Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
Unknown	0	broad.mit.edu	37	1	2618217	2618218	+	IGR	INS	-	GAC	GAC	rs146142066	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2618217_2618218insGAC								MMEL1 (53736 upstream) : ACTRT2 (319828 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	2622981	2622981	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2622981delC								MMEL1 (58500 upstream) : ACTRT2 (315065 downstream)																																			---	---	---	---
KIAA0562	9731	broad.mit.edu	37	1	3737058	3737059	+	Intron	INS	-	G	G	rs145872202	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3737058_3737059insG	uc001aky.2	-						KIAA0562_uc010nzm.1_Intron	NM_014704	NP_055519			glycine-, glutamate-,							centriole	binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	5266109	5266109	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5266109delC								AJAP1 (422259 upstream) : NPHP4 (656761 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	6805865	6805866	+	IGR	INS	-	AA	AA	rs112275608		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6805865_6805866insAA								DNAJC11 (43899 upstream) : CAMTA1 (39518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	8147256	8147257	+	IGR	INS	-	T	T	rs35232246		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8147256_8147257insT								ERRFI1 (60863 upstream) : SLC45A1 (237133 downstream)																																			---	---	---	---
KIAA2013	90231	broad.mit.edu	37	1	11987197	11987198	+	5'Flank	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11987197_11987198insA	uc001atk.2	-						KIAA2013_uc001atl.1_5'Flank	NM_138346	NP_612355			hypothetical protein LOC90231 precursor							integral to membrane				ovary(1)	1	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
CROCCL1	84809	broad.mit.edu	37	1	16965449	16965449	+	Intron	DEL	A	-	-	rs141730973		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16965449delA	uc001azg.1	-						CROCCL1_uc001azi.1_Intron|uc001azj.1_Intron					Homo sapiens mRNA for FLJ00313 protein.												0																		---	---	---	---
PADI4	23569	broad.mit.edu	37	1	17673452	17673452	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17673452delT	uc001baj.2	+						PADI4_uc009vpc.2_Intron	NM_012387	NP_036519			peptidyl arginine deiminase, type IV						chromatin modification|peptidyl-citrulline biosynthetic process from peptidyl-arginine|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)													---	---	---	---
EIF4G3	8672	broad.mit.edu	37	1	21343152	21343152	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21343152delA	uc001bec.2	-						EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beg.2_Intron|EIF4G3_uc010odk.1_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751			eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)														---	---	---	---
SH3BGRL3	83442	broad.mit.edu	37	1	26606113	26606113	+	5'Flank	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26606113delG	uc001blu.2	+							NM_031286	NP_112576			SH3 domain binding glutamic acid-rich protein						cell redox homeostasis	cytoplasm|nucleus	electron carrier activity|protein disulfide oxidoreductase activity				0		all_cancers(24;1.16e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.22e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00751)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
DHDDS	79947	broad.mit.edu	37	1	26771574	26771575	+	Intron	INS	-	CATT	CATT	rs10671692		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26771574_26771575insCATT	uc001bml.2	+						DHDDS_uc001bmk.2_Intron|DHDDS_uc001bmm.2_Intron|DHDDS_uc001bmn.2_Intron|DHDDS_uc010ofd.1_Intron	NM_205861	NP_995583			dehydrodolichyl diphosphate synthase isoform b								protein binding|transferase activity, transferring alkyl or aryl (other than methyl) groups			breast(3)	3		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	30322385	30322385	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30322385delT								PTPRU (669070 upstream) : MATN1 (861741 downstream)																																			---	---	---	---
KHDRBS1	10657	broad.mit.edu	37	1	32507184	32507185	+	Intron	INS	-	T	T	rs149031295		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32507184_32507185insT	uc001bub.2	+						KHDRBS1_uc001bua.1_Intron|KHDRBS1_uc001buc.1_Intron	NM_006559	NP_006550			KH domain containing, RNA binding, signal						cell cycle arrest|cell proliferation|cell surface receptor linked signaling pathway|G2/M transition of mitotic cell cycle|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of RNA export from nucleus|transcription, DNA-dependent	membrane|nucleus	DNA binding|RNA binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)																---	---	---	---
LCK	3932	broad.mit.edu	37	1	32717831	32717831	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32717831delC	uc001bux.2	+							NM_005356	NP_005347			lymphocyte-specific protein tyrosine kinase						activation of caspase activity|cellular zinc ion homeostasis|induction of apoptosis|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of T cell receptor signaling pathway|regulation of defense response to virus by virus|release of sequestered calcium ion into cytosol|response to drug|T cell costimulation|T cell differentiation|T cell receptor signaling pathway|viral reproduction	cytosol|Golgi apparatus|membrane raft|pericentriolar material|plasma membrane	ATP binding|ATPase binding|CD4 receptor binding|CD8 receptor binding|glycoprotein binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol 3-kinase binding|protein C-terminus binding|protein kinase binding|protein serine/threonine phosphatase activity|SH2 domain binding			lung(3)|central_nervous_system(2)|ovary(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)			T	TRB@	T-ALL								---	---	---	---
RNF19B	127544	broad.mit.edu	37	1	33432418	33432418	+	5'Flank	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33432418delG	uc010oho.1	-						RNF19B_uc001bwm.3_5'Flank|RNF19B_uc010ohp.1_5'Flank	NM_153341	NP_699172			ring finger protein 19B isoform a							integral to membrane	ligase activity|protein binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	33923514	33923515	+	IGR	INS	-	T	T	rs72019022		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33923514_33923515insT								PHC2 (26899 upstream) : ZSCAN20 (14717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	34876834	34876835	+	IGR	INS	-	TTCAACCCTGCTCCTCCAAACCATCC	TTCAACCCTGCTCCTCCAAACCATCC	rs145216220	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34876834_34876835insTTCAACCCTGCTCCTCCAAACCATCC								C1orf94 (192105 upstream) : MIR552 (258365 downstream)																																			---	---	---	---
ZMYM4	9202	broad.mit.edu	37	1	35771588	35771588	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35771588delT	uc001byt.2	+						ZMYM4_uc009vuu.2_Intron|ZMYM4_uc001byu.2_Intron	NM_005095	NP_005086			zinc finger protein 262						multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	37033542	37033542	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37033542delG								CSF3R (85033 upstream) : GRIK3 (227586 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	37837577	37837577	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37837577delG								GRIK3 (337733 upstream) : ZC3H12A (102542 downstream)																																			---	---	---	---
UTP11L	51118	broad.mit.edu	37	1	38483749	38483750	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38483749_38483750insT	uc001ccn.3	+						UTP11L_uc009vvm.2_Intron|UTP11L_uc010oil.1_Intron|UTP11L_uc001cco.3_Intron	NM_016037	NP_057121			UTP11-like, U3 small nucleolar						induction of apoptosis|nerve growth factor receptor signaling pathway|nervous system development|rRNA processing	cytoplasm|extracellular space|nucleolus|small-subunit processome	protein binding				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	38690895	38690896	+	IGR	INS	-	TG	TG	rs141621767	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38690895_38690896insTG								POU3F1 (178445 upstream) : RRAGC (614119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	39032603	39032604	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39032603_39032604insT								POU3F1 (520153 upstream) : RRAGC (272411 downstream)																																			---	---	---	---
SCMH1	22955	broad.mit.edu	37	1	41571550	41571550	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41571550delT	uc001cgo.2	-						SCMH1_uc010ojr.1_Intron|SCMH1_uc001cgp.2_Intron|SCMH1_uc001cgr.2_Intron|SCMH1_uc001cgs.2_Intron|SCMH1_uc001cgt.2_Intron|SCMH1_uc001cgq.2_Intron|SCMH1_uc010ojs.1_Intron	NM_001031694	NP_001026864			sex comb on midleg 1 isoform 1						anatomical structure morphogenesis|gene silencing|multicellular organismal development|negative regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	42832529	42832530	+	IGR	INS	-	T	T	rs4660627	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42832529_42832530insT								FOXJ3 (30981 upstream) : RIMKLA (13938 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	43514339	43514339	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43514339delT								SLC2A1 (89492 upstream) : FAM183A (99255 downstream)																																			---	---	---	---
KIF2C	11004	broad.mit.edu	37	1	45206451	45206452	+	Intron	INS	-	T	T	rs35083631		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45206451_45206452insT	uc001cmg.3	+						KIF2C_uc010olb.1_Intron	NM_006845	NP_006836			kinesin family member 2C						blood coagulation|cell division|cell proliferation|chromosome segregation|establishment or maintenance of microtubule cytoskeleton polarity|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|kinesin complex|microtubule|nucleus	ATP binding|centromeric DNA binding|microtubule motor activity|microtubule plus-end binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	45237857	45237857	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45237857delT								KIF2C (4421 upstream) : RPS8 (3389 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	46503132	46503132	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46503132delA								MAST2 (1335 upstream) : PIK3R3 (2681 downstream)																																	OREG0013454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	1	48208729	48208743	+	IGR	DEL	TGGTGGTGGTGGCAG	-	-	rs79475307		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48208729_48208743delTGGTGGTGGTGGCAG								FOXD2 (302367 upstream) : SKINTL (358644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	48209375	48209378	+	IGR	DEL	TATG	-	-	rs113277562		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48209375_48209378delTATG								FOXD2 (303013 upstream) : SKINTL (358009 downstream)																																			---	---	---	---
TXNDC12	51060	broad.mit.edu	37	1	52507011	52507011	+	Intron	DEL	A	-	-	rs111745022		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52507011delA	uc001cti.2	-							NM_015913	NP_056997			thioredoxin domain containing 12 precursor						activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			ovary(1)	1																		---	---	---	---
FAM159A	348378	broad.mit.edu	37	1	53099993	53099993	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53099993delT	uc001cuf.2	+						FAM159A_uc001cug.1_Intron|FAM159A_uc001cuh.2_Intron	NM_001042693	NP_001036158			hypothetical protein LOC348378							integral to membrane					0																		---	---	---	---
ZYG11A	440590	broad.mit.edu	37	1	53314237	53314237	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53314237delG	uc001cuk.2	+						ZYG11A_uc001cul.2_Intron	NM_001004339	NP_001004339			zyg-11 homolog A								binding				0																		---	---	---	---
PODN	127435	broad.mit.edu	37	1	53549546	53549546	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53549546delG	uc001cuv.2	+						PODN_uc001cuw.2_Intron|PODN_uc010onr.1_Intron|PODN_uc010ons.1_Intron	NM_153703	NP_714914			podocan						negative regulation of cell migration|negative regulation of cell proliferation	cytoplasm|extracellular space|proteinaceous extracellular matrix	collagen binding			ovary(1)|pancreas(1)	2																		---	---	---	---
GLIS1	148979	broad.mit.edu	37	1	54021710	54021715	+	Intron	DEL	GTGTGT	-	-	rs114791803		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54021710_54021715delGTGTGT	uc001cvr.1	-							NM_147193	NP_671726			GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
TMEM48	55706	broad.mit.edu	37	1	54305468	54305468	+	5'Flank	DEL	A	-	-	rs113657916		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54305468delA	uc001cvs.2	-						TMEM48_uc010onu.1_5'Flank|TMEM48_uc001cvt.2_5'Flank|TMEM48_uc009vzk.2_5'Flank|TMEM48_uc010onv.1_5'Flank	NM_018087	NP_060557			transmembrane protein 48						mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore			ovary(1)|pancreas(1)	2																		---	---	---	---
C1orf177	163747	broad.mit.edu	37	1	55285763	55285766	+	Intron	DEL	TTCT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55285763_55285766delTTCT	uc001cyb.3	+						C1orf177_uc001cya.3_Intron	NM_001110533	NP_001104003			hypothetical protein LOC163747 isoform 2												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	56457474	56457474	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56457474delC								USP24 (776712 upstream) : PPAP2B (502959 downstream)																																			---	---	---	---
DAB1	1600	broad.mit.edu	37	1	57528913	57528914	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57528913_57528914insA	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	57994308	57994309	+	Intron	INS	-	GACA	GACA	rs146463782	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57994308_57994309insGACA	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58115989	58115990	+	Intron	INS	-	T	T	rs138400815	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58115989_58115990insT	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58429769	58429769	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58429769delG	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58445951	58445952	+	Intron	INS	-	AA	AA	rs72500904	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58445951_58445952insAA	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58587471	58587472	+	Intron	DEL	AT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58587471_58587472delAT	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
FGGY	55277	broad.mit.edu	37	1	59981755	59981764	+	Intron	DEL	TTATGCCTTC	-	-	rs71794323		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59981755_59981764delTTATGCCTTC	uc001czi.3	+						FGGY_uc001czg.2_Intron|FGGY_uc001czh.2_Intron|FGGY_uc009wac.2_Intron|FGGY_uc001czj.3_Intron|FGGY_uc001czk.3_Intron|FGGY_uc001czl.3_Intron|FGGY_uc001czm.3_Intron	NM_018291	NP_060761			FGGY carbohydrate kinase domain containing						carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	61429486	61429487	+	Intron	INS	-	AA	AA			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61429486_61429487insAA	uc001czu.2	-											Homo sapiens cDNA clone IMAGE:4796864.																														---	---	---	---
PDE4B	5142	broad.mit.edu	37	1	66444114	66444117	+	Intron	DEL	AGAA	-	-	rs140040493		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66444114_66444117delAGAA	uc001dcn.2	+						PDE4B_uc009war.2_Intron|PDE4B_uc001dco.2_Intron	NM_001037341	NP_001032418			phosphodiesterase 4B isoform 1						signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)													---	---	---	---
PDE4B	5142	broad.mit.edu	37	1	66694701	66694701	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66694701delT	uc001dcn.2	+						PDE4B_uc009war.2_Intron|PDE4B_uc001dco.2_Intron|PDE4B_uc001dcp.2_Intron	NM_001037341	NP_001032418			phosphodiesterase 4B isoform 1						signal transduction	cytosol|insoluble fraction|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Cilostazol(DB01166)|Dyphylline(DB00651)|Enprofylline(DB00824)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Theophylline(DB00277)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	67989777	67989778	+	IGR	DEL	AT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67989777_67989778delAT								SERBP1 (93654 upstream) : GADD45A (161105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	68155325	68155326	+	IGR	DEL	TT	-	-	rs74583334		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68155325_68155326delTT								GADD45A (1306 upstream) : GNG12 (11823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	69080056	69080057	+	IGR	DEL	AT	-	-	rs56804149		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69080056_69080057delAT								DEPDC1 (117257 upstream) : LRRC7 (952811 downstream)																																			---	---	---	---
NEGR1	257194	broad.mit.edu	37	1	72200592	72200593	+	Intron	INS	-	T	T	rs144942780	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72200592_72200593insT	uc001dfw.2	-						NEGR1_uc001dfv.2_Intron|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169			neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	74452998	74452998	+	IGR	DEL	C	-	-	rs13376548	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74452998delC								None (None upstream) : LRRIQ3 (38706 downstream)																																			---	---	---	---
TNNI3K	51086	broad.mit.edu	37	1	74669726	74669726	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74669726delA	uc001dge.1	+						TNNI3K_uc001dgc.1_Intron|TNNI3K_uc001dgd.2_Intron|FPGT_uc010oqt.1_Intron|FPGT_uc010oqu.1_Intron|FPGT_uc001dgb.1_Intron|FPGT_uc010oqv.1_Intron	NM_001112808	NP_001106279			TNNI3 interacting kinase isoform a							cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10																		---	---	---	---
C1orf173	127254	broad.mit.edu	37	1	75059957	75059958	+	Intron	INS	-	GTGT	GTGT	rs10655150		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75059957_75059958insGTGT	uc001dgg.2	-						uc001dgh.2_Intron|C1orf173_uc001dgi.3_Intron	NM_001002912	NP_001002912			hypothetical protein LOC127254											ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5																		---	---	---	---
ACADM	34	broad.mit.edu	37	1	76190927	76190927	+	Intron	DEL	A	-	-	rs72686164		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76190927delA	uc001dgw.3	+						uc001dgv.2_5'Flank|ACADM_uc010orc.1_Intron|ACADM_uc010ord.1_Intron|ACADM_uc009wbp.2_Intron|ACADM_uc009wbr.2_Intron|ACADM_uc010ore.1_Intron|ACADM_uc010orf.1_Intron|ACADM_uc001dgx.3_5'Flank	NM_000016	NP_000007			medium-chain acyl-CoA dehydrogenase isoform a						carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
ST6GALNAC3	256435	broad.mit.edu	37	1	76947853	76947854	+	Intron	DEL	AT	-	-	rs35298544	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76947853_76947854delAT	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541			sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5																		---	---	---	---
AK5	26289	broad.mit.edu	37	1	77784401	77784402	+	Intron	INS	-	T	T	rs113209635		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77784401_77784402insT	uc001dhn.2	+						AK5_uc001dho.2_Intron	NM_174858	NP_777283			adenylate kinase 5 isoform 1						ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1																		---	---	---	---
USP33	23032	broad.mit.edu	37	1	78225713	78225713	+	5'Flank	DEL	T	-	-	rs80254926		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78225713delT	uc001dht.2	-						USP33_uc001dhu.2_5'Flank|USP33_uc001dhw.2_5'Flank	NM_015017	NP_055832			ubiquitin specific protease 33 isoform 1						axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3																		---	---	---	---
MGC27382	149047	broad.mit.edu	37	1	78752618	78752618	+	Intron	DEL	C	-	-	rs57600470		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78752618delC	uc001dil.1	+						MGC27382_uc009wcc.2_Intron					Homo sapiens cDNA FLJ34438 fis, clone HLUNG2001144.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	82761626	82761627	+	IGR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82761626_82761627delCA								LPHN2 (303520 upstream) : None (None downstream)																																			---	---	---	---
DNASE2B	58511	broad.mit.edu	37	1	84865772	84865772	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84865772delC	uc001djt.1	+						UOX_uc009wcg.2_5'Flank	NM_021233	NP_067056			deoxyribonuclease II beta isoform 1 precursor						DNA metabolic process	lysosome	deoxyribonuclease II activity				0				all cancers(265;0.00303)|Epithelial(280;0.0112)|OV - Ovarian serous cystadenocarcinoma(397;0.0808)									Direct_reversal_of_damage					---	---	---	---
COL24A1	255631	broad.mit.edu	37	1	86427130	86427130	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86427130delA	uc001dlj.2	-						COL24A1_uc001dli.2_5'UTR|COL24A1_uc010osd.1_Intron|COL24A1_uc001dlk.2_Intron|COL24A1_uc010ose.1_Intron|COL24A1_uc010osf.1_Intron	NM_152890	NP_690850			collagen, type XXIV, alpha 1 precursor						cell adhesion	collagen	extracellular matrix structural constituent			ovary(3)|central_nervous_system(1)|skin(1)	5				all cancers(265;0.0627)|Epithelial(280;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	88457429	88457431	+	IGR	DEL	GAT	-	-	rs142496806		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88457429_88457431delGAT								LMO4 (642826 upstream) : PKN2 (692491 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	89783259	89783260	+	IGR	INS	-	G	G	rs145081528	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89783259_89783260insG								GBP5 (44715 upstream) : GBP6 (46176 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	91055462	91055462	+	IGR	DEL	A	-	-	rs112052817		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91055462delA								ZNF326 (561368 upstream) : BARHL2 (122118 downstream)																																			---	---	---	---
TGFBR3	7049	broad.mit.edu	37	1	92372405	92372405	+	5'Flank	DEL	T	-	-	rs67136116		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92372405delT	uc001doj.2	-							NM_003243	NP_003234			transforming growth factor, beta receptor III						BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)														---	---	---	---
ABCA4	24	broad.mit.edu	37	1	94583038	94583038	+	Intron	DEL	A	-	-	rs113395890		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94583038delA	uc001dqh.2	-						ABCA4_uc010otn.1_Intron	NM_000350	NP_000341			ATP-binding cassette, sub-family A member 4						phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	95416355	95416356	+	IGR	DEL	CG	-	-	rs10562437	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95416355_95416356delCG								CNN3 (23620 upstream) : ALG14 (31923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	96121176	96121177	+	IGR	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96121176_96121177delCT								RWDD3 (408403 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	96550057	96550057	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:96550057delA								RWDD3 (837284 upstream) : PTBP2 (637118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	98714492	98714493	+	IGR	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98714492_98714493delAC								MIR137 (202765 upstream) : SNX7 (412743 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	103289513	103289513	+	IGR	DEL	A	-	-	rs67515326		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103289513delA								OLFM3 (826723 upstream) : COL11A1 (52511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	104395092	104395092	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104395092delT								AMY1A (187920 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	104893454	104893467	+	IGR	DEL	TCCCCTGCCTTAGC	-	-	rs71763984		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104893454_104893467delTCCCCTGCCTTAGC								AMY1A (686282 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	105459141	105459143	+	IGR	DEL	TTA	-	-	rs5776766		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105459141_105459143delTTA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	105528283	105528283	+	IGR	DEL	T	-	-	rs138144442		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105528283delT								None (None upstream) : None (None downstream)																																			---	---	---	---
NTNG1	22854	broad.mit.edu	37	1	107740836	107740836	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107740836delA	uc001dvh.3	+						NTNG1_uc001dvf.3_Intron|NTNG1_uc010out.1_Intron|NTNG1_uc001dvc.3_Intron|NTNG1_uc001dvd.1_Intron	NM_001113226	NP_001106697			netrin G1 isoform 1						axonogenesis	anchored to plasma membrane	protein binding			large_intestine(2)|ovary(2)|skin(2)	6		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	108622267	108622267	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108622267delT								VAV3 (114722 upstream) : SLC25A24 (55182 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	108808776	108808776	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108808776delA	uc001dvp.1	-											Homo sapiens cDNA clone IMAGE:6167132.																														---	---	---	---
WDR47	22911	broad.mit.edu	37	1	109533373	109533373	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109533373delA	uc001dwj.2	-						WDR47_uc001dwl.2_Intron|WDR47_uc001dwi.2_Intron|WDR47_uc001dwk.2_Intron|WDR47_uc010ovf.1_Intron	NM_001142551	NP_001136023			WD repeat domain 47 isoform 3											ovary(1)	1		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	111790621	111790624	+	IGR	DEL	TGAA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111790621_111790624delTGAA								CHI3L2 (4561 upstream) : LOC149620 (32522 downstream)																																			---	---	---	---
ADORA3	140	broad.mit.edu	37	1	112054297	112054298	+	Intron	DEL	AC	-	-	rs150737451		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112054297_112054298delAC	uc001ebg.3	-							NM_001081976	NP_001075445			adenosine A3 receptor isoform 3						activation of adenylate cyclase activity|inflammatory response|regulation of heart contraction	integral to plasma membrane	adenosine receptor activity, G-protein coupled			ovary(2)|large_intestine(1)|skin(1)	4		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)													---	---	---	---
KCND3	3752	broad.mit.edu	37	1	112362002	112362002	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112362002delA	uc001ebu.1	-						KCND3_uc001ebv.1_Intron	NM_004980	NP_004971			potassium voltage-gated channel, Shal-related							sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)														---	---	---	---
ST7L	54879	broad.mit.edu	37	1	113095855	113095856	+	Intron	INS	-	ACAC	ACAC	rs138030007	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113095855_113095856insACAC	uc001ecd.2	-						ST7L_uc009wgh.2_Intron|ST7L_uc001ecc.2_Intron|ST7L_uc010owg.1_Intron|ST7L_uc010owh.1_Intron|ST7L_uc001ece.2_Intron|ST7L_uc001ecf.2_Intron|ST7L_uc001ecg.2_Intron|ST7L_uc010owi.1_Intron|ST7L_uc001ech.2_Intron|ST7L_uc001eci.2_Intron|ST7L_uc009wgi.1_Intron|ST7L_uc010owj.1_Intron	NM_017744	NP_060214			suppression of tumorigenicity 7-like isoform 1						negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	113344868	113344868	+	IGR	DEL	G	-	-	rs34067773		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113344868delG								FAM19A3 (75014 upstream) : SLC16A1 (109604 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	118861285	118861285	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118861285delC								SPAG17 (133437 upstream) : TBX15 (564381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	119723994	119723994	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119723994delT	uc001ehp.1	+						uc009whk.1_Intron					Homo sapiens cDNA FLJ43771 fis, clone TESTI2049553.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	120113623	120113624	+	IGR	DEL	AC	-	-	rs113690307	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120113623_120113624delAC								HSD3B1 (55942 upstream) : ZNF697 (48376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	121348316	121348318	+	IGR	DEL	AAA	-	-	rs75641212		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121348316_121348318delAAA								LOC647121 (34630 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142580904	142580904	+	IGR	DEL	G	-	-	rs111819322		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142580904delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142610631	142610631	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142610631delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142640886	142640886	+	Intron	DEL	T	-	-	rs111783433		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142640886delT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142729354	142729354	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142729354delA	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143421221	143421221	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143421221delA								None (None upstream) : LOC100286793 (226418 downstream)																																			---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144530876	144530877	+	Intron	INS	-	CC	CC	rs72257362		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144530876_144530877insCC	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144590319	144590319	+	Intron	DEL	A	-	-	rs71217589		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144590319delA	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	145024577	145024590	+	Intron	DEL	ACACACACACACAT	-	-	rs72183284		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145024577_145024590delACACACACACACAT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145069497	145069498	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145069497_145069498insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145220306	145220306	+	Intron	DEL	C	-	-	rs150855626		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145220306delC	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145624409	145624410	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145624409_145624410insT	uc001emp.3	+						RNF115_uc001eoj.2_Intron|RNF115_uc001eok.2_Intron|RNF115_uc009wiy.2_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145748886	145748886	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145748886delC	uc001emp.3	+						PDZK1_uc001eon.1_Intron|PDZK1_uc001eoo.1_Intron|PDZK1_uc010oza.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	148001178	148001180	+	Intron	DEL	AGG	-	-	rs35235086		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148001178_148001180delAGG	uc001eqf.2	-						LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	148877319	148877320	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148877319_148877320insT	uc009wkv.1	+											Homo sapiens cDNA, FLJ17483.																														---	---	---	---
SV2A	9900	broad.mit.edu	37	1	149887466	149887467	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149887466_149887467delCA	uc001etg.2	-						SV2A_uc001eth.2_Intron	NM_014849	NP_055664			synaptic vesicle glycoprotein 2						neurotransmitter transport	cell junction|endoplasmic reticulum|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(6)|pancreas(1)	7	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)													---	---	---	---
OTUD7B	56957	broad.mit.edu	37	1	149930662	149930663	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149930662_149930663insT	uc001etn.2	-							NM_020205	NP_064590			zinc finger protein Cezanne						negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	150144526	150144527	+	IGR	INS	-	A	A	rs145192635	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150144526_150144527insA								PLEKHO1 (12710 upstream) : ANP32E (46191 downstream)																																			---	---	---	---
RPRD2	23248	broad.mit.edu	37	1	150390386	150390387	+	Intron	INS	-	TCTC	TCTC	rs140431392	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150390386_150390387insTCTC	uc009wlr.2	+						RPRD2_uc010pcc.1_Intron|RPRD2_uc001eup.3_Intron	NM_015203	NP_056018			Regulation of nuclear pre-mRNA domain containing								protein binding			ovary(1)	1																		---	---	---	---
RPRD2	23248	broad.mit.edu	37	1	150432870	150432871	+	Intron	INS	-	GTT	GTT	rs141601995	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150432870_150432871insGTT	uc009wlr.2	+						RPRD2_uc010pcc.1_Intron|RPRD2_uc001eup.3_Intron	NM_015203	NP_056018			Regulation of nuclear pre-mRNA domain containing								protein binding			ovary(1)	1																		---	---	---	---
GOLPH3L	55204	broad.mit.edu	37	1	150622918	150622918	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150622918delG	uc001evj.2	-						GOLPH3L_uc010pci.1_Intron	NM_018178	NP_060648			Golgi phosphoprotein 3-like							Golgi cisterna membrane				ovary(1)	1	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
MLLT11	10962	broad.mit.edu	37	1	151039409	151039409	+	Intron	DEL	A	-	-	rs34007069		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151039409delA	uc001ewq.2	+							NM_006818	NP_006809			MLLT11 protein						positive regulation of apoptosis|positive regulation of mitochondrial depolarization|positive regulation of release of cytochrome c from mitochondria|positive regulation of transcription, DNA-dependent						0	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
TUFT1	7286	broad.mit.edu	37	1	151529850	151529857	+	Intron	DEL	AATCATCA	-	-	rs151327344		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151529850_151529857delAATCATCA	uc001eyl.2	+						TUFT1_uc001eym.2_Intron|TUFT1_uc010pdf.1_Intron|TUFT1_uc010pdg.1_Intron	NM_020127	NP_064512			tuftelin 1 isoform 1						bone mineralization|odontogenesis	cytoplasm|extracellular region	structural constituent of tooth enamel				0	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
S100A10	6281	broad.mit.edu	37	1	151955955	151955955	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151955955delT	uc001ezl.2	-							NM_002966	NP_002957			S100 calcium binding protein A10						signal transduction		calcium ion binding|receptor binding				0	Melanoma(130;0.0648)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	152306196	152306197	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152306196_152306197insT	uc001ezv.2	+											Homo sapiens cDNA FLJ31869 fis, clone NT2RP7002151.																														---	---	---	---
SLC39A1	27173	broad.mit.edu	37	1	153937416	153937417	+	5'Flank	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153937416_153937417insA	uc001fdh.2	-						SLC39A1_uc001fdi.2_5'Flank|SLC39A1_uc001fdj.2_5'Flank|SLC39A1_uc001fdk.2_5'Flank|SLC39A1_uc010pee.1_5'Flank|SLC39A1_uc001fdl.2_Intron|CREB3L4_uc001fdn.3_5'Flank|CREB3L4_uc010pef.1_5'Flank|CREB3L4_uc001fdo.3_5'Flank|CREB3L4_uc001fdm.1_5'Flank|CREB3L4_uc001fdp.1_5'Flank	NM_014437	NP_055252			solute carrier family 39 (zinc transporter),							endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	zinc ion transmembrane transporter activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)	Colorectal(1306;0.019)														---	---	---	---
ATP8B2	57198	broad.mit.edu	37	1	154312015	154312015	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154312015delC	uc001fex.2	+							NM_020452	NP_065185			ATPase, class I, type 8B, member 2 isoform a						ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)															---	---	---	---
TDRD10	126668	broad.mit.edu	37	1	154479999	154480000	+	Intron	INS	-	CCCTGGTG	CCCTGGTG	rs138256638	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154479999_154480000insCCCTGGTG	uc009wow.2	+						TDRD10_uc001ffd.2_Intron	NM_001098475	NP_001091945			tudor domain containing 10 isoform a								nucleotide binding|RNA binding			ovary(1)	1	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)															---	---	---	---
KCNN3	3782	broad.mit.edu	37	1	154787802	154787802	+	Intron	DEL	T	-	-	rs67719166		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154787802delT	uc001ffp.2	-						KCNN3_uc001ffo.2_Intron|KCNN3_uc009wox.1_Intron	NM_002249	NP_002240			small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	156278392	156278393	+	IGR	INS	-	A	A	rs112082432		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156278392_156278393insA								VHLL (8964 upstream) : CCT3 (359 downstream)																																			---	---	---	---
IQGAP3	128239	broad.mit.edu	37	1	156517181	156517184	+	Intron	DEL	ACAC	-	-	rs140742772		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156517181_156517184delACAC	uc001fpf.2	-							NM_178229	NP_839943			IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	157080605	157080605	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157080605delA								ETV3L (11005 upstream) : ETV3 (13854 downstream)																																			---	---	---	---
KIRREL	55243	broad.mit.edu	37	1	157967258	157967259	+	Intron	INS	-	GT	GT	rs147774169	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157967258_157967259insGT	uc001frn.3	+						KIRREL_uc010pib.1_Intron	NM_018240	NP_060710			kin of IRRE like precursor							integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	159201228	159201229	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159201228_159201229insA								DARC (24940 upstream) : FCER1A (58277 downstream)																																			---	---	---	---
SLAMF1	6504	broad.mit.edu	37	1	160617553	160617554	+	5'Flank	DEL	TG	-	-	rs5778175		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160617553_160617554delTG	uc001fwl.3	-						SLAMF1_uc010pjk.1_5'Flank|SLAMF1_uc010pjl.1_5'Flank|SLAMF1_uc010pjm.1_5'Flank|SLAMF1_uc001fwm.2_5'Flank	NM_003037	NP_003028			signaling lymphocytic activation molecule family						interspecies interaction between organisms|lymphocyte activation|positive regulation of cell proliferation	integral to membrane	antigen binding|transmembrane receptor activity			ovary(1)|breast(1)	2	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)															---	---	---	---
NOS1AP	9722	broad.mit.edu	37	1	162204930	162204931	+	Intron	INS	-	T	T	rs140850807	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162204930_162204931insT	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512			nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)															---	---	---	---
NOS1AP	9722	broad.mit.edu	37	1	162291712	162291712	+	Intron	DEL	G	-	-	rs34334894		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162291712delG	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512			nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	162894262	162894262	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162894262delT								C1orf110 (55657 upstream) : RGS4 (144134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	162894266	162894266	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162894266delA								C1orf110 (55661 upstream) : RGS4 (144130 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	164001972	164001972	+	IGR	DEL	T	-	-	rs5778368		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164001972delT								NUF2 (676419 upstream) : PBX1 (526830 downstream)																																			---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164632547	164632548	+	Intron	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164632547_164632548delCT	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron|uc001gcu.1_Intron	NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
PBX1	5087	broad.mit.edu	37	1	164846326	164846326	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164846326delT	uc010pkw.1	+							NM_002585	NP_002576			pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5								T	TCF3|EWSR1	pre B-ALL|myoepithelioma								---	---	---	---
Unknown	0	broad.mit.edu	37	1	166004194	166004197	+	IGR	DEL	TGTG	-	-	rs143962223		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166004194_166004197delTGTG								UCK2 (126857 upstream) : FAM78B (25219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	166407423	166407423	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166407423delC								FAM78B (271217 upstream) : FMO9P (165730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	167105507	167105508	+	IGR	INS	-	A	A	rs150170981	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167105507_167105508insA								DUSP27 (7105 upstream) : POU2F1 (84635 downstream)																																			---	---	---	---
ADCY10	55811	broad.mit.edu	37	1	167851722	167851723	+	Intron	INS	-	AAAA	AAAA			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167851722_167851723insAAAA	uc001ger.2	-						ADCY10_uc009wvk.2_Intron|ADCY10_uc010plj.1_Intron|ADCY10_uc009wvl.2_Intron|ADCY10_uc009wvm.2_Intron	NM_018417	NP_060887			adenylate cyclase 10						intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3																		---	---	---	---
SELP	6403	broad.mit.edu	37	1	169575833	169575833	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169575833delT	uc001ggi.3	-						SELP_uc001ggh.2_Intron|SELP_uc009wvr.2_Intron	NM_003005	NP_002996			selectin P precursor						platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	169881876	169881876	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169881876delG								SCYL3 (18800 upstream) : KIFAP3 (8596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	170140207	170140207	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170140207delT								METTL11B (3284 upstream) : LOC284688 (100340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	170774972	170774977	+	IGR	DEL	CACATG	-	-	rs79128992	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170774972_170774977delCACATG								PRRX1 (66432 upstream) : C1orf129 (129635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	170799177	170799177	+	IGR	DEL	T	-	-	rs10753824	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170799177delT								PRRX1 (90637 upstream) : C1orf129 (105435 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	171266902	171266902	+	IGR	DEL	T	-	-	rs35965034		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171266902delT								FMO1 (11791 upstream) : FMO4 (16584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	171417866	171417866	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171417866delA								FMO4 (106644 upstream) : BAT2L2 (36800 downstream)																																			---	---	---	---
DNM3	26052	broad.mit.edu	37	1	172185896	172185897	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172185896_172185897delCA	uc001gie.2	+						DNM3_uc009wwb.2_Intron|DNM3_uc001gif.2_Intron	NM_015569	NP_056384			dynamin 3 isoform a						endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1																		---	---	---	---
TNR	7143	broad.mit.edu	37	1	175349713	175349713	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175349713delA	uc001gkp.1	-						TNR_uc009wwu.1_Intron	NM_003285	NP_003276			tenascin R precursor						axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	175859847	175859847	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175859847delT								TNR (147095 upstream) : RFWD2 (54120 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	176816463	176816464	+	IGR	DEL	CT	-	-	rs149634541		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176816463_176816464delCT								PAPPA2 (4495 upstream) : ASTN1 (9977 downstream)																																			---	---	---	---
RASAL2	9462	broad.mit.edu	37	1	178379806	178379807	+	Intron	INS	-	AA	AA			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178379806_178379807insAA	uc001glr.2	+						RASAL2_uc009wxb.2_Intron|RASAL2_uc001glq.2_Intron	NM_004841	NP_004832			RAS protein activator like 2 isoform 1						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5																		---	---	---	---
C1orf49	84066	broad.mit.edu	37	1	178488083	178488083	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178488083delA	uc001glt.1	+						C1orf49_uc001glu.1_Intron|C1orf49_uc001glv.1_Intron|C1orf49_uc001glw.1_Intron	NM_032126	NP_115502			hypothetical protein LOC84066							microtubule cytoskeleton					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	178589967	178589968	+	IGR	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178589967_178589968delAG								C1orf220 (71943 upstream) : RALGPS2 (104332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	178615665	178615666	+	IGR	INS	-	A	A	rs147409098	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178615665_178615666insA								C1orf220 (97641 upstream) : RALGPS2 (78634 downstream)																																			---	---	---	---
RALGPS2	55103	broad.mit.edu	37	1	178878539	178878541	+	Intron	DEL	TTG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178878539_178878541delTTG	uc001glz.2	+						RALGPS2_uc010pnb.1_Intron	NM_152663	NP_689876			Ral GEF with PH domain and SH3 binding motif 2						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity|protein binding				0																		---	---	---	---
SOAT1	6646	broad.mit.edu	37	1	179286668	179286668	+	Intron	DEL	A	-	-	rs71661022		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179286668delA	uc001gml.2	+						SOAT1_uc010pni.1_Intron|SOAT1_uc001gmm.2_Intron|SOAT1_uc010pnj.1_Intron|SOAT1_uc010pnk.1_Intron	NM_003101	NP_003092			sterol O-acyltransferase 1						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)													---	---	---	---
XPR1	9213	broad.mit.edu	37	1	180643698	180643698	+	Intron	DEL	T	-	-	rs67695564		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180643698delT	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727			xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0																		---	---	---	---
XPR1	9213	broad.mit.edu	37	1	180800104	180800104	+	Intron	DEL	A	-	-	rs35823570		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180800104delA	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727			xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0																		---	---	---	---
XPR1	9213	broad.mit.edu	37	1	180800179	180800179	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180800179delG	uc001goi.2	+						XPR1_uc009wxm.2_Intron|XPR1_uc009wxn.2_Intron	NM_004736	NP_004727			xenotropic and polytropic retrovirus receptor							integral to plasma membrane	G-protein coupled receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	181888867	181888868	+	IGR	DEL	GA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181888867_181888868delGA								CACNA1E (118154 upstream) : ZNF648 (134839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	182713425	182713426	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182713425_182713426insA								RGS8 (71358 upstream) : NPL (45446 downstream)																																			---	---	---	---
NMNAT2	23057	broad.mit.edu	37	1	183318184	183318184	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183318184delC	uc001gqc.1	-							NM_015039	NP_055854			nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1																		---	---	---	---
C1orf21	81563	broad.mit.edu	37	1	184388781	184388782	+	Intron	INS	-	A	A	rs143773954	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184388781_184388782insA	uc001gqv.1	+							NM_030806	NP_110433			chromosome 1 open reading frame 21												0		Breast(1374;0.00262)		Colorectal(1306;4.8e-08)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)														---	---	---	---
HMCN1	83872	broad.mit.edu	37	1	186137579	186137580	+	Intron	INS	-	A	A	rs35413214		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186137579_186137580insA	uc001grq.1	+						HMCN1_uc001grs.1_Intron	NM_031935	NP_114141			hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	186238575	186238575	+	IGR	DEL	A	-	-	rs140136004		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186238575delA								HMCN1 (78490 upstream) : PRG4 (26830 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	186752238	186752239	+	IGR	INS	-	A	A	rs147286629	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186752238_186752239insA								PTGS2 (102679 upstream) : PLA2G4A (45793 downstream)																																			---	---	---	---
PLA2G4A	5321	broad.mit.edu	37	1	186894181	186894183	+	Intron	DEL	AAC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186894181_186894183delAAC	uc001gsc.2	+						PLA2G4A_uc010pos.1_Intron	NM_024420	NP_077734			cytosolic phospholipase A2, group IVA						phospholipid catabolic process|platelet activating factor biosynthetic process|platelet activation	cytosol|endoplasmic reticulum membrane	calcium ion binding|calcium-dependent phospholipid binding|lysophospholipase activity			lung(2)|breast(1)	3					Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Medrysone(DB00253)|Quinacrine(DB01103)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	187863270	187863271	+	IGR	INS	-	T	T	rs10602627		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187863270_187863271insT								PLA2G4A (905165 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	188776656	188776657	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188776656_188776657insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	189291960	189291960	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189291960delC								None (None upstream) : FAM5C (774837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	189831120	189831121	+	IGR	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:189831120_189831121delTC								None (None upstream) : FAM5C (235676 downstream)																																			---	---	---	---
FAM5C	339479	broad.mit.edu	37	1	190382325	190382326	+	Intron	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190382325_190382326delGT	uc001gse.1	-						FAM5C_uc010pot.1_Intron	NM_199051	NP_950252			family with sequence similarity 5, member C							extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	190881872	190881872	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190881872delA								FAM5C (435113 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191194639	191194640	+	IGR	INS	-	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191194639_191194640insC								FAM5C (747880 upstream) : RGS18 (932952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	192053588	192053588	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192053588delT								None (None upstream) : RGS18 (74004 downstream)																																			---	---	---	---
RGS13	6003	broad.mit.edu	37	1	192620858	192620858	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192620858delT	uc001gsj.2	+						RGS13_uc001gsk.2_Intron	NM_002927	NP_002918			regulator of G-protein signalling 13							plasma membrane	GTPase activator activity|signal transducer activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	193592315	193592315	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193592315delT								CDC73 (368375 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	196586673	196586674	+	IGR	INS	-	A	A	rs35337217		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196586673_196586674insA								KCNT2 (9174 upstream) : CFH (34334 downstream)																																			---	---	---	---
DENND1B	163486	broad.mit.edu	37	1	197514113	197514114	+	Intron	INS	-	GGAAGAA	GGAAGAA	rs146556758	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197514113_197514114insGGAAGAA	uc010ppe.1	-						DENND1B_uc010ppf.1_Intron	NM_001142795	NP_001136267			DENN/MADD domain containing 1B isoform 1							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	198011233	198011233	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198011233delA								LHX9 (109518 upstream) : NEK7 (114875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200150233	200150233	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200150233delG								NR5A2 (3685 upstream) : FAM58B (32423 downstream)																																			---	---	---	---
PPP1R12B	4660	broad.mit.edu	37	1	202380721	202380723	+	Intron	DEL	TTT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202380721_202380723delTTT	uc001gya.1	+						PPP1R12B_uc001gxy.2_Intron|PPP1R12B_uc009xad.1_Intron|PPP1R12B_uc009xae.1_Intron|PPP1R12B_uc001gxz.1_Intron	NM_002481	NP_002472			protein phosphatase 1, regulatory (inhibitor)						regulation of muscle contraction|signal transduction	cytoplasm	enzyme activator activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
PPFIA4	8497	broad.mit.edu	37	1	203005946	203005947	+	Intron	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203005946_203005947insG	uc009xaj.2	+											SubName: Full=Liprin alpha4;						cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	204745845	204745845	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204745845delA								MDM4 (68184 upstream) : NFASC (51937 downstream)																																			---	---	---	---
FCAMR	83953	broad.mit.edu	37	1	207141677	207141678	+	Intron	INS	-	CAA	CAA	rs143325039	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207141677_207141678insCAA	uc001hfa.3	-						FCAMR_uc001hfb.2_Intron|FCAMR_uc009xca.1_Intron|FCAMR_uc001hfc.2_Intron	NM_001122980	NP_001116452			Fc receptor, IgA, IgM, high affinity isoform 2							integral to membrane|plasma membrane	receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	208478002	208478002	+	IGR	DEL	T	-	-	rs67510717		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208478002delT								PLXNA2 (60337 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209087298	209087298	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209087298delC								PLXNA2 (669633 upstream) : LOC642587 (514870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	209178490	209178491	+	IGR	INS	-	A	A	rs76569171		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209178490_209178491insA								PLXNA2 (760825 upstream) : LOC642587 (423677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	210341410	210341412	+	IGR	DEL	GGT	-	-	rs72194371		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210341410_210341412delGGT								SYT14 (3779 upstream) : C1orf133 (63392 downstream)																																			---	---	---	---
KCNH1	3756	broad.mit.edu	37	1	211233928	211233928	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211233928delA	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872			potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212012811	212012811	+	IGR	DEL	T	-	-	rs76302395		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212012811delT								LPGAT1 (8697 upstream) : INTS7 (101887 downstream)																																			---	---	---	---
DTL	51514	broad.mit.edu	37	1	212237237	212237238	+	Intron	INS	-	TT	TT			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212237237_212237238insTT	uc009xdc.2	+						DTL_uc010ptb.1_Intron|DTL_uc001hiz.3_Intron	NM_016448	NP_057532			denticleless homolog						DNA replication|G2/M transition DNA damage checkpoint|protein monoubiquitination|protein polyubiquitination|response to UV|translesion synthesis|ubiquitin-dependent protein catabolic process	centrosome|Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|nuclear membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	212343360	212343360	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212343360delT								DTL (65174 upstream) : PPP2R5A (115519 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	212647427	212647430	+	IGR	DEL	AGAG	-	-	rs111271470		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212647427_212647430delAGAG								NENF (27708 upstream) : ATF3 (91267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	213460576	213460585	+	IGR	DEL	TGTGTGTGTG	-	-	rs113322018		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213460576_213460585delTGTGTGTGTG								RPS6KC1 (13769 upstream) : PROX1 (700701 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	214421220	214421220	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214421220delT								PROX1 (211460 upstream) : SMYD2 (33345 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	215633689	215633690	+	IGR	INS	-	TG	TG	rs140679264	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215633689_215633690insTG								KCNK2 (223254 upstream) : KCTD3 (107045 downstream)																																			---	---	---	---
SPATA17	128153	broad.mit.edu	37	1	217953002	217953002	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217953002delT	uc001hlh.1	+						SPATA17_uc009xdr.1_Intron|SPATA17_uc001hli.2_Intron	NM_138796	NP_620151			spermatogenesis associated 17							cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	218309034	218309034	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218309034delA								SPATA17 (268532 upstream) : RRP15 (149595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	219067065	219067066	+	IGR	DEL	TG	-	-	rs72352622		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219067065_219067066delTG								TGFB2 (449106 upstream) : LYPLAL1 (280126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	222154658	222154658	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222154658delT								DUSP10 (239197 upstream) : HHIPL2 (540944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	222591396	222591396	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222591396delT								DUSP10 (675935 upstream) : HHIPL2 (104206 downstream)																																			---	---	---	---
WDR26	80232	broad.mit.edu	37	1	224613570	224613570	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224613570delT	uc001hop.3	-						WDR26_uc001hoq.3_Intron|WDR26_uc009xei.1_Intron	NM_025160	NP_079436			WD repeat domain 26 isoform a							cytoplasm|nucleus					0				GBM - Glioblastoma multiforme(131;0.0104)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	224685535	224685535	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224685535delT	uc001hor.1	+											full-length cDNA clone CS0DC026YN07 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	226274274	226274274	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226274274delT	uc001hpx.2	+											Homo sapiens cDNA clone IMAGE:5260914.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	229113624	229113625	+	IGR	INS	-	GT	GT			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229113624_229113625insGT								RHOU (231215 upstream) : RAB4A (293254 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	229159606	229159606	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229159606delT								RHOU (277197 upstream) : RAB4A (247273 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	229819917	229819918	+	IGR	INS	-	A	A	rs113752941		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229819917_229819918insA								URB2 (23971 upstream) : GALNT2 (373618 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	230638682	230638682	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230638682delA								PGBD5 (125315 upstream) : COG2 (139520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	231211953	231211953	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231211953delT								FAM89A (35958 upstream) : TRIM67 (86721 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	232213586	232213586	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232213586delT								DISC1 (36570 upstream) : SIPA1L2 (320128 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	232851543	232851543	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232851543delG								SIPA1L2 (200300 upstream) : KIAA1383 (89095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234700798	234700798	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234700798delG								TARBP1 (85949 upstream) : IRF2BP2 (39219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234754488	234754489	+	IGR	INS	-	AC	AC	rs149042358	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234754488_234754489insAC								IRF2BP2 (9217 upstream) : TOMM20 (518171 downstream)																																			---	---	---	---
ARID4B	51742	broad.mit.edu	37	1	235459290	235459291	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235459290_235459291insA	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_Intron	NM_016374	NP_057458			AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)															---	---	---	---
TBCE	6905	broad.mit.edu	37	1	235583634	235583634	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235583634delT	uc001hwz.1	+						TBCE_uc010pxq.1_Intron|TBCE_uc001hxa.1_Intron|TBCE_uc010pxr.1_Intron|TBCE_uc001hxb.1_Intron	NM_003193	NP_003184			beta-tubulin cofactor E						'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|nucleus|plasma membrane	chaperone binding				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	236831249	236831249	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236831249delT								HEATR1 (63435 upstream) : ACTN2 (18521 downstream)																																			---	---	---	---
MTR	4548	broad.mit.edu	37	1	237034817	237034817	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237034817delA	uc001hyi.3	+						MTR_uc010pxw.1_Intron|MTR_uc010pxx.1_Intron|MTR_uc010pxy.1_Intron	NM_000254	NP_000245			5-methyltetrahydrofolate-homocysteine						nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	237199220	237199223	+	IGR	DEL	TCCT	-	-	rs66520854		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237199220_237199223delTCCT								MTR (131940 upstream) : RYR2 (6479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	238497833	238497834	+	IGR	INS	-	AGAA	AGAA	rs147849661	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238497833_238497834insAGAA								LOC100130331 (406216 upstream) : LOC339535 (145852 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	239127473	239127473	+	IGR	DEL	T	-	-	rs80006245		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239127473delT								LOC339535 (478156 upstream) : CHRM3 (422392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	239197537	239197538	+	IGR	INS	-	TG	TG	rs143011278	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239197537_239197538insTG								LOC339535 (548220 upstream) : CHRM3 (352327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	239231067	239231068	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239231067_239231068insT								LOC339535 (581750 upstream) : CHRM3 (318797 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	239439995	239439996	+	IGR	INS	-	A	A	rs138195060	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239439995_239439996insA								LOC339535 (790678 upstream) : CHRM3 (109869 downstream)																																			---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240381862	240381863	+	Intron	INS	-	A	A	rs34031862		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240381862_240381863insA	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
GREM2	64388	broad.mit.edu	37	1	240773604	240773604	+	Intron	DEL	T	-	-	rs34584796		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240773604delT	uc001hys.2	-							NM_022469	NP_071914			gremlin 2 precursor						BMP signaling pathway	extracellular space	cytokine activity				0		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)															---	---	---	---
RGS7	6000	broad.mit.edu	37	1	240970700	240970700	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240970700delA	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron|RGS7_uc001hyt.2_Intron	NM_002924	NP_002915			regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)															---	---	---	---
WDR64	128025	broad.mit.edu	37	1	241876445	241876446	+	Intron	INS	-	A	A	rs71809025		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241876445_241876446insA	uc001hze.1	+						WDR64_uc001hzf.1_Intron					RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	242995203	242995204	+	IGR	INS	-	GAAA	GAAA	rs10926878	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242995203_242995204insGAAA								PLD5 (307205 upstream) : CEP170 (292527 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	243275775	243275775	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243275775delA								PLD5 (587777 upstream) : CEP170 (11956 downstream)																																			---	---	---	---
SDCCAG8	10806	broad.mit.edu	37	1	243647508	243647508	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243647508delT	uc001hzw.2	+						SDCCAG8_uc010pyk.1_Intron|SDCCAG8_uc010pyl.1_Intron|SDCCAG8_uc001hzx.2_Intron	NM_006642	NP_006633			serologically defined colon cancer antigen 8						establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	244210653	244210654	+	IGR	INS	-	T	T	rs113813584		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244210653_244210654insT								AKT3 (204100 upstream) : ZNF238 (3907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	245310731	245310736	+	IGR	DEL	TGTGTG	-	-	rs57832793		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245310731_245310736delTGTGTG								EFCAB2 (22201 upstream) : KIF26B (7551 downstream)																																			---	---	---	---
ZNF670	93474	broad.mit.edu	37	1	247232132	247232132	+	Intron	DEL	A	-	-	rs35582452		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247232132delA	uc001icd.1	-						ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron	NM_033213	NP_149990			zinc finger protein 670						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	248597555	248597556	+	IGR	INS	-	CTT	CTT	rs150635077	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248597555_248597556insCTT								OR2T1 (27151 upstream) : OR2T2 (18543 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	830379	830380	+	Intron	INS	-	T	T	rs146795537	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:830379_830380insT	uc002qwn.1	-						uc002qwo.1_Intron					Homo sapiens cDNA clone IMAGE:5174186.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	1599740	1599741	+	IGR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1599740_1599741delCA								TPO (53242 upstream) : PXDN (35919 downstream)																																			---	---	---	---
MYT1L	23040	broad.mit.edu	37	2	2162476	2162477	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2162476_2162477delAC	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron|MYT1L_uc002qxf.1_Intron	NM_015025	NP_055840			myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	2568849	2568852	+	IGR	DEL	CACA	-	-	rs10581385		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2568849_2568852delCACA								MYT1L (233804 upstream) : TSSC1 (623889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	2708739	2708739	+	IGR	DEL	T	-	-	rs146181538	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2708739delT								MYT1L (373694 upstream) : TSSC1 (484002 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	2953982	2953985	+	Intron	DEL	ACAC	-	-	rs149150262		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2953982_2953985delACAC	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																														---	---	---	---
TSSC1	7260	broad.mit.edu	37	2	3196642	3196642	+	Intron	DEL	A	-	-	rs5828967		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3196642delA	uc002qxj.2	-						TSSC1_uc002qxi.2_Intron	NM_003310	NP_003301			tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	4517831	4517833	+	IGR	DEL	GAG	-	-	rs112813492		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4517831_4517833delGAG								ALLC (767573 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	4732753	4732753	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4732753delG								ALLC (982495 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5309630	5309631	+	IGR	DEL	TG	-	-	rs71400812		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5309630_5309631delTG								None (None upstream) : SOX11 (523168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	8993797	8993797	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8993797delG								KIDINS220 (16042 upstream) : MBOAT2 (2904 downstream)																																			---	---	---	---
C2orf48	348738	broad.mit.edu	37	2	10350022	10350022	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10350022delT	uc002rai.1	+							NM_182626	NP_872432			hypothetical protein LOC348738												0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)														---	---	---	---
ATP6V1C2	245973	broad.mit.edu	37	2	10872359	10872360	+	Intron	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10872359_10872360delCT	uc002ras.2	+						ATP6V1C2_uc002rat.2_Intron	NM_001039362	NP_001034451			vacuolar H+ ATPase C2 isoform a						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting V-type ATPase, V1 domain				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	11065481	11065503	+	IGR	DEL	CCAGGGTGGGATTTGGGGAGCTC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11065481_11065503delCCAGGGTGGGATTTGGGGAGCTC								KCNF1 (11131 upstream) : C2orf50 (207676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	11290467	11290467	+	IGR	DEL	T	-	-	rs68124639		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11290467delT								C2orf50 (3551 upstream) : PQLC3 (5073 downstream)																																			---	---	---	---
ROCK2	9475	broad.mit.edu	37	2	11422733	11422734	+	Intron	INS	-	AAA	AAA	rs71393871		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11422733_11422734insAAA	uc002rbd.1	-							NM_004850	NP_004841			Rho-associated, coiled-coil containing protein						axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	12552281	12552282	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12552281_12552282insT	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	13214134	13214134	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13214134delC								TRIB2 (331278 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13250971	13250972	+	IGR	DEL	TG	-	-	rs146636504	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13250971_13250972delTG								TRIB2 (368115 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13560220	13560220	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13560220delT								TRIB2 (677364 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	13751345	13751345	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13751345delT								TRIB2 (868489 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	14264323	14264323	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14264323delT								None (None upstream) : FAM84A (508533 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	15152986	15152987	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15152986_15152987insT								FAM84A (362053 upstream) : NBAS (154045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	15227348	15227349	+	IGR	DEL	AC	-	-	rs140890829		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15227348_15227349delAC								FAM84A (436415 upstream) : NBAS (79683 downstream)																																			---	---	---	---
NBAS	51594	broad.mit.edu	37	2	15565286	15565287	+	Intron	INS	-	A	A	rs143677242	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15565286_15565287insA	uc002rcc.1	-						NBAS_uc010exl.1_5'Flank|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993			neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	16010726	16010727	+	IGR	INS	-	AC	AC	rs148820155	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16010726_16010727insAC								DDX1 (239502 upstream) : MYCNOS (69293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16407867	16407867	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16407867delT								MYCN (320739 upstream) : FAM49A (326034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16576797	16576798	+	IGR	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16576797_16576798delAG								MYCN (489669 upstream) : FAM49A (157103 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19067561	19067561	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19067561delT								NT5C1B (296723 upstream) : OSR1 (483686 downstream)																																			---	---	---	---
C2orf43	60526	broad.mit.edu	37	2	20901818	20901818	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20901818delT	uc002rec.2	-						C2orf43_uc002rea.1_Intron|C2orf43_uc002reb.1_Intron|C2orf43_uc010yka.1_Intron|C2orf43_uc010ykb.1_Intron|C2orf43_uc010ykc.1_Intron|C2orf43_uc010ykd.1_Intron|C2orf43_uc010yke.1_Intron|C2orf43_uc010ykf.1_Intron	NM_021925	NP_068744			hypothetical protein LOC60526												0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	21687993	21687993	+	IGR	DEL	A	-	-	rs67503706		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21687993delA								APOB (421048 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	22477573	22477574	+	IGR	DEL	GT	-	-	rs10572601		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22477573_22477574delGT								None (None upstream) : None (None downstream)																																			---	---	---	---
UBXN2A	165324	broad.mit.edu	37	2	24159415	24159416	+	Intron	INS	-	A	A	rs113655000		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24159415_24159416insA	uc010exy.2	+						UBXN2A_uc002rem.2_Intron	NM_181713	NP_859064			UBX domain containing 4												0																		---	---	---	---
LOC375190	375190	broad.mit.edu	37	2	24329605	24329605	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24329605delT	uc002rew.2	+											SubName: Full=Putative uncharacterized protein C2orf84;												0																		---	---	---	---
LOC375190	375190	broad.mit.edu	37	2	24338778	24338780	+	Intron	DEL	AAA	-	-	rs67562598		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24338778_24338780delAAA	uc002rew.2	+						PFN4_uc002rfa.1_Intron					SubName: Full=Putative uncharacterized protein C2orf84;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	24617818	24617819	+	IGR	INS	-	GT	GT	rs139155211	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24617818_24617819insGT								ITSN2 (34421 upstream) : NCOA1 (169360 downstream)																																			---	---	---	---
NCOA1	8648	broad.mit.edu	37	2	24841207	24841207	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24841207delA	uc002rfk.2	+						NCOA1_uc010eye.2_Intron|NCOA1_uc002rfi.2_Intron|NCOA1_uc002rfj.2_Intron|NCOA1_uc002rfl.2_Intron	NM_003743	NP_003734			nuclear receptor coactivator 1 isoform 1										PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							T	PAX3	alveolar rhadomyosarcoma								---	---	---	---
Unknown	0	broad.mit.edu	37	2	25433878	25433878	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25433878delC								POMC (42319 upstream) : DNMT3A (21968 downstream)																																			---	---	---	---
DNMT3A	1788	broad.mit.edu	37	2	25552543	25552546	+	Intron	DEL	CACA	-	-	rs72100592		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25552543_25552546delCACA	uc002rgc.2	-						DNMT3A_uc002rgd.2_Intron|DNMT3A_uc010eyi.2_Intron|DNMT3A_uc002rge.2_Intron|DNMT3A_uc002rgf.2_Intron|MIR1301_hsa-mir-1301|MI0003815_5'Flank	NM_022552	NP_072046			DNA cytosine methyltransferase 3 alpha isoform						regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							Mis|F|N|S		AML								---	---	---	---
