	1			STAD - Stomach adenocarcinoma(86;0.228)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	36413692	36413693	+	IGR	INS	-	TTTGTTTG	TTTGTTTG	rs147210566	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36413692_36413693insTTTGTTTG								RNF38 (12497 upstream) : MELK (159212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	36543284	36543284	+	IGR	DEL	A	-	-	rs113402318		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36543284delA								RNF38 (142089 upstream) : MELK (29621 downstream)																																			---	---	---	---
FBXO10	26267	broad.mit.edu	37	9	37523393	37523394	+	Intron	INS	-	A	A	rs144481245	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37523393_37523394insA	uc004aab.2	-						FBXO10_uc004aac.2_Intron|FBXO10_uc004aad.2_Intron	NM_012166	NP_036298			F-box protein 10							ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(5)	5				GBM - Glioblastoma multiforme(29;0.0107)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	66683209	66683210	+	IGR	INS	-	T	T	rs140091316		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66683209_66683210insT								LOC442421 (180182 upstream) : AQP7P1 (571057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68406889	68406889	+	IGR	DEL	G	-	-	rs113316891		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68406889delG								FAM27B (612700 upstream) : MIR1299 (595350 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68424948	68424948	+	IGR	DEL	A	-	-	rs111946108		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68424948delA								FAM27B (630759 upstream) : MIR1299 (577291 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68480277	68480277	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68480277delA								FAM27B (686088 upstream) : MIR1299 (521962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68693088	68693089	+	IGR	INS	-	C	C	rs146537073		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68693088_68693089insC								FAM27B (898899 upstream) : MIR1299 (309150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69735782	69735783	+	IGR	DEL	AT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69735782_69735783delAT								LOC100133920 (70833 upstream) : FOXD4L5 (439926 downstream)																																			---	---	---	---
PIP5K1B	8395	broad.mit.edu	37	9	71534252	71534252	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71534252delA	uc004agu.2	+						PIP5K1B_uc011lrq.1_Intron|PIP5K1B_uc004agv.2_Intron	NM_003558	NP_003549			phosphatidylinositol-4-phosphate 5-kinase, type							endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	72299880	72299881	+	IGR	INS	-	CA	CA			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72299880_72299881insCA								APBA1 (12605 upstream) : PTAR1 (24558 downstream)																																			---	---	---	---
PCSK5	5125	broad.mit.edu	37	9	78725151	78725152	+	Intron	INS	-	G	G	rs149333993	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78725151_78725152insG	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191			proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	80777273	80777276	+	IGR	DEL	ACAC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80777273_80777276delACAC								GNAQ (131081 upstream) : CEP78 (73715 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83063976	83063977	+	IGR	INS	-	A	A	rs59618060		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83063976_83063977insA								TLE4 (722319 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83282388	83282389	+	IGR	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83282388_83282389delGT								TLE4 (940731 upstream) : TLE1 (916211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83646866	83646866	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83646866delG								None (None upstream) : TLE1 (551734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	84421642	84421642	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84421642delG								TLE1 (118046 upstream) : FLJ43950 (106710 downstream)																																			---	---	---	---
GOLM1	51280	broad.mit.edu	37	9	88683409	88683409	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88683409delA	uc004aol.2	-						GOLM1_uc010mqd.1_Intron|GOLM1_uc004aom.2_Intron	NM_016548	NP_057632			golgi membrane protein 1							Golgi apparatus|integral to plasma membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	89704349	89704349	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89704349delT								LOC440173 (47308 upstream) : C9orf170 (59210 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	96681723	96681723	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96681723delT								PHF2 (239856 upstream) : BARX1 (32188 downstream)																																			---	---	---	---
COL15A1	1306	broad.mit.edu	37	9	101828471	101828472	+	Intron	INS	-	GA	GA	rs150428354	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101828471_101828472insGA	uc004azb.1	+							NM_001855	NP_001846			alpha 1 type XV collagen precursor						angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)																---	---	---	---
LPPR1	54886	broad.mit.edu	37	9	103857551	103857552	+	Intron	INS	-	C	C	rs145351093	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103857551_103857552insC	uc004bbb.2	+						LPPR1_uc011lvi.1_Intron	NM_207299	NP_997182			plasticity related gene 3							integral to membrane	catalytic activity				0																		---	---	---	---
BAAT	570	broad.mit.edu	37	9	104142444	104142445	+	Intron	INS	-	T	T	rs146241180	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104142444_104142445insT	uc010mtd.2	-						BAAT_uc004bbd.3_Intron	NM_001127610	NP_001121082			bile acid Coenzyme A: amino acid						acyl-CoA metabolic process|bile acid and bile salt transport|bile acid biosynthetic process|digestion|fatty acid metabolic process|glycine metabolic process	cytosol|peroxisomal matrix	carboxylesterase activity|glycine N-choloyltransferase activity|N-acyltransferase activity|palmitoyl-CoA hydrolase activity			ovary(1)|lung(1)|skin(1)	3		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	110317727	110317727	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110317727delT								KLF4 (65680 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	111484453	111484453	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111484453delA								None (None upstream) : ACTL7B (132418 downstream)																																			---	---	---	---
LPAR1	1902	broad.mit.edu	37	9	113702364	113702364	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113702364delA	uc004bfa.2	-						LPAR1_uc011lwm.1_Intron|LPAR1_uc004bfb.2_Intron|LPAR1_uc004bfc.2_Intron|LPAR1_uc011lwn.1_Intron|LPAR1_uc011lwo.1_Intron|LPAR1_uc010mub.2_Intron	NM_057159	NP_476500			lysophosphatidic acid receptor 1						positive regulation of I-kappaB kinase/NF-kappaB cascade	cell surface|integral to plasma membrane				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	113883343	113883343	+	IGR	DEL	T	-	-	rs79181309		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113883343delT								LPAR1 (81817 upstream) : OR2K2 (206421 downstream)																																			---	---	---	---
DNAJC25-GNG10	552891	broad.mit.edu	37	9	114421510	114421511	+	Intron	INS	-	ACAC	ACAC	rs34430395		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114421510_114421511insACAC	uc004bfn.2	+						GNG10_uc011lws.1_5'Flank|GNG10_uc004bfp.2_5'Flank	NM_004125	NP_004116			DNAJC25-GNG10 protein						protein folding	integral to membrane	heat shock protein binding|unfolded protein binding				0																		---	---	---	---
ZNF618	114991	broad.mit.edu	37	9	116687724	116687724	+	Intron	DEL	T	-	-	rs78143548		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116687724delT	uc004bid.2	+						ZNF618_uc004bib.1_Intron|ZNF618_uc004bic.2_Intron|ZNF618_uc011lxi.1_Intron|ZNF618_uc011lxj.1_Intron	NM_133374	NP_588615			zinc finger protein 618						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119751544	119751544	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119751544delC	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119942907	119942907	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119942907delT	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron|SNORA70C_uc011lxu.1_5'Flank	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	125161632	125161632	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125161632delT								PTGS1 (3651 upstream) : OR1J2 (69208 downstream)																																			---	---	---	---
MAPKAP1	79109	broad.mit.edu	37	9	128360350	128360351	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128360350_128360351insA	uc004bpv.2	-						MAPKAP1_uc011lzt.1_5'Flank|MAPKAP1_uc010mwz.2_5'Flank|MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron|MAPKAP1_uc004bqa.2_Intron|MAPKAP1_uc010mxc.1_Intron	NM_001006617	NP_001006618			mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	128967563	128967564	+	IGR	INS	-	TG	TG	rs143016700	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128967563_128967564insTG								PBX3 (237910 upstream) : FAM125B (121564 downstream)																																			---	---	---	---
RALGPS1	9649	broad.mit.edu	37	9	129790502	129790502	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129790502delT	uc004bqo.1	+						RALGPS1_uc011mab.1_Intron|RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron	NM_014636	NP_055451			Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1																		---	---	---	---
WDR34	89891	broad.mit.edu	37	9	131404255	131404256	+	Intron	INS	-	AC	AC	rs142269423	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131404255_131404256insAC	uc004bvq.1	-						WDR34_uc004bvs.1_Intron|WDR34_uc004bvr.1_Intron|WDR34_uc011mbi.1_5'Flank	NM_052844	NP_443076			WD repeat domain 34							cytoplasm				central_nervous_system(2)|skin(1)	3																		---	---	---	---
NUP188	23511	broad.mit.edu	37	9	131744357	131744357	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131744357delA	uc004bws.1	+						NUP188_uc004bwu.2_5'Flank	NM_015354	NP_056169			nucleoporin 188kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|kidney(1)|breast(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	132039701	132039701	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132039701delT								IER5L (99161 upstream) : C9orf106 (43594 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	132409365	132409366	+	IGR	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132409365_132409366delGT								ASB6 (4921 upstream) : PRRX2 (18554 downstream)																																			---	---	---	---
ABL1	25	broad.mit.edu	37	9	133693256	133693256	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133693256delT	uc004bzv.2	+							NM_007313	NP_009297			c-abl oncogene 1, receptor tyrosine kinase						actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								---	---	---	---
RAPGEF1	2889	broad.mit.edu	37	9	134525400	134525400	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134525400delC	uc004cbc.2	-						RAPGEF1_uc004cbb.2_Intron|RAPGEF1_uc010mzn.2_Intron|RAPGEF1_uc004cbd.2_Intron	NM_005312	NP_005303			guanine nucleotide-releasing factor 2 isoform a						activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)														---	---	---	---
RAPGEF1	2889	broad.mit.edu	37	9	134529041	134529042	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134529041_134529042delTG	uc004cbc.2	-						RAPGEF1_uc004cbb.2_Intron|RAPGEF1_uc010mzn.2_Intron|RAPGEF1_uc004cbd.2_Intron	NM_005312	NP_005303			guanine nucleotide-releasing factor 2 isoform a						activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	136949069	136949070	+	IGR	INS	-	A	A	rs2427948	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136949069_136949070insA								BRD3 (15414 upstream) : WDR5 (52140 downstream)																																			---	---	---	---
OLFM1	10439	broad.mit.edu	37	9	137988137	137988137	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137988137delT	uc010nar.2	+						OLFM1_uc004cfl.3_Intron|OLFM1_uc004cfk.3_Intron|OLFM1_uc004cfm.3_Intron	NM_014279	NP_055094			olfactomedin related ER localized protein						nervous system development	endoplasmic reticulum lumen	protein binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)														---	---	---	---
LCN9	392399	broad.mit.edu	37	9	138553700	138553701	+	5'Flank	DEL	AA	-	-	rs33961667		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138553700_138553701delAA	uc004cgk.1	+							NM_001001676	NP_001001676			lipocalin 9							extracellular region	pheromone binding|transporter activity			large_intestine(2)	2		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;3.43e-07)|Epithelial(140;1.97e-06)|all cancers(34;6.1e-05)														---	---	---	---
NOXA1	10811	broad.mit.edu	37	9	140320927	140320928	+	Intron	INS	-	GGGTC	GGGTC	rs145312088	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140320927_140320928insGGGTC	uc004cmv.2	+						C9orf167_uc011mew.1_Intron|NOXA1_uc004cmu.2_Intron|NOXA1_uc010nch.2_Intron	NM_006647	NP_006638			NADPH oxidase activator 1						regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|superoxide metabolic process	cytoplasm|NADPH oxidase complex	Rac GTPase binding|superoxide-generating NADPH oxidase activator activity				0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000238)|Epithelial(140;0.000982)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	4135576	4135577	+	IGR	INS	-	A	A	rs11409612		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4135576_4135577insA								KLF6 (308103 upstream) : LOC100216001 (485867 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	4602714	4602715	+	IGR	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs140265387	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4602714_4602715insGTGTGTGTGT								KLF6 (775241 upstream) : LOC100216001 (18729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	4734361	4734371	+	IGR	DEL	GGTAGGTGAAG	-	-	rs58423253		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4734361_4734371delGGTAGGTGAAG								LOC100216001 (14099 upstream) : AKR1E2 (134031 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	4778449	4778450	+	IGR	DEL	GT	-	-	rs144133735		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4778449_4778450delGT								LOC100216001 (58187 upstream) : AKR1E2 (89952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	4830783	4830783	+	IGR	DEL	A	-	-	rs147922035		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4830783delA								LOC100216001 (110521 upstream) : AKR1E2 (37619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	5149946	5149947	+	IGR	DEL	GT	-	-	rs72216047		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5149946_5149947delGT								AKR1C3 (70 upstream) : AKR1CL1 (46708 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6445131	6445131	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6445131delT								PFKFB3 (167626 upstream) : PRKCQ (23974 downstream)																																			---	---	---	---
ACBD7	414149	broad.mit.edu	37	10	15133717	15133718	+	5'Flank	INS	-	TTGT	TTGT	rs147505132	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15133717_15133718insTTGT	uc001inv.2	-						ACBD7_uc010qby.1_5'Flank	NM_001039844	NP_001034933			acyl-Coenzyme A binding domain containing 7								fatty-acyl-CoA binding				0																		---	---	---	---
RSU1	6251	broad.mit.edu	37	10	16725160	16725161	+	Intron	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16725160_16725161delGT	uc001iok.2	-						RSU1_uc001iol.2_Intron|RSU1_uc001iom.2_Intron	NM_152724	NP_689937			ras suppressor protein 1 isoform 2						cell junction assembly|signal transduction	cytosol	protein binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(1;7.54e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	23415959	23415960	+	IGR	DEL	CA	-	-	rs111992559		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23415959_23415960delCA								MSRB2 (5018 upstream) : PTF1A (65500 downstream)																																			---	---	---	---
PARD3	56288	broad.mit.edu	37	10	34737063	34737064	+	Intron	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34737063_34737064delGT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixp.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixt.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565			partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---
PARD3	56288	broad.mit.edu	37	10	35016806	35016807	+	Intron	INS	-	CACA	CACA	rs151323206	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35016806_35016807insCACA	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565			partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	36613798	36613799	+	IGR	DEL	TC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36613798_36613799delTC								FZD8 (683436 upstream) : ANKRD30A (800986 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39146893	39146897	+	IGR	DEL	AGGGC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39146893_39146897delAGGGC								LOC399744 (405813 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42538402	42538403	+	IGR	INS	-	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42538402_42538403insC								None (None upstream) : LOC441666 (288912 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42602922	42602923	+	IGR	DEL	AA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42602922_42602923delAA								None (None upstream) : LOC441666 (224392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42653182	42653182	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42653182delT								None (None upstream) : LOC441666 (174133 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42876030	42876030	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42876030delA								LOC441666 (12537 upstream) : LOC84856 (94909 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	43210148	43210148	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43210148delG								ZNF33B (76156 upstream) : BMS1 (67806 downstream)																																			---	---	---	---
MARCH8	220972	broad.mit.edu	37	10	45984314	45984314	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45984314delG	uc001jci.1	-						MARCH8_uc001jch.2_Intron|MARCH8_uc001jcj.1_Intron|MARCH8_uc001jck.1_Intron	NM_001002266	NP_001002266			cellular modulator of immune recognition isoform							cytoplasmic vesicle membrane|early endosome membrane|integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47106845	47106846	+	Intron	INS	-	GTC	GTC	rs142357475		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47106845_47106846insGTC	uc001jed.3	-						uc001jef.2_Intron					Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47109455	47109456	+	Intron	INS	-	C	C	rs71868789		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47109455_47109456insC	uc001jed.3	-						uc001jef.2_Intron					Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
ZNF488	118738	broad.mit.edu	37	10	48369849	48369849	+	Intron	DEL	C	-	-	rs34492159		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48369849delC	uc001jex.2	+						ZNF488_uc001jey.2_Intron	NM_153034	NP_694579			zinc finger protein 488						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	52878262	52878262	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52878262delT	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron|PRKG1_uc010qhp.1_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	56450070	56450071	+	Intron	INS	-	T	T	rs150286573		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56450070_56450071insT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045			protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
SLC16A9	220963	broad.mit.edu	37	10	61459660	61459663	+	Intron	DEL	ACAC	-	-	rs148641065		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61459660_61459663delACAC	uc010qig.1	-							NM_194298	NP_919274			solute carrier family 16 (monocarboxylic acid						urate metabolic process	integral to membrane|plasma membrane	symporter activity			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	65454701	65454701	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65454701delT								REEP3 (72730 upstream) : None (None downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68934801	68934801	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68934801delA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	71423624	71423624	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71423624delA								C10orf35 (30277 upstream) : COL13A1 (138020 downstream)																																			---	---	---	---
PSAP	5660	broad.mit.edu	37	10	73583573	73583574	+	Intron	INS	-	A	A	rs68178384		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73583573_73583574insA	uc001jsm.2	-						PSAP_uc001jsl.2_5'Flank	NM_002778	NP_002769			prosaposin isoform a preproprotein						glycosphingolipid metabolic process|lipid transport|platelet activation|platelet degranulation	extracellular space|Golgi apparatus|integral to membrane|lysosomal lumen	enzyme activator activity|lipid binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	77210229	77210230	+	IGR	INS	-	A	A	rs141857857	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77210229_77210230insA								C10orf41 (41490 upstream) : MIR606 (101986 downstream)																																			---	---	---	---
C10orf11	83938	broad.mit.edu	37	10	78217269	78217270	+	Intron	INS	-	T	T	rs138587159	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78217269_78217270insT	uc001jxi.2	+							NM_032024	NP_114413			chromosome 10 open reading frame 11												0	Prostate(51;0.0095)|all_epithelial(25;0.0221)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	81784444	81784445	+	IGR	INS	-	AA	AA	rs150128041	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81784444_81784445insAA								MBL1P (73661 upstream) : LOC219347 (21546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	82583946	82583946	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82583946delG								SH2D4B (177630 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	83373009	83373010	+	IGR	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83373009_83373010delTT								SH2D4B (966693 upstream) : NRG3 (262060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	86380063	86380065	+	IGR	DEL	CTC	-	-	rs112703941		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86380063_86380065delCTC								FAM190B (101787 upstream) : GRID1 (979247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	86949280	86949280	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86949280delT								FAM190B (671004 upstream) : GRID1 (410032 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	87327687	87327688	+	IGR	INS	-	T	T	rs146780793	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87327687_87327688insT								None (None upstream) : GRID1 (31624 downstream)																																			---	---	---	---
GRID1	2894	broad.mit.edu	37	10	88092530	88092533	+	Intron	DEL	CCTC	-	-	rs67797838		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88092530_88092533delCCTC	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021			glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)										Multiple Myeloma(13;0.14)			---	---	---	---
RNLS	55328	broad.mit.edu	37	10	90238377	90238378	+	Intron	INS	-	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90238377_90238378insC	uc001kfe.2	-						RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Intron|RNLS_uc009xtj.2_Intron	NM_001031709	NP_001026879			renalase isoform 1							extracellular region	oxidoreductase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	92269507	92269507	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92269507delT								KIF20B (734807 upstream) : HTR7 (231071 downstream)																																			---	---	---	---
RPP30	10556	broad.mit.edu	37	10	92638254	92638255	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92638254_92638255insT	uc009xtx.2	+						RPP30_uc001khd.2_Intron|RPP30_uc010qnj.1_Intron	NM_006413	NP_006404			ribonuclease P/MRP 30kDa subunit isoform b						tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity				0																		---	---	---	---
LOC100188947	100188947	broad.mit.edu	37	10	93360666	93360666	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93360666delC	uc010qnl.1	-							NR_024467				Homo sapiens, clone IMAGE:6063621, mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	101905060	101905060	+	IGR	DEL	T	-	-	rs141815914		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101905060delT								CPN1 (63418 upstream) : ERLIN1 (4788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	106379590	106379590	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106379590delG								CCDC147 (164751 upstream) : SORCS3 (21269 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	107453638	107453639	+	IGR	INS	-	TT	TT	rs139268499		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107453638_107453639insTT								SORCS3 (428645 upstream) : SORCS1 (879783 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	107602553	107602553	+	IGR	DEL	T	-	-	rs5787615		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107602553delT								SORCS3 (577560 upstream) : SORCS1 (730869 downstream)																																			---	---	---	---
ABLIM1	3983	broad.mit.edu	37	10	116450447	116450448	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116450447_116450448insT	uc001lbz.1	-											Homo sapiens cDNA FLJ25105 fis, clone CBR01442.						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117557111	117557112	+	Intron	INS	-	A	A	rs140813114	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117557111_117557112insA	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	119552884	119552884	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119552884delG								EMX2 (243828 upstream) : RAB11FIP2 (211545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	120395599	120395599	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120395599delC								PRLHR (40439 upstream) : C10orf46 (38035 downstream)																																			---	---	---	---
SEC23IP	11196	broad.mit.edu	37	10	121650905	121650905	+	5'Flank	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121650905delT	uc001leu.1	+						SEC23IP_uc010qtc.1_5'Flank	NM_007190	NP_009121			Sec23-interacting protein p125						Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	124874328	124874329	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124874328_124874329insA								ACADSB (56523 upstream) : HMX3 (21238 downstream)																																			---	---	---	---
FANK1	92565	broad.mit.edu	37	10	127585797	127585798	+	Intron	INS	-	A	A	rs141524801		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127585797_127585798insA	uc001ljh.3	+						DHX32_uc001ljg.1_5'Flank|FANK1_uc010quk.1_Intron|FANK1_uc009yan.2_Intron	NM_145235	NP_660278			fibronectin type III and ankyrin repeat domains							cytoplasm|nucleus				ovary(1)	1		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)																---	---	---	---
ADAM12	8038	broad.mit.edu	37	10	127940392	127940392	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127940392delG	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465			ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)														---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	128821807	128821807	+	Intron	DEL	T	-	-	rs72037531		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128821807delT	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	129199992	129199993	+	Intron	INS	-	A	A	rs149112468	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129199992_129199993insA	uc001ljt.2	+						DOCK1_uc010qun.1_Intron|DOCK1_uc009yaq.2_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	130964267	130964268	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs148722393	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130964267_130964268insGGAAGGAA								None (None upstream) : MGMT (301186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132442246	132442246	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132442246delC								GLRX3 (459462 upstream) : TCERG1L (448410 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133438839	133438841	+	IGR	DEL	TTT	-	-	rs139833134		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133438839_133438841delTTT								TCERG1L (328855 upstream) : PPP2R2D (309119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133833691	133833694	+	IGR	DEL	CCTC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133833691_133833694delCCTC								BNIP3 (38256 upstream) : JAKMIP3 (84619 downstream)																																			---	---	---	---
INPP5A	3632	broad.mit.edu	37	10	134477267	134477268	+	Intron	DEL	GA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134477267_134477268delGA	uc001llp.2	+						INPP5A_uc001llo.1_Intron|INPP5A_uc001llq.2_Intron	NM_005539	NP_005530			inositol polyphosphate-5-phosphatase A						cell communication	membrane	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|PH domain binding			skin(1)	1		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	357676	357677	+	IGR	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:357676_357677delAC								IFITM3 (36762 upstream) : B4GALNT4 (12118 downstream)																																			---	---	---	---
ANO9	338440	broad.mit.edu	37	11	427708	427709	+	Intron	DEL	TC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:427708_427709delTC	uc001lpi.2	-						ANO9_uc001lph.2_Intron|ANO9_uc010qvv.1_Intron	NM_001012302	NP_001012302			tumor protein p53 inducible protein 5							chloride channel complex	chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	1935813	1935814	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1935813_1935814delTG								LSP1 (22321 upstream) : TNNT3 (4985 downstream)																																			---	---	---	---
KCNQ1	3784	broad.mit.edu	37	11	2835532	2835535	+	Intron	DEL	GATA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2835532_2835535delGATA	uc001lwn.2	+						KCNQ1_uc001lwo.2_Intron	NM_000218	NP_000209			potassium voltage-gated channel, KQT-like						blood circulation|membrane depolarization|muscle contraction|sensory perception of sound		delayed rectifier potassium channel activity|protein binding			ovary(1)	1		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)													---	---	---	---
SLC22A18	5002	broad.mit.edu	37	11	2940338	2940360	+	Intron	DEL	GGCACTTTCCACACCAGGGATAC	-	-	rs143592360		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2940338_2940360delGGCACTTTCCACACCAGGGATAC	uc001lwx.2	+						SLC22A18_uc001lwy.2_Intron|SLC22A18_uc001lwz.2_Intron	NM_183233	NP_899056			tumor suppressing subtransferable candidate 5						excretion|organic cation transport	apical plasma membrane|cytoplasmic part|integral to membrane|nuclear envelope	drug:hydrogen antiporter activity|symporter activity|ubiquitin protein ligase binding			central_nervous_system(2)|ovary(1)	3		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	5197783	5197788	+	IGR	DEL	TGTGTG	-	-	rs138681389		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5197783_5197788delTGTGTG								OR52A1 (24184 upstream) : OR51V1 (23178 downstream)																																			---	---	---	---
ST5	6764	broad.mit.edu	37	11	8759462	8759462	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8759462delT	uc001mgt.2	-						ST5_uc009yfr.2_Intron|ST5_uc001mgu.2_Intron|ST5_uc001mgv.2_Intron|ST5_uc010rbq.1_Intron|ST5_uc001mgw.1_Intron	NM_213618	NP_998783			suppression of tumorigenicity 5 isoform 1						positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	11083030	11083031	+	IGR	INS	-	TCTT	TCTT	rs142456839	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11083030_11083031insTCTT								ZBED5 (203410 upstream) : GALNTL4 (209390 downstream)																																			---	---	---	---
TEAD1	7003	broad.mit.edu	37	11	12886164	12886165	+	Intron	INS	-	TTTTG	TTTTG	rs117880397	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12886164_12886165insTTTTG	uc001mkj.3	+						TEAD1_uc009ygk.2_Intron	NM_021961	NP_068780			TEA domain family member 1						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	13023951	13023951	+	IGR	DEL	T	-	-	rs10710420		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13023951delT								TEAD1 (57653 upstream) : RASSF10 (6745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15791049	15791049	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15791049delG								INSC (522297 upstream) : SOX6 (196947 downstream)																																			---	---	---	---
PLEKHA7	144100	broad.mit.edu	37	11	16864378	16864378	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16864378delT	uc001mmo.2	-						PLEKHA7_uc010rcu.1_Intron	NM_175058	NP_778228			pleckstrin homology domain containing, family A						epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	19320220	19320221	+	IGR	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19320220_19320221delGT								E2F8 (57053 upstream) : NAV2 (52050 downstream)																																			---	---	---	---
NELL1	4745	broad.mit.edu	37	11	20880347	20880347	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20880347delT	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148			nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	24099685	24099686	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24099685_24099686insA								None (None upstream) : LUZP2 (418870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	30932783	30932783	+	Intron	DEL	T	-	-	rs72110565		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30932783delT	uc001mss.1	-						uc009yjk.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																														---	---	---	---
CAT	847	broad.mit.edu	37	11	34477806	34477807	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34477806_34477807insA	uc001mvm.2	+						CAT_uc009ykc.1_Intron	NM_001752	NP_001743			catalase						hydrogen peroxide catabolic process|negative regulation of apoptosis|positive regulation of cell division|protein tetramerization|purine base metabolic process|purine nucleotide catabolic process|UV protection	peroxisomal matrix|peroxisomal membrane	catalase activity|heme binding|NADP binding|protein homodimerization activity			ovary(2)|pancreas(1)	3		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	38912240	38912240	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38912240delA								None (None upstream) : None (None downstream)																																			---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40977274	40977274	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40977274delA	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980			netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	42642804	42642804	+	IGR	DEL	T	-	-	rs5791521		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42642804delT								None (None upstream) : API5 (690701 downstream)																																			---	---	---	---
TTC17	55761	broad.mit.edu	37	11	43416162	43416162	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43416162delA	uc001mxi.2	+						TTC17_uc001mxh.2_Intron|TTC17_uc010rfj.1_Intron|TTC17_uc001mxj.2_5'Flank	NM_018259	NP_060729			tetratricopeptide repeat domain 17								binding			ovary(5)	5																		---	---	---	---
HSD17B12	51144	broad.mit.edu	37	11	43717517	43717517	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43717517delT	uc001mxq.3	+						HSD17B12_uc001mxp.2_Intron	NM_016142	NP_057226			hydroxysteroid (17-beta) dehydrogenase 12						long-chain fatty-acyl-CoA biosynthetic process|steroid biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	estradiol 17-beta-dehydrogenase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	44801752	44801753	+	IGR	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44801752_44801753delAC								CD82 (160439 upstream) : TSPAN18 (80126 downstream)																																			---	---	---	---
MAPK8IP1	9479	broad.mit.edu	37	11	45914046	45914047	+	Intron	INS	-	C	C	rs149308365	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45914046_45914047insC	uc001nbr.2	+							NM_005456	NP_005447			mitogen-activated protein kinase 8 interacting						vesicle-mediated transport	nucleus|perinuclear region of cytoplasm	kinesin binding|MAP-kinase scaffold activity|protein kinase inhibitor activity			ovary(2)|breast(1)|skin(1)	4				GBM - Glioblastoma multiforme(35;0.231)														---	---	---	---
HARBI1	283254	broad.mit.edu	37	11	46633261	46633261	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46633261delA	uc001ncy.2	-							NM_173811	NP_776172			harbinger transposase derived 1							cytoplasm|nucleus	metal ion binding|nuclease activity				0																		---	---	---	---
DDB2	1643	broad.mit.edu	37	11	47240294	47240294	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47240294delA	uc001neb.2	+						DDB2_uc001nec.2_Intron|DDB2_uc009yli.1_Intron|DDB2_uc001ned.2_Intron|DDB2_uc001nee.2_Intron|DDB2_uc001nef.2_Intron|DDB2_uc001neg.2_Intron|DDB2_uc001neh.2_Intron	NM_000107	NP_000098			damage-specific DNA binding protein 2						nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3								Mis|N			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				---	---	---	---
SLC39A13	91252	broad.mit.edu	37	11	47379060	47379061	+	Intron	DEL	CA	-	-	rs36116648		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47379060_47379061delCA	uc001nfd.2	+						SPI1_uc001nfb.1_Intron|SPI1_uc001nfc.1_Intron					RecName: Full=Zinc transporter ZIP13; AltName: Full=Zrt- and Irt-like protein 13;          Short=ZIP-13; AltName: Full=Solute carrier family 39 member 13; AltName: Full=LIV-1 subfamily of ZIP zinc transporter 9; AltName: Full=LZT-Hs9;						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity				0				Lung(87;0.0936)														---	---	---	---
KBTBD4	55709	broad.mit.edu	37	11	47597411	47597412	+	Intron	INS	-	T	T	rs35653820		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47597411_47597412insT	uc001nfx.2	-						NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_Intron|KBTBD4_uc001nfz.2_Intron|KBTBD4_uc001nfy.2_Intron	NM_016506	NP_057590			kelch repeat and BTB (POZ) domain containing 4											ovary(1)|central_nervous_system(1)	2																		---	---	---	---
AGBL2	79841	broad.mit.edu	37	11	47682108	47682109	+	Intron	INS	-	T	T	rs112707895		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47682108_47682109insT	uc001ngg.2	-						AGBL2_uc001ngf.2_Intron	NM_024783	NP_079059			carboxypeptidase 2, cytosolic						proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	48763163	48763163	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48763163delA								OR4A47 (251891 upstream) : FOLH1 (405025 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50697699	50697699	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50697699delC								LOC646813 (317896 upstream) : OR4A5 (713749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50748777	50748777	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50748777delA								LOC646813 (368974 upstream) : OR4A5 (662671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	54808968	54808969	+	IGR	DEL	CT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:54808968_54808969delCT								None (None upstream) : TRIM48 (220689 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	56202608	56202609	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56202608_56202609insT								OR5R1 (16900 upstream) : OR5M9 (27338 downstream)																																			---	---	---	---
OR9Q1	219956	broad.mit.edu	37	11	57890434	57890435	+	Intron	INS	-	T	T	rs143978968	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57890434_57890435insT	uc001nmj.2	+							NM_001005212	NP_001005212			olfactory receptor, family 9, subfamily Q,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.222)																---	---	---	---
CD5	921	broad.mit.edu	37	11	60874160	60874161	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60874160_60874161delTG	uc009ynk.2	+							NM_014207	NP_055022			CD5 molecule precursor						cell proliferation|cell recognition	integral to plasma membrane	scavenger receptor activity			ovary(1)	1		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)														---	---	---	---
SDHAF2	54949	broad.mit.edu	37	11	61198328	61198328	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61198328delT	uc001nrt.2	+						CPSF7_uc001nro.2_5'Flank|CPSF7_uc001nrp.2_5'Flank|CPSF7_uc001nrq.2_5'Flank|CPSF7_uc001nrr.2_5'Flank|CPSF7_uc001nrs.1_5'Flank|CPSF7_uc009ynp.2_5'Flank	NM_017841	NP_060311			succinate dehydrogenase complex assembly factor						mitochondrial electron transport, succinate to ubiquinone|protein-FAD linkage	mitochondrion	protein binding			ovary(2)	2														Familial_Paragangliomas				---	---	---	---