DTNB	1838	broad.mit.edu	37	2	25868226	25868227	+	Intron	INS	-	A	A	rs142437899		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25868226_25868227insA	uc002rgh.2	-						DTNB_uc010yko.1_Intron|DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc002rgr.1_Intron|DTNB_uc010ykq.1_Intron	NM_021907	NP_068707			dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
DTNB	1838	broad.mit.edu	37	2	25892774	25892774	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25892774delA	uc002rgh.2	-						DTNB_uc010ykp.1_Intron|DTNB_uc002rgo.2_Intron|DTNB_uc002rgi.2_Intron|DTNB_uc002rgj.2_Intron|DTNB_uc002rgk.2_Intron|DTNB_uc002rgl.2_Intron|DTNB_uc002rgq.2_Intron|DTNB_uc002rgm.2_Intron|DTNB_uc002rgn.2_Intron|DTNB_uc010ykq.1_Intron	NM_021907	NP_068707			dystrobrevin, beta isoform 1							cytoplasm	calcium ion binding|zinc ion binding			large_intestine(2)|ovary(2)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
ASXL2	55252	broad.mit.edu	37	2	26055441	26055441	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26055441delA	uc002rgs.2	-							NM_018263	NP_060733			additional sex combs like 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	26910024	26910025	+	IGR	DEL	AC	-	-	rs72323112	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26910024_26910025delAC								CIB4 (45813 upstream) : KCNK3 (5556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	27065472	27065473	+	IGR	INS	-	T	T	rs144865489		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27065472_27065473insT								CENPA (41540 upstream) : DPYSL5 (5496 downstream)																																			---	---	---	---
CGREF1	10669	broad.mit.edu	37	2	27331814	27331815	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27331814_27331815insT	uc010eys.1	-						CGREF1_uc010ylf.1_Intron|CGREF1_uc002rip.1_Intron|CGREF1_uc002rir.1_Intron|CGREF1_uc002ris.2_Intron	NM_006569	NP_006560			cell growth regulator with EF-hand domain 1						cell adhesion|cell cycle arrest|negative regulation of cell proliferation|response to stress	extracellular region	calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	28596678	28596679	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28596678_28596679insT								BRE (34913 upstream) : FOSL2 (19100 downstream)																																			---	---	---	---
PLB1	151056	broad.mit.edu	37	2	28845266	28845266	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28845266delG	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rme.1_Intron|PLB1_uc002rmf.1_Intron	NM_153021	NP_694566			phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
CLIP4	79745	broad.mit.edu	37	2	29374396	29374397	+	Intron	INS	-	A	A	rs149377141	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29374396_29374397insA	uc002rmv.2	+						CLIP4_uc002rmu.2_Intron|CLIP4_uc010ezm.1_Intron|CLIP4_uc002rmw.2_Intron|CLIP4_uc010ymn.1_Intron	NM_024692	NP_078968			CAP-GLY domain containing linker protein family,											ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
ALK	238	broad.mit.edu	37	2	29536357	29536359	+	Intron	DEL	GCC	-	-	rs143002001		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29536357_29536359delGCC	uc002rmy.2	-							NM_004304	NP_004295			anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				---	---	---	---
ALK	238	broad.mit.edu	37	2	29880220	29880220	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29880220delA	uc002rmy.2	-							NM_004304	NP_004295			anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	2	30655699	30655699	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30655699delT								LBH (172800 upstream) : LCLAT1 (14424 downstream)																																			---	---	---	---
SPAST	6683	broad.mit.edu	37	2	32291043	32291043	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32291043delT	uc002roc.2	+						SPAST_uc002rod.2_Intron	NM_014946	NP_055761			spastin isoform 1						cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	34321003	34321003	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34321003delG								MYADML (367719 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	36531632	36531632	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36531632delA								None (None upstream) : CRIM1 (51765 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	36578585	36578588	+	IGR	DEL	AGAG	-	-	rs71838152		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36578585_36578588delAGAG								None (None upstream) : CRIM1 (4809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	39823683	39823684	+	Intron	INS	-	TTTTCTTTTC	TTTTCTTTTC	rs142891071	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39823683_39823684insTTTTCTTTTC	uc002rrq.2	+						uc002rrr.1_Intron|uc002rrs.1_Intron					Homo sapiens cDNA FLJ33477 fis, clone BRAMY2002604.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	41896564	41896564	+	IGR	DEL	T	-	-	rs142724888		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41896564delT								None (None upstream) : PKDCC (378597 downstream)																																			---	---	---	---
MTA3	57504	broad.mit.edu	37	2	42838463	42838464	+	Intron	DEL	AC	-	-	rs66824873		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42838463_42838464delAC	uc002rso.1	+						MTA3_uc002rsp.1_Intron|MTA3_uc002rsq.2_Intron|MTA3_uc002rsr.2_Intron	NM_020744	NP_065795			metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2																		---	---	---	---
PRKCE	5581	broad.mit.edu	37	2	46162207	46162208	+	Intron	DEL	CA	-	-	rs111632236		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46162207_46162208delCA	uc002rut.2	+							NM_005400	NP_005391			protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)															---	---	---	---
PRKCE	5581	broad.mit.edu	37	2	46165869	46165870	+	Intron	INS	-	AAAT	AAAT	rs143813874	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46165869_46165870insAAAT	uc002rut.2	+							NM_005400	NP_005391			protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)															---	---	---	---
TTC7A	57217	broad.mit.edu	37	2	47159293	47159293	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47159293delT	uc002rvm.2	+						MCFD2_uc010fba.2_Intron|MCFD2_uc010yof.1_Intron	NM_020458	NP_065191			tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)															---	---	---	---
TTC7A	57217	broad.mit.edu	37	2	47257177	47257178	+	Intron	INS	-	TT	TT	rs150553570	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47257177_47257178insTT	uc002rvo.2	+						TTC7A_uc002rvm.2_Intron|TTC7A_uc002rvn.1_Intron|TTC7A_uc010fbb.2_Intron|TTC7A_uc010fbc.2_Intron|TTC7A_uc002rvp.2_Intron|TTC7A_uc002rvq.2_Intron|TTC7A_uc002rvr.2_Intron	NM_020458	NP_065191			tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	47467493	47467493	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47467493delT	uc002rvu.1	-											Homo sapiens cDNA FLJ37024 fis, clone BRACE2010837.									p.?(1)																					---	---	---	---
Unknown	0	broad.mit.edu	37	2	48654961	48654961	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48654961delA								FOXN2 (48527 upstream) : KLRAQ1 (12947 downstream)																																			---	---	---	---
FSHR	2492	broad.mit.edu	37	2	49353464	49353465	+	Intron	INS	-	A	A	rs72531888	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49353464_49353465insA	uc002rww.2	-						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Intron|FSHR_uc010fbo.1_Intron	NM_000145	NP_000136			follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)									Gonadal_Dysgenesis_46_XX				---	---	---	---
Unknown	0	broad.mit.edu	37	2	50128471	50128472	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50128471_50128472insA								FSHR (746841 upstream) : NRXN1 (17172 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	50131059	50131059	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50131059delT								FSHR (749429 upstream) : NRXN1 (14585 downstream)																																			---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50188458	50188459	+	Intron	INS	-	CACA	CACA	rs143296642	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50188458_50188459insCACA	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc010yon.1_Intron|NRXN1_uc002rxa.3_Intron	NM_138735	NP_620072			neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	52618836	52618837	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52618836_52618837delGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	54636005	54636005	+	IGR	DEL	C	-	-	rs67124190		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54636005delC								C2orf73 (47291 upstream) : SPTBN1 (47449 downstream)																																			---	---	---	---
PNPT1	87178	broad.mit.edu	37	2	55881391	55881392	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55881391_55881392insA	uc002rzf.2	-						PNPT1_uc002rzg.2_Intron	NM_033109	NP_149100			polyribonucleotide nucleotidyltransferase 1						mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	56319312	56319312	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56319312delT	uc002rzk.2	+						uc002rzl.1_5'Flank					Homo sapiens, clone IMAGE:3873411, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	57237798	57237799	+	IGR	INS	-	ACACACACACAC	ACACACACACAC	rs143855508	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57237798_57237799insACACACACACAC								CCDC85A (624490 upstream) : VRK2 (896987 downstream)																																			---	---	---	---
FANCL	55120	broad.mit.edu	37	2	58448466	58448466	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58448466delA	uc002rzw.3	-						FANCL_uc002rzx.3_Intron|FANCL_uc010fce.2_Intron|FANCL_uc010fcf.1_Intron	NM_018062	NP_060532			Fanconi anemia, complementation group L isoform						DNA repair	cytoplasm|nucleoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2													Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
Unknown	0	broad.mit.edu	37	2	59517621	59517621	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59517621delT								None (None upstream) : None (None downstream)																																			---	---	---	---
BCL11A	53335	broad.mit.edu	37	2	60750786	60750787	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60750786_60750787insT	uc002sae.1	-						BCL11A_uc002sab.2_Intron|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Intron|BCL11A_uc002sad.1_Intron|BCL11A_uc002saf.1_Intron	NM_022893	NP_075044			B-cell CLL/lymphoma 11A isoform 1						negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)					T	IGH@	B-CLL								---	---	---	---
Unknown	0	broad.mit.edu	37	2	61837390	61837391	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61837390_61837391insA								XPO1 (71972 upstream) : FAM161A (214594 downstream)																																			---	---	---	---
COMMD1	150684	broad.mit.edu	37	2	62170064	62170065	+	Intron	DEL	AT	-	-	rs115672423	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62170064_62170065delAT	uc002sbp.2	+							NM_152516	NP_689729			MURR1						copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity			ovary(1)	1	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	62603732	62603732	+	IGR	DEL	A	-	-	rs35512231		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62603732delA								B3GNT2 (151868 upstream) : TMEM17 (123624 downstream)																																			---	---	---	---
EHBP1	23301	broad.mit.edu	37	2	62955117	62955117	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62955117delA	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc010fcq.1_Intron|EHBP1_uc002sbx.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron|EHBP1_uc002sca.2_Intron	NM_015252	NP_056067			EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)											Hereditary_Prostate_Cancer				---	---	---	---
Unknown	0	broad.mit.edu	37	2	64709365	64709366	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64709365_64709366insT								HSPC159 (20854 upstream) : AFTPH (42099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	64854455	64854455	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64854455delG								AFTPH (34324 upstream) : SERTAD2 (4301 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	65423840	65423841	+	IGR	INS	-	AC	AC	rs150265203	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65423840_65423841insAC								RAB1A (66405 upstream) : ACTR2 (30988 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	66101546	66101546	+	Intron	DEL	T	-	-	rs5831783		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66101546delT	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	66478212	66478213	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66478212_66478213insA								SPRED2 (818556 upstream) : MEIS1 (184319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	66632344	66632345	+	IGR	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66632344_66632345delAC								SPRED2 (972688 upstream) : MEIS1 (30187 downstream)																																			---	---	---	---
MEIS1	4211	broad.mit.edu	37	2	66752347	66752350	+	Intron	DEL	AAAC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66752347_66752350delAAAC	uc002sdu.2	+						MEIS1_uc002sdt.2_Intron|MEIS1_uc002sdv.2_Intron|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Intron|MEIS1_uc002sdw.1_Intron	NM_002398	NP_002389			Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	66988347	66988347	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66988347delT								MEIS1 (188457 upstream) : ETAA1 (636095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	67193723	67193723	+	IGR	DEL	A	-	-	rs76507887	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67193723delA								MEIS1 (393833 upstream) : ETAA1 (430719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	67444704	67444706	+	Intron	DEL	ATG	-	-	rs139034223		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67444704_67444706delATG	uc002sdx.2	+						uc002sdy.1_5'Flank					Homo sapiens, clone IMAGE:5541055, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	67900530	67900531	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67900530_67900531insA								ETAA1 (262997 upstream) : C1D (368802 downstream)																																			---	---	---	---
GFPT1	2673	broad.mit.edu	37	2	69615975	69615975	+	5'Flank	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69615975delA	uc002sfh.2	-							NM_002056	NP_002047			glucosamine-fructose-6-phosphate						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1																		---	---	---	---
ANXA4	307	broad.mit.edu	37	2	70030329	70030329	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70030329delA	uc002sfr.3	+						ANXA4_uc010yqn.1_Intron|ANXA4_uc002sfs.3_Intron|ANXA4_uc010yqo.1_Intron	NM_001153	NP_001144			annexin IV						anti-apoptosis|signal transduction	cytoplasm	calcium ion binding|calcium-dependent phospholipid binding|phospholipase inhibitor activity				0																		---	---	---	---
ASPRV1	151516	broad.mit.edu	37	2	70282221	70282221	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70282221delG	uc002sga.2	-						uc002sgb.1_Intron|uc002sgc.2_Intron|uc002sgd.2_Intron|uc002sge.1_Intron					Homo sapiens cDNA FLJ32260 fis, clone PROST1000334.						protein maturation by peptide bond cleavage|skin development		aspartic-type endopeptidase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	70347724	70347725	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70347724_70347725insT								PCBP1 (31392 upstream) : LOC100133985 (3444 downstream)																																			---	---	---	---
CD207	50489	broad.mit.edu	37	2	71063410	71063410	+	5'Flank	DEL	A	-	-	rs72202989		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71063410delA	uc002shg.2	-							NM_015717	NP_056532			CD207 antigen, langerin						defense response to virus	endocytic vesicle|integral to membrane	mannose binding			ovary(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	71487393	71487393	+	IGR	DEL	C	-	-	rs11305731		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71487393delC								PAIP2B (33160 upstream) : ZNF638 (16330 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	71487549	71487550	+	IGR	INS	-	AAAC	AAAC	rs140941689	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71487549_71487550insAAAC								PAIP2B (33316 upstream) : ZNF638 (16173 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	71996093	71996094	+	IGR	INS	-	AC	AC	rs12992497	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71996093_71996094insAC								DYSF (82201 upstream) : CYP26B1 (360273 downstream)																																			---	---	---	---
SLC4A5	57835	broad.mit.edu	37	2	74557753	74557754	+	Intron	INS	-	T	T	rs139880064		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74557753_74557754insT	uc002skn.2	-						SLC4A5_uc002skl.2_Intron|SLC4A5_uc002skp.1_5'Flank|SLC4A5_uc002sks.1_Intron	NM_133478	NP_597812			sodium bicarbonate transporter 4 isoform c							apical plasma membrane|integral to membrane	inorganic anion exchanger activity|sodium:bicarbonate symporter activity			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	74989934	74989934	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74989934delT								SEMA4F (80749 upstream) : HK2 (69848 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	76842528	76842528	+	IGR	DEL	A	-	-	rs138339332		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76842528delA								C2orf3 (904417 upstream) : LRRTM4 (132330 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	76846513	76846513	+	IGR	DEL	G	-	-	rs67302354		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76846513delG								C2orf3 (908402 upstream) : LRRTM4 (128345 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	77923985	77923985	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77923985delT								LRRTM4 (174483 upstream) : SNAR-H (258048 downstream)																																			---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	79813485	79813485	+	Intron	DEL	A	-	-	rs66746609		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79813485delA	uc010yse.1	+						CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80123411	80123411	+	Intron	DEL	A	-	-	rs78890962		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80123411delA	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80859403	80859404	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80859403_80859404delAC	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysi.1_Intron|CTNNA2_uc010ysj.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	82565926	82565926	+	IGR	DEL	A	-	-	rs36045068		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82565926delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	83671119	83671119	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83671119delT								None (None upstream) : FUNDC2P2 (846687 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	83924492	83924493	+	IGR	DEL	AC	-	-	rs72138141		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83924492_83924493delAC								None (None upstream) : FUNDC2P2 (593313 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	83970977	83970978	+	IGR	INS	-	AA	AA	rs72458365		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83970977_83970978insAA								None (None upstream) : FUNDC2P2 (546828 downstream)																																			---	---	---	---
DNAH6	1768	broad.mit.edu	37	2	84900400	84900400	+	Intron	DEL	G	-	-	rs78446259		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84900400delG	uc010fgb.2	+						DNAH6_uc002sor.2_Intron	NM_001370	NP_001361			dynein, axonemal, heavy polypeptide 6						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1																		---	---	---	---
TCF7L1	83439	broad.mit.edu	37	2	85510394	85510395	+	Intron	INS	-	CCG	CCG	rs147227391	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85510394_85510395insCCG	uc002soy.2	+							NM_031283	NP_112573			HMG-box transcription factor TCF-3						chromatin organization|regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
VPS24	51652	broad.mit.edu	37	2	86752656	86752656	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86752656delA	uc002srj.2	-						VPS24_uc002srk.2_Intron|VPS24_uc002srl.2_Intron|VPS24_uc010ytl.1_Intron	NM_016079	NP_057163			vacuolar protein sorting 24 isoform 1						cell cycle|cell division|cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			central_nervous_system(1)	1																		---	---	---	---
VPS24	51652	broad.mit.edu	37	2	86927390	86927390	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86927390delT	uc010ytl.1	-							NM_001005753	NP_001005753			vacuolar protein sorting 24 isoform 2						cell cycle|cell division|cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			central_nervous_system(1)	1																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87035530	87035531	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87035530_87035531delTG	uc002srs.3	+						CD8A_uc002srv.2_5'Flank					SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																OREG0014760	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87253295	87253296	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87253295_87253296insT	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	88314870	88314870	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88314870delT								RMND5A (276104 upstream) : KRCC1 (11854 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	90295507	90295508	+	Intron	INS	-	GATGAAATGATGA	GATGAAATGATGA			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90295507_90295508insGATGAAATGATGA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	90416456	90416457	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90416456_90416457insA	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	90417245	90417247	+	Intron	DEL	GAG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90417245_90417247delGAG	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	90470953	90470953	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90470953delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91683264	91683265	+	IGR	INS	-	A	A	rs143557730		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91683264_91683265insA								None (None upstream) : LOC654342 (121927 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91944753	91944754	+	IGR	DEL	GT	-	-	rs62142720	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91944753_91944754delGT								LOC654342 (96778 upstream) : GGT8P (18614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92154824	92154826	+	IGR	DEL	TGA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92154824_92154826delTGA								FKSG73 (24330 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92192846	92192847	+	IGR	DEL	AT	-	-	rs112639286		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92192846_92192847delAT								FKSG73 (62352 upstream) : None (None downstream)																																			---	---	---	---
ANKRD20B	729171	broad.mit.edu	37	2	95443335	95443335	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95443335delG	uc010fhp.2	-							NR_003366				Homo sapiens ankyrin repeat domain 20B (ANKRD20B), non-coding RNA.												0																		---	---	---	---
ANKRD20B	729171	broad.mit.edu	37	2	95471010	95471011	+	Intron	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95471010_95471011delTC	uc010fhp.2	-							NR_003366				Homo sapiens ankyrin repeat domain 20B (ANKRD20B), non-coding RNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	96433012	96433012	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96433012delT								TRIM43 (167545 upstream) : LOC729234 (243287 downstream)																																			---	---	---	---
SNRNP200	23020	broad.mit.edu	37	2	96950488	96950488	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96950488delT	uc002svu.2	-						SNRNP200_uc002svt.2_5'Flank|SNRNP200_uc010yuj.1_Intron|SNRNP200_uc002svv.1_5'UTR	NM_014014	NP_054733			activating signal cointegrator 1 complex subunit							catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10																		---	---	---	---
KIAA1310	55683	broad.mit.edu	37	2	97287851	97287856	+	Intron	DEL	AAAAAA	-	-	rs113914476		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97287851_97287856delAAAAAA	uc002swn.3	-						KIAA1310_uc002swh.3_Intron|KIAA1310_uc002swi.3_Intron|KIAA1310_uc002swj.3_Intron|KIAA1310_uc002swk.3_Intron|KIAA1310_uc010fhz.2_Intron|KIAA1310_uc002swl.3_Intron|KIAA1310_uc002swm.3_Intron|KIAA1310_uc010yur.1_Intron|KIAA1310_uc002swp.1_Intron|KIAA1310_uc002swq.1_Intron|KIAA1310_uc010fhy.1_Intron	NM_001115016	NP_001108488			hypothetical protein LOC55683 isoform a												0																		---	---	---	---
CNNM3	26505	broad.mit.edu	37	2	97500392	97500393	+	3'UTR	INS	-	AG	AG	rs150040636	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97500392_97500393insAG	uc002swy.2	+	8					CNNM3_uc002swz.2_3'UTR	NM_017623	NP_060093			cyclin M3 isoform 1						ion transport	integral to membrane|plasma membrane	protein binding			ovary(1)	1																		---	---	---	---
FAM178B	51252	broad.mit.edu	37	2	97653120	97653121	+	5'Flank	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97653120_97653121delAC	uc002sxl.3	-							NM_001122646	NP_001116118			hypothetical protein LOC51252 isoform A												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	97684996	97684997	+	IGR	INS	-	AC	AC	rs56083754	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97684996_97684997insAC								FAM178B (32695 upstream) : FAHD2B (64327 downstream)																																			---	---	---	---
ANKRD36	375248	broad.mit.edu	37	2	97812185	97812187	+	Intron	DEL	TTG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97812185_97812187delTTG	uc010yva.1	+						ANKRD36_uc010yuz.1_Intron|ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron	NM_001164315	NP_001157787			ankyrin repeat domain 36												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	100142471	100142471	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100142471delT								REV1 (35991 upstream) : AFF3 (21247 downstream)																																			---	---	---	---
AFF3	3899	broad.mit.edu	37	2	100285923	100285924	+	Intron	INS	-	A	A	rs139403587	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100285923_100285924insA	uc002tag.2	-						AFF3_uc002taf.2_Intron|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Intron|AFF3_uc002tah.1_Intron	NM_002285	NP_002276			AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	101778731	101778734	+	IGR	DEL	ACAC	-	-	rs3841079		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101778731_101778734delACAC								TBC1D8 (10885 upstream) : C2orf29 (90611 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	102682501	102682502	+	IGR	INS	-	T	T	rs149337808		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102682501_102682502insT								IL1R2 (37621 upstream) : IL1R1 (4334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	103217853	103217854	+	IGR	DEL	GA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103217853_103217854delGA								SLC9A4 (67423 upstream) : SLC9A2 (18312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	103547721	103547722	+	IGR	DEL	AC	-	-	rs71939401		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103547721_103547722delAC								TMEM182 (113585 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	103691599	103691599	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103691599delA								TMEM182 (257463 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105135839	105135840	+	IGR	INS	-	GGAA	GGAA	rs139198455	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105135839_105135840insGGAA								LOC150568 (6625 upstream) : POU3F3 (336129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105151571	105151572	+	IGR	INS	-	AGAA	AGAA	rs145058088	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105151571_105151572insAGAA								LOC150568 (22357 upstream) : POU3F3 (320397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105170872	105170874	+	IGR	DEL	TAC	-	-	rs142607087		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105170872_105170874delTAC								LOC150568 (41658 upstream) : POU3F3 (301095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105401814	105401814	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105401814delT								LOC150568 (272600 upstream) : POU3F3 (70155 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105488532	105488533	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105488532_105488533delAC	uc002tcm.1	-											Homo sapiens cDNA FLJ38179 fis, clone FCBBF1000118.																														---	---	---	---
NPHP1	4867	broad.mit.edu	37	2	110916504	110916505	+	Intron	INS	-	C	C	rs148314281	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110916504_110916505insC	uc002tfn.3	-						NPHP1_uc002tfm.3_Intron|NPHP1_uc002tfl.3_Intron|NPHP1_uc002tfo.3_Intron|NPHP1_uc010ywx.1_Intron|NPHP1_uc010fjv.1_Intron	NM_207181	NP_997064			nephrocystin 1 isoform 2						actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	112306382	112306383	+	IGR	INS	-	C	C	rs908767		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112306382_112306383insC								LOC541471 (53690 upstream) : ANAPC1 (220258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	113103935	113103935	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103935delC								ZC3H6 (6295 upstream) : RGPD8 (22031 downstream)																																			---	---	---	---
TTL	150465	broad.mit.edu	37	2	113278192	113278193	+	Intron	INS	-	TA	TA	rs138859384	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113278192_113278193insTA	uc002thu.2	+						TTL_uc010fkm.1_Intron	NM_153712	NP_714923			tubulin tyrosine ligase						protein modification process		ATP binding|tubulin-tyrosine ligase activity				0		Ovarian(717;0.024)		BRCA - Breast invasive adenocarcinoma(221;6.17e-07)|STAD - Stomach adenocarcinoma(1183;0.00644)				T	ETV6	ALL								---	---	---	---
WASH2P	375260	broad.mit.edu	37	2	114345023	114345025	+	Intron	DEL	ATT	-	-	rs62160570		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114345023_114345025delATT	uc002tka.2	+						WASH2P_uc002tkb.2_Intron|WASH2P_uc010fkx.1_5'Flank|WASH2P_uc002tkd.2_5'Flank	NR_024077				Homo sapiens cDNA FLJ75027 complete cds, highly similar to Homo sapiens CXYorf1-related protein (MGC52000), mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	114406040	114406041	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114406040_114406041insA								RABL2A (5066 upstream) : SLC35F5 (65890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	117784839	117784840	+	IGR	INS	-	AAC	AAC	rs142997209	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:117784839_117784840insAAC								None (None upstream) : DDX18 (787415 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	117969197	117969197	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:117969197delA								None (None upstream) : DDX18 (603058 downstream)																																			---	---	---	---
INSIG2	51141	broad.mit.edu	37	2	118850459	118850466	+	Intron	DEL	TGAGGACG	-	-	rs61226625	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118850459_118850466delTGAGGACG	uc002tlk.2	+						INSIG2_uc010yye.1_Intron	NM_016133	NP_057217			insulin induced protein 2						ER-nuclear sterol response pathway	SREBP-SCAP-Insig complex				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	119453493	119453493	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119453493delG								INSIG2 (585897 upstream) : EN1 (146255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119531969	119531969	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119531969delT								INSIG2 (664373 upstream) : EN1 (67779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119661178	119661179	+	IGR	DEL	AG	-	-	rs149898994		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119661178_119661179delAG								EN1 (55419 upstream) : MARCO (38566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	120148349	120148349	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120148349delT								DBI (18229 upstream) : TMEM37 (41097 downstream)																																			---	---	---	---
PTPN4	5775	broad.mit.edu	37	2	120570828	120570829	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120570828_120570829insT	uc002tmf.1	+							NM_002830	NP_002821			protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity			ovary(2)	2					Alendronate(DB00630)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	121187749	121187749	+	IGR	DEL	T	-	-	rs112005741		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121187749delT								INHBB (78366 upstream) : LOC84931 (34162 downstream)																																			---	---	---	---
TFCP2L1	29842	broad.mit.edu	37	2	122004065	122004066	+	Intron	INS	-	G	G	rs144946334	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122004065_122004066insG	uc002tmx.2	-						TFCP2L1_uc010flr.2_Intron	NM_014553	NP_055368			LBP-9						female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			pancreas(2)|ovary(1)	3	Renal(3;0.01)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	127906976	127906976	+	IGR	DEL	T	-	-	rs74319992		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127906976delT								BIN1 (42112 upstream) : CYP27C1 (34436 downstream)																																			---	---	---	---
UGGT1	56886	broad.mit.edu	37	2	128896088	128896089	+	Intron	INS	-	A	A	rs112766490		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128896088_128896089insA	uc002tps.2	+						UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505			UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1																		---	---	---	---
UGGT1	56886	broad.mit.edu	37	2	128903076	128903083	+	Intron	DEL	ACACACAC	-	-	rs148179494		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128903076_128903083delACACACAC	uc002tps.2	+						UGGT1_uc010fme.1_Intron|UGGT1_uc002tpr.2_Intron	NM_020120	NP_064505			UDP-glucose ceramide glucosyltransferase-like 1						'de novo' posttranslational protein folding|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity|unfolded protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	129446039	129446042	+	IGR	DEL	TCTG	-	-	rs78146778		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129446039_129446042delTCTG								HS6ST1 (369868 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	130546996	130547002	+	IGR	DEL	TTTTGTT	-	-	rs113896388		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130546996_130547002delTTTTGTT								None (None upstream) : LOC389033 (133433 downstream)																																			---	---	---	---
SMPD4	55627	broad.mit.edu	37	2	130926101	130926102	+	Intron	INS	-	T	T	rs144874756	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130926101_130926102insT	uc002tqq.1	-						SMPD4_uc002tqp.1_Intron|SMPD4_uc010yzy.1_Intron|SMPD4_uc010yzz.1_Intron|SMPD4_uc002tqr.1_Intron|SMPD4_uc002tqs.1_Intron|SMPD4_uc002tqt.1_Intron|SMPD4_uc010zaa.1_Intron|SMPD4_uc010zab.1_Intron|SMPD4_uc010zac.1_Intron|SMPD4_uc010zad.1_Intron	NM_017951	NP_060421			sphingomyelin phosphodiesterase 4 isoform 2						sphingomyelin catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|trans-Golgi network	metal ion binding|protein binding|sphingomyelin phosphodiesterase activity|sphingomyelin phosphodiesterase D activity				0	Colorectal(110;0.1)				Phosphatidylserine(DB00144)													---	---	---	---
ARHGEF4	50649	broad.mit.edu	37	2	131786960	131786960	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131786960delA	uc002tsa.1	+						ARHGEF4_uc010fmw.1_Intron|ARHGEF4_uc002tsb.1_Intron|ARHGEF4_uc010fmx.1_Intron	NM_015320	NP_056135			Rho guanine nucleotide exchange factor 4 isoform						apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity			breast(3)|ovary(2)|skin(1)	6		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)														---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	132984742	132984743	+	Intron	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132984742_132984743insG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133032788	133032793	+	IGR	DEL	GAGAGA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133032788_133032793delGAGAGA								NCRNA00164 (17246 upstream) : GPR39 (141354 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133038819	133038820	+	IGR	DEL	GG	-	-	rs34812864		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133038819_133038820delGG								NCRNA00164 (23277 upstream) : GPR39 (135327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133064260	133064261	+	Intron	INS	-	C	C	rs148351345	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133064260_133064261insC	uc002ttk.1	+											Homo sapiens cDNA FLJ37280 fis, clone BRAMY2012881.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	133076665	133076666	+	Intron	INS	-	T	T	rs146146156	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133076665_133076666insT	uc002ttk.1	+											Homo sapiens cDNA FLJ37280 fis, clone BRAMY2012881.																														---	---	---	---
GPR39	2863	broad.mit.edu	37	2	133308856	133308857	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133308856_133308857insA	uc002ttl.2	+							NM_001508	NP_001499			G protein-coupled receptor 39							integral to plasma membrane	G-protein coupled receptor activity|metal ion binding				0																		---	---	---	---
GPR39	2863	broad.mit.edu	37	2	133324893	133324893	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133324893delA	uc002ttl.2	+							NM_001508	NP_001499			G protein-coupled receptor 39							integral to plasma membrane	G-protein coupled receptor activity|metal ion binding				0																		---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	133677711	133677712	+	Intron	INS	-	T	T	rs147058918	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133677711_133677712insT	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron|uc002ttr.2_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	134597588	134597588	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134597588delA								NCKAP5 (271557 upstream) : MGAT5 (414242 downstream)																																			---	---	---	---
MGAT5	4249	broad.mit.edu	37	2	135127298	135127299	+	Intron	INS	-	TG	TG	rs143265088	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135127298_135127299insTG	uc002ttv.1	+							NM_002410	NP_002401			N-acetylglucosaminyltransferase V						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0964)														---	---	---	---
MGAT5	4249	broad.mit.edu	37	2	135194424	135194424	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135194424delG	uc002ttv.1	+							NM_002410	NP_002401			N-acetylglucosaminyltransferase V						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0964)														---	---	---	---
ACMSD	130013	broad.mit.edu	37	2	135595500	135595500	+	5'Flank	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135595500delA	uc002ttz.2	+						ACMSD_uc002tua.2_5'Flank	NM_138326	NP_612199			aminocarboxymuconate semialdehyde decarboxylase						quinolinate metabolic process|tryptophan catabolic process	cytosol	aminocarboxymuconate-semialdehyde decarboxylase activity|metal ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.115)														---	---	---	---
UBXN4	23190	broad.mit.edu	37	2	136522361	136522361	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136522361delC	uc002tur.2	+						UBXN4_uc002tus.2_Intron	NM_014607	NP_055422			UBX domain containing 2						response to unfolded protein	endoplasmic reticulum membrane|nuclear envelope	protein binding			skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	136658781	136658781	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136658781delT								MCM6 (24770 upstream) : DARS (5473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	136849138	136849138	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136849138delC								DARS (105916 upstream) : CXCR4 (22782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	137087942	137087942	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137087942delT								CXCR4 (212217 upstream) : THSD7B (435173 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	138487153	138487154	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138487153_138487154insA								THSD7B (51866 upstream) : HNMT (234436 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	139930766	139930767	+	IGR	INS	-	CT	CT	rs143285736	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139930766_139930767insCT								NXPH2 (392955 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	140436539	140436540	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140436539_140436540insT								NXPH2 (898728 upstream) : LRP1B (552456 downstream)																																			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141470895	141470895	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141470895delT	uc002tvj.1	-							NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	142469522	142469523	+	Intron	DEL	AC	-	-	rs71998053		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142469522_142469523delAC	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	2	143536067	143536067	+	IGR	DEL	A	-	-	rs58147340		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143536067delA								LRP1B (646797 upstream) : KYNU (99128 downstream)																																			---	---	---	---
ARHGAP15	55843	broad.mit.edu	37	2	144252717	144252719	+	Intron	DEL	TTT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144252717_144252719delTTT	uc002tvm.3	+						ARHGAP15_uc002tvn.2_Intron	NM_018460	NP_060930			ARHGAP15						regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	145830741	145830741	+	RNA	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145830741delT	uc002twc.2	+	5		c.1218delT			uc002twd.2_Intron|uc002twe.2_Intron					Homo sapiens hypothetical gene supported by BC043549; BX648102, mRNA (cDNA clone IMAGE:5172341).																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	148298476	148298477	+	IGR	INS	-	AAAC	AAAC	rs148918175	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148298476_148298477insAAAC								PABPC1P2 (949919 upstream) : ACVR2A (303609 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	148463045	148463045	+	IGR	DEL	A	-	-	rs5835165		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148463045delA								None (None upstream) : ACVR2A (139041 downstream)																																			---	---	---	---
ORC4L	5000	broad.mit.edu	37	2	148744140	148744141	+	Intron	DEL	GA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148744140_148744141delGA	uc002twi.2	-						ORC4L_uc002twj.2_Intron|ORC4L_uc010zbo.1_Intron|ORC4L_uc010zbp.1_Intron|ORC4L_uc010fnr.2_Intron|ORC4L_uc010zbq.1_Intron|ORC4L_uc002twk.2_Intron|ORC4L_uc010zbr.1_Intron	NM_181741	NP_859525			origin recognition complex subunit 4						cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|nucleoside-triphosphatase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.0963)|COAD - Colon adenocarcinoma(177;0.203)														---	---	---	---
EPC2	26122	broad.mit.edu	37	2	149468311	149468311	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149468311delA	uc010zbt.1	+							NM_015630	NP_056445			enhancer of polycomb homolog 2						chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)|breast(1)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0516)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	152053610	152053611	+	IGR	DEL	AC	-	-	rs71403143		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152053610_152053611delAC								RND3 (709430 upstream) : RBM43 (51118 downstream)																																			---	---	---	---
STAM2	10254	broad.mit.edu	37	2	153022572	153022572	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153022572delC	uc002tyc.3	-						STAM2_uc010foa.1_Intron|STAM2_uc002tyd.2_Intron	NM_005843	NP_005834			signal transducing adaptor molecule 2						cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.22)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	153042016	153042017	+	IGR	INS	-	T	T	rs71410483		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153042016_153042017insT								STAM2 (9510 upstream) : FMNL2 (149734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	154572347	154572347	+	IGR	DEL	T	-	-	rs71940777		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154572347delT								RPRM (237025 upstream) : GALNT13 (156079 downstream)																																			---	---	---	---
GALNT13	114805	broad.mit.edu	37	2	154822885	154822886	+	Intron	INS	-	T	T	rs71396375		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154822885_154822886insT	uc002tyr.3	+						GALNT13_uc002tyt.3_Intron	NM_052917	NP_443149			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
GALNT13	114805	broad.mit.edu	37	2	155181651	155181651	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155181651delA	uc002tyr.3	+						GALNT13_uc002tyt.3_Intron|GALNT13_uc010foc.1_Intron|GALNT13_uc010fod.2_Intron	NM_052917	NP_443149			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	155934063	155934063	+	IGR	DEL	T	-	-	rs79183472		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155934063delT								KCNJ3 (221049 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	156671110	156671110	+	IGR	DEL	A	-	-	rs151142783		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156671110delA								KCNJ3 (958096 upstream) : NR4A2 (509836 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	159642568	159642568	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159642568delA								PKP4 (104630 upstream) : DAPL1 (9261 downstream)																																			---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160509296	160509296	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160509296delT	uc002uau.1	-											SubName: Full=Putative uncharacterized protein DKFZp686H10114;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	163779988	163779988	+	IGR	DEL	T	-	-	rs72166681		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163779988delT								KCNH7 (84748 upstream) : FIGN (684130 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	163845608	163845608	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163845608delG								KCNH7 (150368 upstream) : FIGN (618510 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	163933423	163933424	+	IGR	INS	-	GT	GT	rs139996987	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163933423_163933424insGT								KCNH7 (238183 upstream) : FIGN (530694 downstream)																																			---	---	---	---
COBLL1	22837	broad.mit.edu	37	2	165594232	165594232	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165594232delT	uc010zcw.1	-						COBLL1_uc002ucp.2_Intron|COBLL1_uc002ucq.2_Intron|COBLL1_uc010zcx.1_Intron|COBLL1_uc002ucs.1_Intron	NM_014900	NP_055715			COBL-like 1											ovary(2)|pancreas(1)	3																OREG0015041	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	2	167392334	167392334	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167392334delA								SCN7A (41617 upstream) : XIRP2 (352663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	167615441	167615441	+	IGR	DEL	A	-	-	rs68160930		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167615441delA								SCN7A (264724 upstream) : XIRP2 (129556 downstream)																																			---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	167864722	167864722	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167864722delT	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron	NM_152381	NP_689594			xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	167997380	167997380	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167997380delT	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Intron	NM_152381	NP_689594			xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	168461995	168461996	+	IGR	INS	-	T	T	rs146553279	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168461995_168461996insT								XIRP2 (345736 upstream) : B3GALT1 (213186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	169161975	169161976	+	IGR	INS	-	T	T	rs35887133		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169161975_169161976insT								STK39 (57870 upstream) : LASS6 (150859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	170990160	170990160	+	IGR	DEL	A	-	-	rs139243934		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170990160delA								UBR3 (49523 upstream) : MYO3B (44495 downstream)																																			---	---	---	---
MYO3B	140469	broad.mit.edu	37	2	171321378	171321379	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171321378_171321379insT	uc002ufy.2	+						MYO3B_uc002ufv.2_Intron|MYO3B_uc010fqb.1_Intron|MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482			myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	171601529	171601530	+	Intron	INS	-	TCTG	TCTG	rs150946358	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171601529_171601530insTCTG	uc002ugf.1	-											Homo sapiens cDNA FLJ13453 fis, clone PLACE1003205.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	171739953	171739953	+	IGR	DEL	T	-	-	rs113511890		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171739953delT								GAD1 (22296 upstream) : GORASP2 (45029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	172372677	172372677	+	IGR	DEL	T	-	-	rs71401427		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172372677delT								DCAF17 (31117 upstream) : CYBRD1 (6189 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	172634933	172634934	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172634933_172634934insA								DYNC1I2 (30014 upstream) : SLC25A12 (4981 downstream)																																			---	---	---	---
SLC25A12	8604	broad.mit.edu	37	2	172659475	172659476	+	Intron	DEL	GT	-	-	rs67016782		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172659475_172659476delGT	uc002uhh.2	-						SLC25A12_uc010fqh.2_Intron	NM_003705	NP_003696			solute carrier family 25, member 12						gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)													---	---	---	---
MAP1D	254042	broad.mit.edu	37	2	172899308	172899309	+	Intron	INS	-	TG	TG	rs60184291		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172899308_172899309insTG	uc002uhk.2	+						MAP1D_uc010zdw.1_Intron	NM_199227	NP_954697			methionine aminopeptidase 1D precursor						N-terminal protein amino acid modification|peptidyl-methionine modification|proteolysis	mitochondrion	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.216)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	174199558	174199560	+	IGR	DEL	CTT	-	-	rs142799208		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174199558_174199560delCTT								ZAK (66822 upstream) : CDCA7 (20001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	174348066	174348066	+	IGR	DEL	A	-	-	rs71405144		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174348066delA								CDCA7 (114348 upstream) : SP3 (425193 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	174356706	174356706	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174356706delA								CDCA7 (122988 upstream) : SP3 (416553 downstream)																																			---	---	---	---
WIPF1	7456	broad.mit.edu	37	2	175504196	175504196	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175504196delG	uc010fqt.1	-						uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Intron|WIPF1_uc002ujc.1_Intron	NM_003387	NP_003378			WAS/WASL interacting protein family, member 1						actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	176222550	176222550	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176222550delG								ATP5G3 (176060 upstream) : KIAA1715 (567860 downstream)																																			---	---	---	---
MTX2	10651	broad.mit.edu	37	2	177164870	177164871	+	Intron	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177164870_177164871delAG	uc002ukx.2	+						MTX2_uc002ukw.2_Intron	NM_006554	NP_006545			metaxin 2						protein targeting to mitochondrion	mitochondrial outer membrane				ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00365)|Epithelial(96;0.0654)|all cancers(119;0.181)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	177749288	177749288	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177749288delC								MIR1246 (283508 upstream) : HNRNPA3 (328134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	178008573	178008573	+	IGR	DEL	A	-	-	rs68183592		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178008573delA								MIR1246 (542793 upstream) : HNRNPA3 (68849 downstream)																																			---	---	---	---
NFE2L2	4780	broad.mit.edu	37	2	178135520	178135521	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178135520_178135521insT	uc002uli.3	-							NM_001145412	NP_001138884			nuclear factor erythroid 2-like 2 isoform 2						transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)					Mis		NSCLC|HNSCC					HNSCC(56;0.16)			---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178495859	178495860	+	Intron	DEL	TC	-	-	rs148865215		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178495859_178495860delTC	uc002ulq.2	-						PDE11A_uc010zfd.1_Intron|PDE11A_uc002ulp.2_Intron|PDE11A_uc002ulr.2_Intron|PDE11A_uc002uls.1_Intron|PDE11A_uc002ult.1_Intron|PDE11A_uc002ulu.1_Intron	NM_016953	NP_058649			phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178521199	178521199	+	Intron	DEL	T	-	-	rs35046636		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178521199delT	uc002ulq.2	-						PDE11A_uc010zfd.1_Intron|PDE11A_uc002ulp.2_Intron|PDE11A_uc002ulr.2_Intron|PDE11A_uc002uls.1_Intron|PDE11A_uc002ult.1_Intron|PDE11A_uc002ulu.1_Intron	NM_016953	NP_058649			phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178702204	178702204	+	Intron	DEL	T	-	-	rs71410766		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178702204delT	uc002ulq.2	-						PDE11A_uc002ulp.2_Intron|PDE11A_uc002ulr.2_Intron|PDE11A_uc002uls.1_Intron|PDE11A_uc002ult.1_Intron|PDE11A_uc002ulu.1_Intron	NM_016953	NP_058649			phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178793884	178793886	+	Intron	DEL	CTC	-	-	rs150054171		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178793884_178793886delCTC	uc002ulq.2	-						PDE11A_uc002ulr.2_Intron|PDE11A_uc002ult.1_Intron	NM_016953	NP_058649			phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
PRKRA	8575	broad.mit.edu	37	2	179296382	179296385	+	3'UTR	DEL	CAAT	-	-	rs72223867		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179296382_179296385delCAAT	uc002umf.2	-	8					PRKRA_uc002umc.2_3'UTR|PRKRA_uc002umd.2_3'UTR|PRKRA_uc002ume.2_3'UTR|PRKRA_uc002umg.2_3'UTR|uc002umb.1_Intron|PRKRA_uc002umh.1_RNA	NM_003690	NP_003681			protein kinase, interferon-inducible double						immune response|negative regulation of cell proliferation|production of siRNA involved in RNA interference|response to virus	perinuclear region of cytoplasm	double-stranded RNA binding|enzyme activator activity|protein homodimerization activity			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)															---	---	---	---
ZNF385B	151126	broad.mit.edu	37	2	180479034	180479035	+	Intron	INS	-	TT	TT	rs148366189	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180479034_180479035insTT	uc002unn.3	-						ZNF385B_uc002unm.2_Intron	NM_152520	NP_689733			zinc finger protein 385B isoform 1							nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	181337750	181337751	+	IGR	DEL	AC	-	-	rs112236402		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181337750_181337751delAC								CWC22 (465910 upstream) : UBE2E3 (507361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	181555594	181555595	+	IGR	DEL	TG	-	-	rs10550083		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181555594_181555595delTG								CWC22 (683754 upstream) : UBE2E3 (289517 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	182048908	182048909	+	Intron	DEL	AC	-	-	rs66474158		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182048908_182048909delAC	uc002uns.1	+											Homo sapiens cDNA FLJ43011 fis, clone BRTHA2015853.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	182224455	182224455	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182224455delA	uc002uns.1	+											Homo sapiens cDNA FLJ43011 fis, clone BRTHA2015853.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	183500402	183500403	+	IGR	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183500402_183500403delTC								PDE1A (112895 upstream) : DNAJC10 (80596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	184383724	184383725	+	IGR	INS	-	AACA	AACA	rs143172759	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184383724_184383725insAACA								NUP35 (357317 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	184931939	184931940	+	IGR	DEL	TT	-	-	rs71401966		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184931939_184931940delTT								NUP35 (905532 upstream) : ZNF804A (531153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	185284474	185284474	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185284474delT								None (None upstream) : ZNF804A (178619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	186701536	186701537	+	IGR	DEL	AA	-	-	rs143725270		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186701536_186701537delAA								ZNF804A (897324 upstream) : ZC3H15 (649348 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	187860221	187860222	+	IGR	DEL	GT	-	-	rs141476621		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187860221_187860222delGT								ZSWIM2 (146324 upstream) : CALCRL (347629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	191420342	191420342	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191420342delA								TMEM194B (20874 upstream) : NAB1 (93506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	191729939	191729940	+	IGR	INS	-	A	A	rs111813727		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191729939_191729940insA								NAB1 (172448 upstream) : GLS (15607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	192457381	192457381	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192457381delT								MYO1B (167266 upstream) : OBFC2A (85417 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	192522086	192522086	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:192522086delT								MYO1B (231971 upstream) : OBFC2A (20712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	193379308	193379309	+	IGR	DEL	TG	-	-	rs71406705		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193379308_193379309delTG								TMEFF2 (319664 upstream) : PCGEM1 (235262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	194219546	194219546	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:194219546delT								PCGEM1 (577925 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	194960899	194960899	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:194960899delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	195095746	195095747	+	IGR	INS	-	TG	TG	rs143391792	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195095746_195095747insTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	195761944	195761944	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195761944delC								None (None upstream) : SLC39A10 (759588 downstream)																																			---	---	---	---
HECW2	57520	broad.mit.edu	37	2	197127746	197127747	+	Intron	INS	-	T	T	rs143331022	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197127746_197127747insT	uc002utm.1	-						HECW2_uc002utl.1_Intron|uc002utn.1_Intron	NM_020760	NP_065811			HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18																		---	---	---	---
ANKRD44	91526	broad.mit.edu	37	2	198067128	198067129	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198067128_198067129insA	uc002uuc.2	-						ANKRD44_uc002uub.2_Intron|ANKRD44_uc010zgw.1_Intron|ANKRD44_uc002uud.1_Intron	NM_153697	NP_710181			ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)															---	---	---	---
SPATS2L	26010	broad.mit.edu	37	2	201274088	201274088	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201274088delT	uc002uvn.3	+						SPATS2L_uc010fst.2_Intron|SPATS2L_uc002uvo.3_Intron|SPATS2L_uc002uvp.3_Intron|SPATS2L_uc002uvq.3_Intron|SPATS2L_uc002uvr.3_Intron|SPATS2L_uc010zhc.1_Intron	NM_015535	NP_056350			SPATS2-like protein isoform a							cytoplasm|nucleolus				ovary(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	203035836	203035841	+	Intron	DEL	ACACAC	-	-	rs10532176		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203035836_203035841delACACAC	uc002uyy.1	+											RecName: Full=Uncharacterized protein KIAA2012;																														---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	205889784	205889784	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205889784delA	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	206507598	206507603	+	IGR	DEL	CACACA	-	-	rs10557094		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206507598_206507603delCACACA								PARD3B (27061 upstream) : NRP2 (39621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	207597477	207597477	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207597477delA								DYTN (14357 upstream) : MDH1B (1466 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	213489941	213489942	+	IGR	DEL	AC	-	-	rs144624143		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213489941_213489942delAC								ERBB4 (86589 upstream) : IKZF2 (374471 downstream)																																			---	---	---	---
SPAG16	79582	broad.mit.edu	37	2	214332690	214332691	+	Intron	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214332690_214332691delCT	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808			sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	215746201	215746202	+	IGR	DEL	GA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215746201_215746202delGA								BARD1 (71773 upstream) : ABCA12 (50065 downstream)																																			---	---	---	---
MARCH4	57574	broad.mit.edu	37	2	217130809	217130809	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217130809delA	uc002vgb.2	-							NM_020814	NP_065865			membrane-associated ring finger (C3HC4) 4							Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	217957923	217957930	+	IGR	DEL	TGTGTGGT	-	-	rs7340432		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217957923_217957930delTGTGTGGT								TNP1 (233141 upstream) : DIRC3 (190818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	219624292	219624292	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219624292delG								TTLL4 (4156 upstream) : CYP27A1 (22180 downstream)																																			---	---	---	---
SPEG	10290	broad.mit.edu	37	2	220329675	220329675	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220329675delA	uc010fwg.2	+						SPEG_uc002vlm.2_Intron|SPEG_uc010fwh.1_Intron|SPEG_uc002vln.1_3'UTR|SPEG_uc002vlp.1_3'UTR|SPEG_uc002vlq.2_Intron	NM_005876	NP_005867			SPEG complex locus						muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	220620793	220620793	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220620793delT								SLC4A3 (114092 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	220685841	220685842	+	IGR	INS	-	C	C	rs147167412	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220685841_220685842insC								SLC4A3 (179140 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	220960433	220960433	+	IGR	DEL	C	-	-	rs34764654		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220960433delC								SLC4A3 (453732 upstream) : None (None downstream)																																			---	---	---	---
COL4A3	1285	broad.mit.edu	37	2	228089060	228089061	+	Intron	INS	-	T	T	rs144735010	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228089060_228089061insT	uc002vom.1	+						COL4A3_uc002von.1_Intron|COL4A3_uc002voo.1_Intron|COL4A3_uc002vop.1_Intron	NM_000091	NP_000082			alpha 3 type IV collagen isoform 1 precursor						activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)														---	---	---	---
SP110	3431	broad.mit.edu	37	2	231075835	231075836	+	Intron	INS	-	C	C	rs148043569	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231075835_231075836insC	uc002vqh.3	-						SP110_uc002vqg.3_Intron|SP110_uc002vqi.3_Intron|SP110_uc010fxk.2_Intron	NM_004509	NP_004500			SP110 nuclear body protein isoform a						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|signal transducer activity|zinc ion binding			ovary(2)|breast(2)	4		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)														---	---	---	---
SPATA3	130560	broad.mit.edu	37	2	231870053	231870055	+	Intron	DEL	CAC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231870053_231870055delCAC	uc010zmd.1	+						SPATA3_uc002vri.3_Intron|SPATA3_uc002vrk.2_Intron	NM_139073	NP_620712			testis and spermatogenesis cell apoptosis						apoptosis|spermatogenesis						0																		---	---	---	---
NGEF	25791	broad.mit.edu	37	2	233765323	233765324	+	Intron	INS	-	TCAC	TCAC	rs71058509		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233765323_233765324insTCAC	uc002vts.2	-						NGEF_uc010zmm.1_Intron|NGEF_uc010fyg.1_Intron|NGEF_uc002vtt.2_Intron	NM_019850	NP_062824			neuronal guanine nucleotide exchange factor						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)|skin(1)	7		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	233901466	233901466	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233901466delT								NEU2 (1700 upstream) : INPP5D (23570 downstream)																																			---	---	---	---
INPP5D	3635	broad.mit.edu	37	2	234068048	234068048	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234068048delA	uc010zmo.1	+						INPP5D_uc010zmp.1_Intron	NM_001017915	NP_001017915			SH2 containing inositol phosphatase isoform a						apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)														---	---	---	---
INPP5D	3635	broad.mit.edu	37	2	234087815	234087816	+	Intron	INS	-	CCT	CCT	rs139019730	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234087815_234087816insCCT	uc010zmo.1	+						INPP5D_uc010zmp.1_Intron	NM_001017915	NP_001017915			SH2 containing inositol phosphatase isoform a						apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	235209258	235209259	+	IGR	INS	-	C	C	rs143971727	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235209258_235209259insC								SPP2 (223482 upstream) : ARL4C (192429 downstream)																																			---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236998587	236998588	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236998587_236998588insA	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
ASB18	401036	broad.mit.edu	37	2	237110331	237110331	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237110331delT	uc010znh.1	-							NM_212556	NP_997721			ankyrin repeat and SOCS box-containing 18						intracellular signal transduction					ovary(1)	1		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	237764455	237764456	+	IGR	INS	-	G	G	rs147601516	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237764455_237764456insG								CXCR7 (273463 upstream) : COPS8 (229628 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237782227	237782234	+	IGR	DEL	CCTTCCTT	-	-	rs28568974		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237782227_237782234delCCTTCCTT								CXCR7 (291235 upstream) : COPS8 (211850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	238340825	238340825	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238340825delC								COL6A3 (17975 upstream) : MLPH (54228 downstream)																																			---	---	---	---
TRAF3IP1	26146	broad.mit.edu	37	2	239260476	239260481	+	Intron	DEL	GTGTGT	-	-	rs10527993		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239260476_239260481delGTGTGT	uc002vye.2	+						TRAF3IP1_uc002vyf.2_Intron	NM_015650	NP_056465			TNF receptor-associated factor 3 interacting							cytoplasm|cytoskeleton	protein binding			ovary(1)	1		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	239323047	239323047	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239323047delA								TRAF3IP1 (13508 upstream) : ASB1 (12579 downstream)																																			---	---	---	---
TWIST2	117581	broad.mit.edu	37	2	239778902	239778903	+	Intron	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239778902_239778903delAG	uc010znx.1	+						TWIST2_uc010zny.1_Intron	NM_057179	NP_476527			twist homolog 2						negative regulation of osteoblast differentiation	cytoplasm	DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	239857667	239857668	+	IGR	INS	-	A	A	rs35990622		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239857667_239857668insA								TWIST2 (25430 upstream) : HDAC4 (112197 downstream)																																			---	---	---	---
HDAC4	9759	broad.mit.edu	37	2	240295167	240295170	+	Intron	DEL	TTGT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240295167_240295170delTTGT	uc002vyk.3	-						HDAC4_uc010fza.2_Intron	NM_006037	NP_006028			histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	240457433	240457433	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240457433delT								HDAC4 (134087 upstream) : NDUFA10 (442725 downstream)																																			---	---	---	---
KIF1A	547	broad.mit.edu	37	2	241664496	241664496	+	Intron	DEL	A	-	-	rs34304629		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241664496delA	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron|KIF1A_uc002vzw.2_5'Flank|KIF1A_uc002vzx.2_Intron	NM_004321	NP_004312			axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	226238	226238	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:226238delT								None (None upstream) : CHL1 (12412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	998312	998317	+	IGR	DEL	CACACA	-	-	rs10566247		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:998312_998317delCACACA								CHL1 (547217 upstream) : CNTN6 (136303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	1046821	1046821	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1046821delA								CHL1 (595726 upstream) : CNTN6 (87799 downstream)																																			---	---	---	---
CNTN6	27255	broad.mit.edu	37	3	1213302	1213302	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1213302delT	uc003boz.2	+						CNTN6_uc010hbo.2_Intron|CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276			contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)														---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	3047425	3047426	+	Intron	INS	-	G	G	rs149217606	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3047425_3047426insG	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron|CNTN4_uc003bpd.1_Intron|CNTN4_uc003bpe.2_Intron|CNTN4_uc003bpf.2_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	4526487	4526487	+	IGR	DEL	T	-	-	rs112552152		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4526487delT								SUMF1 (17533 upstream) : ITPR1 (8547 downstream)																																			---	---	---	---
ITPR1	3708	broad.mit.edu	37	3	4710159	4710159	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4710159delT	uc003bqa.2	+						ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron|ITPR1_uc010hcb.1_Intron	NM_001099952	NP_001093422			inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	6009232	6009239	+	IGR	DEL	TTCCTTCC	-	-	rs10576670		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6009232_6009239delTTCCTTCC								EDEM1 (747583 upstream) : GRM7 (893563 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	6581877	6581878	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6581877_6581878insT	uc003bqj.1	+											Homo sapiens clone P1 NTera2D1 teratocarcinoma mRNA.																														---	---	---	---
FANCD2	2177	broad.mit.edu	37	3	10125974	10125975	+	Intron	INS	-	T	T	rs112071263		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10125974_10125975insT	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_Intron|C3orf24_uc003buz.2_Intron	NM_033084	NP_149075			Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)				D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
HRH1	3269	broad.mit.edu	37	3	11279722	11279723	+	Intron	INS	-	TTTG	TTTG	rs145956051		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11279722_11279723insTTTG	uc010hdr.2	+						HRH1_uc010hds.2_Intron|HRH1_uc010hdt.2_Intron	NM_001098213	NP_001091683			histamine receptor H1						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|inflammatory response	cytoplasm|integral to plasma membrane|nucleus	histamine receptor activity			large_intestine(1)|ovary(1)	2					Aceprometazine(DB01615)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzquinamide(DB00767)|Bepotastine(DB04890)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlophedianol(DB04837)|Chlorpheniramine(DB01114)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clemastine(DB00283)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Maprotiline(DB00934)|Meclizine(DB00737)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nedocromil(DB00716)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Pemirolast(DB00885)|Phenindamine(DB01619)|Pheniramine(DB01620)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Terfenadine(DB00342)|Thiethylperazine(DB00372)|Trazodone(DB00656)|Trimeprazine(DB01246)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)													---	---	---	---
VGLL4	9686	broad.mit.edu	37	3	11680908	11680908	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11680908delT	uc003bwf.2	-						VGLL4_uc010hdx.1_Intron|VGLL4_uc003bwg.2_Intron	NM_014667	NP_055482			vestigial like 4 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)														---	---	---	---
PPARG	5468	broad.mit.edu	37	3	12404996	12404997	+	Intron	INS	-	T	T	rs145774308	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12404996_12404997insT	uc003bwx.2	+						PPARG_uc003bwr.2_Intron|PPARG_uc003bws.2_Intron|PPARG_uc003bwu.2_Intron|PPARG_uc003bwv.2_Intron|PPARG_uc003bwq.1_Intron|PPARG_uc010hdz.1_Intron|PPARG_uc003bwt.1_Intron|PPARG_uc003bww.1_Intron	NM_015869	NP_056953			peroxisome proliferative activated receptor						activation of caspase activity|cell fate commitment|cell maturation|cellular response to insulin stimulus|epithelial cell differentiation|glucose homeostasis|induction of apoptosis|innate immune response|lipid homeostasis|lipoprotein transport|long-chain fatty acid transport|low-density lipoprotein particle receptor biosynthetic process|monocyte differentiation|negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|placenta development|positive regulation of fat cell differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of blood pressure|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to lipid|response to low-density lipoprotein particle stimulus|white fat cell differentiation	cytosol|nucleoplasm	activating transcription factor binding|arachidonic acid binding|drug binding|enzyme binding|prostaglandin receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|kidney(1)	2					Atorvastatin(DB01076)|Icosapent(DB00159)|Pioglitazone(DB01132)|Rosiglitazone(DB00412)|Troglitazone(DB00197)			T	PAX8	follicular thyroid		Insulin resistance ; lipodystrophy|familial partial L;diabetes mellitus|insulin-resistantI|with acanthosis nigricans and hypertension						---	---	---	---
Unknown	0	broad.mit.edu	37	3	13308082	13308082	+	IGR	DEL	T	-	-	rs113470359		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13308082delT								IQSEC1 (193465 upstream) : NUP210 (49655 downstream)																																			---	---	---	---
WNT7A	7476	broad.mit.edu	37	3	13882094	13882097	+	Intron	DEL	CATC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13882094_13882097delCATC	uc003bye.1	-							NM_004625	NP_004616			wingless-type MMTV integration site family,						activation of JUN kinase activity|anterior/posterior pattern formation|canonical Wnt receptor signaling pathway|cell proliferation in forebrain|cellular response to transforming growth factor beta stimulus|central nervous system vasculogenesis|cerebellar granule cell differentiation|dorsal/ventral pattern formation|embryonic axis specification|embryonic digit morphogenesis|embryonic forelimb morphogenesis|embryonic leg morphogenesis|lens fiber cell development|negative regulation of neurogenesis|palate development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of JNK cascade|positive regulation of synaptogenesis|positive regulation of transcription from RNA polymerase II promoter|regulation of axon diameter|satellite cell activation|satellite cell maintenance involved in skeletal muscle regeneration|sex differentiation|uterus development|Wnt receptor signaling pathway involved in wound healing, spreading of epidermal cells|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	cytokine activity|frizzled binding|receptor agonist activity|signal transducer activity			ovary(2)|breast(1)	3																		---	---	---	---
FGD5	152273	broad.mit.edu	37	3	14909579	14909579	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14909579delA	uc003bzc.2	+						FGD5_uc011avk.1_Intron	NM_152536	NP_689749			FYVE, RhoGEF and PH domain containing 5						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|kidney(1)|pancreas(1)	5																		---	---	---	---
PLCL2	23228	broad.mit.edu	37	3	17076403	17076404	+	Intron	INS	-	CTT	CTT	rs141179799	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17076403_17076404insCTT	uc011awc.1	+						PLCL2_uc011awd.1_Intron	NM_001144382	NP_001137854			phospholipase C-like 2 isoform 1						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17313584	17313588	+	Intron	DEL	GGAAA	-	-	rs10566587		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17313584_17313588delGGAAA	uc003cbf.2	-						TBC1D5_uc010heu.2_Intron|TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron|TBC1D5_uc010hew.1_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17440236	17440237	+	Intron	INS	-	C	C	rs148153374	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17440236_17440237insC	uc003cbf.2	-						TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron|TBC1D5_uc010hew.1_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	18576818	18576821	+	IGR	DEL	AAAC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18576818_18576821delAAAC								SATB1 (96566 upstream) : KCNH8 (613196 downstream)																																			---	---	---	---
KCNH8	131096	broad.mit.edu	37	3	19435980	19435981	+	Intron	DEL	AG	-	-	rs35675545		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19435980_19435981delAG	uc003cbk.1	+						KCNH8_uc011awe.1_Intron|KCNH8_uc010hex.1_Intron|KCNH8_uc011awf.1_Intron	NM_144633	NP_653234			potassium voltage-gated channel, subfamily H,							integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5																		---	---	---	---
KCNH8	131096	broad.mit.edu	37	3	19480374	19480374	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19480374delG	uc003cbk.1	+						KCNH8_uc011awe.1_Intron|KCNH8_uc010hex.1_Intron|KCNH8_uc011awf.1_Intron	NM_144633	NP_653234			potassium voltage-gated channel, subfamily H,							integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5																		---	---	---	---
ZNF385D	79750	broad.mit.edu	37	3	22126670	22126670	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22126670delA	uc010hfb.1	-											Homo sapiens cDNA: FLJ22419 fis, clone HRC08593.							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	22851607	22851607	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22851607delA								ZNF385D (437484 upstream) : UBE2E2 (393046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	26853824	26853827	+	IGR	DEL	GTCT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:26853824_26853827delGTCT								LRRC3B (101561 upstream) : NEK10 (298568 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	30603273	30603273	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30603273delT								RBMS3 (556654 upstream) : TGFBR2 (44721 downstream)																																			---	---	---	---
GADL1	339896	broad.mit.edu	37	3	30863843	30863844	+	Intron	DEL	AT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30863843_30863844delAT	uc003cep.2	-						GADL1_uc003ceq.1_Intron	NM_207359	NP_997242			glutamate decarboxylase-like 1						carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	32499436	32499437	+	IGR	INS	-	C	C	rs147597602	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32499436_32499437insC								CMTM7 (3103 upstream) : CMTM6 (23367 downstream)																																			---	---	---	---
GLB1	2720	broad.mit.edu	37	3	33075271	33075272	+	Intron	DEL	AA	-	-	rs71687294		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33075271_33075272delAA	uc003cfi.1	-						GLB1_uc003cfh.1_Intron|GLB1_uc003cfj.1_Intron|GLB1_uc011axk.1_Intron	NM_000404	NP_000395			galactosidase, beta 1 isoform a preproprotein						carbohydrate metabolic process	lysosome|perinuclear region of cytoplasm	beta-galactosidase activity|cation binding|protein binding			large_intestine(1)	1		Melanoma(143;0.104)																---	---	---	---
FBXL2	25827	broad.mit.edu	37	3	33421115	33421116	+	Intron	DEL	TT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33421115_33421116delTT	uc003cfp.2	+						FBXL2_uc011axm.1_Intron|FBXL2_uc011axn.1_Intron|FBXL2_uc011axo.1_Intron|FBXL2_uc011axp.1_Intron|FBXL2_uc011axq.1_Intron|FBXL2_uc011axr.1_Intron|FBXL2_uc011axs.1_Intron	NM_012157	NP_036289			F-box and leucine-rich repeat protein 2						interspecies interaction between organisms|proteolysis	cytoplasm|membrane	protein binding|ubiquitin-protein ligase activity			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	33823012	33823015	+	IGR	DEL	AAAC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33823012_33823015delAAAC								CLASP2 (63164 upstream) : PDCD6IP (17051 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	35344380	35344381	+	IGR	INS	-	GTCCT	GTCCT	rs148394908	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35344380_35344381insGTCCT								None (None upstream) : ARPP21 (336700 downstream)																																			---	---	---	---
ITGA9	3680	broad.mit.edu	37	3	37615979	37615979	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37615979delG	uc003chd.2	+						ITGA9_uc003chc.2_Intron	NM_002207	NP_002198			integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)														---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41634896	41634897	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41634896_41634897delCA	uc003ckv.3	-							NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
NKTR	4820	broad.mit.edu	37	3	42686471	42686472	+	Intron	DEL	TG	-	-	rs35077404		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42686471_42686472delTG	uc003clo.2	+						NKTR_uc003clp.2_Intron|NKTR_uc011azp.1_Intron|NKTR_uc003cls.2_Intron	NM_005385	NP_005376			natural killer-tumor recognition sequence						protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)														---	---	---	---
C3orf77	375337	broad.mit.edu	37	3	44372827	44372827	+	Intron	DEL	T	-	-	rs10711072		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44372827delT	uc003cna.3	+							NM_001145030	NP_001138502			hypothetical protein LOC375337											pancreas(1)	1																		---	---	---	---
ZNF660	285349	broad.mit.edu	37	3	44632629	44632629	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44632629delT	uc003cnl.1	+							NM_173658	NP_775929			zinc finger protein 660						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	45215961	45215961	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45215961delT								CDCP1 (28047 upstream) : TMEM158 (49996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	45423679	45423679	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45423679delG								TMEM158 (155865 upstream) : LARS2 (6396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	45724829	45724829	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45724829delC	uc003cor.2	-											Homo sapiens cDNA: FLJ22553 fis, clone HSI01074, highly similar to HSA132408 Homo sapiens mRNA for LIM domains containing protein 1.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	46890567	46890567	+	IGR	DEL	T	-	-	rs111386910		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46890567delT								PRSS42 (14982 upstream) : MYL3 (8790 downstream)																																	OREG0015541	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MAP4	4134	broad.mit.edu	37	3	48072546	48072546	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48072546delG	uc003csb.2	-						MAP4_uc003csc.3_Intron|MAP4_uc011bbf.1_Intron|MAP4_uc003csf.3_Intron|MAP4_uc003csg.2_Intron	NM_002375	NP_002366			microtubule-associated protein 4 isoform 1						negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	48438878	48438879	+	IGR	INS	-	T	T	rs146785607	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48438878_48438879insT								FBXW12 (2690 upstream) : PLXNB1 (6382 downstream)																																			---	---	---	---
CDHR4	389118	broad.mit.edu	37	3	49839614	49839615	+	5'Flank	INS	-	T	T	rs146977980	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49839614_49839615insT	uc010hkz.2	-						CDHR4_uc003cxp.2_5'Flank|CDHR4_uc011bcw.1_5'Flank|C3orf54_uc003cxq.1_5'Flank	NM_001007540	NP_001007541			cadherin-like 29 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0																		---	---	---	---
CACNA2D2	9254	broad.mit.edu	37	3	50503704	50503705	+	Intron	DEL	TG	-	-	rs111770654		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50503704_50503705delTG	uc003daq.2	-						CACNA2D2_uc003dap.2_Intron	NM_006030	NP_006021			calcium channel, voltage-dependent, alpha						energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Gabapentin(DB00996)													---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	51171214	51171219	+	Intron	DEL	GGGTCA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51171214_51171219delGGGTCA	uc011bds.1	+							NM_004947	NP_004938			dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	51357294	51357295	+	Intron	INS	-	A	A	rs145425520	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51357294_51357295insA	uc011bds.1	+							NM_004947	NP_004938			dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
IQCF1	132141	broad.mit.edu	37	3	51921095	51921095	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51921095delT	uc003dbq.3	-											Homo sapiens cDNA FLJ27508 fis, clone TST08061.											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	52052915	52052915	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52052915delT								RPL29 (22957 upstream) : DUSP7 (30024 downstream)																																			---	---	---	---
PBRM1	55193	broad.mit.edu	37	3	52674114	52674114	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52674114delA	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron|PBRM1_uc003dfb.1_Intron	NM_181042	NP_060635			polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)				Mis|N|F|S|D|O		clear cell renal carcinoma|breast								---	---	---	---
TMEM110	375346	broad.mit.edu	37	3	52899627	52899629	+	Intron	DEL	AAC	-	-	rs35947894		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52899627_52899629delAAC	uc003dge.2	-						TMEM110_uc003dgc.3_Intron	NM_198563	NP_940965			transmembrane protein 110							integral to membrane				large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;7.72e-05)|Kidney(197;0.000777)|KIRC - Kidney renal clear cell carcinoma(197;0.000915)|OV - Ovarian serous cystadenocarcinoma(275;0.0541)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	54144632	54144632	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54144632delT								SELK (218643 upstream) : CACNA2D3 (12061 downstream)																																			---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54462877	54462888	+	Intron	DEL	TCCTACATCCGA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54462877_54462888delTCCTACATCCGA	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
PDHB	5162	broad.mit.edu	37	3	58416941	58416941	+	Intron	DEL	T	-	-	rs111261470		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58416941delT	uc003dkf.3	-						PDHB_uc003dke.3_Intron|PDHB_uc003dkg.3_Intron|PDHB_uc010hnl.2_Intron|PDHB_uc011bff.1_Intron	NM_000925	NP_000916			pyruvate dehydrogenase (lipoamide) beta						glycolysis|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(55;0.000179)|Kidney(10;0.00231)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.187)	NADH(DB00157)|Pyruvic acid(DB00119)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	63726313	63726313	+	IGR	DEL	T	-	-	rs113056432		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63726313delT								SNTN (75432 upstream) : C3orf49 (78728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	64419213	64419213	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64419213delG								PRICKLE2 (208082 upstream) : ADAMTS9 (82120 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	64879957	64879957	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64879957delT	uc003dml.2	+											Homo sapiens cDNA FLJ25194 fis, clone REC04095.																														---	---	---	---
MAGI1	9223	broad.mit.edu	37	3	65732345	65732346	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65732345_65732346insA	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc010hny.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229			membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)														---	---	---	---
MAGI1	9223	broad.mit.edu	37	3	65908144	65908145	+	Intron	INS	-	T	T	rs144794138	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65908144_65908145insT	uc003dmn.2	-						MAGI1_uc003dmm.2_Intron|MAGI1_uc003dmo.2_Intron|MAGI1_uc003dmp.2_Intron|MAGI1_uc003dmr.2_Intron	NM_001033057	NP_001028229			membrane associated guanylate kinase, WW and PDZ						cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	66889205	66889205	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66889205delT								LRIG1 (338360 upstream) : KBTBD8 (159522 downstream)																																			---	---	---	---
SUCLG2	8801	broad.mit.edu	37	3	67693274	67693275	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67693274_67693275delTG	uc003dna.3	-							NM_003848	NP_003839			succinate-CoA ligase, GDP-forming beta subunit						succinyl-CoA metabolic process|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|GTP binding|succinate-CoA ligase (GDP-forming) activity			central_nervous_system(1)|skin(1)	2		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	70826752	70826752	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70826752delA								MITF (809266 upstream) : FOXP1 (177985 downstream)																																			---	---	---	---
FOXP1	27086	broad.mit.edu	37	3	71224066	71224067	+	Intron	INS	-	T	T	rs1879770		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71224066_71224067insT	uc003dol.2	-						FOXP1_uc003dom.2_Intron|FOXP1_uc003don.2_Intron|FOXP1_uc003doo.2_Intron|FOXP1_uc003dop.2_Intron|FOXP1_uc003doq.1_Intron	NM_032682	NP_116071			forkhead box P1 isoform 1						cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)				T	PAX5	ALL								---	---	---	---
FOXP1	27086	broad.mit.edu	37	3	71575279	71575282	+	Intron	DEL	ATAA	-	-	rs151187342		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71575279_71575282delATAA	uc003dop.2	-						FOXP1_uc003doo.2_Intron|FOXP1_uc003dos.2_Intron	NM_032682	NP_116071			forkhead box P1 isoform 1						cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)				T	PAX5	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	3	72046595	72046597	+	IGR	DEL	GAA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72046595_72046597delGAA								PROK2 (212238 upstream) : RYBP (377154 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	73393913	73393914	+	IGR	DEL	GT	-	-	rs9839969	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73393913_73393914delGT								PPP4R2 (278902 upstream) : PDZRN3 (37738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	76143286	76143287	+	IGR	DEL	CA	-	-	rs72304579		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76143286_76143287delCA								ZNF717 (308616 upstream) : ROBO2 (946007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	77837617	77837618	+	IGR	INS	-	C	C	rs143767257	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77837617_77837618insC								ROBO2 (140956 upstream) : ROBO1 (808770 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	81238331	81238332	+	IGR	DEL	AA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81238331_81238332delAA								None (None upstream) : GBE1 (300518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	83434459	83434460	+	IGR	INS	-	TG	TG	rs144593845	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83434459_83434460insTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	84546937	84546938	+	IGR	INS	-	A	A	rs144740939	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84546937_84546938insA								None (None upstream) : CADM2 (461195 downstream)																																			---	---	---	---
CADM2	253559	broad.mit.edu	37	3	85521930	85521931	+	Intron	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85521930_85521931delTC	uc003dqj.2	+						CADM2_uc003dqk.2_Intron	NM_153184	NP_694854			immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	86142218	86142218	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86142218delG								CADM2 (24270 upstream) : VGLL3 (844907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	86778878	86778879	+	IGR	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86778878_86778879delAC								CADM2 (660930 upstream) : VGLL3 (208246 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	88301512	88301512	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88301512delA								C3orf38 (94399 upstream) : EPHA3 (855162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90368025	90368026	+	IGR	DEL	TT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90368025_90368026delTT								EPHA3 (836743 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90442889	90442890	+	IGR	INS	-	C	C	rs78504040		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90442889_90442890insC								EPHA3 (911607 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90474035	90474035	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90474035delA								EPHA3 (942753 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	94156931	94156932	+	IGR	INS	-	T	T	rs77825202		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94156931_94156932insT								NSUN3 (311301 upstream) : LOC255025 (500175 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	96217811	96217811	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96217811delT								None (None upstream) : EPHA6 (315614 downstream)																																			---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	97464538	97464538	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97464538delA	uc010how.1	+						EPHA6_uc010hox.1_Intron	NM_001080448	NP_001073917			EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	97555665	97555665	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97555665delA	uc011bgq.1	+											SubName: Full=cDNA FLJ60082, weakly similar to Uro-adherence factor A; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	98996945	98996945	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98996945delC								DCBLD2 (376412 upstream) : COL8A1 (360509 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	99070663	99070663	+	IGR	DEL	T	-	-	rs35423469		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99070663delT								DCBLD2 (450130 upstream) : COL8A1 (286791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	100716344	100716344	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100716344delC								ABI3BP (4010 upstream) : IMPG2 (228944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	100826118	100826120	+	IGR	DEL	AAG	-	-	rs68002520		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100826118_100826120delAAG								ABI3BP (113784 upstream) : IMPG2 (119168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	100919286	100919289	+	IGR	DEL	ACAC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100919286_100919289delACAC								ABI3BP (206952 upstream) : IMPG2 (25999 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	100932594	100932597	+	IGR	DEL	CTTT	-	-	rs1843093		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100932594_100932597delCTTT								ABI3BP (220260 upstream) : IMPG2 (12691 downstream)																																			---	---	---	---
IMPG2	50939	broad.mit.edu	37	3	100960446	100960446	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100960446delG	uc003duq.1	-						IMPG2_uc011bhe.1_Intron	NM_016247	NP_057331			interphotoreceptor matrix proteoglycan 2						visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	104600736	104600736	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104600736delA								None (None upstream) : ALCAM (484977 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	105069222	105069223	+	IGR	INS	-	TGTG	TGTG	rs60572874		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105069222_105069223insTGTG								None (None upstream) : ALCAM (16490 downstream)																																			---	---	---	---
CBLB	868	broad.mit.edu	37	3	105387910	105387917	+	Intron	DEL	ATCCATCC	-	-	rs71111382		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105387910_105387917delATCCATCC	uc003dwc.2	-						CBLB_uc003dwa.2_Intron|CBLB_uc011bhi.1_Intron	NM_170662	NP_733762			Cas-Br-M (murine) ecotropic retroviral						cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9								Mis S		AML								---	---	---	---
CBLB	868	broad.mit.edu	37	3	105580557	105580558	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105580557_105580558delAC	uc003dwc.2	-						CBLB_uc011bhi.1_Intron|CBLB_uc003dwd.1_Intron|CBLB_uc003dwe.1_Intron|CBLB_uc011bhj.1_Intron	NM_170662	NP_733762			Cas-Br-M (murine) ecotropic retroviral						cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9								Mis S		AML								---	---	---	---
BBX	56987	broad.mit.edu	37	3	107279160	107279160	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107279160delA	uc010hpr.2	+						BBX_uc003dwk.3_Intron|BBX_uc003dwl.3_Intron	NM_001142568	NP_001136040			HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)															---	---	---	---
CD47	961	broad.mit.edu	37	3	107785098	107785099	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107785098_107785099insA	uc003dwt.1	-						CD47_uc003dwu.1_Intron|CD47_uc003dwv.1_Intron|CD47_uc003dww.1_Intron	NM_001777	NP_001768			CD47 antigen isoform 1 precursor						blood coagulation|cell adhesion|cell junction assembly|integrin-mediated signaling pathway|leukocyte migration|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to plasma membrane	protein binding|thrombospondin receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	108893224	108893224	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108893224delA								MORC1 (56231 upstream) : C3orf66 (3788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	111389013	111389013	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111389013delC								CD96 (4416 upstream) : PLCXD2 (4494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	112898209	112898210	+	IGR	DEL	AC	-	-	rs72327001		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112898209_112898210delAC								C3orf17 (159654 upstream) : BOC (32202 downstream)																																			---	---	---	---
KIAA2018	205717	broad.mit.edu	37	3	113386712	113386713	+	Intron	INS	-	AAAC	AAAC	rs141014014	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113386712_113386713insAAAC	uc003eam.2	-						KIAA2018_uc003eal.2_Intron	NM_001009899	NP_001009899			hypothetical protein LOC205717						regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	114006390	114006391	+	IGR	INS	-	AT	AT	rs150755255	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114006390_114006391insAT								ZNF80 (49965 upstream) : TIGIT (6484 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	116688358	116688358	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116688358delC								LOC285194 (252473 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	117100575	117100575	+	IGR	DEL	A	-	-	rs76912504		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117100575delA								LOC285194 (664690 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	118574252	118574252	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118574252delT								None (None upstream) : IGSF11 (45229 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	118977681	118977681	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118977681delA								B4GALT4 (17929 upstream) : ARHGAP31 (35539 downstream)																																			---	---	---	---
IQCB1	9657	broad.mit.edu	37	3	121502148	121502148	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121502148delT	uc010hre.1	-						IQCB1_uc003eek.2_Intron|IQCB1_uc010hrf.1_Intron	NM_001023570	NP_001018864			IQ motif containing B1 isoform a						cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding				0				GBM - Glioblastoma multiforme(114;0.0983)														---	---	---	---
MYLK	4638	broad.mit.edu	37	3	123352881	123352881	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123352881delA	uc003ego.2	-						MYLK_uc010hrr.2_Intron|MYLK_uc011bjv.1_Intron|MYLK_uc011bjw.1_Intron|MYLK_uc003egp.2_Intron|MYLK_uc003egq.2_Intron|MYLK_uc003egr.2_Intron|MYLK_uc003egs.2_Intron	NM_053025	NP_444253			myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	123732836	123732836	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123732836delC								ROPN1 (21852 upstream) : KALRN (19706 downstream)																																			---	---	---	---
UMPS	7372	broad.mit.edu	37	3	124450064	124450067	+	Intron	DEL	AAAT	-	-	rs10562112		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124450064_124450067delAAAT	uc003ehl.3	+						UMPS_uc003ehm.3_Intron|UMPS_uc011bka.1_Intron|UMPS_uc011bkb.1_Intron|UMPS_uc011bkc.1_Intron|UMPS_uc003ehn.3_Intron|UMPS_uc011bkd.1_Intron|hsa-mir-544b|MI0014159_5'Flank	NM_000373	NP_000364			uridine monophosphate synthase						'de novo' pyrimidine base biosynthetic process|'de novo' UMP biosynthetic process|pyrimidine nucleoside biosynthetic process	cytosol|nucleus	orotate phosphoribosyltransferase activity|orotidine-5'-phosphate decarboxylase activity			kidney(1)	1				GBM - Glioblastoma multiforme(114;0.146)														---	---	---	---
ITGB5	3693	broad.mit.edu	37	3	124596780	124596780	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124596780delC	uc003eho.2	-							NM_002213	NP_002204			integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)														---	---	---	---
OSBPL11	114885	broad.mit.edu	37	3	125297614	125297615	+	Intron	INS	-	A	A	rs79694077		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125297614_125297615insA	uc003eic.2	-							NM_022776	NP_073613			oxysterol binding protein-like 11						lipid transport		lipid binding			ovary(3)|breast(1)|kidney(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	125606669	125606670	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125606669_125606670delGT								MIR548I1 (97274 upstream) : LOC100125556 (28774 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	127196119	127196119	+	IGR	DEL	A	-	-	rs78285588		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127196119delA								PLXNA1 (439891 upstream) : TPRA1 (95789 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	127548524	127548524	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127548524delT								MGLL (6473 upstream) : KBTBD12 (85794 downstream)																																			---	---	---	---
RUVBL1	8607	broad.mit.edu	37	3	127848351	127848352	+	Intron	INS	-	AAC	AAC	rs148415277	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127848351_127848352insAAC	uc003ekf.2	-							NM_003707	NP_003698			RuvB-like 1						cell division|CenH3-containing nucleosome assembly at centromere|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|mitosis|regulation of growth|regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription, DNA-dependent	Golgi apparatus|Ino80 complex|membrane|microtubule organizing center|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|DNA helicase activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.181)														---	---	---	---
RAB7A	7879	broad.mit.edu	37	3	128507292	128507294	+	Intron	DEL	TAG	-	-	rs139263326		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128507292_128507294delTAG	uc003eks.1	+						RAB7A_uc010hsv.1_Intron	NM_004637	NP_004628			RAB7, member RAS oncogene family						endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)														---	---	---	---
RAB43	339122	broad.mit.edu	37	3	128836051	128836051	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128836051delA	uc003eln.1	-						RAB43_uc003elo.1_Intron|RAB43_uc010hsy.1_Intron	NM_198490	NP_940892			RAB43 protein						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1																		---	---	---	---
RPL32P3	132241	broad.mit.edu	37	3	129111868	129111868	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129111868delG	uc003ema.2	-						RPL32P3_uc003emb.2_Intron|uc003emc.1_5'Flank|RPL32P3_uc003emd.1_RNA	NR_003111				Homo sapiens cDNA FLJ36158 fis, clone TESTI2025757, weakly similar to Human mRNA for ribosomal protein L32.												0																		---	---	---	---
ALG1L2	644974	broad.mit.edu	37	3	129800641	129800651	+	5'Flank	DEL	CTGACCCACCC	-	-	rs140390186		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129800641_129800651delCTGACCCACCC	uc011bld.1	+						ALG1L2_uc010hth.2_5'Flank	NM_001136152	NP_001129624			asparagine-linked glycosylation 1-like 2						biosynthetic process		transferase activity, transferring glycosyl groups				0																		---	---	---	---
COL29A1	256076	broad.mit.edu	37	3	130132669	130132669	+	Intron	DEL	C	-	-	rs71639083		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130132669delC	uc010htj.1	+						COL29A1_uc010hti.1_Intron	NM_153264	NP_694996			collagen, type XXIX, alpha 1						axon guidance|cell adhesion	collagen					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	130267725	130267725	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130267725delG								COL29A1 (64037 upstream) : COL6A6 (11453 downstream)																																			---	---	---	---
NEK11	79858	broad.mit.edu	37	3	131032974	131032975	+	Intron	INS	-	GT	GT	rs143988468	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131032974_131032975insGT	uc003eny.2	+						NEK11_uc003eoa.2_Intron|NEK11_uc003enz.2_Intron|NEK11_uc010htn.2_Intron|NEK11_uc011blk.1_Intron|NEK11_uc011bll.1_Intron	NM_024800	NP_079076			NIMA-related kinase 11 isoform 1						cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	134157370	134157370	+	IGR	DEL	T	-	-	rs112931473		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134157370delT								AMOTL2 (63111 upstream) : ANAPC13 (39177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	134184591	134184591	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134184591delA								AMOTL2 (90332 upstream) : ANAPC13 (11956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	134396100	134396101	+	IGR	INS	-	A	A	rs149380401		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134396100_134396101insA								KY (25622 upstream) : EPHB1 (118159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	135369678	135369691	+	IGR	DEL	GTGTGTGTGTGTGT	-	-	rs113321743		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135369678_135369691delGTGTGTGTGTGTGT								EPHB1 (390373 upstream) : PPP2R3A (314876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	135957521	135957521	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135957521delT								MSL2 (42833 upstream) : PCCB (11646 downstream)																																			---	---	---	---
STAG1	10274	broad.mit.edu	37	3	136379644	136379645	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136379644_136379645insA	uc003era.1	-						STAG1_uc003erb.1_Intron|STAG1_uc003erc.1_Intron|STAG1_uc010hua.1_Intron|STAG1_uc003ere.2_Intron	NM_005862	NP_005853			stromal antigen 1						cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2																		---	---	---	---
DZIP1L	199221	broad.mit.edu	37	3	137835623	137835624	+	5'Flank	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137835623_137835624delCT	uc003erq.2	-							NM_173543	NP_775814			DAZ interacting protein 1-like							intracellular	zinc ion binding			ovary(1)|pancreas(1)	2																		---	---	---	---
ARMC8	25852	broad.mit.edu	37	3	137981526	137981526	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137981526delA	uc003esa.1	+						TXNDC6_uc003esd.1_Intron|TXNDC6_uc010huf.1_Intron|TXNDC6_uc003ese.1_Intron|ARMC8_uc011bmf.1_Intron|ARMC8_uc011bmg.1_Intron|ARMC8_uc011bmh.1_Intron|ARMC8_uc003esb.1_Intron|ARMC8_uc003esc.1_Intron|ARMC8_uc003esf.1_5'Flank	NM_015396	NP_056211			armadillo repeat containing 8 isoform 2								binding				0																		---	---	---	---
CLSTN2	64084	broad.mit.edu	37	3	140071368	140071368	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140071368delA	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414			calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7															HNSCC(16;0.037)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	142308903	142308905	+	IGR	DEL	TCT	-	-	rs149099929		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142308903_142308905delTCT								ATR (11235 upstream) : PLS1 (6324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	144038254	144038255	+	IGR	DEL	AC	-	-	rs111631544		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144038254_144038255delAC								C3orf58 (327045 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	145993664	145993664	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145993664delG								PLSCR4 (24698 upstream) : PLSCR2 (157418 downstream)																																			---	---	---	---
PLSCR2	57047	broad.mit.edu	37	3	146194709	146194709	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146194709delC	uc003evv.1	-						PLSCR2_uc003evw.1_Intron	NM_020359	NP_065092			phospholipid scramblase 2						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	147531306	147531306	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147531306delT								ZIC1 (396802 upstream) : AGTR1 (884352 downstream)																																			---	---	---	---
WWTR1	25937	broad.mit.edu	37	3	149280388	149280389	+	Intron	DEL	AC	-	-	rs72130972		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149280388_149280389delAC	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron	NM_015472	NP_056287			WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	150545338	150545339	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150545338_150545339delTG								SIAH2 (64075 upstream) : CLRN1OS (24932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	152811134	152811135	+	IGR	INS	-	T	T	rs140876329	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152811134_152811135insT								P2RY1 (255293 upstream) : RAP2B (68894 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	153731456	153731459	+	IGR	DEL	AAAG	-	-	rs62817260		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153731456_153731459delAAAG								C3orf79 (510973 upstream) : SGEF (107690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	153976006	153976006	+	IGR	DEL	T	-	-	rs111657759		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153976006delT								SGEF (390 upstream) : DHX36 (17452 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	154915300	154915300	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154915300delG								MME (13782 upstream) : PLCH1 (282371 downstream)																																			---	---	---	---
LEKR1	389170	broad.mit.edu	37	3	156673748	156673748	+	Intron	DEL	A	-	-	rs111483916		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156673748delA	uc003fba.1	+							NM_001004316	NP_001004316			leucine, glutamate and lysine rich 1												0			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
SCHIP1	29970	broad.mit.edu	37	3	159471862	159471862	+	Intron	DEL	C	-	-	rs34737442		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159471862delC	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron	NM_014575	NP_055390			schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)															---	---	---	---
SCHIP1	29970	broad.mit.edu	37	3	159551862	159551862	+	Intron	DEL	T	-	-	rs146818308		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159551862delT	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron|SCHIP1_uc010hvz.1_Intron	NM_014575	NP_055390			schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	167615537	167615540	+	Intron	DEL	GAAG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167615537_167615540delGAAG	uc003ffc.2	+						uc003ffd.2_Intron					Homo sapiens cDNA FLJ36036 fis, clone TESTI2017125.																														---	---	---	---
CLDN11	5010	broad.mit.edu	37	3	170142727	170142730	+	Intron	DEL	GTGC	-	-	rs151021962		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170142727_170142730delGTGC	uc003fgx.2	+						CLDN11_uc011bpt.1_Intron|CLDN11_uc003fgy.2_Intron	NM_005602	NP_005593			claudin 11						calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---
TNIK	23043	broad.mit.edu	37	3	170971070	170971071	+	Intron	INS	-	A	A	rs72166652		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170971070_170971071insA	uc003fhh.2	-						TNIK_uc003fhi.2_Intron|TNIK_uc003fhj.2_Intron|TNIK_uc003fhk.2_Intron|TNIK_uc003fhl.2_Intron|TNIK_uc003fhm.2_Intron|TNIK_uc003fhn.2_Intron|TNIK_uc003fho.2_Intron	NM_015028	NP_055843			TRAF2 and NCK interacting kinase isoform 1						actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	176515058	176515059	+	IGR	DEL	AC	-	-	rs35390585		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176515058_176515059delAC								NAALADL2 (991632 upstream) : TBL1XR1 (223484 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	177202248	177202248	+	IGR	DEL	A	-	-	rs11293920		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177202248delA								TBL1XR1 (287200 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	177296555	177296555	+	IGR	DEL	C	-	-	rs34858531		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177296555delC								TBL1XR1 (381507 upstream) : KCNMB2 (957669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	177393178	177393178	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177393178delA								TBL1XR1 (478130 upstream) : KCNMB2 (861046 downstream)																																			---	---	---	---
USP13	8975	broad.mit.edu	37	3	179383383	179383384	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179383383_179383384insT	uc003fkh.2	+						USP13_uc003fkf.2_Intron	NM_003940	NP_003931			ubiquitin thiolesterase 13						ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	179905494	179905495	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179905494_179905495insT								PEX5L (150977 upstream) : TTC14 (414423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	181647607	181647608	+	IGR	INS	-	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181647607_181647608insC								SOX2OT (188604 upstream) : ATP11B (863683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	187190634	187190634	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187190634delT								RTP4 (101267 upstream) : SST (196062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	187263624	187263625	+	IGR	INS	-	G	G	rs143213141	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187263624_187263625insG								RTP4 (174257 upstream) : SST (123071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	187644042	187644043	+	IGR	INS	-	A	A	rs76682859		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187644042_187644043insA								BCL6 (180567 upstream) : LPP (227676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	188610177	188610177	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188610177delT								LPP (12736 upstream) : TPRG1 (54826 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	189284271	189284272	+	IGR	INS	-	AC	AC	rs79948544		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189284271_189284272insAC								TPRG1 (243001 upstream) : TP63 (64944 downstream)																																			---	---	---	---
TP63	8626	broad.mit.edu	37	3	189555930	189555931	+	Intron	DEL	CC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189555930_189555931delCC	uc003fry.2	+						TP63_uc003frx.2_Intron|TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron|TP63_uc003fsa.2_Intron|TP63_uc003fsb.2_Intron|TP63_uc003fsc.2_Intron|TP63_uc003fsd.2_Intron|TP63_uc010hzd.1_Intron|TP63_uc003fse.1_Intron	NM_003722	NP_003713			tumor protein p63 isoform 1						anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)										Hay-Wells_syndrome	HNSCC(45;0.13)			---	---	---	---
TP63	8626	broad.mit.edu	37	3	189566030	189566031	+	Intron	INS	-	T	T	rs59468983		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189566030_189566031insT	uc003fry.2	+						TP63_uc003frx.2_Intron|TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron|TP63_uc003fsa.2_Intron|TP63_uc003fsb.2_Intron|TP63_uc003fsc.2_Intron|TP63_uc003fsd.2_Intron|TP63_uc010hzd.1_Intron|TP63_uc003fse.1_Intron	NM_003722	NP_003713			tumor protein p63 isoform 1						anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)										Hay-Wells_syndrome	HNSCC(45;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	189892564	189892564	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189892564delT								LEPREL1 (52338 upstream) : CLDN1 (130939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	189933527	189933528	+	IGR	INS	-	ACAC	ACAC	rs147467536	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189933527_189933528insACAC								LEPREL1 (93301 upstream) : CLDN1 (89975 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	190722770	190722770	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190722770delT								SNAR-I (126931 upstream) : OSTN (207552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	190749341	190749341	+	IGR	DEL	A	-	-	rs112430868		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190749341delA								SNAR-I (153502 upstream) : OSTN (180981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	191141012	191141012	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191141012delA								CCDC50 (24554 upstream) : PYDC2 (37940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	191568796	191568797	+	IGR	INS	-	AAAC	AAAC	rs143810890	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191568796_191568797insAAAC								PYDC2 (389553 upstream) : FGF12 (290887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	193611021	193611021	+	IGR	DEL	T	-	-	rs71908591		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193611021delT								OPA1 (195422 upstream) : LOC100128023 (99863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	193778230	193778233	+	Intron	DEL	TGTT	-	-	rs71179343		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193778230_193778233delTGTT	uc003ftp.3	-											Homo sapiens cDNA clone IMAGE:4828668.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	194672880	194672881	+	IGR	INS	-	GAAAGAAA	GAAAGAAA	rs138522427	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194672880_194672881insGAAAGAAA								FAM43A (263116 upstream) : C3orf21 (116134 downstream)																																			---	---	---	---
LRRC33	375387	broad.mit.edu	37	3	196383298	196383298	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196383298delT	uc003fwv.2	+							NM_198565	NP_940967			leucine rich repeat containing 33 precursor							integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	196395222	196395223	+	IGR	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196395222_196395223delAG								LRRC33 (6350 upstream) : C3orf34 (37926 downstream)																																			---	---	---	---
DLG1	1739	broad.mit.edu	37	3	197018097	197018098	+	Intron	INS	-	TCCT	TCCT	rs146890109		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197018097_197018098insTCCT	uc003fxo.3	-						DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron|DLG1_uc011buf.1_Intron|DLG1_uc003fxp.2_Intron|DLG1_uc010iam.1_Intron	NM_001098424	NP_001091894			discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	197186847	197186847	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197186847delG								DLG1 (160704 upstream) : BDH1 (49808 downstream)																																			---	---	---	---
KIAA0226	9711	broad.mit.edu	37	3	197406476	197406477	+	Intron	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197406476_197406477delCT	uc003fyc.2	-						KIAA0226_uc003fyd.3_Intron|KIAA0226_uc003fye.1_Intron	NM_014687	NP_055502			hypothetical protein LOC9711 isoform 2.						autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	43179	43179	+	IGR	DEL	C	-	-	rs112472020		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43179delC								None (None upstream) : ZNF595 (10048 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	380438	380439	+	IGR	INS	-	C	C	rs140300339	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:380438_380439insC								ZNF141 (2679 upstream) : ABCA11P (38785 downstream)																																			---	---	---	---
POLN	353497	broad.mit.edu	37	4	2121153	2121154	+	Intron	INS	-	GT	GT	rs138515520	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2121153_2121154insGT	uc003ger.2	-						POLN_uc010icg.1_Intron|POLN_uc010ich.1_Intron	NM_181808	NP_861524			DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)										DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
GRK4	2868	broad.mit.edu	37	4	2978125	2978126	+	Intron	INS	-	T	T	rs150726510	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2978125_2978126insT	uc003ggn.1	+						GRK4_uc003ggo.1_Intron|GRK4_uc003ggp.1_Intron|GRK4_uc003ggq.1_Intron	NM_182982	NP_892027			G protein-coupled receptor kinase 4 isoform							cell cortex	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3586749	3586749	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3586749delA	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																														---	---	---	---
OTOP1	133060	broad.mit.edu	37	4	4227465	4227465	+	Intron	DEL	C	-	-	rs80279674		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4227465delC	uc003ghp.1	-							NM_177998	NP_819056			otopetrin 1						biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)														---	---	---	---
STK32B	55351	broad.mit.edu	37	4	5078714	5078714	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5078714delT	uc003gih.1	+						STK32B_uc010ida.1_Intron	NM_018401	NP_060871			serine/threonine kinase 32B								ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	6763462	6763462	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6763462delA								CNO (44075 upstream) : KIAA0232 (20997 downstream)																																			---	---	---	---
TBC1D14	57533	broad.mit.edu	37	4	6939493	6939493	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6939493delG	uc011bwg.1	+						TBC1D14_uc003gjs.3_Intron	NM_001113361	NP_001106832			TBC1 domain family, member 14 isoform a							intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2																		---	---	---	---
GRPEL1	80273	broad.mit.edu	37	4	7068987	7068988	+	Intron	INS	-	A	A	rs34723634		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7068987_7068988insA	uc003gjy.1	-						GRPEL1_uc003gjz.1_Intron	NM_025196	NP_079472			GrpE-like 1, mitochondrial precursor						protein folding|protein import into mitochondrial matrix	mitochondrial matrix	adenyl-nucleotide exchange factor activity|chaperone binding|protein homodimerization activity|unfolded protein binding				0																		---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7623255	7623256	+	Intron	DEL	TA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7623255_7623256delTA	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7641663	7641664	+	Intron	DEL	TC	-	-	rs139983893		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7641663_7641664delTC	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
ABLIM2	84448	broad.mit.edu	37	4	8055537	8055537	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8055537delT	uc003gko.2	-						ABLIM2_uc003gkl.2_Intron|ABLIM2_uc003gkj.3_Intron|ABLIM2_uc003gkm.3_Intron|ABLIM2_uc003gkp.2_Intron|ABLIM2_uc003gkq.2_Intron|ABLIM2_uc003gkr.2_Intron|ABLIM2_uc003gks.3_Intron|ABLIM2_uc011bwl.1_Intron	NM_001130084	NP_001123556			actin binding LIM protein family, member 2						axon guidance|cytoskeleton organization	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus	actin binding|zinc ion binding			pancreas(3)	3																		---	---	---	---
SLC2A9	56606	broad.mit.edu	37	4	9871082	9871089	+	Intron	DEL	CCTGGGCT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9871082_9871089delCCTGGGCT	uc003gmc.2	-						SLC2A9_uc003gmd.2_Intron	NM_020041	NP_064425			solute carrier family 2, member 9 protein						glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	12533925	12533925	+	IGR	DEL	T	-	-	rs111684457		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12533925delT								None (None upstream) : HSP90AB2P (801112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	14875294	14875294	+	Intron	DEL	G	-	-	rs66475033		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14875294delG	uc003gne.2	-						uc003gnf.2_Intron					Homo sapiens cDNA clone IMAGE:3604199, **** WARNING: chimeric clone ****.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	15250866	15250866	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15250866delT								CPEB2 (179092 upstream) : C1QTNF7 (90694 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	15944967	15944968	+	IGR	INS	-	A	A	rs76128326		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15944967_15944968insA								FGFBP1 (4996 upstream) : FGFBP2 (16896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	17564411	17564411	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17564411delG								CLRN2 (35684 upstream) : LAP3 (14516 downstream)																																			---	---	---	---
FAM184B	27146	broad.mit.edu	37	4	17770433	17770433	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17770433delT	uc003gpm.3	-							NM_015688	NP_056503			hypothetical protein LOC27146											central_nervous_system(1)	1																		---	---	---	---
LCORL	254251	broad.mit.edu	37	4	17980203	17980203	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17980203delA	uc003gpq.2	-						LCORL_uc011bxk.1_Intron	NM_153686	NP_710153			ligand dependent nuclear receptor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
LCORL	254251	broad.mit.edu	37	4	18006551	18006551	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18006551delT	uc003gpq.2	-						LCORL_uc011bxk.1_Intron	NM_153686	NP_710153			ligand dependent nuclear receptor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	19416854	19416855	+	IGR	INS	-	TTT	TTT	rs150741103	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19416854_19416855insTTT								None (None upstream) : SLIT2 (838380 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	22192399	22192399	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22192399delA								KCNIP4 (242025 upstream) : GPR125 (196600 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	30541375	30541376	+	IGR	INS	-	GCGGGTACA	GCGGGTACA	rs138960362	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30541375_30541376insGCGGGTACA								None (None upstream) : PCDH7 (180661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31961915	31961918	+	IGR	DEL	TCTC	-	-	rs35166558		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31961915_31961918delTCTC								PCDH7 (813494 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32170651	32170652	+	IGR	INS	-	ATAA	ATAA	rs144634231	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32170651_32170652insATAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32275655	32275655	+	IGR	DEL	T	-	-	rs36062662		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32275655delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	34837114	34837115	+	IGR	INS	-	TT	TT	rs149021285	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34837114_34837115insTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	35563737	35563737	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:35563737delC								None (None upstream) : ARAP2 (386107 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	38176773	38176776	+	IGR	DEL	TCCA	-	-	rs139984172		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38176773_38176776delTCCA								TBC1D1 (35980 upstream) : FLJ13197 (437546 downstream)																																			---	---	---	---
C4orf34	201895	broad.mit.edu	37	4	39582150	39582151	+	Intron	DEL	TT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39582150_39582151delTT	uc003guo.2	-						uc003gum.1_Intron|C4orf34_uc010ifm.2_Intron	NM_174921	NP_777581			hypothetical protein LOC201895							integral to membrane	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	40732575	40732576	+	IGR	INS	-	AG	AG	rs146912327	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40732575_40732576insAG								RBM47 (99935 upstream) : NSUN7 (19338 downstream)																																			---	---	---	---
TXK	7294	broad.mit.edu	37	4	48076653	48076653	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48076653delA	uc003gxx.3	-						TXK_uc010igj.2_Intron|TXK_uc011bzj.1_Intron	NM_003328	NP_003319			TXK tyrosine kinase							cytoplasm	ATP binding|non-membrane spanning protein tyrosine kinase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	49167729	49167730	+	IGR	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49167729_49167730insG								CWH43 (103636 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49217676	49217677	+	IGR	INS	-	C	C	rs146012723	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49217676_49217677insC								CWH43 (153583 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49311195	49311196	+	IGR	INS	-	TCTG	TCTG			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49311195_49311196insTCTG								CWH43 (247102 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53173634	53173634	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53173634delG								SPATA18 (210177 upstream) : USP46 (283495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	53655043	53655044	+	IGR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53655043_53655044delCA								KIAA0114 (74738 upstream) : RASL11B (73451 downstream)																																			---	---	---	---
SCFD2	152579	broad.mit.edu	37	4	53847718	53847719	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53847718_53847719insT	uc003gzu.2	-						SCFD2_uc010igm.2_Intron	NM_152540	NP_689753			sec1 family domain containing 2						protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	55167005	55167006	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55167005_55167006insT								PDGFRA (2594 upstream) : KIT (357089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	55936250	55936250	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55936250delA								KIT (329371 upstream) : KDR (8177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	56635297	56635299	+	IGR	DEL	AAG	-	-	rs67385178		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56635297_56635299delAAG								NMU (132832 upstream) : LOC644145 (50938 downstream)																																			---	---	---	---
SRP72	6731	broad.mit.edu	37	4	57340709	57340709	+	Intron	DEL	T	-	-	rs112716931		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57340709delT	uc003hbv.2	+						SRP72_uc010ihe.2_Intron|SRP72_uc003hbw.1_Intron	NM_006947	NP_008878			signal recognition particle 72kDa						response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|nucleolus|plasma membrane|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding			ovary(1)	1	Glioma(25;0.08)|all_neural(26;0.101)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	58642553	58642556	+	IGR	DEL	GTGT	-	-	rs146674622		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58642553_58642556delGTGT								IGFBP7 (666014 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59503537	59503538	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59503537_59503538insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	82445603	82445603	+	IGR	DEL	A	-	-	rs142493056		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82445603delA								RASGEF1B (52542 upstream) : HNRNPD (828864 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	87834218	87834218	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87834218delA								C4orf36 (20643 upstream) : AFF1 (21945 downstream)																																			---	---	---	---
FAM190A	401145	broad.mit.edu	37	4	92227210	92227211	+	Intron	INS	-	TG	TG	rs6148568		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:92227210_92227211insTG	uc003hsv.3	+							NM_001145065	NP_001138537			KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2																		---	---	---	---
BMPR1B	658	broad.mit.edu	37	4	95914034	95914034	+	Intron	DEL	T	-	-	rs35942593		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:95914034delT	uc003htm.3	+							NM_001203	NP_001194			bone morphogenetic protein receptor, type IB						BMP signaling pathway|cartilage condensation|eye development|limb morphogenesis|ovarian cumulus expansion|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	receptor complex	ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta receptor activity			lung(4)|skin(2)|stomach(1)|breast(1)	8		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	100388292	100388293	+	IGR	INS	-	TG	TG	rs149078825	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100388292_100388293insTG								ADH7 (31767 upstream) : C4orf17 (43907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	100601699	100601700	+	IGR	INS	-	TTC	TTC	rs150759522	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100601699_100601700insTTC								MTTP (56546 upstream) : DAPP1 (136281 downstream)																																			---	---	---	---
NFKB1	4790	broad.mit.edu	37	4	103535416	103535416	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103535416delA	uc011ceq.1	+						NFKB1_uc011cep.1_Intron|NFKB1_uc011cer.1_Intron	NM_003998	NP_003989			nuclear factor kappa-B, subunit 1 isoform 1						anti-apoptosis|apoptosis|cellular response to mechanical stimulus|inflammatory response|innate immune response|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of calcidiol 1-monooxygenase activity|nerve growth factor receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter	cytosol|I-kappaB/NF-kappaB complex|mitochondrion|nucleoplasm	protein binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(2)|breast(2)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Dexamethasone(DB01234)|Pranlukast(DB01411)|Thalidomide(DB01041)													---	---	---	---
NHEDC1	150159	broad.mit.edu	37	4	103826510	103826511	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103826510_103826511delCA	uc003hww.2	-						NHEDC1_uc003hwu.2_Intron|NHEDC1_uc010ilm.2_Intron|NHEDC1_uc003hwv.2_Intron|NHEDC1_uc011cev.1_Intron	NM_139173	NP_631912			Na+/H+ exchanger domain containing 1 isoform 1							integral to membrane	solute:hydrogen antiporter activity			ovary(1)|skin(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;1.5e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	120324739	120324753	+	Intron	DEL	TTCTGGTGCAAGAGA	-	-	rs70944868		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120324739_120324753delTTCTGGTGCAAGAGA	uc003icx.1	+											Homo sapiens cDNA FLJ40382 fis, clone TESTI2035775.																														---	---	---	---
SCLT1	132320	broad.mit.edu	37	4	129956697	129956698	+	Intron	INS	-	A	A	rs141885852	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129956697_129956698insA	uc003igp.2	-						SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron	NM_144643	NP_653244			sodium channel associated protein 1							centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	130231912	130231925	+	IGR	DEL	TGTGTGTGTGTGTG	-	-	rs36223041		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130231912_130231925delTGTGTGTGTGTGTG								C4orf33 (198070 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	132660349	132660351	+	IGR	DEL	CTC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:132660349_132660351delCTC								None (None upstream) : None (None downstream)																																			---	---	---	---
SLC7A11	23657	broad.mit.edu	37	4	139128919	139128919	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139128919delA	uc011chb.1	-							NM_014331	NP_055146			solute carrier family 7, (cationic amino acid						blood coagulation|cellular nitrogen compound metabolic process|leukocyte migration|response to toxin	integral to membrane|plasma membrane	cystine:glutamate antiporter activity|protein binding			skin(1)	1	all_hematologic(180;0.166)				L-Cystine(DB00138)|L-Glutamic Acid(DB00142)|Sulfasalazine(DB00795)													---	---	---	---
SLC7A11	23657	broad.mit.edu	37	4	139163463	139163465	+	5'UTR	DEL	CTG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139163463_139163465delCTG	uc011chb.1	-	1						NM_014331	NP_055146			solute carrier family 7, (cationic amino acid						blood coagulation|cellular nitrogen compound metabolic process|leukocyte migration|response to toxin	integral to membrane|plasma membrane	cystine:glutamate antiporter activity|protein binding			skin(1)	1	all_hematologic(180;0.166)				L-Cystine(DB00138)|L-Glutamic Acid(DB00142)|Sulfasalazine(DB00795)													---	---	---	---
MAML3	55534	broad.mit.edu	37	4	141009656	141009656	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141009656delC	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187			mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	142692797	142692797	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142692797delA								IL15 (38186 upstream) : INPP4B (256387 downstream)																																			---	---	---	---
MMAA	166785	broad.mit.edu	37	4	146574028	146574028	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146574028delT	uc003ikh.3	+						MMAA_uc010iow.2_Intron	NM_172250	NP_758454			methylmalonic aciduria type A precursor							mitochondrion	GTP binding|nucleoside-triphosphatase activity			ovary(1)	1	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
SLC10A7	84068	broad.mit.edu	37	4	147445949	147445949	+	5'Flank	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147445949delA	uc010ioz.2	-						SLC10A7_uc003ikr.2_5'Flank|SLC10A7_uc010ipa.2_5'Flank|SLC10A7_uc003iks.2_5'Flank|SLC10A7_uc003ikt.2_5'Flank|SLC10A7_uc003iku.3_5'Flank	NM_001029998	NP_001025169			solute carrier family 10 (sodium/bile acid							integral to membrane	bile acid:sodium symporter activity				0	all_hematologic(180;0.151)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	149960612	149960612	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149960612delC								NR3C2 (596969 upstream) : None (None downstream)																																			---	---	---	---
LRBA	987	broad.mit.edu	37	4	151664756	151664756	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151664756delT	uc010ipj.2	-						LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron	NM_006726	NP_006717			LPS-responsive vesicle trafficking, beach and							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	152995166	152995166	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152995166delG								PET112L (313020 upstream) : FBXW7 (247245 downstream)														p.?(1)																					---	---	---	---
DCHS2	54798	broad.mit.edu	37	4	155307640	155307641	+	Intron	INS	-	T	T	rs142304293	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155307640_155307641insT	uc003inw.2	-						DCHS2_uc003inx.2_Intron	NM_017639	NP_060109			dachsous 2 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	155921374	155921374	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155921374delG								RBM46 (171410 upstream) : NPY2R (208407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	157582668	157582669	+	IGR	INS	-	T	T	rs147676816	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157582668_157582669insT								CTSO (707620 upstream) : PDGFC (100095 downstream)																																			---	---	---	---
RAPGEF2	9693	broad.mit.edu	37	4	160277487	160277488	+	Intron	DEL	TG	-	-	rs28492028	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160277487_160277488delTG	uc003iqg.3	+							NM_014247	NP_055062			Rap guanine nucleotide exchange factor 2						cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	160722662	160722662	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160722662delT								RAPGEF2 (441363 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	161188234	161188234	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161188234delT								RAPGEF2 (906935 upstream) : None (None downstream)																																			---	---	---	---
SH3RF1	57630	broad.mit.edu	37	4	170052497	170052498	+	Intron	INS	-	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170052497_170052498insC	uc003isa.1	-						SH3RF1_uc010irc.1_Intron	NM_020870	NP_065921			SH3 domain containing ring finger 1							Golgi apparatus|lamellipodium|perinuclear region of cytoplasm	ligase activity|zinc ion binding			breast(2)|lung(1)	3		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	172192457	172192457	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:172192457delC								None (None upstream) : GALNTL6 (542118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	175535291	175535294	+	IGR	DEL	AGAG	-	-	rs138783799		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175535291_175535294delAGAG								HPGD (91247 upstream) : GLRA3 (27904 downstream)																																			---	---	---	---
ACSL1	2180	broad.mit.edu	37	4	185723728	185723728	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185723728delC	uc003iww.2	-						ACSL1_uc011ckm.1_Intron|ACSL1_uc003iwt.1_Intron|ACSL1_uc003iwu.1_Intron|ACSL1_uc011ckn.1_Intron|ACSL1_uc003iwv.1_Intron	NM_001995	NP_001986			acyl-CoA synthetase long-chain family member 1						digestion|fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|regulation of fatty acid oxidation|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			ovary(2)	2		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00172)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0315)|all_neural(102;0.107)|Medulloblastoma(177;0.146)		all cancers(43;1.33e-28)|Epithelial(43;5.3e-25)|OV - Ovarian serous cystadenocarcinoma(60;4.88e-11)|Colorectal(24;3.59e-06)|STAD - Stomach adenocarcinoma(60;2.72e-05)|GBM - Glioblastoma multiforme(59;2.83e-05)|BRCA - Breast invasive adenocarcinoma(30;7.66e-05)|COAD - Colon adenocarcinoma(29;0.000538)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.0419)	Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	185907004	185907005	+	IGR	INS	-	T	T	rs142095850	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185907004_185907005insT								ACSL1 (159789 upstream) : HELT (32990 downstream)																																			---	---	---	---
SNX25	83891	broad.mit.edu	37	4	186250836	186250837	+	Intron	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186250836_186250837delAG	uc003ixh.2	+						SNX25_uc010ish.2_Intron|SNX25_uc003ixi.2_Intron	NM_031953	NP_114159			sorting nexin 25						cell communication|protein transport	endosome membrane	phosphatidylinositol binding|signal transducer activity			ovary(2)|breast(2)|pancreas(1)	5		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)														---	---	---	---
CYP4V2	285440	broad.mit.edu	37	4	187118942	187118945	+	Intron	DEL	TATG	-	-	rs144489932		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187118942_187118945delTATG	uc003iyw.3	+							NM_207352	NP_997235			cytochrome P450, family 4, subfamily v,						response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)														---	---	---	---
FAT1	2195	broad.mit.edu	37	4	187650043	187650043	+	5'Flank	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187650043delG	uc010iso.1	-											Homo sapiens cDNA, FLJ97886.						actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12															HNSCC(5;0.00058)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188049350	188049350	+	IGR	DEL	A	-	-	rs35179358		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188049350delA								FAT1 (401500 upstream) : ZFP42 (867575 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190198107	190198108	+	IGR	DEL	GT	-	-	rs62342938	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190198107_190198108delGT								None (None upstream) : FRG1 (663866 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190626821	190626822	+	IGR	DEL	TT	-	-	rs150059094		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190626821_190626822delTT								None (None upstream) : FRG1 (235152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190646859	190646860	+	IGR	INS	-	A	A	rs71278840		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190646859_190646860insA								None (None upstream) : FRG1 (215114 downstream)																																			---	---	---	---
FRG1	2483	broad.mit.edu	37	4	190883957	190883957	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190883957delA	uc003izs.2	+							NM_004477	NP_004468			FSHD region gene 1						rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	1389130	1389131	+	IGR	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1389130_1389131delTC								CLPTM1L (44128 upstream) : SLC6A3 (3779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1450972	1450972	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1450972delT								SLC6A3 (5434 upstream) : LPCAT1 (10572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	1782787	1782788	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1782787_1782788delTG								LOC728613 (148667 upstream) : MRPL36 (15712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	7913224	7913225	+	IGR	INS	-	TACCTGT	TACCTGT	rs145207022	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7913224_7913225insTACCTGT								MTRR (11991 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	8579351	8579351	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8579351delA								MTRR (678118 upstream) : SEMA5A (455787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	10160415	10160415	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10160415delA								LOC285692 (256479 upstream) : FAM173B (66023 downstream)																																			---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11447455	11447455	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11447455delA	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
ANKH	56172	broad.mit.edu	37	5	14855958	14855958	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14855958delA	uc003jfm.3	-							NM_054027	NP_473368			progressive ankylosis protein						locomotory behavior|regulation of bone mineralization|skeletal system development	integral to plasma membrane|outer membrane	inorganic diphosphate transmembrane transporter activity|inorganic phosphate transmembrane transporter activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	17468955	17468956	+	IGR	INS	-	GTGTGTGT	GTGTGTGT	rs147265274	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17468955_17468956insGTGTGTGT								BASP1 (192020 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	18896913	18896913	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18896913delA								None (None upstream) : CDH18 (576244 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	20533003	20533003	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20533003delT								CDH18 (544696 upstream) : GUSBP1 (808939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	23375616	23375616	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23375616delT								CDH12 (521885 upstream) : PRDM9 (132108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	29909441	29909441	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:29909441delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	30778859	30778859	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30778859delC								None (None upstream) : CDH6 (414937 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	31389657	31389657	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31389657delC								CDH6 (64420 upstream) : RNASEN (10945 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	31577767	31577768	+	IGR	DEL	AG	-	-	rs10532106		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31577767_31577768delAG								C5orf22 (22603 upstream) : PDZD2 (61749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	36571499	36571499	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36571499delT								RANBP3L (269488 upstream) : SLC1A3 (34958 downstream)																																			---	---	---	---
PLCXD3	345557	broad.mit.edu	37	5	41463434	41463434	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41463434delC	uc003jmm.1	-							NM_001005473	NP_001005473			phosphatidylinositol-specific phospholipase C, X						intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	42178445	42178445	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42178445delG								FBXO4 (236782 upstream) : GHR (245581 downstream)																																			---	---	---	---