DAGLA	747	broad.mit.edu	37	11	61471150	61471151	+	Intron	INS	-	ATGGATGG	ATGGATGG	rs150674059	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61471150_61471151insATGGATGG	uc001nsa.2	+							NM_006133	NP_006124			neural stem cell-derived dendrite regulator						cell death|lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3				READ - Rectum adenocarcinoma(4;0.219)														---	---	---	---
ASRGL1	80150	broad.mit.edu	37	11	62120816	62120816	+	Intron	DEL	T	-	-	rs149506563		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62120816delT	uc001nte.3	+						ASRGL1_uc001ntf.3_Intron|ASRGL1_uc001ntg.3_Intron	NM_025080	NP_079356			asparaginase-like 1						asparagine catabolic process via L-aspartate|protein maturation	cytoplasm|microtubule cytoskeleton|nucleus	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity				0					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	62719750	62719750	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62719750delT								CHRM1 (30738 upstream) : SLC22A6 (24320 downstream)																																			---	---	---	---
POLA2	23649	broad.mit.edu	37	11	65064420	65064420	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65064420delA	uc001odj.2	+						POLA2_uc001odk.2_Intron	NM_002689	NP_002680			DNA-directed DNA polymerase alpha 2						DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	nucleoplasm	DNA binding				0					Dacarbazine(DB00851)													---	---	---	---
SYT12	91683	broad.mit.edu	37	11	66787368	66787368	+	5'Flank	DEL	A	-	-	rs72505821		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66787368delA	uc009yrl.2	+							NM_177963	NP_808878			synaptotagmin XII							cell junction|integral to membrane|synaptic vesicle membrane				ovary(1)	1																		---	---	---	---
LOC100130987	100130987	broad.mit.edu	37	11	67146714	67146715	+	Intron	INS	-	GTGTGTGT	GTGTGTGT	rs139023332	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67146714_67146715insGTGTGTGT	uc010rpo.1	+							NR_024469				Homo sapiens cDNA FLJ38836 fis, clone MESAN2002519, weakly similar to Mus musculus cell cycle checkpoint control protein Mrad9 gene.												0																		---	---	---	---
SAPS3	55291	broad.mit.edu	37	11	68305521	68305522	+	Intron	INS	-	T	T	rs147520180	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68305521_68305522insT	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633			SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)															---	---	---	---
CPT1A	1374	broad.mit.edu	37	11	68547263	68547264	+	Intron	INS	-	A	A	rs67964012		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68547263_68547264insA	uc001oog.3	-						CPT1A_uc001oof.3_Intron|CPT1A_uc009ysj.2_Intron	NM_001876	NP_001867			carnitine palmitoyltransferase 1A liver isoform						carnitine shuttle|fatty acid beta-oxidation	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			skin(2)	2	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		L-Carnitine(DB00583)|Perhexiline(DB01074)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	68647791	68647791	+	IGR	DEL	A	-	-	rs112779742		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68647791delA								CPT1A (38392 upstream) : MRPL21 (10956 downstream)																																			---	---	---	---
TPCN2	219931	broad.mit.edu	37	11	68877872	68877873	+	Intron	INS	-	CCATCCAT	CCATCCAT	rs148763447		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68877872_68877873insCCATCCAT	uc001oot.2	+							NM_139075				two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	68966681	68966684	+	IGR	DEL	CCAT	-	-	rs112659950		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68966681_68966684delCCAT								TPCN2 (36774 upstream) : MYEOV (94938 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	69042854	69042857	+	IGR	DEL	CATC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69042854_69042857delCATC								TPCN2 (112947 upstream) : MYEOV (18765 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	69441119	69441120	+	IGR	INS	-	T	T	rs139272869	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69441119_69441120insT								MYEOV (284670 upstream) : CCND1 (14753 downstream)																																			---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70386479	70386480	+	Intron	INS	-	C	C	rs140779547	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70386479_70386480insC	uc001oqc.2	-						SHANK2_uc010rqn.1_Intron|SHANK2_uc001opz.2_Intron|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Intron	NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70801568	70801573	+	Intron	DEL	CACGGG	-	-	rs151074427		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70801568_70801573delCACGGG	uc001oqc.2	-							NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	70970433	70970433	+	IGR	DEL	T	-	-	rs113566879		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70970433delT								SHANK2 (34625 upstream) : DHCR7 (175026 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	71055047	71055048	+	IGR	INS	-	AC	AC	rs146013870	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71055047_71055048insAC								SHANK2 (119239 upstream) : DHCR7 (90411 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	71406252	71406253	+	IGR	INS	-	A	A	rs140953448	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71406252_71406253insA								KRTAP5-11 (112331 upstream) : FAM86C (92304 downstream)																																			---	---	---	---
FCHSD2	9873	broad.mit.edu	37	11	72773890	72773890	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72773890delC	uc009ytl.2	-						FCHSD2_uc010rrg.1_Intron|FCHSD2_uc001oth.3_Intron|FCHSD2_uc001oti.2_Intron	NM_014824	NP_055639			FCH and double SH3 domains 2								protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)															---	---	---	---
UCP3	7352	broad.mit.edu	37	11	73712721	73712721	+	Intron	DEL	T	-	-	rs58267612		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73712721delT	uc001our.2	-							NM_003356	NP_003347			uncoupling protein 3 isoform UCP3L						mitochondrial transport|respiratory electron transport chain|respiratory gaseous exchange	integral to membrane|mitochondrial inner membrane	binding			pancreas(1)	1	Breast(11;2.08e-05)																	---	---	---	---
UVRAG	7405	broad.mit.edu	37	11	75693498	75693499	+	Intron	INS	-	T	T	rs139152087	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75693498_75693499insT	uc001oxc.2	+						UVRAG_uc010rrw.1_Intron|UVRAG_uc001oxd.2_Intron|UVRAG_uc010rrx.1_5'Flank|UVRAG_uc009yuh.1_Intron	NM_003369	NP_003360			UV radiation resistance associated						DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6																		---	---	---	---
B3GNT6	192134	broad.mit.edu	37	11	76748863	76748863	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76748863delG	uc001oxw.2	+							NM_138706	NP_619651			UDP-GlcNAc:betaGal						O-glycan processing, core 3	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity|galactosyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	78304467	78304467	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78304467delT								NARS2 (18558 upstream) : ODZ4 (59862 downstream)																																			---	---	---	---
DLG2	1740	broad.mit.edu	37	11	84836851	84836856	+	Intron	DEL	ACACAC	-	-	rs113703304		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84836851_84836856delACACAC	uc001pak.2	-							NM_001142699	NP_001136171			chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
SYTL2	54843	broad.mit.edu	37	11	85524734	85524737	+	5'Flank	DEL	CCTC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85524734_85524737delCCTC	uc010rti.1	-						SYTL2_uc010rtj.1_5'Flank	NM_032943	NP_116561			synaptotagmin-like 2 isoform a						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	95183818	95183819	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95183818_95183819insT								SESN3 (218113 upstream) : FAM76B (318287 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	98556562	98556563	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98556562_98556563insA								None (None upstream) : CNTN5 (335308 downstream)																																			---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	99919039	99919039	+	Intron	DEL	C	-	-	rs35938290		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99919039delC	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176			contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
YAP1	10413	broad.mit.edu	37	11	102042924	102042925	+	Intron	INS	-	A	A	rs138976808	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102042924_102042925insA	uc001pgt.2	+						YAP1_uc001pgs.2_Intron|YAP1_uc001pgu.2_Intron|YAP1_uc001pgv.2_Intron|YAP1_uc010ruo.1_Intron|YAP1_uc001pgw.2_Intron	NM_001130145	NP_001123617			Yes-associated protein 1, 65kDa isoform 1						cell proliferation|cellular response to gamma radiation|contact inhibition|hippo signaling cascade|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)														---	---	---	---
DYNC2H1	79659	broad.mit.edu	37	11	103162888	103162888	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103162888delT	uc001pho.2	+						DYNC2H1_uc001phn.1_Intron|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932			dynein, cytoplasmic 2, heavy chain 1						cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	107126051	107126051	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107126051delT								GUCY1A2 (236880 upstream) : CWF19L2 (71023 downstream)																																			---	---	---	---
ATM	472	broad.mit.edu	37	11	108196856	108196856	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108196856delG	uc001pkb.1	+	47	7264	c.6879delG	c.(6877-6879)CTGfs	p.L2293fs	ATM_uc009yxr.1_Frame_Shift_Del_p.L2293fs|C11orf65_uc010rvx.1_Intron|ATM_uc001pke.1_Frame_Shift_Del_p.L945fs|ATM_uc001pkg.1_Frame_Shift_Del_p.L650fs	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	2293	FAT.				cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)				D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			---	---	---	---
DDX10	1662	broad.mit.edu	37	11	108781525	108781534	+	Intron	DEL	TGTCTGTGTC	-	-	rs139983666	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108781525_108781534delTGTCTGTGTC	uc001pkm.2	+						DDX10_uc001pkl.1_Intron	NM_004398	NP_004389			DEAD (Asp-Glu-Ala-Asp) box polypeptide 10								ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity			breast(2)|lung(1)|prostate(1)	4		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)				T	NUP98	AML*								---	---	---	---
BTG4	54766	broad.mit.edu	37	11	111359598	111359598	+	Intron	DEL	C	-	-	rs150373828	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111359598delC	uc001plj.2	-							NM_017589	NP_060059			B-cell translocation gene 4						cell cycle arrest|negative regulation of cell proliferation|neuron differentiation						0		all_cancers(61;3.78e-13)|all_epithelial(67;5.29e-08)|Melanoma(852;3.15e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0204)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.22e-06)|BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|all cancers(92;2.18e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0509)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	112577994	112577995	+	IGR	INS	-	TT	TT	rs149691460	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112577994_112577995insTT								PTS (437317 upstream) : NCAM1 (254000 downstream)																																			---	---	---	---
FAM55A	120400	broad.mit.edu	37	11	114421456	114421457	+	Intron	DEL	TT	-	-	rs34926546		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114421456_114421457delTT	uc001ppa.2	-						FAM55A_uc001ppb.1_Intron	NM_152315	NP_689528			hypothetical protein LOC120400							extracellular region					0		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;3.02e-06)|Epithelial(105;0.000144)|all cancers(92;0.00106)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	116546936	116546937	+	IGR	INS	-	G	G	rs146560706	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116546936_116546937insG								None (None upstream) : BUD13 (71951 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	118226597	118226598	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118226597_118226598delTG								CD3G (2100 upstream) : UBE4A (3704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	120038822	120038823	+	IGR	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120038822_120038823delGT								TRIM29 (29959 upstream) : OAF (42924 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	124926865	124926865	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124926865delT								CCDC15 (15482 upstream) : SLC37A2 (6148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	128102916	128102916	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128102916delA								None (None upstream) : ETS1 (225740 downstream)																																			---	---	---	---
JAM3	83700	broad.mit.edu	37	11	134015045	134015048	+	Intron	DEL	CTTC	-	-	rs71993546		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134015045_134015048delCTTC	uc001qhb.1	+						JAM3_uc009zcz.1_Intron	NM_032801	NP_116190			junctional adhesion molecule 3 precursor						angiogenesis|blood coagulation|regulation of neutrophil chemotaxis	cell-cell contact zone|desmosome|extracellular space|integral to membrane	integrin binding			ovary(1)	1	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)														---	---	---	---
GLB1L3	112937	broad.mit.edu	37	11	134178251	134178252	+	Intron	INS	-	ACC	ACC			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134178251_134178252insACC	uc009zdf.2	+						GLB1L3_uc010scu.1_Intron|GLB1L3_uc001qho.3_Intron	NM_001080407	NP_001073876			galactosidase, beta 1 like 3						carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	169091	169094	+	IGR	DEL	CTGA	-	-	rs139655934		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:169091_169094delCTGA								FAM138D (19679 upstream) : IQSEC3 (7109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	287473	287474	+	IGR	DEL	GA	-	-	rs71849208		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:287473_287474delGA								IQSEC3 (1151 upstream) : SLC6A12 (11776 downstream)																																			---	---	---	---
NINJ2	4815	broad.mit.edu	37	12	694417	694417	+	Intron	DEL	G	-	-	rs72405782		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:694417delG	uc001qil.2	-						NINJ2_uc010sdr.1_Intron|NINJ2_uc010sds.1_Intron	NM_016533	NP_057617			ninjurin 2						nervous system development|neuron cell-cell adhesion|tissue regeneration	integral to plasma membrane				ovary(2)	2	all_cancers(10;0.0101)|all_epithelial(11;0.0174)|Ovarian(42;0.0512)|all_lung(10;0.103)|Lung NSC(10;0.185)		OV - Ovarian serous cystadenocarcinoma(31;3.26e-05)|BRCA - Breast invasive adenocarcinoma(9;0.0508)															---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1261373	1261373	+	Intron	DEL	A	-	-	rs111767008		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1261373delA	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron|ERC1_uc010sdv.1_Intron|ERC1_uc009zdp.2_Intron	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1284632	1284632	+	Intron	DEL	A	-	-	rs148373633		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1284632delA	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron|ERC1_uc010sdv.1_Intron|ERC1_uc009zdp.2_Intron	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
DCP1B	196513	broad.mit.edu	37	12	2114778	2114778	+	5'Flank	DEL	T	-	-	rs112489273		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2114778delT	uc001qjx.1	-						DCP1B_uc010sdy.1_5'Flank|DCP1B_uc010sdz.1_5'Flank	NM_152640	NP_689853			decapping enzyme Dcp1b						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	hydrolase activity|protein binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00193)															---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2777294	2777295	+	Intron	INS	-	TCTC	TCTC	rs150206855	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2777294_2777295insTCTC	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc010sea.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2801469	2801470	+	3'UTR	INS	-	T	T	rs143104262	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2801469_2801470insT	uc009zdu.1	+	50					CACNA1C_uc009zdv.1_3'UTR|CACNA1C_uc001qkb.2_3'UTR|CACNA1C_uc001qkc.2_3'UTR|CACNA1C_uc001qke.2_3'UTR|CACNA1C_uc001qkf.2_3'UTR|CACNA1C_uc001qjz.2_3'UTR|CACNA1C_uc001qkd.2_3'UTR|CACNA1C_uc001qkg.2_3'UTR|CACNA1C_uc009zdw.1_3'UTR|CACNA1C_uc001qkh.2_3'UTR|CACNA1C_uc001qkl.2_3'UTR|CACNA1C_uc001qkn.2_3'UTR|CACNA1C_uc001qko.2_3'UTR|CACNA1C_uc001qkp.2_3'UTR|CACNA1C_uc001qkr.2_3'UTR|CACNA1C_uc001qku.2_3'UTR|CACNA1C_uc001qkq.2_3'UTR|CACNA1C_uc001qks.2_3'UTR|CACNA1C_uc001qkt.2_3'UTR|CACNA1C_uc001qki.1_3'UTR|CACNA1C_uc001qkj.1_3'UTR|CACNA1C_uc001qkk.1_3'UTR|CACNA1C_uc001qkm.1_3'UTR|CACNA1C_uc010sea.1_3'UTR|uc001qkx.1_5'Flank|CACNA1C_uc001qky.1_3'UTR	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	3163974	3163975	+	IGR	INS	-	T	T	rs146946827	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3163974_3163975insT								TEAD4 (14133 upstream) : TSPAN9 (22582 downstream)																																			---	---	---	---
EFCAB4B	84766	broad.mit.edu	37	12	3775523	3775524	+	Intron	DEL	GT	-	-	rs66798123		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3775523_3775524delGT	uc001qmj.2	-						EFCAB4B_uc010sen.1_Intron|EFCAB4B_uc010seo.1_Intron|EFCAB4B_uc001qmi.1_Intron	NM_032680	NP_116069			EF-hand calcium binding domain 4B isoform c						activation of store-operated calcium channel activity|store-operated calcium entry	cytoplasm	calcium ion binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)															---	---	---	---
EFCAB4B	84766	broad.mit.edu	37	12	3814252	3814252	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3814252delC	uc001qmj.2	-						EFCAB4B_uc010sen.1_Intron|EFCAB4B_uc010seo.1_Intron	NM_032680	NP_116069			EF-hand calcium binding domain 4B isoform c						activation of store-operated calcium channel activity|store-operated calcium entry	cytoplasm	calcium ion binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)															---	---	---	---
NDUFA9	4704	broad.mit.edu	37	12	4767599	4767599	+	Intron	DEL	T	-	-	rs4147699		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4767599delT	uc001qnc.2	+						NDUFA9_uc009zei.1_Intron|NDUFA9_uc010ses.1_5'Flank	NM_005002	NP_004993			NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|sodium ion transport	mitochondrial matrix|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)													---	---	---	---
NDUFA9	4704	broad.mit.edu	37	12	4795591	4795591	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4795591delT	uc001qnc.2	+						NDUFA9_uc010ses.1_Intron	NM_005002	NP_004993			NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|sodium ion transport	mitochondrial matrix|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	5144824	5144825	+	IGR	INS	-	ACAC	ACAC	rs141230574	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5144824_5144825insACAC								KCNA1 (117404 upstream) : KCNA5 (8260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	5441992	5441993	+	IGR	INS	-	AG	AG	rs146572124	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5441992_5441993insAG								KCNA5 (286044 upstream) : NTF3 (99287 downstream)																																			---	---	---	---
ANO2	57101	broad.mit.edu	37	12	6012813	6012814	+	Intron	INS	-	TGTGTG	TGTGTG	rs143239619	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6012813_6012814insTGTGTG	uc001qnm.2	-							NM_020373	NP_065106			anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	6237002	6237003	+	IGR	INS	-	A	A	rs140057356	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6237002_6237003insA								VWF (3166 upstream) : CD9 (71870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	7331502	7331503	+	IGR	INS	-	T	T	rs148155319	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7331502_7331503insT								CLSTN3 (19974 upstream) : PEX5 (10256 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	7432409	7432410	+	IGR	INS	-	A	A	rs145660417	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7432409_7432410insA								PEX5 (61242 upstream) : ACSM4 (24518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	7927199	7927201	+	IGR	DEL	TTG	-	-	rs140409113		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7927199_7927201delTTG								LOC360030 (482 upstream) : NANOG (14794 downstream)																																			---	---	---	---
FAM66C	440078	broad.mit.edu	37	12	8353659	8353660	+	Intron	INS	-	A	A	rs74656374		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8353659_8353660insA	uc009zgc.2	+						FAM66C_uc001qug.3_Intron					Homo sapiens cDNA FLJ38982 fis, clone NT2RI2005239.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	8508185	8508186	+	IGR	DEL	AG	-	-	rs146846168		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8508185_8508186delAG								LOC653113 (112643 upstream) : LOC389634 (1376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	8741786	8741787	+	IGR	INS	-	C	C	rs150737655	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8741786_8741787insC								CLEC4E (48228 upstream) : AICDA (12975 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	9431771	9431771	+	IGR	DEL	T	-	-	rs11361397		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9431771delT								MIR1244 (39624 upstream) : LOC642846 (4482 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	9900056	9900057	+	IGR	INS	-	T	T	rs138784711		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9900056_9900057insT								CLECL1 (14196 upstream) : CD69 (5027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	10521342	10521343	+	Intron	INS	-	AAAAATA	AAAAATA	rs146167901	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10521342_10521343insAAAAATA	uc001qya.1	+											Homo sapiens cDNA FLJ38995 fis, clone NT2RI2019826.																														---	---	---	---
HTR7P1	93164	broad.mit.edu	37	12	13162767	13162768	+	Intron	INS	-	TT	TT	rs112735891		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13162767_13162768insTT	uc001rbh.2	+											Homo sapiens cDNA FLJ43688 fis, clone TBAES2003492.												0																		---	---	---	---
GRIN2B	2904	broad.mit.edu	37	12	13809014	13809014	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13809014delT	uc001rbt.2	-							NM_000834	NP_000825			N-methyl-D-aspartate receptor subunit 2B						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	17055997	17055997	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17055997delT								LMO3 (293239 upstream) : None (None downstream)																																			---	---	---	---
PIK3C2G	5288	broad.mit.edu	37	12	18514908	18514908	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18514908delT	uc001rdt.2	+						PIK3C2G_uc010sia.1_Intron|PIK3C2G_uc010sib.1_Intron|PIK3C2G_uc010sic.1_Intron	NM_004570	NP_004561			phosphoinositide-3-kinase, class 2 gamma						cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	20396123	20396126	+	IGR	DEL	TTCT	-	-	rs62944161		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20396123_20396126delTTCT								AEBP2 (720950 upstream) : PDE3A (126071 downstream)																																			---	---	---	---
SLCO1B1	10599	broad.mit.edu	37	12	21389856	21389857	+	Intron	INS	-	A	A	rs142200558	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21389856_21389857insA	uc001req.3	+							NM_006446	NP_006437			solute carrier organic anion transporter family,						bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)													---	---	---	---
SLCO1A2	6579	broad.mit.edu	37	12	21482436	21482437	+	Intron	INS	-	T	T	rs79033234		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21482436_21482437insT	uc001rer.2	-						SLCO1A2_uc001res.2_Intron|SLCO1A2_uc010siq.1_Intron|SLCO1A2_uc010sio.1_Intron|SLCO1A2_uc010sip.1_Intron	NM_021094	NP_066580			organic anion transporting polypeptide A						bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	21895225	21895226	+	IGR	INS	-	T	T	rs36058561		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21895225_21895226insT								LDHB (84449 upstream) : KCNJ8 (22664 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	25574493	25574494	+	IGR	INS	-	G	G	rs150611421	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25574493_25574494insG								KRAS (170630 upstream) : IFLTD1 (54522 downstream)																																			---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26523590	26523592	+	Intron	DEL	TTG	-	-	rs71950988		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26523590_26523592delTTG	uc001rhg.2	-							NM_002223	NP_002214			inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	27216403	27216405	+	IGR	DEL	CTC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27216403_27216405delCTC								MED21 (33721 upstream) : C12orf71 (17586 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	27216455	27216457	+	IGR	DEL	TCC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27216455_27216457delTCC								MED21 (33773 upstream) : C12orf71 (17534 downstream)																																			---	---	---	---
STK38L	23012	broad.mit.edu	37	12	27447644	27447644	+	Intron	DEL	T	-	-	rs35709589		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27447644delT	uc001rhr.2	+						STK38L_uc001rhs.2_Intron|STK38L_uc010sjm.1_Intron	NM_015000	NP_055815			serine/threonine kinase 38 like						intracellular protein kinase cascade|regulation of cellular component organization	actin cytoskeleton|cytoplasm	actin binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|kidney(1)	5	Colorectal(261;0.0847)																	---	---	---	---
ARNTL2	56938	broad.mit.edu	37	12	27565934	27565934	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27565934delA	uc001rht.1	+						ARNTL2_uc001rhw.2_Intron|ARNTL2_uc010sjp.1_Intron|ARNTL2_uc001rhu.1_Intron|ARNTL2_uc009zji.1_Intron|ARNTL2_uc001rhv.1_Intron|uc001rhx.2_Intron	NM_020183	NP_064568			aryl hydrocarbon receptor nuclear						circadian rhythm|entrainment of circadian clock|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(1)|skin(1)	2	Colorectal(261;0.0847)|Lung SC(9;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	27915243	27915243	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27915243delT								MRPS35 (6016 upstream) : LOC100133893 (356 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	29265686	29265687	+	IGR	INS	-	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29265686_29265687insG								CCDC91 (562588 upstream) : FAR2 (36545 downstream)																																			---	---	---	---
TMTC1	83857	broad.mit.edu	37	12	29782261	29782261	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29782261delA	uc001rjb.2	-						TMTC1_uc001riz.2_Intron|TMTC1_uc001rja.2_Intron|TMTC1_uc001rjc.1_Intron	NM_175861	NP_787057			transmembrane and tetratricopeptide repeat							integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	30467782	30467783	+	IGR	INS	-	GT	GT	rs141521971	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30467782_30467783insGT								TMTC1 (530090 upstream) : IPO8 (314140 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	30535731	30535731	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30535731delA								TMTC1 (598039 upstream) : IPO8 (246192 downstream)																																			---	---	---	---
DENND5B	160518	broad.mit.edu	37	12	31736641	31736642	+	Intron	INS	-	AAC	AAC			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31736641_31736642insAAC	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc001rkj.2_Intron	NM_144973	NP_659410			DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	34359773	34359774	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34359773_34359774delTG								ALG10 (178539 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34459500	34459501	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34459500_34459501insA								ALG10 (278266 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38007363	38007364	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38007363_38007364insA								None (None upstream) : ALG10B (703193 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38095518	38095518	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38095518delG								None (None upstream) : ALG10B (615039 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38785564	38785565	+	IGR	INS	-	AAACTT	AAACTT	rs139574159	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38785564_38785565insAAACTT								ALG10B (62037 upstream) : CPNE8 (260437 downstream)																																			---	---	---	---
CPNE8	144402	broad.mit.edu	37	12	39178916	39178916	+	Intron	DEL	G	-	-	rs115104594	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39178916delG	uc001rls.1	-							NM_153634	NP_705898			copine VIII											pancreas(1)	1	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	39624137	39624140	+	IGR	DEL	TGTG	-	-	rs34013535		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39624137_39624140delTGTG								CPNE8 (324717 upstream) : KIF21A (62891 downstream)																																			---	---	---	---
SLC2A13	114134	broad.mit.edu	37	12	40435763	40435763	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40435763delC	uc010skm.1	-						SLC2A13_uc001rmf.2_Intron	NM_052885	NP_443117			solute carrier family 2 (facilitated glucose							integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)													HNSCC(50;0.14)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	40976319	40976322	+	IGR	DEL	TCTA	-	-	rs137861570		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40976319_40976322delTCTA								LRRK2 (213235 upstream) : CNTN1 (110036 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	42296491	42296492	+	IGR	DEL	TG	-	-	rs147994119		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42296491_42296492delTG								PDZRN4 (328107 upstream) : GXYLT1 (179158 downstream)																																			---	---	---	---
PPHLN1	51535	broad.mit.edu	37	12	42746214	42746215	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42746214_42746215insT	uc001rng.1	+						PPHLN1_uc001rmy.2_Intron|PPHLN1_uc001rna.2_Intron|PPHLN1_uc001rne.2_Intron|PPHLN1_uc001rnb.2_Intron|PPHLN1_uc001rnd.2_Intron|PPHLN1_uc001rnc.2_Intron|PPHLN1_uc001rnf.2_Intron|PPHLN1_uc010skq.1_Intron|PPHLN1_uc010skr.1_Intron|PPHLN1_uc010sks.1_Intron|PPHLN1_uc010skt.1_Intron|PPHLN1_uc001rni.1_Intron|PPHLN1_uc001rnh.1_Intron|PPHLN1_uc010sku.1_Intron	NM_016488	NP_057572			periphilin 1 isoform 1						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	45352751	45352753	+	IGR	DEL	AGG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45352751_45352753delAGG								NELL2 (45040 upstream) : DBX2 (55786 downstream)																																			---	---	---	---
ARID2	196528	broad.mit.edu	37	12	46220843	46220843	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46220843delC	uc001ros.1	+						ARID2_uc001ror.2_Intron	NM_152641	NP_689854			AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	47777523	47777524	+	IGR	DEL	CC	-	-	rs144538682		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47777523_47777524delCC								FAM113B (147082 upstream) : RPAP3 (278192 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	47793780	47793781	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47793780_47793781insA								FAM113B (163339 upstream) : RPAP3 (261935 downstream)																																			---	---	---	---
RHEBL1	121268	broad.mit.edu	37	12	49463357	49463374	+	Intron	DEL	CCAATCCTCCACTCTTCC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49463357_49463374delCCAATCCTCCACTCTTCC	uc001rtc.1	-						RHEBL1_uc001rtd.1_Intron|RHEBL1_uc009zlc.1_Intron	NM_144593	NP_653194			Ras homolog enriched in brain like 1 precursor						positive regulation of NF-kappaB transcription factor activity|small GTPase mediated signal transduction|TOR signaling cascade	cytoplasm|plasma membrane	GTP binding|GTPase activity|protein binding			lung(1)|breast(1)	2																		---	---	---	---
LIMA1	51474	broad.mit.edu	37	12	50611688	50611688	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50611688delC	uc001rwj.3	-						LIMA1_uc001rwh.3_Intron|LIMA1_uc001rwi.3_Intron|LIMA1_uc001rwk.3_Intron|LIMA1_uc010smr.1_Intron|LIMA1_uc010sms.1_Intron	NM_016357	NP_057441			LIM domain and actin binding 1 isoform b						actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1																		---	---	---	---
DIP2B	57609	broad.mit.edu	37	12	51008202	51008202	+	Intron	DEL	T	-	-	rs11365705		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51008202delT	uc001rwv.2	+						DIP2B_uc001rwu.2_Intron	NM_173602	NP_775873			DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	51438870	51438871	+	IGR	INS	-	GT	GT	rs56952888	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51438870_51438871insGT								SLC11A2 (16812 upstream) : LETMD1 (3213 downstream)																																			---	---	---	---
CSRNP2	81566	broad.mit.edu	37	12	51459282	51459282	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51459282delT	uc001rxu.1	-							NM_030809	NP_110436			TGF-beta induced apoptosis protein 12						apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	55094762	55094763	+	IGR	INS	-	TG	TG	rs139078649	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55094762_55094763insTG								DCD (52613 upstream) : MUCL1 (153536 downstream)																																			---	---	---	---
STAT6	6778	broad.mit.edu	37	12	57505073	57505074	+	5'Flank	DEL	AC	-	-	rs143689240		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57505073_57505074delAC	uc009zpe.2	-						STAT6_uc009zpf.2_5'UTR|STAT6_uc001sna.2_5'UTR|STAT6_uc010srb.1_5'UTR|STAT6_uc010src.1_5'UTR|STAT6_uc010srd.1_5'UTR|STAT6_uc009zpg.2_Intron	NM_003153	NP_003144			signal transducer and activator of transcription						regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	calcium ion binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
INHBC	3626	broad.mit.edu	37	12	57829631	57829632	+	Intron	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57829631_57829632delTT	uc001snv.1	+							NM_005538	NP_005529			inhibin beta C chain preproprotein						growth	extracellular region	growth factor activity|hormone activity|transforming growth factor beta receptor binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	58271788	58271788	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58271788delA								CTDSP2 (31041 upstream) : XRCC6BP1 (63657 downstream)																																			---	---	---	---
XRCC6BP1	91419	broad.mit.edu	37	12	58339650	58339650	+	Intron	DEL	T	-	-	rs34127224		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58339650delT	uc001sqp.2	+							NM_033276	NP_150592			XRCC6 binding protein 1						double-strand break repair via nonhomologous end joining	DNA-dependent protein kinase-DNA ligase 4 complex	DNA-dependent protein kinase activity|metal ion binding|metalloendopeptidase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	58546875	58546875	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58546875delA								XRCC6BP1 (195824 upstream) : LRIG3 (719063 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	59018152	59018153	+	Intron	INS	-	T	T	rs149167670	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59018152_59018153insT	uc001sqq.1	-											Homo sapiens cDNA FLJ35805 fis, clone TESTI2005982.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	63868907	63868908	+	IGR	INS	-	T	T	rs33950118		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63868907_63868908insT								AVPR1A (322317 upstream) : DPY19L2 (83785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	64645436	64645436	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64645436delA	uc001srx.2	+											Homo sapiens mRNA; cDNA DKFZp434A0326 (from clone DKFZp434A0326).																														---	---	---	---
MSRB3	253827	broad.mit.edu	37	12	65815032	65815032	+	Intron	DEL	A	-	-	rs36064372		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65815032delA	uc001ssn.2	+						MSRB3_uc001ssm.2_Intron|MSRB3_uc009zqp.2_Intron	NM_198080	NP_932346			methionine sulfoxide reductase B3 isoform 1						protein repair	endoplasmic reticulum|mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)														---	---	---	---
HMGA2	8091	broad.mit.edu	37	12	66292072	66292072	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66292072delT	uc001ssx.2	+						HMGA2_uc001ssw.1_Intron|HMGA2_uc001ssu.1_Intron|HMGA2_uc001ssv.2_Intron	NM_003483	NP_003474			high mobility group AT-hook 2 isoform a						cell division|chromatin organization|mitosis|multicellular organismal development|regulation of growth|transcription, DNA-dependent	chromatin	AT DNA binding		HMGA2/LPP(161)|HMGA2/WIF1_ENST00000286574(14)|HMGA2/RAD51B(11)|HMGA2/NFIB_ENST00000397581(8)|HMGA2/FHIT_ENST00000476844(4)|HMGA2/CCNB1IP1(2)|HMGA2/ALDH2_ENST00000261733(2)|HMGA2/EBF1(2)|HMGA2/LHFP(2)|HMGA2/COX6C(2)	soft_tissue(159)|bone(27)|salivary_gland(22)	208	all_cancers(1;5.78e-46)		GBM - Glioblastoma multiforme(1;0.00179)|LUSC - Lung squamous cell carcinoma(43;0.156)	GBM - Glioblastoma multiforme(28;0.0386)				T	 LHFP|RAD51L1|LPP|HEI10|COX6C|CMKOR1|NFIB|ALDH2|CCNB1IP1|EBF1|WIF1|FHIT	lipoma|leiomyoma|pleiomorphic salivary gland adenoma								---	---	---	---
GRIP1	23426	broad.mit.edu	37	12	66809867	66809867	+	Intron	DEL	A	-	-	rs79639789		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66809867delA	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stj.2_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973			glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	67946616	67946616	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67946616delG	uc001stq.1	+											Homo sapiens cDNA FLJ31412 fis, clone NT2NE2000222.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	68749576	68749577	+	IGR	DEL	TC	-	-	rs35731942		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68749576_68749577delTC								MDM1 (23415 upstream) : RAP1B (255075 downstream)																																			---	---	---	---
CCT2	10576	broad.mit.edu	37	12	69985660	69985662	+	Intron	DEL	AAC	-	-	rs34385564		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69985660_69985662delAAC	uc001svb.1	+						CCT2_uc009zrm.1_Intron|CCT2_uc009zrn.1_Intron|CCT2_uc010stl.1_Intron	NM_006431	NP_006422			chaperonin containing TCP1, subunit 2						'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	70430783	70430786	+	IGR	DEL	ACAC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70430783_70430786delACAC								RAB3IP (213801 upstream) : CNOT2 (205991 downstream)																																			---	---	---	---
PTPRR	5801	broad.mit.edu	37	12	71179108	71179109	+	Intron	INS	-	TTCAT	TTCAT	rs138591998	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71179108_71179109insTTCAT	uc001swi.1	-						PTPRR_uc010stq.1_Intron	NM_002849	NP_002840			protein tyrosine phosphatase, receptor type, R						in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)														---	---	---	---
TSPAN8	7103	broad.mit.edu	37	12	71572816	71572817	+	Intron	DEL	AA	-	-	rs35903658		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71572816_71572817delAA	uc001swk.1	-							NM_004616	NP_004607			transmembrane 4 superfamily member 3						protein glycosylation	integral to membrane|lysosome	signal transducer activity			skin(2)|lung(1)|central_nervous_system(1)	4			LUSC - Lung squamous cell carcinoma(43;0.24)|OV - Ovarian serous cystadenocarcinoma(12;0.244)															---	---	---	---
TBC1D15	64786	broad.mit.edu	37	12	72287220	72287221	+	Intron	INS	-	TG	TG	rs139574467	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72287220_72287221insTG	uc001swu.2	+						TBC1D15_uc009zrv.2_Intron|TBC1D15_uc010stt.1_Intron|TBC1D15_uc001swv.2_Intron|TBC1D15_uc001sww.2_Intron	NM_022771	NP_073608			TBC1 domain family, member 15 isoform 1								protein binding|Rab GTPase activator activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	74052536	74052536	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74052536delT								TRHDE (993115 upstream) : ATXN7L3B (879015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77952932	77952933	+	IGR	INS	-	AGA	AGA	rs150149725	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77952932_77952933insAGA								E2F7 (493572 upstream) : NAV3 (272136 downstream)																																			---	---	---	---
NAV3	89795	broad.mit.edu	37	12	78334655	78334655	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78334655delT	uc001syp.2	+						NAV3_uc001syo.2_Intron	NM_014903	NP_055718			neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---
Unknown	0	broad.mit.edu	37	12	82642191	82642192	+	IGR	INS	-	CA	CA	rs141010215	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82642191_82642192insCA								PPFIA2 (489082 upstream) : CCDC59 (103898 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	90463921	90463922	+	IGR	INS	-	AT	AT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90463921_90463922insAT								LOC338758 (358193 upstream) : C12orf12 (882071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	90625871	90625872	+	IGR	INS	-	TG	TG	rs144531535	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90625871_90625872insTG								LOC338758 (520143 upstream) : C12orf12 (720121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	104779490	104779491	+	IGR	INS	-	TAT	TAT	rs111252226		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104779490_104779491insTAT								TXNRD1 (35432 upstream) : CHST11 (71258 downstream)																																			---	---	---	---
CHST11	50515	broad.mit.edu	37	12	104879359	104879360	+	Intron	DEL	TG	-	-	rs35379294		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104879359_104879360delTG	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
KIAA1033	23325	broad.mit.edu	37	12	105506294	105506294	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105506294delA	uc001tld.2	+						KIAA1033_uc010swr.1_Intron|KIAA1033_uc010sws.1_5'Flank	NM_015275	NP_056090			hypothetical protein LOC23325						endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	108414981	108414982	+	IGR	DEL	GA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108414981_108414982delGA								ASCL4 (244561 upstream) : WSCD2 (108529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	108972363	108972365	+	IGR	DEL	ATC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108972363_108972365delATC								ISCU (9205 upstream) : TMEM119 (11259 downstream)																																			---	---	---	---
MYO1H	283446	broad.mit.edu	37	12	109854184	109854185	+	Intron	INS	-	T	T	rs79695819		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109854184_109854185insT	uc010sxn.1	+							NM_001101421	NP_001094891			myosin 1H							myosin complex	motor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	111221808	111221808	+	IGR	DEL	T	-	-	rs76284834		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111221808delT								PPP1CC (41051 upstream) : CCDC63 (63003 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	113468823	113468824	+	IGR	DEL	CT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113468823_113468824delCT								OAS2 (19296 upstream) : DTX1 (26838 downstream)																																	OREG0022136	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	12	114562410	114562412	+	IGR	DEL	AAG	-	-	rs79992030		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114562410_114562412delAAG								RBM19 (158234 upstream) : TBX5 (229324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	115688433	115688434	+	IGR	INS	-	CACACAATG	CACACAATG	rs139447891	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115688433_115688434insCACACAATG								TBX3 (566464 upstream) : MED13L (707949 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	116233483	116233484	+	IGR	INS	-	CTT	CTT	rs150018492	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116233483_116233484insCTT								None (None upstream) : MED13L (162899 downstream)																																			---	---	---	---
FBXO21	23014	broad.mit.edu	37	12	117616476	117616477	+	Intron	INS	-	C	C	rs145913515	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117616476_117616477insC	uc001twk.2	-						FBXO21_uc001twj.2_Intron|FBXO21_uc009zwq.2_Intron	NM_033624	NP_296373			F-box only protein 21 isoform 1						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)														---	---	---	---
CIT	11113	broad.mit.edu	37	12	120194922	120194922	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120194922delA	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105			citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)														---	---	---	---
DYNLL1	8655	broad.mit.edu	37	12	120921141	120921141	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120921141delA	uc001tyj.2	+							NM_001037494	NP_001032583			dynein light chain 1						actin cytoskeleton organization|activation of pro-apoptotic gene products|anatomical structure morphogenesis|female gamete generation|G2/M transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|microtubule-based process|negative regulation of phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transport	centrosome|cytoplasmic dynein complex|cytosol|microtubule|mitochondrion|nucleus|plasma membrane	motor activity|protein binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
P2RX4	5025	broad.mit.edu	37	12	121665105	121665105	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121665105delC	uc001tzr.2	+						P2RX4_uc010szr.1_Intron|P2RX4_uc010szs.1_Intron|P2RX4_uc009zxc.2_Intron|P2RX4_uc001tzs.2_Intron|P2RX4_uc009zxb.2_Intron|P2RX4_uc010szt.1_Intron	NM_002560	NP_002551			purinergic receptor P2X4						endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---
BCL7A	605	broad.mit.edu	37	12	122472647	122472648	+	Intron	INS	-	AA	AA			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122472647_122472648insAA	uc001ubp.2	+						BCL7A_uc001ubo.2_Intron	NM_001024808	NP_001019979			B-cell CLL/lymphoma 7A isoform b						negative regulation of transcription, DNA-dependent					ovary(1)|lung(1)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)				T	MYC	BNHL								---	---	---	---
Unknown	0	broad.mit.edu	37	12	122634439	122634439	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122634439delT								MLXIP (5474 upstream) : LRRC43 (17827 downstream)																																			---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124264151	124264152	+	Intron	INS	-	GAGA	GAGA	rs143069832	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124264151_124264152insGAGA	uc001uft.3	+							NM_207437	NP_997320			dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	125040807	125040808	+	Intron	INS	-	G	G	rs149791498	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125040807_125040808insG	uc001ugj.1	-							NM_006312	NP_006303			nuclear receptor co-repressor 2 isoform 1						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	125745468	125745469	+	IGR	INS	-	TGTG	TGTG	rs138498920	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125745468_125745469insTGTG								AACS (117596 upstream) : TMEM132B (65693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	127383686	127383687	+	IGR	INS	-	TG	TG	rs150858049	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127383686_127383687insTG								LOC100128554 (426356 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	127736432	127736433	+	IGR	DEL	AG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127736432_127736433delAG								LOC100128554 (779102 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	128674090	128674091	+	IGR	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128674090_128674091delGT								None (None upstream) : TMEM132C (225200 downstream)																																			---	---	---	---
TMEM132C	92293	broad.mit.edu	37	12	129150166	129150167	+	Intron	INS	-	CACACA	CACACA	rs139344256	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129150166_129150167insCACACA	uc001uhs.3	+							NM_001136103	NP_001129575			transmembrane protein 132C							integral to membrane				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	131814645	131814660	+	IGR	DEL	ATCCATCCATCCATCC	-	-	rs71962612		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131814645_131814660delATCCATCCATCCATCC								LOC116437 (117170 upstream) : SFRS8 (380975 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	132620873	132620873	+	IGR	DEL	G	-	-	rs66798518		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132620873delG								EP400NL (20789 upstream) : DDX51 (269 downstream)																																			---	---	---	---
GOLGA3	2802	broad.mit.edu	37	12	133379664	133379671	+	Intron	DEL	AACAACAA	-	-	rs72339251		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133379664_133379671delAACAACAA	uc001ukz.1	-						GOLGA3_uc001ula.1_Intron|GOLGA3_uc001ulb.2_Intron	NM_005895	NP_005886			Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	133416543	133416544	+	IGR	INS	-	C	C	rs149468729	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133416543_133416544insC								GOLGA3 (11093 upstream) : CHFR (394 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	19937640	19937640	+	IGR	DEL	A	-	-	rs71912370		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19937640delA								LOC100101938 (18527 upstream) : TPTE2 (59381 downstream)																																			---	---	---	---
SKA3	221150	broad.mit.edu	37	13	21748550	21748550	+	Intron	DEL	A	-	-	rs34354326		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21748550delA	uc001unt.2	-						SKA3_uc001unv.2_Intron|SKA3_uc001unu.2_Intron|MRP63_uc001unw.2_5'Flank	NM_145061	NP_659498			SKA3						cell division|chromosome segregation|mitosis|regulation of microtubule polymerization or depolymerization	condensed chromosome outer kinetochore|cytoplasm|spindle microtubule	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	21874006	21874007	+	Intron	INS	-	TTGT	TTGT	rs143892791	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21874006_21874007insTTGT	uc001unz.1	+						uc001uny.2_Intron					Homo sapiens cDNA FLJ33446 fis, clone BRAMY1000095.																														---	---	---	---
ZDHHC20	253832	broad.mit.edu	37	13	22005622	22005623	+	Intron	INS	-	AAGTA	AAGTA	rs140857787	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22005622_22005623insAAGTA	uc001uob.2	-						ZDHHC20_uc001uod.2_Intron|ZDHHC20_uc001uoc.2_Intron|ZDHHC20_uc001uoe.2_Intron|ZDHHC20_uc010tcs.1_Intron	NM_153251	NP_694983			zinc finger, DHHC-type containing 20							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)														---	---	---	---
ZDHHC20	253832	broad.mit.edu	37	13	22029773	22029778	+	Intron	DEL	GTGTGT	-	-	rs66511848		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22029773_22029778delGTGTGT	uc001uob.2	-						ZDHHC20_uc001uod.2_Intron|ZDHHC20_uc001uoc.2_Intron|ZDHHC20_uc001uoe.2_Intron|ZDHHC20_uc010tcs.1_Intron	NM_153251	NP_694983			zinc finger, DHHC-type containing 20							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	22599994	22599994	+	IGR	DEL	A	-	-	rs67546649		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22599994delA								FGF9 (321354 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	24269342	24269344	+	IGR	DEL	AAA	-	-	rs10581260		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24269342_24269344delAAA								TNFRSF19 (19111 upstream) : MIPEP (34985 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	24962799	24962812	+	IGR	DEL	GGTCACAGGAGGGA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24962799_24962812delGGTCACAGGAGGGA								C1QTNF9 (66134 upstream) : PARP4 (32263 downstream)																																			---	---	---	---
PARP4	143	broad.mit.edu	37	13	25007892	25007892	+	Intron	DEL	A	-	-	rs35265827		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25007892delA	uc001upl.2	-							NM_006437	NP_006428			poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	25715033	25715034	+	IGR	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25715033_25715034delAC								PABPC3 (42331 upstream) : FAM123A (27639 downstream)																																			---	---	---	---
RNF6	6049	broad.mit.edu	37	13	26797215	26797215	+	5'Flank	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26797215delA	uc001uqo.2	-						RNF6_uc001uqn.1_5'Flank|RNF6_uc010aak.2_5'Flank|RNF6_uc001uqp.2_5'Flank|RNF6_uc001uqq.2_5'Flank|RNF6_uc010tdk.1_5'Flank	NM_183044	NP_898865			ring finger protein 6						negative regulation of axon extension|positive regulation of transcription, DNA-dependent|protein K27-linked ubiquitination|protein K48-linked ubiquitination|protein K6-linked ubiquitination|regulation of androgen receptor signaling pathway|ubiquitin-dependent protein catabolic process	axon|cytoplasm|PML body	androgen receptor binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	27486986	27486989	+	IGR	DEL	CTGT	-	-	rs141930994		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27486986_27486989delCTGT								GPR12 (152064 upstream) : USP12 (155449 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	30546241	30546242	+	IGR	DEL	CT	-	-	rs35407772		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30546241_30546242delCT								UBL3 (121421 upstream) : KATNAL1 (230526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	31550330	31550331	+	IGR	INS	-	CA	CA	rs145954400	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31550330_31550331insCA								C13orf26 (1179 upstream) : HSPH1 (160434 downstream)																																			---	---	---	---
B3GALTL	145173	broad.mit.edu	37	13	31841748	31841749	+	Intron	INS	-	A	A	rs138343689		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31841748_31841749insA	uc010aaz.2	+						B3GALTL_uc001utn.3_Intron	NM_194318	NP_919299			beta 1,3-galactosyltransferase-like						fucose metabolic process	endoplasmic reticulum membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)														---	---	---	---
RXFP2	122042	broad.mit.edu	37	13	32368506	32368507	+	Intron	DEL	CA	-	-	rs112846075		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32368506_32368507delCA	uc001utt.2	+						RXFP2_uc010aba.2_Intron	NM_130806	NP_570718			relaxin/insulin-like family peptide receptor 2							integral to membrane|plasma membrane					0		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)														---	---	---	---
EEF1DP3	196549	broad.mit.edu	37	13	32501255	32501256	+	Intron	INS	-	A	A	rs143835792	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32501255_32501256insA	uc001utu.2	+						EEF1DP3_uc010tdv.1_Intron					Homo sapiens similar to hypothetical protein FLJ20897, mRNA (cDNA clone IMAGE:5267252).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	35443702	35443703	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35443702_35443703insT								RFC3 (903008 upstream) : NBEA (72753 downstream)																																			---	---	---	---
NBEA	26960	broad.mit.edu	37	13	36206630	36206631	+	Intron	INS	-	TT	TT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36206630_36206631insTT	uc001uvb.2	+						NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_Intron|NBEA_uc001uvd.2_Intron	NM_015678	NP_056493			neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	36333580	36333582	+	IGR	DEL	CTT	-	-	rs35981691		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36333580_36333582delCTT								NBEA (86708 upstream) : DCLK1 (9541 downstream)																																			---	---	---	---
SOHLH2	54937	broad.mit.edu	37	13	36799750	36799750	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36799750delT	uc010tei.1	-							NM_017826	NP_060296			spermatogenesis and oogenesis specific basic						cell differentiation|multicellular organismal development|oogenesis|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	38500311	38500312	+	IGR	INS	-	A	A	rs139069312	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38500311_38500312insA								TRPC4 (56372 upstream) : UFM1 (423630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	39204637	39204637	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39204637delA								UFM1 (267495 upstream) : FREM2 (56536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	39221206	39221213	+	IGR	DEL	GTGTGTGT	-	-	rs10529782		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39221206_39221213delGTGTGTGT								UFM1 (284064 upstream) : FREM2 (39960 downstream)																																			---	---	---	---
FREM2	341640	broad.mit.edu	37	13	39418027	39418028	+	Intron	INS	-	T	T	rs141100077		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39418027_39418028insT	uc001uwv.2	+						FREM2_uc001uww.2_Intron	NM_207361	NP_997244			FRAS1-related extracellular matrix protein 2						cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)														---	---	---	---
LHFP	10186	broad.mit.edu	37	13	40082164	40082164	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40082164delT	uc001uxf.2	-							NM_005780	NP_005771			lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)				T	HMGA2	lipoma								---	---	---	---
Unknown	0	broad.mit.edu	37	13	40677690	40677691	+	IGR	INS	-	AC	AC	rs137920521	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40677690_40677691insAC								COG6 (311888 upstream) : LOC646982 (243582 downstream)																																			---	---	---	---
FOXO1	2308	broad.mit.edu	37	13	41163486	41163487	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41163486_41163487insA	uc001uxl.3	-						FOXO1_uc010acc.1_Intron	NM_002015	NP_002006			forkhead box O1						anti-apoptosis|blood vessel development|embryo development|endocrine pancreas development|insulin receptor signaling pathway|negative regulation of stress-activated MAPK cascade|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|response to DNA damage stimulus|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding		PAX3/FOXO1(749)|PAX7/FOXO1(197)	soft_tissue(946)|lung(1)|central_nervous_system(1)	948		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	42925064	42925065	+	IGR	INS	-	C	C	rs144886953	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42925064_42925065insC								AKAP11 (27662 upstream) : TNFSF11 (211807 downstream)																																			---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	44314204	44314204	+	Intron	DEL	C	-	-	rs61397417		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44314204delC	uc001uzc.3	-							NM_017993	NP_060463			ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	45006699	45006700	+	IGR	INS	-	G	G	rs144454297	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45006699_45006700insG								SERP2 (34850 upstream) : TSC22D1 (961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	45621566	45621568	+	IGR	DEL	TCT	-	-	rs72460379		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45621566_45621568delTCT								KIAA1704 (13824 upstream) : GTF2F2 (73063 downstream)																																	OREG0022390	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
GTF2F2	2963	broad.mit.edu	37	13	45812083	45812084	+	Intron	INS	-	TGTT	TGTT	rs138553739	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45812083_45812084insTGTT	uc001uzw.2	+						GTF2F2_uc001uzv.2_Intron	NM_004128	NP_004119			general transcription factor IIF, polypeptide 2,						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	microtubule cytoskeleton|transcription factor TFIIF complex	ATP binding|ATP-dependent helicase activity|DNA binding|protein binding				0		Lung NSC(96;0.00115)|Prostate(109;0.00578)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000647)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	46252880	46252880	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46252880delT								FAM194B (63006 upstream) : SPERT (23566 downstream)																																			---	---	---	---
LRCH1	23143	broad.mit.edu	37	13	47141628	47141631	+	Intron	DEL	TGTG	-	-	rs35848521		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47141628_47141631delTGTG	uc001vbj.2	+						LRCH1_uc010acp.2_Intron|LRCH1_uc001vbk.2_Intron|LRCH1_uc001vbl.3_Intron	NM_015116	NP_055931			leucine-rich repeats and calponin homology (CH)											ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	48232531	48232532	+	IGR	DEL	CA	-	-	rs72458219		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48232531_48232532delCA								HTR2A (761481 upstream) : SUCLA2 (284260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	48282967	48282968	+	IGR	INS	-	T	T	rs141171913	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48282967_48282968insT								HTR2A (811917 upstream) : SUCLA2 (233824 downstream)																																			---	---	---	---
CAB39L	81617	broad.mit.edu	37	13	49974610	49974615	+	Intron	DEL	ACACAT	-	-	rs60080189		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49974610_49974615delACACAT	uc001vcw.2	-						CAB39L_uc001vcx.2_Intron|CAB39L_uc010adf.2_Intron	NM_030925	NP_112187			calcium binding protein 39-like						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	protein binding				0		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)														---	---	---	---
DLEU2	8847	broad.mit.edu	37	13	50566078	50566079	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50566078_50566079insT	uc001vdn.1	-						DLEU2_uc001vdo.1_Intron	NR_002612				Homo sapiens BCMS-upstream neighbor (BCMSUN) mRNA, partial sequence.												0																		---	---	---	---
KCNRG	283518	broad.mit.edu	37	13	50593288	50593288	+	Intron	DEL	T	-	-	rs11284044		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50593288delT	uc001vdu.2	+						DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|KCNRG_uc001vdt.2_Intron	NM_173605	NP_775876			potassium channel regulator isoform 1							voltage-gated potassium channel complex	identical protein binding|voltage-gated potassium channel activity				0		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.48e-10)|COAD - Colon adenocarcinoma(199;0.204)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	51280390	51280390	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51280390delT								DLEU1 (177720 upstream) : DLEU7 (6369 downstream)																																			---	---	---	---
ATP7B	540	broad.mit.edu	37	13	52577762	52577763	+	Intron	INS	-	AA	AA	rs77701270		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52577762_52577763insAA	uc001vfw.2	-						ATP7B_uc010adv.2_Intron|ATP7B_uc001vfx.2_Intron|ATP7B_uc001vfy.2_Intron|ATP7B_uc010tgt.1_Intron|ATP7B_uc010tgu.1_Intron|ATP7B_uc010tgv.1_Intron	NM_000053	NP_000044			ATPase, Cu++ transporting, beta polypeptide						ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)										Wilson_disease				---	---	---	---
Unknown	0	broad.mit.edu	37	13	52612058	52612059	+	IGR	INS	-	AA	AA			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52612058_52612059insAA								UTP14C (4324 upstream) : NEK5 (26843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55173927	55173927	+	IGR	DEL	A	-	-	rs34369978		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55173927delA								MIR1297 (287744 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	58009523	58009523	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58009523delT								PRR20B (265171 upstream) : PCDH17 (196266 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59905973	59905974	+	IGR	INS	-	TGTGTATA	TGTGTATA	rs147147428	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59905973_59905974insTGTGTATA								None (None upstream) : DIAPH3 (333751 downstream)																																			---	---	---	---
DIAPH3	81624	broad.mit.edu	37	13	60484960	60484961	+	Intron	INS	-	TT	TT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60484960_60484961insTT	uc001vht.2	-						DIAPH3_uc001vhu.2_Intron|DIAPH3_uc001vhv.2_Intron	NM_001042517	NP_001035982			diaphanous homolog 3 isoform a						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	62792106	62792107	+	IGR	INS	-	A	A	rs147825050	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62792106_62792107insA								PCDH20 (790027 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62969441	62969442	+	IGR	INS	-	A	A	rs112212320		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62969441_62969442insA								PCDH20 (967362 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	64073946	64073947	+	IGR	INS	-	T	T	rs142952934	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64073946_64073947insT								None (None upstream) : OR7E156P (237621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	65095248	65095249	+	IGR	DEL	AC	-	-	rs77685002		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65095248_65095249delAC								OR7E156P (778547 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	65582677	65582678	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65582677_65582678insA								None (None upstream) : None (None downstream)																																			---	---	---	---
PCDH9	5101	broad.mit.edu	37	13	67393066	67393067	+	Intron	INS	-	A	A	rs111342744		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67393066_67393067insA	uc001vik.2	-						PCDH9_uc010aei.2_Intron|PCDH9_uc001vil.2_Intron|PCDH9_uc010thl.1_Intron	NM_203487	NP_982354			protocadherin 9 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	68034591	68034592	+	IGR	INS	-	A	A	rs71211568		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68034591_68034592insA								PCDH9 (230123 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69064128	69064128	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69064128delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69515706	69515707	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69515706_69515707insT								None (None upstream) : KLHL1 (759019 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	71643462	71643462	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:71643462delT								ATXN8OS (929577 upstream) : DACH1 (368636 downstream)																																			---	---	---	---
PIBF1	10464	broad.mit.edu	37	13	73529512	73529513	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73529512_73529513delTG	uc001vjc.2	+						PIBF1_uc001vjb.2_Intron|PIBF1_uc010aep.2_Intron	NM_006346	NP_006337			progesterone-induced blocking factor 1							centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)														---	---	---	---
PIBF1	10464	broad.mit.edu	37	13	73564667	73564667	+	Intron	DEL	A	-	-	rs113835188		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73564667delA	uc001vjc.2	+						PIBF1_uc010aep.2_Intron	NM_006346	NP_006337			progesterone-induced blocking factor 1							centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	73653377	73653378	+	IGR	INS	-	A	A	rs34137490		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73653377_73653378insA								KLF5 (1702 upstream) : KLF12 (606772 downstream)																																			---	---	---	---
KLF12	11278	broad.mit.edu	37	13	74413231	74413231	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74413231delT	uc001vjf.2	-						KLF12_uc010aeq.2_Intron|KLF12_uc001vjg.3_Intron	NM_007249	NP_009180			Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)														---	---	---	---
TBC1D4	9882	broad.mit.edu	37	13	76022705	76022705	+	Intron	DEL	A	-	-	rs75467310		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76022705delA	uc001vjl.1	-						TBC1D4_uc010aer.2_Intron|TBC1D4_uc010aes.2_Intron	NM_014832	NP_055647			TBC1 domain family, member 4							cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)														---	---	---	---
COMMD6	170622	broad.mit.edu	37	13	76108113	76108113	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76108113delT	uc001vjo.1	-						COMMD6_uc001vjn.1_Intron|COMMD6_uc010aet.1_Intron|COMMD6_uc001vjp.1_Intron	NM_203495	NP_987091			COMM domain containing 6 isoform b							cytoplasm|nucleus	protein binding				0		Breast(118;0.0979)|Prostate(6;0.122)		GBM - Glioblastoma multiforme(99;0.0104)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	77127786	77127786	+	IGR	DEL	A	-	-	rs11297673		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77127786delA								LMO7 (693782 upstream) : KCTD12 (326518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	77351884	77351885	+	IGR	INS	-	A	A	rs145552360	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77351884_77351885insA								LMO7 (917880 upstream) : KCTD12 (102419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	78886894	78886895	+	Intron	INS	-	TGTGTGTG	TGTGTGTG	rs138134815	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78886894_78886895insTGTGTGTG	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	78998295	78998296	+	Intron	INS	-	AGGA	AGGA	rs148481164	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78998295_78998296insAGGA	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	81443926	81443927	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81443926_81443927insT								SPRY2 (528840 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	86366815	86366816	+	IGR	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86366815_86366816delGT								None (None upstream) : SLITRK6 (106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	88637346	88637347	+	IGR	INS	-	T	T	rs140003197	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88637346_88637347insT								SLITRK5 (305478 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	95352168	95352168	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95352168delG								GPR180 (70224 upstream) : SOX21 (9714 downstream)																																			---	---	---	---
DOCK9	23348	broad.mit.edu	37	13	99537790	99537791	+	Intron	INS	-	A	A	rs35464733		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99537790_99537791insA	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tis.1_Intron|DOCK9_uc010tit.1_Intron|DOCK9_uc010afu.1_Intron	NM_015296	NP_056111			dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
UBAC2	337867	broad.mit.edu	37	13	99988253	99988253	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99988253delA	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron|UBAC2_uc001voh.2_Intron	NM_001144072	NP_001137544			UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	101512148	101512148	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101512148delA								TMTC4 (185045 upstream) : NALCN (193982 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	104788194	104788195	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104788194_104788195delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
COL4A2	1284	broad.mit.edu	37	13	111162964	111162965	+	Intron	DEL	TG	-	-	rs35675138		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111162964_111162965delTG	uc001vqx.2	+							NM_001846	NP_001837			alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)															---	---	---	---
ATP11A	23250	broad.mit.edu	37	13	113429544	113429544	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113429544delG	uc001vsi.3	+						ATP11A_uc001vsj.3_Intron	NM_015205	NP_056020			ATPase, class VI, type 11A isoform a						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	20629459	20629460	+	IGR	INS	-	A	A	rs141982297	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20629459_20629460insA								OR4N5 (16639 upstream) : OR11G2 (36035 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20686932	20686932	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20686932delA								OR11G2 (20402 upstream) : OR11H6 (4937 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	24969351	24969356	+	Intron	DEL	TGTGTG	-	-	rs33920976		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24969351_24969356delTGTGTG	uc001wpo.1	+											Homo sapiens cDNA FLJ31806 fis, clone NT2RI2009151.																														---	---	---	---
STXBP6	29091	broad.mit.edu	37	14	25497714	25497714	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25497714delA	uc001wpu.2	-						STXBP6_uc001wpv.2_Intron|STXBP6_uc001wpw.2_Intron|STXBP6_uc001wpx.1_Intron	NM_014178	NP_054897			amisyn						vesicle-mediated transport	cytoplasm|integral to membrane					0				GBM - Glioblastoma multiforme(265;0.0296)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	25524800	25524800	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25524800delA								STXBP6 (5629 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	25983695	25983696	+	IGR	INS	-	G	G	rs147519825	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25983695_25983696insG								STXBP6 (464524 upstream) : NOVA1 (931394 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	27919212	27919213	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27919212_27919213delTG	uc010amc.1	-											Homo sapiens cDNA clone IMAGE:40107853.																														---	---	---	---
NUBPL	80224	broad.mit.edu	37	14	32211092	32211092	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32211092delT	uc001wrk.3	+						NUBPL_uc010amj.2_Intron|NUBPL_uc010tpl.1_Intron	NM_025152	NP_079428			nucleotide binding protein-like						mitochondrial respiratory chain complex I assembly|mitochondrion morphogenesis	mitochondrion	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding				0	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	33077706	33077706	+	Intron	DEL	A	-	-	rs140315942		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33077706delA	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	36899322	36899324	+	IGR	DEL	AGA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36899322_36899324delAGA								MBIP (109440 upstream) : SFTA3 (43172 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	39666629	39666629	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39666629delT								PNN (14208 upstream) : MIA2 (36496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	40101162	40101162	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40101162delT								FBXO33 (199458 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	42454162	42454163	+	IGR	INS	-	TG	TG	rs150943391	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42454162_42454163insTG								LRFN5 (80412 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44960107	44960107	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44960107delA								None (None upstream) : FSCB (13248 downstream)																																			---	---	---	---
FANCM	57697	broad.mit.edu	37	14	45610797	45610798	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45610797_45610798insT	uc001wwd.3	+						FANCM_uc001wwc.2_Intron|FANCM_uc010anf.2_Intron	NM_020937	NP_065988			Fanconi anemia, complementation group M						DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7													Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
MDGA2	161357	broad.mit.edu	37	14	47976134	47976134	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47976134delT	uc001wwj.3	-						MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970			MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6																		---	---	---	---
SOS2	6655	broad.mit.edu	37	14	50631349	50631350	+	Intron	INS	-	A	A	rs79971204		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50631349_50631350insA	uc001wxs.3	-						SOS2_uc010tql.1_Intron|SOS2_uc001wxt.2_Intron	NM_006939	NP_008870			son of sevenless homolog 2						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)																	---	---	---	---
KIAA0831	22863	broad.mit.edu	37	14	55839024	55839025	+	Intron	INS	-	C	C	rs141913903	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55839024_55839025insC	uc001xbx.1	-						FBXO34_uc001xbv.2_Intron|KIAA0831_uc001xbw.1_Intron	NM_014924	NP_055739			Barkor						autophagic vacuole assembly|positive regulation of autophagy	autophagic vacuole|endoplasmic reticulum|pre-autophagosomal structure membrane	protein binding				0																		---	---	---	---
C14orf101	54916	broad.mit.edu	37	14	57050709	57050712	+	Intron	DEL	TGTG	-	-	rs35393718		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57050709_57050712delTGTG	uc001xcm.2	+						C14orf101_uc001xcj.2_Intron|C14orf101_uc001xck.2_Intron|C14orf101_uc010aot.1_Intron|C14orf101_uc001xcl.1_Intron|C14orf101_uc001xcn.2_Intron|C14orf101_uc010trf.1_Intron	NM_017799	NP_060269			hypothetical protein LOC54916							integral to membrane				breast(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(311;0.226)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	58465522	58465523	+	IGR	INS	-	CTTC	CTTC	rs150352160	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58465522_58465523insCTTC								SLC35F4 (401907 upstream) : C14orf37 (5286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	59260394	59260395	+	IGR	DEL	CA	-	-	rs149391748	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59260394_59260395delCA								DACT1 (145358 upstream) : DAAM1 (395004 downstream)																																			---	---	---	---
DAAM1	23002	broad.mit.edu	37	14	59728771	59728772	+	Intron	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59728771_59728772delTT	uc001xdz.1	+						DAAM1_uc001xea.1_Intron|DAAM1_uc001xeb.1_Intron|DAAM1_uc001xdy.2_Intron	NM_014992	NP_055807			dishevelled-associated activator of						actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	60885548	60885548	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60885548delG								PPM1A (119745 upstream) : C14orf39 (17127 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	62087927	62087930	+	Intron	DEL	TGTG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62087927_62087930delTGTG	uc001xfp.2	+											Homo sapiens cDNA: FLJ22447 fis, clone HRC09479.																														---	---	---	---
PPP2R5E	5529	broad.mit.edu	37	14	63960209	63960210	+	Intron	INS	-	GTGC	GTGC			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63960209_63960210insGTGC	uc001xgd.1	-						PPP2R5E_uc010tsf.1_Intron|PPP2R5E_uc010tsg.1_Intron|PPP2R5E_uc001xge.2_Intron|PPP2R5E_uc010tsh.1_Intron|PPP2R5E_uc001xgf.1_Intron|PPP2R5E_uc001xgg.3_Intron	NM_006246	NP_006237			epsilon isoform of regulatory subunit B56,						signal transduction	cytoplasm|intracellular membrane-bounded organelle|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)														---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64664514	64664515	+	Intron	INS	-	G	G	rs140764690	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64664514_64664515insG	uc001xgm.2	+						SYNE2_uc001xgl.2_Intron|SYNE2_uc010apy.2_Intron|SYNE2_uc001xgn.2_Intron|SYNE2_uc001xgo.2_Intron|SYNE2_uc010aqa.2_Intron|SYNE2_uc001xgq.2_Intron	NM_015180	NP_055995			spectrin repeat containing, nuclear envelope 2						centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	66544159	66544160	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66544159_66544160insA								FUT8 (334198 upstream) : C14orf53 (408949 downstream)																																			---	---	---	---
EIF2S1	1965	broad.mit.edu	37	14	67840560	67840561	+	Intron	DEL	GT	-	-	rs145264950		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67840560_67840561delGT	uc001xjg.2	+							NM_004094	NP_004085			eukaryotic translation initiation factor 2,							cytosol|eukaryotic translation initiation factor 2 complex|polysome|stress granule	protein binding|ribosome binding|translation initiation factor activity			ovary(1)	1				all cancers(60;0.000683)|OV - Ovarian serous cystadenocarcinoma(108;0.00579)|BRCA - Breast invasive adenocarcinoma(234;0.00937)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	69827077	69827077	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69827077delA								GALNTL1 (5894 upstream) : ERH (19763 downstream)																																			---	---	---	---
SFRS5	6430	broad.mit.edu	37	14	70213321	70213321	+	Intron	DEL	T	-	-	rs75911845		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70213321delT	uc001xll.2	+							NM_006925	NP_008856			splicing factor, arginine/serine-rich 5						mRNA 3'-end processing|mRNA export from nucleus|mRNA splice site selection|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding				0				all cancers(60;0.00144)|BRCA - Breast invasive adenocarcinoma(234;0.0132)|OV - Ovarian serous cystadenocarcinoma(108;0.0154)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	71675208	71675209	+	IGR	INS	-	A	A	rs142662295	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71675208_71675209insA								PCNX (93109 upstream) : SNORD56B (189845 downstream)																																			---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72920509	72920509	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72920509delG	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron|RGS6_uc010ttp.1_Intron|RGS6_uc010arg.2_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