HMGCS1	3157	broad.mit.edu	37	5	43309340	43309341	+	Intron	INS	-	T	T	rs36036640		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43309340_43309341insT	uc003jnr.3	-						HMGCS1_uc003jnq.3_Intron	NM_001098272	NP_001091742			hydroxymethylglutaryl-CoA synthase 1						cholesterol biosynthetic process|isoprenoid biosynthetic process	cytosol|soluble fraction	hydroxymethylglutaryl-CoA synthase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	46399512	46399512	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46399512delT								HCN1 (703292 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	53863044	53863045	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53863044_53863045delTG								SNX18 (20629 upstream) : ESM1 (410651 downstream)																																			---	---	---	---
IL6ST	3572	broad.mit.edu	37	5	55273660	55273661	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55273660_55273661delAC	uc003jqq.2	-						IL6ST_uc010iwb.2_5'Flank|IL6ST_uc010iwc.2_5'Flank|IL6ST_uc010iwd.2_5'Flank|IL6ST_uc011cqk.1_Intron|IL6ST_uc003jqr.2_Intron|IL6ST_uc010iwf.1_5'Flank	NM_002184	NP_002175			interleukin 6 signal transducer isoform 1						interleukin-6-mediated signaling pathway|leukemia inhibitory factor signaling pathway|negative regulation of interleukin-6-mediated signaling pathway|positive regulation of anti-apoptosis|positive regulation of cardiac muscle hypertrophy|positive regulation of osteoblast differentiation|positive regulation of T cell proliferation|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation vascular endothelial growth factor production	ciliary neurotrophic factor receptor complex|extracellular region|extracellular space|interleukin-6 receptor complex|oncostatin-M receptor complex	ciliary neurotrophic factor receptor activity|ciliary neurotrophic factor receptor binding|growth factor binding|protein homodimerization activity			large_intestine(1)|ovary(1)	2		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)						O		hepatocellular ca								---	---	---	---
Unknown	0	broad.mit.edu	37	5	55839877	55839878	+	IGR	DEL	CA	-	-	rs71920919		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55839877_55839878delCA								ANKRD55 (310691 upstream) : MAP3K1 (271022 downstream)																																			---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58806631	58806631	+	Intron	DEL	C	-	-	rs143695401	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58806631delC	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	60593074	60593074	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60593074delT								C5orf43 (134772 upstream) : ZSWIM6 (35026 downstream)																																			---	---	---	---
ZSWIM6	57688	broad.mit.edu	37	5	60742672	60742673	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60742672_60742673delCA	uc003jsr.2	+							NM_020928	NP_065979			zinc finger, SWIM-type containing 6								zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	60874382	60874382	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60874382delT								ZSWIM6 (32384 upstream) : FLJ37543 (59254 downstream)																																			---	---	---	---
IPO11	51194	broad.mit.edu	37	5	61748551	61748552	+	Intron	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61748551_61748552delGT	uc003jtc.2	+						IPO11_uc011cqr.1_Intron|IPO11_uc003jtb.1_Intron	NM_016338	NP_057422			Ran binding protein 11 isoform 2							cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	65597762	65597763	+	IGR	INS	-	AAG	AAG	rs76469485		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65597762_65597763insAAG								SFRS12 (121050 upstream) : MAST4 (294413 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	66739207	66739207	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66739207delA								CD180 (246590 upstream) : PIK3R1 (772397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	72622543	72622544	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72622543_72622544delTG								TMEM174 (151575 upstream) : FOXD1 (119543 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	74334907	74334907	+	IGR	DEL	G	-	-	rs78535539	byFrequency;by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74334907delG								GCNT4 (8183 upstream) : ANKRD31 (108155 downstream)																																			---	---	---	---
SV2C	22987	broad.mit.edu	37	5	75476658	75476658	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75476658delT	uc003kei.1	+							NM_014979	NP_055794			synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	76292605	76292605	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76292605delA								CRHBP (27307 upstream) : AGGF1 (33627 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	76830545	76830546	+	IGR	DEL	CA	-	-	rs143028704		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76830545_76830546delCA								WDR41 (42213 upstream) : OTP (93992 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	78856852	78856853	+	IGR	DEL	TC	-	-	rs35806902		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78856852_78856853delTC								HOMER1 (47152 upstream) : PAPD4 (51390 downstream)																																			---	---	---	---
FAM151B	167555	broad.mit.edu	37	5	79794832	79794833	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79794832_79794833insA	uc003kgv.1	+						FAM151B_uc010jal.1_Intron	NM_205548	NP_991111			hypothetical protein LOC167555												0		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	83219797	83219806	+	IGR	DEL	GTGTGTGTGT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83219797_83219806delGTGTGTGTGT								HAPLN1 (202901 upstream) : EDIL3 (18320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	85481670	85481671	+	IGR	DEL	GT	-	-	rs3069184		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85481670_85481671delGT								None (None upstream) : NBPF22P (96591 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	85957414	85957414	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85957414delT								COX7C (40833 upstream) : RASA1 (606737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	90475783	90475785	+	IGR	DEL	AGG	-	-	rs140241795	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475783_90475785delAGG								GPR98 (15751 upstream) : ARRDC3 (188756 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	96635025	96635025	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96635025delT								RIOK2 (116020 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	100965718	100965719	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:100965718_100965719insA								ST8SIA4 (726731 upstream) : SLCO4C1 (603975 downstream)																																			---	---	---	---
GIN1	54826	broad.mit.edu	37	5	102426605	102426606	+	Intron	DEL	AC	-	-	rs72058777		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102426605_102426606delAC	uc003koa.1	-						GIN1_uc003kob.1_Intron|GIN1_uc003koc.1_Intron	NM_017676	NP_060146			zinc finger, H2C2 domain containing						DNA integration		DNA binding			ovary(1)|skin(1)	2		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	105219436	105219437	+	IGR	DEL	TG	-	-	rs66968138		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:105219436_105219437delTG								RAB9BP1 (783638 upstream) : None (None downstream)																																			---	---	---	---
MAN2A1	4124	broad.mit.edu	37	5	109184396	109184397	+	Intron	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109184396_109184397delCT	uc003kou.1	+							NM_002372	NP_002363			mannosidase, alpha, class 2A, member 1						mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	109620654	109620655	+	IGR	INS	-	TG	TG	rs78381589		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109620654_109620655insTG								MAN2A1 (417225 upstream) : TMEM232 (4279 downstream)																																			---	---	---	---
TMEM232	642987	broad.mit.edu	37	5	109649754	109649754	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109649754delA	uc003kov.1	-											Homo sapiens cDNA FLJ35903 fis, clone TESTI2009585.							integral to membrane					0																		---	---	---	---
TMEM232	642987	broad.mit.edu	37	5	109778727	109778754	+	Intron	DEL	CAACCTGATGTCAGCACAGCACTGGGTC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109778727_109778754delCAACCTGATGTCAGCACAGCACTGGGTC	uc011cvh.1	-						TMEM232_uc003kow.1_Intron|TMEM232_uc003kox.2_Intron|TMEM232_uc010jbs.2_Intron|TMEM232_uc003koy.3_Intron					SubName: Full=cDNA FLJ54480;							integral to membrane					0																		---	---	---	---
YTHDC2	64848	broad.mit.edu	37	5	112876434	112876434	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112876434delG	uc003kqn.2	+						YTHDC2_uc010jce.1_Intron|YTHDC2_uc010jcf.1_Intron	NM_022828	NP_073739			YTH domain containing 2								ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)														---	---	---	---
KCNN2	3781	broad.mit.edu	37	5	113734182	113734182	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113734182delT	uc003kqo.2	+							NM_021614	NP_067627			small conductance calcium-activated potassium							integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	114448559	114448560	+	IGR	DEL	TT	-	-	rs5870637		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114448559_114448560delTT								KCNN2 (616363 upstream) : TRIM36 (11907 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	116598469	116598470	+	IGR	INS	-	A	A	rs139749721	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116598469_116598470insA								SEMA6A (687918 upstream) : None (None downstream)																																			---	---	---	---
DMXL1	1657	broad.mit.edu	37	5	118434894	118434895	+	Intron	INS	-	TTTG	TTTG	rs138823497	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118434894_118434895insTTTG	uc003ksd.2	+						DMXL1_uc010jcl.1_Intron|DMXL1_uc003ksc.1_Intron	NM_005509	NP_005500			Dmx-like 1											ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)														---	---	---	---
FAM170A	340069	broad.mit.edu	37	5	118967109	118967110	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118967109_118967110delTG	uc003ksm.2	+						FAM170A_uc003ksl.2_Intron|FAM170A_uc003ksn.2_Intron|FAM170A_uc003kso.2_Intron	NM_182761	NP_877438			family with sequence similarity 170, member A							intracellular	zinc ion binding			skin(1)	1																		---	---	---	---
PRR16	51334	broad.mit.edu	37	5	119919249	119919249	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119919249delT	uc003ksq.2	+						PRR16_uc003ksp.2_Intron	NM_016644	NP_057728			proline rich 16											pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)														---	---	---	---
SNCAIP	9627	broad.mit.edu	37	5	121778606	121778607	+	Intron	INS	-	A	A	rs139237270	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121778606_121778607insA	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|SNCAIP_uc011cwm.1_Intron|SNCAIP_uc003kta.1_Intron|SNCAIP_uc010jcv.1_Intron|SNCAIP_uc010jcw.1_Intron|SNCAIP_uc010jcx.1_Intron|uc003ktb.1_Intron|SNCAIP_uc003ktc.1_5'Flank	NM_005460	NP_005451			synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	124818244	124818244	+	IGR	DEL	A	-	-	rs35353545		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124818244delA								ZNF608 (733744 upstream) : GRAMD3 (877544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	125001516	125001516	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125001516delG								ZNF608 (917016 upstream) : GRAMD3 (694272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	125025145	125025145	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125025145delA								ZNF608 (940645 upstream) : GRAMD3 (670643 downstream)																																			---	---	---	---
GRAMD3	65983	broad.mit.edu	37	5	125719302	125719302	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125719302delA	uc011cwt.1	+						GRAMD3_uc011cwu.1_Intron	NM_001146319	NP_001139791			GRAM domain containing 3 isoform 1											central_nervous_system(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)														---	---	---	---
GRAMD3	65983	broad.mit.edu	37	5	125829706	125829706	+	3'UTR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125829706delA	uc003ktu.2	+	14					GRAMD3_uc011cwt.1_3'UTR|GRAMD3_uc011cwv.1_3'UTR|GRAMD3_uc011cww.1_3'UTR|GRAMD3_uc011cwx.1_RNA|GRAMD3_uc011cwy.1_3'UTR|GRAMD3_uc011cwz.1_3'UTR	NM_023927	NP_076416			GRAM domain containing 3 isoform 2											central_nervous_system(1)	1		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	129529283	129529284	+	IGR	DEL	AC	-	-	rs67844386	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129529283_129529284delAC								CHSY3 (6957 upstream) : HINT1 (965591 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	131517823	131517823	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131517823delA								CSF2 (105965 upstream) : P4HA2 (10483 downstream)																																			---	---	---	---
AFF4	27125	broad.mit.edu	37	5	132281218	132281218	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132281218delA	uc003kyd.2	-						AFF4_uc011cxk.1_Intron|AFF4_uc003kye.1_Intron|AFF4_uc003kyf.3_Intron	NM_014423	NP_055238			ALL1 fused gene from 5q31						transcription from RNA polymerase II promoter	mitochondrion|nucleolus	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|kidney(2)|skin(1)	5		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	133346263	133346264	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133346263_133346264insA								VDAC1 (5439 upstream) : TCF7 (104138 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	133376266	133376266	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133376266delA								VDAC1 (35442 upstream) : TCF7 (74136 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	133838682	133838683	+	IGR	INS	-	A	A	rs78185414		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133838682_133838683insA								CDKN2AIPNL (91093 upstream) : PHF15 (21383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	136942124	136942124	+	IGR	DEL	A	-	-	rs72515374		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136942124delA								SPOCK1 (107106 upstream) : KLHL3 (11066 downstream)																																			---	---	---	---
NRG2	9542	broad.mit.edu	37	5	139419801	139419801	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139419801delT	uc003lex.1	-						NRG2_uc003lev.1_Intron|NRG2_uc003lew.1_Intron|NRG2_uc003ley.1_Intron	NM_004883	NP_004874			neuregulin 2 isoform 1						embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB7	56129	broad.mit.edu	37	5	140551627	140551627	+	5'Flank	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140551627delG	uc003lit.2	+							NM_018940	NP_061763			protocadherin beta 7 precursor						calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	141292208	141292208	+	IGR	DEL	C	-	-	rs3045699		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141292208delC								PCDH1 (34264 upstream) : KIAA0141 (11177 downstream)																																			---	---	---	---
SLC26A2	1836	broad.mit.edu	37	5	149338795	149338796	+	5'Flank	INS	-	A	A	rs148181591	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149338795_149338796insA	uc003lrh.2	+							NM_000112	NP_000103			solute carrier family 26 member 2							integral to plasma membrane|membrane fraction	secondary active sulfate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	150069809	150069809	+	IGR	DEL	A	-	-	rs67977338		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150069809delA								MYOZ3 (10884 upstream) : RBM22 (544 downstream)																																			---	---	---	---
SPARC	6678	broad.mit.edu	37	5	151041877	151041878	+	3'UTR	INS	-	ATA	ATA	rs143024185	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151041877_151041878insATA	uc003luh.2	-	9					GM2A_uc011dcs.1_Intron|SPARC_uc003lug.2_3'UTR|SPARC_uc003lui.2_3'UTR	NM_003118	NP_003109			secreted protein, acidic, cysteine-rich						ossification|platelet activation|platelet degranulation|signal transduction	basement membrane|extracellular space|platelet alpha granule lumen	calcium ion binding|collagen binding			central_nervous_system(1)	1		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)	Becaplermin(DB00102)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	154570364	154570365	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154570364_154570365delTG								KIF4B (172679 upstream) : SGCD (564698 downstream)																																			---	---	---	---
SGCD	6444	broad.mit.edu	37	5	155974451	155974452	+	Intron	INS	-	T	T	rs35755122		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:155974451_155974452insT	uc003lwd.3	+						SGCD_uc003lwa.1_Intron|SGCD_uc003lwb.2_Intron|SGCD_uc003lwc.3_Intron	NM_001128209	NP_001121681			delta-sarcoglycan isoform 3						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	160409406	160409407	+	IGR	INS	-	TT	TT	rs146407506		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160409406_160409407insTT								LOC285629 (43773 upstream) : GABRB2 (306029 downstream)																																			---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	167091938	167091938	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167091938delG	uc010jjd.2	+							NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
WWC1	23286	broad.mit.edu	37	5	167794958	167794959	+	Intron	DEL	AC	-	-	rs35741249		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167794958_167794959delAC	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron	NM_015238	NP_056053			WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)														---	---	---	---
WWC1	23286	broad.mit.edu	37	5	167827825	167827826	+	Intron	DEL	GA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167827825_167827826delGA	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron	NM_015238	NP_056053			WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)														---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168389343	168389344	+	Intron	DEL	AC	-	-	rs13179349		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168389343_168389344delAC	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053			slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
FGF18	8817	broad.mit.edu	37	5	170872538	170872539	+	Intron	INS	-	T	T	rs140690032		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170872538_170872539insT	uc003mbk.2	+							NM_003862	NP_003853			fibroblast growth factor 18 precursor						cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell proliferation	extracellular space|nucleolus	growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
UBTD2	92181	broad.mit.edu	37	5	171695174	171695175	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171695174_171695175insT	uc003mbp.1	-							NM_152277	NP_689490			dendritic cell-derived ubiquitin-like protein							cytoplasm					0	Renal(175;0.000159)|Lung NSC(126;0.00976)|all_lung(126;0.0156)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	172851339	172851339	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172851339delA								STC2 (94833 upstream) : LOC285593 (155307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	173638214	173638214	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173638214delA								HMP19 (102033 upstream) : MSX2 (513361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	173728221	173728222	+	IGR	DEL	AA	-	-	rs67139163		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173728221_173728222delAA								HMP19 (192040 upstream) : MSX2 (423353 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	173773126	173773126	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173773126delA								HMP19 (236945 upstream) : MSX2 (378449 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	177407561	177407562	+	IGR	INS	-	GT	GT	rs147148558	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177407561_177407562insGT								LOC728554 (96294 upstream) : PROP1 (11674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	179356747	179356748	+	IGR	INS	-	AAA	AAA	rs34934872		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179356747_179356748insAAA								TBC1D9B (21891 upstream) : RNF130 (25726 downstream)																																			---	---	---	---
GFPT2	9945	broad.mit.edu	37	5	179776879	179776879	+	Intron	DEL	T	-	-	rs66486074		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179776879delT	uc003mlw.1	-							NM_005110	NP_005101			glutamine-fructose-6-phosphate transaminase 2						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			ovary(1)|skin(1)	2	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)													---	---	---	---
Unknown	0	broad.mit.edu	37	5	179917814	179917814	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179917814delA								GFPT2 (137499 upstream) : CNOT6 (3603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	180495093	180495093	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180495093delT								BTNL9 (6571 upstream) : OR2V2 (86850 downstream)																																			---	---	---	---
DUSP22	56940	broad.mit.edu	37	6	344807	344808	+	Intron	DEL	GA	-	-	rs150748532		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:344807_344808delGA	uc003msx.2	+						DUSP22_uc011dhn.1_Intron|DUSP22_uc003msy.1_Intron	NM_020185	NP_064570			dual specificity phosphatase 22						apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)														---	---	---	---
GMDS	2762	broad.mit.edu	37	6	1871292	1871293	+	Intron	INS	-	CA	CA	rs147925111	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1871292_1871293insCA	uc003mtq.2	-							NM_001500	NP_001491			GDP-mannose 4,6-dehydratase						'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity			central_nervous_system(1)	1	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	3563140	3563140	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3563140delG								SLC22A23 (106347 upstream) : C6orf145 (159696 downstream)																																			---	---	---	---
CDYL	9425	broad.mit.edu	37	6	4745079	4745080	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4745079_4745080insT	uc003mwi.2	+							NM_001143971	NP_001137443			chromodomain protein, Y chromosome-like isoform						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)														---	---	---	---
FARS2	10667	broad.mit.edu	37	6	5476766	5476767	+	Intron	INS	-	ATGA	ATGA	rs143579033	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5476766_5476767insATGA	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558			phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	6054397	6054397	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6054397delA								NRN1 (46764 upstream) : F13A1 (89915 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	7048035	7048036	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7048035_7048036insA								LY86 (392819 upstream) : RREB1 (60152 downstream)																																			---	---	---	---
SNRNP48	154007	broad.mit.edu	37	6	7610923	7610934	+	3'UTR	DEL	ATTGAAAATGTT	-	-	rs66604210		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7610923_7610934delATTGAAAATGTT	uc003mxr.2	+	9					SNRNP48_uc003mxs.2_RNA	NM_152551	NP_689764			U11/U12 snRNP 48K						mRNA processing	cytoplasm|U12-type spliceosomal complex	metal ion binding				0																		---	---	---	---
TXNDC5	81567	broad.mit.edu	37	6	7960319	7960320	+	Intron	DEL	AA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7960319_7960320delAA	uc003mxw.2	-							NM_001145549	NP_001139021			thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	8179267	8179267	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8179267delC								EEF1E1 (76439 upstream) : SLC35B3 (232466 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	8459822	8459822	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8459822delT	uc003mye.2	+											Homo sapiens, clone IMAGE:5539086, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	8461013	8461013	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8461013delT	uc003mye.2	+											Homo sapiens, clone IMAGE:5539086, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	8473424	8473425	+	Intron	INS	-	TG	TG	rs34452904		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8473424_8473425insTG	uc003mye.2	+											Homo sapiens, clone IMAGE:5539086, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	10453180	10453181	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10453180_10453181delTG								C6orf218 (18125 upstream) : GCNT2 (39275 downstream)																																			---	---	---	---
SYCP2L	221711	broad.mit.edu	37	6	10960102	10960103	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10960102_10960103insA	uc003mzo.2	+						SYCP2L_uc010jow.2_Intron	NM_001040274	NP_001035364			synaptonemal complex protein 2-like							nucleus				ovary(1)|skin(1)	2	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)															---	---	---	---
NEDD9	4739	broad.mit.edu	37	6	11210203	11210204	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11210203_11210204insT	uc003mzv.2	-						NEDD9_uc010joz.2_Intron|NEDD9_uc003mzw.3_Intron|NEDD9_uc003mzx.2_Intron	NM_006403	NP_006394			neural precursor cell expressed, developmentally						actin filament bundle assembly|cell adhesion|cell division|integrin-mediated signaling pathway|mitosis|regulation of growth	cell cortex|focal adhesion|Golgi apparatus|lamellipodium|nucleus	protein binding				0	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	11876489	11876489	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11876489delA								C6orf105 (97209 upstream) : HIVEP1 (136235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	11977946	11977946	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11977946delC								C6orf105 (198666 upstream) : HIVEP1 (34778 downstream)																																			---	---	---	---
JARID2	3720	broad.mit.edu	37	6	15331570	15331575	+	Intron	DEL	AAAAAC	-	-	rs143932407		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15331570_15331575delAAAAAC	uc003nbj.2	+						JARID2_uc011diu.1_Intron|JARID2_uc011div.1_Intron	NM_004973	NP_004964			jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	15962697	15962706	+	IGR	DEL	GTGTGTGTGT	-	-	rs113915386	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15962697_15962706delGTGTGTGTGT								DTNBP1 (299426 upstream) : MYLIP (166611 downstream)																																			---	---	---	---
ATXN1	6310	broad.mit.edu	37	6	16581427	16581428	+	Intron	DEL	TG	-	-	rs36226540		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16581427_16581428delTG	uc003nbt.2	-						ATXN1_uc010jpi.2_Intron|ATXN1_uc010jpj.1_Intron|ATXN1_uc003nbu.1_Intron	NM_000332	NP_000323			ataxin 1						cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association			skin(3)|central_nervous_system(1)	4	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)																---	---	---	---
CAP2	10486	broad.mit.edu	37	6	17469648	17469649	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17469648_17469649delTG	uc003ncb.2	+						CAP2_uc010jpk.1_Intron|CAP2_uc011dja.1_Intron|CAP2_uc011djb.1_Intron|CAP2_uc011djc.1_Intron|CAP2_uc011djd.1_Intron	NM_006366	NP_006357			adenylyl cyclase-associated protein 2						activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)															---	---	---	---
CAP2	10486	broad.mit.edu	37	6	17496692	17496692	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17496692delG	uc003ncb.2	+						CAP2_uc010jpk.1_Intron|CAP2_uc011dja.1_Intron|CAP2_uc011djb.1_Intron|CAP2_uc011djc.1_Intron|CAP2_uc011djd.1_Intron	NM_006366	NP_006357			adenylyl cyclase-associated protein 2						activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	18739678	18739678	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18739678delT								MIR548A1 (167567 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	20065024	20065024	+	IGR	DEL	T	-	-	rs10713109		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20065024delT								ID4 (224110 upstream) : MBOAT1 (35911 downstream)																																			---	---	---	---
CDKAL1	54901	broad.mit.edu	37	6	21220433	21220434	+	Intron	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21220433_21220434delGT	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron|CDKAL1_uc003ndf.1_Intron|CDKAL1_uc003ndg.2_Intron	NM_017774	NP_060244			CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	23648722	23648733	+	IGR	DEL	GTGTGTGTGTGT	-	-	rs112593901		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23648722_23648733delGTGTGTGTGTGT								None (None upstream) : NRSN1 (477681 downstream)																																			---	---	---	---
ALDH5A1	7915	broad.mit.edu	37	6	24508864	24508865	+	Intron	INS	-	T	T	rs144188640	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24508864_24508865insT	uc003neg.2	+						ALDH5A1_uc003nef.2_Intron	NM_001080	NP_001071			aldehyde dehydrogenase 5A1 isoform 2 precursor						acetate metabolic process|central nervous system development|galactosylceramide metabolic process|gamma-aminobutyric acid catabolic process|glucose metabolic process|glutamate metabolic process|glutamine metabolic process|glutathione metabolic process|glycerophospholipid metabolic process|neurotransmitter catabolic process|neurotransmitter secretion|protein homotetramerization|respiratory electron transport chain|short-chain fatty acid metabolic process|succinate metabolic process	mitochondrial matrix|soluble fraction	succinate-semialdehyde dehydrogenase activity				0					Chlormerodrin(DB00534)|NADH(DB00157)|Succinic acid(DB00139)													---	---	---	---
FAM65B	9750	broad.mit.edu	37	6	24921370	24921370	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24921370delA	uc011djs.1	-						FAM65B_uc011dju.1_Intron	NM_015864	NP_056948			hypothetical protein LOC9750 isoform 2						cell differentiation|muscle organ development	cytoskeleton|filopodium|mitochondrion	binding			ovary(1)	1																		---	---	---	---
LRRC16A	55604	broad.mit.edu	37	6	25277850	25277852	+	5'Flank	DEL	AAA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25277850_25277852delAAA	uc011djw.1	+						LRRC16A_uc010jpx.2_5'Flank|LRRC16A_uc010jpy.2_5'Flank	NM_017640	NP_060110			leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
LRRC16A	55604	broad.mit.edu	37	6	25284108	25284109	+	Intron	INS	-	T	T	rs150318867	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25284108_25284109insT	uc011djw.1	+						LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Intron	NM_017640	NP_060110			leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
LRRC16A	55604	broad.mit.edu	37	6	25479028	25479028	+	Intron	DEL	A	-	-	rs111562802		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25479028delA	uc011djw.1	+						LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Intron|LRRC16A_uc003nez.1_Intron	NM_017640	NP_060110			leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
LRRC16A	55604	broad.mit.edu	37	6	25544382	25544382	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25544382delT	uc011djw.1	+						LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Intron|LRRC16A_uc003nfa.1_Intron	NM_017640	NP_060110			leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
SLC17A4	10050	broad.mit.edu	37	6	25776376	25776377	+	Intron	INS	-	A	A	rs137907151	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25776376_25776377insA	uc003nfe.2	+						SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Intron|SLC17A4_uc003nfg.2_Intron|SLC17A4_uc010jqa.2_Intron	NM_005495	NP_005486			solute carrier family 17 (sodium phosphate),						phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	30236669	30236670	+	IGR	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30236669_30236670delAG								HLA-L (1941 upstream) : HCG18 (18504 downstream)																																			---	---	---	---
PPP1R10	5514	broad.mit.edu	37	6	30581658	30581659	+	Intron	INS	-	A	A	rs139914199	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30581658_30581659insA	uc003nqn.1	-						PPP1R10_uc010jsc.1_Intron	NM_002714	NP_002705			protein phosphatase 1, regulatory subunit 10						protein import into nucleus|transcription, DNA-dependent	PTW/PP1 phosphatase complex	DNA binding|protein phosphatase inhibitor activity|RNA binding|zinc ion binding			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
POU5F1	5460	broad.mit.edu	37	6	31135730	31135731	+	Intron	INS	-	C	C	rs147048044	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31135730_31135731insC	uc003nsv.2	-						POU5F1_uc003nsu.2_5'Flank|uc011dng.1_5'Flank	NM_002701	NP_002692			POU domain, class 5, transcription factor 1						anatomical structure morphogenesis|blastocyst development|BMP signaling pathway involved in heart induction|cardiac cell fate determination|cell fate commitment involved in formation of primary germ layers|mRNA transcription from RNA polymerase II promoter|negative regulation of gene silencing by miRNA|positive regulation of catenin import into nucleus|positive regulation of SMAD protein import into nucleus|positive regulation of transcription from RNA polymerase II promoter|regulation of asymmetric cell division|regulation of heart induction by regulation of canonical Wnt receptor signaling pathway|regulation of methylation-dependent chromatin silencing|response to wounding|somatic stem cell maintenance|somatic stem cell maintenance	cytosol|nucleoplasm|transcription factor complex	miRNA binding|sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding		EWSR1/POU5F1(10)	skin(7)|salivary_gland(2)|bone(2)|lung(1)|ovary(1)	13								T	EWSR1	sarcoma								---	---	---	---
HLA-DRB5	3127	broad.mit.edu	37	6	32526684	32526685	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32526684_32526685insT	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obm.1_Intron|HLA-DRB6_uc003obn.1_Intron|HLA-DRB6_uc003obo.1_Intron	NM_002125	NP_002116			major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	33188802	33188802	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33188802delT								RING1 (8304 upstream) : VPS52 (29247 downstream)																																			---	---	---	---
TAPBP	6892	broad.mit.edu	37	6	33269367	33269367	+	3'UTR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33269367delG	uc003odx.1	-	8					RGL2_uc003odv.2_5'Flank|RGL2_uc003odw.2_5'Flank|RGL2_uc011drb.1_5'Flank|TAPBP_uc010jus.1_3'UTR	NM_003190	NP_003181			tapasin isoform 1 precursor						antigen processing and presentation of endogenous peptide antigen via MHC class I|immune response|peptide antigen stabilization|protein complex assembly|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|MHC class I peptide loading complex|microsome	MHC class I protein binding|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|unfolded protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	33458626	33458626	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33458626delC								ZBTB9 (33308 upstream) : BAK1 (81698 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	33472037	33472041	+	IGR	DEL	ACCTC	-	-	rs76056537		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33472037_33472041delACCTC								ZBTB9 (46719 upstream) : BAK1 (68283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	33581537	33581538	+	IGR	INS	-	GT	GT	rs111751153		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33581537_33581538insGT								C6orf227 (20422 upstream) : ITPR3 (7623 downstream)																																			---	---	---	---
SCUBE3	222663	broad.mit.edu	37	6	35186717	35186717	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35186717delA	uc003okf.1	+						SCUBE3_uc003okg.1_Intron	NM_152753	NP_689966			signal peptide, CUB domain, EGF-like 3						protein heterooligomerization|protein homooligomerization	cell surface|extracellular region	calcium ion binding|protein binding			skin(1)	1																		---	---	---	---
PPARD	5467	broad.mit.edu	37	6	35393541	35393541	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35393541delT	uc003okm.2	+						PPARD_uc003okn.2_Intron|PPARD_uc011dtb.1_Intron|PPARD_uc011dtc.1_Intron	NM_006238	NP_006229			peroxisome proliferative activated receptor,						apoptosis|axon ensheathment|cholesterol metabolic process|decidualization|embryo implantation|fatty acid beta-oxidation|fatty acid transport|generation of precursor metabolites and energy|glucose metabolic process|glucose transport|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fat cell differentiation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|linoleic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1					Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)													---	---	---	---
ZFAND3	60685	broad.mit.edu	37	6	37933347	37933347	+	Intron	DEL	T	-	-	rs68183493		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37933347delT	uc003onx.2	+							NM_021943	NP_068762			zinc finger, AN1-type domain 3								DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
BTBD9	114781	broad.mit.edu	37	6	38148333	38148334	+	Intron	INS	-	TC	TC	rs140403842	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38148333_38148334insTC	uc003ony.3	-						BTBD9_uc010jwv.2_Intron|BTBD9_uc010jww.2_Intron|BTBD9_uc003ooa.3_Intron|BTBD9_uc010jwx.2_Intron|uc003oob.1_3'UTR	NM_152733	NP_689946			BTB (POZ) domain containing 9 isoform b						cell adhesion						0																		---	---	---	---
BTBD9	114781	broad.mit.edu	37	6	38577146	38577146	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38577146delA	uc003ooa.3	-						BTBD9_uc010jwx.2_Intron	NM_052893	NP_443125			BTB (POZ) domain containing 9 isoform a						cell adhesion						0																		---	---	---	---
DNAH8	1769	broad.mit.edu	37	6	38706810	38706810	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38706810delT	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	40121315	40121316	+	IGR	DEL	AT	-	-	rs146342564		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40121315_40121316delAT								MOCS1 (219061 upstream) : TDRG1 (224847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	40562869	40562869	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40562869delG								LRFN2 (7743 upstream) : UNC5CL (431903 downstream)																																			---	---	---	---
MED20	9477	broad.mit.edu	37	6	41882460	41882460	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41882460delA	uc003ork.2	-						MED20_uc003orj.2_Intron|MED20_uc011duh.1_Intron|MED20_uc011dui.1_Intron|MED20_uc011duj.1_Intron	NM_004275	NP_004266			Trf (TATA binding protein-related						regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	mediator complex	DNA-directed RNA polymerase activity|protein binding				0	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000367)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
TRERF1	55809	broad.mit.edu	37	6	42262231	42262232	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42262231_42262232insA	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037			transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	43206096	43206097	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43206096_43206097insA								C6orf108 (8885 upstream) : TTBK1 (5125 downstream)																																			---	---	---	---
TJAP1	93643	broad.mit.edu	37	6	43448262	43448263	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43448262_43448263insT	uc003ovd.2	+						TJAP1_uc003ovf.2_Intron|TJAP1_uc003ove.2_Intron|TJAP1_uc003ovc.2_Intron|TJAP1_uc010jyp.2_Intron|TJAP1_uc011dvh.1_Intron	NM_001146016	NP_001139488			tight junction associated protein 1 isoform a							Golgi apparatus|tight junction	protein binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	44009820	44009821	+	Intron	INS	-	TG	TG	rs78857004		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44009820_44009821insTG	uc003owm.1	-											Homo sapiens cDNA: FLJ21083 fis, clone CAS03150.																														---	---	---	---
MRPL14	64928	broad.mit.edu	37	6	44084961	44084962	+	Intron	INS	-	AAC	AAC	rs142051077	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44084961_44084962insAAC	uc003owp.2	-							NM_032111	NP_115487			mitochondrial ribosomal protein L14 precursor						translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0181)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	46120628	46120628	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46120628delT								ENPP4 (6193 upstream) : ENPP5 (7134 downstream)																																			---	---	---	---
RCAN2	10231	broad.mit.edu	37	6	46198548	46198548	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46198548delA	uc003oyb.1	-						RCAN2_uc003oyc.1_Intron|RCAN2_uc003oyd.1_Intron	NM_005822	NP_005813			Down syndrome critical region gene 1-like 1						calcium-mediated signaling|central nervous system development		nucleotide binding|protein phosphatase 2B binding				0																		---	---	---	---
PLA2G7	7941	broad.mit.edu	37	6	46702101	46702102	+	Intron	DEL	GA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46702101_46702102delGA	uc010jzf.2	-						PLA2G7_uc010jzg.1_Intron|PLA2G7_uc011dwd.1_Intron|PLA2G7_uc011dwe.1_Intron	NM_005084	NP_005075			phospholipase A2, group VII						inflammatory response|lipid catabolic process	extracellular space	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding				0			Lung(136;0.192)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	47714007	47714007	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47714007delT								GPR115 (24250 upstream) : OPN5 (35791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	48388379	48388380	+	IGR	DEL	CA	-	-	rs34877155		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48388379_48388380delCA								C6orf138 (309436 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	50292279	50292279	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50292279delG								DEFB112 (275915 upstream) : TFAP2D (388978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	51133487	51133487	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51133487delC								TFAP2B (318162 upstream) : PKHD1 (346658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	52578939	52578939	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52578939delG								TMEM14A (27556 upstream) : GSTA2 (35949 downstream)																																			---	---	---	---
HCRTR2	3062	broad.mit.edu	37	6	55051875	55051875	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55051875delA	uc003pcl.2	+						HCRTR2_uc010jzv.2_Intron	NM_001526	NP_001517			orexin receptor 2						feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)															---	---	---	---
GFRAL	389400	broad.mit.edu	37	6	55237886	55237887	+	Intron	DEL	AA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55237886_55237887delAA	uc003pcm.1	+							NM_207410	NP_997293			GDNF family receptor alpha like precursor							integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)															---	---	---	---
BMP5	653	broad.mit.edu	37	6	55685122	55685122	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55685122delA	uc003pcq.2	-						BMP5_uc011dxf.1_Intron	NM_021073	NP_066551			bone morphogenetic protein 5 preproprotein						cartilage development|cell differentiation|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(2)	2	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)															---	---	---	---
COL21A1	81578	broad.mit.edu	37	6	55929587	55929589	+	Intron	DEL	AAG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55929587_55929589delAAG	uc003pcs.2	-						COL21A1_uc010jzz.2_Intron|COL21A1_uc011dxg.1_Intron|COL21A1_uc011dxh.1_Intron|COL21A1_uc003pcr.2_Intron	NM_030820	NP_110447			collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)															---	---	---	---
COL21A1	81578	broad.mit.edu	37	6	56251387	56251389	+	Intron	DEL	TTG	-	-	rs35794959		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56251387_56251389delTTG	uc003pcu.1	-							NM_030820	NP_110447			collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)															---	---	---	---
DST	667	broad.mit.edu	37	6	56497992	56497993	+	Intron	INS	-	T	T	rs60599813		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56497992_56497993insT	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Intron|DST_uc003pdd.3_Intron	NM_001144769	NP_001138241			dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)															---	---	---	---
BEND6	221336	broad.mit.edu	37	6	56830888	56830889	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56830888_56830889insT	uc010kab.2	+						BEND6_uc003pdg.2_Intron	NM_152731	NP_689944			BEN domain containing 6												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	56896929	56896931	+	IGR	DEL	CAG	-	-	rs147395500		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56896929_56896931delCAG								BEND6 (4791 upstream) : KIAA1586 (14453 downstream)																																			---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57261078	57261079	+	Intron	INS	-	CTGT	CTGT	rs147489906	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57261078_57261079insCTGT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57265999	57266006	+	Intron	DEL	CTTTGGTT	-	-	rs111641104		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57265999_57266006delCTTTGGTT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57274966	57274967	+	Intron	INS	-	A	A	rs142189795	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57274966_57274967insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57308617	57308618	+	Intron	INS	-	A	A	rs146159570	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57308617_57308618insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57360568	57360569	+	Intron	DEL	AT	-	-	rs140251188		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57360568_57360569delAT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57369333	57369334	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57369333_57369334insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57396574	57396574	+	Intron	DEL	A	-	-	rs79549638	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57396574delA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57411089	57411089	+	Intron	DEL	G	-	-	rs11293899		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57411089delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57436347	57436348	+	Intron	DEL	CT	-	-	rs5876618		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57436347_57436348delCT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57437778	57437779	+	Intron	INS	-	C	C	rs149492685	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57437778_57437779insC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57465439	57465448	+	Intron	DEL	AATCAGAAGT	-	-	rs33935554		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57465439_57465448delAATCAGAAGT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57552362	57552363	+	IGR	INS	-	TTA	TTA	rs145796484	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57552362_57552363insTTA								PRIM2 (38987 upstream) : GUSBL2 (693796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57557095	57557095	+	IGR	DEL	T	-	-	rs79478192		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57557095delT								PRIM2 (43720 upstream) : GUSBL2 (689064 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57604449	57604449	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57604449delT								PRIM2 (91074 upstream) : GUSBL2 (641710 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57838919	57838920	+	IGR	INS	-	GCAGGG	GCAGGG	rs144641845	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57838919_57838920insGCAGGG								PRIM2 (325544 upstream) : GUSBL2 (407239 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	64892820	64892820	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64892820delG	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	65353013	65353014	+	Intron	INS	-	A	A	rs148906713	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65353013_65353014insA	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	67389257	67389258	+	IGR	DEL	TG	-	-	rs34513295		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:67389257_67389258delTG								MCART3P (889882 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	68962996	68962996	+	IGR	DEL	C	-	-	rs56806004		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:68962996delC								None (None upstream) : BAI3 (382636 downstream)																																			---	---	---	---
BAI3	577	broad.mit.edu	37	6	69805706	69805707	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69805706_69805707delCA	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695			brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)																---	---	---	---
COL9A1	1297	broad.mit.edu	37	6	70962720	70962720	+	Intron	DEL	A	-	-	rs71787720		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70962720delA	uc003pfg.3	-						COL9A1_uc003pfe.3_Intron|COL9A1_uc003pff.3_Intron	NM_001851	NP_001842			alpha 1 type IX collagen isoform 1 precursor						axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	72183710	72183710	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72183710delG								C6orf155 (53262 upstream) : RIMS1 (412940 downstream)																																			---	---	---	---
KHDC1	80759	broad.mit.edu	37	6	73961763	73961764	+	Intron	INS	-	T	T	rs112248383		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73961763_73961764insT	uc003pgo.2	-						KHDC1_uc011dyl.1_Intron|KHDC1_uc003pgn.3_Intron	NM_030568	NP_085045			KH homology domain containing 1							integral to membrane	RNA binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	74781153	74781154	+	Intron	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74781153_74781154delAG	uc003phr.2	+											Homo sapiens full length insert cDNA clone ZD50H02.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	77640338	77640339	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77640338_77640339delTG								IMPG1 (858003 upstream) : HTR1B (531609 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	78477411	78477414	+	IGR	DEL	CACA	-	-	rs113399058		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78477411_78477414delCACA								HTR1B (304291 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	78652526	78652526	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78652526delA								HTR1B (479406 upstream) : IRAK1BP1 (924663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	79384897	79384898	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79384897_79384898insA								None (None upstream) : IRAK1BP1 (192291 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	82159139	82159139	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82159139delC								None (None upstream) : FAM46A (296309 downstream)																																			---	---	---	---
RARS2	57038	broad.mit.edu	37	6	88292086	88292087	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88292086_88292087insT	uc003pme.2	-						RARS2_uc003pmb.2_Intron|RARS2_uc003pmc.2_Intron|RARS2_uc003pmd.2_Intron|RARS2_uc003pmf.2_Intron	NM_020320	NP_064716			arginyl-tRNA synthetase 2, mitochondrial						arginyl-tRNA aminoacylation	mitochondrial matrix	arginine-tRNA ligase activity|ATP binding|protein binding			ovary(2)|central_nervous_system(1)	3		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	89240376	89240379	+	IGR	DEL	AGGC	-	-	rs36011169		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89240376_89240379delAGGC								CNR1 (364609 upstream) : RNGTT (79610 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	89720674	89720675	+	IGR	DEL	TC	-	-	rs149932118		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89720674_89720675delTC								RNGTT (47326 upstream) : PNRC1 (69754 downstream)																																			---	---	---	---
ANKRD6	22881	broad.mit.edu	37	6	90226116	90226116	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90226116delT	uc003pni.3	+						ANKRD6_uc003pne.3_Intron|ANKRD6_uc003pnf.3_Intron	NM_014942	NP_055757			ankyrin repeat domain 6								protein binding			ovary(2)|pancreas(1)	3		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)														---	---	---	---
EPHA7	2045	broad.mit.edu	37	6	94105621	94105621	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:94105621delC	uc003poe.2	-						EPHA7_uc003pof.2_Intron|EPHA7_uc011eac.1_Intron	NM_004440	NP_004431			ephrin receptor EphA7 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	95873420	95873420	+	IGR	DEL	T	-	-	rs72303328		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95873420delT								None (None upstream) : MANEA (151993 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	96238570	96238571	+	IGR	INS	-	A	A	rs139523308	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96238570_96238571insA								MANEA (181244 upstream) : FUT9 (225274 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	98478209	98478210	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98478209_98478210insA								MIR2113 (5712 upstream) : POU3F2 (804370 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	98488938	98488938	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98488938delG								MIR2113 (16441 upstream) : POU3F2 (793642 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	99514295	99514295	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99514295delT								FBXL4 (118446 upstream) : C6orf168 (206499 downstream)																																			---	---	---	---
SFRS18	25957	broad.mit.edu	37	6	99861268	99861271	+	Intron	DEL	ATCC	-	-	rs144357391		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99861268_99861271delATCC	uc003ppo.3	-						SFRS18_uc003ppp.3_Intron|SFRS18_uc011eag.1_Intron|SFRS18_uc003ppr.2_Intron|SFRS18_uc003ppt.2_Intron|SFRS18_uc003pps.2_Intron	NM_032870	NP_116259			splicing factor, arginine/serine-rich 130							nuclear speck					0		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0631)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	100159415	100159415	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100159415delG								PRDM13 (95961 upstream) : MCHR2 (208371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	101496111	101496111	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101496111delT								ASCC3 (166887 upstream) : GRIK2 (350794 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	104178218	104178221	+	IGR	DEL	ACAC	-	-	rs141574839		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104178218_104178221delACAC								None (None upstream) : HACE1 (997747 downstream)																																			---	---	---	---
PREP	5550	broad.mit.edu	37	6	105806733	105806733	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105806733delG	uc003prc.2	-							NM_002726	NP_002717			prolyl endopeptidase						proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	106387644	106387644	+	IGR	DEL	A	-	-	rs71708191		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106387644delA								PREP (536675 upstream) : PRDM1 (146551 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	107152714	107152717	+	IGR	DEL	AAAC	-	-	rs72464899		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107152714_107152717delAAAC								QRSL1 (36424 upstream) : MIR587 (79283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	107277901	107277901	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107277901delT								MIR587 (45806 upstream) : C6orf203 (71506 downstream)																																			---	---	---	---
AKD1	221264	broad.mit.edu	37	6	109958476	109958476	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109958476delT	uc003ptn.2	-						AKD1_uc003ptr.3_Intron	NM_001145128	NP_001138600			adenylate kinase domain containing 1 isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1																		---	---	---	---
AMD1	262	broad.mit.edu	37	6	111197646	111197646	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111197646delT	uc003puk.1	+						AMD1_uc011eay.1_Intron|AMD1_uc011eaz.1_Intron|AMD1_uc011eba.1_Intron|AMD1_uc003pul.1_Intron	NM_001634	NP_001625			adenosylmethionine decarboxylase 1 isoform 1						spermidine biosynthetic process|spermine biosynthetic process	cytosol	adenosylmethionine decarboxylase activity			upper_aerodigestive_tract(1)	1		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	112271300	112271303	+	IGR	DEL	CCTC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112271300_112271303delCCTC								FYN (76673 upstream) : WISP3 (103975 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	113647959	113647962	+	IGR	DEL	TAAA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113647959_113647962delTAAA								RFPL4B (975461 upstream) : MARCKS (530565 downstream)																																			---	---	---	---
HS3ST5	222537	broad.mit.edu	37	6	114388446	114388446	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114388446delG	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840			heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	114717950	114717950	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114717950delA								HS3ST5 (54410 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	115596007	115596008	+	IGR	INS	-	CT	CT			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115596007_115596008insCT								HS3ST5 (932467 upstream) : FRK (666685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	115750492	115750493	+	IGR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115750492_115750493delCA								None (None upstream) : FRK (512200 downstream)																																			---	---	---	---
NT5DC1	221294	broad.mit.edu	37	6	116473855	116473856	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116473855_116473856insT	uc003pwj.2	+						NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Intron	NM_152729	NP_689942			5'-nucleotidase, cytosolic II-like 1 protein								hydrolase activity|metal ion binding				0		all_cancers(87;0.00367)|all_epithelial(87;0.00449)|Colorectal(196;0.0469)		all cancers(137;0.0327)|OV - Ovarian serous cystadenocarcinoma(136;0.0445)|GBM - Glioblastoma multiforme(226;0.0719)|Epithelial(106;0.112)														---	---	---	---
NT5DC1	221294	broad.mit.edu	37	6	116491409	116491409	+	Intron	DEL	C	-	-	rs67536342		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116491409delC	uc003pwj.2	+						NT5DC1_uc003pwk.2_Intron|NT5DC1_uc003pwl.2_Intron	NM_152729	NP_689942			5'-nucleotidase, cytosolic II-like 1 protein								hydrolase activity|metal ion binding				0		all_cancers(87;0.00367)|all_epithelial(87;0.00449)|Colorectal(196;0.0469)		all cancers(137;0.0327)|OV - Ovarian serous cystadenocarcinoma(136;0.0445)|GBM - Glioblastoma multiforme(226;0.0719)|Epithelial(106;0.112)														---	---	---	---
KPNA5	3841	broad.mit.edu	37	6	117062727	117062727	+	3'UTR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117062727delA	uc003pxh.2	+	15						NM_002269	NP_002260			karyopherin alpha 5						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	117423021	117423022	+	IGR	INS	-	CA	CA	rs145491541	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117423021_117423022insCA								RFX6 (169713 upstream) : VGLL2 (163699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	119268430	119268432	+	IGR	DEL	ATC	-	-	rs144501213		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119268430_119268432delATC								MCM9 (12127 upstream) : FAM184A (12566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	121740473	121740473	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121740473delC								C6orf170 (84829 upstream) : GJA1 (16272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122383551	122383551	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122383551delT								GJA1 (612679 upstream) : HSF2 (337145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122464659	122464660	+	IGR	INS	-	A	A	rs146981735	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122464659_122464660insA								GJA1 (693787 upstream) : HSF2 (256036 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122651704	122651704	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122651704delT								GJA1 (880832 upstream) : HSF2 (68992 downstream)																																			---	---	---	---
CLVS2	134829	broad.mit.edu	37	6	123366288	123366289	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123366288_123366289delAC	uc003pzi.1	+							NM_001010852	NP_001010852			retinaldehyde binding protein 1-like 2						lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---
TRDN	10345	broad.mit.edu	37	6	123942186	123942186	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123942186delC	uc003pzj.1	-						TRDN_uc003pzk.1_Intron|TRDN_uc003pzl.1_Intron|TRDN_uc010ken.2_Intron|TRDN_uc010keo.1_Intron	NM_006073	NP_006064			triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124497034	124497035	+	Intron	DEL	TT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124497034_124497035delTT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010kep.1_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124752885	124752885	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124752885delT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
TPD52L1	7164	broad.mit.edu	37	6	125493281	125493282	+	Intron	INS	-	CC	CC			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125493281_125493282insCC	uc003pzu.1	+						TPD52L1_uc003pzv.1_Intron|TPD52L1_uc003pzw.1_Intron|TPD52L1_uc003pzx.1_Intron|TPD52L1_uc003pzy.1_Intron	NM_003287	NP_003278			tumor protein D52-like 1 isoform 1						DNA fragmentation involved in apoptotic nuclear change|G2/M transition of mitotic cell cycle|induction of apoptosis|positive regulation of JNK cascade|positive regulation of MAP kinase activity	perinuclear region of cytoplasm	caspase activator activity|protein heterodimerization activity|protein homodimerization activity				0			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	129851215	129851215	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129851215delA	uc003qbq.2	-											Homo sapiens cDNA clone IMAGE:4822830.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	130308750	130308750	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130308750delA								C6orf191 (126334 upstream) : L3MBTL3 (30984 downstream)																																			---	---	---	---
EPB41L2	2037	broad.mit.edu	37	6	131258664	131258664	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131258664delA	uc003qch.2	-						EPB41L2_uc003qcg.1_Intron|EPB41L2_uc011eby.1_Intron|EPB41L2_uc003qci.2_Intron|EPB41L2_uc010kfk.2_Intron|EPB41L2_uc010kfl.1_Intron	NM_001431	NP_001422			erythrocyte membrane protein band 4.1-like 2						cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	132404997	132404997	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132404997delA								CTGF (132479 upstream) : MOXD1 (212198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	135080556	135080557	+	IGR	DEL	AA	-	-	rs67144684		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135080556_135080557delAA								SGK1 (441360 upstream) : ALDH8A1 (157972 downstream)																																			---	---	---	---
HBS1L	10767	broad.mit.edu	37	6	135362453	135362454	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135362453_135362454delTG	uc003qez.2	-						HBS1L_uc011ecy.1_Intron|HBS1L_uc011ecz.1_Intron|HBS1L_uc011eda.1_Intron|HBS1L_uc003qfa.2_Intron	NM_006620	NP_006611			Hsp70 subfamily B suppressor 1-like protein						signal transduction		GTP binding|GTPase activity|translation elongation factor activity			skin(2)	2	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)														---	---	---	---
AHI1	54806	broad.mit.edu	37	6	135734617	135734617	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135734617delA	uc003qgi.2	-						AHI1_uc003qgf.2_Intron|AHI1_uc003qgg.2_Intron|AHI1_uc003qgh.2_Intron|AHI1_uc003qgj.2_Intron|AHI1_uc003qgk.3_Intron|AHI1_uc003qgl.3_Intron	NM_001134831	NP_001128303			Abelson helper integration site 1 isoform a							adherens junction|cilium|microtubule basal body				ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)														---	---	---	---
MAP7	9053	broad.mit.edu	37	6	136775410	136775411	+	Intron	INS	-	ATCT	ATCT	rs150936891	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136775410_136775411insATCT	uc003qgz.2	-						MAP7_uc011edf.1_Intron|MAP7_uc011edg.1_Intron|MAP7_uc010kgu.2_Intron|MAP7_uc011edh.1_Intron|MAP7_uc010kgv.2_Intron|MAP7_uc010kgs.2_Intron|MAP7_uc011edi.1_Intron|MAP7_uc010kgq.1_Intron|MAP7_uc003qha.1_Intron|MAP7_uc010kgr.2_Intron|MAP7_uc010kgt.2_Intron	NM_003980	NP_003971			microtubule-associated protein 7						establishment or maintenance of cell polarity|microtubule cytoskeleton organization|protein localization in plasma membrane|response to osmotic stress	basolateral plasma membrane|microtubule|microtubule associated complex|nucleus|perinuclear region of cytoplasm	receptor binding|structural molecule activity				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	137286843	137286844	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137286843_137286844insT								SLC35D3 (40069 upstream) : NHEG1 (13528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	138360465	138360466	+	IGR	INS	-	A	A	rs67436981		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138360465_138360466insA								TNFAIP3 (156020 upstream) : PERP (49176 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	139450049	139450051	+	IGR	DEL	TTG	-	-	rs67767351		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139450049_139450051delTTG								C6orf115 (85610 upstream) : HECA (6198 downstream)																																			---	---	---	---
FUCA2	2519	broad.mit.edu	37	6	143821189	143821190	+	Intron	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143821189_143821190delGT	uc003qjm.2	-						FUCA2_uc003qjn.2_Intron	NM_032020	NP_114409			fucosidase, alpha-L- 2, plasma precursor						fucose metabolic process	extracellular region	alpha-L-fucosidase activity|cation binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)														---	---	---	---
RAB32	10981	broad.mit.edu	37	6	146861882	146861882	+	5'Flank	DEL	A	-	-	rs67376463		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146861882delA	uc003qln.1	+							NM_006834	NP_006825			RAB32, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	mitochondrion	GTP binding				0		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.68e-09)|GBM - Glioblastoma multiforme(68;0.00608)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	148890624	148890624	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148890624delT								SASH1 (17440 upstream) : UST (177647 downstream)																																			---	---	---	---
TAB2	23118	broad.mit.edu	37	6	149610531	149610531	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149610531delA	uc011eec.1	+							NM_015093	NP_055908			mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0																		---	---	---	---
PPIL4	85313	broad.mit.edu	37	6	149841718	149841719	+	Intron	DEL	CA	-	-	rs66670803		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149841718_149841719delCA	uc003qmo.1	-						PPIL4_uc010kic.2_Intron|PPIL4_uc003qmp.1_Intron	NM_139126	NP_624311			peptidylprolyl isomerase-like 4						protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	149912857	149912858	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149912857_149912858insT								C6orf72 (790 upstream) : KATNA1 (3314 downstream)																																			---	---	---	---
KATNA1	11104	broad.mit.edu	37	6	149962814	149962814	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149962814delC	uc003qms.2	-						KATNA1_uc003qmt.2_Intron	NM_007044	NP_008975			katanin p60 subunit A 1						cell division|interphase of mitotic cell cycle|mitosis	microtubule|microtubule organizing center|spindle pole	ATP binding|microtubule binding|microtubule-severing ATPase activity|protein heterodimerization activity			skin(1)	1		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)														---	---	---	---
PLEKHG1	57480	broad.mit.edu	37	6	151086041	151086041	+	Intron	DEL	C	-	-	rs150600562	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151086041delC	uc003qny.1	+						PLEKHG1_uc011eel.1_Intron|PLEKHG1_uc011eem.1_Intron|PLEKHG1_uc003qnz.2_Intron	NM_001029884	NP_001025055			pleckstrin homology domain containing, family G						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	151459879	151459880	+	IGR	INS	-	G	G	rs143655559	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151459879_151459880insG								MTHFD1L (36859 upstream) : AKAP12 (101254 downstream)																																			---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152076377	152076377	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152076377delA	uc003qom.3	+							NM_001122742	NP_001116214			estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152941275	152941277	+	Intron	DEL	ATT	-	-	rs74273735		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152941275_152941277delATT	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_Intron	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	6	153555605	153555606	+	IGR	INS	-	GAAA	GAAA			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153555605_153555606insGAAA								RGS17 (103216 upstream) : OPRM1 (776030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	153682710	153682711	+	IGR	INS	-	AGA	AGA	rs143184881	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153682710_153682711insAGA								RGS17 (230321 upstream) : OPRM1 (648925 downstream)																																			---	---	---	---
OPRM1	4988	broad.mit.edu	37	6	154339557	154339560	+	Intron	DEL	AAAC	-	-	rs67128829		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154339557_154339560delAAAC	uc011efe.1	+						OPRM1_uc011efb.1_Intron|OPRM1_uc011efc.1_Intron|OPRM1_uc011efd.1_Intron	NM_001145279	NP_001138751			opioid receptor, mu 1 isoform MOR-1H						behavior|negative regulation of cell proliferation|sensory perception	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	mu-opioid receptor activity|protein binding			ovary(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tramadol(DB00193)													---	---	---	---
TIAM2	26230	broad.mit.edu	37	6	155266293	155266293	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155266293delC	uc003qqb.2	+							NM_012454	NP_036586			T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	156631993	156631993	+	IGR	DEL	A	-	-	rs80252740		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156631993delA								MIR1202 (363980 upstream) : ARID1B (467093 downstream)																																			---	---	---	---
ZDHHC14	79683	broad.mit.edu	37	6	158077738	158077739	+	Intron	INS	-	A	A	rs11275040		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158077738_158077739insA	uc003qqt.2	+						ZDHHC14_uc003qqs.2_Intron|ZDHHC14_uc010kjn.2_Intron	NM_024630	NP_078906			zinc finger, DHHC-type containing 14 isoform 1							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)														---	---	---	---
GTF2H5	404672	broad.mit.edu	37	6	158596042	158596043	+	Intron	INS	-	TGTG	TGTG	rs78269942		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158596042_158596043insTGTG	uc003qrd.2	+							NM_207118	NP_997001			general transcription factor IIH, polypeptide 5						nucleotide-excision repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Breast(66;0.00519)|Ovarian(120;0.123)|Prostate(117;0.178)		OV - Ovarian serous cystadenocarcinoma(65;5.98e-18)|BRCA - Breast invasive adenocarcinoma(81;2.83e-05)									Direct_reversal_of_damage|NER					---	---	---	---
SYTL3	94120	broad.mit.edu	37	6	159167855	159167855	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159167855delA	uc003qrp.2	+						SYTL3_uc011efp.1_Intron|SYTL3_uc003qro.2_Intron|SYTL3_uc003qrq.2_Intron|SYTL3_uc003qrr.2_Intron|SYTL3_uc003qrs.2_Intron|SYTL3_uc011efq.1_Intron	NM_001009991	NP_001009991			synaptotagmin-like 3						intracellular protein transport	endomembrane system|membrane	Rab GTPase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	159898918	159898918	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159898918delA								FNDC1 (205779 upstream) : SOD2 (201233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	161195644	161195645	+	IGR	INS	-	ACTT	ACTT	rs150529100	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161195644_161195645insACTT								PLG (21299 upstream) : MAP3K4 (217177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	164332796	164332796	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164332796delC								QKI (337904 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	166172015	166172016	+	IGR	INS	-	GAAGAG	GAAGAG	rs112372946	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166172015_166172016insGAAGAG								PDE10A (96431 upstream) : C6orf176 (165520 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	167306437	167306437	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167306437delC								RPS6KA2 (30666 upstream) : RNASET2 (36571 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	167928478	167928480	+	IGR	DEL	CCG	-	-	rs145798392	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167928478_167928480delCCG								TCP10 (130480 upstream) : C6orf123 (256741 downstream)																																			---	---	---	---
WDR27	253769	broad.mit.edu	37	6	169976157	169976158	+	Intron	INS	-	T	T	rs146119198	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169976157_169976158insT	uc003qwx.2	-						WDR27_uc003qwv.1_Intron|WDR27_uc010kkw.1_Intron|WDR27_uc003qwy.2_Intron					RecName: Full=WD repeat-containing protein 27;											pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	170216572	170216572	+	IGR	DEL	G	-	-	rs143410082		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170216572delG								C6orf208 (13603 upstream) : LOC154449 (346850 downstream)																																			---	---	---	---
PSMB1	5689	broad.mit.edu	37	6	170838701	170838702	+	Intron	INS	-	CTT	CTT	rs77446182	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170838701_170838702insCTT	uc003qxq.2	-							NM_002793				proteasome beta 1 subunit precursor						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cell junction|cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.0563)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;7.5e-23)|BRCA - Breast invasive adenocarcinoma(81;4.88e-06)|GBM - Glioblastoma multiforme(31;0.00643)	Bortezomib(DB00188)													---	---	---	---
PRKAR1B	5575	broad.mit.edu	37	7	732576	732576	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:732576delT	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron	NM_002735	NP_002726			protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)														---	---	---	---
PRKAR1B	5575	broad.mit.edu	37	7	746003	746003	+	Intron	DEL	A	-	-	rs80282537		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:746003delA	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron	NM_002735	NP_002726			protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	2927134	2927136	+	IGR	DEL	ATT	-	-	rs57644991		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2927134_2927136delATT								GNA12 (43175 upstream) : CARD11 (18633 downstream)																																			---	---	---	---
CARD11	84433	broad.mit.edu	37	7	3017070	3017070	+	Intron	DEL	A	-	-	rs113661039		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3017070delA	uc003smv.2	-							NM_032415	NP_115791			caspase recruitment domain family, member 11						positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)				Mis		DLBCL								---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3626337	3626337	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3626337delA	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	4380519	4380520	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4380519_4380520insT								SDK1 (71890 upstream) : FOXK1 (302868 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	4590801	4590802	+	IGR	INS	-	CA	CA	rs138445506	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4590801_4590802insCA								SDK1 (282172 upstream) : FOXK1 (92586 downstream)																																			---	---	---	---
CYTH3	9265	broad.mit.edu	37	7	6242914	6242915	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6242914_6242915insT	uc003spt.2	-							NM_004227	NP_004218			cytohesin 3						regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|membrane fraction|plasma membrane	1-phosphatidylinositol binding|ARF guanyl-nucleotide exchange factor activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity				0																		---	---	---	---
C7orf70	84792	broad.mit.edu	37	7	6390249	6390250	+	5'Flank	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6390249_6390250delAC	uc003spu.2	-							NM_001037163	NP_001032240			hypothetical protein LOC84792							nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	6665766	6665767	+	IGR	DEL	AT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6665766_6665767delAT								ZNF853 (1847 upstream) : ZNF12 (62297 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	8866737	8866738	+	IGR	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8866737_8866738insG								NXPH1 (74145 upstream) : PER4 (807162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	9625706	9625712	+	IGR	DEL	CACCATT	-	-	rs111702439		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9625706_9625712delCACCATT								NXPH1 (833114 upstream) : PER4 (48188 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	10772650	10772650	+	IGR	DEL	A	-	-	rs35655165		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:10772650delA								None (None upstream) : NDUFA4 (200165 downstream)																																			---	---	---	---
PHF14	9678	broad.mit.edu	37	7	11129185	11129185	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11129185delA	uc003sry.1	+						PHF14_uc011jxi.1_Intron|PHF14_uc003srz.2_Intron|PHF14_uc011jxj.1_Intron	NM_014660	NP_055475			PHD finger protein 14 isoform 2								zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	12325983	12325983	+	IGR	DEL	A	-	-	rs112369359		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12325983delA								TMEM106B (49094 upstream) : VWDE (44526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	12534558	12534558	+	IGR	DEL	T	-	-	rs34886781		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12534558delT								VWDE (90706 upstream) : SCIN (61629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	13361366	13361366	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13361366delA								ARL4A (630810 upstream) : ETV1 (569492 downstream)																																			---	---	---	---
ETV1	2115	broad.mit.edu	37	7	13960067	13960068	+	Intron	DEL	GT	-	-	rs67520653		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13960067_13960068delGT	uc011jxq.1	-						ETV1_uc011jxn.1_Intron|ETV1_uc011jxo.1_Intron|ETV1_uc011jxp.1_Intron|ETV1_uc003ssw.3_Intron|ETV1_uc003ssx.2_Intron|ETV1_uc011jxr.1_Intron|ETV1_uc011jxs.1_Intron|ETV1_uc010ktv.2_Intron	NM_004956	NP_004947			ets variant gene 1 isoform a						transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35								T	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3	Ewing sarcoma|prostate								---	---	---	---
Unknown	0	broad.mit.edu	37	7	14143471	14143474	+	IGR	DEL	AAGG	-	-	rs72151112		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14143471_14143474delAAGG								ETV1 (112421 upstream) : DGKB (41201 downstream)																																			---	---	---	---
DGKB	1607	broad.mit.edu	37	7	14314596	14314597	+	Intron	INS	-	TT	TT	rs76260349		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14314596_14314597insTT	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071			diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	15038840	15038841	+	IGR	INS	-	A	A	rs72393185		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15038840_15038841insA								DGKB (96290 upstream) : TMEM195 (201102 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	16009243	16009244	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16009243_16009244insA								MEOX2 (282935 upstream) : ISPD (117908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	19430749	19430752	+	IGR	DEL	GTGT	-	-	rs72229244	byFrequency	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19430749_19430752delGTGT								FERD3L (245705 upstream) : TWISTNB (304333 downstream)																																			---	---	---	---
MACC1	346389	broad.mit.edu	37	7	20196026	20196026	+	Intron	DEL	T	-	-	rs1010701	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20196026delT	uc003sus.3	-						MACC1_uc010kug.2_Intron	NM_182762	NP_877439			putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	20592280	20592280	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20592280delA								ITGB8 (136902 upstream) : ABCB5 (62965 downstream)																																			---	---	---	---
DNAH11	8701	broad.mit.edu	37	7	21838025	21838025	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21838025delT	uc003svc.2	+							NM_003777	NP_003768			dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15														Kartagener_syndrome				---	---	---	---
CCDC126	90693	broad.mit.edu	37	7	23669343	23669344	+	Intron	INS	-	AG	AG	rs140673382	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23669343_23669344insAG	uc003swl.2	+						CCDC126_uc003swm.2_Intron|CCDC126_uc003swn.2_Intron	NM_138771	NP_620126			coiled-coil domain containing 126 precursor							extracellular region				ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	25736170	25736171	+	IGR	INS	-	G	G	rs139964384	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25736170_25736171insG								NPVF (468065 upstream) : MIR148A (253368 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	25780306	25780306	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25780306delT								NPVF (512201 upstream) : MIR148A (209233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	26607999	26607999	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26607999delA								KIAA0087 (29555 upstream) : C7orf71 (69491 downstream)																																			---	---	---	---
SKAP2	8935	broad.mit.edu	37	7	26847494	26847495	+	Intron	INS	-	T	T	rs144113319	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26847494_26847495insT	uc003syc.2	-						SKAP2_uc011jzi.1_Intron|SKAP2_uc011jzj.1_Intron	NM_003930	NP_003921			src kinase associated phosphoprotein 2						B cell activation|cell junction assembly|protein complex assembly|signal transduction	cytosol|plasma membrane	SH3/SH2 adaptor activity			pancreas(1)	1																		---	---	---	---
HIBADH	11112	broad.mit.edu	37	7	27647364	27647364	+	Intron	DEL	A	-	-	rs35970473		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27647364delA	uc003szf.2	-						HIBADH_uc003szg.2_Intron|HIBADH_uc003szh.2_Intron|HIBADH_uc003szi.2_Intron	NM_152740	NP_689953			3-hydroxyisobutyrate dehydrogenase precursor						branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)													---	---	---	---
CHN2	1124	broad.mit.edu	37	7	29469206	29469207	+	Intron	INS	-	AG	AG	rs28624792		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29469206_29469207insAG	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058			beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2																		---	---	---	---
BBS9	27241	broad.mit.edu	37	7	33173670	33173670	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33173670delT	uc003tdn.1	+						BBS9_uc003tdo.1_Intron|BBS9_uc003tdp.1_Intron|BBS9_uc003tdq.1_Intron|BBS9_uc010kwn.1_Intron	NM_198428	NP_940820			parathyroid hormone-responsive B1 isoform 2						fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)											Bardet-Biedl_syndrome				---	---	---	---
BBS9	27241	broad.mit.edu	37	7	33637289	33637290	+	Intron	INS	-	A	A	rs140418894	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33637289_33637290insA	uc003tdn.1	+						BBS9_uc003tdo.1_Intron|BBS9_uc003tdp.1_Intron|BBS9_uc003tdq.1_Intron|BBS9_uc010kwn.1_Intron|BBS9_uc003tdr.1_Intron|BBS9_uc003tds.1_Intron|BBS9_uc003tdt.2_Intron	NM_198428	NP_940820			parathyroid hormone-responsive B1 isoform 2						fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)											Bardet-Biedl_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	33904188	33904188	+	IGR	DEL	A	-	-	rs145614697		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33904188delA								BBS9 (258508 upstream) : BMPER (40924 downstream)																																			---	---	---	---
BMPER	168667	broad.mit.edu	37	7	34108183	34108184	+	Intron	INS	-	CAAAT	CAAAT	rs142802976	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34108183_34108184insCAAAT	uc011kap.1	+							NM_133468	NP_597725			BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	34239410	34239411	+	IGR	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34239410_34239411insG								BMPER (45299 upstream) : AAA1 (150624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	36356714	36356715	+	IGR	DEL	GT	-	-	rs72302972		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36356714_36356715delGT								EEPD1 (15563 upstream) : KIAA0895 (7044 downstream)																																			---	---	---	---
POU6F2	11281	broad.mit.edu	37	7	39281981	39281981	+	Intron	DEL	T	-	-	rs71558161		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39281981delT	uc003thb.1	+						POU6F2_uc010kxo.2_Intron	NM_007252	NP_009183			POU class 6 homeobox 2 isoform 1						central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	39842961	39842962	+	IGR	INS	-	TT	TT	rs67575743		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39842961_39842962insTT								LOC349114 (8740 upstream) : CDK13 (146997 downstream)																																			---	---	---	---
CDK13	8621	broad.mit.edu	37	7	40052511	40052511	+	Intron	DEL	A	-	-	rs149201870		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40052511delA	uc003thh.3	+						CDK13_uc003thi.3_Intron|CDK13_uc011kbf.1_Intron	NM_003718	NP_003709			cell division cycle 2-like 5 isoform 1						alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5																		---	---	---	---
GLI3	2737	broad.mit.edu	37	7	42102197	42102198	+	Intron	INS	-	TTAGATG	TTAGATG	rs138002036	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42102197_42102198insTTAGATG	uc011kbh.1	-						GLI3_uc011kbg.1_Intron	NM_000168	NP_000159			GLI-Kruppel family member GLI3						negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19														Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	44755097	44755097	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44755097delG								OGDH (6429 upstream) : ZMIZ2 (33083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	46106979	46106980	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46106979_46106980insT								IGFBP3 (146108 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	46756806	46756807	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46756806_46756807delTG								IGFBP3 (795935 upstream) : TNS3 (557946 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	46988849	46988849	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:46988849delT								None (None upstream) : TNS3 (325904 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	47199912	47199913	+	IGR	INS	-	G	G	rs145780514		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47199912_47199913insG								None (None upstream) : TNS3 (114840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	48955216	48955217	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48955216_48955217delTG								ABCA13 (268125 upstream) : CDC14C (8940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	49117940	49117941	+	IGR	INS	-	G	G	rs142343993	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49117940_49117941insG								CDC14C (150891 upstream) : VWC2 (695316 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	50231076	50231076	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50231076delA								C7orf72 (31718 upstream) : IKZF1 (113302 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53224592	53224592	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53224592delT								POM121L12 (119975 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53610661	53610662	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53610661_53610662delTG								POM121L12 (506044 upstream) : HPVC1 (658255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54661664	54661665	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54661664_54661665insA								VSTM2A (23477 upstream) : SEC61G (158276 downstream)																																			---	---	---	---
LANCL2	55915	broad.mit.edu	37	7	55473960	55473960	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55473960delA	uc003tqp.2	+							NM_018697	NP_061167			LanC lantibiotic synthetase component C-like 2						negative regulation of transcription, DNA-dependent|positive regulation of abscisic acid mediated signaling pathway	cortical actin cytoskeleton|cytosol|nucleus|plasma membrane	ATP binding|catalytic activity|GTP binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding			ovary(1)|skin(1)	2	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	55943326	55943327	+	IGR	INS	-	A	A	rs142691245		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55943326_55943327insA								SEPT14 (12844 upstream) : ZNF713 (11835 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56427602	56427602	+	IGR	DEL	T	-	-	rs112641651		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56427602delT								PSPH (243512 upstream) : DKFZp434L192 (136314 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57776385	57776386	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57776385_57776386insT								ZNF716 (243120 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57886274	57886275	+	IGR	INS	-	CCCA	CCCA	rs145944938	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57886274_57886275insCCCA								ZNF716 (353009 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61066549	61066550	+	IGR	INS	-	A	A	rs73121321	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61066549_61066550insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61754264	61754265	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61754264_61754265insA								None (None upstream) : LOC643955 (997407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61793234	61793234	+	IGR	DEL	T	-	-	rs113024867		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61793234delT								None (None upstream) : LOC643955 (958438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61825165	61825166	+	IGR	INS	-	CCGAC	CCGAC	rs143853348		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61825165_61825166insCCGAC								None (None upstream) : LOC643955 (926506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61894155	61894156	+	IGR	INS	-	A	A	rs147464603	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61894155_61894156insA								None (None upstream) : LOC643955 (857516 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62047542	62047542	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62047542delA								None (None upstream) : LOC643955 (704130 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62433051	62433052	+	IGR	INS	-	A	A	rs113642971		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62433051_62433052insA								None (None upstream) : LOC643955 (318620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63132747	63132748	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63132747_63132748delGT								LOC100287704 (320596 upstream) : ZNF727 (373073 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63556637	63556637	+	IGR	DEL	A	-	-	rs111721056		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63556637delA								ZNF727 (17712 upstream) : ZNF735 (110944 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63746528	63746529	+	IGR	INS	-	A	A	rs150553331	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63746528_63746529insA								ZNF679 (19228 upstream) : ZNF680 (233726 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64816856	64816856	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64816856delT								INTS4L1 (122257 upstream) : ZNF92 (21912 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64955508	64955509	+	IGR	INS	-	ACCAA	ACCAA	rs59274377		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64955508_64955509insACCAA								ZNF92 (89511 upstream) : INTS4L2 (157268 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65311618	65311619	+	IGR	INS	-	C	C	rs142359740	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65311618_65311619insC								CCT6P1 (82957 upstream) : VKORC1L1 (26638 downstream)																																			---	---	---	---
VKORC1L1	154807	broad.mit.edu	37	7	65387591	65387592	+	Intron	INS	-	A	A	rs149725969	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65387591_65387592insA	uc003tul.2	+						VKORC1L1_uc011kds.1_Intron	NM_173517	NP_775788			vitamin K epoxide reductase complex, subunit							integral to membrane					0		Lung NSC(55;0.197)			Menadione(DB00170)|Warfarin(DB00682)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	65832840	65832841	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65832840_65832841insT								TPST1 (7403 upstream) : NCRNA00174 (8191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65893975	65893985	+	IGR	DEL	TGTCTGGAACC	-	-	rs67892899		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65893975_65893985delTGTCTGGAACC								NCRNA00174 (28580 upstream) : LOC493754 (99461 downstream)																																			---	---	---	---
TYW1	55253	broad.mit.edu	37	7	66629671	66629672	+	Intron	INS	-	A	A	rs140831379	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66629671_66629672insA	uc003tvn.2	+						TYW1_uc010lai.2_Intron|TYW1_uc011kef.1_Intron	NM_018264	NP_060734			radical S-adenosyl methionine and flavodoxin						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	68240743	68240743	+	IGR	DEL	A	-	-	rs111888564		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68240743delA								None (None upstream) : AUTS2 (823162 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68431657	68431657	+	IGR	DEL	A	-	-	rs34179344		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68431657delA								None (None upstream) : AUTS2 (632248 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68599744	68599744	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68599744delC								None (None upstream) : AUTS2 (464161 downstream)																																			---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69082171	69082172	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69082171_69082172insA	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69112343	69112344	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69112343_69112344insT	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
WBSCR17	64409	broad.mit.edu	37	7	70796700	70796701	+	Intron	INS	-	A	A	rs150288327	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70796700_70796701insA	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924			UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)																---	---	---	---
CALN1	83698	broad.mit.edu	37	7	71768065	71768065	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71768065delA	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440			calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	72018086	72018087	+	IGR	INS	-	AAAACAAAAC	AAAACAAAAC	rs145900827	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72018086_72018087insAAAACAAAAC								CALN1 (105950 upstream) : TYW1B (5642 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	73058543	73058544	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73058543_73058544insT								MLXIPL (19673 upstream) : VPS37D (23630 downstream)																																			---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73562246	73562247	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73562246_73562247insT	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	73842734	73842734	+	IGR	DEL	T	-	-	rs146956423		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73842734delT								CLIP2 (22462 upstream) : GTF2IRD1 (25386 downstream)																																			---	---	---	---
RHBDD2	57414	broad.mit.edu	37	7	75506982	75506982	+	5'Flank	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75506982delT	uc003udw.1	+						RHBDD2_uc003udv.1_5'Flank	NM_001040456	NP_001035546			rhomboid domain containing 2 isoform a							integral to membrane	serine-type endopeptidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	77305676	77305676	+	Intron	DEL	T	-	-	rs113826906		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77305676delT	uc003ugj.1	-											Homo sapiens clone 124-1V1, mRNA sequence.																														---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78561828	78561828	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78561828delA	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	79250803	79250803	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79250803delA								MAGI2 (167913 upstream) : GNAI1 (513337 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	80712859	80712860	+	IGR	INS	-	TT	TT	rs113501132		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80712859_80712860insTT								SEMA3C (161184 upstream) : HGF (618585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	81202548	81202549	+	IGR	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81202548_81202549delTC								SEMA3C (650873 upstream) : HGF (128896 downstream)																																			---	---	---	---
CACNA2D1	781	broad.mit.edu	37	7	81914614	81914614	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81914614delC	uc003uhr.1	-							NM_000722	NP_000713			calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)													---	---	---	---
SEMA3A	10371	broad.mit.edu	37	7	83640744	83640744	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83640744delA	uc003uhz.2	-							NM_006080	NP_006071			semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	83858153	83858153	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83858153delC								SEMA3A (33936 upstream) : SEMA3D (766721 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	84277779	84277779	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84277779delC								SEMA3A (453562 upstream) : SEMA3D (347095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	84446630	84446633	+	IGR	DEL	CTTC	-	-	rs62474469	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84446630_84446633delCTTC								SEMA3A (622413 upstream) : SEMA3D (178241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85042838	85042838	+	IGR	DEL	A	-	-	rs144692129		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85042838delA								SEMA3D (226667 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85981545	85981546	+	IGR	DEL	AG	-	-	rs11347660		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85981545_85981546delAG								None (None upstream) : GRM3 (291684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	88043123	88043123	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88043123delA								STEAP4 (106914 upstream) : ZNF804B (345630 downstream)																																			---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90524648	90524649	+	Intron	INS	-	TCCTT	TCCTT	rs140781210	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90524648_90524649insTCCTT	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	90982921	90982921	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90982921delT								FZD1 (84790 upstream) : MTERF (448539 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	94462089	94462089	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94462089delA								PEG10 (163085 upstream) : PPP1R9A (74860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	97039070	97039071	+	IGR	INS	-	A	A	rs34727272		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97039070_97039071insA								ACN9 (227997 upstream) : TAC1 (322200 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	97476669	97476670	+	IGR	DEL	AA	-	-	rs34513155		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97476669_97476670delAA								TAC1 (106887 upstream) : ASNS (4773 downstream)																																			---	---	---	---
MGC72080	389538	broad.mit.edu	37	7	97589261	97589262	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97589261_97589262delCA	uc010lfp.1	-											Homo sapiens cDNA, FLJ99734.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	98385383	98385383	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98385383delC								NPTX2 (126202 upstream) : TMEM130 (58729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	98414870	98414871	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98414870_98414871delGT								NPTX2 (155689 upstream) : TMEM130 (29241 downstream)																																			---	---	---	---
C7orf59	389541	broad.mit.edu	37	7	99746445	99746445	+	5'Flank	DEL	G	-	-	rs58185311		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99746445delG	uc003utq.2	+							NM_001008395	NP_001008396			hypothetical protein LOC389541												0																		---	---	---	---
ZAN	7455	broad.mit.edu	37	7	100367814	100367814	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100367814delT	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron|ZAN_uc011kkd.1_Intron	NM_003386	NP_003377			zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)															---	---	---	---
SERPINE1	5054	broad.mit.edu	37	7	100777827	100777827	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100777827delT	uc003uxt.2	+						SERPINE1_uc011kkj.1_Intron|SERPINE1_uc003uxu.1_3'UTR	NM_000602	NP_000593			plasminogen activator inhibitor-1 isoform 1						angiogenesis|cellular response to chemical stimulus|cellular response to lipopolysaccharide|chronological cell aging|defense response to Gram-negative bacterium|fibrinolysis|negative regulation of apoptosis|negative regulation of cell adhesion mediated by integrin|negative regulation of fibrinolysis|negative regulation of plasminogen activation|negative regulation of smooth muscle cell migration|negative regulation of smooth muscle cell-matrix adhesion|negative regulation of vascular wound healing|platelet activation|platelet degranulation|positive regulation of angiogenesis|positive regulation of interleukin-8 production|positive regulation of leukotriene production involved in inflammatory response|positive regulation of monocyte chemotaxis|positive regulation of receptor-mediated endocytosis|regulation of receptor activity	extracellular matrix|extracellular space|plasma membrane|platelet alpha granule lumen	protease binding|serine-type endopeptidase inhibitor activity			ovary(1)|lung(1)|central_nervous_system(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)				Atorvastatin(DB01076)|Dimethyl sulfoxide(DB01093)|Drotrecogin alfa(DB00055)|Simvastatin(DB00641)|Tenecteplase(DB00031)|Troglitazone(DB00197)|Urokinase(DB00013)													---	---	---	---
VGF	7425	broad.mit.edu	37	7	100811300	100811301	+	5'Flank	INS	-	T	T	rs59001268		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100811300_100811301insT	uc003uxx.3	-							NM_003378	NP_003369			VGF nerve growth factor inducible precursor						response to cAMP	extracellular space|transport vesicle	growth factor activity				0	Lung NSC(181;0.168)|all_lung(186;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	100956636	100956636	+	IGR	DEL	T	-	-	rs79547911		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100956636delT								FIS1 (61043 upstream) : RABL5 (13 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	100988355	100988355	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100988355delT								RABL5 (23262 upstream) : EMID2 (17767 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	101276374	101276374	+	IGR	DEL	T	-	-	rs11324652		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101276374delT								MYL10 (3798 upstream) : CUX1 (182918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	101444136	101444136	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101444136delT								MYL10 (171560 upstream) : CUX1 (15156 downstream)																																			---	---	---	---
RASA4	10156	broad.mit.edu	37	7	102232285	102232285	+	Intron	DEL	T	-	-	rs144691366		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102232285delT	uc003vae.2	-						UPK3BL_uc003uzy.2_Intron|RASA4_uc011kla.1_Intron|RASA4_uc010lig.2_Intron|RASA4_uc003vaf.2_Intron|RASA4_uc011klb.1_Intron|RASA4_uc010lih.2_Intron|RASA4_uc011kld.1_Intron|uc003vag.1_5'Flank|RASA4_uc011kkz.1_Intron|RASA4_uc003vad.2_Intron|RASA4_uc011klc.1_Intron|uc010lii.1_5'Flank	NM_006989	NP_008920			RAS p21 protein activator 4 isoform 1						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytosol|intrinsic to internal side of plasma membrane	metal ion binding|Ras GTPase activator activity				0																		---	---	---	---
RELN	5649	broad.mit.edu	37	7	103292699	103292699	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103292699delT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036			reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	104573421	104573422	+	IGR	DEL	AC	-	-	rs35801381		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104573421_104573422delAC								LOC723809 (6329 upstream) : LOC100216545 (77567 downstream)																																			---	---	---	---
ATXN7L1	222255	broad.mit.edu	37	7	105505076	105505077	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105505076_105505077insT	uc003vde.2	-						ATXN7L1_uc003vdi.2_Intron	NM_020725	NP_065776			ataxin 7-like 1 isoform 1												0																		---	---	---	---
SLC26A3	1811	broad.mit.edu	37	7	107427059	107427059	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107427059delA	uc003ver.2	-						SLC26A3_uc003ves.2_Intron	NM_000111	NP_000102			solute carrier family 26, member 3						excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4																		---	---	---	---
LAMB4	22798	broad.mit.edu	37	7	107720508	107720508	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107720508delA	uc010ljo.1	-						LAMB4_uc003vey.2_Intron	NM_007356	NP_031382			laminin, beta 4 precursor						cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	109063880	109063880	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109063880delT								C7orf66 (539243 upstream) : EIF3IP1 (535404 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109198270	109198270	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109198270delC								C7orf66 (673633 upstream) : EIF3IP1 (401014 downstream)																																			---	---	---	---
DOCK4	9732	broad.mit.edu	37	7	111573871	111573871	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111573871delG	uc003vfx.2	-						DOCK4_uc003vfy.2_Intron|DOCK4_uc003vga.1_Intron	NM_014705	NP_055520			dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)																---	---	---	---
FOXP2	93986	broad.mit.edu	37	7	113937110	113937110	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113937110delT	uc003vgv.1	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgt.1_Intron	NM_014491	NP_055306			forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8																		---	---	---	---
CAV1	857	broad.mit.edu	37	7	116138978	116138979	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116138978_116138979delAC	uc010lkd.1	+						CAV2_uc003vhv.2_Intron|CAV2_uc003vhw.2_Intron|CAV2_uc003vhx.2_Intron|CAV2_uc010lkb.1_Intron|CAV2_uc010lkc.2_Intron|CAV2_uc003vib.2_Intron|CAV2_uc003vhz.2_Intron|CAV2_uc003via.2_Intron|CAV1_uc010lke.1_Intron|CAV2_uc003vid.2_5'Flank|CAV2_uc003vie.2_5'Flank	NM_001753	NP_001744			caveolin 1						blood coagulation|calcium ion transport|caveola assembly|cellular response to starvation|cholesterol homeostasis|cytosolic calcium ion homeostasis|inactivation of MAPK activity|interspecies interaction between organisms|leukocyte migration|lipid storage|maintenance of protein location in cell|mammary gland involution|membrane depolarization|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of endothelial cell proliferation|negative regulation of epithelial cell differentiation|negative regulation of nitric oxide biosynthetic process|negative regulation of peptidyl-serine phosphorylation|negative regulation of protein binding|negative regulation of transcription from RNA polymerase II promoter|nitric oxide homeostasis|nitric oxide metabolic process|positive regulation of calcium ion transport into cytosol|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of metalloenzyme activity|positive regulation of peptidyl-serine phosphorylation|positive regulation of vasoconstriction|protein homooligomerization|receptor internalization|regulation of blood coagulation|regulation of fatty acid metabolic process|regulation of nitric-oxide synthase activity|regulation of smooth muscle contraction|response to calcium ion|response to estrogen stimulus|response to hypoxia|response to progesterone stimulus|skeletal muscle tissue development|T cell costimulation|triglyceride metabolic process|vasculogenesis|vesicle organization	apical plasma membrane|basolateral plasma membrane|caveola|caveola|cytosol|endoplasmic reticulum|endosome|Golgi membrane|lipid particle|perinuclear region of cytoplasm	cholesterol binding|nitric-oxide synthase binding|peptidase activator activity|protein binding|protein complex scaffold|receptor binding				0	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)													OREG0003444	type=REGULATORY REGION|Gene=CAV2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---
Unknown	0	broad.mit.edu	37	7	118227323	118227324	+	IGR	INS	-	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118227323_118227324insC								ANKRD7 (344541 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118664695	118664696	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118664695_118664696insT								ANKRD7 (781913 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118808453	118808453	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118808453delT								ANKRD7 (925671 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	119469615	119469616	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119469615_119469616delGT								None (None upstream) : KCND2 (444106 downstream)																																			---	---	---	---
C7orf58	79974	broad.mit.edu	37	7	120915991	120915991	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120915991delA	uc003vjq.3	+							NM_024913	NP_079189			hypothetical protein LOC79974 isoform 1							endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	123228733	123228734	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123228733_123228734insT								NDUFA5 (30775 upstream) : ASB15 (13187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	123637630	123637631	+	Intron	DEL	TG	-	-	rs77195982		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123637630_123637631delTG	uc003vlg.2	+						uc010lkv.1_Intron					Homo sapiens cDNA clone IMAGE:5301388.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	125269996	125269997	+	IGR	INS	-	GAG	GAG	rs142585045	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125269996_125269997insGAG								POT1 (699959 upstream) : GRM8 (808655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	125728537	125728538	+	IGR	DEL	GT	-	-	rs71960674		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125728537_125728538delGT								None (None upstream) : GRM8 (350114 downstream)																																			---	---	---	---
GRM8	2918	broad.mit.edu	37	7	126224281	126224282	+	Intron	INS	-	T	T	rs147591844	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126224281_126224282insT	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron	NM_000845	NP_000836			glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)										HNSCC(24;0.065)			---	---	---	---
GRM8	2918	broad.mit.edu	37	7	126369083	126369084	+	Intron	DEL	TT	-	-	rs35670237		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126369083_126369084delTT	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron|GRM8_uc003vlu.1_Intron	NM_000845	NP_000836			glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)										HNSCC(24;0.065)			---	---	---	---
METTL2B	55798	broad.mit.edu	37	7	128137876	128137876	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128137876delT	uc003vnf.2	+						METTL2B_uc003vng.2_Intron|METTL2B_uc011kop.1_Intron	NM_018396	NP_060866			methyltransferase like 2B								methyltransferase activity			skin(1)	1																		---	---	---	---
KCP	375616	broad.mit.edu	37	7	128528089	128528090	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128528089_128528090delAC	uc011kor.1	-							NM_001135914	NP_001129386			cysteine rich BMP regulator 2 isoform 1							extracellular region				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	129792287	129792288	+	IGR	INS	-	CA	CA	rs145940720	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129792287_129792288insCA								KLHDC10 (18694 upstream) : TMEM209 (12267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	129796107	129796110	+	IGR	DEL	CTTT	-	-	rs71527949		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129796107_129796110delCTTT								KLHDC10 (22514 upstream) : TMEM209 (8445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	129966734	129966734	+	IGR	DEL	T	-	-	rs113700161		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129966734delT								CPA4 (2715 upstream) : CPA5 (17896 downstream)																																			---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	132247713	132247715	+	Intron	DEL	TCT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132247713_132247715delTCT	uc003vra.3	-						PLXNA4_uc003vrc.2_Intron|PLXNA4_uc003vrb.2_Intron	NM_020911	NP_065962			plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
LRGUK	136332	broad.mit.edu	37	7	133909452	133909452	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133909452delA	uc003vrm.1	+							NM_144648	NP_653249			leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5																		---	---	---	---
CALD1	800	broad.mit.edu	37	7	134592177	134592177	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134592177delA	uc003vrz.2	+						CALD1_uc003vry.2_Intron|CALD1_uc003vsa.2_Intron|CALD1_uc003vsb.2_Intron|CALD1_uc010lmm.2_Intron|CALD1_uc011kpt.1_Intron|CALD1_uc003vsc.2_Intron|CALD1_uc003vsd.2_Intron	NM_033138	NP_149129			caldesmon 1 isoform 1						cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	136419392	136419392	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136419392delA								LUZP6 (757188 upstream) : CHRM2 (134007 downstream)																																			---	---	---	---
PTN	5764	broad.mit.edu	37	7	137019878	137019879	+	Intron	INS	-	T	T	rs145417371		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137019878_137019879insT	uc003vtq.2	-						PTN_uc010lmx.2_Intron|PTN_uc003vtr.1_Intron	NM_002825	NP_002816			pleiotrophin						nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	138368153	138368153	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138368153delC								SVOPL (4363 upstream) : ATP6V0A4 (22887 downstream)																																			---	---	---	---
TBXAS1	6916	broad.mit.edu	37	7	139604857	139604858	+	Intron	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139604857_139604858delTC	uc011kqv.1	+						TBXAS1_uc003vvh.2_Intron|TBXAS1_uc010lne.2_Intron|TBXAS1_uc011kqu.1_Intron|TBXAS1_uc003vvi.2_Intron|TBXAS1_uc003vvj.2_Intron|TBXAS1_uc011kqw.1_Intron|TBXAS1_uc011kqx.1_Intron	NM_001130966	NP_001124438			thromboxane A synthase 1, platelet isoform						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)																	---	---	---	---
PARP12	64761	broad.mit.edu	37	7	139764349	139764350	+	5'Flank	DEL	AA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139764349_139764350delAA	uc003vvl.1	-						PARP12_uc010lnf.1_5'Flank	NM_022750	NP_073587			poly ADP-ribose polymerase 12							nucleus	NAD+ ADP-ribosyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)	3	Melanoma(164;0.0142)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	140864538	140864538	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140864538delA								MRPS33 (149757 upstream) : AGK (386540 downstream)																																			---	---	---	---
KIAA1147	57189	broad.mit.edu	37	7	141387264	141387265	+	Intron	DEL	TT	-	-	rs75166976		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141387264_141387265delTT	uc003vwk.2	-							NM_001080392	NP_001073861			hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	142244830	142244830	+	Intron	DEL	A	-	-	rs56725566		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142244830delA	uc011krp.1	+						uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron|uc011kse.1_Intron|uc003vye.2_RNA					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	143281588	143281588	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143281588delT								LOC441294 (10345 upstream) : FAM115C (36457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	143543892	143543892	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143543892delC								LOC154761 (10082 upstream) : FAM115A (6157 downstream)																																			---	---	---	---
OR2A9P	441295	broad.mit.edu	37	7	144049976	144049977	+	Intron	DEL	AG	-	-	rs5888130		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144049976_144049977delAG	uc003wec.1	-						ARHGEF5_uc003wek.2_5'Flank|ARHGEF5_uc003wel.2_5'Flank					SubName: Full=Seven transmembrane helix receptor;												0																		---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147678879	147678880	+	Intron	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147678879_147678880delGT	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152105101	152105101	+	Intron	DEL	G	-	-	rs5888473		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152105101delG	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152110681	152110681	+	Intron	DEL	A	-	-	rs66519558		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152110681delA	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154061474	154061474	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154061474delC	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron|DPP6_uc010lqh.1_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154469820	154469821	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154469820_154469821insA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154674760	154674771	+	Intron	DEL	TGCTCACACATT	-	-	rs61723982		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154674760_154674771delTGCTCACACATT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154675938	154675939	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154675938_154675939delCA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	155121334	155121335	+	IGR	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155121334_155121335delCT								INSIG1 (19392 upstream) : EN2 (129489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155128171	155128171	+	IGR	DEL	G	-	-	rs78957141		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155128171delG								INSIG1 (26229 upstream) : EN2 (122653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	155709296	155709296	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155709296delA								SHH (104329 upstream) : C7orf4 (623889 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	156030572	156030573	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156030572_156030573delTG								SHH (425605 upstream) : C7orf4 (302612 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	156152281	156152281	+	IGR	DEL	T	-	-	rs34437239		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156152281delT								SHH (547314 upstream) : C7orf4 (180904 downstream)																																			---	---	---	---
NOM1	64434	broad.mit.edu	37	7	156745829	156745830	+	Intron	INS	-	TT	TT	rs55948664		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156745829_156745830insTT	uc003wmy.2	+							NM_138400	NP_612409			nucleolar protein with MIF4G domain 1						RNA metabolic process	nucleolus	protein binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157924072	157924077	+	Intron	DEL	ACTCAT	-	-	rs78325217		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157924072_157924077delACTCAT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	158036938	158036939	+	Intron	INS	-	AGGAAA	AGGAAA	rs146087801	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158036938_158036939insAGGAAA	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	158037241	158037242	+	Intron	INS	-	TG	TG	rs147719844	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158037241_158037242insTG	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
WDR60	55112	broad.mit.edu	37	7	158665324	158665324	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158665324delA	uc003woe.3	+							NM_018051	NP_060521			WD repeat domain 60											ovary(2)|breast(1)|central_nervous_system(1)	4	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	2896807	2896807	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2896807delT	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
MCPH1	79648	broad.mit.edu	37	8	6399813	6399814	+	Intron	DEL	GT	-	-	rs113553124	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6399813_6399814delGT	uc003wqi.2	+						ANGPT2_uc003wqj.3_Intron|ANGPT2_uc003wqk.3_Intron|ANGPT2_uc010lri.2_Intron|ANGPT2_uc003wql.3_Intron	NM_024596	NP_078872			microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	9379979	9379979	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9379979delT								PPP1R3B (370895 upstream) : TNKS (33466 downstream)																																			---	---	---	---
BLK	640	broad.mit.edu	37	8	11384984	11384984	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11384984delT	uc003wty.2	+						BLK_uc003wtz.2_Intron	NM_001715	NP_001706			B lymphoid tyrosine kinase						intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)														---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12397047	12397050	+	Intron	DEL	GTAC	-	-	rs78070613		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12397047_12397050delGTAC	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	12443687	12443688	+	Intron	INS	-	GGGTGGAT	GGGTGGAT	rs113126637	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12443687_12443688insGGGTGGAT	uc003wvy.3	-											Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	12448061	12448061	+	Intron	DEL	T	-	-	rs147215813		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12448061delT	uc003wvy.3	-											Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	16408738	16408739	+	IGR	DEL	AT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16408738_16408739delAT								MSR1 (358438 upstream) : FGF20 (441595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	20507752	20507752	+	IGR	DEL	T	-	-	rs11356171		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20507752delT								LZTS1 (394949 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	22404841	22404841	+	5'Flank	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22404841delT	uc003xbu.1	-											Homo sapiens cDNA FLJ43872 fis, clone TESTI4008417.																														---	---	---	---
DOCK5	80005	broad.mit.edu	37	8	25162347	25162347	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25162347delG	uc003xeg.2	+						DOCK5_uc010luf.1_Intron|DOCK5_uc003xeh.1_Intron|DOCK5_uc003xef.2_3'UTR	NM_024940	NP_079216			dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)														---	---	---	---
PPP2R2A	5520	broad.mit.edu	37	8	25424745	25424746	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25424745_25424746insA	uc003xek.2	+							NM_002717	NP_002708			alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	26985619	26985620	+	IGR	INS	-	AAAG	AAAG	rs145644126	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26985619_26985620insAAAG								MIR548H-4 (79139 upstream) : STMN4 (108196 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	27045609	27045609	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27045609delT								MIR548H-4 (139129 upstream) : STMN4 (48207 downstream)																																			---	---	---	---
STMN4	81551	broad.mit.edu	37	8	27097924	27097927	+	Intron	DEL	TCAT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27097924_27097927delTCAT	uc003xfk.2	-						STMN4_uc003xfj.2_Intron|STMN4_uc011lai.1_Intron|STMN4_uc011laj.1_Intron|STMN4_uc011lak.1_Intron|STMN4_uc010luo.2_Intron					RecName: Full=Stathmin-4; AltName: Full=Stathmin-like protein B3;          Short=RB3;						intracellular signal transduction					large_intestine(1)|pancreas(1)	2		Ovarian(32;0.00167)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0214)|Epithelial(17;9.82e-10)|Colorectal(74;0.142)														---	---	---	---
PTK2B	2185	broad.mit.edu	37	8	27245952	27245953	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27245952_27245953insA	uc003xfn.1	+						PTK2B_uc003xfo.1_Intron|PTK2B_uc003xfp.1_Intron|PTK2B_uc003xfq.1_Intron	NM_173174	NP_775266			PTK2B protein tyrosine kinase 2 beta isoform a						apoptosis|bone resorption|positive regulation of cell proliferation|signal complex assembly	cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|signal transducer activity			lung(3)|ovary(1)|skin(1)	5		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	27345608	27345609	+	IGR	INS	-	TA	TA	rs141526916	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27345608_27345609insTA								CHRNA2 (8795 upstream) : EPHX2 (3036 downstream)																																			---	---	---	---
SCARA3	51435	broad.mit.edu	37	8	27506307	27506310	+	Intron	DEL	AAAG	-	-	rs67890750		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27506307_27506310delAAAG	uc003xga.1	+						SCARA3_uc003xgb.1_Intron	NM_016240	NP_057324			scavenger receptor class A, member 3 isoform 1						response to oxidative stress|UV protection	collagen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	scavenger receptor activity			skin(2)|ovary(1)|breast(1)	4		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Colorectal(74;0.148)														---	---	---	---
ESCO2	157570	broad.mit.edu	37	8	27666035	27666035	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27666035delA	uc010luy.1	+											Homo sapiens clone 305-4G mRNA sequence.						cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding			central_nervous_system(1)	1		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|KIRC - Kidney renal clear cell carcinoma(542;0.0955)|Kidney(114;0.115)|Colorectal(74;0.132)										SC_Phocomelia_syndrome				---	---	---	---
FZD3	7976	broad.mit.edu	37	8	28383425	28383426	+	Intron	INS	-	G	G	rs147983445	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28383425_28383426insG	uc003xgx.2	+						FZD3_uc010lvb.2_Intron	NM_017412	NP_059108			frizzled 3 precursor						canonical Wnt receptor signaling pathway|cell proliferation in midbrain|commissural neuron axon guidance|establishment of planar polarity|facial nucleus development|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|neural tube closure|vasculature development	apical part of cell|axon|cytoplasm|dendrite|integral to membrane|neuron projection membrane|neuronal cell body|presynaptic active zone	G-protein coupled receptor activity|PDZ domain binding|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	29289887	29289888	+	IGR	INS	-	CTT	CTT			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29289887_29289888insCTT								DUSP4 (81702 upstream) : C8orf75 (288890 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	29520991	29520991	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29520991delG								DUSP4 (312806 upstream) : C8orf75 (57787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	29866878	29866880	+	IGR	DEL	CCA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29866878_29866880delCCA								LOC286135 (55757 upstream) : TMEM66 (53752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	30123884	30123884	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30123884delC								DCTN6 (82825 upstream) : RBPMS (118060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	30836787	30836787	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30836787delT								TEX15 (90565 upstream) : PURG (16534 downstream)																																			---	---	---	---
WRN	7486	broad.mit.edu	37	8	30970722	30970722	+	Intron	DEL	A	-	-	rs71771146		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30970722delA	uc003xio.3	+						WRN_uc010lvk.2_Intron	NM_000553	NP_000544			Werner syndrome protein						base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)				Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	8	31076328	31076328	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31076328delA								WRN (45052 upstream) : NRG1 (420940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	31327746	31327747	+	IGR	INS	-	A	A	rs149699308	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31327746_31327747insA								WRN (296470 upstream) : NRG1 (169521 downstream)																																			---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32335780	32335781	+	Intron	INS	-	G	G	rs138725404	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32335780_32335781insG	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	33795962	33795963	+	IGR	INS	-	T	T	rs151028985	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33795962_33795963insT								DUSP26 (338523 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34102563	34102564	+	IGR	DEL	AT	-	-	rs146014888		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34102563_34102564delAT								DUSP26 (645124 upstream) : UNC5D (990411 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34842712	34842712	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34842712delG								None (None upstream) : UNC5D (250263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	36518238	36518238	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36518238delT								UNC5D (866058 upstream) : KCNU1 (123604 downstream)																																			---	---	---	---
KCNU1	157855	broad.mit.edu	37	8	36771119	36771119	+	Intron	DEL	T	-	-	rs11331239		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36771119delT	uc010lvw.2	+						KCNU1_uc003xjw.2_Intron	NM_001031836	NP_001027006			potassium channel, subfamily U, member 1							voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	38080210	38080210	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38080210delT								BAG4 (11673 upstream) : DDHD2 (8799 downstream)																																			---	---	---	---
DDHD2	23259	broad.mit.edu	37	8	38093846	38093846	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38093846delT	uc003xlb.2	+						DDHD2_uc003xla.2_Intron|DDHD2_uc003xlc.2_Intron|DDHD2_uc011lbl.1_Intron	NM_015214	NP_056029			DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	38360074	38360075	+	IGR	DEL	GA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38360074_38360075delGA								FGFR1 (33722 upstream) : C8orf86 (8277 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	40237123	40237124	+	IGR	INS	-	T	T	rs112627085		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40237123_40237124insT								C8orf4 (224302 upstream) : ZMAT4 (150992 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	40997633	40997634	+	IGR	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40997633_40997634delTC								ZMAT4 (242290 upstream) : SFRP1 (121845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	41306366	41306369	+	IGR	DEL	TAGG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41306366_41306369delTAGG								SFRP1 (139386 upstream) : GOLGA7 (41712 downstream)																																			---	---	---	---
HOOK3	84376	broad.mit.edu	37	8	42870279	42870280	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42870279_42870280insA	uc003xpr.2	+							NM_032410	NP_115786			golgi-associated microtubule-binding protein						cytoplasmic microtubule organization|early endosome to late endosome transport|endosome organization|endosome to lysosome transport|Golgi localization|interkinetic nuclear migration|lysosome organization|microtubule anchoring|negative regulation of neurogenesis|protein localization to centrosome|protein transport	cis-Golgi network|FHF complex|microtubule|pericentriolar material	identical protein binding|microtubule binding			ovary(1)|breast(1)	2	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)					T	RET	papillary thyroid								---	---	---	---
Unknown	0	broad.mit.edu	37	8	43776401	43776401	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43776401delA								POTEA (558073 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	47094650	47094650	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47094650delC								None (None upstream) : BEYLA (657858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	49873460	49873461	+	IGR	INS	-	T	T	rs147967339	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49873460_49873461insT								SNAI2 (39472 upstream) : C8orf22 (111442 downstream)																																			---	---	---	---
SNTG1	54212	broad.mit.edu	37	8	51699531	51699532	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51699531_51699532insA	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840			syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	51966617	51966618	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51966617_51966618delTG								SNTG1 (261190 upstream) : PXDNL (265526 downstream)																																			---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52413907	52413908	+	Intron	DEL	CT	-	-	rs10583891		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52413907_52413908delCT	uc003xqu.3	-							NM_144651	NP_653252			peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
ST18	9705	broad.mit.edu	37	8	53037991	53037992	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53037991_53037992delAC	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron	NM_014682	NP_055497			suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)																---	---	---	---
ST18	9705	broad.mit.edu	37	8	53040535	53040536	+	Intron	INS	-	T	T	rs11393476		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53040535_53040536insT	uc003xqz.2	-						ST18_uc011ldq.1_Intron|ST18_uc011ldr.1_Intron|ST18_uc011lds.1_Intron|ST18_uc003xra.2_Intron	NM_014682	NP_055497			suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)																---	---	---	---
ST18	9705	broad.mit.edu	37	8	53297346	53297347	+	Intron	INS	-	GT	GT	rs147007096	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53297346_53297347insGT	uc003xra.2	-						ST18_uc003xrb.2_Intron|ST18_uc010lyb.2_Intron	NM_014682	NP_055497			suppression of tumorigenicity 18							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	54100134	54100134	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54100134delA								NPBWR1 (246681 upstream) : OPRK1 (38142 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	54317559	54317559	+	IGR	DEL	A	-	-	rs35019858		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54317559delA								OPRK1 (153365 upstream) : ATP6V1H (310557 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	55097200	55097200	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55097200delA								MRPL15 (36126 upstream) : SOX17 (273295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	55771902	55771903	+	IGR	INS	-	GGTGTC	GGTGTC	rs151039855	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55771902_55771903insGGTGTC								RP1 (89371 upstream) : XKR4 (243114 downstream)																																			---	---	---	---
LYN	4067	broad.mit.edu	37	8	56860540	56860540	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56860540delT	uc003xsk.3	+						LYN_uc003xsl.3_Intron	NM_002350	NP_002341			Yamaguchi sarcoma viral (v-yes-1) oncogene						erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	58165966	58165967	+	IGR	INS	-	AGAG	AGAG	rs140629767	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58165966_58165967insAGAG								IMPAD1 (259539 upstream) : C8orf71 (26135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	58765413	58765414	+	IGR	INS	-	CA	CA	rs142434643	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58765413_58765414insCA								C8orf71 (568125 upstream) : FAM110B (141699 downstream)																																			---	---	---	---
FAM110B	90362	broad.mit.edu	37	8	58912717	58912717	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58912717delG	uc003xtj.1	+							NM_147189	NP_671722			hypothetical protein LOC90362							microtubule organizing center|mitochondrion|nucleus				large_intestine(1)	1		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)																---	---	---	---
ASPH	444	broad.mit.edu	37	8	62474948	62474949	+	Intron	INS	-	TCTGTGTGTGTG	TCTGTGTGTGTG	rs150312211	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62474948_62474949insTCTGTGTGTGTG	uc003xuj.2	-						ASPH_uc011leg.1_Intron	NM_004318	NP_004309			aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)													---	---	---	---
NKAIN3	286183	broad.mit.edu	37	8	63225383	63225383	+	Intron	DEL	A	-	-	rs67703257		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63225383delA	uc010lyq.1	+							NM_173688	NP_775959			Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)																---	---	---	---
NKAIN3	286183	broad.mit.edu	37	8	63330763	63330763	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63330763delC	uc010lyq.1	+							NM_173688	NP_775959			Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	66494596	66494598	+	IGR	DEL	GGA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66494596_66494598delGGA								CYP7B1 (783248 upstream) : ARMC1 (20474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	67209521	67209522	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67209521_67209522delGT								CRH (118823 upstream) : RRS1 (131741 downstream)																																			---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69040676	69040677	+	Intron	INS	-	G	G	rs141994323	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69040676_69040677insG	uc003xxv.1	+							NM_024870	NP_079146			DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	72107313	72107314	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72107313_72107314insA								XKR9 (459137 upstream) : EYA1 (2356 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	74058462	74058463	+	IGR	INS	-	A	A	rs144060627	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74058462_74058463insA								C8orf84 (52955 upstream) : RPL7 (144412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	74193729	74193731	+	IGR	DEL	AAT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74193729_74193731delAAT								C8orf84 (188222 upstream) : RPL7 (9144 downstream)																																			---	---	---	---
STAU2	27067	broad.mit.edu	37	8	74587605	74587606	+	Intron	INS	-	AC	AC	rs143781202	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74587605_74587606insAC	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron|STAU2_uc003xzo.2_Intron|STAU2_uc003xzp.2_Intron|STAU2_uc011lfi.1_Intron|STAU2_uc003xzq.2_Intron|STAU2_uc010lzk.2_Intron|STAU2_uc010lzl.1_Intron|STAU2_uc003xzs.2_Intron|STAU2_uc003xzr.2_Intron	NM_014393	NP_055208			staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)															---	---	---	---
UBE2W	55284	broad.mit.edu	37	8	74730291	74730291	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74730291delT	uc003xzv.2	-						UBE2W_uc003xzt.2_Intron|UBE2W_uc003xzu.2_Intron|UBE2W_uc003xzw.2_Intron	NM_018299	NP_060769			ubiquitin-conjugating enzyme E2W (putative)						protein K11-linked ubiquitination|protein monoubiquitination		ATP binding|protein binding|ubiquitin-protein ligase activity				0	Breast(64;0.0311)		Epithelial(68;0.0235)|all cancers(69;0.0687)|BRCA - Breast invasive adenocarcinoma(89;0.069)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	74856472	74856472	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74856472delA								UBE2W (65362 upstream) : TCEB1 (2162 downstream)																																			---	---	---	---
JPH1	56704	broad.mit.edu	37	8	75198802	75198803	+	Intron	DEL	CT	-	-	rs143345541		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75198802_75198803delCT	uc003yae.2	-						JPH1_uc003yaf.2_Intron|JPH1_uc003yag.1_Intron	NM_020647	NP_065698			junctophilin 1						calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane				ovary(1)	1	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)															---	---	---	---
GDAP1	54332	broad.mit.edu	37	8	75275020	75275021	+	Intron	INS	-	C	C	rs147679120		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75275020_75275021insC	uc003yah.2	+						GDAP1_uc011lfj.1_Intron|GDAP1_uc003yai.2_Intron	NM_018972	NP_061845			ganglioside-induced differentiation-associated							cytoplasm					0	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	77273325	77273327	+	IGR	DEL	CTC	-	-	rs145800587		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77273325_77273327delCTC								HNF4G (794266 upstream) : LOC100192378 (249788 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	79410141	79410142	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:79410141_79410142delTG								None (None upstream) : PKIA (18194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	80195408	80195408	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80195408delT								IL7 (477650 upstream) : STMN2 (327972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	80370915	80370916	+	IGR	INS	-	AG	AG			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80370915_80370916insAG								IL7 (653157 upstream) : STMN2 (152464 downstream)																																			---	---	---	---
PAG1	55824	broad.mit.edu	37	8	81982004	81982004	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81982004delA	uc003ybz.2	-							NM_018440	NP_060910			phosphoprotein associated with glycosphingolipid						epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity				0	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	82509266	82509271	+	IGR	DEL	ACACAC	-	-	rs112223098		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82509266_82509271delACACAC								FABP12 (65716 upstream) : IMPA1 (59880 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	83073447	83073448	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83073447_83073448delGT								SNX16 (318926 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84062451	84062452	+	IGR	DEL	AA	-	-	rs113355377		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84062451_84062452delAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84673196	84673196	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84673196delA								None (None upstream) : RALYL (422257 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84836534	84836534	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84836534delT								None (None upstream) : RALYL (258919 downstream)																																			---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85832988	85832989	+	Intron	INS	-	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85832988_85832989insC	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron|RALYL_uc003ycu.3_Intron|RALYL_uc003ycv.3_Intron	NM_001100392	NP_001093862			RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	86078116	86078117	+	IGR	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86078116_86078117delCT								LRRCC1 (19804 upstream) : E2F5 (11502 downstream)																																			---	---	---	---
ATP6V0D2	245972	broad.mit.edu	37	8	87113376	87113376	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87113376delA	uc003ydp.1	+							NM_152565	NP_689778			ATPase, H+ transporting, lysosomal 38kDa, V0						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	apical plasma membrane|endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex	hydrogen ion transmembrane transporter activity|protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	87172818	87172819	+	IGR	INS	-	GTTT	GTTT	rs145361329	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87172818_87172819insGTTT								ATP6V0D2 (6364 upstream) : SLC7A13 (53469 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	88756737	88756738	+	IGR	INS	-	TT	TT	rs148537266	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88756737_88756738insTT								CNBD1 (361782 upstream) : DCAF4L2 (126235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	90701141	90701141	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90701141delA								None (None upstream) : RIPK2 (68834 downstream)																																			---	---	---	---
LRRC69	100130742	broad.mit.edu	37	8	92212823	92212823	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92212823delT	uc010mal.1	+						LRRC69_uc003yev.1_Intron|LRRC69_uc003yew.1_Intron	NM_001129890	NP_001123362			leucine rich repeat containing 69												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	94410139	94410140	+	IGR	INS	-	CA	CA	rs144209952	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94410139_94410140insCA								C8orf83 (380238 upstream) : FAM92A1 (302633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	95249062	95249062	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95249062delT								CDH17 (19531 upstream) : GEM (12425 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	96107422	96107422	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96107422delT								C8orf38 (19026 upstream) : PLEKHF2 (38616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	96721697	96721697	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96721697delT								C8orf37 (440260 upstream) : GDF6 (432863 downstream)																																			---	---	---	---
PTDSS1	9791	broad.mit.edu	37	8	97323767	97323768	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97323767_97323768delTG	uc003yht.1	+						PTDSS1_uc003yhu.1_Intron	NM_014754	NP_055569			phosphatidylserine synthase 1						phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	101387757	101387758	+	IGR	INS	-	AT	AT	rs34422857		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101387757_101387758insAT								RNF19A (65430 upstream) : ANKRD46 (134229 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	101439056	101439057	+	IGR	INS	-	AT	AT			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101439056_101439057insAT								RNF19A (116729 upstream) : ANKRD46 (82930 downstream)																																			---	---	---	---
NCALD	83988	broad.mit.edu	37	8	103072712	103072712	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103072712delT	uc003ykf.2	-						NCALD_uc003ykg.2_Intron|NCALD_uc003ykh.2_Intron|NCALD_uc003yki.2_Intron|NCALD_uc003ykj.2_Intron|NCALD_uc003ykk.2_Intron|NCALD_uc003ykl.2_Intron	NM_001040628	NP_001035718			neurocalcin delta						synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	104014107	104014107	+	IGR	DEL	G	-	-	rs35550826		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104014107delG								AZIN1 (137710 upstream) : ATP6V1C1 (19141 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	105654271	105654271	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105654271delC								LRP12 (53051 upstream) : ZFPM2 (676876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	106141387	106141387	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106141387delA								LRP12 (540167 upstream) : ZFPM2 (189760 downstream)																																			---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106602990	106602991	+	Intron	INS	-	CA	CA	rs138719110	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106602990_106602991insCA	uc003ymd.2	+							NM_012082	NP_036214			zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	109267393	109267405	+	IGR	DEL	CCTAGAAGTCAAA	-	-	rs149317071		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109267393_109267405delCCTAGAAGTCAAA								EIF3E (6434 upstream) : TTC35 (188448 downstream)																																			---	---	---	---
TMEM74	157753	broad.mit.edu	37	8	109759466	109759467	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109759466_109759467delTG	uc003ymx.2	-											Homo sapiens cDNA FLJ30668 fis, clone FCBBF1000675.						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	114312220	114312221	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114312220_114312221insA	uc003ynu.2	-						CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron|CSMD3_uc010mcx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116189429	116189429	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116189429delT								None (None upstream) : TRPS1 (231296 downstream)																																			---	---	---	---
EXT1	2131	broad.mit.edu	37	8	118856931	118856931	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118856931delC	uc003yok.1	-							NM_000127	NP_000118			exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
SAMD12	401474	broad.mit.edu	37	8	119278686	119278686	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119278686delA	uc010mda.1	-						SAMD12_uc010mdb.1_Intron	NM_001101676	NP_001095146			sterile alpha motif domain containing 12 isoform											ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)															---	---	---	---
HAS2AS	594842	broad.mit.edu	37	8	122654148	122654149	+	Intron	INS	-	GT	GT	rs149791430	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122654148_122654149insGT	uc003ypi.1	+						HAS2_uc003yph.2_5'Flank	NR_002835				Homo sapiens HAS2 antisense RNA (non-protein coding) (HAS2AS), non-coding RNA.												0																		---	---	---	---