NUMB	8650	broad.mit.edu	37	14	73863030	73863031	+	Intron	DEL	GT	-	-	rs112167260		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73863030_73863031delGT	uc001xny.1	-						NUMB_uc001xoa.1_Intron|NUMB_uc001xnz.1_Intron|NUMB_uc001xob.1_Intron|NUMB_uc001xod.1_Intron|NUMB_uc001xoc.1_Intron|NUMB_uc010ars.1_Intron|NUMB_uc001xof.1_Intron|NUMB_uc001xog.2_Intron|NUMB_uc001xoh.1_Intron	NM_001005743	NP_001005743			numb homolog isoform 1						axon guidance|lateral ventricle development|neuroblast division in subventricular zone|positive regulation of neurogenesis	integral to plasma membrane				ovary(2)|central_nervous_system(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	74311608	74311609	+	IGR	DEL	TT	-	-	rs139167178		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74311608_74311609delTT								C14orf43 (57712 upstream) : PTGR2 (6925 downstream)																																			---	---	---	---
ZNF410	57862	broad.mit.edu	37	14	74368636	74368637	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74368636_74368637insA	uc001xoz.1	+						ZNF410_uc001xoy.1_Intron|ZNF410_uc010ary.1_Intron|ZNF410_uc010tuf.1_Intron|ZNF410_uc010tug.1_Intron|ZNF410_uc010tuh.1_Intron|ZNF410_uc010tui.1_Intron|ZNF410_uc010arz.1_Intron|ZNF410_uc001xpa.1_Intron|ZNF410_uc001xpb.1_Intron|ZNF410_uc001xpc.1_Intron|ZNF410_uc010tuj.1_Intron	NM_021188	NP_067011			zinc finger protein 410						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00369)														---	---	---	---
LTBP2	4053	broad.mit.edu	37	14	75016014	75016017	+	Intron	DEL	TGAA	-	-	rs66477145		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75016014_75016017delTGAA	uc001xqa.2	-							NM_000428	NP_000419			latent transforming growth factor beta binding						protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)														---	---	---	---
ALKBH1	8846	broad.mit.edu	37	14	78146571	78146572	+	Intron	INS	-	C	C	rs140024209	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78146571_78146572insC	uc001xuc.1	-						ALKBH1_uc001xud.1_Intron	NM_006020	NP_006011			alkylated DNA repair protein alkB homolog						DNA dealkylation involved in DNA repair|DNA demethylation|oxidative demethylation|RNA repair	mitochondrion	DNA-(apurinic or apyrimidinic site) lyase activity|ferrous iron binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			ovary(1)|skin(1)	2			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	78453572	78453572	+	IGR	DEL	T	-	-	rs34840832		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78453572delT								ADCK1 (53276 upstream) : NRXN3 (183356 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	80701442	80701442	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80701442delC	uc001xuw.1	+											Homo sapiens, clone IMAGE:5167652, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	82648877	82648878	+	IGR	INS	-	A	A	rs143922412	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82648877_82648878insA								SEL1L (648672 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84459654	84459654	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84459654delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	88491794	88491795	+	RNA	INS	-	A	A	rs149742091	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88491794_88491795insA	uc001xvw.2	+	2		c.164_165insA								Homo sapiens cDNA clone IMAGE:4734409.																														---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89681692	89681692	+	Intron	DEL	T	-	-	rs34110877		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89681692delT	uc001xxo.3	-						FOXN3_uc001xxn.3_Intron|FOXN3_uc010atk.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
KCNK13	56659	broad.mit.edu	37	14	90587260	90587261	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90587260_90587261insT	uc001xye.1	+							NM_022054	NP_071337			potassium channel, subfamily K, member 13							integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(1)	1		all_cancers(154;0.186)																---	---	---	---
TTC7B	145567	broad.mit.edu	37	14	91147832	91147833	+	Intron	INS	-	A	A	rs35635095		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91147832_91147833insA	uc001xyp.2	-						TTC7B_uc010ats.2_Intron	NM_001010854	NP_001010854			tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	91328800	91328802	+	IGR	DEL	CTT	-	-	rs80353457		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91328800_91328802delCTT								TTC7B (46039 upstream) : RPS6KA5 (8365 downstream)																																			---	---	---	---
CATSPERB	79820	broad.mit.edu	37	14	92131400	92131401	+	Intron	INS	-	T	T	rs145367061	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92131400_92131401insT	uc001xzs.1	-						CATSPERB_uc010aub.1_Intron	NM_024764	NP_079040			cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)																---	---	---	---
TC2N	123036	broad.mit.edu	37	14	92308321	92308322	+	Intron	DEL	TT	-	-	rs141430957		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92308321_92308322delTT	uc001xzv.3	-							NM_001128596	NP_001122068			tandem C2 domains, nuclear							nucleus				upper_aerodigestive_tract(1)	1				COAD - Colon adenocarcinoma(157;0.218)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	92522466	92522468	+	IGR	DEL	CCT	-	-	rs10554546		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92522466_92522468delCCT								TRIP11 (15649 upstream) : ATXN3 (2429 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	92645659	92645667	+	IGR	DEL	GGGGAGGAG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92645659_92645667delGGGGAGGAG								CPSF2 (15116 upstream) : SLC24A4 (143258 downstream)																																			---	---	---	---
SLC24A4	123041	broad.mit.edu	37	14	92895704	92895720	+	Intron	DEL	GTATGTGAGATAGATAA	-	-	rs68039058		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92895704_92895720delGTATGTGAGATAGATAA	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron	NM_153646	NP_705932			solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)														---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	94080982	94080982	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94080982delA	uc001ybv.1	+						KIAA1409_uc001ybs.1_Intron	NM_020818	NP_065869			hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	95533122	95533124	+	IGR	DEL	CAC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95533122_95533124delCAC								GSC (296623 upstream) : DICER1 (19441 downstream)																																			---	---	---	---
C14orf139	79686	broad.mit.edu	37	14	95874113	95874114	+	3'UTR	INS	-	AC	AC	rs143327133	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95874113_95874114insAC	uc001yeh.3	-	1						NR_026779				RecName: Full=Uncharacterized protein C14orf139;												0																		---	---	---	---
C14orf49	161176	broad.mit.edu	37	14	95897162	95897163	+	Intron	INS	-	A	A	rs35170615		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95897162_95897163insA	uc001yei.3	-						C14orf49_uc010avi.2_Intron	NM_152592	NP_689805			nesprin-3						cytoskeletal anchoring at nuclear membrane	integral to membrane|nuclear outer membrane|SUN-KASH complex	actin binding			central_nervous_system(1)	1		all_cancers(154;0.0937)		COAD - Colon adenocarcinoma(157;0.245)														---	---	---	---
BDKRB1	623	broad.mit.edu	37	14	96726362	96726363	+	Intron	INS	-	TT	TT	rs142823176		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96726362_96726363insTT	uc001yfh.2	+						BDKRB1_uc010avn.2_Intron	NM_000710	NP_000701			bradykinin receptor B1						elevation of cytosolic calcium ion concentration	endoplasmic reticulum|integral to plasma membrane	bradykinin receptor activity			ovary(3)	3		all_cancers(154;0.0677)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.208)|Epithelial(152;0.226)														---	---	---	---
AK7	122481	broad.mit.edu	37	14	96865313	96865314	+	Intron	INS	-	T	T	rs3832934		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96865313_96865314insT	uc001yfn.2	+						AK7_uc001yfm.1_3'UTR	NM_152327	NP_689540			adenylate kinase 7						cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	97396704	97396705	+	IGR	INS	-	T	T	rs33933335		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97396704_97396705insT								VRK1 (48754 upstream) : C14orf64 (995242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	97739044	97739045	+	IGR	DEL	TC	-	-	rs34072359		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97739044_97739045delTC								VRK1 (391094 upstream) : C14orf64 (652902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99030248	99030249	+	IGR	INS	-	AC	AC	rs141876141	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99030248_99030249insAC								C14orf64 (585787 upstream) : C14orf177 (147701 downstream)																																			---	---	---	---
EVL	51466	broad.mit.edu	37	14	100591895	100591896	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100591895_100591896insT	uc001ygt.2	+						EVL_uc001ygv.2_Intron|EVL_uc001ygu.2_Intron|EVL_uc010avu.2_Intron	NM_016337	NP_057421			Enah/Vasp-like						actin polymerization or depolymerization|axon guidance|cell surface receptor linked signaling pathway|organ morphogenesis	cytoskeleton|cytosol|focal adhesion|lamellipodium	actin binding|profilin binding|SH3 domain binding			large_intestine(2)|ovary(1)	3		Melanoma(154;0.152)																---	---	---	---
RCOR1	23186	broad.mit.edu	37	14	103091111	103091111	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103091111delA	uc001ymb.2	+							NM_015156	NP_055971			REST corepressor 1						blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding			ovary(1)	1																		---	---	---	---
KIAA0125	9834	broad.mit.edu	37	14	106375882	106375883	+	Intron	INS	-	C	C	rs34101324		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106375882_106375883insC	uc001ysq.2	+						ADAM6_uc010tyt.1_Intron|KIAA0125_uc001ysr.2_Intron|KIAA0125_uc001yss.2_Intron					SubName: Full=HCG2029388, isoform CRA_d; SubName: Full=FAM30A protein;												0																		---	---	---	---
KIAA0125	9834	broad.mit.edu	37	14	106385208	106385217	+	Intron	DEL	TTCAGTGGGG	-	-	rs71406526		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106385208_106385217delTTCAGTGGGG	uc001ysq.2	+						ADAM6_uc010tyt.1_Intron|KIAA0125_uc001ysr.2_Intron|KIAA0125_uc001yss.2_Intron|KIAA0125_uc001yst.2_Intron					SubName: Full=HCG2029388, isoform CRA_d; SubName: Full=FAM30A protein;												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106785241	106785241	+	Intron	DEL	A	-	-	rs10715730		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106785241delA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106802196	106802197	+	Intron	INS	-	A	A	rs138774888	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106802196_106802197insA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106824992	106824993	+	Intron	INS	-	CT	CT	rs147931546	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106824992_106824993insCT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20015312	20015312	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20015312delG								None (None upstream) : GOLGA6L6 (721782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20061212	20061213	+	IGR	DEL	AT	-	-	rs148605021		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20061212_20061213delAT								None (None upstream) : GOLGA6L6 (675881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20104531	20104531	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20104531delG								None (None upstream) : GOLGA6L6 (632563 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20138520	20138521	+	IGR	INS	-	AGG	AGG			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20138520_20138521insAGG								None (None upstream) : GOLGA6L6 (598573 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	23232199	23232199	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23232199delC								WHAMML1 (23842 upstream) : GOLGA9P (23043 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	24167287	24167298	+	IGR	DEL	CTTTTTTCTTTT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24167287_24167298delCTTTTTTCTTTT								NDN (234837 upstream) : PWRN2 (242628 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	24310294	24310296	+	IGR	DEL	ACA	-	-	rs36051359		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24310294_24310296delACA								NDN (377844 upstream) : PWRN2 (99630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	25485848	25485848	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25485848delG	uc001zae.2	+						SNORD115-39_uc001zah.1_5'Flank|SNORD115-40_uc001zai.1_5'Flank					Homo sapiens clone Rt-16 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																														---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27646994	27646995	+	Intron	INS	-	T	T	rs151156152	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27646994_27646995insT	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	28701620	28701621	+	IGR	INS	-	G	G	rs71287560		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28701620_28701621insG								GOLGA8G (64449 upstream) : WHAMML2 (281108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	30140373	30140373	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30140373delA								TJP1 (25667 upstream) : FAM7A3 (255562 downstream)																																			---	---	---	---
RYR3	6263	broad.mit.edu	37	15	34077788	34077788	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34077788delG	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
CHRM5	1133	broad.mit.edu	37	15	34332372	34332372	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34332372delA	uc001zhk.1	+						AVEN_uc001zhj.2_5'Flank|CHRM5_uc001zhl.1_Intron	NM_012125	NP_036257			cholinergic receptor, muscarinic 5						cell proliferation|inhibition of adenylate cyclase activity by muscarinic acetylcholine receptor signaling pathway	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)													---	---	---	---
LPCAT4	254531	broad.mit.edu	37	15	34656626	34656627	+	Intron	DEL	TC	-	-	rs60508631	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34656626_34656627delTC	uc001zig.2	-						LPCAT4_uc010bav.1_Intron	NM_153613	NP_705841			lysophosphatidylcholine acyltransferase 4						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|calcium ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	34863590	34863592	+	IGR	DEL	AAG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34863590_34863592delAAG								GOLGA8B (35368 upstream) : GJD2 (181087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	35353093	35353094	+	IGR	INS	-	T	T	rs141554525		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35353093_35353094insT								ZNF770 (72639 upstream) : LOC723972 (176433 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	40342842	40342843	+	Intron	INS	-	TGTG	TGTG	rs145298688	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40342842_40342843insTGTG	uc001zks.1	+											Homo sapiens cDNA FLJ45796 fis, clone NT2RI2012542.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	41474049	41474049	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41474049delT								INO80 (65709 upstream) : EXD1 (884 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	44712355	44712355	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44712355delT								CASC4 (4400 upstream) : CTDSPL2 (7224 downstream)																																			---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	48045204	48045204	+	Intron	DEL	A	-	-	rs35829736		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48045204delA	uc010bek.2	+						SEMA6D_uc001zvw.2_Intron|SEMA6D_uc001zvx.1_Intron|SEMA6D_uc001zvy.2_Intron|SEMA6D_uc001zvz.2_Intron|SEMA6D_uc001zwa.2_Intron|SEMA6D_uc001zwb.2_Intron|SEMA6D_uc001zwc.2_Intron	NM_153618	NP_705871			semaphorin 6D isoform 4 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
C15orf33	196951	broad.mit.edu	37	15	49799924	49799925	+	Intron	INS	-	AA	AA			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49799924_49799925insAA	uc001zxl.2	-						C15orf33_uc001zxm.2_Intron	NM_152647	NP_689860			hypothetical protein LOC196951											ovary(1)	1		all_lung(180;0.00187)		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)														---	---	---	---
HDC	3067	broad.mit.edu	37	15	50551358	50551359	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50551358_50551359insA	uc001zxz.2	-						HDC_uc010uff.1_Intron|HDC_uc010bet.1_Intron|HDC_uc010beu.1_Intron	NM_002112	NP_002103			histidine decarboxylase						catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)													---	---	---	---
USP50	373509	broad.mit.edu	37	15	50805919	50805920	+	Intron	INS	-	C	C	rs150814184	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50805919_50805920insC	uc001zyq.3	-							NM_203494	NP_987090			ubiquitin specific protease 50						ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			lung(1)|breast(1)	2				all cancers(107;0.000519)|GBM - Glioblastoma multiforme(94;0.00288)														---	---	---	---
SPPL2A	84888	broad.mit.edu	37	15	51046002	51046003	+	Intron	INS	-	T	T	rs28626383		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51046002_51046003insT	uc001zyv.2	-							NM_032802	NP_116191			signal peptide peptidase-like 2A							integral to membrane	aspartic-type endopeptidase activity				0				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	55305986	55305987	+	IGR	INS	-	TCTC	TCTC	rs150626838	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55305986_55305987insTCTC								UNC13C (385181 upstream) : RSL24D1 (167534 downstream)																																			---	---	---	---
ZNF280D	54816	broad.mit.edu	37	15	56989388	56989389	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56989388_56989389insT	uc002adu.2	-						ZNF280D_uc002adv.2_Intron|ZNF280D_uc010bfq.2_Intron|ZNF280D_uc002adw.1_Intron|ZNF280D_uc010bfr.1_Intron	NM_017661	NP_060131			suppressor of hairy wing homolog 4 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	61817798	61817798	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61817798delT								RORA (296296 upstream) : VPS13C (326794 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	65124561	65124561	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65124561delT								PIF1 (6723 upstream) : PLEKHO2 (9521 downstream)																																			---	---	---	---
CALML4	91860	broad.mit.edu	37	15	68495440	68495440	+	Intron	DEL	A	-	-	rs111702159		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68495440delA	uc002arb.2	-						CALML4_uc002arc.2_Intron|CALML4_uc002ard.2_Intron|CALML4_uc002are.2_Intron|CALML4_uc010bhz.2_Intron	NM_033429	NP_219501			calmodulin-like 4 isoform 1								calcium ion binding				0																		---	---	---	---
LRRC49	54839	broad.mit.edu	37	15	71222759	71222761	+	Intron	DEL	TTG	-	-	rs34264733		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71222759_71222761delTTG	uc002asw.2	+						LRRC49_uc002asu.2_Intron|LRRC49_uc002asx.2_Intron|LRRC49_uc010ukf.1_Intron|LRRC49_uc002asy.2_Intron|LRRC49_uc002asz.2_Intron	NM_017691	NP_060161			leucine rich repeat containing 49							cytoplasm|microtubule				ovary(1)	1																		---	---	---	---
HCN4	10021	broad.mit.edu	37	15	73642550	73642550	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73642550delT	uc002avp.2	-							NM_005477	NP_005468			hyperpolarization activated cyclic						blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)														---	---	---	---
UBL7	84993	broad.mit.edu	37	15	74739352	74739353	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74739352_74739353insA	uc002axw.1	-						UBL7_uc002axx.1_Intron|UBL7_uc010bjr.1_Intron|UBL7_uc002axy.1_Intron|UBL7_uc002axz.1_Intron	NM_032907	NP_116296			ubiquitin-like 7								protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	75070579	75070580	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75070579_75070580insT								CYP1A2 (21638 upstream) : CSK (3845 downstream)																																			---	---	---	---
LINGO1	84894	broad.mit.edu	37	15	77962907	77962907	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77962907delT	uc002bcu.1	-							NM_032808	NP_116197			leucine-rich repeat neuronal 6A						negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)|lung(1)	2																		---	---	---	---
RASGRF1	5923	broad.mit.edu	37	15	79285714	79285715	+	Intron	INS	-	GT	GT	rs144031196	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79285714_79285715insGT	uc002beq.2	-						RASGRF1_uc002bep.2_Intron|RASGRF1_uc010blm.1_Intron|RASGRF1_uc002ber.3_Intron|RASGRF1_uc010unh.1_Intron|RASGRF1_uc002beo.2_Intron	NM_002891	NP_002882			Ras protein-specific guanine						activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	79456059	79456060	+	IGR	DEL	TC	-	-	rs10592832		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79456059_79456060delTC								RASGRF1 (72844 upstream) : MIR184 (46070 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	80919315	80919316	+	IGR	INS	-	CCTT	CCTT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80919315_80919316insCCTT								ARNT2 (29043 upstream) : FAM108C1 (68336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	80937815	80937816	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80937815_80937816insA								ARNT2 (47543 upstream) : FAM108C1 (49836 downstream)																																			---	---	---	---
SH3GL3	6457	broad.mit.edu	37	15	84196906	84196906	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84196906delT	uc002bjw.2	+						SH3GL3_uc010bms.2_Intron|SH3GL3_uc010uot.1_Intron|SH3GL3_uc002bjx.2_Intron|SH3GL3_uc002bju.2_Intron|SH3GL3_uc002bjv.2_Intron	NM_003027	NP_003018			SH3-domain GRB2-like 3						central nervous system development|endocytosis|signal transduction	early endosome membrane	identical protein binding|lipid binding			pancreas(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86277374	86277374	+	Intron	DEL	A	-	-	rs66493267		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86277374delA	uc002blv.1	+						AKAP13_uc002blu.1_Intron|AKAP13_uc002blw.1_Intron|AKAP13_uc002blx.1_Intron	NM_007200	NP_009131			A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
KIF7	374654	broad.mit.edu	37	15	90193630	90193631	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90193630_90193631insT	uc002bof.2	-						KIF7_uc010upw.1_5'Flank|KIF7_uc002bog.2_Intron	NM_198525	NP_940927			kinesin family member 7						microtubule-based movement|negative regulation of smoothened signaling pathway|positive regulation of smoothened signaling pathway	cilium	ATP binding|microtubule motor activity|protein binding			ovary(2)|lung(1)	3	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)															---	---	---	---
KIF7	374654	broad.mit.edu	37	15	90199591	90199592	+	5'Flank	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90199591_90199592delTT	uc002bof.2	-						KIF7_uc002bog.2_5'Flank	NM_198525	NP_940927			kinesin family member 7						microtubule-based movement|negative regulation of smoothened signaling pathway|positive regulation of smoothened signaling pathway	cilium	ATP binding|microtubule motor activity|protein binding			ovary(2)|lung(1)	3	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	90298155	90298156	+	IGR	INS	-	C	C	rs148662551	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90298155_90298156insC								MESP1 (3615 upstream) : MESP2 (5666 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	90493602	90493602	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90493602delC								AP3S2 (37380 upstream) : ZNF710 (51150 downstream)																																			---	---	---	---
FURIN	5045	broad.mit.edu	37	15	91409410	91409422	+	5'Flank	DEL	TATAACTCATCGC	-	-	rs113917967		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91409410_91409422delTATAACTCATCGC	uc002bpu.1	+							NM_002569	NP_002560			furin preproprotein						cell proliferation|negative regulation of low-density lipoprotein particle receptor catabolic process|negative regulation of transforming growth factor-beta1 production|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|Notch signaling pathway|peptide biosynthetic process|peptidyl-glutamic acid carboxylation|post-translational protein modification|secretion by cell|signal peptide processing|transforming growth factor beta receptor signaling pathway|viral assembly, maturation, egress, and release	cell surface|Golgi lumen|Golgi membrane|integral to membrane|membrane raft|plasma membrane|trans-Golgi network|trans-Golgi network transport vesicle	metal ion binding|nerve growth factor binding|peptide binding|protease binding|serine-type endopeptidase activity|serine-type endopeptidase inhibitor activity			central_nervous_system(4)|lung(2)|breast(1)	7	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)															---	---	---	---
FES	2242	broad.mit.edu	37	15	91429197	91429198	+	Intron	DEL	CA	-	-	rs151102841		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91429197_91429198delCA	uc002bpv.2	+						FES_uc010uqj.1_Intron|FES_uc010uqk.1_Intron|FES_uc002bpw.2_Intron|FES_uc010bny.2_Intron|FES_uc002bpx.2_Intron|FES_uc002bpy.2_Intron	NM_002005	NP_001996			feline sarcoma oncogene isoform 1						axon guidance|cell proliferation|peptidyl-tyrosine phosphorylation	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)													OREG0023474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	15	91861655	91861655	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91861655delC								SV2B (23007 upstream) : SLCO3A1 (535283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	93786641	93786642	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93786641_93786642delTG								RGMA (154208 upstream) : MCTP2 (988159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	93959131	93959140	+	Intron	DEL	TAGAGGAAGA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93959131_93959140delTAGAGGAAGA	uc002bsu.1	+						uc002bsw.1_5'Flank|uc010urd.1_5'Flank|uc002bsx.1_5'Flank|uc002bsy.2_5'Flank					Homo sapiens cDNA FLJ37033 fis, clone BRACE2011389.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	94647422	94647423	+	IGR	INS	-	TGTG	TGTG			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94647422_94647423insTGTG								None (None upstream) : MCTP2 (127378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96339168	96339169	+	IGR	INS	-	AC	AC	rs58549413		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96339168_96339169insAC								LOC145820 (288094 upstream) : NR2F2 (529988 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96736319	96736320	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96736319_96736320insT								LOC145820 (685245 upstream) : NR2F2 (132837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96900880	96900880	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96900880delT								NR2F2 (17390 upstream) : SPATA8 (425799 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	96952497	96952497	+	IGR	DEL	C	-	-	rs34014993		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96952497delC								NR2F2 (69007 upstream) : SPATA8 (374182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97591769	97591772	+	IGR	DEL	TTTG	-	-	rs72049194		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97591769_97591772delTTTG								SPATA8 (262925 upstream) : LOC91948 (694074 downstream)																																			---	---	---	---
ADAMTS17	170691	broad.mit.edu	37	15	100869732	100869732	+	Intron	DEL	A	-	-	rs35680287		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100869732delA	uc002bvv.1	-						ADAMTS17_uc002bvx.1_Intron	NM_139057	NP_620688			ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)														---	---	---	---
LRRK1	79705	broad.mit.edu	37	15	101568328	101568328	+	Intron	DEL	A	-	-	rs34415456		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101568328delA	uc002bwr.2	+						LRRK1_uc010usb.1_Intron|LRRK1_uc010usc.1_Intron	NM_024652	NP_078928			leucine-rich repeat kinase 1						small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	102382786	102382787	+	IGR	INS	-	TG	TG	rs145296118	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102382786_102382787insTG								OR4F15 (23460 upstream) : OR4F4 (79558 downstream)																																			---	---	---	---
LUC7L	55692	broad.mit.edu	37	16	265622	265623	+	Intron	INS	-	A	A	rs76727487		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:265622_265623insA	uc002cgc.1	-						LUC7L_uc002cga.1_Intron|LUC7L_uc002cgd.1_Intron|LUC7L_uc002cge.1_Intron	NM_201412	NP_958815			LUC7-like isoform b								metal ion binding			central_nervous_system(1)	1		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	868852	868853	+	IGR	INS	-	TG	TG	rs149509187		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:868852_868853insTG								PRR25 (4992 upstream) : LMF1 (34782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	1314475	1314476	+	IGR	DEL	TA	-	-	rs3085828		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1314475_1314476delTA								TPSD1 (5981 upstream) : UBE2I (44704 downstream)																																			---	---	---	---
BAIAP3	8938	broad.mit.edu	37	16	1385463	1385464	+	Intron	INS	-	G	G	rs147345623	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1385463_1385464insG	uc002clk.1	+						BAIAP3_uc002clj.2_Intron|BAIAP3_uc010uuz.1_Intron|BAIAP3_uc010uva.1_Intron|BAIAP3_uc010uvb.1_Intron|BAIAP3_uc010uvc.1_5'Flank	NM_003933	NP_003924			BAI1-associated protein 3						G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)																---	---	---	---
CLCN7	1186	broad.mit.edu	37	16	1513136	1513137	+	Intron	DEL	AG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1513136_1513137delAG	uc002clv.2	-						CLCN7_uc002clw.2_Intron	NM_001287	NP_001278			chloride channel 7 isoform a							integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	4508225	4508226	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4508225_4508226insA								DNAJA3 (1452 upstream) : NMRAL1 (3470 downstream)																																			---	---	---	---
MGRN1	23295	broad.mit.edu	37	16	4718140	4718140	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4718140delC	uc002cwz.2	+						MGRN1_uc002cxa.2_Intron|MGRN1_uc010btx.2_Intron|MGRN1_uc010btw.2_Intron|MGRN1_uc002cxb.2_Intron|MGRN1_uc010uxo.1_Intron|MGRN1_uc010uxp.1_Intron|MGRN1_uc010uxq.1_Intron	NM_001142290	NP_001135762			mahogunin, ring finger 1 isoform 3						endosome to lysosome transport|negative regulation of cAMP-mediated signaling|negative regulation of G-protein coupled receptor protein signaling pathway|protein monoubiquitination	cytosol|early endosome|nucleus|plasma membrane|plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	5248355	5248356	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5248355_5248356insA								FAM86A (100566 upstream) : A2BP1 (820776 downstream)																																			---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7591664	7591664	+	Intron	DEL	C	-	-	rs1507028	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7591664delC	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	10393116	10393116	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10393116delT								GRIN2A (116505 upstream) : ATF7IP2 (86796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	10953453	10953470	+	IGR	DEL	ATGGTGGTGGTGACGATA	-	-	rs144978460	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10953453_10953470delATGGTGGTGGTGACGATA								FAM18A (40832 upstream) : CIITA (17585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	11569814	11569815	+	Intron	INS	-	CGG	CGG			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11569814_11569815insCGG	uc002dax.1	-											Homo sapiens cDNA FLJ44575 fis, clone UTERU3018154.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	11584978	11584978	+	Intron	DEL	A	-	-	rs79622886		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11584978delA	uc002dax.1	-											Homo sapiens cDNA FLJ44575 fis, clone UTERU3018154.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	14096242	14096242	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14096242delA								ERCC4 (50037 upstream) : MKL2 (68954 downstream)																																			---	---	---	---
PLA2G10	8399	broad.mit.edu	37	16	14773959	14773960	+	Intron	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14773959_14773960delTT	uc002dcq.2	-							NM_003561	NP_003552			phospholipase A2, group X precursor						arachidonic acid metabolic process|axon guidance|cholesterol homeostasis|lipid catabolic process|lysophospholipid transport|negative regulation of cholesterol efflux|negative regulation of sequence-specific DNA binding transcription factor activity|phospholipid metabolic process|positive regulation of arachidonic acid secretion|positive regulation of cellular protein metabolic process|positive regulation of lipid storage|positive regulation of prostaglandin secretion|regulation of macrophage activation	extracellular region	calcium ion binding|phospholipase A2 activity				0																		---	---	---	---
C16orf45	89927	broad.mit.edu	37	16	15671859	15671859	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15671859delT	uc002ddo.2	+						C16orf45_uc002ddp.2_Intron	NM_033201	NP_149978			hypothetical protein LOC89927 isoform 1											ovary(1)	1																		---	---	---	---
ABCC1	4363	broad.mit.edu	37	16	16077409	16077410	+	Intron	INS	-	TTT	TTT	rs11416710		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16077409_16077410insTTT	uc010bvi.2	+						ABCC1_uc010bvj.2_Intron|ABCC1_uc010bvk.2_Intron|ABCC1_uc010bvl.2_Intron|ABCC1_uc010bvm.2_Intron	NM_004996	NP_004987			ATP-binding cassette, sub-family C, member 1						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	17729769	17729770	+	IGR	DEL	AG	-	-	rs36098032		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17729769_17729770delAG								XYLT1 (165031 upstream) : NOMO2 (781413 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	19115599	19115600	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19115599_19115600delTG								COQ7 (24249 upstream) : ITPRIPL2 (9654 downstream)																																			---	---	---	---
GDE1	51573	broad.mit.edu	37	16	19522426	19522426	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19522426delT	uc002dgh.2	-						GDE1_uc002dgi.2_Intron	NM_016641	NP_057725			glycerophosphodiester phosphodiesterase 1						glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol glycerophosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
IQCK	124152	broad.mit.edu	37	16	19822842	19822842	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19822842delA	uc002dgr.2	+						IQCK_uc002dgs.2_Intron|IQCK_uc010vat.1_Intron|IQCK_uc010bwc.2_Intron|IQCK_uc010vau.1_Intron	NM_153208	NP_694940			IQ motif containing K											skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	20143313	20143313	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20143313delA								GPR139 (58213 upstream) : GP2 (178499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	20309885	20309886	+	IGR	INS	-	TCCA	TCCA	rs62032822		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20309885_20309886insTCCA								GPR139 (224785 upstream) : GP2 (11926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	22662051	22662052	+	IGR	INS	-	A	A	rs112918197		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22662051_22662052insA								LOC653786 (73865 upstream) : HS3ST2 (163808 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	23807914	23807915	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23807914_23807915insT								CHP2 (37658 upstream) : PRKCB (39385 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26525136	26525138	+	IGR	DEL	TGT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26525136_26525138delTGT								HS3ST4 (376128 upstream) : C16orf82 (553081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	26888569	26888569	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26888569delA								HS3ST4 (739561 upstream) : C16orf82 (189650 downstream)																																			---	---	---	---
GSG1L	146395	broad.mit.edu	37	16	28062830	28062831	+	Intron	INS	-	A	A	rs12928004	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28062830_28062831insA	uc002doz.2	-						GSG1L_uc010bya.1_Intron	NM_001109763	NP_001103233			GSG1-like isoform 1							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	28617930	28617931	+	Intron	INS	-	G	G	rs143299878	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28617930_28617931insG	uc010vct.1	-						SULT1A1_uc002dqi.2_Intron|SULT1A1_uc002dqj.2_Intron|SULT1A1_uc002dqk.2_Intron|SULT1A1_uc002dql.2_Intron|SULT1A1_uc002dqm.2_Intron|SULT1A1_uc002dqn.2_Intron|SULT1A1_uc002dqo.2_Intron|SULT1A1_uc002dqp.2_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	30446078	30446079	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30446078_30446079insA								DCTPP1 (4705 upstream) : SEPHS2 (8874 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32408376	32408377	+	IGR	INS	-	T	T	rs112712028		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32408376_32408377insT								HERC2P4 (244502 upstream) : TP53TG3B (276464 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32468054	32468055	+	IGR	INS	-	T	T	rs144763151		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32468054_32468055insT								HERC2P4 (304180 upstream) : TP53TG3B (216786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32471773	32471774	+	IGR	INS	-	A	A	rs149995933	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32471773_32471774insA								HERC2P4 (307899 upstream) : TP53TG3B (213067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32472561	32472561	+	IGR	DEL	G	-	-	rs111755090		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32472561delG								HERC2P4 (308687 upstream) : TP53TG3B (212280 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32536024	32536024	+	IGR	DEL	A	-	-	rs76063307		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32536024delA								HERC2P4 (372150 upstream) : TP53TG3B (148817 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32545108	32545109	+	IGR	INS	-	C	C	rs150722905	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32545108_32545109insC								HERC2P4 (381234 upstream) : TP53TG3B (139732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32637517	32637517	+	IGR	DEL	G	-	-	rs138054619		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32637517delG								HERC2P4 (473643 upstream) : TP53TG3B (47324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32856215	32856215	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32856215delT								TP53TG3B (167337 upstream) : SLC6A10P (32582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33060395	33060395	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33060395delA								SLC6A10P (163932 upstream) : MIR1826 (905113 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33368402	33368403	+	IGR	INS	-	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33368402_33368403insG								SLC6A10P (471939 upstream) : MIR1826 (597105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33394431	33394432	+	IGR	INS	-	T	T	rs149259965		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33394431_33394432insT								SLC6A10P (497968 upstream) : MIR1826 (571076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33739067	33739070	+	IGR	DEL	GGCA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33739067_33739070delGGCA								SLC6A10P (842604 upstream) : MIR1826 (226438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33763037	33763037	+	IGR	DEL	C	-	-	rs113972262		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33763037delC								SLC6A10P (866574 upstream) : MIR1826 (202471 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33946421	33946422	+	IGR	INS	-	A	A	rs112464617		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33946421_33946422insA								None (None upstream) : MIR1826 (19086 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33951847	33951847	+	IGR	DEL	T	-	-	rs78456927	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33951847delT								None (None upstream) : MIR1826 (13661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33960256	33960256	+	IGR	DEL	T	-	-	rs113045910		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33960256delT								None (None upstream) : MIR1826 (5252 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34183942	34183942	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34183942delT								MIR1826 (218350 upstream) : UBE2MP1 (219860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34195874	34195876	+	IGR	DEL	AAT	-	-	rs149318354		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34195874_34195876delAAT								MIR1826 (230282 upstream) : UBE2MP1 (207926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46432059	46432062	+	IGR	DEL	TGAA	-	-	rs143698487		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46432059_46432062delTGAA								None (None upstream) : ANKRD26P1 (71187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46444744	46444744	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46444744delC								None (None upstream) : ANKRD26P1 (58505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	47824253	47824254	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47824253_47824254insT								PHKB (88820 upstream) : ABCC12 (292630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	49115894	49115894	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49115894delC								N4BP1 (471774 upstream) : CBLN1 (196317 downstream)																																			---	---	---	---