FAM83A	84985	broad.mit.edu	37	8	124192526	124192526	+	Intron	DEL	A	-	-	rs72388487		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124192526delA	uc003ypv.2	+						FAM83A_uc003ypw.2_Intron|FAM83A_uc003ypy.2_5'Flank|FAM83A_uc003ypx.2_5'Flank|FAM83A_uc003ypz.2_5'Flank	NM_032899	NP_116288			hypothetical protein LOC84985 isoform a											ovary(3)|skin(1)	4	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)															---	---	---	---
ZHX1	11244	broad.mit.edu	37	8	124289349	124289350	+	5'Flank	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124289349_124289350insA	uc003yqe.2	-						ZHX1_uc003yqf.2_5'Flank|ZHX1_uc003yqg.2_5'Flank|ZHX1_uc010mdi.2_5'Flank	NM_007222	NP_009153			zinc fingers and homeoboxes 1						negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	126847887	126847887	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126847887delA								TRIB1 (397245 upstream) : FAM84B (716800 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127681825	127681826	+	IGR	INS	-	T	T	rs150614172	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127681825_127681826insT								FAM84B (111359 upstream) : LOC727677 (620236 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127694968	127694969	+	IGR	INS	-	ATAC	ATAC	rs145373178	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127694968_127694969insATAC								FAM84B (124502 upstream) : LOC727677 (607093 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128161008	128161008	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128161008delA								FAM84B (590542 upstream) : LOC727677 (141054 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128166237	128166237	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128166237delA								FAM84B (595771 upstream) : LOC727677 (135825 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128354615	128354616	+	Intron	INS	-	CA	CA	rs141857489	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128354615_128354616insCA	uc003ysc.1	-						uc003ysd.1_Intron|LOC727677_uc003yse.1_Intron					Homo sapiens isolate DGPc1_8_exons1-2-3-4-6-8 unknown mRNA, alternatively spliced.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	128574528	128574529	+	IGR	INS	-	CA	CA	rs141738143	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128574528_128574529insCA								LOC727677 (80144 upstream) : MYC (173236 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	128758080	128758080	+	IGR	DEL	T	-	-	rs111950023		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128758080delT								MYC (4402 upstream) : PVT1 (48699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129217188	129217188	+	IGR	DEL	G	-	-	rs35525128		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129217188delG								MIR1208 (54754 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129429901	129429901	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129429901delA	uc003ysn.2	-											Homo sapiens cDNA clone IMAGE:3877235, partial cds.																														---	---	---	---
FAM49B	51571	broad.mit.edu	37	8	130889909	130889910	+	Intron	INS	-	GTGTGT	GTGTGT	rs56004410		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130889909_130889910insGTGTGT	uc003yss.2	-						FAM49B_uc003yst.2_Intron|FAM49B_uc003ysu.2_Intron|FAM49B_uc003ysv.2_Intron|FAM49B_uc003ysw.2_Intron|FAM49B_uc003ysx.2_Intron|FAM49B_uc003ysy.1_Intron	NM_016623	NP_057707			hypothetical protein LOC51571												0	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)															---	---	---	---
ASAP1	50807	broad.mit.edu	37	8	131233183	131233183	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131233183delG	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952			development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4																		---	---	---	---
TMEM71	137835	broad.mit.edu	37	8	133743490	133743490	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133743490delA	uc003ytp.2	-						TMEM71_uc003ytm.1_Intron|TMEM71_uc003ytn.2_Intron|TMEM71_uc003yto.2_Intron	NM_144649	NP_653250			transmembrane protein 71 isoform 1							integral to membrane				ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	134772832	134772833	+	IGR	INS	-	GT	GT	rs141566936	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134772832_134772833insGT								ST3GAL1 (188649 upstream) : ZFAT (717200 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135244660	135244660	+	IGR	DEL	A	-	-	rs112859771		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135244660delA								ST3GAL1 (660477 upstream) : ZFAT (245373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	135283525	135283526	+	IGR	INS	-	G	G	rs142709904	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135283525_135283526insG								ST3GAL1 (699342 upstream) : ZFAT (206507 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	136451120	136451120	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136451120delA								LOC286094 (139161 upstream) : KHDRBS3 (18596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	138383465	138383466	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138383465_138383466insT								None (None upstream) : FAM135B (758802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	139109653	139109653	+	IGR	DEL	T	-	-	rs34038032		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139109653delT								None (None upstream) : FAM135B (32615 downstream)																																			---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139403620	139403621	+	Intron	INS	-	TCCTT	TCCTT	rs138517552	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139403620_139403621insTCCTT	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996			hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139640944	139640944	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139640944delG	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139924994	139924995	+	Intron	DEL	AA	-	-	rs111443003		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139924994_139924995delAA	uc003yvd.2	-							NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	140536129	140536130	+	IGR	INS	-	T	T	rs149128067	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140536129_140536130insT								COL22A1 (609893 upstream) : KCNK9 (76952 downstream)																																			---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141414988	141414989	+	Intron	INS	-	GA	GA	rs146281629	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141414988_141414989insGA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
EIF2C2	27161	broad.mit.edu	37	8	141610141	141610142	+	Intron	INS	-	AT	AT	rs145704416	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141610141_141610142insAT	uc003yvn.2	-						EIF2C2_uc010men.2_Intron|EIF2C2_uc010meo.2_Intron	NM_012154	NP_036286			argonaute 2 isoform 1						mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	142314170	142314170	+	IGR	DEL	G	-	-	rs35328870		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142314170delG								SLC45A4 (49945 upstream) : LOC731779 (36478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	143094506	143094507	+	IGR	INS	-	C	C	rs142486871		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143094506_143094507insC								MIR1302-7 (226832 upstream) : NCRNA00051 (185210 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	143671157	143671169	+	IGR	DEL	CAGGGTCTCTGGA	-	-	rs142869224		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143671157_143671169delCAGGGTCTCTGGA								BAI1 (44790 upstream) : ARC (21241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144031641	144031642	+	IGR	INS	-	TAG	TAG			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144031641_144031642insTAG								CYP11B2 (32382 upstream) : LOC100133669 (31806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144218987	144218987	+	IGR	DEL	A	-	-	rs75154976		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144218987delA								C8orf31 (83267 upstream) : LY6H (20345 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144756883	144756883	+	IGR	DEL	A	-	-	rs113927149		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144756883delA								ZNF623 (20983 upstream) : ZNF707 (9739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144853814	144853814	+	IGR	DEL	G	-	-	rs7840691	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144853814delG								FAM83H (37900 upstream) : SCRIB (19276 downstream)																																			---	---	---	---
SHARPIN	81858	broad.mit.edu	37	8	145155743	145155744	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145155743_145155744insT	uc003zba.2	-						SHARPIN_uc003zbb.2_Intron	NM_030974	NP_112236			shank-interacting protein-like 1						negative regulation of inflammatory response|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein linear polyubiquitination|regulation of CD40 signaling pathway|regulation of tumor necrosis factor-mediated signaling pathway	cytosol|LUBAC complex	polyubiquitin binding|zinc ion binding			ovary(1)	1	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)															---	---	---	---
ZNF251	90987	broad.mit.edu	37	8	145950402	145950402	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145950402delT	uc003zdv.3	-							NM_138367	NP_612376			zinc finger protein 251						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)														---	---	---	---
SMARCA2	6595	broad.mit.edu	37	9	2172368	2172368	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2172368delG	uc003zhc.2	+						SMARCA2_uc003zhd.2_Intron|SMARCA2_uc010mha.2_Intron|SMARCA2_uc011llw.1_Intron|SMARCA2_uc003zhf.2_Intron|SMARCA2_uc011llx.1_Intron|SMARCA2_uc003zhe.2_Intron|SMARCA2_uc003zhg.2_Intron|SMARCA2_uc010mhb.2_Intron	NM_003070	NP_003061			SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)														---	---	---	---
SLC1A1	6505	broad.mit.edu	37	9	4546429	4546429	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4546429delA	uc003zij.1	+							NM_004170	NP_004161			solute carrier family 1, member 1						D-aspartate import|L-glutamate import|synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	8078259	8078259	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8078259delT								C9orf123 (278460 upstream) : PTPRD (235988 downstream)																																			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	10444706	10444707	+	Intron	INS	-	A	A	rs146406785	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:10444706_10444707insA	uc003zkk.2	-						PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
C9orf150	286343	broad.mit.edu	37	9	12791691	12791696	+	Intron	DEL	ACACAC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12791691_12791696delACACAC	uc003zkw.2	+							NM_203403	NP_981948			hypothetical protein LOC286343												0				GBM - Glioblastoma multiforme(1;1.64e-13)														---	---	---	---
MPDZ	8777	broad.mit.edu	37	9	13168251	13168251	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13168251delA	uc010mia.1	-						MPDZ_uc011lmm.1_5'Flank|MPDZ_uc003zkz.3_Intron|MPDZ_uc010mhy.2_Intron|MPDZ_uc010mhz.2_Intron|MPDZ_uc011lmn.1_Intron|MPDZ_uc003zlb.3_Intron	NM_003829	NP_003820			multiple PDZ domain protein						interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)														---	---	---	---
TTC39B	158219	broad.mit.edu	37	9	15253729	15253729	+	Intron	DEL	T	-	-	rs35077513		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15253729delT	uc003zlr.1	-						TTC39B_uc010mie.1_Intron|TTC39B_uc011lmq.1_Intron|TTC39B_uc011lmr.1_Intron|TTC39B_uc010mif.1_Intron|TTC39B_uc010mig.1_Intron|TTC39B_uc011lms.1_Intron	NM_152574	NP_689787			tetratricopeptide repeat domain 39B								binding			ovary(1)	1																		---	---	---	---
C9orf93	203238	broad.mit.edu	37	9	15954149	15954150	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15954149_15954150insT	uc003zmd.2	+						C9orf93_uc003zme.2_Intron|C9orf93_uc011lmu.1_Intron	NM_173550	NP_775821			hypothetical protein LOC203238												0				GBM - Glioblastoma multiforme(50;4.84e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	16334994	16334994	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16334994delA								C9orf93 (363099 upstream) : BNC2 (74508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	17116119	17116120	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17116119_17116120insA								BNC2 (245333 upstream) : CNTLN (18918 downstream)																																			---	---	---	---
CNTLN	54875	broad.mit.edu	37	9	17255137	17255137	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17255137delA	uc003zmz.2	+						CNTLN_uc003zmx.3_Intron|CNTLN_uc003zmy.2_Intron|CNTLN_uc010mio.2_Intron	NM_017738	NP_060208			centlein isoform 1							centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	17929397	17929397	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17929397delC								SH3GL2 (132277 upstream) : ADAMTSL1 (544707 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	19507118	19507118	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19507118delT								ACER2 (54618 upstream) : SLC24A2 (8860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	24977721	24977722	+	IGR	INS	-	AC	AC	rs150203877	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:24977721_24977722insAC								None (None upstream) : TUSC1 (698672 downstream)																																			---	---	---	---
NCRNA00032	158035	broad.mit.edu	37	9	27266737	27266737	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27266737delA	uc010mjd.1	-							NR_026687				Homo sapiens C9orf14 mRNA, complete sequence, alternatively spliced.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	27617353	27617354	+	IGR	INS	-	AAAGA	AAAGA	rs144709931	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27617353_27617354insAAAGA								C9orf72 (43511 upstream) : LINGO2 (331174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	27850403	27850403	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27850403delG								C9orf72 (276561 upstream) : LINGO2 (98125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	29227813	29227813	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29227813delT								MIR873 (338860 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	30855557	30855557	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30855557delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32332850	32332850	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32332850delA								None (None upstream) : ACO1 (51751 downstream)																																			---	---	---	---
DCAF12	25853	broad.mit.edu	37	9	34087592	34087593	+	3'UTR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34087592_34087593insA	uc003ztt.2	-	9						NM_015397	NP_056212			DDB1 and CUL4 associated factor 12							centrosome|CUL4 RING ubiquitin ligase complex					0																		---	---	---	---
CCDC107	203260	broad.mit.edu	37	9	35656647	35656647	+	5'Flank	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35656647delG	uc011lox.1	+						CCDC107_uc010mkx.1_5'Flank|CCDC107_uc011loy.1_5'Flank|CCDC107_uc003zxj.2_5'Flank|CCDC107_uc003zxk.2_5'Flank	NM_174923	NP_777583			coiled-coil domain containing 107 precursor							integral to membrane					0	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	44730970	44730973	+	IGR	DEL	AAGG	-	-	rs149119595		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44730970_44730973delAAGG								None (None upstream) : FAM27C (259263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	44802999	44803000	+	IGR	INS	-	C	C	rs10908167		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44802999_44803000insC								None (None upstream) : FAM27C (187236 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	45404668	45404668	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45404668delA								FAM27C (413177 upstream) : FAM27A (322361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	65628483	65628486	+	IGR	DEL	TCCT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:65628483_65628486delTCCT								FAM74A4 (134097 upstream) : LOC442421 (867984 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66768754	66768755	+	IGR	DEL	AA	-	-	rs111633067		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66768754_66768755delAA								LOC442421 (265727 upstream) : AQP7P1 (485512 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66843444	66843447	+	IGR	DEL	TTGA	-	-	rs138234214		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66843444_66843447delTTGA								LOC442421 (340417 upstream) : AQP7P1 (410820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66977084	66977084	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66977084delA								LOC442421 (474057 upstream) : AQP7P1 (277183 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	67339664	67339664	+	IGR	DEL	T	-	-	rs60512825		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67339664delT								AQP7P1 (50172 upstream) : FAM27B (453266 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68352138	68352138	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68352138delG								FAM27B (557949 upstream) : MIR1299 (650101 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68389317	68389317	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68389317delT								FAM27B (595128 upstream) : MIR1299 (612922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68395499	68395499	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68395499delT								FAM27B (601310 upstream) : MIR1299 (606740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68395827	68395828	+	IGR	INS	-	T	T	rs147508092		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68395827_68395828insT								FAM27B (601638 upstream) : MIR1299 (606411 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68494777	68494777	+	IGR	DEL	A	-	-	rs144718275	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68494777delA								FAM27B (700588 upstream) : MIR1299 (507462 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69031598	69031599	+	IGR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69031598_69031599delCA								MIR1299 (29277 upstream) : PGM5P2 (48646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69494424	69494424	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69494424delA								ANKRD20A4 (69316 upstream) : LOC100133920 (156937 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69495995	69495996	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69495995_69495996delGT								ANKRD20A4 (70887 upstream) : LOC100133920 (155365 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	70839396	70839396	+	IGR	DEL	A	-	-	rs55766796		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70839396delA								CBWD3 (339333 upstream) : FOXD4L3 (78387 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	71314421	71314422	+	IGR	INS	-	CTT	CTT	rs149864446	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71314421_71314422insCTT								C9orf71 (158638 upstream) : PIP5K1B (6194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	77541275	77541275	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77541275delT								TRPM6 (38265 upstream) : C9orf40 (20225 downstream)																																			---	---	---	---
PCSK5	5125	broad.mit.edu	37	9	78799401	78799401	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78799401delT	uc004ajz.2	+						PCSK5_uc004aka.2_Intron|PCSK5_uc004akb.2_Intron	NM_006200	NP_006191			proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3																		---	---	---	---
GNAQ	2776	broad.mit.edu	37	9	80338362	80338362	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80338362delA	uc004akw.2	-						GNAQ_uc011lso.1_Intron|GNAQ_uc004akv.1_5'Flank	NM_002072	NP_002063			guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|glutamate signaling pathway|negative regulation of protein kinase activity|platelet activation|protein ADP-ribosylation|protein stabilization|regulation of action potential|regulation of catenin import into nucleus	cytoplasm|heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activator activity|GTPase activity|signal transducer activity			eye(136)|skin(44)|meninges(11)|ovary(1)|kidney(1)	193								Mis		uveal melanoma								---	---	---	---
Unknown	0	broad.mit.edu	37	9	83901235	83901235	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83901235delT								None (None upstream) : TLE1 (297365 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	84450638	84450639	+	IGR	DEL	AG	-	-	rs77708634		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84450638_84450639delAG								TLE1 (147042 upstream) : FLJ43950 (77713 downstream)																																			---	---	---	---
RMI1	80010	broad.mit.edu	37	9	86596322	86596322	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86596322delG	uc004anq.3	+						HNRNPK_uc004ank.3_5'Flank|HNRNPK_uc004anf.3_5'Flank|HNRNPK_uc004ang.3_5'Flank|HNRNPK_uc004anh.3_5'Flank|HNRNPK_uc011lsx.1_5'Flank|HNRNPK_uc004ani.3_5'Flank|HNRNPK_uc004anj.3_5'Flank|HNRNPK_uc004ann.3_5'Flank|HNRNPK_uc004anl.3_5'Flank|HNRNPK_uc004anm.3_5'Flank|RMI1_uc004anr.3_Intron|RMI1_uc004anp.3_Intron	NM_024945	NP_079221			RMI1, RecQ mediated genome instability 1,						DNA replication	nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	86734373	86734373	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86734373delT								RMI1 (115391 upstream) : SLC28A3 (158719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	90002270	90002271	+	IGR	INS	-	C	C	rs11999549	byFrequency	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90002270_90002271insC								C9orf170 (227629 upstream) : DAPK1 (110387 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	90707189	90707190	+	IGR	INS	-	C	C	rs148576746	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90707189_90707190insC								CDK20 (117522 upstream) : SPIN1 (295650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91140239	91140240	+	IGR	INS	-	CA	CA			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91140239_91140240insCA								SPIN1 (46619 upstream) : NXNL2 (9776 downstream)																																			---	---	---	---
SHC3	53358	broad.mit.edu	37	9	91642510	91642516	+	Intron	DEL	CATAAGC	-	-	rs138834651		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91642510_91642516delCATAAGC	uc004aqg.2	-							NM_016848	NP_058544			src homology 2 domain-containing transforming						central nervous system development|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	protein binding|signal transducer activity			lung(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	93037722	93037722	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93037722delC								LOC100129066 (703048 upstream) : DIRAS2 (334392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	94922972	94922973	+	IGR	DEL	AC	-	-	rs58710196		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94922972_94922973delAC								C9orf44 (1082 upstream) : IARS (49652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	96930677	96930678	+	IGR	DEL	AT	-	-	rs145948313		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96930677_96930678delAT								PTPDC1 (58541 upstream) : MIRLET7A1 (7561 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	98920231	98920234	+	IGR	DEL	TGTA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98920231_98920234delTGTA								NCRNA00092 (136194 upstream) : HSD17B3 (77355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	99675796	99675796	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99675796delT								LOC441454 (3060 upstream) : FAM22G (14796 downstream)																																			---	---	---	---
NANS	54187	broad.mit.edu	37	9	100830728	100830729	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100830728_100830729insT	uc004ayb.2	+						NANS_uc004ayc.2_Intron	NM_018946	NP_061819			N-acetylneuraminic acid phosphate synthase						lipopolysaccharide biosynthetic process	cytoplasm	N-acetylneuraminate synthase activity|N-acylneuraminate cytidylyltransferase activity|N-acylneuraminate-9-phosphate synthase activity			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)																---	---	---	---
ANKS6	203286	broad.mit.edu	37	9	101543396	101543396	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101543396delG	uc004ayu.2	-						ANKS6_uc004ayt.2_Intron|ANKS6_uc004ayw.1_5'Flank|ANKS6_uc004ayx.1_Intron|ANKS6_uc004ayy.1_Intron	NM_173551	NP_775822			ankyrin repeat and sterile alpha motif domain											ovary(2)	2		Acute lymphoblastic leukemia(62;0.0527)																---	---	---	---
Unknown	0	broad.mit.edu	37	9	102102275	102102278	+	IGR	DEL	TTGT	-	-	rs113819150		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102102275_102102278delTTGT								SEC61B (109375 upstream) : NR4A3 (481859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	102238231	102238231	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102238231delC								SEC61B (245331 upstream) : NR4A3 (345906 downstream)																																			---	---	---	---
ERP44	23071	broad.mit.edu	37	9	102807507	102807507	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102807507delT	uc004bam.2	-						ERP44_uc010msy.2_Intron|ERP44_uc010msz.2_Intron	NM_015051	NP_055866			thioredoxin domain containing 4 (endoplasmic						cell redox homeostasis|glycoprotein metabolic process|protein folding|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|ER-Golgi intermediate compartment	protein binding|protein disulfide isomerase activity				0																		---	---	---	---
LPPR1	54886	broad.mit.edu	37	9	103977984	103977984	+	Intron	DEL	T	-	-	rs111548700		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103977984delT	uc004bbb.2	+						LPPR1_uc011lvi.1_Intron|LPPR1_uc004bbc.2_Intron	NM_207299	NP_997182			plasticity related gene 3							integral to membrane	catalytic activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	104603273	104603274	+	IGR	INS	-	CAATACTCA	CAATACTCA	rs142009020	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104603273_104603274insCAATACTCA								GRIN3A (102411 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	110127456	110127456	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110127456delG								RAD23B (32987 upstream) : KLF4 (119679 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	112272133	112272133	+	IGR	DEL	A	-	-	rs11330633		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112272133delA								PTPN3 (11540 upstream) : PALM2 (130939 downstream)																																			---	---	---	---
MUSK	4593	broad.mit.edu	37	9	113458558	113458558	+	Intron	DEL	A	-	-	rs71875603		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113458558delA	uc004bey.2	+						MUSK_uc004bex.2_Intron	NM_005592	NP_005583			skeletal muscle receptor tyrosine kinase						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|ovary(2)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	114262388	114262388	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114262388delT								KIAA0368 (15363 upstream) : ZNF483 (25059 downstream)																																			---	---	---	---
ROD1	9991	broad.mit.edu	37	9	115079252	115079252	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115079252delA	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147			ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	116361852	116361852	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116361852delC								RGS3 (1835 upstream) : ZNF618 (276710 downstream)																																			---	---	---	---
ORM1	5004	broad.mit.edu	37	9	117083134	117083135	+	5'Flank	INS	-	A	A	rs147862193		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117083134_117083135insA	uc004bik.3	+						ORM1_uc011lxo.1_5'Flank	NM_000607	NP_000598			orosomucoid 1 precursor						acute-phase response|regulation of immune system process|transport	extracellular space	protein binding				0		Myeloproliferative disorder(63;0.163)			Acenocoumarol(DB01418)|Alfentanil(DB00802)|Aprindine(DB01429)|Disopyramide(DB00280)|Penbutolol(DB01359)|Phenprocoumon(DB00946)|Quinidine(DB00908)|Tamsulosin(DB00706)													---	---	---	---
C9orf91	203197	broad.mit.edu	37	9	117393213	117393214	+	Intron	INS	-	TG	TG	rs139311168	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117393213_117393214insTG	uc004bjd.3	+						C9orf91_uc004bje.3_Intron|C9orf91_uc004bjf.3_Intron	NM_153045	NP_694590			hypothetical protein LOC203197							integral to membrane				pancreas(1)	1																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	120138429	120138429	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120138429delG	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	121460541	121460541	+	IGR	DEL	A	-	-	rs56284815	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121460541delA								TLR4 (980777 upstream) : DBC1 (468367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	121730366	121730368	+	IGR	DEL	ATC	-	-	rs113448242		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121730366_121730368delATC								None (None upstream) : DBC1 (198540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	126971349	126971349	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126971349delT								LHX2 (175907 upstream) : NEK6 (48537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	130745915	130745915	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130745915delC								FAM102A (3420 upstream) : NAIF1 (77598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	133419186	133419205	+	IGR	DEL	GTGTGTGTGTGTGTGTGTGT	-	-	rs71499249		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133419186_133419205delGTGTGTGTGTGTGTGTGTGT								ASS1 (42526 upstream) : LOC100272217 (33534 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	135871460	135871461	+	IGR	INS	-	AT	AT	rs148165975	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135871460_135871461insAT								GFI1B (4377 upstream) : GTF3C5 (34601 downstream)																																			---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137715862	137715863	+	Intron	DEL	TG	-	-	rs5901055		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137715862_137715863delTG	uc004cfe.2	+						uc004cff.2_Intron	NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	964260	964260	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:964260delA								LARP4B (32558 upstream) : GTPBP4 (70089 downstream)																																			---	---	---	---
WDR37	22884	broad.mit.edu	37	10	1111405	1111406	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1111405_1111406insA	uc001igf.1	+						WDR37_uc001ige.2_Intron|WDR37_uc009xhm.1_Intron|WDR37_uc009xhn.1_Intron	NM_014023	NP_054742			WD repeat domain 37												0		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	2963961	2963962	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2963961_2963962delGT								None (None upstream) : PFKP (145790 downstream)																																			---	---	---	---
AKR1C1	1645	broad.mit.edu	37	10	4941584	4941584	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4941584delC	uc001iho.2	+						AKR1E2_uc001ihl.1_Intron|tAKR_uc001ihm.3_Intron	NM_001353	NP_001344			aldo-keto reductase family 1, member C1						bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)													---	---	---	---
IL15RA	3601	broad.mit.edu	37	10	6012917	6012917	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6012917delC	uc001iiv.2	-						IL15RA_uc010qau.1_Intron|IL15RA_uc001iiw.2_Intron|IL15RA_uc001iix.2_Intron|IL15RA_uc001iiy.2_Intron	NM_002189	NP_002180			interleukin 15 receptor, alpha isoform 1						cell proliferation	cytoplasmic vesicle membrane|endoplasmic reticulum membrane|extracellular space|Golgi membrane|integral to membrane|nuclear membrane	cytokine receptor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	10451260	10451260	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10451260delG								None (None upstream) : SFTA1P (375142 downstream)																																			---	---	---	---
CELF2	10659	broad.mit.edu	37	10	11186552	11186552	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11186552delA	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron	NM_001025077	NP_001020248			CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	13758728	13758728	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13758728delA	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
ACBD7	414149	broad.mit.edu	37	10	15083578	15083578	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15083578delT	uc010qby.1	-						OLAH_uc001int.2_5'Flank|OLAH_uc001inu.2_5'Flank					SubName: Full=cDNA FLJ52263, highly similar to Artemis protein (EC 3.1.-.-);								fatty-acyl-CoA binding				0																		---	---	---	---
ITGA8	8516	broad.mit.edu	37	10	15685604	15685604	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15685604delA	uc001ioc.1	-						ITGA8_uc010qcb.1_Intron	NM_003638	NP_003629			integrin, alpha 8 precursor						cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6																		---	---	---	---
VIM	7431	broad.mit.edu	37	10	17272904	17272904	+	Intron	DEL	T	-	-	rs5783538		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17272904delT	uc001iou.2	+						uc001iot.1_5'Flank|VIM_uc001iov.1_Intron|VIM_uc001iow.1_Intron|VIM_uc001iox.1_Intron|VIM_uc001ioy.1_Intron|VIM_uc001ioz.1_Intron|VIM_uc001ipb.1_Intron|VIM_uc009xjv.1_Intron|VIM_uc001ipc.1_Intron	NM_003380	NP_003371			vimentin						cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4																OREG0020050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ST8SIA6	338596	broad.mit.edu	37	10	17392383	17392383	+	Intron	DEL	T	-	-	rs76427907		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17392383delT	uc001ipd.2	-						ST8SIA6_uc010qce.1_Intron	NM_001004470	NP_001004470			ST8 alpha-N-acetyl-neuraminide						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	18401171	18401172	+	IGR	DEL	GG	-	-	rs72076001		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18401171_18401172delGG								SLC39A12 (68950 upstream) : CACNB2 (28434 downstream)																																			---	---	---	---
CACNB2	783	broad.mit.edu	37	10	18648531	18648531	+	Intron	DEL	T	-	-	rs76879438		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18648531delT	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron|CACNB2_uc009xkb.1_Intron|CACNB2_uc010qcm.1_Intron|CACNB2_uc001ipz.2_Intron|CACNB2_uc001ipy.2_Intron	NM_201596	NP_963890			calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
MLLT10	8028	broad.mit.edu	37	10	21828877	21828878	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21828877_21828878insA	uc001iqs.2	+						MLLT10_uc001iqt.2_Intron|MLLT10_uc001iqv.2_Intron|MLLT10_uc001iqy.2_Intron|MLLT10_uc001iqr.1_Intron|MLLT10_uc001iqq.1_Intron|MLLT10_uc001iqu.1_Intron|MLLT10_uc009xke.1_Intron|MLLT10_uc001iqw.1_Intron|MLLT10_uc001iqx.1_Intron|MLLT10_uc009xkf.1_Intron	NM_004641	NP_004632			myeloid/lymphoid or mixed-lineage leukemia						positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2								T	MLL|PICALM|CDK6	AL								---	---	---	---
Unknown	0	broad.mit.edu	37	10	23185070	23185071	+	IGR	DEL	AT	-	-	rs150376090		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23185070_23185071delAT								PIP4K2A (181567 upstream) : ARMC3 (31883 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	26885571	26885571	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26885571delC								C10orf50 (2322 upstream) : LOC731789 (46466 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	27217363	27217363	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27217363delA								ABI1 (67404 upstream) : NCRNA00202 (2772 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	27245561	27245561	+	IGR	DEL	A	-	-	rs71873303		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27245561delA								NCRNA00202 (14631 upstream) : ANKRD26 (47484 downstream)																																			---	---	---	---
ZNF438	220929	broad.mit.edu	37	10	31263422	31263424	+	Intron	DEL	CAA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31263422_31263424delCAA	uc010qdz.1	-						ZNF438_uc001ivn.2_Intron|ZNF438_uc010qdy.1_Intron|ZNF438_uc001ivo.3_Intron|ZNF438_uc009xlg.2_Intron|ZNF438_uc001ivp.3_Intron|ZNF438_uc010qea.1_Intron|ZNF438_uc010qeb.1_Intron|ZNF438_uc010qec.1_Intron	NM_182755	NP_877432			zinc finger protein 438 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)																---	---	---	---
PARD3	56288	broad.mit.edu	37	10	34823193	34823194	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34823193_34823194insA	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixt.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565			partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---
ZNF37A	7587	broad.mit.edu	37	10	38380282	38380282	+	5'Flank	DEL	A	-	-	rs80074474		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38380282delA	uc001izk.2	+						ZNF37A_uc001izl.2_5'Flank|ZNF37A_uc001izm.2_5'Flank	NM_001007094	NP_001007095			zinc finger protein 37a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	38566004	38566004	+	IGR	DEL	A	-	-	rs141952557		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38566004delA								LOC100129055 (62732 upstream) : HSD17B7P2 (79304 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39090898	39090898	+	IGR	DEL	T	-	-	rs145632232		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39090898delT								LOC399744 (349818 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39113104	39113104	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39113104delC								LOC399744 (372024 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	43224099	43224099	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43224099delT								ZNF33B (90107 upstream) : BMS1 (53855 downstream)																																			---	---	---	---
RASGEF1A	221002	broad.mit.edu	37	10	43755746	43755747	+	Intron	INS	-	CTGCTCC	CTGCTCC	rs139741180	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43755746_43755747insCTGCTCC	uc001jap.1	-							NM_145313	NP_660356			RasGEF domain family, member 1A						cell migration|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	44093370	44093371	+	IGR	INS	-	T	T	rs111331694		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44093370_44093371insT								ZNF239 (23304 upstream) : ZNF485 (8484 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	45185550	45185551	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45185550_45185551insT								CXCL12 (305008 upstream) : TMEM72 (221213 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	45370752	45370753	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45370752_45370753insT	uc001jbk.1	-						uc001jbl.2_Intron					Homo sapiens cDNA FLJ31956 fis, clone NT2RP7007359.																														---	---	---	---
FAM21C	253725	broad.mit.edu	37	10	46254741	46254742	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46254741_46254742insA	uc001jcu.2	+						FAM21C_uc001jcs.1_Intron|FAM21C_uc001jct.2_Intron|FAM21C_uc010qfi.1_Intron|FAM21C_uc010qfj.1_Intron|FAM21C_uc010qfk.1_Intron	NM_015262	NP_056077			hypothetical protein LOC253725											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	47713561	47713562	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47713561_47713562insA								ANTXRL (12115 upstream) : ANXA8L2 (33358 downstream)																																			---	---	---	---
FRMPD2	143162	broad.mit.edu	37	10	49392346	49392347	+	Intron	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49392346_49392347insG	uc001jgi.2	-						FRMPD2_uc001jgh.2_Intron|FRMPD2_uc001jgj.2_Intron	NM_001018071	NP_001018081			FERM and PDZ domain containing 2 isoform 3						tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	50566617	50566617	+	IGR	DEL	C	-	-	rs147192257		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50566617delC								C10orf71 (31080 upstream) : DRGX (7545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	54453691	54453691	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54453691delC								DKK1 (376275 upstream) : MBL2 (71450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	57755643	57755646	+	IGR	DEL	TGTA	-	-	rs142537988		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57755643_57755646delTGTA								PCDH15 (367941 upstream) : ZWINT (361553 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58308564	58308564	+	IGR	DEL	T	-	-	rs71465060		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58308564delT								ZWINT (187530 upstream) : None (None downstream)																																			---	---	---	---
CCDC6	8030	broad.mit.edu	37	10	61569006	61569006	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61569006delG	uc001jks.3	-							NM_005436	NP_005427			coiled-coil domain containing 6							cytoplasm|cytoskeleton	SH3 domain binding|structural constituent of cytoskeleton			ovary(3)|breast(1)	4				Kidney(211;0.0597)												OREG0020198	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	10	62890751	62890751	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62890751delA								RHOBTB1 (129553 upstream) : TMEM26 (275650 downstream)																																			---	---	---	---
ARID5B	84159	broad.mit.edu	37	10	63685207	63685207	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63685207delA	uc001jlt.1	+						ARID5B_uc010qil.1_Intron	NM_032199	NP_115575			AT rich interactive domain 5B (MRF1-like)						liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)																	---	---	---	---
ARID5B	84159	broad.mit.edu	37	10	63746510	63746510	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63746510delA	uc001jlt.1	+						ARID5B_uc010qil.1_Intron	NM_032199	NP_115575			AT rich interactive domain 5B (MRF1-like)						liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	64452840	64452841	+	IGR	INS	-	G	G	rs10822051		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64452840_64452841insG								ZNF365 (21069 upstream) : ADO (111675 downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	67997253	67997254	+	Intron	INS	-	G	G	rs147729002	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67997253_67997254insG	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68120587	68120588	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68120587_68120588insT	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68246598	68246599	+	Intron	INS	-	AA	AA	rs146639934	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68246598_68246599insAA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	69552673	69552674	+	IGR	DEL	TG	-	-	rs113922759		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69552673_69552674delTG								CTNNA3 (96724 upstream) : DNAJC12 (3754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	71512503	71512504	+	IGR	INS	-	TTCA	TTCA	rs144497834	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71512503_71512504insTTCA								C10orf35 (119156 upstream) : COL13A1 (49140 downstream)																																			---	---	---	---
H2AFY2	55506	broad.mit.edu	37	10	71852198	71852199	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71852198_71852199insA	uc001jqm.2	+						H2AFY2_uc001jqn.2_Intron	NM_018649	NP_061119			H2A histone family, member Y2						chromatin modification|dosage compensation|nucleosome assembly	Barr body|nucleosome	DNA binding			skin(1)	1																		---	---	---	---
KIAA1274	27143	broad.mit.edu	37	10	72281952	72281952	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72281952delT	uc001jrd.3	+							NM_014431	NP_055246			KIAA1274											ovary(2)|central_nervous_system(1)	3																		---	---	---	---
ADAMTS14	140766	broad.mit.edu	37	10	72509365	72509366	+	Intron	DEL	GT	-	-	rs72483126		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72509365_72509366delGT	uc001jrh.2	+						ADAMTS14_uc001jrg.2_Intron	NM_080722	NP_542453			ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	72729649	72729650	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72729649_72729650insA								PCBD1 (81108 upstream) : UNC5B (242648 downstream)																																			---	---	---	---
CDH23	64072	broad.mit.edu	37	10	73522418	73522421	+	Intron	DEL	CAGT	-	-	rs112466817		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73522418_73522421delCAGT	uc001jrx.3	+						C10orf54_uc001jsd.2_Intron|C10orf54_uc001jse.2_Intron|C10orf54_uc009xqm.2_Intron|C10orf54_uc001jsf.1_Intron	NM_022124	NP_071407			cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11																		---	---	---	---
CCDC109A	90550	broad.mit.edu	37	10	74573565	74573565	+	Intron	DEL	T	-	-	rs112493625		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74573565delT	uc001jtc.2	+						CCDC109A_uc009xqp.1_Intron|CCDC109A_uc009xqq.1_Intron|CCDC109A_uc010qjy.1_Intron|CCDC109A_uc009xqr.2_Intron|CCDC109A_uc001jtd.2_Intron	NM_138357	NP_612366			coiled-coil domain containing 109A						elevation of mitochondrial calcium ion concentration|mitochondrial calcium ion transport|protein complex oligomerization	integral to membrane|mitochondrial inner membrane	protein binding				0	Prostate(51;0.0198)																	---	---	---	---
SAMD8	142891	broad.mit.edu	37	10	76929246	76929253	+	Intron	DEL	AAAGAAAG	-	-	rs113777051		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76929246_76929253delAAAGAAAG	uc001jwx.1	+						SAMD8_uc001jwy.1_Intron	NM_144660	NP_653261			sterile alpha motif domain containing 8						sphingomyelin biosynthetic process	integral to membrane					0	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)																	---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	79004569	79004570	+	Intron	INS	-	G	G	rs140668963	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79004569_79004570insG	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
LOC283050	283050	broad.mit.edu	37	10	80780201	80780202	+	Intron	DEL	CA	-	-	rs28414222		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80780201_80780202delCA	uc001jzz.2	-						LOC283050_uc001jzx.2_Intron|LOC283050_uc001jzy.2_Intron|LOC283050_uc001kab.1_RNA	NR_024431				Homo sapiens cDNA FLJ40604 fis, clone THYMU2011806.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	81134432	81134433	+	IGR	INS	-	A	A	rs113190466		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81134432_81134433insA								PPIF (19348 upstream) : ZCCHC24 (7652 downstream)																																	OREG0020309	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
NRG3	10718	broad.mit.edu	37	10	84526031	84526031	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84526031delG	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848			neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	85883359	85883360	+	IGR	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85883359_85883360delCT								None (None upstream) : GHITM (15825 downstream)																																			---	---	---	---
WAPAL	23063	broad.mit.edu	37	10	88229795	88229795	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88229795delT	uc001kdo.2	-						WAPAL_uc009xsv.2_Intron|WAPAL_uc001kdn.2_Intron|WAPAL_uc009xsw.2_Intron	NM_015045	NP_055860			wings apart-like homolog						cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---
BMPR1A	657	broad.mit.edu	37	10	88580129	88580130	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88580129_88580130insT	uc001kdy.2	+							NM_004329	NP_004320			bone morphogenetic protein receptor, type IA						BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity			lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8								Mis|N|F			gastrointestinal polyps			Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis				---	---	---	---
BMPR1A	657	broad.mit.edu	37	10	88635556	88635556	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88635556delT	uc001kdy.2	+							NM_004329	NP_004320			bone morphogenetic protein receptor, type IA						BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity			lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8								Mis|N|F			gastrointestinal polyps			Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis				---	---	---	---
KILLIN	100144748	broad.mit.edu	37	10	89621380	89621380	+	3'UTR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89621380delG	uc009xti.2	-	1					PTEN_uc001kfb.2_5'Flank	NM_001126049	NP_001119521			killin protein						apoptosis|cell cycle	nucleus	DNA binding				0														Cowden_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	10	92111773	92111773	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92111773delG								KIF20B (577073 upstream) : HTR7 (388805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	93486710	93486716	+	IGR	DEL	CAGCAGC	-	-	rs140234460		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93486710_93486716delCAGCAGC								PPP1R3C (93852 upstream) : TNKS2 (71435 downstream)																																			---	---	---	---
MYOF	26509	broad.mit.edu	37	10	95150571	95150573	+	Intron	DEL	AAA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95150571_95150573delAAA	uc001kin.2	-						MYOF_uc001kio.2_Intron	NM_013451	NP_038479			myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4																		---	---	---	---
SORBS1	10580	broad.mit.edu	37	10	97118426	97118427	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97118426_97118427delCA	uc001kkp.2	-						SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Intron|SORBS1_uc001kkn.2_Intron|SORBS1_uc001kkm.2_Intron|SORBS1_uc001kko.2_Intron|SORBS1_uc001kkq.2_Intron|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Intron|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126			sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)														---	---	---	---
C10orf12	26148	broad.mit.edu	37	10	98668410	98668410	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98668410delT	uc009xvg.1	+						LCOR_uc001kmr.2_Intron|LCOR_uc001kms.1_Intron|LCOR_uc001kmt.1_Intron|LCOR_uc001kmu.1_Intron	NM_015652	NP_056467			hypothetical protein LOC26148											skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)														---	---	---	---
SFRP5	6425	broad.mit.edu	37	10	99532943	99532943	+	5'Flank	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99532943delT	uc001kor.3	-							NM_003015	NP_003006			secreted frizzled-related protein 5 precursor						apoptosis|brain development|cell differentiation|embryo development|establishment or maintenance of cell polarity|gonad development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of protein kinase B signaling cascade|negative regulation of sequence-specific DNA binding transcription factor activity|vasculature development|visual perception	cytoplasm|extracellular space|plasma membrane	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1		Colorectal(252;0.234)		Epithelial(162;4.98e-10)|all cancers(201;3.58e-08)														---	---	---	---
SFXN2	118980	broad.mit.edu	37	10	104483876	104483876	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104483876delT	uc001kwb.2	+						SFXN2_uc001kwc.2_Intron|SFXN2_uc001kwd.2_Intron	NM_178858	NP_849189			sideroflexin 2						iron ion homeostasis	integral to membrane	cation transmembrane transporter activity				0		Colorectal(252;0.207)		Epithelial(162;4.53e-09)|all cancers(201;1.2e-07)|BRCA - Breast invasive adenocarcinoma(275;0.218)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	106279012	106279013	+	IGR	INS	-	T	T	rs147246314	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106279012_106279013insT								CCDC147 (64173 upstream) : SORCS3 (121846 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	106359919	106359920	+	IGR	DEL	GT	-	-	rs111416965		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106359919_106359920delGT								CCDC147 (145080 upstream) : SORCS3 (40939 downstream)																																			---	---	---	---
SORCS3	22986	broad.mit.edu	37	10	106850878	106850885	+	Intron	DEL	TCCCTCCT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106850878_106850885delTCCCTCCT	uc001kyi.1	+							NM_014978	NP_055793			VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	109281018	109281025	+	IGR	DEL	ACACACAC	-	-	rs72351707		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:109281018_109281025delACACACAC								SORCS1 (356726 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	110164371	110164372	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110164371_110164372insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	111218816	111218816	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111218816delT								None (None upstream) : XPNPEP1 (405708 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	112108100	112108100	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112108100delT								SMNDC1 (43393 upstream) : DUSP5 (149525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	112232816	112232816	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112232816delT								SMNDC1 (168109 upstream) : DUSP5 (24809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	113167131	113167132	+	IGR	INS	-	CAAT	CAAT			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113167131_113167132insCAAT								ADRA2A (326471 upstream) : GPAM (742490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	115494583	115494583	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115494583delT								CASP7 (3921 upstream) : C10orf81 (16630 downstream)																																			---	---	---	---
C10orf81	79949	broad.mit.edu	37	10	115541015	115541016	+	3'UTR	INS	-	C	C	rs66490176		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115541015_115541016insC	uc009xyc.1	+	13					C10orf81_uc001lar.1_3'UTR|C10orf81_uc001las.1_3'UTR|C10orf81_uc001lau.1_3'UTR|C10orf81_uc001lav.2_5'Flank					RecName: Full=PH domain-containing protein C10orf81;											central_nervous_system(1)	1		Colorectal(252;0.175)		Epithelial(162;0.0181)|all cancers(201;0.0204)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117342830	117342830	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117342830delT	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117641377	117641377	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117641377delT	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
PDZD8	118987	broad.mit.edu	37	10	119127421	119127421	+	Intron	DEL	A	-	-	rs79752083		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119127421delA	uc001lde.1	-							NM_173791	NP_776152			PDZ domain containing 8						intracellular signal transduction		metal ion binding				0		Colorectal(252;0.19)		all cancers(201;0.0121)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	120201099	120201100	+	IGR	INS	-	A	A	rs74741255		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120201099_120201100insA								C10orf84 (99260 upstream) : PRLHR (151816 downstream)																																			---	---	---	---
SFXN4	119559	broad.mit.edu	37	10	120922288	120922289	+	Intron	DEL	CT	-	-	rs147698904		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120922288_120922289delCT	uc001leb.2	-						SFXN4_uc001ldy.2_5'Flank|SFXN4_uc001ldz.2_Intron|SFXN4_uc001lea.2_Intron	NM_213649	NP_998814			sideroflexin 4						iron ion homeostasis	integral to membrane|mitochondrial membrane	cation transmembrane transporter activity			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	121806740	121806741	+	IGR	INS	-	GT	GT	rs139131495	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121806740_121806741insGT								SEC23IP (105495 upstream) : PPAPDC1A (409725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	122564258	122564259	+	Intron	INS	-	T	T	rs149644380	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122564258_122564259insT	uc001lfb.1	-											Homo sapiens cDNA FLJ37330 fis, clone BRAMY2019509.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	122893803	122893804	+	IGR	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122893803_122893804delCT								WDR11 (224768 upstream) : FGFR2 (344041 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123162676	123162679	+	IGR	DEL	AAAC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123162676_123162679delAAAC								WDR11 (493641 upstream) : FGFR2 (75166 downstream)																																			---	---	---	---
TACC2	10579	broad.mit.edu	37	10	123834867	123834868	+	Intron	INS	-	C	C	rs148366839	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123834867_123834868insC	uc001lfv.2	+						TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Intron|TACC2_uc010qtv.1_Intron	NM_206862	NP_996744			transforming, acidic coiled-coil containing							microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	124306694	124306695	+	IGR	DEL	TT	-	-	rs67857588		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124306694_124306695delTT								HTRA1 (32270 upstream) : DMBT1 (13486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	126015513	126015513	+	IGR	DEL	C	-	-	rs142739816		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126015513delC								CHST15 (162307 upstream) : OAT (70359 downstream)																																			---	---	---	---
LHPP	64077	broad.mit.edu	37	10	126236956	126236956	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126236956delC	uc001lhs.1	+						LHPP_uc001lht.1_Intron|LHPP_uc009yai.1_Intron	NM_022126	NP_071409			phospholysine phosphohistidine inorganic						protein dephosphorylation	cytosol|nucleus	inorganic diphosphatase activity|magnesium ion binding|phosphohistidine phosphatase activity|protein homodimerization activity				0		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)														---	---	---	---
FAM175B	23172	broad.mit.edu	37	10	126520597	126520597	+	Intron	DEL	T	-	-	rs149149081	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126520597delT	uc001lib.3	+							NM_032182	NP_115558			hypothetical protein LOC23172							BRISC complex	polyubiquitin binding				0																		---	---	---	---
FANK1	92565	broad.mit.edu	37	10	127599605	127599606	+	Intron	INS	-	AA	AA	rs149052488		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127599605_127599606insAA	uc001ljh.3	+						FANK1_uc010quk.1_Intron|FANK1_uc009yan.2_Intron	NM_145235	NP_660278			fibronectin type III and ankyrin repeat domains							cytoplasm|nucleus				ovary(1)	1		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)																---	---	---	---
ADAM12	8038	broad.mit.edu	37	10	127863275	127863275	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127863275delT	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465			ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	130993945	130993945	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130993945delG								None (None upstream) : MGMT (271509 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132871073	132871074	+	IGR	DEL	AT	-	-	rs35246001		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132871073_132871074delAT								GLRX3 (888289 upstream) : TCERG1L (19582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132879217	132879218	+	IGR	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132879217_132879218delAC								GLRX3 (896433 upstream) : TCERG1L (11438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133632776	133632776	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133632776delG								TCERG1L (522792 upstream) : PPP2R2D (115184 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	134616876	134616877	+	IGR	INS	-	C	C	rs142441264	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134616876_134616877insC								NKX6-2 (17339 upstream) : C10orf93 (125814 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	134855943	134855943	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134855943delC								C10orf93 (99879 upstream) : GPR123 (28490 downstream)																																			---	---	---	---
LOC619207	619207	broad.mit.edu	37	10	135288780	135288783	+	Intron	DEL	CTCA	-	-	rs145478021		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135288780_135288783delCTCA	uc001lni.1	+											Homo sapiens cDNA FLJ41380 fis, clone BRCAN2011254.												0																		---	---	---	---
FRG2B	441581	broad.mit.edu	37	10	135440687	135440689	+	5'Flank	DEL	TAT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135440687_135440689delTAT	uc010qvg.1	-							NM_001080998	NP_001074467			FSHD region gene 2 family, member B							nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)														---	---	---	---
PTDSS2	81490	broad.mit.edu	37	11	475247	475248	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:475247_475248insA	uc001lpj.2	+						PTDSS2_uc009ybv.1_Intron	NM_030783	NP_110410			phosphatidylserine synthase 2							integral to membrane					0		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;2.76e-26)|Epithelial(43;2.56e-25)|OV - Ovarian serous cystadenocarcinoma(40;7.54e-20)|BRCA - Breast invasive adenocarcinoma(625;8.76e-05)|Lung(200;0.0407)|LUSC - Lung squamous cell carcinoma(625;0.0735)	Phosphatidylserine(DB00144)													---	---	---	---
HRAS	3265	broad.mit.edu	37	11	534404	534415	+	Intron	DEL	CCCAGGCCCAGC	-	-	rs45443193		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:534404_534415delCCCAGGCCCAGC	uc001lpv.2	-						HRAS_uc010qvw.1_Intron|HRAS_uc010qvx.1_Intron|HRAS_uc010qvy.1_Intron	NM_005343	NP_005334			v-Ha-ras Harvey rat sarcoma viral oncogene						activation of MAPKK activity|axon guidance|blood coagulation|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|Ras protein signal transduction|synaptic transmission	cytosol|Golgi membrane|plasma membrane	GTP binding|GTPase activity|protein C-terminus binding			urinary_tract(174)|thyroid(155)|skin(126)|upper_aerodigestive_tract(112)|soft_tissue(37)|prostate(29)|salivary_gland(24)|cervix(23)|stomach(14)|pituitary(10)|lung(9)|haematopoietic_and_lymphoid_tissue(9)|breast(6)|testis(5)|endometrium(4)|bone(3)|large_intestine(2)|oesophagus(2)|penis(2)|kidney(1)|adrenal_gland(1)|thymus(1)	749		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Sulindac(DB00605)		6	Mis		infrequent sarcomas|rare other types	rhadomyosarcoma|ganglioneuroblastoma|bladder			Costello_syndrome	HNSCC(11;0.0054)			---	---	---	---
TOLLIP	54472	broad.mit.edu	37	11	1297795	1297795	+	3'UTR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1297795delG	uc001lte.2	-	6					TOLLIP_uc001ltd.2_3'UTR|TOLLIP_uc009ycu.2_3'UTR|TOLLIP_uc001ltf.2_3'UTR	NM_019009	NP_061882			toll interacting protein						cell-cell signaling|inflammatory response|innate immune response|intracellular signal transduction|leukocyte activation|phosphorylation	cytosol|interleukin-1 receptor complex|interleukin-18 receptor complex	kinase binding|signal transducer activity|Toll-like receptor binding				0		all_cancers(49;7.62e-05)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00152)|Lung(200;0.09)|LUSC - Lung squamous cell carcinoma(625;0.107)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	1531726	1531727	+	IGR	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1531726_1531727insG								MOB2 (23750 upstream) : DUSP8 (43554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	1721674	1721674	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1721674delT								KRTAP5-6 (2690 upstream) : CTSD (52311 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	2081637	2081638	+	IGR	INS	-	T	T	rs145230663	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2081637_2081638insT								H19 (62572 upstream) : IGF2 (68710 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	3228035	3228043	+	IGR	DEL	TGATGGTGA	-	-	rs111700232		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3228035_3228043delTGATGGTGA								OSBPL5 (40066 upstream) : C11orf36 (11519 downstream)																																			---	---	---	---
HBG2	3048	broad.mit.edu	37	11	5552873	5552874	+	Intron	INS	-	C	C	rs148388800	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5552873_5552874insC	uc001mak.1	-											Homo sapiens hemoglobin gamma-G (HBG2) mRNA, partial cds.						blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	6467401	6467401	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6467401delC								HPX (5147 upstream) : TRIM3 (2443 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	7219248	7219251	+	IGR	DEL	TAAC	-	-	rs141919721		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7219248_7219251delTAAC								RBMXL2 (106869 upstream) : MIR302E (36746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	9122545	9122545	+	IGR	DEL	G	-	-	rs11307632		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9122545delG								FLJ46111 (4808 upstream) : DENND5A (37832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	9363545	9363546	+	IGR	INS	-	G	G	rs143641265	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9363545_9363546insG								TMEM41B (27249 upstream) : IPO7 (42623 downstream)																																			---	---	---	---
MRVI1	10335	broad.mit.edu	37	11	10662592	10662593	+	Intron	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10662592_10662593delTC	uc010rcc.1	-						MRVI1_uc001miw.2_Intron|MRVI1_uc010rcb.1_Intron|MRVI1_uc009ygb.1_Intron|MRVI1_uc001mix.2_Intron|MRVI1_uc001miz.2_Intron|MRVI1_uc009ygc.1_Intron|MRVI1_uc010rcd.1_Intron|MRVI1_uc009ygd.1_Intron	NM_001100167	NP_001093637			JAW1-related protein isoform c						platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	10958443	10958444	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10958443_10958444delGT								ZBED5 (78823 upstream) : GALNTL4 (333977 downstream)																																			---	---	---	---
GALNTL4	374378	broad.mit.edu	37	11	11294796	11294800	+	Intron	DEL	AAAGT	-	-	rs10578464		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11294796_11294800delAAAGT	uc001mjo.2	-							NM_198516	NP_940918			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	11726987	11726988	+	IGR	INS	-	AGTT	AGTT	rs145915379	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11726987_11726988insAGTT								GALNTL4 (83426 upstream) : USP47 (135982 downstream)																																			---	---	---	---
PARVA	55742	broad.mit.edu	37	11	12462893	12462893	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12462893delT	uc001mki.2	+						PARVA_uc001mkh.2_Intron|PARVA_uc010rck.1_Intron	NM_018222	NP_060692			parvin, alpha						cell adhesion|cell junction assembly|cilium morphogenesis	actin cytoskeleton|cytosol|focal adhesion	actin binding			breast(3)	3				Epithelial(150;0.00624)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	13917874	13917875	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13917874_13917875delGT								FAR1 (163983 upstream) : SPON1 (66039 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	13978070	13978071	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13978070_13978071insA								FAR1 (224179 upstream) : SPON1 (5843 downstream)																																	OREG0020787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	11	14927745	14927748	+	IGR	DEL	GCGC	-	-	rs140667348		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14927745_14927748delGCGC								CYP2R1 (13994 upstream) : CALCA (60468 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15422781	15422782	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15422781_15422782delGT								INSC (154029 upstream) : SOX6 (565214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15484020	15484021	+	IGR	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15484020_15484021delCT								INSC (215268 upstream) : SOX6 (503975 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15816148	15816152	+	IGR	DEL	TAGAG	-	-	rs143142782		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15816148_15816152delTAGAG								INSC (547396 upstream) : SOX6 (171844 downstream)																																			---	---	---	---
C11orf58	10944	broad.mit.edu	37	11	16774649	16774650	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16774649_16774650insT	uc001mmk.2	+						C11orf58_uc010rct.1_Intron	NM_014267	NP_055082			small acidic protein isoform a												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	17039506	17039507	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17039506_17039507insT								PLEKHA7 (3543 upstream) : RPS13 (56433 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	18984438	18984439	+	IGR	INS	-	AAC	AAC	rs141541063	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18984438_18984439insAAC								MRGPRX1 (27889 upstream) : MRGPRX2 (91566 downstream)																																			---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19462996	19462999	+	Intron	DEL	CACA	-	-	rs72212525		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19462996_19462999delCACA	uc001mpp.2	+							NM_001111018	NP_001104488			neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19803078	19803078	+	Intron	DEL	A	-	-	rs72249126		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19803078delA	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093			neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	24168061	24168062	+	IGR	INS	-	A	A	rs140782599	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24168061_24168062insA								None (None upstream) : LUZP2 (350494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	24181635	24181640	+	IGR	DEL	TGTGTC	-	-	rs60863475		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24181635_24181640delTGTGTC								None (None upstream) : LUZP2 (336916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	25671874	25671877	+	IGR	DEL	TATA	-	-	rs143745330		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:25671874_25671877delTATA								LUZP2 (567692 upstream) : ANO3 (538952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	27010452	27010452	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27010452delT								SLC5A12 (265478 upstream) : FIBIN (5176 downstream)																																			---	---	---	---
BBOX1	8424	broad.mit.edu	37	11	27105992	27105992	+	Intron	DEL	A	-	-	rs113895578		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27105992delA	uc001mre.1	+						BBOX1_uc009yih.1_Intron|BBOX1_uc001mrg.1_Intron	NM_003986	NP_003977			gamma-butyrobetaine dioxygenase						carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1					Succinic acid(DB00139)|Vitamin C(DB00126)													---	---	---	---
BDNFOS	497258	broad.mit.edu	37	11	27632729	27632729	+	Intron	DEL	T	-	-	rs34232309		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27632729delT	uc001mrm.2	+						BDNFOS_uc009yij.2_Intron|BDNFOS_uc009yik.2_Intron|BDNFOS_uc009yil.2_Intron|BDNFOS_uc001mrp.2_Intron|BDNFOS_uc009yim.2_Intron|BDNFOS_uc009yin.2_Intron|BDNFOS_uc009yio.2_Intron|BDNFOS_uc009yip.2_Intron|BDNFOS_uc001mrn.2_Intron|BDNFOS_uc009yiq.2_Intron|BDNFOS_uc001mro.2_Intron|BDNFOS_uc009yir.2_Intron|BDNFOS_uc009yis.2_Intron|BDNFOS_uc009yit.2_Intron|BDNFOS_uc009yiu.2_Intron|BDNFOS_uc009yiv.2_Intron|BDNFOS_uc009yiw.2_Intron|BDNFOS_uc009yix.2_Intron|BDNFOS_uc009yiy.2_Intron|BDNFOS_uc009yiz.2_Intron|BDNFOS_uc001mrq.3_Intron|BDNFOS_uc001mrr.3_Intron|BDNFOS_uc009yja.2_Intron|BDNFOS_uc009yjb.2_Intron	NR_002832				Homo sapiens non-coding transcript BT2C (BDNF) mRNA, complete sequence; alternatively spliced.												0																		---	---	---	---
METT5D1	196074	broad.mit.edu	37	11	28164448	28164448	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28164448delA	uc001msh.2	+						METT5D1_uc001msg.2_Intron|METT5D1_uc001mse.2_Intron	NM_001113528	NP_001107000			methyltransferase 5 domain containing 1 isoform								methyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	28569826	28569831	+	IGR	DEL	TTGTTG	-	-	rs143789862		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28569826_28569831delTTGTTG								METT5D1 (214772 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29598471	29598472	+	IGR	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29598471_29598472delAG								None (None upstream) : KCNA4 (433294 downstream)																																			---	---	---	---
MPPED2	744	broad.mit.edu	37	11	30470730	30470731	+	Intron	INS	-	GAAT	GAAT	rs144506809	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30470730_30470731insGAAT	uc001msr.2	-						MPPED2_uc001msq.3_Intron|MPPED2_uc009yji.2_Intron	NM_001584	NP_001575			metallophosphoesterase domain containing 2						nervous system development		hydrolase activity|metal ion binding			skin(1)	1																		---	---	---	---
ELP4	26610	broad.mit.edu	37	11	31603300	31603300	+	Intron	DEL	T	-	-	rs111876394		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31603300delT	uc001mtb.2	+						ELP4_uc001mta.1_Intron|ELP4_uc001mtc.2_Intron|ELP4_uc010rdz.1_Intron	NM_019040	NP_061913			elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)																	---	---	---	---
RCN1	5954	broad.mit.edu	37	11	32121862	32121865	+	Intron	DEL	CTTG	-	-	rs3830870		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32121862_32121865delCTTG	uc010reb.1	+						RCN1_uc010rea.1_Intron|RCN1_uc001mtk.2_Intron	NM_002901	NP_002892			reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)																	---	---	---	---
WT1	7490	broad.mit.edu	37	11	32409550	32409551	+	3'UTR	DEL	AC	-	-	rs71678456		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32409550_32409551delAC	uc001mtn.1	-	10					WT1_uc001mtl.1_3'UTR|WT1_uc001mtm.1_3'UTR|WT1_uc001mto.1_3'UTR|WT1_uc001mtp.1_3'UTR|WT1_uc001mtq.1_3'UTR|WT1_uc009yjs.1_RNA	NM_024426	NP_077744			Wilms tumor 1 isoform D						adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding		EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)					D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				---	---	---	---
Unknown	0	broad.mit.edu	37	11	32596036	32596036	+	IGR	DEL	A	-	-	rs113959499		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32596036delA								WIT1 (127775 upstream) : EIF3M (9355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	32911368	32911369	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32911368_32911369insA								PRRG4 (35265 upstream) : QSER1 (3423 downstream)																																			---	---	---	---
C11orf41	25758	broad.mit.edu	37	11	33639896	33639896	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33639896delA	uc001mup.3	+							NM_012194	NP_036326			hypothetical protein LOC25758							integral to membrane				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	33981911	33981912	+	IGR	INS	-	TT	TT	rs35227042		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33981911_33981912insTT								LMO2 (68075 upstream) : CAPRIN1 (91318 downstream)																																			---	---	---	---
CD44	960	broad.mit.edu	37	11	35220989	35220990	+	Intron	INS	-	A	A	rs148820083	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35220989_35220990insA	uc001mvu.2	+						CD44_uc001mvv.2_Intron|CD44_uc001mvw.2_Intron|CD44_uc001mvx.2_Intron|CD44_uc001mvy.2_Intron|CD44_uc001mwc.3_Intron|CD44_uc010rer.1_Intron|CD44_uc009ykh.2_Intron|CD44_uc010res.1_Intron|CD44_uc010ret.1_Intron|CD44_uc010reu.1_Intron	NM_000610	NP_000601			CD44 antigen isoform 1 precursor						cell-cell adhesion|cell-matrix adhesion|interferon-gamma-mediated signaling pathway|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation	cell surface|Golgi apparatus|integral to plasma membrane	collagen binding|hyaluronic acid binding|receptor activity			pancreas(1)	1	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronidase(DB00070)													---	---	---	---