ZNF423	23090	broad.mit.edu	37	16	49525454	49525456	+	Intron	DEL	TTT	-	-	rs67625918		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49525454_49525456delTTT	uc002efs.2	-						ZNF423_uc010vgn.1_Intron	NM_015069	NP_055884			zinc finger protein 423						cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)																---	---	---	---
ZNF423	23090	broad.mit.edu	37	16	49625750	49625751	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49625750_49625751insA	uc002efs.2	-						ZNF423_uc010vgn.1_Intron	NM_015069	NP_055884			zinc finger protein 423						cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	50684485	50684485	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50684485delA								NKD1 (15844 upstream) : SNX20 (15726 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51864377	51864379	+	IGR	DEL	TCC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51864377_51864379delTCC								SALL1 (679194 upstream) : TOX3 (607539 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52788695	52788696	+	IGR	INS	-	ACAC	ACAC	rs151144449	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52788695_52788696insACAC								TOX3 (206981 upstream) : CHD9 (300249 downstream)																																			---	---	---	---
CCDC135	84229	broad.mit.edu	37	16	57763863	57763866	+	Intron	DEL	TGGA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57763863_57763866delTGGA	uc002emi.2	+						CCDC135_uc002emj.2_Intron|CCDC135_uc002emk.2_Intron	NM_032269	NP_115645			coiled-coil domain containing 135							cytoplasm				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	57907007	57907008	+	IGR	INS	-	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57907007_57907008insG								KIFC3 (10274 upstream) : CNGB1 (9236 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	61610136	61610137	+	IGR	DEL	TG	-	-	rs138137098		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61610136_61610137delTG								None (None upstream) : CDH8 (77098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	62485514	62485515	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62485514_62485515delTG								CDH8 (415478 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	63348514	63348514	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:63348514delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	64417207	64417208	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64417207_64417208delTG								None (None upstream) : CDH11 (563477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	64554424	64554424	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64554424delT								None (None upstream) : CDH11 (426261 downstream)																																			---	---	---	---
SNTB2	6645	broad.mit.edu	37	16	69338754	69338754	+	3'UTR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69338754delT	uc002ewu.2	+	7					SNTB2_uc010cfk.2_RNA	NM_006750	NP_006741			basic beta 2 syntrophin							cell junction|dystrophin-associated glycoprotein complex|membrane fraction|microtubule|transport vesicle membrane	actin binding|calmodulin binding|protein binding				0		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.208)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	69741492	69741492	+	IGR	DEL	C	-	-	rs11304478		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69741492delC								NFAT5 (2939 upstream) : NQO1 (1813 downstream)																																			---	---	---	---
HYDIN	54768	broad.mit.edu	37	16	71199646	71199646	+	Intron	DEL	A	-	-	rs57295348		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71199646delA	uc002ezr.2	-						HYDIN_uc010cfz.1_Intron|HYDIN_uc002ezv.2_Intron|HYDIN_uc010vmc.1_Intron|HYDIN_uc010vmd.1_Intron|HYDIN_uc002ezw.3_Intron	NM_032821	NP_116210			hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)																---	---	---	---
KIAA0174	9798	broad.mit.edu	37	16	71948018	71948019	+	Intron	INS	-	TTGT	TTGT	rs148747653	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71948018_71948019insTTGT	uc002fbj.1	+						KIAA0174_uc010cgh.1_Intron|KIAA0174_uc002fbk.1_Intron|KIAA0174_uc002fbm.1_Intron|KIAA0174_uc002fbl.1_Intron|KIAA0174_uc002fbn.1_Intron|KIAA0174_uc010cgi.1_5'Flank|KIAA0174_uc010cgj.1_5'Flank|KIAA0174_uc010vmk.1_Intron					SubName: Full=cDNA FLJ32696 fis, clone TESTI2000358; SubName: Full=cDNA FLJ77725;						cell cycle|cell division	cytoplasmic membrane-bounded vesicle|ER-Golgi intermediate compartment	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	73594142	73594143	+	IGR	INS	-	AGTTTATT	AGTTTATT	rs150816421	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73594142_73594143insAGTTTATT								HTA (466472 upstream) : PSMD7 (736538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	74165561	74165562	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74165561_74165562insA								None (None upstream) : PSMD7 (165119 downstream)																																			---	---	---	---
CLEC18B	497190	broad.mit.edu	37	16	74444233	74444234	+	Intron	INS	-	G	G	rs143495339	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74444233_74444234insG	uc002fct.2	-						CLEC18B_uc002fcu.2_Intron	NM_001011880	NP_001011880			C-type lectin domain family 18, member B							extracellular region	sugar binding				0																		---	---	---	---
CNTNAP4	85445	broad.mit.edu	37	16	76320072	76320073	+	Intron	DEL	GT	-	-	rs67773026		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76320072_76320073delGT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron	NM_033401	NP_207837			cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	77577132	77577132	+	IGR	DEL	A	-	-	rs112301346		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77577132delA								ADAMTS18 (108121 upstream) : NUDT7 (179279 downstream)																																			---	---	---	---
WWOX	51741	broad.mit.edu	37	16	79074172	79074173	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79074172_79074173insT	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457			WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	80937478	80937479	+	IGR	DEL	AC	-	-	rs10542405		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80937478_80937479delAC								CDYL2 (99303 upstream) : C16orf61 (72222 downstream)																																			---	---	---	---
C16orf46	123775	broad.mit.edu	37	16	81087883	81087883	+	Intron	DEL	C	-	-	rs62054595		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81087883delC	uc010chf.2	-							NM_001100873	NP_001094343			chromosome 16 open reading frame 46 isoform 1												0																		---	---	---	---
PKD1L2	114780	broad.mit.edu	37	16	81200160	81200163	+	Intron	DEL	GTGA	-	-	rs150289909		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81200160_81200163delGTGA	uc002fgh.1	-						PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124			polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
CMIP	80790	broad.mit.edu	37	16	81490779	81490780	+	Intron	INS	-	C	C	rs138067921	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81490779_81490780insC	uc002fgp.2	+							NM_198390	NP_938204			c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0																		---	---	---	---
CDH13	1012	broad.mit.edu	37	16	82826532	82826533	+	Intron	INS	-	G	G	rs144990054	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82826532_82826533insG	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
MBTPS1	8720	broad.mit.edu	37	16	84131442	84131443	+	Intron	INS	-	GT	GT	rs3082452		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84131442_84131443insGT	uc002fhi.2	-							NM_003791	NP_003782			membrane-bound transcription factor site-1						cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	85380212	85380213	+	IGR	INS	-	GATG	GATG	rs148008740	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85380212_85380213insGATG								FAM92B (234098 upstream) : KIAA0182 (264816 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85735989	85735991	+	IGR	DEL	CTT	-	-	rs75455471		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85735989_85735991delCTT								GINS2 (13401 upstream) : C16orf74 (5135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86103264	86103267	+	IGR	DEL	TGTC	-	-	rs150551535		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86103264_86103267delTGTC								IRF8 (147055 upstream) : LOC732275 (262189 downstream)																																			---	---	---	---
KLHDC4	54758	broad.mit.edu	37	16	87778455	87778456	+	Intron	INS	-	CA	CA	rs147708763	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87778455_87778456insCA	uc002fki.2	-						KLHDC4_uc010cht.1_Intron|KLHDC4_uc002fkj.2_Intron|KLHDC4_uc002fkk.2_Intron|KLHDC4_uc002fkl.2_Intron|KLHDC4_uc010chu.1_Intron	NM_017566	NP_060036			kelch domain containing 4											pancreas(2)	2				BRCA - Breast invasive adenocarcinoma(80;0.0283)														---	---	---	---
SLC7A5	8140	broad.mit.edu	37	16	87882837	87882837	+	Intron	DEL	G	-	-	rs34180161		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87882837delG	uc002fkm.2	-							NM_003486	NP_003477			solute carrier family 7 (cationic amino acid						blood coagulation|cell differentiation|cellular amino acid metabolic process|ion transport|leukocyte migration|nervous system development	apical plasma membrane|cytosol|integral to membrane	neutral amino acid transmembrane transporter activity|peptide antigen binding				0				BRCA - Breast invasive adenocarcinoma(80;0.049)														---	---	---	---
SMYD4	114826	broad.mit.edu	37	17	1693313	1693313	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1693313delG	uc002ftm.3	-						SMYD4_uc002ftn.1_Intron	NM_052928	NP_443160			SET and MYND domain containing 4								zinc ion binding			skin(3)|kidney(2)	5																		---	---	---	---
SMG6	23293	broad.mit.edu	37	17	2127217	2127217	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2127217delA	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045			Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4																		---	---	---	---
SGSM2	9905	broad.mit.edu	37	17	2243884	2243884	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2243884delT	uc002fun.3	+						SGSM2_uc002fum.3_Intron|SGSM2_uc010vqw.1_Intron	NM_001098509	NP_001091979			RUN and TBC1 domain containing 1 isoform 2							intracellular	Rab GTPase activator activity				0				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)														---	---	---	---
NLRP1	22861	broad.mit.edu	37	17	5463903	5463903	+	Intron	DEL	G	-	-	rs71151875		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5463903delG	uc002gci.2	-						NLRP1_uc002gcg.1_Intron|NLRP1_uc002gck.2_Intron|NLRP1_uc002gcj.2_Intron|NLRP1_uc002gcl.2_Intron|NLRP1_uc002gch.3_Intron|NLRP1_uc010clh.2_Intron	NM_033004	NP_127497			NLR family, pyrin domain containing 1 isoform 1						defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	6137031	6137032	+	IGR	DEL	AC	-	-	rs71372661		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6137031_6137032delAC								WSCD1 (109286 upstream) : AIPL1 (190028 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	6464214	6464215	+	IGR	DEL	CT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6464214_6464215delCT								PITPNM3 (4337 upstream) : KIAA0753 (17431 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	13176473	13176474	+	IGR	INS	-	T	T	rs147804673	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13176473_13176474insT								ELAC2 (255114 upstream) : HS3ST3A1 (222532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	13513633	13513634	+	IGR	INS	-	T	T	rs139834901	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13513633_13513634insT								HS3ST3A1 (8389 upstream) : CDRT15P (414181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	13792361	13792362	+	IGR	INS	-	T	T	rs142159241	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13792361_13792362insT								HS3ST3A1 (287117 upstream) : CDRT15P (135453 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	15195964	15195965	+	IGR	INS	-	T	T	rs146801516	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15195964_15195965insT								PMP22 (27320 upstream) : TEKT3 (11166 downstream)																																			---	---	---	---
MAP2K3	5606	broad.mit.edu	37	17	21204581	21204584	+	Intron	DEL	TGTG	-	-	rs34743272		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21204581_21204584delTGTG	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731			mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)														---	---	---	---
MAP2K3	5606	broad.mit.edu	37	17	21210172	21210172	+	Intron	DEL	A	-	-	rs79837732		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21210172delA	uc002gys.2	+						MAP2K3_uc002gyt.2_Intron|MAP2K3_uc002gyu.2_Intron	NM_145109	NP_659731			mitogen-activated protein kinase kinase 3						activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of transcription, DNA-dependent|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0				COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	21246683	21246683	+	IGR	DEL	A	-	-	rs66832039		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21246683delA								MAP2K3 (28134 upstream) : KCNJ12 (33016 downstream)																																			---	---	---	---
KCNJ12	3768	broad.mit.edu	37	17	21311149	21311150	+	Intron	INS	-	C	C	rs139435686		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21311149_21311150insC	uc002gyv.1	+							NM_021012	NP_066292			potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21327654	21327655	+	IGR	DEL	AC	-	-	rs5819767		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21327654_21327655delAC								KCNJ12 (4475 upstream) : C17orf51 (103917 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21335417	21335419	+	IGR	DEL	ACA	-	-	rs112205373		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21335417_21335419delACA								KCNJ12 (12238 upstream) : C17orf51 (96153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21347043	21347044	+	IGR	DEL	AG	-	-	rs111380221		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21347043_21347044delAG								KCNJ12 (23864 upstream) : C17orf51 (84528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21522887	21522888	+	IGR	INS	-	T	T	rs142447857	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21522887_21522888insT								C17orf51 (45156 upstream) : FAM27L (302482 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21542883	21542883	+	IGR	DEL	T	-	-	rs112016452		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21542883delT								C17orf51 (65152 upstream) : FAM27L (282487 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21836645	21836646	+	IGR	DEL	CA	-	-	rs35267202	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21836645_21836646delCA								FAM27L (10142 upstream) : FLJ36000 (67416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	22208225	22208225	+	IGR	DEL	T	-	-	rs150860792		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22208225delT								FLJ36000 (295155 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25293211	25293212	+	IGR	DEL	AA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25293211_25293212delAA								None (None upstream) : WSB1 (327894 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25296374	25296374	+	IGR	DEL	C	-	-	rs145918287	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25296374delC								None (None upstream) : WSB1 (324732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25617890	25617890	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25617890delA								None (None upstream) : WSB1 (3216 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	26277651	26277653	+	IGR	DEL	AAC	-	-	rs72182210		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26277651_26277653delAAC								NOS2 (57242 upstream) : NLK (92035 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	27581571	27581571	+	IGR	DEL	T	-	-	rs111316904		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27581571delT								CRYBA1 (71 upstream) : NUFIP2 (1284 downstream)																																			---	---	---	---
TMIGD1	388364	broad.mit.edu	37	17	28652941	28652942	+	Intron	INS	-	A	A	rs145234195	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28652941_28652942insA	uc002hfa.1	-						TMIGD1_uc010csh.1_Intron	NM_206832	NP_996663			transmembrane and immunoglobulin domain							integral to membrane					0																		---	---	---	---
NF1	4763	broad.mit.edu	37	17	29648731	29648731	+	Intron	DEL	A	-	-	rs66615255		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29648731delA	uc002hgg.2	+						NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron|EVI2A_uc002hgl.2_5'Flank|EVI2A_uc002hgm.2_5'Flank	NM_001042492	NP_001035957			neurofibromin isoform 1						actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)				D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	29980195	29980198	+	IGR	DEL	GAGA	-	-	rs113617876		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29980195_29980198delGAGA								MIR365-2 (77655 upstream) : C17orf79 (198687 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	30560902	30560903	+	IGR	INS	-	T	T	rs72245217		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30560902_30560903insT								RHOT1 (8157 upstream) : RHBDL3 (32292 downstream)																																			---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	30876382	30876382	+	Intron	DEL	G	-	-	rs71362848		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30876382delG	uc002hho.1	-							NM_015194	NP_056009			myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
ACACA	31	broad.mit.edu	37	17	35507466	35507466	+	Intron	DEL	A	-	-	rs111498996		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35507466delA	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuy.2_Intron|ACACA_uc010wdc.1_Intron	NM_198836	NP_942133			acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)													---	---	---	---
PIP4K2B	8396	broad.mit.edu	37	17	36950137	36950137	+	Intron	DEL	A	-	-	rs79216751		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36950137delA	uc002hqs.2	-						PIP4K2B_uc010wdt.1_Intron	NM_003559	NP_003550			phosphatidylinositol-5-phosphate 4-kinase, type						cell surface receptor linked signaling pathway	endoplasmic reticulum membrane|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|receptor signaling protein activity			ovary(1)	1																		---	---	---	---
LASP1	3927	broad.mit.edu	37	17	37048841	37048842	+	Intron	INS	-	CC	CC	rs72819776	byFrequency;by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37048841_37048842insCC	uc002hra.2	+						LASP1_uc010wdy.1_Intron|LASP1_uc010cvq.2_Intron|LASP1_uc010wdz.1_Intron	NM_006148	NP_006139			LIM and SH3 protein 1							cortical actin cytoskeleton	ion transmembrane transporter activity|SH3/SH2 adaptor activity|zinc ion binding			lung(1)	1								T	MLL	AML								---	---	---	---
CDK12	51755	broad.mit.edu	37	17	37676944	37676945	+	Intron	INS	-	TTG	TTG	rs146197279	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37676944_37676945insTTG	uc010cvv.2	+						CDK12_uc010wef.1_Intron|CDK12_uc002hrw.3_Intron	NM_016507	NP_057591			Cdc2-related kinase, arginine/serine-rich						mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19															TCGA Ovarian(9;0.13)			---	---	---	---
IKZF3	22806	broad.mit.edu	37	17	37955688	37955688	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37955688delA	uc002hsu.2	-						IKZF3_uc002htd.2_Intron|IKZF3_uc010cwd.2_Intron|IKZF3_uc002hsv.2_Intron|IKZF3_uc010cwe.2_Intron|IKZF3_uc010cwf.2_Intron|IKZF3_uc010cwg.2_Intron|IKZF3_uc002hsw.2_Intron|IKZF3_uc002hsx.2_Intron|IKZF3_uc002hsy.2_Intron|IKZF3_uc002hsz.2_Intron|IKZF3_uc002hta.2_Intron|IKZF3_uc002htb.2_Intron|IKZF3_uc010cwh.2_Intron|IKZF3_uc002htc.2_Intron	NM_012481	NP_036613			aiolos isoform 1						B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)															---	---	---	---
TNS4	84951	broad.mit.edu	37	17	38647584	38647584	+	Intron	DEL	A	-	-	rs71152675		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38647584delA	uc010cxb.2	-							NM_032865	NP_116254			tensin 4 precursor						apoptosis|protein localization	cytoplasm|cytoskeleton|focal adhesion	actin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)															---	---	---	---
KRTAP9-9	81870	broad.mit.edu	37	17	39392292	39392293	+	Intron	INS	-	AAAG	AAAG	rs139660867	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39392292_39392293insAAAG	uc010wfq.1	+						KRTAP9-8_uc002hwh.3_5'Flank	NM_030975	NP_112237			keratin associated protein 9-9							keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)															---	---	---	---
SC65	10609	broad.mit.edu	37	17	39959887	39959888	+	Intron	INS	-	G	G	rs146004988	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39959887_39959888insG	uc002hxt.2	-						SC65_uc002hxu.2_Intron	NM_006455	NP_006446			synaptonemal complex protein SC65						synaptonemal complex assembly	nucleolus|synaptonemal complex	binding				0		Breast(137;0.000162)		BRCA - Breast invasive adenocarcinoma(366;0.149)														---	---	---	---
ACLY	47	broad.mit.edu	37	17	40060609	40060613	+	Intron	DEL	GGAAG	-	-	rs111634568		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40060609_40060613delGGAAG	uc002hyg.2	-						ACLY_uc002hyh.2_Intron|ACLY_uc002hyi.2_Intron|ACLY_uc010wfx.1_Intron|ACLY_uc010wfy.1_Intron	NM_001096	NP_001087			ATP citrate lyase isoform 1						ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)																---	---	---	---
CNP	1267	broad.mit.edu	37	17	40123369	40123369	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40123369delA	uc002hyl.1	+						CNP_uc010wfz.1_Intron|CNP_uc002hym.1_Intron|CNP_uc010wga.1_Intron|CNP_uc002hyn.1_5'Flank	NM_033133	NP_149124			2',3'-cyclic nucleotide 3' phosphodiesterase						cell killing|cyclic nucleotide catabolic process|RNA metabolic process|synaptic transmission	extracellular space|melanosome	2',3'-cyclic-nucleotide 3'-phosphodiesterase activity|ATP binding|protein binding				0		all_cancers(22;2.38e-06)|all_epithelial(22;6.79e-05)|Breast(137;0.000143)		UCEC - Uterine corpus endometrioid carcinoma (308;0.171)														---	---	---	---
WNK4	65266	broad.mit.edu	37	17	40934114	40934114	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40934114delG	uc002ibj.2	+						WNK4_uc010wgx.1_Intron|WNK4_uc002ibk.1_5'Flank	NM_032387	NP_115763			WNK lysine deficient protein kinase 4						intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity			ovary(3)|skin(3)|stomach(1)	7		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	41677783	41677784	+	IGR	INS	-	CA	CA	rs140263678	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41677783_41677784insCA								ETV4 (54021 upstream) : MEOX1 (39983 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	42653646	42653646	+	IGR	DEL	A	-	-	rs140177642		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42653646delA								FZD2 (16739 upstream) : C17orf104 (80336 downstream)																																			---	---	---	---
GJC1	10052	broad.mit.edu	37	17	42881669	42881669	+	3'UTR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42881669delA	uc002ihj.2	-	2					GJC1_uc002ihk.2_3'UTR|GJC1_uc002ihl.2_3'UTR|GJC1_uc010czx.2_3'UTR|GJC1_uc010czy.1_Intron	NM_005497	NP_005488			connexin 45						cellular membrane organization|gap junction assembly|muscle contraction|synaptic transmission|transport	connexon complex|integral to membrane					0		Prostate(33;0.0959)																---	---	---	---
KIAA1267	284058	broad.mit.edu	37	17	44155890	44155891	+	Intron	INS	-	A	A	rs150288078	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44155890_44155891insA	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258			hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	46823801	46823804	+	IGR	DEL	TGTG	-	-	rs72042412		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46823801_46823804delTGTG								HOXB13 (17690 upstream) : TTLL6 (15790 downstream)																																			---	---	---	---
ATP5G1	516	broad.mit.edu	37	17	46970083	46970084	+	5'Flank	INS	-	A	A	rs72523749		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46970083_46970084insA	uc002iog.2	+						ATP5G1_uc002ioh.2_5'Flank	NM_005175	NP_005166			ATP synthase, H+ transporting, mitochondrial F0						ATP hydrolysis coupled proton transport|mitochondrial ATP synthesis coupled proton transport|respiratory electron transport chain	integral to membrane|mitochondrial proton-transporting ATP synthase complex|proton-transporting ATP synthase complex, coupling factor F(o)	hydrogen ion transmembrane transporter activity|lipid binding				0																		---	---	---	---
ABI3	51225	broad.mit.edu	37	17	47295005	47295005	+	Intron	DEL	C	-	-	rs113223751		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47295005delC	uc002iop.1	+						ABI3_uc002ioq.1_Intron	NM_016428	NP_057512			NESH protein isoform 1						cellular component movement|regulation of cell migration	cytoplasm|lamellipodium	protein binding				0			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)												HNSCC(55;0.14)			---	---	---	---
PHOSPHO1	162466	broad.mit.edu	37	17	47307464	47307465	+	Intron	INS	-	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47307464_47307465insG	uc010wlv.1	-						PHOSPHO1_uc002ios.2_Intron	NM_178500	NP_848595			phosphatase, orphan 1 isoform 2						regulation of bone mineralization		metal ion binding|phosphoethanolamine/phosphocholine phosphatase activity				0			Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)		Choline(DB00122)													---	---	---	---
MYST2	11143	broad.mit.edu	37	17	47894177	47894178	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47894177_47894178insT	uc002ipm.2	+						MYST2_uc002ipl.1_Intron|MYST2_uc010wma.1_Intron|MYST2_uc010wmb.1_Intron|MYST2_uc010wmc.1_Intron|MYST2_uc010wmd.1_Intron|MYST2_uc010wme.1_Intron|MYST2_uc010wmf.1_Intron|MYST2_uc010wmg.1_Intron	NM_007067	NP_008998			MYST histone acetyltransferase 2						DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	histone acetyltransferase activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---
ANKRD40	91369	broad.mit.edu	37	17	48782781	48782782	+	Intron	INS	-	A	A	rs11459587		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48782781_48782782insA	uc002iso.2	-							NM_052855	NP_443087			ankyrin repeat domain 40												0			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	49451827	49451829	+	IGR	DEL	CAG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49451827_49451829delCAG								UTP18 (76537 upstream) : CA10 (255846 downstream)																																			---	---	---	---
STXBP4	252983	broad.mit.edu	37	17	53215250	53215251	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53215250_53215251insA	uc002iuf.1	+						STXBP4_uc010dcd.1_Intron	NM_178509	NP_848604			syntaxin binding protein 4							cytoplasm	calcium ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	54725523	54725526	+	IGR	DEL	CTCT	-	-	rs112677856		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54725523_54725526delCTCT								NOG (52572 upstream) : C17orf67 (143749 downstream)																																			---	---	---	---
TEX14	56155	broad.mit.edu	37	17	56720930	56720930	+	Intron	DEL	A	-	-	rs66819461		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56720930delA	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207			testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
PPM1E	22843	broad.mit.edu	37	17	56943951	56943965	+	Intron	DEL	TCATTGTAAATGCTG	-	-	rs142311883		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56943951_56943965delTCATTGTAAATGCTG	uc002iwx.2	+						PPM1E_uc010ddd.2_Intron	NM_014906	NP_055721			protein phosphatase 1E						protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)|skin(1)	5	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)															---	---	---	---
TBX2	6909	broad.mit.edu	37	17	59484101	59484103	+	Intron	DEL	GGG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59484101_59484103delGGG	uc010wox.1	+						TBX2_uc002ize.2_3'UTR|TBX2_uc002izg.2_Intron	NM_005994	NP_005985			T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0																		---	---	---	---
BRIP1	83990	broad.mit.edu	37	17	59812986	59812987	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59812986_59812987insA	uc002izk.1	-						BRIP1_uc002izl.1_Intron	NM_032043	NP_114432			BRCA1 interacting protein C-terminal helicase 1						DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1								F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
BRIP1	83990	broad.mit.edu	37	17	59848231	59848231	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59848231delA	uc002izk.1	-						BRIP1_uc002izl.1_Intron	NM_032043	NP_114432			BRCA1 interacting protein C-terminal helicase 1						DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1								F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
MED13	9969	broad.mit.edu	37	17	60046727	60046727	+	Intron	DEL	C	-	-	rs9944499	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60046727delC	uc002izo.2	-							NM_005121	NP_005112			mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
TBC1D3P2	440452	broad.mit.edu	37	17	60355074	60355074	+	5'Flank	DEL	T	-	-	rs71867731		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60355074delT	uc002izq.2	-						TBC1D3P2_uc010woz.1_5'Flank					SubName: Full=Putative uncharacterized protein TBC1D3E;												0																		---	---	---	---
TEX2	55852	broad.mit.edu	37	17	62326399	62326399	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62326399delA	uc002jed.2	-						TEX2_uc002jee.2_Intron	NM_018469	NP_060939			testis expressed sequence 2						signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)														---	---	---	---
PRKCA	5578	broad.mit.edu	37	17	64389759	64389760	+	Intron	INS	-	GT	GT	rs140856055	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64389759_64389760insGT	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728			protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)													---	---	---	---
HELZ	9931	broad.mit.edu	37	17	65147532	65147532	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65147532delA	uc010wqk.1	-						HELZ_uc002jfv.3_Intron|HELZ_uc002jfx.3_Intron	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)																	---	---	---	---
PITPNC1	26207	broad.mit.edu	37	17	65460860	65460861	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65460860_65460861insT	uc002jgc.2	+						PITPNC1_uc002jgb.2_Intron	NM_012417	NP_036549			phosphatidylinositol transfer protein,						signal transduction	cytoplasm	lipid binding|phosphatidylinositol transporter activity|protein binding			skin(1)	1	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	66701391	66701392	+	IGR	DEL	TC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66701391_66701392delTC								FAM20A (104296 upstream) : ABCA8 (162041 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	67761591	67761593	+	IGR	DEL	CTC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67761591_67761593delCTC								MAP2K6 (223129 upstream) : KCNJ16 (309833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68719129	68719130	+	IGR	INS	-	TG	TG	rs72470377		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68719129_68719130insTG								KCNJ2 (542948 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68898829	68898830	+	IGR	INS	-	CAAA	CAAA	rs139038603	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68898829_68898830insCAAA								KCNJ2 (722648 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69304388	69304389	+	IGR	INS	-	A	A	rs111414701		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69304388_69304389insA								None (None upstream) : SOX9 (812772 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69400120	69400149	+	IGR	DEL	AGAAAAGAAAAGAAAAGAAAAGAAAAGAAA	-	-	rs72448205		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69400120_69400149delAGAAAAGAAAAGAAAAGAAAAGAAAAGAAA								None (None upstream) : SOX9 (717012 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70464351	70464352	+	Intron	INS	-	GAGG	GAGG	rs140213869	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70464351_70464352insGAGG	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																														---	---	---	---
SLC39A11	201266	broad.mit.edu	37	17	70910459	70910460	+	Intron	INS	-	A	A	rs145772163	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70910459_70910460insA	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242			solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1																		---	---	---	---
SDK2	54549	broad.mit.edu	37	17	71428907	71428908	+	Intron	DEL	GT	-	-	rs66464388		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71428907_71428908delGT	uc010dfm.2	-						SDK2_uc010dfn.2_Intron	NM_001144952	NP_001138424			sidekick 2						cell adhesion	integral to membrane				ovary(2)	2																		---	---	---	---
SDK2	54549	broad.mit.edu	37	17	71620293	71620293	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71620293delA	uc010dfm.2	-							NM_001144952	NP_001138424			sidekick 2						cell adhesion	integral to membrane				ovary(2)	2																		---	---	---	---
RAB37	326624	broad.mit.edu	37	17	72737726	72737727	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72737726_72737727insA	uc002jlk.2	+						RAB37_uc002jlc.2_Intron|RAB37_uc010dfu.2_Intron|RAB37_uc002jld.2_Intron|RAB37_uc010wrb.1_Intron|RAB37_uc010wrc.1_Intron|RAB37_uc010wrd.1_Intron|RAB37_uc010wre.1_Intron|RAB37_uc002jll.3_Intron	NM_001006638	NP_001006639			RAB37, member RAS oncogene family isoform 2						protein transport|small GTPase mediated signal transduction	ER-Golgi intermediate compartment	GTP binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	74505422	74505423	+	IGR	INS	-	C	C	rs141079770	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74505422_74505423insC								RHBDF2 (7914 upstream) : CYGB (18017 downstream)																																			---	---	---	---
MFSD11	79157	broad.mit.edu	37	17	74765068	74765068	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74765068delA	uc002jta.2	+						MFSD11_uc002jtb.2_Intron|MFSD11_uc010dha.2_Intron|MFSD11_uc002jtc.2_Intron|MFSD11_uc002jtd.3_Intron|MFSD11_uc010dhb.2_Intron|MFSD11_uc002jte.2_Intron	NM_024311	NP_077287			major facilitator superfamily domain containing							integral to membrane				ovary(1)	1																		---	---	---	---
MGAT5B	146664	broad.mit.edu	37	17	74903138	74903138	+	Intron	DEL	T	-	-	rs111711663		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74903138delT	uc002jti.2	+						MGAT5B_uc002jth.2_Intron	NM_198955	NP_945193			N-acetylglucosaminyltranferase VB isoform 2							Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3																		---	---	---	---
SEPT9	10801	broad.mit.edu	37	17	75335597	75335597	+	Intron	DEL	T	-	-	rs34622485		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75335597delT	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron	NM_001113491	NP_001106963			septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	75864764	75864765	+	IGR	DEL	TG	-	-	rs113869156		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75864764_75864765delTG								SEPT9 (368088 upstream) : FLJ45079 (10344 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	77910716	77910717	+	RNA	INS	-	GTGC	GTGC	rs894870		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77910716_77910717insGTGC	uc002jxg.1	-	1		c.1561_1562insGCAC								Homo sapiens cDNA FLJ20748 fis, clone HEP05772.																														---	---	---	---
RNF213	57674	broad.mit.edu	37	17	78345567	78345568	+	Intron	INS	-	AC	AC	rs139434668	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78345567_78345568insAC	uc002jyh.1	+						uc002jyi.1_Intron|RNF213_uc010dhw.1_Intron	NM_020914	NP_065965			ring finger protein 213											ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)															---	---	---	---
RNF213	57674	broad.mit.edu	37	17	78366406	78366406	+	Intron	DEL	T	-	-	rs34876847		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78366406delT	uc002jyh.1	+						uc002jyi.1_Intron|RNF213_uc010dhx.1_Intron	NM_020914	NP_065965			ring finger protein 213											ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)															---	---	---	---
NPLOC4	55666	broad.mit.edu	37	17	79540511	79540512	+	Intron	INS	-	T	T	rs139107565	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79540511_79540512insT	uc002kat.3	-						NPLOC4_uc002kau.3_Intron|NPLOC4_uc010wur.1_Intron	NM_017921	NP_060391			nuclear protein localization 4						cellular membrane fusion|ER-associated protein catabolic process|Golgi organization	cytosol|endoplasmic reticulum|nuclear outer membrane-endoplasmic reticulum membrane network|nucleus	zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)															---	---	---	---
ASPSCR1	79058	broad.mit.edu	37	17	79942704	79942704	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79942704delC	uc002kcx.2	+						ASPSCR1_uc002kcw.1_Intron|ASPSCR1_uc002kcy.2_Intron|ASPSCR1_uc002kcz.2_Intron|ASPSCR1_uc002kda.2_Intron|ASPSCR1_uc002kdb.1_Intron	NM_024083	NP_076988			alveolar soft part sarcoma chromosome region,								protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)					T	TFE3	alveolar soft part sarcoma								---	---	---	---
ASPSCR1	79058	broad.mit.edu	37	17	79953982	79953982	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79953982delA	uc002kcx.2	+						ASPSCR1_uc002kcw.1_Intron|ASPSCR1_uc002kcy.2_Intron|ASPSCR1_uc002kcz.2_Intron|ASPSCR1_uc002kda.2_Intron|ASPSCR1_uc002kdb.1_Intron	NM_024083	NP_076988			alveolar soft part sarcoma chromosome region,								protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)					T	TFE3	alveolar soft part sarcoma								---	---	---	---
ASPSCR1	79058	broad.mit.edu	37	17	79956993	79956993	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79956993delG	uc002kcx.2	+						ASPSCR1_uc002kcw.1_Intron|ASPSCR1_uc002kcy.2_Intron|ASPSCR1_uc002kcz.2_Intron|ASPSCR1_uc002kda.2_Intron|ASPSCR1_uc002kdb.1_Intron	NM_024083	NP_076988			alveolar soft part sarcoma chromosome region,								protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)					T	TFE3	alveolar soft part sarcoma								---	---	---	---
CCDC57	284001	broad.mit.edu	37	17	80152185	80152186	+	Intron	INS	-	TT	TT	rs140430398		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80152185_80152186insTT	uc002kdz.1	-						CCDC57_uc002kdx.1_Intron	NM_198082	NP_932348			coiled-coil domain containing 57											ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	80179467	80179468	+	IGR	INS	-	AAC	AAC	rs143230826	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80179467_80179468insAAC								CCDC57 (8778 upstream) : SLC16A3 (6825 downstream)																																			---	---	---	---
RAB40B	10966	broad.mit.edu	37	17	80629209	80629210	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80629209_80629210delTG	uc002kft.2	-						RAB40B_uc002kfs.2_Intron	NM_006822	NP_006813			RAB40B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			central_nervous_system(1)	1	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	81090913	81090914	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:81090913_81090914delTG								METRNL (38324 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	81046	81047	+	IGR	INS	-	ACAA	ACAA	rs113222546		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:81046_81047insACAA								None (None upstream) : USP14 (77436 downstream)																																			---	---	---	---
COLEC12	81035	broad.mit.edu	37	18	443885	443885	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:443885delT	uc002kkm.2	-							NM_130386	NP_569057			collectin sub-family member 12						carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	998332	998332	+	IGR	DEL	C	-	-	rs113436356		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:998332delC								ADCYAP1 (86161 upstream) : C18orf2 (256058 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	1616498	1616499	+	IGR	INS	-	A	A	rs146107831	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1616498_1616499insA								C18orf2 (209317 upstream) : METTL4 (921026 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	5096584	5096584	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5096584delA								DLGAP1 (641318 upstream) : LOC642597 (47088 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10902874	10902874	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10902874delG								FAM38B (200895 upstream) : GNAL (786262 downstream)																																			---	---	---	---