PAMR1	25891	broad.mit.edu	37	11	35455394	35455397	+	Intron	DEL	GAGG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35455394_35455397delGAGG	uc001mwg.2	-						PAMR1_uc001mwf.2_Intron|PAMR1_uc010rew.1_Intron|PAMR1_uc010rex.1_Intron	NM_001001991	NP_001001991			regeneration associated muscle protease isoform						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	35623933	35623934	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35623933_35623934delTG								PAMR1 (72085 upstream) : FJX1 (15801 downstream)																																			---	---	---	---
LDLRAD3	143458	broad.mit.edu	37	11	35986538	35986539	+	Intron	INS	-	A	A	rs112086351		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35986538_35986539insA	uc001mwk.1	+						LDLRAD3_uc010rey.1_Intron|LDLRAD3_uc010rez.1_Intron	NM_174902	NP_777562			low density lipoprotein receptor class A domain							integral to membrane	receptor activity			central_nervous_system(1)	1	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)																---	---	---	---
PRR5L	79899	broad.mit.edu	37	11	36387964	36387967	+	Intron	DEL	GAGA	-	-	rs71465991		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36387964_36387967delGAGA	uc001mwo.3	+							NM_001160167	NP_001153639			protor-2 isoform a											ovary(1)	1																		---	---	---	---
C11orf74	119710	broad.mit.edu	37	11	36621505	36621505	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36621505delT	uc001mwy.1	+						RAG2_uc001mwv.3_5'Flank|C11orf74_uc010rfd.1_Intron|C11orf74_uc001mww.1_Intron|C11orf74_uc001mwx.1_Intron|C11orf74_uc001mwz.1_Intron|C11orf74_uc010rfe.1_Intron	NM_138787	NP_620142			hypothetical protein LOC119710												0	all_lung(20;0.226)	all_hematologic(20;0.0118)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	36758141	36758142	+	IGR	INS	-	T	T	rs140301396	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36758141_36758142insT								C11orf74 (61751 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	38925733	38925733	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:38925733delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	39317347	39317356	+	IGR	DEL	AGACAAATAC	-	-	rs112355773		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39317347_39317356delAGACAAATAC								None (None upstream) : LRRC4C (818397 downstream)																																			---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40722997	40722997	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40722997delA	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980			netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	41834469	41834469	+	IGR	DEL	A	-	-	rs71481443		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:41834469delA								LRRC4C (353146 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	42763436	42763436	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42763436delT								None (None upstream) : API5 (570069 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	45473660	45473660	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45473660delT								SYT13 (165776 upstream) : CHST1 (196767 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	45739910	45739910	+	5'Flank	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45739910delG	uc010rgg.1	-						uc001nau.2_5'Flank|uc010rgh.1_5'Flank|uc001nav.2_5'Flank|uc001naw.1_5'Flank|uc010rgi.1_5'Flank|uc001nax.1_5'Flank|uc001nay.2_5'Flank					DQ586575																														---	---	---	---
MYBPC3	4607	broad.mit.edu	37	11	47361671	47361672	+	Intron	INS	-	AC	AC	rs145375791	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47361671_47361672insAC	uc001nfa.3	-						MYBPC3_uc010rhl.1_Intron	NM_000256	NP_000247			myosin binding protein C, cardiac						cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding			ovary(2)|central_nervous_system(1)	3				Lung(87;0.176)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	48361050	48361050	+	IGR	DEL	C	-	-	rs113248100		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48361050delC								OR4C3 (13570 upstream) : OR4C45 (5852 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48361295	48361299	+	IGR	DEL	AAGTC	-	-	rs112247977		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48361295_48361299delAAGTC								OR4C3 (13815 upstream) : OR4C45 (5603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50001417	50001417	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50001417delA								OR4C13 (26515 upstream) : OR4C12 (1693 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50669139	50669139	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50669139delC								LOC646813 (289336 upstream) : OR4A5 (742309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	59470324	59470324	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59470324delA								PATL1 (33813 upstream) : OR10V1 (10065 downstream)																																			---	---	---	---
CD6	923	broad.mit.edu	37	11	60758272	60758280	+	Intron	DEL	TACTGGACA	-	-	rs112339941		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60758272_60758280delTACTGGACA	uc001nqq.2	+						CD6_uc009yni.2_Intron|CD6_uc009ynj.2_Intron|CD6_uc001nqp.2_Intron|CD6_uc001nqr.2_Intron|CD6_uc001nqs.2_Intron|CD6_uc001nqt.2_Intron	NM_006725	NP_006716			CD6 molecule precursor						cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1																		---	---	---	---
SYT7	9066	broad.mit.edu	37	11	61323245	61323246	+	Intron	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61323245_61323246delGT	uc001nrv.2	-						SYT7_uc009ynr.2_Intron|SYT7_uc001nrx.1_Intron	NM_004200	NP_004191			synaptotagmin VII							cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			ovary(3)|pancreas(1)	4																		---	---	---	---
AHNAK	79026	broad.mit.edu	37	11	62309607	62309608	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62309607_62309608delCA	uc001ntl.2	-						AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611			AHNAK nucleoprotein isoform 1						nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)																---	---	---	---
C11orf48	79081	broad.mit.edu	37	11	62441141	62441142	+	5'Flank	INS	-	T	T	rs36018053		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62441141_62441142insT	uc001nue.2	-						C11orf48_uc001nuf.2_5'Flank|C11orf48_uc010rmd.1_5'Flank	NM_024099	NP_077004			hypothetical protein LOC79081												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	64229873	64229873	+	IGR	DEL	T	-	-	rs76916131		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64229873delT								RPS6KA4 (90187 upstream) : SLC22A11 (93225 downstream)																																			---	---	---	---
PPP2R5B	5526	broad.mit.edu	37	11	64691972	64691973	+	5'Flank	INS	-	A	A	rs148255296	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64691972_64691973insA	uc001oby.2	+						PPP2R5B_uc001obz.2_5'Flank	NM_006244	NP_006235			beta isoform of regulatory subunit B56, protein						signal transduction	cytoplasm|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(2)	2																		---	---	---	---
ZDHHC24	254359	broad.mit.edu	37	11	66308189	66308189	+	Intron	DEL	A	-	-	rs72534195		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66308189delA	uc001oin.1	-						ZDHHC24_uc001oim.1_Intron|ZDHHC24_uc009yrg.1_Intron	NM_207340	NP_997223			zinc finger, DHHC-type containing 24							integral to membrane	acyltransferase activity|zinc ion binding				0																		---	---	---	---
PC	5091	broad.mit.edu	37	11	66641437	66641438	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66641437_66641438insT	uc001ojn.1	-						PC_uc001ojo.1_Intron|PC_uc001ojp.1_Intron	NM_022172	NP_071504			pyruvate carboxylase precursor						gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity			ovary(2)|lung(1)|kidney(1)	4		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)													---	---	---	---
SHANK2	22941	broad.mit.edu	37	11	70713222	70713222	+	Intron	DEL	A	-	-	rs34341953		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70713222delA	uc001oqc.2	-							NM_012309	NP_036441			SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	71141545	71141546	+	IGR	INS	-	GTGGTGGT	GTGGTGGT	rs141674169	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71141545_71141546insGTGGTGGT								SHANK2 (205737 upstream) : DHCR7 (3913 downstream)																																			---	---	---	---
ARHGEF17	9828	broad.mit.edu	37	11	73032313	73032314	+	Intron	INS	-	TCT	TCT	rs143394387	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73032313_73032314insTCT	uc001otu.2	+							NM_014786	NP_055601			Rho guanine nucleotide exchange factor (GEF) 17						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity				0																		---	---	---	---
FAM168A	23201	broad.mit.edu	37	11	73248354	73248354	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73248354delT	uc001otz.1	-						FAM168A_uc001oty.1_Intron|FAM168A_uc009ytp.1_Intron	NM_015159	NP_055974			hypothetical protein LOC23201												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	73350758	73350758	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73350758delT								FAM168A (41530 upstream) : PLEKHB1 (6465 downstream)																																			---	---	---	---
PLEKHB1	58473	broad.mit.edu	37	11	73362399	73362399	+	Intron	DEL	A	-	-	rs35147175		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73362399delA	uc001oua.2	+						PLEKHB1_uc001oub.2_Intron|PLEKHB1_uc010rrh.1_Intron|PLEKHB1_uc001ouc.2_Intron|PLEKHB1_uc001oud.2_Intron|PLEKHB1_uc009ytq.2_Intron	NM_021200	NP_067023			pleckstrin homology domain containing, family B						multicellular organismal development|phototransduction	cytoplasm|integral to membrane	signal transducer activity			ovary(1)|lung(1)	2																		---	---	---	---
POLD3	10714	broad.mit.edu	37	11	74336916	74336917	+	Intron	INS	-	TG	TG	rs142784051	by1000genomes;by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74336916_74336917insTG	uc001ovf.1	+						POLD3_uc009yua.1_Intron	NM_006591	NP_006582			DNA-directed DNA polymerase delta 3						base-excision repair|DNA strand elongation involved in DNA replication|DNA synthesis involved in DNA repair|mismatch repair|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm	DNA-directed DNA polymerase activity|protein binding			kidney(2)|ovary(1)	3	Breast(11;3.21e-06)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	75401199	75401200	+	IGR	INS	-	ACC	ACC	rs33916113		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75401199_75401200insACC								MAP6 (21720 upstream) : MOGAT2 (27734 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	75408908	75408908	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75408908delT								MAP6 (29429 upstream) : MOGAT2 (20026 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	75967407	75967408	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75967407_75967408insA								WNT11 (45604 upstream) : PRKRIR (93596 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	76005473	76005476	+	IGR	DEL	CAAC	-	-	rs57753671		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76005473_76005476delCAAC								WNT11 (83670 upstream) : PRKRIR (55528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	77374064	77374065	+	IGR	INS	-	CA	CA	rs140823768	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77374064_77374065insCA								CLNS1A (25213 upstream) : RSF1 (3210 downstream)																																			---	---	---	---
INTS4	92105	broad.mit.edu	37	11	77666822	77666823	+	Intron	DEL	GA	-	-	rs111550299		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77666822_77666823delGA	uc001oys.2	-						INTS4_uc001oyt.2_Intron|INTS4_uc001oyu.1_Intron	NM_033547	NP_291025			integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)															---	---	---	---
NARS2	79731	broad.mit.edu	37	11	78179457	78179458	+	Intron	INS	-	T	T	rs112260820		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78179457_78179458insT	uc001ozi.2	-						NARS2_uc010rsq.1_Intron	NM_024678	NP_078954			asparaginyl-tRNA synthetase 2, mitochondrial						asparaginyl-tRNA aminoacylation	mitochondrial matrix	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding			ovary(2)	2	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)													---	---	---	---
ODZ4	26011	broad.mit.edu	37	11	78946917	78946917	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78946917delT	uc001ozl.3	-						ODZ4_uc009yvc.2_Intron	NM_001098816	NP_001092286			odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	79241372	79241372	+	IGR	DEL	T	-	-	rs35349821		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79241372delT								ODZ4 (89677 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	80012197	80012197	+	IGR	DEL	A	-	-	rs68164696		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80012197delA								ODZ4 (860502 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	80730377	80730377	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80730377delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	81243806	81243806	+	IGR	DEL	A	-	-	rs147237776		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81243806delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	81593914	81593914	+	Intron	DEL	T	-	-	rs79970681		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81593914delT	uc001ozo.1	-											Homo sapiens cDNA clone IMAGE:5298883.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	83032334	83032334	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83032334delC	uc001pag.2	+											Homo sapiens cDNA clone IMAGE:5296561.																														---	---	---	---
DLG2	1740	broad.mit.edu	37	11	84973982	84973982	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84973982delC	uc001pak.2	-							NM_001142699	NP_001136171			chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
SYTL2	54843	broad.mit.edu	37	11	85458924	85458924	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85458924delA	uc010rth.1	-						SYTL2_uc010rtg.1_Intron|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Intron|SYTL2_uc001pbf.3_Intron	NM_001162951	NP_001156423			synaptotagmin-like 2 isoform g						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	89769257	89769257	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89769257delA	uc010rua.1	+							NM_020358	NP_065091			ring finger protein 18																														---	---	---	---
CHORDC1	26973	broad.mit.edu	37	11	89943548	89943549	+	Intron	INS	-	CAGA	CAGA	rs150562845	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89943548_89943549insCAGA	uc001pdg.2	-						CHORDC1_uc009yvz.2_Intron	NM_012124	NP_036256			cysteine and histidine-rich domain-containing						chaperone-mediated protein folding|regulation of response to stress|response to stress		Hsp90 protein binding|identical protein binding				0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.00915)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	90094468	90094468	+	IGR	DEL	A	-	-	rs138230727	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90094468delA								CHORDC1 (137936 upstream) : MIR1261 (507821 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	91968239	91968239	+	IGR	DEL	A	-	-	rs11360371		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91968239delA								None (None upstream) : FAT3 (117023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	94739783	94739783	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94739783delG								KDM4D (7109 upstream) : KDM4DL (18639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	95397354	95397354	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95397354delT								SESN3 (431649 upstream) : FAM76B (104752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	97200043	97200043	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97200043delT								None (None upstream) : None (None downstream)																																			---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	99070698	99070699	+	Intron	INS	-	CAT	CAT	rs147514290	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99070698_99070699insCAT	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176			contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	101158344	101158347	+	IGR	DEL	AGAC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101158344_101158347delAGAC								PGR (157800 upstream) : TRPC6 (163949 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	101211037	101211040	+	IGR	DEL	TAAG	-	-	rs34560251		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101211037_101211040delTAAG								PGR (210493 upstream) : TRPC6 (111256 downstream)																																			---	---	---	---
YAP1	10413	broad.mit.edu	37	11	102054434	102054435	+	Intron	DEL	TG	-	-	rs55649437		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102054434_102054435delTG	uc001pgt.2	+						YAP1_uc001pgs.2_Intron|YAP1_uc001pgu.2_Intron|YAP1_uc001pgv.2_Intron|YAP1_uc010ruo.1_Intron|YAP1_uc001pgw.2_Intron|YAP1_uc010rup.1_5'Flank	NM_001130145	NP_001123617			Yes-associated protein 1, 65kDa isoform 1						cell proliferation|cellular response to gamma radiation|contact inhibition|hippo signaling cascade|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_cancers(8;0.000575)|all_epithelial(12;0.00564)	Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.00936)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0189)														---	---	---	---
PDGFD	80310	broad.mit.edu	37	11	103997615	103997632	+	Intron	DEL	AGAGTAAAAAATTACATG	-	-	rs113401077		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103997615_103997632delAGAGTAAAAAATTACATG	uc001phq.2	-						PDGFD_uc001php.2_Intron	NM_025208	NP_079484			platelet derived growth factor D isoform 1						positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	104468781	104468781	+	IGR	DEL	A	-	-	rs112189057		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104468781delA								PDGFD (433754 upstream) : CASP12 (287661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	108479549	108479550	+	IGR	INS	-	AAAAC	AAAAC			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108479549_108479550insAAAAC								EXPH5 (15175 upstream) : DDX10 (56266 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	108976454	108976456	+	IGR	DEL	TTG	-	-	rs111399974		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108976454_108976456delTTG								DDX10 (164808 upstream) : C11orf87 (316419 downstream)																																			---	---	---	---
ARHGAP20	57569	broad.mit.edu	37	11	110496432	110496433	+	Intron	DEL	AT	-	-	rs10542154		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110496432_110496433delAT	uc001pkz.1	-						ARHGAP20_uc001pky.1_Intron|ARHGAP20_uc009yyb.1_Intron|ARHGAP20_uc001pla.1_Intron	NM_020809	NP_065860			Rho GTPase activating protein 20						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)|kidney(2)	5		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)														---	---	---	---
ARHGAP20	57569	broad.mit.edu	37	11	110540195	110540196	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110540195_110540196insA	uc001pkz.1	-						ARHGAP20_uc001pky.1_Intron|ARHGAP20_uc009yyb.1_Intron|ARHGAP20_uc001pla.1_Intron	NM_020809	NP_065860			Rho GTPase activating protein 20						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)|kidney(2)	5		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	112629395	112629396	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112629395_112629396delGT								PTS (488718 upstream) : NCAM1 (202599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	113558210	113558213	+	IGR	DEL	TGTC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113558210_113558213delTGTC								DRD2 (211797 upstream) : TMPRSS5 (56 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	113904737	113904740	+	IGR	DEL	TGTG	-	-	rs143756553		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113904737_113904740delTGTG								HTR3A (43705 upstream) : ZBTB16 (25691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	114657540	114657541	+	IGR	INS	-	C	C	rs143493044	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114657540_114657541insC								FAM55B (79888 upstream) : CADM1 (382412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116145687	116145688	+	IGR	DEL	GT	-	-	rs7121267		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116145687_116145688delGT								CADM1 (770446 upstream) : BUD13 (473200 downstream)																																			---	---	---	---
PCSK7	9159	broad.mit.edu	37	11	117085108	117085109	+	Intron	INS	-	CAAGGAGG	CAAGGAGG	rs148973131	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117085108_117085109insCAAGGAGG	uc001pqr.2	-							NM_004716	NP_004707			proprotein convertase subtilisin/kexin type 7						peptide hormone processing	integral to Golgi membrane	serine-type endopeptidase activity				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)				T	IGH@	MLCLS								---	---	---	---
DSCAML1	57453	broad.mit.edu	37	11	117647023	117647023	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117647023delA	uc001prh.1	-						DSCAML1_uc001pri.1_Intron	NM_020693	NP_065744			Down syndrome cell adhesion molecule like 1						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)														---	---	---	---
DSCAML1	57453	broad.mit.edu	37	11	117671282	117671282	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117671282delT	uc001pri.1	-											Homo sapiens mRNA for KIAA1132 protein, partial cds.						axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	118807577	118807578	+	IGR	DEL	TT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118807577_118807578delTT								BCL9L (25964 upstream) : UPK2 (19448 downstream)																																			---	---	---	---
VPS11	55823	broad.mit.edu	37	11	118937684	118937685	+	5'Flank	INS	-	T	T	rs140967588		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118937684_118937685insT	uc010ryx.1	+						VPS11_uc010ryy.1_5'Flank	NM_021729	NP_068375			vacuolar protein sorting 11						protein transport	endocytic vesicle|HOPS complex|late endosome membrane|lysosomal membrane	nucleotide binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	119713199	119713200	+	IGR	INS	-	CA	CA	rs140907457	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119713199_119713200insCA								PVRL1 (113764 upstream) : TRIM29 (268795 downstream)																																			---	---	---	---
SORL1	6653	broad.mit.edu	37	11	121339428	121339428	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121339428delC	uc001pxx.2	+							NM_003105	NP_003096			sortilin-related receptor containing LDLR class						cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	121585104	121585105	+	IGR	DEL	TA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121585104_121585105delTA								SORL1 (80633 upstream) : LOC399959 (374706 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	122267391	122267391	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122267391delG								LOC399959 (28924 upstream) : UBASH3B (259007 downstream)																																			---	---	---	---
ST14	6768	broad.mit.edu	37	11	130061657	130061657	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130061657delT	uc001qfw.2	+						ST14_uc010sca.1_Intron	NM_021978	NP_068813			matriptase						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	130463713	130463713	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130463713delC								ADAMTS15 (119998 upstream) : SNX19 (282054 downstream)																																			---	---	---	---
NTM	50863	broad.mit.edu	37	11	131735632	131735633	+	Intron	INS	-	AT	AT	rs142684063	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131735632_131735633insAT	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530			neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
OPCML	4978	broad.mit.edu	37	11	132794786	132794787	+	Intron	INS	-	T	T	rs146916119	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132794786_132794787insT	uc001qgs.2	-						OPCML_uc001qgu.2_Intron|OPCML_uc010sck.1_Intron|OPCML_uc001qgt.2_Intron|OPCML_uc010scl.1_Intron	NM_002545	NP_002536			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	134486501	134486501	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134486501delT								B3GAT1 (204689 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	70226	70226	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70226delT								None (None upstream) : LOC100288778 (4046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	169091	169094	+	IGR	DEL	CTGA	-	-	rs139655934		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:169091_169094delCTGA								FAM138D (19679 upstream) : IQSEC3 (7109 downstream)																																			---	---	---	---
KDM5A	5927	broad.mit.edu	37	12	393805	393805	+	3'UTR	DEL	T	-	-	rs71649836		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:393805delT	uc001qif.1	-	28					KDM5A_uc001qie.1_3'UTR	NM_001042603	NP_001036068			retinoblastoma binding protein 2 isoform 1						chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3								T 	NUP98	AML								---	---	---	---
RAD52	5893	broad.mit.edu	37	12	1048218	1048219	+	Intron	INS	-	TGTG	TGTG	rs61917202		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1048218_1048219insTGTG	uc001qis.1	-						RAD52_uc001qit.1_Intron|RAD52_uc010sdt.1_Intron|RAD52_uc001qiu.1_Intron|RAD52_uc001qiv.1_Intron|RAD52_uc001qiw.1_Intron|RAD52_uc010sdu.1_Intron	NM_134424	NP_602296			RAD52 homolog						DNA recombinase assembly|mitotic recombination|reciprocal meiotic recombination	nucleoplasm	DNA binding|protein binding			central_nervous_system(1)	1	all_cancers(10;0.0119)|all_epithelial(11;0.0171)|all_lung(10;0.0521)|Ovarian(42;0.0816)|Lung NSC(10;0.0987)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.0323)										Homologous_recombination					---	---	---	---
CACNA2D4	93589	broad.mit.edu	37	12	2025743	2025744	+	Intron	INS	-	AGC	AGC			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2025743_2025744insAGC	uc001qjp.2	-						CACNA2D4_uc009zds.1_Intron|CACNA2D4_uc009zdt.1_Intron	NM_172364	NP_758952			voltage-gated calcium channel alpha(2)delta-4							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)														---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2656822	2656823	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2656822_2656823delTG	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc009zdy.1_Intron|CACNA1C_uc001qkv.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	4013216	4013216	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4013216delT								PARP11 (30608 upstream) : CCND2 (369686 downstream)																																			---	---	---	---
FGF6	2251	broad.mit.edu	37	12	4545930	4545932	+	Intron	DEL	TCT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4545930_4545932delTCT	uc001qmr.1	-							NM_020996	NP_066276			fibroblast growth factor 6 precursor						angiogenesis|cell proliferation|cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell division|positive regulation of cell proliferation	extracellular space	growth factor activity			lung(2)|ovary(1)	3			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)															---	---	---	---
VWF	7450	broad.mit.edu	37	12	6138254	6138254	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6138254delA	uc001qnn.1	-						VWF_uc010set.1_Intron	NM_000552	NP_000543			von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)													---	---	---	---
C12orf53	196500	broad.mit.edu	37	12	6809653	6809653	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6809653delG	uc001qqf.1	-						C12orf53_uc001qqg.1_Intron	NM_153685	NP_710152			hypothetical protein LOC196500 precursor							integral to membrane					0																		---	---	---	---
A2M	2	broad.mit.edu	37	12	9260470	9260471	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9260470_9260471insT	uc001qvk.1	-						A2M_uc009zgk.1_Intron	NM_000014	NP_000005			alpha-2-macroglobulin precursor						blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)													---	---	---	---
MIR1244	100302285	broad.mit.edu	37	12	9394744	9394745	+	5'Flank	INS	-	TT	TT	rs77464119		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9394744_9394745insTT	hsa-mir-1244-3|MI0015975	-						uc001qvm.1_RNA																	0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	11600101	11600102	+	IGR	INS	-	AAAG	AAAG	rs141471688	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11600101_11600102insAAAG								PRB2 (51603 upstream) : ETV6 (202686 downstream)																																			---	---	---	---
DUSP16	80824	broad.mit.edu	37	12	12640597	12640598	+	Intron	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12640597_12640598delGT	uc001rao.1	-						DUSP16_uc001ran.1_Intron	NM_030640	NP_085143			dual specificity phosphatase 16						inactivation of MAPK activity|MAPK export from nucleus|MAPK phosphatase export from nucleus, leptomycin B sensitive	cytoplasmic membrane-bounded vesicle|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)														---	---	---	---
DUSP16	80824	broad.mit.edu	37	12	12713881	12713882	+	Intron	DEL	CA	-	-	rs71890495		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12713881_12713882delCA	uc001rao.1	-							NM_030640	NP_085143			dual specificity phosphatase 16						inactivation of MAPK activity|MAPK export from nucleus|MAPK phosphatase export from nucleus, leptomycin B sensitive	cytoplasmic membrane-bounded vesicle|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Prostate(47;0.0687)		BRCA - Breast invasive adenocarcinoma(232;0.0203)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	15066969	15066969	+	IGR	DEL	T	-	-	rs34204704		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15066969delT								MGP (28141 upstream) : ERP27 (8 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	17192904	17192905	+	IGR	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17192904_17192905delAC								LMO3 (430146 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	18311376	18311377	+	IGR	INS	-	GT	GT	rs151052935	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18311376_18311377insGT								RERGL (68262 upstream) : PIK3C2G (103097 downstream)																																			---	---	---	---
PDE3A	5139	broad.mit.edu	37	12	20810916	20810916	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20810916delG	uc001reh.1	+							NM_000921	NP_000912			phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	23385216	23385217	+	IGR	INS	-	A	A	rs34890500		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23385216_23385217insA								ETNK1 (541609 upstream) : SOX5 (300015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	23641424	23641424	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23641424delG								ETNK1 (797817 upstream) : SOX5 (43808 downstream)																																			---	---	---	---
SOX5	6660	broad.mit.edu	37	12	23943476	23943477	+	Intron	DEL	AA	-	-	rs113508034		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23943476_23943477delAA	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_Intron|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Intron|SOX5_uc001rga.2_Intron	NM_006940	NP_008871			SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
SOX5	6660	broad.mit.edu	37	12	23979634	23979634	+	Intron	DEL	A	-	-	rs34746862		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23979634delA	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_Intron|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Intron|SOX5_uc001rga.2_Intron	NM_006940	NP_008871			SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
SOX5	6660	broad.mit.edu	37	12	24103912	24103915	+	5'Flank	DEL	CACA	-	-	rs144378502		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24103912_24103915delCACA	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_5'UTR|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_5'Flank|SOX5_uc001rga.2_5'UTR	NM_006940	NP_008871			SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
LRMP	4033	broad.mit.edu	37	12	25251544	25251545	+	Intron	DEL	CC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25251544_25251545delCC	uc001rgh.2	+						LRMP_uc010sja.1_Intron|LRMP_uc010sjb.1_Intron|LRMP_uc001rgi.2_Intron|LRMP_uc010sjc.1_Intron|LRMP_uc010sjd.1_Intron	NM_006152	NP_006143			lymphoid-restricted membrane protein						vesicle fusion|vesicle targeting	endoplasmic reticulum membrane|integral to plasma membrane				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)																	---	---	---	---
CASC1	55259	broad.mit.edu	37	12	25334618	25334619	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25334618_25334619insA	uc001rgl.2	-						CASC1_uc001rgk.2_Intron|CASC1_uc001rgm.3_Intron|CASC1_uc001rgj.2_Intron|CASC1_uc010sje.1_Intron|CASC1_uc010sjf.1_Intron|CASC1_uc010sjg.1_Intron|CASC1_uc010sjh.1_Intron	NM_001082973	NP_001076442			cancer susceptibility candidate 1 isoform b											ovary(2)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	26325700	26325701	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26325700_26325701insT	uc001rhc.2	+											Homo sapiens cDNA clone IMAGE:5300499.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	27372505	27372506	+	IGR	INS	-	T	T	rs150770870	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27372505_27372506insT								C12orf71 (137050 upstream) : STK38L (24572 downstream)																																			---	---	---	---
STK38L	23012	broad.mit.edu	37	12	27398807	27398809	+	Intron	DEL	ATA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27398807_27398809delATA	uc001rhr.2	+						STK38L_uc001rhs.2_Intron|STK38L_uc010sjm.1_Intron	NM_015000	NP_055815			serine/threonine kinase 38 like						intracellular protein kinase cascade|regulation of cellular component organization	actin cytoskeleton|cytoplasm	actin binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|kidney(1)	5	Colorectal(261;0.0847)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	28857358	28857359	+	IGR	INS	-	T	T	rs139818700	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28857358_28857359insT								CCDC91 (154260 upstream) : FAR2 (444873 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	29007851	29007856	+	IGR	DEL	CAAGCT	-	-	rs141975206		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29007851_29007856delCAAGCT								CCDC91 (304753 upstream) : FAR2 (294376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	30583504	30583505	+	IGR	INS	-	G	G	rs112511908		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30583504_30583505insG								TMTC1 (645812 upstream) : IPO8 (198418 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	30608149	30608150	+	IGR	INS	-	T	T	rs147673603	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30608149_30608150insT								TMTC1 (670457 upstream) : IPO8 (173773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	30756174	30756175	+	IGR	INS	-	A	A	rs139409745	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30756174_30756175insA								TMTC1 (818482 upstream) : IPO8 (25748 downstream)																																			---	---	---	---
DENND5B	160518	broad.mit.edu	37	12	31549295	31549295	+	Intron	DEL	T	-	-	rs113360395		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31549295delT	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron	NM_144973	NP_659410			DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	31962520	31962521	+	IGR	INS	-	ATT	ATT	rs143768455	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31962520_31962521insATT								H3F3C (17345 upstream) : C12orf35 (149832 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	32208867	32208868	+	IGR	DEL	AT	-	-	rs76682153		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32208867_32208868delAT								C12orf35 (62836 upstream) : BICD1 (51317 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	32596711	32596711	+	IGR	DEL	A	-	-	rs141746554		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32596711delA								BICD1 (65571 upstream) : FGD4 (42195 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34395421	34395422	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34395421_34395422delTG								ALG10 (214187 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38065567	38065567	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38065567delA								None (None upstream) : ALG10B (644990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38113261	38113261	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38113261delT								None (None upstream) : ALG10B (597296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	46848780	46848780	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46848780delT								SLC38A2 (82135 upstream) : SLC38A4 (309764 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	47129915	47129916	+	IGR	DEL	AT	-	-	rs36019556		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47129915_47129916delAT								SLC38A2 (363270 upstream) : SLC38A4 (28628 downstream)																																			---	---	---	---
PFKM	5213	broad.mit.edu	37	12	48506117	48506117	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48506117delG	uc001rrb.1	+						PFKM_uc001rra.1_Intron	NM_000289	NP_000280			phosphofructokinase, muscle						fructose 6-phosphate metabolic process|glycolysis|muscle cell homeostasis	6-phosphofructokinase complex|apical plasma membrane	6-phosphofructokinase activity|ATP binding|identical protein binding|kinase binding|metal ion binding|protein C-terminus binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	49928067	49928068	+	IGR	INS	-	A	A	rs142255590	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49928067_49928068insA								SPATS2 (6860 upstream) : KCNH3 (4872 downstream)																																			---	---	---	---
LIMA1	51474	broad.mit.edu	37	12	50599577	50599578	+	Intron	INS	-	A	A	rs79375215		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50599577_50599578insA	uc001rwj.3	-						LIMA1_uc001rwh.3_Intron|LIMA1_uc001rwi.3_Intron|LIMA1_uc001rwk.3_Intron|LIMA1_uc010smr.1_Intron|LIMA1_uc010sms.1_Intron	NM_016357	NP_057441			LIM domain and actin binding 1 isoform b						actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1																		---	---	---	---
DIP2B	57609	broad.mit.edu	37	12	51136679	51136679	+	Intron	DEL	A	-	-	rs75661397		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51136679delA	uc001rwv.2	+						DIP2B_uc009zlt.2_Intron	NM_173602	NP_775873			DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	53392098	53392099	+	IGR	INS	-	T	T	rs142512409		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53392098_53392099insT								KRT18 (45414 upstream) : EIF4B (7963 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	54551776	54551776	+	IGR	DEL	A	-	-	rs111490088		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54551776delA								LOC400043 (25157 upstream) : SMUG1 (22007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	54685292	54685293	+	IGR	INS	-	A	A	rs34616263		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54685292_54685293insA								HNRNPA1 (4420 upstream) : NFE2 (605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	54706904	54706905	+	IGR	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54706904_54706905delAG								NFE2 (12113 upstream) : COPZ1 (12006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	58464130	58464131	+	IGR	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58464130_58464131delTC								XRCC6BP1 (113079 upstream) : LRIG3 (801807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	58976396	58976397	+	Intron	INS	-	TATGA	TATGA	rs140218320	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58976396_58976397insTATGA	uc001sqq.1	-											Homo sapiens cDNA FLJ35805 fis, clone TESTI2005982.																														---	---	---	---
FAM19A2	338811	broad.mit.edu	37	12	62296689	62296690	+	Intron	DEL	AA	-	-	rs148379944		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62296689_62296690delAA	uc001sqw.2	-						FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634			family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	67935467	67935467	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67935467delC	uc001stq.1	+											Homo sapiens cDNA FLJ31412 fis, clone NT2NE2000222.																														---	---	---	---
RAP1B	5908	broad.mit.edu	37	12	69019701	69019701	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69019701delA	uc001sub.2	+						RAP1B_uc010ste.1_Intron|RAP1B_uc001suc.2_Intron|RAP1B_uc010stf.1_Intron|RAP1B_uc010stg.1_Intron|RAP1B_uc010sth.1_Intron|RAP1B_uc010sti.1_Intron	NM_001089704	NP_001083173			SubName: Full=Ras-related protein Rap-1A; SubName: Full=cDNA FLJ75985, highly similar to Homo sapiens RAP1A, member of RAS oncogene family (RAP1A), transcript variant 2, mRNA; SubName: Full=RAP1A, member of RAS oncogene family;						blood coagulation|energy reserve metabolic process|regulation of establishment of cell polarity|regulation of insulin secretion	cell-cell junction|cytosol	GDP binding|GTP binding|GTPase activity|protein binding				0	Breast(13;1.24e-05)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)	GBM - Glioblastoma multiforme(7;0.000306)														---	---	---	---
FRS2	10818	broad.mit.edu	37	12	69878113	69878113	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69878113delT	uc001suy.2	+						FRS2_uc001suz.2_Intron|FRS2_uc009zrj.2_Intron|FRS2_uc009zrk.2_Intron	NM_006654	NP_006645			fibroblast growth factor receptor substrate 2						activation of MAPKK activity|activation of phospholipase C activity|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|transmembrane receptor protein tyrosine phosphatase signaling pathway	endomembrane system|endosome|integral to plasma membrane|membrane fraction	fibroblast growth factor receptor binding|insulin receptor binding|phosphatase activator activity|transmembrane receptor protein tyrosine kinase adaptor activity			prostate(1)|kidney(1)	2	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)															---	---	---	---
CCT2	10576	broad.mit.edu	37	12	69983063	69983064	+	Intron	DEL	TT	-	-	rs3841585		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69983063_69983064delTT	uc001svb.1	+						CCT2_uc009zrm.1_Intron|CCT2_uc009zrn.1_Intron|CCT2_uc010stl.1_Intron	NM_006431	NP_006422			chaperonin containing TCP1, subunit 2						'de novo' posttranslational protein folding	nucleus	ATP binding|unfolded protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)															---	---	---	---
CNOT2	4848	broad.mit.edu	37	12	70677427	70677428	+	Intron	INS	-	AA	AA	rs34501610		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70677427_70677428insAA	uc001svv.2	+						CNOT2_uc009zro.2_Intron|CNOT2_uc009zrp.2_Intron|CNOT2_uc009zrq.2_Intron	NM_014515	NP_055330			CCR4-NOT transcription complex, subunit 2						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	73193669	73193669	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73193669delA								TRHDE (134248 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	73306212	73306212	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73306212delT								TRHDE (246791 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	73758973	73758973	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73758973delC								TRHDE (699552 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	74874652	74874653	+	IGR	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74874652_74874653insG								None (None upstream) : ATXN7L3B (56898 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77035687	77035688	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77035687_77035688insT								OSBPL8 (82098 upstream) : ZDHHC17 (122166 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77665862	77665862	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77665862delA								E2F7 (206502 upstream) : NAV3 (559207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	80828010	80828010	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80828010delT								PPP1R12A (498775 upstream) : PTPRQ (10116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	90468352	90468354	+	IGR	DEL	CTC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90468352_90468354delCTC								LOC338758 (362624 upstream) : C12orf12 (877639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	90562874	90562874	+	IGR	DEL	T	-	-	rs35548992		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90562874delT								LOC338758 (457146 upstream) : C12orf12 (783119 downstream)																																			---	---	---	---
BTG1	694	broad.mit.edu	37	12	92541169	92541170	+	5'Flank	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92541169_92541170insT	uc001tby.3	-						uc001tca.2_Intron	NM_001731	NP_001722			B-cell translocation protein 1						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)						T	MYC	BCLL								---	---	---	---
PLXNC1	10154	broad.mit.edu	37	12	94686023	94686023	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94686023delA	uc001tdc.2	+						PLXNC1_uc010sut.1_Intron|PLXNC1_uc009zsv.2_Intron	NM_005761	NP_005752			plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
METAP2	10988	broad.mit.edu	37	12	95892792	95892792	+	Intron	DEL	A	-	-	rs36125447		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95892792delA	uc001tec.2	+						METAP2_uc010suv.1_Intron|METAP2_uc009ztd.2_Intron|METAP2_uc001ted.2_Intron|METAP2_uc001tef.2_Intron|METAP2_uc001tee.2_Intron	NM_006838	NP_006829			methionyl aminopeptidase 2						N-terminal protein amino acid modification|peptidyl-methionine modification|protein processing|proteolysis	cytoplasm	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0					L-Methionine(DB00134)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	96885018	96885018	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96885018delT	uc009ztl.1	+						uc001teq.2_Intron					RecName: Full=Uncharacterized protein C12orf55;																														---	---	---	---
CCDC53	51019	broad.mit.edu	37	12	102417860	102417861	+	Intron	INS	-	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102417860_102417861insC	uc010svw.1	-						CCDC53_uc010svx.1_Intron|CCDC53_uc010svy.1_Intron|CCDC53_uc010svz.1_Intron	NM_016053	NP_057137			coiled-coil domain containing 53							WASH complex	protein binding				0																		---	---	---	---
CHST11	50515	broad.mit.edu	37	12	105011689	105011689	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105011689delT	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
WSCD2	9671	broad.mit.edu	37	12	108546878	108546879	+	Intron	INS	-	CAAACAAA	CAAACAAA	rs140875536	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108546878_108546879insCAAACAAA	uc001tms.2	+						WSCD2_uc001tmt.2_Intron	NM_014653	NP_055468			WSC domain containing 2							integral to membrane				ovary(1)|large_intestine(1)|breast(1)	3																		---	---	---	---
FICD	11153	broad.mit.edu	37	12	108909298	108909298	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108909298delA	uc001tmx.1	+							NM_007076	NP_009007			Huntingtin interacting protein E						negative regulation of Rho GTPase activity	integral to membrane	binding|protein adenylyltransferase activity				0																		---	---	---	---
ACACB	32	broad.mit.edu	37	12	109692901	109692902	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109692901_109692902delAC	uc001tob.2	+						ACACB_uc001toc.2_Intron|ACACB_uc010sxl.1_Intron|ACACB_uc001tod.2_Intron|ACACB_uc010sxm.1_Intron	NM_001093	NP_001084			acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)													---	---	---	---
CUX2	23316	broad.mit.edu	37	12	111478102	111478102	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111478102delC	uc001tsa.1	+							NM_015267	NP_056082			cut-like 2							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6																		---	---	---	---
ALDH2	217	broad.mit.edu	37	12	112225013	112225013	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112225013delA	uc001tst.2	+						ALDH2_uc010syi.1_Intron|ALDH2_uc009zvy.2_Intron	NM_000690	NP_000681			mitochondrial aldehyde dehydrogenase 2						carbohydrate metabolic process|ethanol oxidation|neurotransmitter biosynthetic process|xenobiotic metabolic process	mitochondrial matrix	aldehyde dehydrogenase (NAD) activity|aldehyde dehydrogenase|electron carrier activity			skin(2)|ovary(1)|central_nervous_system(1)	4					Disulfiram(DB00822)|Guanidine(DB00536)|NADH(DB00157)|Nitroglycerin(DB00727)			T	HMGA2	leiomyoma								---	---	---	---
RNF10	9921	broad.mit.edu	37	12	120979677	120979677	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120979677delT	uc001typ.3	+						RNF10_uc010szk.1_Intron	NM_014868	NP_055683			ring finger protein 10						negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
RNF10	9921	broad.mit.edu	37	12	120994889	120994889	+	Intron	DEL	A	-	-	rs146436590		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120994889delA	uc001typ.3	+						RNF10_uc010szk.1_Intron|RNF10_uc001tyq.3_Intron	NM_014868	NP_055683			ring finger protein 10						negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
KDM2B	84678	broad.mit.edu	37	12	121914098	121914099	+	Intron	INS	-	A	A	rs150541167		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121914098_121914099insA	uc001uat.2	-						KDM2B_uc001uar.2_Intron|KDM2B_uc001uas.2_Intron|KDM2B_uc001uau.2_Intron	NM_032590	NP_115979			F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	124729455	124729455	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124729455delC								ZNF664 (229488 upstream) : FAM101A (44255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	125260215	125260215	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125260215delA								NCOR2 (208205 upstream) : SCARB1 (1960 downstream)																																			---	---	---	---
TMEM132B	114795	broad.mit.edu	37	12	125879537	125879537	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125879537delG	uc001uhe.1	+							NM_052907	NP_443139			transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)														---	---	---	---
TMEM132B	114795	broad.mit.edu	37	12	126015282	126015283	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126015282_126015283delTG	uc001uhe.1	+							NM_052907	NP_443139			transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	127300328	127300331	+	IGR	DEL	TGTG	-	-	rs71712225		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127300328_127300331delTGTG								LOC100128554 (342998 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	128131246	128131246	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:128131246delC								None (None upstream) : TMEM132C (768045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	131379900	131379901	+	IGR	DEL	GT	-	-	rs67224987		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131379900_131379901delGT								RAN (19076 upstream) : GPR133 (58551 downstream)																																			---	---	---	---
ZNF268	10795	broad.mit.edu	37	12	133746496	133746497	+	Intron	INS	-	T	T	rs147952599	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133746496_133746497insT	uc010tbv.1	+											RecName: Full=Zinc finger protein 268; AltName: Full=Zinc finger protein 3; AltName: Full=HZF3;							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	19389007	19389007	+	IGR	DEL	T	-	-	rs112593948		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19389007delT								None (None upstream) : LOC284232 (19536 downstream)																																			---	---	---	---
DKFZp686A1627	266695	broad.mit.edu	37	13	19645660	19645660	+	Intron	DEL	G	-	-	rs112020856		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19645660delG	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	19960649	19960653	+	IGR	DEL	GGACT	-	-	rs55819858		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19960649_19960653delGGACT								LOC100101938 (41536 upstream) : TPTE2 (36368 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	20515463	20515463	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20515463delA								ZMYM5 (77687 upstream) : ZMYM2 (17347 downstream)																																			---	---	---	---
IFT88	8100	broad.mit.edu	37	13	21144815	21144816	+	Intron	INS	-	AATAGATT	AATAGATT	rs139553267	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21144815_21144816insAATAGATT	uc001unh.2	+						IFT88_uc001uni.2_Intron|IFT88_uc001unj.2_Intron|IFT88_uc010tcq.1_Intron	NM_175605	NP_783195			intraflagellar transport 88 homolog isoform 1						cilium morphogenesis	centriole|intraflagellar transport particle B|microtubule basal body|microtubule-based flagellum	protein binding			ovary(1)	1		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	21664077	21664077	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21664077delA								LATS2 (28355 upstream) : SAP18 (50576 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22815187	22815187	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22815187delA	uc001uoi.2	+						uc001uoj.2_Intron					Homo sapiens cDNA FLJ30283 fis, clone BRACE2002807.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	22997283	22997284	+	IGR	INS	-	A	A	rs148367447	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22997283_22997284insA								FGF9 (718643 upstream) : SGCG (757776 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	23727315	23727317	+	IGR	DEL	ATG	-	-	rs72370440		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23727315_23727317delATG								None (None upstream) : SGCG (27743 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	24488758	24488758	+	Intron	DEL	G	-	-	rs34525056		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24488758delG	uc001upb.1	-											Homo sapiens cDNA FLJ45359 fis, clone BRHIP3013588.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	25689557	25689558	+	IGR	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25689557_25689558delAC								PABPC3 (16855 upstream) : FAM123A (53115 downstream)																																			---	---	---	---
ATP8A2	51761	broad.mit.edu	37	13	26083410	26083410	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26083410delA	uc001uqk.2	+						ATP8A2_uc010tdi.1_Intron|ATP8A2_uc010tdj.1_Intron|ATP8A2_uc001uql.1_Intron	NM_016529	NP_057613			ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)														---	---	---	---
CDK8	1024	broad.mit.edu	37	13	26883791	26883791	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26883791delT	uc001uqr.1	+						CDK8_uc001uqs.1_Intron|CDK8_uc001uqt.1_Intron	NM_001260	NP_001251			cyclin-dependent kinase 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|large_intestine(1)|ovary(1)|skin(1)	5	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)														---	---	---	---
LNX2	222484	broad.mit.edu	37	13	28130229	28130229	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28130229delT	uc001url.3	-						LNX2_uc001urm.1_Intron	NM_153371	NP_699202			ligand of numb-protein X 2								zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	6		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	28523032	28523032	+	IGR	DEL	T	-	-	rs35109122		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28523032delT								ATP5EP2 (3323 upstream) : CDX2 (13247 downstream)																																			---	---	---	---
FLT3	2322	broad.mit.edu	37	13	28586102	28586102	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28586102delT	uc001urw.2	-						FLT3_uc010aao.2_Intron|FLT3_uc010tdn.1_Intron	NM_004119	NP_004110			fms-related tyrosine kinase 3 precursor						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)			Mis|O		AML|ALL								---	---	---	---
PAN3	255967	broad.mit.edu	37	13	28740556	28740556	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28740556delG	uc010tdo.1	+							NM_175854	NP_787050			PABP1-dependent poly A-specific ribonuclease						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)														---	---	---	---
FLT1	2321	broad.mit.edu	37	13	28964542	28964542	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28964542delT	uc001usb.3	-						FLT1_uc010aar.1_Intron|FLT1_uc001usc.3_Intron|FLT1_uc010aas.1_Intron|FLT1_uc010aat.1_Intron	NM_002019	NP_002010			fms-related tyrosine kinase 1 isoform 1						cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	29106059	29106060	+	IGR	INS	-	GT	GT	rs148730339	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29106059_29106060insGT								FLT1 (36794 upstream) : POMP (127181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	29327465	29327468	+	IGR	DEL	AGGA	-	-	rs141146839	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29327465_29327468delAGGA								SLC46A3 (34315 upstream) : MTUS2 (271280 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	29417404	29417404	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29417404delT								SLC46A3 (124254 upstream) : MTUS2 (181344 downstream)																																			---	---	---	---
MTUS2	23281	broad.mit.edu	37	13	29890461	29890462	+	Intron	INS	-	T	T	rs141600334	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29890461_29890462insT	uc001usl.3	+							NM_001033602	NP_001028774			hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0																		---	---	---	---
HMGB1	3146	broad.mit.edu	37	13	31115126	31115127	+	Intron	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31115126_31115127delGT	uc001usz.2	-							NM_002128	NP_002119			high-mobility group box 1						base-excision repair, DNA ligation|dendritic cell chemotaxis|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|inflammatory response to antigenic stimulus|innate immune response|myeloid dendritic cell activation|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|neuron projection development|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	cell surface|condensed chromosome|extracellular space|nucleolus|nucleoplasm	chemoattractant activity|cytokine activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|repressing transcription factor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(1)	1		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	31573476	31573476	+	IGR	DEL	T	-	-	rs76756466		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31573476delT								C13orf26 (24325 upstream) : HSPH1 (137289 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	33446495	33446495	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33446495delA								PDS5B (94340 upstream) : KL (143706 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	34915607	34915608	+	IGR	INS	-	GTGT	GTGT	rs142051015	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34915607_34915608insGTGT								RFC3 (374913 upstream) : NBEA (600848 downstream)																																			---	---	---	---
SMAD9	4093	broad.mit.edu	37	13	37460886	37460887	+	Intron	INS	-	TGAAGACCCCT	TGAAGACCCCT			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37460886_37460887insTGAAGACCCCT	uc001uvw.2	-						SMAD9_uc001uvx.2_Intron	NM_001127217	NP_001120689			SMAD family member 9 isoform a						BMP signaling pathway|transforming growth factor beta receptor signaling pathway	cytosol|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity				0		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	38032199	38032200	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38032199_38032200insT								CSNK1A1L (352398 upstream) : POSTN (104520 downstream)																																			---	---	---	---
FREM2	341640	broad.mit.edu	37	13	39307452	39307452	+	Intron	DEL	T	-	-	rs11367311		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39307452delT	uc001uwv.2	+							NM_207361	NP_997244			FRAS1-related extracellular matrix protein 2						cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)														---	---	---	---
LHFP	10186	broad.mit.edu	37	13	39972044	39972045	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39972044_39972045delTG	uc001uxf.2	-							NM_005780	NP_005771			lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)				T	HMGA2	lipoma								---	---	---	---
LOC646982	646982	broad.mit.edu	37	13	40925554	40925554	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40925554delA	uc010tfa.1	-						LOC646982_uc001uxj.3_Intron	NR_024507				Homo sapiens cDNA, FLJ17553.												0																		---	---	---	---
FOXO1	2308	broad.mit.edu	37	13	41080382	41080382	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41080382delT	uc010acc.1	-							NM_002015	NP_002006			forkhead box O1						anti-apoptosis|blood vessel development|embryo development|endocrine pancreas development|insulin receptor signaling pathway|negative regulation of stress-activated MAPK cascade|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|response to DNA damage stimulus|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding		PAX3/FOXO1(749)|PAX7/FOXO1(197)	soft_tissue(946)|lung(1)|central_nervous_system(1)	948		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)														---	---	---	---
FOXO1	2308	broad.mit.edu	37	13	41202494	41202495	+	Intron	DEL	AC	-	-	rs72149911		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41202494_41202495delAC	uc001uxl.3	-							NM_002015	NP_002006			forkhead box O1						anti-apoptosis|blood vessel development|embryo development|endocrine pancreas development|insulin receptor signaling pathway|negative regulation of stress-activated MAPK cascade|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|response to DNA damage stimulus|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding		PAX3/FOXO1(749)|PAX7/FOXO1(197)	soft_tissue(946)|lung(1)|central_nervous_system(1)	948		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)														---	---	---	---
FOXO1	2308	broad.mit.edu	37	13	41210350	41210350	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41210350delA	uc001uxl.3	-							NM_002015	NP_002006			forkhead box O1						anti-apoptosis|blood vessel development|embryo development|endocrine pancreas development|insulin receptor signaling pathway|negative regulation of stress-activated MAPK cascade|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|response to DNA damage stimulus|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding		PAX3/FOXO1(749)|PAX7/FOXO1(197)	soft_tissue(946)|lung(1)|central_nervous_system(1)	948		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	41841387	41841387	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41841387delA								MTRF1 (3645 upstream) : NAA16 (43954 downstream)																																			---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	43845803	43845804	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43845803_43845804delAC	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron|ENOX1_uc001uyz.3_Intron	NM_001127615	NP_001121087			ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
CCDC122	160857	broad.mit.edu	37	13	44426088	44426089	+	Intron	INS	-	A	A	rs143765082	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44426088_44426089insA	uc010acf.2	-							NM_144974	NP_659411			coiled-coil domain containing 122												0		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	44867793	44867793	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44867793delT								LOC121838 (263195 upstream) : SERP2 (80185 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	45859531	45859532	+	IGR	INS	-	TTTG	TTTG	rs151279985	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45859531_45859532insTTTG								GTF2F2 (1294 upstream) : TPT1 (51772 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	47393651	47393653	+	IGR	DEL	GAG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47393651_47393653delGAG								ESD (22284 upstream) : HTR2A (13860 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	48217176	48217176	+	IGR	DEL	A	-	-	rs34504114		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48217176delA								HTR2A (746126 upstream) : SUCLA2 (299616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	48486445	48486446	+	IGR	DEL	AA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48486445_48486446delAA								None (None upstream) : SUCLA2 (30346 downstream)																																			---	---	---	---
FNDC3A	22862	broad.mit.edu	37	13	49580142	49580143	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49580142_49580143insA	uc001vcm.2	+						FNDC3A_uc001vcl.1_Intron|FNDC3A_uc001vcn.2_Intron|FNDC3A_uc001vco.2_Intron	NM_001079673	NP_001073141			fibronectin type III domain containing 3A							Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)														---	---	---	---
DLEU1	10301	broad.mit.edu	37	13	50705652	50705653	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50705652_50705653insT	uc010adl.1	+						DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	51875417	51875417	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51875417delA								FAM124A (19801 upstream) : SERPINE3 (39751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	51884295	51884295	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51884295delT								FAM124A (28679 upstream) : SERPINE3 (30873 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	52046558	52046559	+	IGR	DEL	TG	-	-	rs112046073		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52046558_52046559delTG								INTS6 (19283 upstream) : WDFY2 (111925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	53179723	53179724	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53179723_53179724insA								TPTE2P3 (18499 upstream) : HNRNPA1L2 (11881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	53275937	53275938	+	IGR	INS	-	AC	AC	rs147696123	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53275937_53275938insAC								SUGT1 (13504 upstream) : LECT1 (1462 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55641888	55641888	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55641888delC								MIR1297 (755705 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55711904	55711904	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55711904delT								MIR1297 (825721 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	56260827	56260828	+	IGR	INS	-	A	A	rs35333294		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:56260827_56260828insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	58751865	58751865	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58751865delT								PCDH17 (448800 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	58904528	58904529	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58904528_58904529insT								PCDH17 (601463 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59874063	59874063	+	IGR	DEL	A	-	-	rs11331508		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59874063delA								None (None upstream) : DIAPH3 (365662 downstream)																																			---	---	---	---
DIAPH3	81624	broad.mit.edu	37	13	60474594	60474594	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60474594delT	uc001vht.2	-						DIAPH3_uc001vhu.2_Intron|DIAPH3_uc001vhv.2_Intron	NM_001042517	NP_001035982			diaphanous homolog 3 isoform a						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	60825983	60825983	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60825983delC								DIAPH3 (87864 upstream) : TDRD3 (144608 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	61245383	61245383	+	IGR	DEL	A	-	-	rs34392739		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61245383delA								TDRD3 (97371 upstream) : PCDH20 (738438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63531322	63531322	+	IGR	DEL	C	-	-	rs74948056	byFrequency;by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63531322delC								None (None upstream) : OR7E156P (780246 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	64072718	64072719	+	IGR	DEL	AT	-	-	rs138909570		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64072718_64072719delAT								None (None upstream) : OR7E156P (238849 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69835393	69835394	+	IGR	INS	-	GTGT	GTGT	rs79725639		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69835393_69835394insGTGT								None (None upstream) : KLHL1 (439332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	70119468	70119469	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70119468_70119469delTG								None (None upstream) : KLHL1 (155257 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	70740749	70740750	+	IGR	INS	-	G	G	rs146714617		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70740749_70740750insG								ATXN8OS (26864 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	71741625	71741626	+	IGR	INS	-	AC	AC	rs139641797	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:71741625_71741626insAC								None (None upstream) : DACH1 (270472 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	73254968	73254969	+	IGR	DEL	TT	-	-	rs112667812		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73254968_73254969delTT								DACH1 (813638 upstream) : C13orf37 (27526 downstream)																																			---	---	---	---
PIBF1	10464	broad.mit.edu	37	13	73365175	73365176	+	Intron	INS	-	TTTG	TTTG	rs141805152	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73365175_73365176insTTTG	uc001vjc.2	+						PIBF1_uc001vja.1_Intron|PIBF1_uc010aeo.1_Intron|PIBF1_uc001vjb.2_Intron|PIBF1_uc010aep.2_Intron	NM_006346	NP_006337			progesterone-induced blocking factor 1							centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	74038230	74038230	+	IGR	DEL	T	-	-	rs111953901		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74038230delT								KLF5 (386555 upstream) : KLF12 (221920 downstream)																																			---	---	---	---
UCHL3	7347	broad.mit.edu	37	13	76155484	76155485	+	Intron	DEL	TT	-	-	rs35324601		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76155484_76155485delTT	uc001vjq.2	+						UCHL3_uc001vjr.2_Intron	NM_006002	NP_005993			ubiquitin carboxyl-terminal esterase L3						ubiquitin-dependent protein catabolic process	cytoplasm	cysteine-type peptidase activity|ubiquitin binding|ubiquitin thiolesterase activity				0				GBM - Glioblastoma multiforme(99;0.0125)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	78784368	78784369	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78784368_78784369insT	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	79110748	79110749	+	Intron	DEL	AC	-	-	rs34117313		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79110748_79110749delAC	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	80507345	80507346	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80507345_80507346insT								NDFIP2 (377140 upstream) : SPRY2 (402768 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	81059559	81059559	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81059559delT								SPRY2 (144473 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	81324502	81324502	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81324502delA								SPRY2 (409416 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	81939791	81939791	+	IGR	DEL	A	-	-	rs113818187		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81939791delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85255210	85255211	+	IGR	INS	-	T	T	rs34533085		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85255210_85255211insT								SLITRK1 (798682 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85295787	85295788	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85295787_85295788insT								SLITRK1 (839259 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	86054751	86054752	+	IGR	INS	-	TTTG	TTTG	rs150873153	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86054751_86054752insTTTG								None (None upstream) : SLITRK6 (312170 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	87751051	87751051	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87751051delA								None (None upstream) : SLITRK5 (573819 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	90200114	90200114	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90200114delT								None (None upstream) : MIR622 (683322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	92010047	92010048	+	IGR	INS	-	T	T	rs142614683	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92010047_92010048insT								MIR17HG (3218 upstream) : GPC5 (40887 downstream)																																			---	---	---	---
GPC6	10082	broad.mit.edu	37	13	93895611	93895612	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93895611_93895612insT	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
Unknown	0	broad.mit.edu	37	13	95420951	95420951	+	Intron	DEL	T	-	-	rs8001579		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95420951delT	uc001vmc.2	+											Homo sapiens, clone IMAGE:5728875, mRNA.																														---	---	---	---
DNAJC3	5611	broad.mit.edu	37	13	96340774	96340774	+	Intron	DEL	T	-	-	rs113150172		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96340774delT	uc001vmq.2	+						DNAJC3_uc001vmp.2_Intron|DNAJC3_uc001vmr.2_Intron	NM_006260	NP_006251			DnaJ (Hsp40) homolog, subfamily C, member 3						protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding				0	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	98420258	98420259	+	IGR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98420258_98420259delCA								RAP2A (300007 upstream) : IPO5 (185670 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	98701453	98701454	+	IGR	INS	-	TTGT	TTGT	rs150867866	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98701453_98701454insTTGT								IPO5 (24904 upstream) : FARP1 (93362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	99246407	99246408	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99246407_99246408insT								STK24 (17011 upstream) : SLC15A1 (89649 downstream)																																			---	---	---	---
SLC15A1	6564	broad.mit.edu	37	13	99396573	99396573	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99396573delC	uc001vno.2	-							NM_005073	NP_005064			solute carrier family 15 (oligopeptide						digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)													---	---	---	---
DOCK9	23348	broad.mit.edu	37	13	99479948	99479949	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99479948_99479949insT	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc001vnq.2_Intron|DOCK9_uc001vnr.2_Intron|DOCK9_uc010tin.1_Intron|DOCK9_uc001vns.2_Intron|DOCK9_uc010tio.1_Intron|DOCK9_uc010tip.1_Intron|DOCK9_uc001vnu.1_Intron|DOCK9_uc010tiq.1_Intron	NM_015296	NP_056111			dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
DOCK9	23348	broad.mit.edu	37	13	99592959	99592960	+	Intron	INS	-	T	T	rs144548137	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99592959_99592960insT	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tis.1_Intron|DOCK9_uc010tit.1_Intron	NM_015296	NP_056111			dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