IMPA2	3613	broad.mit.edu	37	18	12029105	12029107	+	Intron	DEL	CTG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12029105_12029107delCTG	uc002kqp.1	+						IMPA2_uc002kqo.1_Intron|IMPA2_uc002kqq.1_Intron	NM_014214	NP_055029			inositol(myo)-1(or 4)-monophosphatase 2						inositol phosphate dephosphorylation|signal transduction	cytoplasm	inositol-1(or 4)-monophosphatase activity|metal ion binding|protein homodimerization activity			skin(2)	2					Lithium(DB01356)													---	---	---	---
Unknown	0	broad.mit.edu	37	18	12725773	12725774	+	IGR	DEL	CT	-	-	rs71354706		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12725773_12725774delCT								PSMG2 (36 upstream) : PTPN2 (59707 downstream)																																			---	---	---	---
PTPN2	5771	broad.mit.edu	37	18	12819651	12819651	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12819651delA	uc002krp.2	-						PTPN2_uc002krl.2_Intron|PTPN2_uc002krn.2_Intron|PTPN2_uc002kro.2_Intron|PTPN2_uc002krm.2_Intron	NM_002828	NP_002819			protein tyrosine phosphatase, non-receptor type						interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway	endoplasmic reticulum|nucleoplasm	protein binding			skin(2)	2		Lung NSC(161;8.94e-06)																---	---	---	---
C18orf1	753	broad.mit.edu	37	18	13488690	13488690	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13488690delA	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146			hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	14629104	14629104	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14629104delT								POTEC (85505 upstream) : ANKRD30B (119135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15346285	15346285	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15346285delT								LOC644669 (20367 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15385208	15385209	+	IGR	DEL	CT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15385208_15385209delCT								LOC644669 (59290 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15397846	15397846	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15397846delG								LOC644669 (71928 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	19656002	19656004	+	IGR	DEL	TTG	-	-	rs36036116		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19656002_19656004delTTG								MIB1 (205092 upstream) : GATA6 (93412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	19928025	19928026	+	IGR	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19928025_19928026delGT								GATA6 (145798 upstream) : CTAGE1 (65538 downstream)																																			---	---	---	---
LAMA3	3909	broad.mit.edu	37	18	21520903	21520904	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21520903_21520904insT	uc002kuq.2	+						LAMA3_uc002kur.2_Intron|LAMA3_uc002kus.3_Intron|LAMA3_uc002kut.3_Intron	NM_198129	NP_937762			laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	18	31328084	31328084	+	IGR	DEL	G	-	-	rs11338031		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31328084delG								ASXL3 (685 upstream) : NOL4 (102986 downstream)																																			---	---	---	---
SETBP1	26040	broad.mit.edu	37	18	42344367	42344369	+	Intron	DEL	TGT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42344367_42344369delTGT	uc010dni.2	+						SETBP1_uc002lay.2_Intron	NM_015559	NP_056374			SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)										Schinzel-Giedion_syndrome				---	---	---	---
KIAA1632	57724	broad.mit.edu	37	18	43481731	43481732	+	Intron	DEL	CA	-	-	rs112113068		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43481731_43481732delCA	uc002lbm.2	-						KIAA1632_uc010xcq.1_Intron|KIAA1632_uc010xcr.1_Intron|KIAA1632_uc010xcs.1_Intron|KIAA1632_uc002lbn.2_Intron	NM_020964	NP_066015			hypothetical protein LOC57724						autophagy						0																		---	---	---	---
LOXHD1	125336	broad.mit.edu	37	18	44097216	44097216	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44097216delA	uc010xcw.1	-						LOXHD1_uc002lcg.1_Intron|LOXHD1_uc002lcd.3_Intron|LOXHD1_uc002lce.3_Intron|LOXHD1_uc002lcf.3_Intron|LOXHD1_uc010xcv.1_Intron|LOXHD1_uc010xcu.1_Intron	NM_144612	NP_653213			lipoxygenase homology domains 1 isoform 1						sensory perception of sound	stereocilium	protein binding				0																		---	---	---	---
KIAA0427	9811	broad.mit.edu	37	18	46301519	46301519	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46301519delA	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron|KIAA0427_uc002lde.3_Intron	NM_014772	NP_055587			hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	52658419	52658420	+	IGR	INS	-	AGAG	AGAG	rs141988286	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52658419_52658420insAGAG								CCDC68 (31680 upstream) : TCF4 (231142 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	55054088	55054089	+	IGR	INS	-	GC	GC	rs141940032	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55054088_55054089insGC								ST8SIA3 (17929 upstream) : ONECUT2 (48828 downstream)																																			---	---	---	---
CCBE1	147372	broad.mit.edu	37	18	57278013	57278013	+	Intron	DEL	G	-	-	rs11303964		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57278013delG	uc002lib.2	-							NM_133459	NP_597716			collagen and calcium binding EGF domains 1						lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	65139887	65139888	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65139887_65139888delTG								CDH19 (868671 upstream) : DSEL (33931 downstream)																																			---	---	---	---
DOK6	220164	broad.mit.edu	37	18	67327907	67327910	+	Intron	DEL	TTTT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67327907_67327910delTTTT	uc002lkl.2	+							NM_152721	NP_689934			docking protein 6								insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	68317922	68317922	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68317922delC								SOCS6 (320488 upstream) : None (None downstream)																																			---	---	---	---
TMPRSS9	360200	broad.mit.edu	37	19	2418306	2418313	+	Intron	DEL	TCCCTCCC	-	-	rs145586236	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2418306_2418313delTCCCTCCC	uc010xgx.1	+							NM_182973	NP_892018			transmembrane protease, serine 9						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
KDM4B	23030	broad.mit.edu	37	19	5002011	5002012	+	Intron	INS	-	T	T	rs143005402	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5002011_5002012insT	uc002mbq.3	+						KDM4B_uc010xil.1_Intron	NM_015015	NP_055830			jumonji domain containing 2B						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1																		---	---	---	---
KDM4B	23030	broad.mit.edu	37	19	5010808	5010808	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5010808delA	uc002mbq.3	+						KDM4B_uc010xil.1_Intron	NM_015015	NP_055830			jumonji domain containing 2B						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	6209706	6209709	+	IGR	DEL	CCAT	-	-	rs10530972		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6209706_6209709delCCAT								ACSBG2 (16594 upstream) : MLLT1 (684 downstream)																																			---	---	---	---
CLPP	8192	broad.mit.edu	37	19	6364743	6364743	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6364743delT	uc002mem.1	+						CLPP_uc002men.1_5'Flank	NM_006012	NP_006003			caseinolytic peptidase, ATP-dependent,						proteolysis	mitochondrial matrix	ATP binding|protein binding|serine-type endopeptidase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	6881121	6881121	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6881121delT								VAV1 (23750 upstream) : EMR1 (6461 downstream)																																			---	---	---	---
MYO1F	4542	broad.mit.edu	37	19	8591234	8591235	+	Intron	DEL	TC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8591234_8591235delTC	uc002mkg.2	-							NM_012335	NP_036467			myosin IF							unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3																		---	---	---	---
ZNF699	374879	broad.mit.edu	37	19	9408812	9408812	+	Intron	DEL	T	-	-	rs144670815		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9408812delT	uc002mlc.1	-							NM_198535	NP_940937			zinc finger protein 699						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
MAST1	22983	broad.mit.edu	37	19	12958563	12958564	+	Intron	INS	-	CCC	CCC			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12958563_12958564insCCC	uc002mvm.2	+						MAST1_uc002mvk.2_Intron|MAST1_uc002mvl.2_Intron	NM_014975	NP_055790			microtubule associated serine/threonine kinase						cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7																OREG0025277	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	19	14997642	14997642	+	IGR	DEL	A	-	-	rs34351275		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14997642delA								OR7A17 (5475 upstream) : OR7C2 (54659 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	17160380	17160383	+	IGR	DEL	AAGT	-	-	rs113736472		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17160380_17160383delAAGT								CPAMD8 (22755 upstream) : HAUS8 (190 downstream)																																			---	---	---	---
FKBP8	23770	broad.mit.edu	37	19	18648070	18648070	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18648070delC	uc002njk.1	-						FKBP8_uc002nji.1_Intron|FKBP8_uc010xqi.1_Intron|FKBP8_uc002njj.1_Intron|FKBP8_uc002njl.1_Intron|FKBP8_uc002njm.1_Intron|FKBP8_uc010ebr.1_Intron|FKBP8_uc002njn.2_Intron	NM_012181	NP_036313			FK506-binding protein 8						apoptosis|interspecies interaction between organisms|intracellular signal transduction|protein folding	integral to endoplasmic reticulum membrane|mitochondrial membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity|protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	20269058	20269059	+	IGR	DEL	TT	-	-	rs144392708		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20269058_20269059delTT								ZNF90 (31173 upstream) : ZNF486 (9024 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	20673680	20673680	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20673680delG								ZNF826 (65918 upstream) : ZNF737 (47119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	22473773	22473773	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22473773delC								ZNF676 (94020 upstream) : ZNF98 (100126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	23814562	23814563	+	IGR	DEL	TC	-	-	rs35446969		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23814562_23814563delTC								ZNF91 (236293 upstream) : ZNF675 (21146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27877562	27877562	+	IGR	DEL	T	-	-	rs113734434		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27877562delT								None (None upstream) : LOC148189 (403840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27887282	27887282	+	IGR	DEL	G	-	-	rs35684483		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27887282delG								None (None upstream) : LOC148189 (394120 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28265715	28265716	+	IGR	INS	-	AG	AG	rs143751984	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28265715_28265716insAG								None (None upstream) : LOC148189 (15686 downstream)																																	OREG0025388	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	19	30365503	30365503	+	IGR	DEL	A	-	-	rs34719	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30365503delA								CCNE1 (50285 upstream) : C19orf2 (49048 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31410818	31410820	+	IGR	DEL	AAG	-	-	rs113701182		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31410818_31410820delAAG								ZNF536 (361853 upstream) : DKFZp566F0947 (229963 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32137070	32137071	+	IGR	INS	-	TT	TT	rs79011220		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32137070_32137071insTT								TSHZ3 (296880 upstream) : ZNF507 (699443 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	33034139	33034140	+	IGR	DEL	AG	-	-	rs113347295		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33034139_33034140delAG								DPY19L3 (58903 upstream) : PDCD5 (37964 downstream)																																			---	---	---	---
ANKRD27	84079	broad.mit.edu	37	19	33156362	33156363	+	Intron	INS	-	T	T	rs145901411	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33156362_33156363insT	uc002ntn.1	-						ANKRD27_uc002nto.1_Intron	NM_032139	NP_115515			ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)																	---	---	---	---
RHPN2	85415	broad.mit.edu	37	19	33489607	33489608	+	Intron	INS	-	GA	GA	rs149528601	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33489607_33489608insGA	uc002nuf.2	-						RHPN2_uc010xro.1_Intron|RHPN2_uc002nue.2_Intron	NM_033103	NP_149094			rhophilin, Rho GTPase binding protein 2						signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	34585626	34585627	+	5'Flank	INS	-	T	T	rs141198205	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34585626_34585627insT	uc002nuz.2	-											full-length cDNA clone CS0DE007YF24 of Placenta of Homo sapiens (human).																														---	---	---	---
MAG	4099	broad.mit.edu	37	19	35803435	35803436	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35803435_35803436insA	uc002nyy.1	+						MAG_uc002nyx.1_Intron|MAG_uc010eds.1_Intron|MAG_uc002nyz.1_Intron	NM_002361	NP_002352			myelin associated glycoprotein isoform a						blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)															---	---	---	---
GAPDHS	26330	broad.mit.edu	37	19	36032278	36032278	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36032278delG	uc002oaf.1	+						uc010eec.1_RNA|uc002oag.2_RNA	NM_014364	NP_055179			glyceraldehyde-3-phosphate dehydrogenase,						gluconeogenesis|glycolysis|positive regulation of glycolysis|sperm motility	cytosol	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|protein binding				0	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		NADH(DB00157)													---	---	---	---
COX6B1	1340	broad.mit.edu	37	19	36144485	36144485	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36144485delT	uc002oav.2	+							NM_001863	NP_001854			cytochrome c oxidase subunit VIb polypeptide 1						respiratory electron transport chain	mitochondrial inner membrane|mitochondrial intermembrane space	cytochrome-c oxidase activity				0	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)															---	---	---	---
C19orf46	163183	broad.mit.edu	37	19	36496125	36496126	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36496125_36496126insT	uc002ocq.1	-						C19orf46_uc002ocr.1_Intron|C19orf46_uc002ocs.1_Intron|C19orf46_uc010een.1_Intron	NM_001039876	NP_001034965			hypothetical protein LOC163183						establishment of epithelial cell apical/basal polarity	integral to nuclear outer membrane	actin binding			ovary(1)	1	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	44046582	44046582	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44046582delC								ZNF575 (6300 upstream) : XRCC1 (882 downstream)																																			---	---	---	---
CEACAM22P	388550	broad.mit.edu	37	19	45048186	45048189	+	Intron	DEL	CATC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45048186_45048189delCATC	uc010ejr.1	-							NR_027754				Homo sapiens cDNA FLJ41856 fis, clone NT2RI3006171, weakly similar to Carcinoembryonic antigen-related celladhesion molecule 5 precursor.												0																		---	---	---	---
CEACAM19	56971	broad.mit.edu	37	19	45180967	45180968	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45180967_45180968insT	uc002ozo.3	+						CEACAM19_uc002ozp.3_Intron	NM_020219	NP_064604			carcinoembryonic antigen-related cell adhesion							integral to membrane					0	Lung NSC(12;0.00308)|all_lung(12;0.00806)	Prostate(69;0.0376)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	45214287	45214288	+	IGR	INS	-	G	G	rs143511316	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45214287_45214288insG								CEACAM16 (303 upstream) : BCL3 (37690 downstream)																																			---	---	---	---
PRKD2	25865	broad.mit.edu	37	19	47185115	47185115	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47185115delG	uc002pfh.2	-						PRKD2_uc002pfd.2_Intron|PRKD2_uc010eks.2_Intron|PRKD2_uc010ekt.2_Intron|PRKD2_uc002pfe.2_Intron|PRKD2_uc002pff.2_Intron|PRKD2_uc002pfg.2_Intron|PRKD2_uc002pfi.2_Intron|PRKD2_uc002pfj.2_Intron|PRKD2_uc010xye.1_Intron|PRKD2_uc002pfk.2_Intron	NM_001079881	NP_001073350			protein kinase D2 isoform A						cell death|intracellular signal transduction|positive regulation of transcription from RNA polymerase II promoter|protein autophosphorylation|T cell receptor signaling pathway	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein kinase C activity			ovary(2)|central_nervous_system(2)|stomach(1)|large_intestine(1)|lung(1)	7		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	47320803	47320804	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47320803_47320804insA								SLC1A5 (28961 upstream) : SNAR-E (13038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	47321387	47321387	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47321387delA								SLC1A5 (29545 upstream) : SNAR-E (12455 downstream)																																			---	---	---	---
GLTSCR1	29998	broad.mit.edu	37	19	48159519	48159521	+	Intron	DEL	AAC	-	-	rs77499934		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48159519_48159521delAAC	uc002phh.3	+							NM_015711	NP_056526			glioma tumor suppressor candidate region gene 1								protein binding			pancreas(3)	3		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)														---	---	---	---
GLTSCR2	29997	broad.mit.edu	37	19	48263219	48263220	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48263219_48263220delTG	uc010elk.1	+											Homo sapiens HSPC271 mRNA, partial cds.							nucleolus				central_nervous_system(1)	1		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)														---	---	---	---
BSPH1	100131137	broad.mit.edu	37	19	48494910	48494911	+	Intron	INS	-	CTT	CTT	rs146875843	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48494910_48494911insCTT	uc002phs.1	-							NM_001128326	NP_001121798			bovine seminal plasma protein-like 1 precursor						single fertilization	extracellular region					0																		---	---	---	---
NUCB1	4924	broad.mit.edu	37	19	49408350	49408350	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49408350delG	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175			nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)														---	---	---	---
LIN7B	64130	broad.mit.edu	37	19	49619267	49619267	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49619267delA	uc002pmp.2	+							NM_022165	NP_071448			lin-7 homolog B						exocytosis|protein transport	basolateral plasma membrane|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein domain specific binding				0		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;5e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000191)|GBM - Glioblastoma multiforme(486;0.00449)|Epithelial(262;0.01)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	51282174	51282174	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51282174delA								GPR32 (7247 upstream) : ACPT (11498 downstream)																																			---	---	---	---
CTU1	90353	broad.mit.edu	37	19	51604191	51604192	+	Intron	INS	-	GT	GT	rs144038398	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51604191_51604192insGT	uc010eop.2	-							NM_145232	NP_660275			ATP binding domain 3						tRNA thio-modification|tRNA wobble uridine modification	cytosol	ATP binding|protein binding|transferase activity|tRNA binding				0																		---	---	---	---
IGLON5	402665	broad.mit.edu	37	19	51823139	51823140	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51823139_51823140delTG	uc002pwc.2	+							NM_001101372	NP_001094842			IgLON family member 5 precursor							extracellular region					0																		---	---	---	---
VSTM1	284415	broad.mit.edu	37	19	54569003	54569004	+	5'Flank	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54569003_54569004insA	uc002qcw.3	-						VSTM1_uc010erb.2_5'Flank|VSTM1_uc002qcx.3_5'Flank	NM_198481	NP_940883			V-set and transmembrane domain containing 1							integral to membrane					0	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)														---	---	---	---
MBOAT7	79143	broad.mit.edu	37	19	54685874	54685875	+	Intron	INS	-	GGAG	GGAG			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54685874_54685875insGGAG	uc002qdq.2	-						MBOAT7_uc010erg.2_Intron|MBOAT7_uc010yem.1_Intron|MBOAT7_uc002qdr.2_Intron|MBOAT7_uc002qds.2_Intron|MBOAT7_uc010yen.1_Intron|MBOAT7_uc002qdt.3_Intron	NM_024298	NP_077274			membrane bound O-acyltransferase domain						phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)																	---	---	---	---
NLRP7	199713	broad.mit.edu	37	19	55458694	55458695	+	Intron	INS	-	A	A	rs80191516		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55458694_55458695insA	uc002qih.3	-						NLRP7_uc002qig.3_Intron|NLRP7_uc002qii.3_Intron|NLRP7_uc010esk.2_Intron|NLRP7_uc010esl.2_Intron	NM_206828	NP_996611			NACHT, leucine rich repeat and PYD containing 7								ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)														---	---	---	---
HSPBP1	23640	broad.mit.edu	37	19	55777843	55777845	+	Intron	DEL	TCC	-	-	rs146055875		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55777843_55777845delTCC	uc002qjx.2	-						HSPBP1_uc002qjy.2_Intron|HSPBP1_uc002qkb.2_Intron|HSPBP1_uc002qka.2_Intron|HSPBP1_uc002qkd.2_Intron|HSPBP1_uc002qkc.2_Intron|uc002qke.2_5'Flank	NM_012267	NP_036399			hsp70-interacting protein						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	56397978	56397980	+	IGR	DEL	TTG	-	-	rs72364065		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56397978_56397980delTTG								NLRP4 (4760 upstream) : NLRP13 (9333 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	929654	929655	+	IGR	INS	-	G	G	rs79821709		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:929654_929655insG								ANGPT4 (32694 upstream) : RSPO4 (9443 downstream)																																			---	---	---	---
SNPH	9751	broad.mit.edu	37	20	1258116	1258119	+	Intron	DEL	TGTC	-	-	rs113405764		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1258116_1258119delTGTC	uc002wes.2	+						SNPH_uc002wet.2_Intron	NM_014723	NP_055538			syntaphilin						synaptic vesicle docking involved in exocytosis	cell junction|integral to membrane|synapse|synaptosome	syntaxin-1 binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	7115008	7115008	+	IGR	DEL	A	-	-	rs11476305		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7115008delA								BMP2 (354098 upstream) : HAO1 (748623 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7592219	7592220	+	IGR	INS	-	GT	GT	rs144840010	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7592219_7592220insGT								BMP2 (831309 upstream) : HAO1 (271411 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	8010145	8010145	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8010145delA								TMX4 (9752 upstream) : PLCB1 (84955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	9477355	9477355	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9477355delT								PLCB4 (15895 upstream) : C20orf103 (17916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11538695	11538696	+	IGR	INS	-	T	T	rs71334469		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11538695_11538696insT								JAG1 (884001 upstream) : BTBD3 (332781 downstream)																																			---	---	---	---
TASP1	55617	broad.mit.edu	37	20	13299870	13299870	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13299870delA	uc010zri.1	-											Homo sapiens cDNA FLJ20212 fis, clone COLF1860.						asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0																		---	---	---	---
DTD1	92675	broad.mit.edu	37	20	18648216	18648216	+	Intron	DEL	T	-	-	rs5840820		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18648216delT	uc002wrf.3	+							NM_080820	NP_543010			D-tyrosyl-tRNA deacylase 1						D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds			ovary(2)	2																		---	---	---	---
RIN2	54453	broad.mit.edu	37	20	19941150	19941150	+	Intron	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19941150delG	uc002wro.1	+						RIN2_uc010gcu.1_Intron|RIN2_uc010gcv.1_Intron	NM_018993	NP_061866			Ras and Rab interactor 2						endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity			lung(4)|ovary(1)	5																		---	---	---	---
TMEM90B	79953	broad.mit.edu	37	20	24642023	24642026	+	Intron	DEL	GAAA	-	-	rs114192043	by1000genomes;by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24642023_24642026delGAAA	uc002wtw.1	+							NM_024893	NP_079169			transmembrane protein 90B						response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0																		---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25754119	25754120	+	Intron	INS	-	T	T	rs113637701		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25754119_25754120insT	uc010zth.1	-						FAM182B_uc002wvd.1_Intron|FAM182B_uc010zti.1_RNA	NR_027061				Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25831101	25831102	+	Intron	INS	-	C	C	rs147373877	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25831101_25831102insC	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25863491	25863491	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25863491delT								FAM182B (14705 upstream) : LOC100134868 (126944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25867693	25867693	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25867693delT								FAM182B (18907 upstream) : LOC100134868 (122742 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	25878204	25878205	+	IGR	INS	-	A	A	rs35451775		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25878204_25878205insA								FAM182B (29418 upstream) : LOC100134868 (112230 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29422533	29422534	+	IGR	DEL	AA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29422533_29422534delAA								None (None upstream) : FRG1B (189345 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29462348	29462349	+	IGR	INS	-	AA	AA	rs140899401	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29462348_29462349insAA								None (None upstream) : FRG1B (149530 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29545921	29545923	+	IGR	DEL	AGA	-	-	rs73620359		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29545921_29545923delAGA								None (None upstream) : FRG1B (65956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29587903	29587903	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29587903delT								None (None upstream) : FRG1B (23976 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29598034	29598034	+	IGR	DEL	G	-	-	rs66541912		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29598034delG								None (None upstream) : FRG1B (13845 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29628777	29628778	+	Intron	INS	-	TG	TG			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29628777_29628778insTG	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29634402	29634402	+	Intron	DEL	T	-	-	rs67656346		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29634402delT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
BCL2L1	598	broad.mit.edu	37	20	30278062	30278062	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30278062delT	uc002wwl.2	-						BCL2L1_uc002wwk.2_Intron|BCL2L1_uc002wwm.2_Intron|BCL2L1_uc002wwn.2_Intron	NM_138578	NP_612815			BCL2-like 1 isoform 1						induction of apoptosis by intracellular signals|negative regulation of establishment of protein localization in plasma membrane|negative regulation of survival gene product expression|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|release of cytochrome c from mitochondria|response to cytokine stimulus	integral to membrane|mitochondrial outer membrane|nuclear membrane	BH3 domain binding|identical protein binding			lung(1)|central_nervous_system(1)	2	all_cancers(5;3.47e-06)|all_epithelial(3;1.83e-06)|Lung NSC(7;2.08e-06)|all_lung(7;3.63e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;2.97e-06)|all cancers(5;3.21e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00052)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	30429481	30429481	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30429481delT								MYLK2 (6981 upstream) : FOXS1 (2622 downstream)																																			---	---	---	---
KIF3B	9371	broad.mit.edu	37	20	30896999	30897001	+	Intron	DEL	TTT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30896999_30897001delTTT	uc002wxq.2	+						KIF3B_uc010ztv.1_Intron|KIF3B_uc010ztw.1_5'Flank	NM_004798	NP_004789			kinesin family member 3B						anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|plus-end-directed vesicle transport along microtubule|spindle assembly involved in mitosis	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|Rho GTPase binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	31636418	31636419	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31636418_31636419insA								BPIL3 (4566 upstream) : C20orf185 (6811 downstream)																																			---	---	---	---
NDRG3	57446	broad.mit.edu	37	20	35308888	35308888	+	Intron	DEL	A	-	-	rs142216011		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35308888delA	uc002xfw.2	-						NDRG3_uc002xfx.2_Intron|NDRG3_uc010zvq.1_Intron|NDRG3_uc010zvr.1_Intron	NM_032013	NP_114402			N-myc downstream regulated gene 3 isoform a						cell differentiation|negative regulation of cell growth|spermatogenesis	cytoplasm				ovary(1)	1		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36036980	36036981	+	IGR	INS	-	CA	CA	rs146531084	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36036980_36036981insCA								SRC (3161 upstream) : BLCAP (108839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37037632	37037632	+	Intron	DEL	T	-	-	rs11286532		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37037632delT	uc002xid.1	-											Homo sapiens cDNA FLJ33613 fis, clone BRAMY2017348.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	37250594	37250594	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37250594delA								ADIG (33490 upstream) : SLC32A1 (102511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37281792	37281794	+	IGR	DEL	ATA	-	-	rs76366444		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37281792_37281794delATA								ADIG (64688 upstream) : SLC32A1 (71311 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37807162	37807162	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37807162delG								DHX35 (138799 upstream) : LOC339568 (35262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	38878462	38878462	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38878462delT								None (None upstream) : MAFB (436057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	40349798	40349798	+	IGR	DEL	T	-	-	rs74496375		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40349798delT								CHD6 (102665 upstream) : PTPRT (351595 downstream)																																			---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41044002	41044003	+	Intron	INS	-	TTTG	TTTG	rs140489557	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41044002_41044003insTTTG	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41790405	41790405	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41790405delA	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
MYBL2	4605	broad.mit.edu	37	20	42318833	42318833	+	Intron	DEL	T	-	-	rs113608338		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42318833delT	uc002xlb.1	+						MYBL2_uc010zwj.1_Intron|MYBL2_uc002xla.1_Intron	NM_002466	NP_002457			MYB-related protein B							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
RIMS4	140730	broad.mit.edu	37	20	43441894	43441895	+	5'Flank	DEL	AT	-	-	rs72470760		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43441894_43441895delAT	uc002xms.2	-						RIMS4_uc010ggu.2_5'Flank	NM_182970	NP_892015			regulating synaptic membrane exocytosis 4						exocytosis|neurotransmitter transport	cell junction|synapse				ovary(4)|central_nervous_system(1)	5		Myeloproliferative disorder(115;0.0122)																---	---	---	---
WFDC3	140686	broad.mit.edu	37	20	44407331	44407331	+	Intron	DEL	A	-	-	rs74176817		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44407331delA	uc002xpf.1	-						WFDC3_uc002xpj.1_Intron|WFDC3_uc002xph.1_Intron|WFDC3_uc010ghh.1_Intron	NM_080614	NP_542181			WAP four-disulfide core domain 3 precursor							extracellular region	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	45497761	45497761	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45497761delA								SLC2A10 (132778 upstream) : EYA2 (25502 downstream)																																			---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45525043	45525044	+	Intron	INS	-	A	A	rs71892947		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45525043_45525044insA	uc002xsm.2	+						EYA2_uc010ghp.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	46072239	46072239	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46072239delA								ZMYND8 (86765 upstream) : NCOA3 (58418 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	46472729	46472732	+	IGR	DEL	GGAG	-	-	rs59838046		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46472729_46472732delGGAG								SULF2 (57369 upstream) : LOC284749 (515922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	47721938	47721940	+	IGR	DEL	TTG	-	-	rs71958449		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47721938_47721940delTTG								CSE1L (8454 upstream) : STAU1 (7938 downstream)																																			---	---	---	---
DDX27	55661	broad.mit.edu	37	20	47837326	47837327	+	Intron	INS	-	TGTC	TGTC			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47837326_47837327insTGTC	uc002xuh.2	+							NM_017895	NP_060365			DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	47908583	47908584	+	IGR	INS	-	T	T	rs142618168	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47908583_47908584insT								C20orf199 (2790 upstream) : KCNB1 (79921 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	47947371	47947374	+	IGR	DEL	CCAT	-	-	rs11467804		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47947371_47947374delCCAT								C20orf199 (41578 upstream) : KCNB1 (41131 downstream)																																			---	---	---	---
SLC9A8	23315	broad.mit.edu	37	20	48462364	48462365	+	Intron	INS	-	T	T	rs6020084	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48462364_48462365insT	uc002xuv.1	+						SLC9A8_uc010zym.1_Intron|SLC9A8_uc010zyj.1_Intron|SLC9A8_uc010zyk.1_Intron|SLC9A8_uc010zyl.1_Intron|SLC9A8_uc010gib.1_Intron	NM_015266	NP_056081			sodium/hydrogen exchanger 8							Golgi membrane|integral to membrane	sodium:hydrogen antiporter activity			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	48622636	48622637	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48622636_48622637insT								SNAI1 (17218 upstream) : TMEM189-UBE2V1 (75026 downstream)																																			---	---	---	---
PARD6B	84612	broad.mit.edu	37	20	49364356	49364356	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49364356delA	uc002xvo.2	+							NM_032521	NP_115910			PAR-6 beta						axonogenesis|cell cycle|cell division|establishment or maintenance of cell polarity|protein complex assembly|regulation of cell migration|tight junction assembly	cytosol|tight junction	protein binding			kidney(1)	1																		---	---	---	---
ZFP64	55734	broad.mit.edu	37	20	50755193	50755194	+	Intron	DEL	AA	-	-	rs10716412		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50755193_50755194delAA	uc002xwk.2	-							NM_199427	NP_955459			zinc finger protein 64 isoform d						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	50844480	50844481	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50844480_50844481insT								ZFP64 (35956 upstream) : TSHZ2 (744396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	51233072	51233073	+	IGR	INS	-	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51233072_51233073insG								ZFP64 (424548 upstream) : TSHZ2 (355804 downstream)																																			---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	52004591	52004591	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52004591delA	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52531830	52531831	+	IGR	INS	-	AG	AG	rs146966906	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52531830_52531831insAG								SUMO1P1 (39582 upstream) : BCAS1 (28248 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55654194	55654195	+	IGR	INS	-	T	T	rs150502066	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55654194_55654195insT								TFAP2C (439858 upstream) : BMP7 (89614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55693920	55693920	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55693920delA								TFAP2C (479584 upstream) : BMP7 (49889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56203328	56203331	+	IGR	DEL	TTGT	-	-	rs3068091		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56203328_56203331delTTGT								ZBP1 (7696 upstream) : PMEPA1 (20123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56705262	56705263	+	IGR	INS	-	T	T	rs145026112	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56705262_56705263insT								PMEPA1 (418721 upstream) : C20orf85 (20720 downstream)																																			---	---	---	---
NPEPL1	79716	broad.mit.edu	37	20	57270238	57270240	+	Intron	DEL	TGT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57270238_57270240delTGT	uc010zzs.1	+						NPEPL1_uc010zzr.1_Intron|NPEPL1_uc002xzn.2_Intron|NPEPL1_uc010gjo.1_Intron|NPEPL1_uc002xzp.2_Intron	NM_024663	NP_078939			aminopeptidase-like 1						proteolysis	cytoplasm	aminopeptidase activity|manganese ion binding|metalloexopeptidase activity				0	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	57495100	57495101	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57495100_57495101insA								GNAS (8851 upstream) : TH1L (61210 downstream)																																			---	---	---	---
SYCP2	10388	broad.mit.edu	37	20	58472867	58472868	+	Intron	INS	-	GT	GT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58472867_58472868insGT	uc002yaz.2	-							NM_014258	NP_055073			synaptonemal complex protein 2						cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	60675721	60675722	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60675721_60675722insA								TAF4 (34855 upstream) : LSM14B (21795 downstream)																																			---	---	---	---
LAMA5	3911	broad.mit.edu	37	20	60898268	60898268	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60898268delC	uc002ycq.2	-							NM_005560	NP_005551			laminin alpha 5 precursor						angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
SLC17A9	63910	broad.mit.edu	37	20	61589140	61589141	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61589140_61589141delTG	uc002yea.3	+						SLC17A9_uc002ydz.3_Intron|SLC17A9_uc011aap.1_Intron	NM_022082	NP_071365			vesicular nucleotide transporter SLC17A9						exocytosis|transmembrane transport	integral to membrane	transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	61743090	61743091	+	IGR	INS	-	T	T	rs146334672	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61743090_61743091insT								HAR1A (7353 upstream) : MIR124-3 (66761 downstream)																																			---	---	---	---
GMEB2	26205	broad.mit.edu	37	20	62238588	62238589	+	Intron	INS	-	T	T	rs34652261		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62238588_62238589insT	uc002yfp.1	-						GMEB2_uc002yfo.1_5'Flank|GMEB2_uc002yfq.1_Intron	NM_012384	NP_036516			glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding				0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	62775523	62775524	+	IGR	INS	-	TG	TG	rs143653085	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62775523_62775524insTG								NPBWR2 (37339 upstream) : MYT1 (7620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10534467	10534468	+	Intron	INS	-	G	G	rs71261237		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10534467_10534468insG	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10607791	10607791	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10607791delT								None (None upstream) : TPTE (298952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10729506	10729506	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10729506delA								None (None upstream) : TPTE (177237 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10802117	10802136	+	IGR	DEL	TGGAGTGGAGTGGAGTGGAA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10802117_10802136delTGGAGTGGAGTGGAGTGGAA								None (None upstream) : TPTE (104607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10805935	10805944	+	IGR	DEL	TGGAGTGGAA	-	-	rs145398556		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10805935_10805944delTGGAGTGGAA								None (None upstream) : TPTE (100799 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10834421	10834425	+	IGR	DEL	GGAAT	-	-	rs112460113		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10834421_10834425delGGAAT								None (None upstream) : TPTE (72318 downstream)																																			---	---	---	---
TPTE	7179	broad.mit.edu	37	21	10912584	10912585	+	Intron	INS	-	A	A	rs138227345		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10912584_10912585insA	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870			transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11060157	11060159	+	Intron	DEL	ACA	-	-	rs144760925		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11060157_11060159delACA	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	11114231	11114232	+	IGR	DEL	AT	-	-	rs138368914		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11114231_11114232delAT								BAGE (15294 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11164717	11164720	+	IGR	DEL	CCCA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11164717_11164720delCCCA								BAGE (65780 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11175717	11175718	+	IGR	INS	-	AA	AA	rs75708488		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11175717_11175718insAA								BAGE (76780 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14388903	14388904	+	IGR	INS	-	TC	TC	rs137931984	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14388903_14388904insTC								None (None upstream) : C21orf99 (21583 downstream)																																			---	---	---	---
C21orf34	388815	broad.mit.edu	37	21	17698256	17698261	+	Intron	DEL	TGTGTG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17698256_17698261delTGTGTG	uc002ykb.2	+						C21orf34_uc010glc.2_Intron|C21orf34_uc002ykc.2_Intron	NR_027790				Homo sapiens C21ORF34 (C21orf34) mRNA, partial cds, alternatively spliced.												0		Breast(209;0.152)		Epithelial(23;8.3e-05)|all cancers(11;0.000383)|Colorectal(24;0.00387)|COAD - Colon adenocarcinoma(22;0.0113)|OV - Ovarian serous cystadenocarcinoma(11;0.0127)|LUSC - Lung squamous cell carcinoma(23;0.153)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	18570199	18570200	+	IGR	INS	-	AGGA	AGGA	rs149741218	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18570199_18570200insAGGA								C21orf34 (588105 upstream) : CXADR (315130 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	21570164	21570165	+	IGR	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21570164_21570165delAC								None (None upstream) : C21orf131 (544749 downstream)																																			---	---	---	---
GRIK1	2897	broad.mit.edu	37	21	31163827	31163827	+	Intron	DEL	G	-	-	rs78685568		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31163827delG	uc002yno.1	-						GRIK1_uc002ynn.2_Intron|GRIK1_uc011acs.1_Intron|GRIK1_uc011act.1_Intron|GRIK1_uc010glq.1_Intron|GRIK1_uc002ynr.2_Intron	NM_000830	NP_000821			glutamate receptor, ionotropic, kainate 1						central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)													---	---	---	---
ITSN1	6453	broad.mit.edu	37	21	35026933	35026933	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35026933delC	uc002yta.1	+						DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_Intron|ITSN1_uc002ysz.2_Intron|ITSN1_uc010gmg.2_Intron|ITSN1_uc010gmh.2_Intron|ITSN1_uc002ysw.2_Intron|ITSN1_uc010gmi.2_Intron|ITSN1_uc010gmj.2_Intron|ITSN1_uc002ysy.2_Intron|ITSN1_uc002ysx.2_Intron|ITSN1_uc002ytb.1_Intron	NM_003024	NP_003015			intersectin 1 isoform ITSN-l						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4																		---	---	---	---
ITSN1	6453	broad.mit.edu	37	21	35171919	35171919	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35171919delT	uc002yta.1	+						DONSON_uc002ysn.1_Intron|ITSN1_uc002yth.3_Intron|ITSN1_uc002ysz.2_Intron|ITSN1_uc010gmg.2_Intron|ITSN1_uc010gmh.2_Intron|ITSN1_uc002ysw.2_Intron|ITSN1_uc010gmi.2_Intron|ITSN1_uc010gmj.2_Intron|ITSN1_uc002ysy.2_Intron|ITSN1_uc002ysx.2_Intron|ITSN1_uc002ytb.1_Intron|ITSN1_uc002ytc.1_Intron|ITSN1_uc002ytd.2_Intron|ITSN1_uc010gmk.2_Intron|ITSN1_uc010gml.2_Intron|ITSN1_uc002ytj.2_Intron|ITSN1_uc010gmm.1_Intron|ITSN1_uc002yte.2_Intron|ITSN1_uc002ytf.1_5'Flank	NM_003024	NP_003015			intersectin 1 isoform ITSN-l						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4																		---	---	---	---
ERG	2078	broad.mit.edu	37	21	39816650	39816650	+	Intron	DEL	A	-	-	rs79182161		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39816650delA	uc010gnw.2	-						ERG_uc002yxa.2_Intron|ERG_uc011aek.1_Intron|ERG_uc010gnv.2_Intron|ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc011aem.1_Intron|ERG_uc002yxc.3_Intron	NM_001136155	NP_001129627			ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	41110818	41110819	+	IGR	INS	-	T	T	rs151264797	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41110818_41110819insT								B3GALT5 (76003 upstream) : IGSF5 (6515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	43197739	43197740	+	IGR	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43197739_43197740delAC								RIPK4 (10490 upstream) : PRDM15 (20647 downstream)																																			---	---	---	---
PRDM15	63977	broad.mit.edu	37	21	43263220	43263221	+	Intron	INS	-	TTTG	TTTG	rs147452558	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43263220_43263221insTTTG	uc002yzq.1	-						PRDM15_uc002yzo.2_Intron|PRDM15_uc002yzp.2_Intron|PRDM15_uc002yzr.1_Intron	NM_022115	NP_071398			PR domain containing 15 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	44742689	44742690	+	IGR	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44742689_44742690delGT								CRYAA (149776 upstream) : SIK1 (91708 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	45188267	45188267	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45188267delG								PDXK (6080 upstream) : CSTB (5565 downstream)																																			---	---	---	---
DNMT3L	29947	broad.mit.edu	37	21	45674711	45674713	+	Intron	DEL	TTG	-	-	rs137985892		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45674711_45674713delTTG	uc002zeg.1	-						DNMT3L_uc002zeh.1_Intron	NM_175867	NP_787063			cytosine-5-methyltransferase 3-like protein						DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)														---	---	---	---
POTEH	23784	broad.mit.edu	37	22	16264445	16264446	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16264445_16264446insA	uc010gqp.2	-						POTEH_uc002zlg.1_Intron|POTEH_uc002zlh.1_Intron	NM_001136213	NP_001129685			ANKRD26-like family C, member 3											skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	17352555	17352556	+	IGR	DEL	GT	-	-	rs140967896		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17352555_17352556delGT								HSFYL1 (42330 upstream) : GAB4 (90273 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	18528057	18528057	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18528057delG								FLJ41941 (7323 upstream) : TUBA8 (32629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	20185699	20185700	+	IGR	INS	-	TCT	TCT	rs150208796	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20185699_20185700insTCT								ZDHHC8 (50170 upstream) : LOC150197 (8155 downstream)																																			---	---	---	---
AIFM3	150209	broad.mit.edu	37	22	21320532	21320542	+	Intron	DEL	CAGGGCTGAAC	-	-	rs67155990		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21320532_21320542delCAGGGCTGAAC	uc002ztj.2	+						AIFM3_uc002ztk.2_Intron|AIFM3_uc002ztl.2_5'Flank|AIFM3_uc011ahx.1_5'Flank	NM_144704	NP_653305			apoptosis-inducing factor,						activation of caspase activity by cytochrome c|cell redox homeostasis|electron transport chain|induction of apoptosis|mitochondrial depolarization|transport	endoplasmic reticulum|mitochondrial inner membrane	2 iron, 2 sulfur cluster binding|caspase activator activity|flavin adenine dinucleotide binding|metal ion binding|oxidoreductase activity|protein binding			ovary(2)|lung(2)	4	all_cancers(11;3.71e-26)|all_epithelial(7;1.59e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0367)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)															---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	23262196	23262196	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23262196delT	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
DDT	1652	broad.mit.edu	37	22	24272790	24272791	+	Intron	DEL	CT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24272790_24272791delCT	uc011ajf.1	-							NM_001355	NP_001346			D-dopachrome tautomerase						melanin biosynthetic process	cytoplasm	D-dopachrome decarboxylase activity|dopachrome isomerase activity|protein binding				0																		---	---	---	---
SGSM1	129049	broad.mit.edu	37	22	25314462	25314463	+	Intron	INS	-	A	A	rs149974556		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25314462_25314463insA	uc003abg.2	+						SGSM1_uc003abh.2_Intron|SGSM1_uc010guu.1_Intron|SGSM1_uc003abj.2_Intron|SGSM1_uc003abi.1_Intron	NM_001039948	NP_001035037			RUN and TBC1 domain containing 2 isoform 1							Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5																		---	---	---	---
DEPDC5	9681	broad.mit.edu	37	22	32295376	32295377	+	Intron	INS	-	T	T	rs113285259		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32295376_32295377insT	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alu.2_Intron|DEPDC5_uc003alv.2_Intron|DEPDC5_uc003alw.2_Intron|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_Intron|DEPDC5_uc011aly.1_Intron	NM_014662	NP_055477			DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8																		---	---	---	---
TRIOBP	11078	broad.mit.edu	37	22	38166054	38166055	+	Intron	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38166054_38166055delTT	uc003atr.2	+						TRIOBP_uc003atu.2_Intron|TRIOBP_uc003atw.2_Intron|TRIOBP_uc003atx.1_Intron|TRIOBP_uc010gxh.2_Intron	NM_001039141	NP_001034230			TRIO and F-actin binding protein isoform 6						actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)																	---	---	---	---
Unknown	0	broad.mit.edu	37	22	38189555	38189556	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38189555_38189556insA								TRIOBP (16993 upstream) : H1F0 (11558 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	40108092	40108093	+	IGR	INS	-	GT	GT	rs138565824	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40108092_40108093insGT								CACNA1I (22354 upstream) : ENTHD1 (30957 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	41081400	41081400	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41081400delC								MCHR1 (2583 upstream) : SLC25A17 (84241 downstream)																																			---	---	---	---
RBX1	9978	broad.mit.edu	37	22	41358499	41358500	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41358499_41358500insT	uc003azk.2	+						XPNPEP3_uc011aoy.1_Intron	NM_014248	NP_055063			ring-box 1						DNA repair|interspecies interaction between organisms|protein neddylation|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|viral reproduction	Cul3-RING ubiquitin ligase complex|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytosol|nucleus|SCF ubiquitin ligase complex	NEDD8 ligase activity|protein binding|zinc ion binding			skin(1)	1																		---	---	---	---
PACSIN2	11252	broad.mit.edu	37	22	43358189	43358190	+	Intron	INS	-	T	T	rs34157596		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43358189_43358190insT	uc003bdg.3	-						PACSIN2_uc003bde.3_5'Flank|PACSIN2_uc003bdf.3_5'Flank	NM_007229	NP_009160			protein kinase C and casein kinase substrate in						actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	48458446	48458446	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48458446delT								TBC1D22A (888724 upstream) : FAM19A5 (426842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49687930	49687930	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49687930delA								FAM19A5 (540188 upstream) : C22orf34 (120246 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	951206	951213	+	IGR	DEL	TCTCTCCT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:951206_951213delTCTCTCCT								SHOX (331061 upstream) : CRLF2 (363674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1973436	1973437	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1973436_1973437insT								ASMT (211463 upstream) : DHRSX (164120 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	2568005	2568008	+	Intron	DEL	TGGA	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2568005_2568008delTGGA	uc004cqj.1	+											Homo sapiens cDNA FLJ13471 fis, clone PLACE1003566.																														---	---	---	---
Unknown	0	broad.mit.edu	37	X	4396299	4396300	+	IGR	INS	-	AGG	AGG			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:4396299_4396300insAGG								PRKX (764638 upstream) : None (None downstream)																																			---	---	---	---
ARHGAP6	395	broad.mit.edu	37	X	11558392	11558393	+	Intron	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11558392_11558393insA	uc004cup.1	-						ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cur.1_Intron	NM_013427	NP_038286			Rho GTPase activating protein 6 isoform 1						actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2																		---	---	---	---
PRPS2	5634	broad.mit.edu	37	X	12819341	12819342	+	Intron	DEL	GT	-	-	rs111670383		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12819341_12819342delGT	uc004cvb.2	+						PRPS2_uc004cva.2_Intron|PRPS2_uc010nec.2_Intron	NM_002765	NP_002756			phosphoribosyl pyrophosphate synthetase 2						nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	13511091	13511092	+	IGR	INS	-	T	T	rs72318156		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13511091_13511092insT								ATXN3L (172573 upstream) : EGFL6 (76649 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	18177361	18177361	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18177361delA								RAI2 (297904 upstream) : BEND2 (3692 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	19147002	19147002	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19147002delT								GPR64 (6325 upstream) : PDHA1 (215009 downstream)																																			---	---	---	---
PHEX	5251	broad.mit.edu	37	X	22140635	22140635	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22140635delC	uc004dah.2	+						PHEX_uc011mjr.1_Intron|PHEX_uc011mjs.1_Intron	NM_000444	NP_000435			phosphate-regulating neutral endopeptidase						biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	25090671	25090672	+	IGR	DEL	TT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:25090671_25090672delTT								ARX (56606 upstream) : None (None downstream)																																			---	---	---	---
XK	7504	broad.mit.edu	37	X	37583005	37583005	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37583005delT	uc004ddq.2	+							NM_021083	NP_066569			membrane transport protein XK						amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	37619076	37619076	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37619076delA								XK (27694 upstream) : CYBB (20194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	39046435	39046435	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39046435delA								MID1IP1 (380654 upstream) : BCOR (864066 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	39053283	39053283	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39053283delC								MID1IP1 (387502 upstream) : BCOR (857218 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	39214541	39214541	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39214541delT								MID1IP1 (548760 upstream) : BCOR (695960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	39215925	39215926	+	IGR	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39215925_39215926delAC								MID1IP1 (550144 upstream) : BCOR (694575 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	39901575	39901576	+	IGR	DEL	CA	-	-	rs150598422		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39901575_39901576delCA								None (None upstream) : BCOR (8925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	40757930	40757931	+	IGR	INS	-	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40757930_40757931insA								LOC100132831 (65481 upstream) : USP9X (186957 downstream)																																			---	---	---	---
CASK	8573	broad.mit.edu	37	X	41534808	41534808	+	Intron	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41534808delA	uc004dfl.3	-						CASK_uc004dfm.3_Intron|CASK_uc004dfn.3_Intron	NM_003688	NP_003679			calcium/calmodulin-dependent serine protein						cell adhesion	actin cytoskeleton|cytoplasm|nucleus|plasma membrane	ATP binding|calmodulin binding|guanylate kinase activity|protein serine/threonine kinase activity			ovary(3)|lung(2)|stomach(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	42325648	42325649	+	IGR	INS	-	AC	AC			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42325648_42325649insAC								CASK (543361 upstream) : PPP1R2P9 (310970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	43451343	43451350	+	IGR	DEL	TCTGTGTG	-	-	rs72113446		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:43451343_43451350delTCTGTGTG								PPP1R2P9 (813857 upstream) : MAOA (64059 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	48312124	48312124	+	IGR	DEL	A	-	-	rs72417883		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48312124delA								SSX4 (59339 upstream) : SLC38A5 (4804 downstream)																																			---	---	---	---
HDAC6	10013	broad.mit.edu	37	X	48683266	48683266	+	3'UTR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48683266delG	uc011mmi.1	+	29					HDAC6_uc004dks.1_3'UTR|HDAC6_uc010nig.1_3'UTR|HDAC6_uc004dkt.1_3'UTR|HDAC6_uc011mmk.1_3'UTR|HDAC6_uc004dkv.1_3'UTR|HDAC6_uc004dkw.1_3'UTR|HDAC6_uc004dkx.1_3'UTR	NM_006044	NP_006035			histone deacetylase 6						aggresome assembly|cellular response to hydrogen peroxide|Hsp90 deacetylation|lysosome localization|macroautophagy|misfolded or incompletely synthesized protein catabolic process|negative regulation of proteolysis|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|polyubiquitinated misfolded protein transport|positive regulation of apoptosis|positive regulation of cellular chaperone-mediated protein complex assembly|positive regulation of epithelial cell migration|positive regulation of receptor biosynthetic process|positive regulation of signal transduction|regulation of androgen receptor signaling pathway|regulation of receptor activity|response to growth factor stimulus|response to toxin|transcription, DNA-dependent|tubulin deacetylation	aggresome|caveola|cell leading edge|cytosol|histone deacetylase complex|microtubule associated complex|perinuclear region of cytoplasm	actin binding|alpha-tubulin binding|beta-catenin binding|dynein complex binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|Hsp90 protein binding|microtubule binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|polyubiquitin binding|tau protein binding|tubulin deacetylase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4					Vorinostat(DB02546)													---	---	---	---
HUWE1	10075	broad.mit.edu	37	X	53635341	53635342	+	Intron	DEL	AT	-	-	rs145059246		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53635341_53635342delAT	uc004dsp.2	-							NM_031407	NP_113584			HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17																		---	---	---	---
HUWE1	10075	broad.mit.edu	37	X	53653172	53653173	+	Intron	DEL	GT	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53653172_53653173delGT	uc004dsp.2	-							NM_031407	NP_113584			HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	54738627	54738628	+	IGR	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54738627_54738628delTG								GNL3L (146654 upstream) : ITIH5L (36704 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	56496048	56496049	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56496048_56496049insT								KLF8 (181728 upstream) : UBQLN2 (94011 downstream)																																			---	---	---	---
SPIN3	169981	broad.mit.edu	37	X	57013757	57013757	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57013757delT	uc004duu.3	-						SPIN3_uc004duw.3_Intron|SPIN3_uc004duv.3_Intron					Homo sapiens cDNA FLJ41127 fis, clone BRACE2017574, weakly  similar to SPINDLIN.						gamete generation					ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	57830433	57830434	+	IGR	INS	-	GT	GT			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57830433_57830434insGT								ZXDB (206527 upstream) : ZXDA (103764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	61709245	61709245	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61709245delT								None (None upstream) : SPIN4 (857863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	62212636	62212636	+	IGR	DEL	T	-	-	rs34355165		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62212636delT								None (None upstream) : SPIN4 (354472 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	64672721	64672722	+	IGR	INS	-	AC	AC	rs138713712		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64672721_64672722insAC								ZC4H2 (418128 upstream) : ZC3H12B (35984 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	65167424	65167424	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65167424delT								MSN (205632 upstream) : MIR223 (71288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	68765907	68765908	+	IGR	DEL	TG	-	-	rs141564833		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68765907_68765908delTG								FAM155B (13558 upstream) : EDA (70003 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	72542361	72542361	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72542361delA								NAP1L2 (107677 upstream) : CDX4 (124729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	74816629	74816629	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74816629delT								ZDHHC15 (73292 upstream) : MAGEE2 (186194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	75086017	75086017	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75086017delT								MAGEE2 (80946 upstream) : CXorf26 (306754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	75452209	75452210	+	IGR	INS	-	TG	TG			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75452209_75452210insTG								CXorf26 (54176 upstream) : MAGEE1 (195907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	80639091	80639091	+	IGR	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:80639091delC								SH3BGRL (85049 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	82756069	82756071	+	IGR	DEL	TAC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82756069_82756071delTAC								None (None upstream) : POU3F4 (7198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	86563601	86563601	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86563601delA								DACH2 (475996 upstream) : KLHL4 (209114 downstream)																																			---	---	---	---
KLHL4	56062	broad.mit.edu	37	X	86897326	86897326	+	Intron	DEL	C	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86897326delC	uc004efb.2	+						KLHL4_uc004efa.2_Intron	NM_019117	NP_061990			kelch-like 4 isoform 1							cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	92204549	92204549	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:92204549delA								PCDH11X (326323 upstream) : NAP1L3 (721380 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	102105158	102105159	+	Intron	DEL	AC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102105158_102105159delAC	uc004ejq.1	+						uc004ejr.2_Intron					Homo sapiens cDNA clone IMAGE:5576940.																														---	---	---	---
TMEM164	84187	broad.mit.edu	37	X	109291788	109291789	+	Intron	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109291788_109291789insT	uc004eom.2	+						TMEM164_uc004eol.2_Intron|TMEM164_uc010npq.2_Intron	NM_032227	NP_115603			transmembrane protein 164 isoform b							integral to membrane				large_intestine(1)|lung(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	110132085	110132085	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110132085delT								CHRDL1 (92799 upstream) : PAK3 (55428 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	116455109	116455110	+	IGR	INS	-	CTAA	CTAA	rs72369784		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:116455109_116455110insCTAA								CXorf61 (860972 upstream) : KLHL13 (576667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	118092465	118092465	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118092465delA								ZCCHC12 (131535 upstream) : LONRF3 (16248 downstream)																																			---	---	---	---
KIAA1210	57481	broad.mit.edu	37	X	118256683	118256684	+	Intron	DEL	TC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118256683_118256684delTC	uc004era.3	-							NM_020721	NP_065772			hypothetical protein LOC57481											ovary(4)|skin(1)	5																		---	---	---	---
SEPT6	23157	broad.mit.edu	37	X	118802276	118802277	+	Intron	DEL	AG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118802276_118802277delAG	uc004erv.2	-						SEPT6_uc010nqk.2_Intron|SEPT6_uc004ers.2_Intron|SEPT6_uc004ert.2_Intron|SEPT6_uc004eru.2_Intron|SEPT6_uc004erw.2_Intron|SEPT6_uc011mtv.1_Intron|SEPT6_uc011mtw.1_Intron	NM_015129	NP_055944			septin 6 isoform B						cell cycle|cytokinesis|interspecies interaction between organisms	cleavage furrow|condensed chromosome kinetochore|midbody|septin complex|spindle	GTP binding|protein binding			lung(1)|ovary(1)|prostate(1)|kidney(1)	4																		---	---	---	---
STAG2	10735	broad.mit.edu	37	X	123230027	123230027	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123230027delT	uc004etz.3	+						STAG2_uc004eua.2_Intron|STAG2_uc004eub.2_Intron|STAG2_uc004euc.2_Intron|STAG2_uc004eud.2_Intron|STAG2_uc004eue.2_Intron	NM_006603	NP_006594			stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	125939323	125939323	+	IGR	DEL	A	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125939323delA								DCAF12L1 (252481 upstream) : CXorf64 (14424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	126576395	126576396	+	IGR	INS	-	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:126576395_126576396insT								CXorf64 (620629 upstream) : ACTRT1 (608547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	129579376	129579376	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129579376delT								RBMX2 (32060 upstream) : FAM45B (49539 downstream)																																			---	---	---	---
LOC286467	286467	broad.mit.edu	37	X	130928305	130928306	+	Intron	DEL	TG	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130928305_130928306delTG	uc004ewi.2	-						LOC286467_uc004ewj.1_Intron	NR_026975				Homo sapiens cDNA FLJ40592 fis, clone THYMU2010192.												0																		---	---	---	---
PHF6	84295	broad.mit.edu	37	X	133528164	133528164	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133528164delT	uc004exj.2	+						PHF6_uc004exk.2_Intron|PHF6_uc011mvk.1_Intron|PHF6_uc004exh.2_Intron|PHF6_uc010nrr.2_Intron|PHF6_uc004exi.2_Intron	NM_001015877	NP_001015877			PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	137165570	137165570	+	IGR	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:137165570delT								ZIC3 (511313 upstream) : LOC158696 (531322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	139203938	139203938	+	IGR	DEL	G	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139203938delG								CXorf66 (156261 upstream) : SOX3 (381214 downstream)																																			---	---	---	---
SPANXC	64663	broad.mit.edu	37	X	140402046	140402046	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140402046delT	uc004fbl.2	-											Homo sapiens nuclear-associated protein SPAN-Xa (SPANX) mRNA, complete cds.							cytoplasm|nucleus					0	Acute lymphoblastic leukemia(192;7.65e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	147341975	147341975	+	IGR	DEL	A	-	-	rs12556460		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147341975delA								FMR1NB (233795 upstream) : AFF2 (240164 downstream)																																			---	---	---	---
MTM1	4534	broad.mit.edu	37	X	149761309	149761309	+	Intron	DEL	T	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149761309delT	uc004fef.3	+						MTM1_uc011mxx.1_Intron|MTM1_uc011mxy.1_Intron|MTM1_uc011mxz.1_Intron|MTM1_uc010nte.2_Intron	NM_000252	NP_000243			myotubularin						endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	Y	58973997	58974001	+	IGR	DEL	ATTCC	-	-			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58973997_58974001delATTCC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	58976110	58976111	+	IGR	INS	-	ACTCC	ACTCC			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58976110_58976111insACTCC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	59012880	59012881	+	IGR	INS	-	GT	GT	rs113332093		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59012880_59012881insGT								None (None upstream) : None (None downstream)																																			---	---	---	---
CAPZB	832	broad.mit.edu	37	1	19775402	19775402	+	Intron	SNP	T	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19775402T>C	uc010ocz.1	-						CAPZB_uc001bce.2_Intron|CAPZB_uc009vpk.2_Missense_Mutation_p.R3G	NM_004930	NP_004921			F-actin capping protein beta subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement	cytosol|F-actin capping protein complex|WASH complex	actin binding				0		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)														---	---	---	---
CD164L2	388611	broad.mit.edu	37	1	27709037	27709037	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27709037C>T	uc001boc.2	-	2	285	c.209G>A	c.(208-210)CGC>CAC	p.R70H		NM_207397	NP_997280	Q6UWJ8	C16L2_HUMAN	CD164 sialomucin-like 2	70	Extracellular (Potential).					integral to membrane					0		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
PABPC4	8761	broad.mit.edu	37	1	40030376	40030376	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40030376G>C	uc010oiv.1	-	9	2213	c.1315C>G	c.(1315-1317)CAA>GAA	p.Q439E	PABPC4_uc001cdl.2_Missense_Mutation_p.Q439E|PABPC4_uc001cdm.2_Missense_Mutation_p.Q439E	NM_003819	NP_003810	Q13310	PABP4_HUMAN	poly A binding protein, cytoplasmic 4 isoform 2	439					blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)															---	---	---	---
ZZZ3	26009	broad.mit.edu	37	1	78098818	78098818	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78098818C>G	uc001dhq.2	-	5	698	c.222G>C	c.(220-222)CAG>CAC	p.Q74H	ZZZ3_uc001dhr.2_Intron|ZZZ3_uc009wbz.1_Missense_Mutation_p.Q74H|ZZZ3_uc001dhp.2_Missense_Mutation_p.Q74H	NM_015534	NP_056349	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	74					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|large_intestine(1)	5																		---	---	---	---
RPTN	126638	broad.mit.edu	37	1	152128013	152128013	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152128013A>G	uc001ezs.1	-	3	1627	c.1562T>C	c.(1561-1563)TTC>TCC	p.F521S		NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin	521	Gln-rich.					proteinaceous extracellular matrix	calcium ion binding				0																		---	---	---	---
OR10R2	343406	broad.mit.edu	37	1	158449950	158449950	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158449950T>G	uc010pik.1	+	1	283	c.283T>G	c.(283-285)TTT>GTT	p.F95V	uc001fso.1_RNA	NM_001004472	NP_001004472	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R,	95	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)																	---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164781290	164781290	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164781290G>A	uc001gct.2	+	6	1159	c.901G>A	c.(901-903)GAA>AAA	p.E301K	PBX1_uc010pku.1_Missense_Mutation_p.E301K|PBX1_uc010pkv.1_Missense_Mutation_p.E218K|PBX1_uc001gcs.2_Missense_Mutation_p.E301K|PBX1_uc010pkw.1_Missense_Mutation_p.E191K	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	301					negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
OR2T33	391195	broad.mit.edu	37	1	248437081	248437081	+	Silent	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248437081G>A	uc010pzi.1	-	1	36	c.36C>T	c.(34-36)CTC>CTT	p.L12L		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	12	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)															---	---	---	---
OR2T12	127064	broad.mit.edu	37	1	248458077	248458077	+	Silent	SNP	G	A	A	rs140272693	byFrequency	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248458077G>A	uc010pzj.1	-	1	804	c.804C>T	c.(802-804)CAC>CAT	p.H268H		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	268	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)															---	---	---	---
ADCY3	109	broad.mit.edu	37	2	25050904	25050904	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25050904T>C	uc002rfs.3	-	13	2498	c.2299A>G	c.(2299-2301)ATG>GTG	p.M767V	ADCY3_uc002rfr.3_Intron|ADCY3_uc010ykm.1_Missense_Mutation_p.M767V	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3	767	Helical; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)															OREG0014498	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
XDH	7498	broad.mit.edu	37	2	31562516	31562516	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31562516C>T	uc002rnv.1	-	34	3692	c.3613G>A	c.(3613-3615)GGC>AGC	p.G1205S		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	1205					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)													---	---	---	---
VIT	5212	broad.mit.edu	37	2	37041491	37041491	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37041491A>G	uc002rpl.2	+	16	2290	c.2069A>G	c.(2068-2070)CAG>CGG	p.Q690R	VIT_uc002rpm.2_Missense_Mutation_p.Q668R|VIT_uc010ezv.2_Missense_Mutation_p.Q646R|VIT_uc010ezw.2_Missense_Mutation_p.Q647R	NM_053276	NP_444506	Q6UXI7	VITRN_HUMAN	vitrin	675						proteinaceous extracellular matrix				ovary(1)|pancreas(1)	2		all_hematologic(82;0.248)																---	---	---	---
GFPT1	2673	broad.mit.edu	37	2	69565693	69565693	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69565693C>T	uc002sfh.2	-	13	1333	c.1154G>A	c.(1153-1155)CGT>CAT	p.R385H		NM_002056	NP_002047	Q06210	GFPT1_HUMAN	glucosamine-fructose-6-phosphate	403	SIS 1.		R -> H (in LGMTA).		dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1																		---	---	---	---
SEMA4C	54910	broad.mit.edu	37	2	97531014	97531014	+	Silent	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97531014C>T	uc002sxh.3	-	7	721	c.561G>A	c.(559-561)ACG>ACA	p.T187T	SEMA4C_uc002sxf.3_5'Flank|SEMA4C_uc002sxe.2_5'Flank|SEMA4C_uc002sxg.3_Silent_p.T240T	NM_017789	NP_060259	Q9C0C4	SEM4C_HUMAN	semaphorin 4C precursor	187	Extracellular (Potential).|Dominant negative effect on myogenic differentiation (By similarity).|Sema.				muscle cell differentiation|nervous system development|positive regulation of stress-activated MAPK cascade	cell junction|integral to membrane|postsynaptic density|postsynaptic membrane|synaptic vesicle membrane	receptor activity			skin(2)	2																		---	---	---	---
EIF5B	9669	broad.mit.edu	37	2	99978270	99978270	+	Silent	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99978270C>A	uc002tab.2	+	4	1090	c.906C>A	c.(904-906)CCC>CCA	p.P302P		NM_015904	NP_056988	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	302					regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			ovary(2)|pancreas(1)	3																		---	---	---	---
MAP4K4	9448	broad.mit.edu	37	2	102486143	102486143	+	Silent	SNP	A	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102486143A>G	uc002tbg.2	+	20	2335	c.2280A>G	c.(2278-2280)AAA>AAG	p.K760K	MAP4K4_uc002tbc.2_Silent_p.K841K|MAP4K4_uc002tbd.2_Silent_p.K733K|MAP4K4_uc002tbe.2_Silent_p.K679K|MAP4K4_uc002tbf.2_Silent_p.K730K|MAP4K4_uc010yvy.1_Silent_p.K756K|MAP4K4_uc002tbh.2_Silent_p.K678K|MAP4K4_uc002tbi.2_Silent_p.K563K|MAP4K4_uc010yvz.1_Silent_p.K736K|MAP4K4_uc002tbk.2_Silent_p.K215K|MAP4K4_uc002tbl.2_5'UTR	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	760					intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
SLC4A10	57282	broad.mit.edu	37	2	162813500	162813500	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162813500A>G	uc002ubx.3	+	20	2727	c.2543A>G	c.(2542-2544)AAA>AGA	p.K848R	SLC4A10_uc002uby.3_Missense_Mutation_p.K818R|SLC4A10_uc010zcs.1_Missense_Mutation_p.K829R	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	848	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179414481	179414481	+	Silent	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179414481G>A	uc010zfg.1	-	287	84488	c.84264C>T	c.(84262-84264)ATC>ATT	p.I28088I	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.I21783I|TTN_uc010zfi.1_Silent_p.I21716I|TTN_uc010zfj.1_Silent_p.I21591I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29015							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179426149	179426149	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179426149A>G	uc010zfg.1	-	275	77230	c.77006T>C	c.(77005-77007)ATT>ACT	p.I25669T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.I19364T|TTN_uc010zfi.1_Missense_Mutation_p.I19297T|TTN_uc010zfj.1_Missense_Mutation_p.I19172T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26596							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
DNAH7	56171	broad.mit.edu	37	2	196636407	196636407	+	Missense_Mutation	SNP	C	T	T	rs113133988		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196636407C>T	uc002utj.3	-	61	11511	c.11410G>A	c.(11410-11412)GTA>ATA	p.V3804I	DNAH7_uc002uti.3_Missense_Mutation_p.V287I	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3804					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12																		---	---	---	---
ARPP21	10777	broad.mit.edu	37	3	35732361	35732361	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35732361C>T	uc003cgb.2	+	9	814	c.550C>T	c.(550-552)CAT>TAT	p.H184Y	ARPP21_uc003cga.2_Missense_Mutation_p.H184Y|ARPP21_uc011axy.1_Missense_Mutation_p.H184Y|ARPP21_uc003cgf.2_Missense_Mutation_p.H20Y	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD	184	R3H.					cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3																		---	---	---	---
ACAA1	30	broad.mit.edu	37	3	38168161	38168161	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38168161G>C	uc003cht.2	-	8	864	c.657C>G	c.(655-657)TTC>TTG	p.F219L	ACAA1_uc003chu.2_Missense_Mutation_p.F186L|ACAA1_uc010hgy.2_Missense_Mutation_p.F178L|ACAA1_uc010hgz.2_Missense_Mutation_p.F219L|ACAA1_uc003chv.2_Missense_Mutation_p.F67L	NM_001607	NP_001598	P09110	THIK_HUMAN	acetyl-Coenzyme A acyltransferase 1 isoform a	219					fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy	peroxisomal matrix	acetyl-CoA C-acyltransferase activity|protein binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)														---	---	---	---
SCN11A	11280	broad.mit.edu	37	3	38946752	38946752	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38946752C>T	uc011ays.1	-	11	1733	c.1534G>A	c.(1534-1536)GAG>AAG	p.E512K		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	512					response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)													---	---	---	---
RPSA	3921	broad.mit.edu	37	3	39453152	39453152	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39453152G>A	uc003cjp.2	+	5	596	c.511G>A	c.(511-513)GTG>ATG	p.V171M	RPSA_uc003cjq.2_Missense_Mutation_p.V176M|RPSA_uc003cjr.2_Missense_Mutation_p.V171M|RPSA_uc003cjt.2_RNA	NM_002295	NP_002286	P08865	RSSA_HUMAN	ribosomal protein SA	171	Laminin-binding.				cell adhesion|endocrine pancreas development|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|ribosomal small subunit assembly|rRNA export from nucleus|translational elongation|translational termination|viral transcription	90S preribosome|cytosolic small ribosomal subunit|nucleus|plasma membrane	protein binding|receptor activity|ribosome binding|structural constituent of ribosome			lung(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0509)|Kidney(284;0.064)														---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78655949	78655949	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78655949C>A	uc003dqe.2	-	29	4886	c.4678G>T	c.(4678-4680)GGG>TGG	p.G1560W	ROBO1_uc003dqb.2_Missense_Mutation_p.G1521W|ROBO1_uc003dqc.2_Missense_Mutation_p.G1460W|ROBO1_uc003dqd.2_Missense_Mutation_p.G1515W|ROBO1_uc010hoh.2_Missense_Mutation_p.G752W|ROBO1_uc011bgl.1_Missense_Mutation_p.G1132W	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	1560	Cytoplasmic (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89259351	89259351	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89259351C>A	uc003dqy.2	+	3	720	c.495C>A	c.(493-495)AAC>AAA	p.N165K	EPHA3_uc003dqx.1_Missense_Mutation_p.N165K|EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	165	Extracellular (Potential).					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
SLC9A10	285335	broad.mit.edu	37	3	111887828	111887828	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111887828C>G	uc003dyu.2	-	25	3355	c.3133G>C	c.(3133-3135)GAT>CAT	p.D1045H	SLC9A10_uc011bhu.1_Missense_Mutation_p.D308H|SLC9A10_uc010hqc.2_Missense_Mutation_p.D997H	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	1045					cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5																		---	---	---	---
HCLS1	3059	broad.mit.edu	37	3	121366177	121366177	+	Silent	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121366177G>T	uc003eeh.3	-	4	402	c.277C>A	c.(277-279)CGA>AGA	p.R93R	HCLS1_uc011bjj.1_Silent_p.R93R|HCLS1_uc011bjk.1_RNA|HCLS1_uc011bjl.1_Silent_p.R93R	NM_005335	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	93	Cortactin 1.				erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(114;0.0912)														---	---	---	---
IGSF10	285313	broad.mit.edu	37	3	151160847	151160847	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151160847C>A	uc011bod.1	-	5	5888	c.5888G>T	c.(5887-5889)TGC>TTC	p.C1963F	IGSF10_uc011bob.1_5'Flank|IGSF10_uc011boc.1_5'Flank	NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	1963	Ig-like C2-type 6.				cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
SH3TC1	54436	broad.mit.edu	37	4	8229754	8229754	+	Missense_Mutation	SNP	C	A	A	rs145110444	byFrequency;by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8229754C>A	uc003gkv.3	+	12	2434	c.2333C>A	c.(2332-2334)CCG>CAG	p.P778Q	SH3TC1_uc003gkw.3_Missense_Mutation_p.P702Q|SH3TC1_uc003gkx.3_RNA|SH3TC1_uc003gky.2_5'Flank	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	778							binding			large_intestine(2)|pancreas(1)	3																		---	---	---	---
CC2D2A	57545	broad.mit.edu	37	4	15529140	15529140	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15529140A>G	uc010idv.2	+	13	1465	c.1220A>G	c.(1219-1221)GAC>GGC	p.D407G	CC2D2A_uc003gnx.2_Missense_Mutation_p.D358G|CC2D2A_uc003gnv.2_Missense_Mutation_p.D407G	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A isoform	407					cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3																		---	---	---	---
PHOX2B	8929	broad.mit.edu	37	4	41749524	41749524	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41749524C>T	uc003gwf.3	-	2	631	c.271G>A	c.(271-273)GGC>AGC	p.G91S		NM_003924	NP_003915	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	91					positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			autonomic_ganglia(7)|lung(2)|ovary(2)|central_nervous_system(1)	12								Mis|F		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				---	---	---	---
PTPN13	5783	broad.mit.edu	37	4	87610305	87610305	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87610305A>C	uc003hpz.2	+	5	988	c.508A>C	c.(508-510)AAA>CAA	p.K170Q	PTPN13_uc003hpy.2_Missense_Mutation_p.K170Q|PTPN13_uc003hqa.2_Missense_Mutation_p.K170Q|PTPN13_uc003hqb.2_Missense_Mutation_p.K170Q	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	170	KIND.					cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)														---	---	---	---
TRAM1L1	133022	broad.mit.edu	37	4	118006510	118006510	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118006510G>C	uc003ibv.3	-	1	227	c.40C>G	c.(40-42)CTC>GTC	p.L14V		NM_152402	NP_689615	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like	14	Cytoplasmic (Potential).				protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane				central_nervous_system(1)	1																		---	---	---	---
CDH18	1016	broad.mit.edu	37	5	19747254	19747254	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19747254G>T	uc003jgc.2	-	3	697	c.320C>A	c.(319-321)ACG>AAG	p.T107K	CDH18_uc003jgd.2_Missense_Mutation_p.T107K|CDH18_uc011cnm.1_Missense_Mutation_p.T107K	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	107	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)																	---	---	---	---
PCDHB13	56123	broad.mit.edu	37	5	140595155	140595155	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140595155C>T	uc003lja.1	+	1	1647	c.1460C>T	c.(1459-1461)ACC>ATC	p.T487I		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	487	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHGA3	56112	broad.mit.edu	37	5	140723858	140723858	+	Silent	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140723858C>T	uc003ljm.1	+	1	258	c.258C>T	c.(256-258)ACC>ACT	p.T86T	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Silent_p.T86T	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	86	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHGA6	56109	broad.mit.edu	37	5	140755330	140755330	+	Silent	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140755330C>A	uc003ljy.1	+	1	1680	c.1680C>A	c.(1678-1680)CCC>CCA	p.P560P	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Silent_p.P560P	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	560	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDH12	51294	broad.mit.edu	37	5	141335911	141335911	+	Silent	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141335911G>T	uc003llx.2	-	1	2717	c.1506C>A	c.(1504-1506)TCC>TCA	p.S502S		NM_016580	NP_057664	Q9NPG4	PCD12_HUMAN	protocadherin 12 precursor	502	Extracellular (Potential).|Cadherin 5.				neuron recognition	integral to plasma membrane	calcium ion binding			ovary(3)	3		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
GRM4	2914	broad.mit.edu	37	6	34004175	34004175	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34004175G>A	uc003oir.3	-	8	1882	c.1712C>T	c.(1711-1713)ACG>ATG	p.T571M	GRM4_uc011dsn.1_Missense_Mutation_p.T524M|GRM4_uc010jvh.2_Missense_Mutation_p.T571M|GRM4_uc010jvi.2_Missense_Mutation_p.T263M|GRM4_uc003oio.2_Missense_Mutation_p.T263M|GRM4_uc003oip.2_RNA|GRM4_uc011dsl.1_Missense_Mutation_p.T431M|GRM4_uc003oiq.2_Missense_Mutation_p.T438M|GRM4_uc011dsm.1_Missense_Mutation_p.T402M	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	571	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)													---	---	---	---
MOXD1	26002	broad.mit.edu	37	6	132636912	132636912	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132636912C>A	uc003qdf.2	-	10	1469	c.1370G>T	c.(1369-1371)GGA>GTA	p.G457V	MOXD1_uc003qde.2_Missense_Mutation_p.G389V	NM_015529	NP_056344	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1 isoform 2	457	Lumenal (Potential).				catecholamine metabolic process	endoplasmic reticulum membrane|integral to membrane	copper ion binding|dopamine beta-monooxygenase activity			ovary(1)	1	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)														---	---	---	---
NFE2L3	9603	broad.mit.edu	37	7	26225139	26225139	+	Missense_Mutation	SNP	A	T	T	rs138448739	by1000genomes	TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26225139A>T	uc003sxq.2	+	4	2093	c.1821A>T	c.(1819-1821)GAA>GAT	p.E607D		NM_004289	NP_004280	Q9Y4A8	NF2L3_HUMAN	nuclear factor erythroid 2-like 3	607	Leucine-zipper.				transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			skin(3)|ovary(1)	4																		---	---	---	---
OGDH	4967	broad.mit.edu	37	7	44735662	44735662	+	Silent	SNP	T	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44735662T>G	uc003tln.2	+	13	1816	c.1707T>G	c.(1705-1707)GCT>GCG	p.A569A	OGDH_uc011kbx.1_Silent_p.A565A|OGDH_uc011kby.1_Silent_p.A419A|OGDH_uc003tlp.2_Silent_p.A580A|OGDH_uc011kbz.1_Silent_p.A364A|OGDH_uc003tlo.1_Silent_p.A402A	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	569					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)													---	---	---	---
POM121L12	285877	broad.mit.edu	37	7	53103758	53103758	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53103758C>T	uc003tpz.2	+	1	410	c.394C>T	c.(394-396)CGG>TGG	p.R132W		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	132											0																		---	---	---	---
SAMD9	54809	broad.mit.edu	37	7	92731506	92731506	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92731506T>A	uc003umf.2	-	3	4161	c.3905A>T	c.(3904-3906)AAA>ATA	p.K1302I	SAMD9_uc003umg.2_Missense_Mutation_p.K1302I	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1302						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)															---	---	---	---
MUC17	140453	broad.mit.edu	37	7	100676181	100676181	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100676181C>A	uc003uxp.1	+	3	1537	c.1484C>A	c.(1483-1485)ACT>AAT	p.T495N	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	495	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|6.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---
PIK3CG	5294	broad.mit.edu	37	7	106508774	106508774	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106508774A>C	uc003vdv.3	+	2	853	c.768A>C	c.(766-768)AAA>AAC	p.K256N	PIK3CG_uc003vdu.2_Missense_Mutation_p.K256N|PIK3CG_uc003vdw.2_Missense_Mutation_p.K256N	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	256					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38																		---	---	---	---
RBM28	55131	broad.mit.edu	37	7	127958000	127958000	+	Intron	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127958000C>T	uc003vmp.2	-						RBM28_uc003vmo.2_Intron|RBM28_uc011koj.1_Intron	NM_018077	NP_060547			RNA binding motif protein 28						mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2																		---	---	---	---
TNFRSF10A	8797	broad.mit.edu	37	8	23054652	23054652	+	Silent	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23054652G>T	uc003xda.2	-	9	1145	c.1080C>A	c.(1078-1080)CCC>CCA	p.P360P		NM_003844	NP_003835	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily,	360	Cytoplasmic (Potential).				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors		caspase activator activity|death receptor activity|TRAIL binding|transcription factor binding			central_nervous_system(3)|ovary(2)|skin(1)	6		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)														---	---	---	---
GNRH1	2796	broad.mit.edu	37	8	25279115	25279115	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25279115G>T	uc003xem.3	-	3	1052	c.211C>A	c.(211-213)CCC>ACC	p.P71T	PPP2R2A_uc003xek.2_Intron|GNRH1_uc003xen.3_Missense_Mutation_p.P71T	NM_001083111	NP_001076580	P01148	GON1_HUMAN	gonadotropin-releasing hormone 1 precursor	71					cell-cell signaling|multicellular organismal development|negative regulation of cell proliferation|signal transduction	soluble fraction	gonadotropin hormone-releasing hormone activity			large_intestine(1)	1		all_cancers(63;0.0423)|Ovarian(32;0.000626)|all_epithelial(46;0.0186)|Hepatocellular(4;0.114)|Breast(100;0.14)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0201)|Epithelial(17;1.25e-12)|Colorectal(74;0.0113)|COAD - Colon adenocarcinoma(73;0.0385)														---	---	---	---
DDHD2	23259	broad.mit.edu	37	8	38117559	38117559	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38117559G>C	uc003xlb.2	+	17	2433	c.2056G>C	c.(2056-2058)GAG>CAG	p.E686Q	DDHD2_uc003xlc.2_Missense_Mutation_p.E686Q|DDHD2_uc003xld.2_Missense_Mutation_p.E305Q	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1	686	DDHD.				lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)															---	---	---	---
PHF20L1	51105	broad.mit.edu	37	8	133826883	133826883	+	Missense_Mutation	SNP	C	T	T	rs142733026		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133826883C>T	uc003ytt.2	+	10	1257	c.932C>T	c.(931-933)GCG>GTG	p.A311V	PHF20L1_uc003yts.2_Missense_Mutation_p.A311V|PHF20L1_uc011lja.1_Missense_Mutation_p.A285V|PHF20L1_uc003ytu.1_RNA	NM_016018	NP_057102	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1 isoform 1	311							nucleic acid binding|zinc ion binding			ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)															---	---	---	---
CDKN2A	1029	broad.mit.edu	37	9	21974677	21974677	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21974677C>A	uc003zpk.2	-	1	362	c.150G>T	c.(148-150)CAG>CAT	p.Q50H	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_Missense_Mutation_p.Q50H|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Intron	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	50	ANK 2.		Q -> R (in CMM2).		cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.?(25)|p.Q50*(5)|p.Q50R(1)|p.V28_V51del(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)			17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			---	---	---	---
DFNB31	25861	broad.mit.edu	37	9	117266867	117266867	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117266867A>T	uc004biz.3	-	1	864	c.215T>A	c.(214-216)TTC>TAC	p.F72Y	DFNB31_uc004biy.3_5'Flank|DFNB31_uc004bja.3_Missense_Mutation_p.F72Y|DFNB31_uc004bjb.2_Missense_Mutation_p.F72Y	NM_015404	NP_056219	Q9P202	WHRN_HUMAN	CASK-interacting protein CIP98 isoform 1	72					inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
MUC5B	727897	broad.mit.edu	37	11	1266007	1266007	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1266007T>C	uc009ycr.1	+	48	9937	c.9811T>C	c.(9811-9813)TGG>CGG	p.W3271R	MUC5B_uc001ltb.2_Missense_Mutation_p.W2636R	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	2633	7 X Cys-rich subdomain repeats.|11 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)														---	---	---	---
OSBP	5007	broad.mit.edu	37	11	59345748	59345748	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59345748G>A	uc001noc.1	-	12	2414	c.1934C>T	c.(1933-1935)ACG>ATG	p.T645M	OSBP_uc009ymr.1_RNA	NM_002556	NP_002547	P22059	OSBP1_HUMAN	oxysterol binding protein	645					lipid transport	Golgi membrane	oxysterol binding			large_intestine(1)	1		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)														---	---	---	---
AHNAK	79026	broad.mit.edu	37	11	62292862	62292862	+	Silent	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62292862C>A	uc001ntl.2	-	5	9327	c.9027G>T	c.(9025-9027)CCG>CCT	p.P3009P	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	3009					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)																---	---	---	---
WDR74	54663	broad.mit.edu	37	11	62601259	62601259	+	Intron	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62601259C>A	uc001nvm.1	-						STX5_uc001nvh.2_5'Flank|STX5_uc010rmi.1_5'Flank|STX5_uc009yoh.2_5'Flank|STX5_uc001nvi.2_5'Flank|STX5_uc010rmj.1_5'Flank|STX5_uc001nvj.2_5'Flank|WDR74_uc001nvk.1_Intron|WDR74_uc001nvl.1_Intron|WDR74_uc001nvn.1_Intron|WDR74_uc009yoi.1_Intron	NM_018093	NP_060563			WD repeat domain 74							nucleolus				ovary(1)	1																		---	---	---	---
RARRES3	5920	broad.mit.edu	37	11	63312350	63312350	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63312350C>A	uc001nxf.3	+	3	444	c.376C>A	c.(376-378)CGC>AGC	p.R126S		NM_004585	NP_004576	Q9UL19	TIG3_HUMAN	retinoic acid receptor responder (tazarotene	126					lipid catabolic process|negative regulation of cell proliferation		hydrolase activity			ovary(1)	1																		---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92623982	92623982	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92623982C>G	uc001pdj.3	+	25	13394	c.13377C>G	c.(13375-13377)AGC>AGG	p.S4459R	FAT3_uc001pdi.3_Missense_Mutation_p.S931R	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	4491	Pro-rich.|Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
ACAD8	27034	broad.mit.edu	37	11	134129524	134129524	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134129524A>G	uc001qhk.2	+	6	651	c.590A>G	c.(589-591)GAG>GGG	p.E197G	ACAD8_uc009zdc.2_3'UTR|ACAD8_uc010sco.1_Missense_Mutation_p.E99G|ACAD8_uc010scp.1_RNA|ACAD8_uc010scq.1_Missense_Mutation_p.E120G|ACAD8_uc001qhl.2_Missense_Mutation_p.E70G|ACAD8_uc010scr.1_Missense_Mutation_p.E159G|ACAD8_uc009zde.1_Missense_Mutation_p.E70G	NM_014384	NP_055199	Q9UKU7	ACAD8_HUMAN	acyl-Coenzyme A dehydrogenase family, member 8	197					branched chain family amino acid catabolic process|lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding				0	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)														---	---	---	---
KCNA5	3741	broad.mit.edu	37	12	5153718	5153718	+	Silent	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5153718G>T	uc001qni.2	+	1	634	c.405G>T	c.(403-405)CTG>CTT	p.L135L		NM_002234	NP_002225	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related	135						Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(2)|breast(2)	4																		---	---	---	---
PRB3	5544	broad.mit.edu	37	12	11420862	11420862	+	Silent	SNP	T	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11420862T>G	uc001qzs.2	-	3	359	c.321A>C	c.(319-321)GGA>GGC	p.G107G	PRB4_uc001qzf.1_Intron	NM_006249	NP_006240	Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	107	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.|3.					extracellular region	Gram-negative bacterial cell surface binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.201)															---	---	---	---
LST-3TM12	338821	broad.mit.edu	37	12	21201777	21201777	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21201777G>T	uc010sin.1	+	8	1126	c.1126G>T	c.(1126-1128)GTT>TTT	p.V376F	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Missense_Mutation_p.V423F	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	376						membrane	transporter activity				0																		---	---	---	---
KRAS	3845	broad.mit.edu	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	A	A	rs121913530		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25398285C>A	uc001rgp.1	-	2	215	c.34G>T	c.(34-36)GGT>TGT	p.G12C	KRAS_uc001rgq.1_Missense_Mutation_p.G12C|KRAS_uc001rgr.2_RNA	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	12	GTP.		G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation).|G -> R (in lung cancer and bladder cancer; somatic mutation).|G -> S (in lung carcinoma and GASC; somatic mutation).|G -> A (in a colorectal cancer sample; somatic mutation).|G -> C (in lung carcinoma; somatic mutation).|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation).		activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding	p.G12D(7175)|p.G12V(4780)|p.G12C(2482)|p.G12A(1180)|p.G12S(1119)|p.G12R(691)|p.G12?(50)|p.G12F(34)|p.G12G(6)|p.G12N(6)|p.G12L(5)|p.G12I(4)|p.G12_G13insG(4)|p.G12E(3)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12fs*3(1)		large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12C(CALU1_LUNG)|G12C(NCIH2030_LUNG)|G12C(LU99_LUNG)|G12C(NCIH1792_LUNG)|G12R(KP2_PANCREAS)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(NCIH2122_LUNG)|G12C(NCIH358_LUNG)|G12R(PSN1_PANCREAS)|G12C(KYSE410_OESOPHAGUS)|G12S(A549_LUNG)|G12R(HUPT3_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12C(HCC44_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(SW1463_LARGE_INTESTINE)|G12C(NCIH23_LUNG)|G12C(LU65_LUNG)|G12C(NCIH1373_LUNG)|G12C(MIAPACA2_PANCREAS)|G12R(HS274T_BREAST)|G12S(LS123_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(OV56_OVARY)|G12C(IALM_LUNG)	119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			---	---	---	---
ADAMTS20	80070	broad.mit.edu	37	12	43777711	43777711	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43777711C>A	uc010skx.1	-	30	4522	c.4522G>T	c.(4522-4524)GTG>TTG	p.V1508L		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1508	TSP type-1 12.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)														---	---	---	---
AMIGO2	347902	broad.mit.edu	37	12	47471698	47471698	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47471698C>A	uc001rpm.2	-	3	1743	c.1088G>T	c.(1087-1089)TGT>TTT	p.C363F	FAM113B_uc001rpn.2_5'Flank|AMIGO2_uc001rpk.2_Missense_Mutation_p.C363F|AMIGO2_uc001rpl.2_Missense_Mutation_p.C363F	NM_001143668	NP_001137140	Q86SJ2	AMGO2_HUMAN	adhesion molecule with Ig-like domain 2	363	Extracellular (Potential).|Ig-like C2-type.				heterophilic cell-cell adhesion|homophilic cell adhesion	integral to membrane|nucleus|plasma membrane				ovary(1)|skin(1)	2	Renal(347;0.138)|Lung SC(27;0.192)																	---	---	---	---
TPH2	121278	broad.mit.edu	37	12	72366364	72366364	+	Missense_Mutation	SNP	G	T	T	rs139896303		TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72366364G>T	uc009zrw.1	+	6	815	c.674G>T	c.(673-675)CGG>CTG	p.R225L	TPH2_uc001swy.2_Missense_Mutation_p.R135L	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	225					aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)													---	---	---	---
MDGA2	161357	broad.mit.edu	37	14	47311173	47311173	+	Silent	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47311173G>T	uc001wwj.3	-	17	3028	c.2832C>A	c.(2830-2832)CCC>CCA	p.P944P	MDGA2_uc001wwh.3_Silent_p.P146P|MDGA2_uc001wwi.3_Silent_p.P715P	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	944					spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6																		---	---	---	---
KCNK10	54207	broad.mit.edu	37	14	88729892	88729892	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88729892G>A	uc001xwo.2	-	2	498	c.41C>T	c.(40-42)GCC>GTC	p.A14V	KCNK10_uc001xwm.2_Missense_Mutation_p.A19V|KCNK10_uc001xwn.2_Missense_Mutation_p.A19V	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	14	Cytoplasmic (Potential).				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5																		---	---	---	---
ZC3H14	79882	broad.mit.edu	37	14	89061238	89061238	+	Intron	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89061238G>A	uc001xww.2	+						ZC3H14_uc010twd.1_Intron|ZC3H14_uc010twe.1_Intron|ZC3H14_uc001xwx.2_Intron|ZC3H14_uc010twf.1_Intron|ZC3H14_uc001xwy.2_Intron|ZC3H14_uc010twg.1_Intron|ZC3H14_uc001xxa.2_Intron|ZC3H14_uc001xxc.2_Missense_Mutation_p.M54I|ZC3H14_uc001xxb.2_Missense_Mutation_p.M56I	NM_024824	NP_079100			zinc finger CCCH-type containing 14 isoform 1							cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
TRIP11	9321	broad.mit.edu	37	14	92461743	92461743	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92461743G>C	uc001xzy.2	-	14	5797	c.5009C>G	c.(5008-5010)GCT>GGT	p.A1670G	TRIP11_uc010auf.1_Missense_Mutation_p.A1406G	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1670	Potential.			A -> R (in Ref. 1; AAD09135).	transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)				T	PDGFRB	AML								---	---	---	---
AHNAK2	113146	broad.mit.edu	37	14	105412466	105412466	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105412466C>T	uc010axc.1	-	7	9442	c.9322G>A	c.(9322-9324)GGC>AGC	p.G3108S	AHNAK2_uc001ypx.2_Missense_Mutation_p.G3008S	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3108						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)															---	---	---	---
C15orf2	23742	broad.mit.edu	37	15	24924152	24924152	+	Silent	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24924152C>A	uc001ywo.2	+	1	3612	c.3138C>A	c.(3136-3138)CCC>CCA	p.P1046P		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	1046					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)														---	---	---	---
NDNL2	56160	broad.mit.edu	37	15	29561554	29561554	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29561554T>C	uc001zco.2	-	1	464	c.356A>G	c.(355-357)TAC>TGC	p.Y119C	FAM189A1_uc010azk.1_Intron	NM_138704	NP_619649	Q96MG7	MAGG1_HUMAN	necdin-like 2	119	MAGE.				regulation of growth	cytoplasm|nucleus					0		all_lung(180;4.69e-11)|Breast(32;0.0013)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00736)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)														---	---	---	---
UBR1	197131	broad.mit.edu	37	15	43290443	43290443	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43290443G>C	uc001zqq.2	-	33	3746	c.3680C>G	c.(3679-3681)GCT>GGT	p.A1227G		NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin	1227					cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)														---	---	---	---
SPG11	80208	broad.mit.edu	37	15	44949505	44949505	+	Intron	SNP	G	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44949505G>C	uc001ztx.2	-						SPG11_uc010ueh.1_Intron|SPG11_uc010uei.1_Intron|SPG11_uc001zua.1_Intron	NM_025137	NP_079413			spatacsin isoform 1						cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)														---	---	---	---
TRAF7	84231	broad.mit.edu	37	16	2223503	2223503	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2223503G>A	uc002cow.2	+	11	1133	c.1034G>A	c.(1033-1035)AGC>AAC	p.S345N		NM_032271	NP_115647	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7	345					activation of MAPKKK activity|apoptosis|regulation of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic membrane-bounded vesicle|ubiquitin ligase complex	identical protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3																		---	---	---	---
USP31	57478	broad.mit.edu	37	16	23080361	23080361	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23080361G>T	uc002dll.2	-	16	3065	c.3065C>A	c.(3064-3066)ACA>AAA	p.T1022K	USP31_uc002dlk.2_Missense_Mutation_p.T294K|USP31_uc010vca.1_Missense_Mutation_p.T325K|USP31_uc010bxm.2_Missense_Mutation_p.T310K	NM_020718	NP_065769	Q70CQ4	UBP31_HUMAN	ubiquitin specific peptidase 31	1022	Ser-rich.				ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(3)|lung(3)|breast(2)|pancreas(1)|skin(1)	10				GBM - Glioblastoma multiforme(48;0.0187)														---	---	---	---
CDH8	1006	broad.mit.edu	37	16	61935112	61935112	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61935112T>C	uc002eog.1	-	3	770	c.518A>G	c.(517-519)CAT>CGT	p.H173R		NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	173	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)														---	---	---	---
CALB2	794	broad.mit.edu	37	16	71419537	71419537	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71419537G>A	uc002faa.3	+	10	755	c.685G>A	c.(685-687)GAG>AAG	p.E229K	CALB2_uc010vme.1_RNA|CALB2_uc002fac.3_3'UTR	NM_001740	NP_001731	P22676	CALB2_HUMAN	calbindin 2 isoform 1	229	EF-hand 5.						calcium ion binding				0		Ovarian(137;0.125)																---	---	---	---
JPH3	57338	broad.mit.edu	37	16	87636906	87636906	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87636906G>T	uc002fkd.2	+	1	408	c.154G>T	c.(154-156)GTC>TTC	p.V52F	JPH3_uc010vou.1_Intron	NM_020655	NP_065706	Q8WXH2	JPH3_HUMAN	junctophilin 3	52	Gly-rich.|Cytoplasmic (Potential).|MORN 2.				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane	protein binding			ovary(1)|pancreas(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0287)														---	---	---	---
P2RX5	5026	broad.mit.edu	37	17	3595058	3595058	+	Silent	SNP	T	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3595058T>C	uc002fwi.2	-	2	452	c.168A>G	c.(166-168)CAA>CAG	p.Q56Q	P2RX5_uc002fwd.2_RNA|P2RX5_uc002fwh.1_Silent_p.Q56Q|P2RX5_uc010vrx.1_Silent_p.Q20Q|P2RX5_uc002fwj.2_Silent_p.Q56Q|P2RX5_uc002fwk.2_Silent_p.Q56Q|P2RX5_uc002fwl.2_Silent_p.Q56Q|P2RX5_uc002fwm.1_Silent_p.Q56Q	NM_002561	NP_002552	Q93086	P2RX5_HUMAN	purinergic receptor P2X5 isoform A	56	Extracellular (Potential).				nervous system development|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0																		---	---	---	---
SMTNL2	342527	broad.mit.edu	37	17	4495754	4495754	+	Intron	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4495754C>T	uc002fyf.1	+						SMTNL2_uc002fye.2_Intron	NM_001114974	NP_001108446			smoothelin-like 2 isoform 1												0				READ - Rectum adenocarcinoma(115;0.0325)														---	---	---	---
EFNB3	1949	broad.mit.edu	37	17	7611833	7611833	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7611833C>T	uc002gis.2	+	3	893	c.496C>T	c.(496-498)CGA>TGA	p.R166*		NM_001406	NP_001397	Q15768	EFNB3_HUMAN	ephrin-B3 precursor	166	Extracellular (Potential).		R -> Q.		cell-cell signaling|interspecies interaction between organisms	integral to plasma membrane	ephrin receptor binding|transmembrane-ephrin receptor activity			ovary(1)	1		all_cancers(10;1.14e-06)|Prostate(122;0.081)																---	---	---	---
MYH1	4619	broad.mit.edu	37	17	10399645	10399645	+	Silent	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10399645G>A	uc002gmo.2	-	34	4972	c.4878C>T	c.(4876-4878)CTC>CTT	p.L1626L	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1626	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21																		---	---	---	---
KRTAP4-4	84616	broad.mit.edu	37	17	39316773	39316773	+	Silent	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39316773C>T	uc002hwc.2	-	1	211	c.171G>A	c.(169-171)AGG>AGA	p.R57R		NM_032524	NP_115913	Q9BYR3	KRA44_HUMAN	keratin associated protein 4.4	57	8.|26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].		Missing (in allele KAP4.13).|Missing (in allele KAP4.4-v1).			keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)															---	---	---	---
SMAD4	4089	broad.mit.edu	37	18	48586262	48586262	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48586262C>T	uc010xdp.1	+	8	1469	c.931C>T	c.(931-933)CAG>TAG	p.Q311*	SMAD4_uc002lfb.3_Nonsense_Mutation_p.Q156*	NM_005359	NP_005350	Q13485	SMAD4_HUMAN	mothers against decapentaplegic homolog 4	311	SAD.				BMP signaling pathway|negative regulation of cell growth|negative regulation of protein catabolic process|negative regulation of transcription, DNA-dependent|palate development|positive regulation of epithelial to mesenchymal transition|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|response to transforming growth factor beta stimulus|SMAD protein complex assembly|SMAD protein signal transduction|transforming growth factor beta receptor signaling pathway	activin responsive factor complex|centrosome|cytosol	I-SMAD binding|protein homodimerization activity|R-SMAD binding|transcription regulatory region DNA binding|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity	p.0?(35)|p.?(3)|p.Q311*(2)		pancreas(170)|large_intestine(108)|thyroid(19)|lung(11)|small_intestine(9)|upper_aerodigestive_tract(8)|biliary_tract(8)|ovary(7)|breast(6)|stomach(5)|oesophagus(3)|testis(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|kidney(1)|urinary_tract(1)|vulva(1)|skin(1)|NS(1)	369		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)										Juvenile_Polyposis|Hereditary_Hemorrhagic_Telangiectasia				---	---	---	---
STARD6	147323	broad.mit.edu	37	18	51858142	51858142	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51858142G>A	uc010xdt.1	-	4	355	c.355C>T	c.(355-357)CGC>TGC	p.R119C		NM_139171	NP_631910	P59095	STAR6_HUMAN	START domain containing protein 6	119	START.				lipid transport		lipid binding			ovary(1)	1				Colorectal(16;0.021)|READ - Rectum adenocarcinoma(59;0.188)														---	---	---	---
ZNF560	147741	broad.mit.edu	37	19	9578900	9578900	+	Silent	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9578900C>A	uc002mlp.1	-	10	933	c.723G>T	c.(721-723)ACG>ACT	p.T241T	ZNF560_uc010dwr.1_Silent_p.T135T	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560	241					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6																		---	---	---	---
TSHZ3	57616	broad.mit.edu	37	19	31767737	31767737	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31767737G>C	uc002nsy.3	-	2	3027	c.2962C>G	c.(2962-2964)CCT>GCT	p.P988A		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	988	C2H2-type 4.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)																	---	---	---	---
TSKS	60385	broad.mit.edu	37	19	50243428	50243428	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50243428G>T	uc002ppm.2	-	10	1521	c.1510C>A	c.(1510-1512)CAG>AAG	p.Q504K		NM_021733	NP_068379	Q9UJT2	TSKS_HUMAN	testis-specific kinase substrate	504							protein binding			large_intestine(1)|skin(1)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)														---	---	---	---
SIGLEC8	27181	broad.mit.edu	37	19	51961630	51961630	+	Silent	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51961630C>A	uc002pwt.2	-	1	79	c.12G>T	c.(10-12)CTG>CTT	p.L4L	SIGLEC8_uc010yda.1_Silent_p.L4L|SIGLEC8_uc002pwu.2_RNA|SIGLEC8_uc010eox.2_Silent_p.L4L	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8 precursor	4					cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)|skin(1)	5		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)														---	---	---	---
MIR523	574471	broad.mit.edu	37	19	54200881	54200881	+	5'Flank	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54200881G>A	hsa-mir-523|MI0003153	+						MIR518F_hsa-mir-518f|MI0003154_5'Flank																	0																		---	---	---	---
LILRA3	11026	broad.mit.edu	37	19	54803005	54803005	+	Intron	SNP	G	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54803005G>C	uc002qfd.2	-						LILRA6_uc002qew.1_Intron|LILRA3_uc010erk.2_Intron	NM_006865	NP_006856			leukocyte immunoglobulin-like receptor,						defense response	extracellular region|plasma membrane	antigen binding|receptor activity			ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)														---	---	---	---
PEG3	5178	broad.mit.edu	37	19	57328708	57328708	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328708C>A	uc002qnu.2	-	7	1453	c.1102G>T	c.(1102-1104)GGG>TGG	p.G368W	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.G339W|PEG3_uc002qnv.2_Missense_Mutation_p.G368W|PEG3_uc002qnw.2_Missense_Mutation_p.G244W|PEG3_uc002qnx.2_Missense_Mutation_p.G242W|PEG3_uc010etr.2_Missense_Mutation_p.G368W	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	368					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)														---	---	---	---
ZIM3	114026	broad.mit.edu	37	19	57646951	57646951	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57646951G>C	uc002qnz.1	-	5	1140	c.754C>G	c.(754-756)CAG>GAG	p.Q252E		NM_052882	NP_443114	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	252	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)														---	---	---	---
C20orf111	51526	broad.mit.edu	37	20	42825829	42825829	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42825829C>A	uc002xlk.2	-	4	879	c.742G>T	c.(742-744)GGC>TGC	p.G248C		NM_016470	NP_057554	Q9NX31	CT111_HUMAN	oxidative stress responsive 1	248											0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
COL6A1	1291	broad.mit.edu	37	21	47404298	47404298	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47404298A>T	uc002zhu.1	+	3	445	c.343A>T	c.(343-345)AGC>TGC	p.S115C		NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor	115	VWFA 1.|N-terminal globular domain.				axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)													---	---	---	---
ARHGAP6	395	broad.mit.edu	37	X	11682448	11682448	+	Silent	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11682448G>A	uc004cup.1	-	1	1374	c.501C>T	c.(499-501)TTC>TTT	p.F167F	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Silent_p.F167F	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	167					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2																		---	---	---	---
ZFX	7543	broad.mit.edu	37	X	24228803	24228803	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24228803C>G	uc004dbf.2	+	9	1986	c.1728C>G	c.(1726-1728)TAC>TAG	p.Y576*	ZFX_uc004dbe.2_3'UTR|ZFX_uc011mjv.1_Nonsense_Mutation_p.Y615*|ZFX_uc010nfz.2_Nonsense_Mutation_p.Y232*	NM_003410	NP_003401	P17010	ZFX_HUMAN	zinc finger protein, X-linked	576	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(2)	2																		---	---	---	---
POLA1	5422	broad.mit.edu	37	X	24806964	24806964	+	Intron	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24806964C>A	uc004dbl.2	+							NM_016937	NP_058633			DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)													---	---	---	---
DCAF8L1	139425	broad.mit.edu	37	X	27998484	27998484	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27998484G>A	uc004dbx.1	-	1	1083	c.968C>T	c.(967-969)TCA>TTA	p.S323L		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	323	WD 3.									ovary(3)|skin(1)	4																		---	---	---	---
EFHC2	80258	broad.mit.edu	37	X	44120530	44120530	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44120530G>A	uc004dgb.3	-	5	487	c.397C>T	c.(397-399)CGT>TGT	p.R133C		NM_025184	NP_079460	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	133	DM10 1.						calcium ion binding	p.R133H(1)		breast(3)|ovary(2)|central_nervous_system(1)	6																		---	---	---	---
SYN1	6853	broad.mit.edu	37	X	47435756	47435756	+	Silent	SNP	G	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47435756G>A	uc004die.2	-	8	1159	c.1030C>T	c.(1030-1032)CTG>TTG	p.L344L	SYN1_uc004did.2_Silent_p.L344L	NM_006950	NP_008881	P17600	SYN1_HUMAN	synapsin I isoform Ia	344	C; actin-binding and synaptic-vesicle binding.					cell junction|Golgi apparatus	actin binding|ATP binding|ligase activity|transporter activity			ovary(1)	1																		---	---	---	---
HUWE1	10075	broad.mit.edu	37	X	53586399	53586399	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53586399C>T	uc004dsp.2	-	57	8233	c.7831G>A	c.(7831-7833)GAT>AAT	p.D2611N	HUWE1_uc004dsn.2_Missense_Mutation_p.D1435N|uc004dss.2_5'Flank|MIRLET7F2_hsa-let-7f-2|MI0000068_5'Flank	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	2611					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17																		---	---	---	---
KIF4A	24137	broad.mit.edu	37	X	69516906	69516906	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69516906G>T	uc004dyg.2	+	4	421	c.294G>T	c.(292-294)ATG>ATT	p.M98I	KIF4A_uc010nkw.2_Missense_Mutation_p.M98I|KIF4A_uc004dyf.1_Missense_Mutation_p.M98I	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4	98	Kinesin-motor.				anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4																		---	---	---	---
GDPD2	54857	broad.mit.edu	37	X	69645291	69645291	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69645291C>A	uc004dyh.2	+	3	444	c.193C>A	c.(193-195)CTG>ATG	p.L65M	GDPD2_uc010nkx.1_Missense_Mutation_p.L65M|GDPD2_uc010nky.1_Intron|GDPD2_uc011mpk.1_Missense_Mutation_p.L65M|GDPD2_uc011mpl.1_Translation_Start_Site|GDPD2_uc011mpm.1_Intron	NM_017711	NP_060181	Q9HCC8	GDPD2_HUMAN	osteoblast differentiation promoting factor	65	Extracellular (Potential).				glycerol metabolic process|lipid metabolic process	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol inositolphosphodiesterase activity|metal ion binding			ovary(2)	2	Renal(35;0.156)																	---	---	---	---
TSIX	9383	broad.mit.edu	37	X	73043620	73043620	+	RNA	SNP	T	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73043620T>A	uc004ebn.2	+	1		c.31581T>A			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0																		---	---	---	---
IL13RA2	3598	broad.mit.edu	37	X	114251790	114251790	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114251790G>C	uc004epx.2	-	2	168	c.43C>G	c.(43-45)CTG>GTG	p.L15V	IL13RA2_uc010nqd.1_Missense_Mutation_p.L15V	NM_000640	NP_000631	Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2 precursor	15						extracellular space|integral to membrane|soluble fraction	cytokine receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3																		---	---	---	---
THOC2	57187	broad.mit.edu	37	X	122747567	122747567	+	Intron	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122747567C>A	uc004etu.2	-						THOC2_uc004etv.3_5'Flank|THOC2_uc010nqt.1_Intron|THOC2_uc004etw.1_Intron	NM_001081550	NP_001075019			THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3																		---	---	---	---
SASH3	54440	broad.mit.edu	37	X	128926596	128926596	+	Intron	SNP	C	A	A			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128926596C>A	uc011mun.1	+						SASH3_uc004euu.2_Intron|SASH3_uc011muo.1_Silent_p.P162P	NM_018990	NP_061863			SAM and SH3 domain containing 3											ovary(2)|pancreas(1)	3																		---	---	---	---
PASD1	139135	broad.mit.edu	37	X	150832611	150832611	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4259-01A-01D-1126-08	TCGA-BR-4259-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150832611C>G	uc004fev.3	+	11	1194	c.862C>G	c.(862-864)CGA>GGA	p.R288G		NM_173493	NP_775764	Q8IV76	PASD1_HUMAN	PAS domain containing 1	288						nucleus	signal transducer activity			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