DOCK9	23348	broad.mit.edu	37	13	99621717	99621718	+	Intron	INS	-	A	A	rs141589900	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99621717_99621718insA	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tis.1_Intron|DOCK9_uc010tit.1_Intron	NM_015296	NP_056111			dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	99752724	99752724	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99752724delA								DOCK9 (14064 upstream) : UBAC2 (99955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	99760263	99760264	+	IGR	INS	-	AGAA	AGAA	rs143655620	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99760263_99760264insAGAA								DOCK9 (21603 upstream) : UBAC2 (92415 downstream)																																			---	---	---	---
PCCA	5095	broad.mit.edu	37	13	101080317	101080317	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101080317delT	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron|PCCA_uc001vop.2_Intron	NM_000282	NP_000273			propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	103779950	103779950	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103779950delT								SLC10A2 (60754 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	106937945	106937950	+	IGR	DEL	ACACAC	-	-	rs111258844		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106937945_106937950delACACAC								DAOA (794563 upstream) : EFNB2 (204148 downstream)																																			---	---	---	---
EFNB2	1948	broad.mit.edu	37	13	107167390	107167391	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107167390_107167391insT	uc001vqi.2	-							NM_004093	NP_004084			ephrin B2 precursor						cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	107691926	107691926	+	IGR	DEL	T	-	-	rs140141682		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107691926delT								ARGLU1 (471412 upstream) : FAM155A (128954 downstream)																																			---	---	---	---
COL4A2	1284	broad.mit.edu	37	13	111101671	111101672	+	Intron	INS	-	AGA	AGA	rs139659403	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111101671_111101672insAGA	uc001vqx.2	+							NM_001846	NP_001837			alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)															---	---	---	---
CARS2	79587	broad.mit.edu	37	13	111351370	111351370	+	Intron	DEL	A	-	-	rs67563672		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111351370delA	uc001vrd.2	-						CARS2_uc010tjm.1_Intron	NM_024537	NP_078813			cysteinyl-tRNA synthetase 2, mitochondrial						cysteinyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|cysteine-tRNA ligase activity|metal ion binding				0	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)													---	---	---	---
CARS2	79587	broad.mit.edu	37	13	111358969	111358972	+	5'Flank	DEL	CAAA	-	-	rs3840808		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111358969_111358972delCAAA	uc001vrd.2	-						CARS2_uc010tjm.1_Intron	NM_024537	NP_078813			cysteinyl-tRNA synthetase 2, mitochondrial						cysteinyl-tRNA aminoacylation	cytosol|mitochondrial matrix	ATP binding|cysteine-tRNA ligase activity|metal ion binding				0	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	111488511	111488512	+	Intron	INS	-	AGGG	AGGG	rs150339177	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111488511_111488512insAGGG	uc001vrj.1	+											full-length cDNA clone CS0DH004YB16 of T cells (Jurkat cell line) of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	112220267	112220268	+	IGR	INS	-	C	C	rs9522278	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112220267_112220268insC								C13orf16 (223674 upstream) : SOX1 (501645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	112342883	112342884	+	IGR	DEL	AT	-	-	rs71703992		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112342883_112342884delAT								C13orf16 (346290 upstream) : SOX1 (379029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	112974706	112974707	+	IGR	INS	-	GCACACACAC	GCACACACAC	rs146528545	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112974706_112974707insGCACACACAC								SOX1 (248686 upstream) : C13orf28 (55962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	113935657	113935657	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113935657delA								CUL4A (16266 upstream) : LAMP1 (15812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	114907046	114907047	+	IGR	DEL	AT	-	-	rs150997761		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114907046_114907047delAT								RASA3 (8951 upstream) : CDC16 (93315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19016097	19016097	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19016097delA								None (None upstream) : OR11H12 (361497 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19018488	19018488	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19018488delA								None (None upstream) : OR11H12 (359106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19093330	19093331	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19093330_19093331insA								None (None upstream) : OR11H12 (284263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19456741	19456742	+	IGR	INS	-	A	A	rs151291738	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19456741_19456742insA								OR11H12 (78169 upstream) : POTEG (96623 downstream)																																			---	---	---	---
TTC5	91875	broad.mit.edu	37	14	20766768	20766768	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20766768delT	uc001vwt.2	-						TTC5_uc001vwu.2_Intron	NM_138376	NP_612385			tetratricopeptide repeat domain 5						DNA repair	cytoplasm|nucleus	binding			ovary(1)	1	all_cancers(95;0.00092)		Epithelial(56;1.1e-06)|all cancers(55;8.07e-06)	GBM - Glioblastoma multiforme(265;0.0106)														---	---	---	---
RNASE2	6036	broad.mit.edu	37	14	21389232	21389232	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21389232delA	uc010aif.2	+							NM_002934	NP_002925			ribonuclease, RNase A family, 2 (liver,						chemotaxis|RNA catabolic process	extracellular region|lysosome	nucleic acid binding|pancreatic ribonuclease activity			ovary(1)	1	all_cancers(95;0.00381)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	22183120	22183120	+	RNA	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22183120delA	uc010tme.1	+	4		c.2378delA								Homo sapiens mRNA for T cell receptor alpha variable 2, partial cds, clone: SEB 280.																														---	---	---	---
HAUS4	54930	broad.mit.edu	37	14	23422359	23422359	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23422359delT	uc001whp.2	-						HAUS4_uc001who.2_Intron|HAUS4_uc001whq.2_Intron|HAUS4_uc001whr.2_Intron|HAUS4_uc001whs.2_Intron|HAUS4_uc001wht.2_Intron|HAUS4_uc001whu.2_Intron|HAUS4_uc001whv.2_Intron|HAUS4_uc001whw.2_Intron|HAUS4_uc001whx.2_Intron	NM_017815	NP_060285			HAUS augmin-like complex, subunit 4						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle				ovary(1)	1																		---	---	---	---
STXBP6	29091	broad.mit.edu	37	14	25417562	25417563	+	Intron	INS	-	CTCT	CTCT	rs139642043	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25417562_25417563insCTCT	uc001wpu.2	-						STXBP6_uc001wpv.2_Intron|STXBP6_uc001wpw.2_Intron|STXBP6_uc001wpx.1_Intron	NM_014178	NP_054897			amisyn						vesicle-mediated transport	cytoplasm|integral to membrane					0				GBM - Glioblastoma multiforme(265;0.0296)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	28348206	28348207	+	IGR	INS	-	TAAG	TAAG	rs147064826	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28348206_28348207insTAAG								None (None upstream) : FOXG1 (888080 downstream)																																			---	---	---	---
HEATR5A	25938	broad.mit.edu	37	14	31831282	31831282	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31831282delT	uc001wrf.3	-						HEATR5A_uc010ami.2_Intron|HEATR5A_uc001wrg.1_Intron|HEATR5A_uc010tpk.1_Intron	NM_015473	NP_056288			HEAT repeat containing 5A								binding			ovary(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)														---	---	---	---
NUBPL	80224	broad.mit.edu	37	14	32096145	32096146	+	Intron	INS	-	AGT	AGT	rs139206530	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32096145_32096146insAGT	uc001wrk.3	+						NUBPL_uc010amj.2_Intron|NUBPL_uc010tpl.1_Intron	NM_025152	NP_079428			nucleotide binding protein-like						mitochondrial respiratory chain complex I assembly|mitochondrion morphogenesis	mitochondrion	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding				0	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	33027376	33027376	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33027376delA	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	33178522	33178522	+	Intron	DEL	T	-	-	rs66665447		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33178522delT	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	36738976	36738977	+	IGR	INS	-	AC	AC			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36738976_36738977insAC								BRMS1L (397808 upstream) : MBIP (28787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	38978136	38978136	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38978136delT								CLEC14A (252562 upstream) : SEC23A (522987 downstream)																																			---	---	---	---
MDGA2	161357	broad.mit.edu	37	14	47552675	47552677	+	Intron	DEL	GAA	-	-	rs72439017		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47552675_47552677delGAA	uc001wwj.3	-						MDGA2_uc001wwi.3_Intron|MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970			MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6																		---	---	---	---
SOS2	6655	broad.mit.edu	37	14	50628014	50628014	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50628014delA	uc001wxs.3	-						SOS2_uc010tql.1_Intron|SOS2_uc010tqm.1_Intron|SOS2_uc001wxt.2_Intron	NM_006939	NP_008870			son of sevenless homolog 2						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)																	---	---	---	---
CDKL1	8814	broad.mit.edu	37	14	50849260	50849261	+	Intron	INS	-	TCCT	TCCT	rs144973546	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50849260_50849261insTCCT	uc010anu.1	-						CDKL1_uc001wxz.2_Intron	NM_004196	NP_004187			cyclin-dependent kinase-like 1							cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(1)|stomach(1)	2	all_epithelial(31;0.000746)|Breast(41;0.0102)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	51839098	51839104	+	IGR	DEL	CTCCATG	-	-	rs149687988		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51839098_51839104delCTCCATG								TMX1 (114728 upstream) : FRMD6 (116751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	53466007	53466008	+	IGR	INS	-	A	A	rs146596072	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53466007_53466008insA								FERMT2 (48192 upstream) : DDHD1 (37451 downstream)																																			---	---	---	---
FBXO34	55030	broad.mit.edu	37	14	55752279	55752279	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55752279delA	uc001xbu.2	+						FBXO34_uc010aoo.2_Intron	NM_017943	NP_060413			F-box only protein 34											ovary(2)|lung(2)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	58179013	58179014	+	IGR	INS	-	T	T	rs148947464	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58179013_58179014insT								SLC35F4 (115398 upstream) : C14orf37 (291795 downstream)																																			---	---	---	---
PRKCH	5583	broad.mit.edu	37	14	61982217	61982217	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61982217delA	uc001xfn.2	+						PRKCH_uc010tsa.1_Intron|PRKCH_uc010tsb.1_Intron	NM_006255	NP_006246			protein kinase C, eta						intracellular signal transduction|platelet activation	cytosol|plasma membrane	ATP binding|enzyme binding|metal ion binding|protein kinase C activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|large_intestine(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	62426935	62426936	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62426935_62426936insT								SNAPC1 (163790 upstream) : SYT16 (26867 downstream)																																			---	---	---	---
WDR89	112840	broad.mit.edu	37	14	64075384	64075385	+	Intron	INS	-	CA	CA	rs146488675	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64075384_64075385insCA	uc001xgh.2	-						WDR89_uc001xgi.2_Intron	NM_001008726	NP_001008726			WD repeat domain 89												0				OV - Ovarian serous cystadenocarcinoma(108;0.00543)|all cancers(60;0.0181)|BRCA - Breast invasive adenocarcinoma(234;0.101)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	65786124	65786125	+	IGR	INS	-	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65786124_65786125insC								MAX (216897 upstream) : LOC645431 (91188 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	65867970	65867970	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65867970delT								MAX (298743 upstream) : LOC645431 (9343 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	66450555	66450556	+	IGR	INS	-	A	A	rs11417257		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66450555_66450556insA								FUT8 (240594 upstream) : C14orf53 (502553 downstream)																																			---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72902973	72902973	+	Intron	DEL	T	-	-	rs72304603		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72902973delT	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron|RGS6_uc010ttp.1_Intron|RGS6_uc010arg.2_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72956416	72956417	+	Intron	INS	-	GAAAG	GAAAG	rs143576477	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72956416_72956417insGAAAG	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron|RGS6_uc010ttp.1_Intron|RGS6_uc001xmz.1_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	73932792	73932798	+	Intron	DEL	CTATTCT	-	-	rs67077500		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73932792_73932798delCTATTCT	uc001xoi.1	+											Homo sapiens cDNA FLJ31314 fis, clone LIVER1000278.																														---	---	---	---
PTGR2	145482	broad.mit.edu	37	14	74318055	74318056	+	5'Flank	INS	-	A	A	rs146628874	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74318055_74318056insA	uc001xow.2	+						PTGR2_uc010tue.1_5'Flank|PTGR2_uc001xox.2_5'Flank|ZNF410_uc001xoy.1_5'Flank	NM_001146154	NP_001139626			prostaglandin reductase 2						prostaglandin metabolic process		15-oxoprostaglandin 13-oxidase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	74691225	74691225	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74691225delA								LIN52 (24108 upstream) : VSX2 (14950 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	76739149	76739150	+	IGR	DEL	GA	-	-	rs145019303		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76739149_76739150delGA								C14orf118 (70016 upstream) : ESRRB (98540 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	77437889	77437890	+	IGR	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77437889_77437890insG								C14orf166B (101244 upstream) : C14orf4 (52998 downstream)																																			---	---	---	---
ADCK1	57143	broad.mit.edu	37	14	78366933	78366934	+	Intron	INS	-	AAC	AAC	rs143482832	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78366933_78366934insAAC	uc001xui.2	+						ADCK1_uc010tvo.1_RNA|ADCK1_uc001xuj.2_Intron|ADCK1_uc001xuk.1_Intron	NM_020421	NP_065154			aarF domain containing kinase 1 isoform a							extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	78406231	78406231	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78406231delC								ADCK1 (5935 upstream) : NRXN3 (230697 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	78453572	78453573	+	IGR	DEL	TT	-	-	rs34840832		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78453572_78453573delTT								ADCK1 (53276 upstream) : NRXN3 (183355 downstream)																																			---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79234418	79234419	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79234418_79234419insA	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc010asv.1_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79284190	79284191	+	Intron	INS	-	A	A	rs139403420	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79284190_79284191insA	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc010asv.1_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	80324983	80324983	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80324983delA	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc001xup.2_Intron|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	82110804	82110804	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82110804delT								SEL1L (110599 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	82259934	82259935	+	IGR	INS	-	TTG	TTG	rs72315830		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82259934_82259935insTTG								SEL1L (259729 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	82643509	82643510	+	IGR	INS	-	T	T	rs141278268	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82643509_82643510insT								SEL1L (643304 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	83510162	83510169	+	IGR	DEL	ACACACAC	-	-	rs67891093		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83510162_83510169delACACACAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84090926	84090927	+	IGR	INS	-	ACAC	ACAC	rs34947032		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84090926_84090927insACAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84375863	84375863	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84375863delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84789891	84789891	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84789891delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84969837	84969839	+	IGR	DEL	AGA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84969837_84969839delAGA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84991325	84991326	+	IGR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84991325_84991326delCA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85082259	85082260	+	IGR	INS	-	TT	TT	rs150354874	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85082259_85082260insTT								None (None upstream) : FLRT2 (914228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85576229	85576230	+	IGR	INS	-	ATACATAC	ATACATAC	rs142816994	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85576229_85576230insATACATAC								None (None upstream) : FLRT2 (420258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85618469	85618470	+	IGR	INS	-	A	A	rs141682770	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85618469_85618470insA								None (None upstream) : FLRT2 (378018 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	87528185	87528185	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87528185delA								None (None upstream) : GALC (775979 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	87653586	87653587	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87653586_87653587insT								None (None upstream) : GALC (650577 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	90882236	90882236	+	IGR	DEL	C	-	-	rs35735462		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90882236delC								CALM1 (7626 upstream) : TTC7B (124697 downstream)																																			---	---	---	---
CCDC88C	440193	broad.mit.edu	37	14	91828784	91828785	+	Intron	INS	-	T	T	rs148587251	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91828784_91828785insT	uc010aty.2	-						CCDC88C_uc010twk.1_Intron	NM_001080414	NP_001073883			DVL-binding protein DAPLE						microtubule cytoskeleton organization|protein destabilization|protein homooligomerization|regulation of protein phosphorylation|Wnt receptor signaling pathway	cytoplasm|insoluble fraction	microtubule binding|PDZ domain binding|protein self-association			ovary(3)	3		all_cancers(154;0.0468)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	92679699	92679700	+	IGR	INS	-	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92679699_92679700insC								CPSF2 (49156 upstream) : SLC24A4 (109225 downstream)																																			---	---	---	---
LGMN	5641	broad.mit.edu	37	14	93189394	93189395	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93189394_93189395insT	uc001yav.2	-						LGMN_uc001yat.2_Intron|LGMN_uc001yau.2_Intron|LGMN_uc001yaw.2_Intron|LGMN_uc010aul.2_Intron|LGMN_uc001yax.2_Intron|LGMN_uc001yay.2_Intron	NM_001008530	NP_001008530			legumain preproprotein						hormone biosynthetic process|negative regulation of neuron apoptosis|vitamin D metabolic process	lysosome	cysteine-type endopeptidase activity|protein serine/threonine kinase activity			skin(1)	1		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)														---	---	---	---
KIAA1409	57578	broad.mit.edu	37	14	93983672	93983673	+	Intron	DEL	TT	-	-	rs34462637		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93983672_93983673delTT	uc001ybv.1	+						KIAA1409_uc001ybs.1_Intron|KIAA1409_uc001ybu.1_Intron	NM_020818	NP_065869			hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	94360501	94360502	+	IGR	INS	-	T	T	rs56748148		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94360501_94360502insT								PRIMA1 (105735 upstream) : C14orf86 (10574 downstream)																																			---	---	---	---
PPP4R4	57718	broad.mit.edu	37	14	94737254	94737255	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94737254_94737255insA	uc001ycs.1	+							NM_058237	NP_478144			HEAT-like repeat-containing protein isoform 1							cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	95533122	95533124	+	IGR	DEL	CAC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95533122_95533124delCAC								GSC (296623 upstream) : DICER1 (19441 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	95961448	95961449	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95961448_95961449insA								C14orf49 (19275 upstream) : SNHG10 (37804 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	97036684	97036685	+	IGR	DEL	TG	-	-	rs147105706		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97036684_97036685delTG								PAPOLA (3238 upstream) : VRK1 (226999 downstream)																																			---	---	---	---
SETD3	84193	broad.mit.edu	37	14	99926499	99926500	+	Intron	INS	-	T	T	rs148351513	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99926499_99926500insT	uc001ygc.2	-						SETD3_uc001ygd.2_Intron|SETD3_uc001ygf.2_Intron	NM_032233	NP_115609			SET domain containing 3 isoform a						peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)																---	---	---	---
YY1	7528	broad.mit.edu	37	14	100744638	100744638	+	3'UTR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100744638delT	uc001ygy.1	+	5					uc001ygz.1_5'Flank	NM_003403	NP_003394			YY1 transcription factor						cell differentiation|cellular response to UV|double-strand break repair via homologous recombination|negative regulation of transcription from RNA polymerase II promoter|response to UV-C|spermatogenesis	Ino80 complex|nuclear matrix|plasma membrane	four-way junction DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding				0		Melanoma(154;0.152)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	101476634	101476634	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101476634delG								SNORD114-31 (16989 upstream) : MIR379 (11769 downstream)																																			---	---	---	---
PPP2R5C	5527	broad.mit.edu	37	14	102302491	102302491	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102302491delT	uc001yko.2	+						PPP2R5C_uc001ykj.3_Intron|PPP2R5C_uc010txr.1_Intron|PPP2R5C_uc001ykk.2_Intron|PPP2R5C_uc010txt.1_Intron|PPP2R5C_uc001ykn.2_Intron|PPP2R5C_uc001ykp.2_Intron|PPP2R5C_uc010txs.1_Intron	NM_002719	NP_002710			gamma isoform of regulatory subunit B56, protein						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of cell proliferation|proteasomal ubiquitin-dependent protein catabolic process|signal transduction	chromosome, centromeric region|nucleus|protein phosphatase type 2A complex	protein binding|protein binding|protein phosphatase type 2A regulator activity|protein phosphatase type 2A regulator activity			ovary(1)|breast(1)	2																		---	---	---	---
CDC42BPB	9578	broad.mit.edu	37	14	103501397	103501398	+	Intron	INS	-	T	T	rs112137178		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103501397_103501398insT	uc001ymi.1	-							NM_006035	NP_006026			CDC42-binding protein kinase beta						actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)														---	---	---	---
EIF5	1983	broad.mit.edu	37	14	103806466	103806467	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103806466_103806467insT	uc001ymq.2	+						EIF5_uc001ymr.2_Intron|EIF5_uc001yms.2_Intron|EIF5_uc001ymt.2_Intron|EIF5_uc001ymu.2_Intron	NM_001969	NP_001960			eukaryotic translation initiation factor 5						regulation of translational initiation|RNA metabolic process	cytosol	GTP binding|GTPase activity|translation initiation factor activity			pancreas(1)|breast(1)|skin(1)	3		Melanoma(154;0.155)	Epithelial(46;0.182)															---	---	---	---
ASPG	374569	broad.mit.edu	37	14	104578163	104578163	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104578163delG	uc001yoq.1	+						ASPG_uc001yop.1_Intron|ASPG_uc001yor.1_Intron	NM_001080464	NP_001073933			60 kDa lysophospholipase						lipid catabolic process		1-alkyl-2-acetylglycerophosphocholine esterase activity|asparaginase activity|lysophospholipase activity				0																		---	---	---	---
C14orf180	400258	broad.mit.edu	37	14	105050183	105050184	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105050183_105050184delAC	uc001yow.1	+						C14orf180_uc010tyh.1_Intron|C14orf180_uc010awy.1_5'Flank	NM_001008404	NP_001008404			hypothetical protein LOC400258							integral to membrane					0		Melanoma(154;0.226)	all cancers(16;0.00405)|OV - Ovarian serous cystadenocarcinoma(23;0.0319)|Epithelial(46;0.0784)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.127)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	105149965	105149966	+	IGR	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105149965_105149966delAC								TMEM179 (78868 upstream) : INF2 (5977 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	105976883	105976884	+	IGR	DEL	TT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105976883_105976884delTT								C14orf80 (11299 upstream) : TMEM121 (16069 downstream)																																			---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106005992	106005992	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106005992delT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106773967	106773972	+	Intron	DEL	ATGTCA	-	-	rs72196767		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106773967_106773972delATGTCA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106787846	106787847	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106787846_106787847insA	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20556978	20556979	+	IGR	DEL	GC	-	-	rs8036331		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20556978_20556979delGC								None (None upstream) : GOLGA6L6 (180115 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20620492	20620495	+	Intron	DEL	TTCT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20620492_20620495delTTCT	uc001ytg.2	-						uc010tyx.1_Intron|uc001yth.3_Intron					RecName: Full=Putative HERC2-like protein 3;																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	20850156	20850159	+	IGR	DEL	ATAA	-	-	rs151226806		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20850156_20850159delATAA								GOLGA8C (69130 upstream) : BCL8 (19897 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20863420	20863420	+	IGR	DEL	T	-	-	rs111525382		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20863420delT								GOLGA8C (82394 upstream) : BCL8 (6636 downstream)																																			---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22326870	22326871	+	Intron	INS	-	A	A	rs151195051	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22326870_22326871insA	uc001yuc.1	+						LOC727924_uc001ytz.1_Intron|LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	22487906	22487907	+	IGR	INS	-	T	T	rs148052169	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22487906_22487907insT								OR4N3P (73521 upstream) : MIR1268 (25322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22886317	22886318	+	IGR	INS	-	T	T	rs60975916		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22886317_22886318insT								TUBGCP5 (12428 upstream) : CYFIP1 (6366 downstream)																																			---	---	---	---
HERC2P2	400322	broad.mit.edu	37	15	23331163	23331163	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23331163delA	uc001yvr.2	-						HERC2P2_uc010ayf.1_Intron					RecName: Full=Putative HERC2-like protein 3;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	24426826	24426826	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24426826delT								PWRN2 (11731 upstream) : PWRN1 (352013 downstream)																																			---	---	---	---
SNRPN	6638	broad.mit.edu	37	15	25234645	25234645	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25234645delA	uc001ywz.1	+						PAR-SN_uc001yxa.1_Intron|PAR-SN_uc001yxc.2_Intron					Homo sapiens SNRPN upstream reading frame protein (SNURF) mRNA, complete cds.						RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)										Prader-Willi_syndrome				---	---	---	---
GABRB3	2562	broad.mit.edu	37	15	26914752	26914753	+	Intron	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26914752_26914753delTC	uc001zaz.2	-						GABRB3_uc001zba.2_Intron|GABRB3_uc001zbb.2_Intron	NM_000814	NP_000805			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
GABRB3	2562	broad.mit.edu	37	15	27092698	27092698	+	Intron	DEL	T	-	-	rs150140109		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27092698delT	uc001zbb.2	-							NM_021912	NP_068712			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
GABRG3	2567	broad.mit.edu	37	15	27474600	27474601	+	Intron	INS	-	TGTG	TGTG	rs138819685	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27474600_27474601insTGTG	uc001zbg.1	+						GABRG3_uc001zbf.2_Intron	NM_033223	NP_150092			gamma-aminobutyric acid (GABA) A receptor, gamma						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	30465106	30465107	+	IGR	INS	-	CA	CA			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30465106_30465107insCA								FAM7A3 (41160 upstream) : DKFZP434L187 (23132 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	31742584	31742585	+	IGR	DEL	GA	-	-	rs112020198		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31742584_31742585delGA								KLF13 (72483 upstream) : OTUD7A (32745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	32508736	32508736	+	Intron	DEL	A	-	-	rs141891898		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32508736delA	uc001zfv.1	-											Homo sapiens cDNA FLJ43588 fis, clone SKNSH2009991.																														---	---	---	---
FAM7A3	89837	broad.mit.edu	37	15	32714606	32714607	+	Intron	INS	-	T	T	rs148437913		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32714606_32714607insT	uc001zgb.2	-						FAM7A3_uc010ubp.1_Intron|FAM7A3_uc001zgd.2_Intron|FAM7A3_uc001zge.2_Intron					Homo sapiens family with sequence similarity 7, member A3, mRNA (cDNA clone IMAGE:4579054).												0																		---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33674394	33674395	+	Intron	INS	-	A	A	rs148503658	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33674394_33674395insA	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	34976763	34976764	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34976763_34976764insT								GOLGA8B (148541 upstream) : GJD2 (67915 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	35368048	35368048	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35368048delA								ZNF770 (87594 upstream) : LOC723972 (161479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	35890309	35890310	+	Intron	INS	-	TG	TG	rs145064711	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35890309_35890310insTG	uc001zjc.2	+											Homo sapiens, Similar to LOC161538, clone IMAGE:5199550, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	36152709	36152709	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36152709delT								ATPBD4 (314305 upstream) : C15orf41 (719103 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	38473338	38473338	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38473338delA	uc001zjy.2	-											Homo sapiens, clone IMAGE:3923347, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	39033505	39033505	+	IGR	DEL	T	-	-	rs5812050		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39033505delT								C15orf53 (41266 upstream) : C15orf54 (509380 downstream)																																			---	---	---	---
GPR176	11245	broad.mit.edu	37	15	40165471	40165471	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40165471delG	uc001zkj.1	-						GPR176_uc001zkk.1_Intron	NM_007223	NP_009154			G protein-coupled receptor 176						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity			ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	40690609	40690610	+	IGR	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40690609_40690610insG								C15orf23 (4121 upstream) : IVD (7076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	41170289	41170289	+	IGR	DEL	T	-	-	rs67960303		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41170289delT								RHOV (3802 upstream) : VPS18 (16339 downstream)																																			---	---	---	---
INO80	54617	broad.mit.edu	37	15	41323820	41323821	+	Intron	INS	-	AGGG	AGGG	rs146180417		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41323820_41323821insAGGG	uc001zni.2	-						INO80_uc010ucu.1_Intron	NM_017553	NP_060023			INO80 complex homolog 1						cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
INO80	54617	broad.mit.edu	37	15	41345932	41345933	+	Intron	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41345932_41345933insG	uc001zni.2	-						INO80_uc010ucu.1_Intron	NM_017553	NP_060023			INO80 complex homolog 1						cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
EHD4	30844	broad.mit.edu	37	15	42212835	42212835	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42212835delT	uc001zot.2	-							NM_139265	NP_644670			EH-domain containing 4						endocytic recycling|protein homooligomerization	early endosome membrane|endoplasmic reticulum|nucleus|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			ovary(2)	2		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	43233130	43233130	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43233130delT								TTBK2 (20123 upstream) : UBR1 (1973 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	45755349	45755350	+	Intron	INS	-	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45755349_45755350insC	uc001zvi.1	+											Homo sapiens cDNA FLJ32124 fis, clone PEBLM1000180.																														---	---	---	---
SHC4	399694	broad.mit.edu	37	15	49194400	49194401	+	Intron	DEL	AA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49194400_49194401delAA	uc001zxb.1	-							NM_203349	NP_976224			rai-like protein						intracellular signal transduction	cell junction|postsynaptic membrane				ovary(3)|pancreas(2)	5		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)														---	---	---	---
MYO5C	55930	broad.mit.edu	37	15	52575876	52575877	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52575876_52575877insT	uc010bff.2	-						MYO5C_uc010uga.1_Intron|MYO5C_uc010ugb.1_Intron|MYO5C_uc010ugc.1_Intron	NM_018728	NP_061198			myosin VC							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	54076287	54076287	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54076287delT								WDR72 (24428 upstream) : UNC13C (228814 downstream)																																			---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54598982	54598983	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54598982_54598983insT	uc002ack.2	+						UNC13C_uc002acl.2_Intron	NM_001080534	NP_001074003			unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	55013395	55013396	+	IGR	DEL	AT	-	-	rs142351877		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55013395_55013396delAT								UNC13C (92590 upstream) : RSL24D1 (460125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	56882839	56882840	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56882839_56882840insA	uc002ads.2	-											Homo sapiens cDNA clone IMAGE:5275275.																														---	---	---	---
CGNL1	84952	broad.mit.edu	37	15	57794454	57794454	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57794454delG	uc002aeg.2	+						CGNL1_uc010bfw.2_Intron	NM_032866	NP_116255			cingulin-like 1							myosin complex|tight junction	motor activity			skin(6)|ovary(4)|central_nervous_system(1)	11				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)														---	---	---	---
ALDH1A2	8854	broad.mit.edu	37	15	58440089	58440090	+	Intron	INS	-	CACA	CACA	rs150269382	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58440089_58440090insCACA	uc010ugw.1	-						AQP9_uc010ugx.1_Intron|AQP9_uc002aez.2_Intron	NM_170697	NP_733798			aldehyde dehydrogenase 1A2 isoform 3						negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	62046888	62046889	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62046888_62046889insA								RORA (525386 upstream) : VPS13C (97703 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	62669026	62669026	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62669026delA								C2CD4B (211544 upstream) : MGC15885 (260345 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	63406999	63406999	+	IGR	DEL	T	-	-	rs67389021		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63406999delT								TPM1 (42888 upstream) : LACTB (7033 downstream)																																			---	---	---	---
DAPK2	23604	broad.mit.edu	37	15	64261941	64261942	+	Intron	DEL	AA	-	-	rs34962717		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64261941_64261942delAA	uc002amr.2	-						DAPK2_uc010uim.1_Intron|DAPK2_uc010bgu.1_Intron	NM_014326	NP_055141			death-associated kinase 2						apoptosis|induction of apoptosis|intracellular protein kinase cascade	cytoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|identical protein binding			stomach(1)|central_nervous_system(1)	2				LUAD - Lung adenocarcinoma(2;0.215)														---	---	---	---
RBPMS2	348093	broad.mit.edu	37	15	65057120	65057120	+	Intron	DEL	A	-	-	rs34364733		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65057120delA	uc002anq.2	-						MIR1272_hsa-mir-1272|MI0006408_5'Flank	NM_194272	NP_919248			RNA binding protein with multiple splicing 2								nucleic acid binding|nucleotide binding				0																		---	---	---	---
ANKDD1A	348094	broad.mit.edu	37	15	65213336	65213337	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65213336_65213337insT	uc002aoa.2	+						ANKDD1A_uc002anx.1_Intron|ANKDD1A_uc002any.2_Intron|ANKDD1A_uc002anz.2_Intron|ANKDD1A_uc002aob.2_Intron|ANKDD1A_uc002aoc.2_5'Flank|ANKDD1A_uc010bha.2_5'Flank	NM_182703	NP_874362			ankyrin repeat and death domain containing 1A						signal transduction					ovary(1)	1																		---	---	---	---
DPP8	54878	broad.mit.edu	37	15	65740845	65740846	+	Intron	INS	-	T	T	rs142779899	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65740845_65740846insT	uc002aov.2	-						DPP8_uc002aow.2_Intron|DPP8_uc010uiv.1_Intron|DPP8_uc002aox.2_Intron|DPP8_uc002aoy.2_Intron|DPP8_uc002aoz.2_Intron|DPP8_uc010bhj.2_Intron|DPP8_uc002apa.2_Intron|DPP8_uc010bhi.2_Intron	NM_130434	NP_569118			dipeptidyl peptidase 8 isoform 1						immune response|proteolysis	cytoplasm|membrane|nucleus	aminopeptidase activity|dipeptidyl-peptidase activity|serine-type peptidase activity			ovary(1)	1																		---	---	---	---
MEGF11	84465	broad.mit.edu	37	15	66265456	66265456	+	Intron	DEL	A	-	-	rs146910886		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66265456delA	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821			multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	66627992	66627993	+	IGR	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66627992_66627993delAC								DIS3L (1757 upstream) : TIPIN (1015 downstream)																																			---	---	---	---
MAP2K1	5604	broad.mit.edu	37	15	66687912	66687913	+	Intron	DEL	TT	-	-	rs72465667		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66687912_66687913delTT	uc010bhq.2	+							NM_002755	NP_002746			mitogen-activated protein kinase kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0														Cardiofaciocutaneous_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	15	67272389	67272390	+	IGR	INS	-	T	T	rs34774362		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67272389_67272390insT								SMAD6 (198054 upstream) : SMAD3 (85805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	67312843	67312843	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67312843delT								SMAD6 (238508 upstream) : SMAD3 (45352 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	67335524	67335527	+	IGR	DEL	TCTC	-	-	rs112058030		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67335524_67335527delTCTC								SMAD6 (261189 upstream) : SMAD3 (22668 downstream)																																			---	---	---	---
MAP2K5	5607	broad.mit.edu	37	15	68078356	68078357	+	Intron	INS	-	T	T	rs11374165		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68078356_68078357insT	uc002aqu.2	+						MAP2K5_uc002aqv.2_Intron|MAP2K5_uc002aqw.2_Intron|MAP2K5_uc002aqx.2_Intron	NM_145160	NP_660143			mitogen-activated protein kinase kinase 5						nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)	2																		---	---	---	---
ITGA11	22801	broad.mit.edu	37	15	68669811	68669812	+	Intron	INS	-	T	T	rs147222383	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68669811_68669812insT	uc002ari.2	-						ITGA11_uc010bib.2_Intron	NM_001004439	NP_001004439			integrin, alpha 11 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)													---	---	---	---
ITGA11	22801	broad.mit.edu	37	15	68698252	68698253	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68698252_68698253delCA	uc002ari.2	-						ITGA11_uc010bib.2_Intron	NM_001004439	NP_001004439			integrin, alpha 11 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	69925431	69925435	+	IGR	DEL	TTTTG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69925431_69925435delTTTTG								LOC145837 (61652 upstream) : C15orf50 (202138 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	70811726	70811727	+	IGR	DEL	AC	-	-	rs146449590		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70811726_70811727delAC								TLE3 (421470 upstream) : UACA (135168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	70834699	70834699	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70834699delA								TLE3 (444443 upstream) : UACA (112196 downstream)																																			---	---	---	---
LRRC49	54839	broad.mit.edu	37	15	71327259	71327261	+	Intron	DEL	ATA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71327259_71327261delATA	uc002asw.2	+						LRRC49_uc002asu.2_Intron|LRRC49_uc002asx.2_Intron|LRRC49_uc010ukf.1_Intron|LRRC49_uc002asy.2_Intron|LRRC49_uc002asz.2_Intron	NM_017691	NP_060161			leucine rich repeat containing 49							cytoplasm|microtubule				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	71358251	71358253	+	IGR	DEL	AAA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71358251_71358253delAAA								LRRC49 (15817 upstream) : CT62 (44330 downstream)																																			---	---	---	---
THSD4	79875	broad.mit.edu	37	15	71668729	71668729	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71668729delC	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
CELF6	60677	broad.mit.edu	37	15	72565146	72565146	+	Intron	DEL	G	-	-	rs139534837	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72565146delG	uc010biv.1	-						PARP6_uc002aud.3_5'Flank|PARP6_uc002auc.2_5'Flank	NM_052840				bruno-like 6, RNA binding protein						mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	nucleotide binding|RNA binding			large_intestine(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---
ARIH1	25820	broad.mit.edu	37	15	72871546	72871546	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72871546delT	uc002aut.3	+							NM_005744	NP_005735			ariadne ubiquitin-conjugating enzyme E2 binding						ubiquitin-dependent protein catabolic process	cytoplasm|ubiquitin ligase complex	ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
BBS4	585	broad.mit.edu	37	15	72999409	72999410	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72999409_72999410insT	uc002avb.2	+						BBS4_uc010ukv.1_Intron|BBS4_uc002avc.2_Intron|BBS4_uc002avd.2_Intron	NM_033028	NP_149017			Bardet-Biedl syndrome 4						adult behavior|brain morphogenesis|cell cycle cytokinesis|centrosome organization|cerebral cortex development|convergent extension involved in gastrulation|dendrite development|fat cell differentiation|heart looping|hippocampus development|intracellular transport|maintenance of protein location in nucleus|melanosome transport|microtubule anchoring at centrosome|neural tube closure|nonmotile primary cilium assembly|photoreceptor cell maintenance|pigment granule aggregation in cell center|positive regulation of flagellum assembly|regulation of cilium beat frequency involved in ciliary motility|regulation of cytokinesis|regulation of lipid metabolic process|retina homeostasis|retinal rod cell development|sensory perception of smell|sensory processing|spermatid development|striatum development	BBSome|centriolar satellite|centriole|cilium membrane|microtubule basal body|motile cilium|nonmotile primary cilium|nucleus|pericentriolar material	alpha-tubulin binding|beta-tubulin binding|dynactin binding|microtubule motor activity				0														Bardet-Biedl_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	15	73039085	73039086	+	IGR	DEL	CT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73039085_73039086delCT								BBS4 (8269 upstream) : ADPGK (4624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	73184466	73184466	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73184466delT								ADPGK (107799 upstream) : NEO1 (160409 downstream)																																			---	---	---	---
C15orf60	283677	broad.mit.edu	37	15	73835288	73835288	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73835288delT	uc002avq.2	+						C15orf60_uc010bjb.2_Intron	NM_001042367	NP_001035826			hypothetical protein LOC283677											pancreas(1)	1																		---	---	---	---
TBC1D21	161514	broad.mit.edu	37	15	74165782	74165785	+	5'Flank	DEL	TTTT	-	-	rs113842983		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74165782_74165785delTTTT	uc002avz.2	+						TBC1D21_uc010ulc.1_5'Flank	NM_153356	NP_699187			TBC1 domain family, member 21							intracellular	Rab GTPase activator activity			ovary(2)	2																OREG0023267	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	15	74392546	74392546	+	IGR	DEL	A	-	-	rs3214584		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74392546delA								GOLGA6A (17655 upstream) : LOC283731 (26168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	74779729	74779732	+	IGR	DEL	TAGA	-	-	rs147605151		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74779729_74779732delTAGA								UBL7 (26200 upstream) : ARID3B (53816 downstream)																																			---	---	---	---
ETFA	2108	broad.mit.edu	37	15	76545239	76545239	+	Intron	DEL	T	-	-	rs142710450		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76545239delT	uc002bbt.2	-						ETFA_uc010bkq.1_Intron|ETFA_uc002bbu.1_Intron	NM_000126	NP_000117			electron transfer flavoprotein, alpha						respiratory electron transport chain|transport	mitochondrial matrix	electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity				0																		---	---	---	---
SCAPER	49855	broad.mit.edu	37	15	77025927	77025928	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77025927_77025928insA	uc002bby.2	-						SCAPER_uc002bbx.2_Intron|SCAPER_uc002bbz.1_Intron|SCAPER_uc002bca.1_Intron|SCAPER_uc002bcb.1_Intron	NM_020843	NP_065894			S-phase cyclin A-associated protein in the ER							endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
SGK269	79834	broad.mit.edu	37	15	77418259	77418260	+	Intron	INS	-	AGC	AGC	rs147686603	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77418259_77418260insAGC	uc002bcm.2	-							NM_024776	NP_079052			NKF3 kinase family member						cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	77779123	77779123	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77779123delA								HMG20A (1180 upstream) : LINGO1 (126246 downstream)																																			---	---	---	---
ACSBG1	23205	broad.mit.edu	37	15	78507677	78507678	+	Intron	DEL	CA	-	-	rs146839943		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78507677_78507678delCA	uc002bdh.2	-						ACSBG1_uc010umw.1_Intron|ACSBG1_uc010umx.1_Intron|ACSBG1_uc010umy.1_Intron	NM_015162	NP_055977			lipidosin						long-chain fatty acid metabolic process|myelination|very long-chain fatty acid metabolic process	cytoplasmic membrane-bounded vesicle|endoplasmic reticulum|microsome	ATP binding|long-chain fatty acid-CoA ligase activity|very long-chain fatty acid-CoA ligase activity			ovary(1)	1																		---	---	---	---
DNAJA4	55466	broad.mit.edu	37	15	78555792	78555793	+	5'Flank	INS	-	C	C	rs147743381	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78555792_78555793insC	uc002bdj.1	+						DNAJA4_uc002bdi.2_5'Flank|DNAJA4_uc002bdk.2_5'Flank	NM_001130182	NP_001123654			DnaJ (Hsp40) homolog, subfamily A, member 4						protein folding|response to heat	membrane	ATP binding|heat shock protein binding|metal ion binding|unfolded protein binding			skin(1)	1																		---	---	---	---
IREB2	3658	broad.mit.edu	37	15	78739522	78739522	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78739522delT	uc002bdr.2	+						IREB2_uc010unb.1_Intron|IREB2_uc002bdq.2_Intron	NM_004136	NP_004127			iron-responsive element binding protein 2								4 iron, 4 sulfur cluster binding|metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)														---	---	---	---
AGPHD1	123688	broad.mit.edu	37	15	78822189	78822190	+	Intron	INS	-	T	T	rs145470351	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78822189_78822190insT	uc010unc.1	+						AGPHD1_uc010ble.2_Intron	NM_001013619	NP_001013641			aminoglycoside phosphotransferase domain							cytoplasm	kinase activity				0																		---	---	---	---
CTSH	1512	broad.mit.edu	37	15	79237967	79237968	+	5'Flank	INS	-	T	T	rs71148581		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79237967_79237968insT	uc002ben.2	-						CTSH_uc010unf.1_5'Flank|CTSH_uc010bll.1_5'Flank|CTSH_uc010ung.1_5'Flank	NM_148979	NP_683880			cathepsin H isoform b precursor						protein destabilization|proteolysis	lysosome	cysteine-type endopeptidase activity			central_nervous_system(2)|large_intestine(1)	3																		---	---	---	---
TMED3	23423	broad.mit.edu	37	15	79641334	79641334	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79641334delC	uc010unj.1	+							NM_007364	NP_031390			transmembrane emp24 domain containing 3						protein transport	ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane				ovary(1)|skin(1)	2																		---	---	---	---
MESDC2	23184	broad.mit.edu	37	15	81247478	81247478	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81247478delA	uc002bfx.2	-						MESDC2_uc010uno.1_Intron	NM_015154				mesoderm development candidate 2						mesoderm development|protein folding|Wnt receptor signaling pathway	endoplasmic reticulum					0																		---	---	---	---
MESDC2	23184	broad.mit.edu	37	15	81266403	81266403	+	Intron	DEL	C	-	-	rs111416993		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81266403delC	uc002bfx.2	-						MESDC2_uc010uno.1_Intron	NM_015154				mesoderm development candidate 2						mesoderm development|protein folding|Wnt receptor signaling pathway	endoplasmic reticulum					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	81303889	81303890	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81303889_81303890insT								MESDC1 (7545 upstream) : C15orf26 (87859 downstream)																																			---	---	---	---
IL16	3603	broad.mit.edu	37	15	81557080	81557081	+	Intron	INS	-	G	G	rs143352281	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81557080_81557081insG	uc002bgh.3	+						IL16_uc002bgc.2_Intron|IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron	NM_172217	NP_757366			interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	83384532	83384535	+	5'Flank	DEL	TATG	-	-	rs140275200		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83384532_83384535delTATG	uc002biz.2	-						uc002bja.2_5'Flank					Homo sapiens cDNA FLJ36177 fis, clone TESTI2026515.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	83739377	83739378	+	IGR	DEL	GT	-	-	rs10560094		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83739377_83739378delGT								BTBD1 (3271 upstream) : TM6SF1 (36946 downstream)																																			---	---	---	---
BNC1	646	broad.mit.edu	37	15	83925151	83925151	+	3'UTR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83925151delT	uc002bjt.1	-	5					BNC1_uc010uos.1_3'UTR	NM_001717	NP_001708			basonuclin 1						epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84489830	84489830	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84489830delA	uc002bjz.3	+						ADAMTSL3_uc002bjy.1_Intron|ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400			ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
ADAMTSL3	57188	broad.mit.edu	37	15	84584253	84584254	+	Intron	DEL	TG	-	-	rs148578344	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84584253_84584254delTG	uc002bjz.3	+						ADAMTSL3_uc010bmt.1_Intron|ADAMTSL3_uc010bmu.1_Intron	NM_207517	NP_997400			ADAMTS-like 3 precursor							proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	84917540	84917541	+	IGR	INS	-	T	T	rs143965723	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84917540_84917541insT								LOC388152 (18620 upstream) : GOLGA6L5 (130197 downstream)																																			---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86007038	86007038	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86007038delT	uc002blv.1	+						AKAP13_uc002bls.2_Intron|AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131			A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86112686	86112687	+	Intron	INS	-	C	C	rs34343084		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86112686_86112687insC	uc002blv.1	+						AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131			A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86137028	86137028	+	Intron	DEL	T	-	-	rs74650287		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86137028delT	uc002blv.1	+						AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron|AKAP13_uc010bne.1_Intron	NM_007200	NP_009131			A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	86878373	86878374	+	Intron	DEL	TT	-	-	rs71468172		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86878373_86878374delTT	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	86899586	86899587	+	Intron	INS	-	GC	GC	rs151263305	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86899586_86899587insGC	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	87462831	87462832	+	Intron	INS	-	CG	CG	rs139599913	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87462831_87462832insCG	uc002blz.1	+							NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
ISG20	3669	broad.mit.edu	37	15	89187786	89187786	+	Intron	DEL	C	-	-	rs67738947		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89187786delC	uc002bmv.1	+						ISG20_uc002bmu.1_Intron|ISG20_uc002bmw.1_Intron|ISG20_uc010upn.1_Intron	NM_002201	NP_002192			interferon stimulated exonuclease						cell proliferation|DNA catabolic process, exonucleolytic|response to virus|RNA catabolic process|type I interferon-mediated signaling pathway	PML body	3'-5'-exoribonuclease activity|exoribonuclease II activity|metal ion binding|RNA binding|single-stranded DNA specific 3'-5' exodeoxyribonuclease activity				0	Lung NSC(78;0.0554)|all_lung(78;0.103)		BRCA - Breast invasive adenocarcinoma(143;0.12)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	89262629	89262629	+	IGR	DEL	A	-	-	rs72307202		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89262629delA								ISG20 (63750 upstream) : ACAN (84045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	89496185	89496191	+	IGR	DEL	TTTTTTT	-	-	rs61102352		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89496185_89496191delTTTTTTT								MFGE8 (39522 upstream) : ABHD2 (135190 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	89957075	89957076	+	IGR	DEL	CA	-	-	rs72501494		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89957075_89957076delCA								LOC254559 (15357 upstream) : RHCG (57562 downstream)																																			---	---	---	---
C15orf42	90381	broad.mit.edu	37	15	90141591	90141592	+	Intron	INS	-	TTGT	TTGT	rs141894536	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90141591_90141592insTTGT	uc002boe.2	+							NM_152259	NP_689472			leucine-rich repeat kinase 1						cell cycle|DNA repair|DNA replication|formation of translation preinitiation complex|G2/M transition checkpoint|mitotic cell cycle DNA replication checkpoint|regulation of DNA-dependent DNA replication initiation|response to ionizing radiation	nucleus	chromatin binding|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)															---	---	---	---
IQGAP1	8826	broad.mit.edu	37	15	90935344	90935344	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90935344delT	uc002bpl.1	+							NM_003870	NP_003861			IQ motif containing GTPase activating protein 1						energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)															---	---	---	---
CRTC3	64784	broad.mit.edu	37	15	91176314	91176314	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91176314delT	uc002bpp.2	+						CRTC3_uc002bpo.2_Intron	NM_022769	NP_073606			transducer of regulated CREB protein 3 isoform						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)					T	MAML2	salivary gland mucoepidermoid								---	---	---	---
Unknown	0	broad.mit.edu	37	15	91374085	91374086	+	IGR	INS	-	A	A	rs141402908	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91374085_91374086insA								BLM (15401 upstream) : FURIN (37799 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	92145948	92145951	+	IGR	DEL	GAGG	-	-	rs146175162		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92145948_92145951delGAGG								SV2B (307300 upstream) : SLCO3A1 (250987 downstream)																																			---	---	---	---
FAM174B	400451	broad.mit.edu	37	15	93246619	93246619	+	Intron	DEL	T	-	-	rs5814552		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93246619delT	uc002bsl.3	-											Homo sapiens cDNA PSEC0264 fis, clone NT2RP3002337.							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	93758437	93758437	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93758437delT								RGMA (126004 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	94423583	94423584	+	Intron	DEL	AC	-	-	rs35288531		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94423583_94423584delAC	uc002bte.1	-											Homo sapiens cDNA clone IMAGE:5266107.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	95861544	95861545	+	Intron	INS	-	TTG	TTG	rs72529493		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95861544_95861545insTTG	uc002btm.2	-											Homo sapiens hypothetical gene supported by BC040875, mRNA (cDNA clone IMAGE:5721930).																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	96897382	96897383	+	IGR	INS	-	CA	CA			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96897382_96897383insCA								NR2F2 (13892 upstream) : SPATA8 (429296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97731040	97731041	+	IGR	INS	-	A	A	rs5814778		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97731040_97731041insA								SPATA8 (402196 upstream) : LOC91948 (554805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	99584318	99584319	+	IGR	DEL	GA	-	-	rs10594029		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99584318_99584319delGA								PGPEP1L (33294 upstream) : SYNM (60967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	99630416	99630417	+	IGR	INS	-	G	G	rs145138353	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99630416_99630417insG								PGPEP1L (79392 upstream) : SYNM (14869 downstream)																																			---	---	---	---
LRRC28	123355	broad.mit.edu	37	15	99844040	99844040	+	Intron	DEL	A	-	-	rs35704800		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99844040delA	uc002bva.1	+						LRRC28_uc010urs.1_Intron|LRRC28_uc002bvb.1_Intron|LRRC28_uc010urt.1_Intron|LRRC28_uc002bvc.1_Intron|LRRC28_uc010uru.1_Intron|LRRC28_uc002bvd.1_Intron	NM_144598	NP_653199			leucine rich repeat containing 28												0	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)															---	---	---	---
ADAMTS17	170691	broad.mit.edu	37	15	100676471	100676472	+	Intron	INS	-	G	G	rs142853962	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100676471_100676472insG	uc002bvv.1	-						ADAMTS17_uc002bvx.1_Intron	NM_139057	NP_620688			ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)														---	---	---	---
LRRK1	79705	broad.mit.edu	37	15	101568328	101568328	+	Intron	DEL	A	-	-	rs34415456		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101568328delA	uc002bwr.2	+						LRRK1_uc010usb.1_Intron|LRRK1_uc010usc.1_Intron	NM_024652	NP_078928			leucine-rich repeat kinase 1						small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	101622437	101622440	+	IGR	DEL	CACA	-	-	rs36234489		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101622437_101622440delCACA								LRRK1 (12122 upstream) : CHSY1 (93492 downstream)																																			---	---	---	---
LMF1	64788	broad.mit.edu	37	16	909861	909861	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:909861delC	uc002ckj.2	-						LMF1_uc010brg.2_Intron|LMF1_uc010brh.2_Intron|LMF1_uc010bri.2_Intron|LMF1_uc002ckk.2_Intron	NM_022773	NP_073610			lipase maturation factor 1							endoplasmic reticulum membrane|integral to membrane					0		Hepatocellular(780;0.00308)																---	---	---	---
IFT140	9742	broad.mit.edu	37	16	1636629	1636630	+	Intron	DEL	CA	-	-	rs71860883		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1636629_1636630delCA	uc002cmb.2	-						IFT140_uc002clz.2_5'Flank	NM_014714	NP_055529			intraflagellar transport 140											ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)																---	---	---	---
SEPT12	124404	broad.mit.edu	37	16	4832912	4832912	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4832912delT	uc002cxq.2	-						SEPT12_uc002cxr.2_Intron|SEPT12_uc010bty.2_Intron	NM_144605	NP_653206			septin 12 isoform 2						cell cycle|cell division	cleavage furrow|midbody|perinuclear region of cytoplasm|septin complex|spindle|stress fiber	GDP binding|GTP binding|phosphatidylinositol binding|protein homodimerization activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	9345686	9345689	+	IGR	DEL	TGTC	-	-	rs111438452		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9345686_9345689delTGTC								C16orf72 (132141 upstream) : GRIN2A (501578 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	9836514	9836514	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9836514delG								C16orf72 (622969 upstream) : GRIN2A (10753 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	10928771	10928774	+	IGR	DEL	ATGA	-	-	rs33963264		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10928771_10928774delATGA								FAM18A (16150 upstream) : CIITA (42281 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	11580292	11580303	+	Intron	DEL	ATGGATGGATGA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11580292_11580303delATGGATGGATGA	uc002dax.1	-											Homo sapiens cDNA FLJ44575 fis, clone UTERU3018154.																														---	---	---	---
SNX29	92017	broad.mit.edu	37	16	12631941	12631941	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12631941delC	uc002dby.3	+							NM_001080530	NP_001073999			sorting nexin 29						cell communication		phosphatidylinositol binding			ovary(1)	1																		---	---	---	---
SHISA9	729993	broad.mit.edu	37	16	13220834	13220835	+	Intron	DEL	GA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13220834_13220835delGA	uc010uyy.1	+							NM_001145204	NP_001138676			shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0																		---	---	---	---
PARN	5073	broad.mit.edu	37	16	14673840	14673840	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14673840delA	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron	NM_002582	NP_002573			poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	14993785	14993785	+	5'Flank	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14993785delC	hsa-mir-3179-1|MI0014213	+																																									---	---	---	---
Unknown	0	broad.mit.edu	37	16	14997707	14997714	+	IGR	DEL	ATGGATGG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14997707_14997714delATGGATGG								NOMO1 (7694 upstream) : NPIP (23350 downstream)																																			---	---	---	---
ABCC1	4363	broad.mit.edu	37	16	16062755	16062756	+	Intron	INS	-	T	T	rs145562761		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16062755_16062756insT	uc010bvi.2	+						ABCC1_uc010bvj.2_Intron|ABCC1_uc010bvk.2_Intron|ABCC1_uc010bvl.2_Intron|ABCC1_uc010bvm.2_Intron	NM_004996	NP_004987			ATP-binding cassette, sub-family C, member 1						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	17145190	17145192	+	IGR	DEL	TTG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17145190_17145192delTTG								LOC339047 (700753 upstream) : XYLT1 (50991 downstream)																																			---	---	---	---
LOC81691	81691	broad.mit.edu	37	16	20858038	20858038	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20858038delT	uc002dhv.2	+						ERI2_uc002dht.3_Intron|LOC81691_uc002dhx.2_Intron|LOC81691_uc002dhw.2_Intron|LOC81691_uc002dhy.3_Intron	NM_030941	NP_112203			exonuclease NEF-sp isoform 1							nucleolus	exonuclease activity|nucleotide binding|RNA binding			ovary(1)|kidney(1)	2																		---	---	---	---
DNAH3	55567	broad.mit.edu	37	16	21114877	21114878	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21114877_21114878delAC	uc010vbe.1	-							NM_017539	NP_060009			dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	21558400	21558401	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21558400_21558401insT	uc002diq.3	+											Homo sapiens cDNA FLJ59829 complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	21573432	21573432	+	Intron	DEL	T	-	-	rs79099481		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21573432delT	uc002diq.3	+											Homo sapiens cDNA FLJ59829 complete cds.																														---	---	---	---
OTOA	146183	broad.mit.edu	37	16	21712045	21712046	+	Intron	INS	-	AA	AA	rs3054189		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21712045_21712046insAA	uc002djh.2	+						uc002diq.3_Intron|OTOA_uc010vbj.1_Intron	NM_144672	NP_653273			otoancorin isoform 1						sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)														---	---	---	---
LOC653786	653786	broad.mit.edu	37	16	22556893	22556894	+	5'Flank	INS	-	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22556893_22556894insC	uc002dlh.3	+							NR_003676				RecName: Full=Otoancorin; Flags: Precursor;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	26242241	26242242	+	IGR	INS	-	CA	CA	rs139621728	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26242241_26242242insCA								HS3ST4 (93233 upstream) : C16orf82 (835977 downstream)																																			---	---	---	---
GSG1L	146395	broad.mit.edu	37	16	27801148	27801151	+	3'UTR	DEL	TGGA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27801148_27801151delTGGA	uc002doz.2	-	7					GSG1L_uc010bya.1_3'UTR|GSG1L_uc010bxz.1_3'UTR|GSG1L_uc002doy.2_3'UTR	NM_001109763	NP_001103233			GSG1-like isoform 1							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	31255967	31255967	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31255967delT								TRIM72 (19457 upstream) : ITGAM (15321 downstream)																																			---	---	---	---
ARMC5	79798	broad.mit.edu	37	16	31467117	31467117	+	5'Flank	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31467117delC	uc010vfn.1	+							NM_001105247	NP_001098717			armadillo repeat containing 5 isoform a								binding			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	32409475	32409475	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32409475delT								HERC2P4 (245601 upstream) : TP53TG3B (275366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32452188	32452188	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32452188delT								HERC2P4 (288314 upstream) : TP53TG3B (232653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32464846	32464847	+	IGR	INS	-	TA	TA	rs141044790	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32464846_32464847insTA								HERC2P4 (300972 upstream) : TP53TG3B (219994 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32525841	32525842	+	IGR	INS	-	A	A	rs143512379		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32525841_32525842insA								HERC2P4 (361967 upstream) : TP53TG3B (158999 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32629071	32629071	+	IGR	DEL	C	-	-	rs141186057		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32629071delC								HERC2P4 (465197 upstream) : TP53TG3B (55770 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32818247	32818248	+	IGR	INS	-	TCA	TCA			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32818247_32818248insTCA								TP53TG3B (129369 upstream) : SLC6A10P (70549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32856620	32856620	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32856620delT								TP53TG3B (167742 upstream) : SLC6A10P (32177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33382685	33382688	+	IGR	DEL	CATG	-	-	rs138261645		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33382685_33382688delCATG								SLC6A10P (486222 upstream) : MIR1826 (582820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33504874	33504875	+	IGR	INS	-	TTTTGT	TTTTGT	rs143788968	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33504874_33504875insTTTTGT								SLC6A10P (608411 upstream) : MIR1826 (460633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33680852	33680869	+	IGR	DEL	CACACACACACACAAACA	-	-	rs72350912		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33680852_33680869delCACACACACACACAAACA								SLC6A10P (784389 upstream) : MIR1826 (284639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33921970	33921970	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33921970delC								None (None upstream) : MIR1826 (43538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33935694	33935694	+	IGR	DEL	C	-	-	rs112373913		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33935694delC								None (None upstream) : MIR1826 (29814 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33937348	33937349	+	IGR	DEL	TT	-	-	rs111232160		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33937348_33937349delTT								None (None upstream) : MIR1826 (28159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33951124	33951125	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33951124_33951125insT								None (None upstream) : MIR1826 (14383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33955493	33955494	+	IGR	DEL	CC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33955493_33955494delCC								None (None upstream) : MIR1826 (10014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33958173	33958177	+	IGR	DEL	TCTGT	-	-	rs138170346		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33958173_33958177delTCTGT								None (None upstream) : MIR1826 (7331 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33979896	33979896	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33979896delC								MIR1826 (14304 upstream) : UBE2MP1 (423906 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34008364	34008364	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34008364delC								MIR1826 (42772 upstream) : UBE2MP1 (395438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	48861507	48861507	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48861507delG								N4BP1 (217387 upstream) : CBLN1 (450704 downstream)																																			---	---	---	---
FTO	79068	broad.mit.edu	37	16	53815707	53815710	+	Intron	DEL	TGTT	-	-	rs113454766		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53815707_53815710delTGTT	uc002ehr.2	+						FTO_uc010vha.1_Intron	NM_001080432	NP_001073901			fat mass and obesity associated						DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	55316924	55316924	+	IGR	DEL	T	-	-	rs72293419		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55316924delT								IRX5 (348531 upstream) : IRX6 (41547 downstream)																																			---	---	---	---
GPR97	222487	broad.mit.edu	37	16	57716772	57716772	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57716772delT	uc002emh.2	+						GPR97_uc010vhv.1_Intron|GPR97_uc010cdd.2_Intron|GPR97_uc010cde.2_Intron	NM_170776	NP_740746			G protein-coupled receptor 97 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	60167669	60167669	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60167669delC								None (None upstream) : None (None downstream)																																			---	---	---	---
CDH8	1006	broad.mit.edu	37	16	61925235	61925235	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61925235delA	uc002eog.1	-							NM_001796	NP_001787			cadherin 8, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	62471002	62471002	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62471002delC								CDH8 (400966 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	64260475	64260476	+	IGR	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64260475_64260476delAC								None (None upstream) : CDH11 (720209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	65781801	65781802	+	IGR	DEL	AA	-	-	rs33959520		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65781801_65781802delAA								LOC283867 (171598 upstream) : CDH5 (618723 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	66095127	66095127	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66095127delA								LOC283867 (484924 upstream) : CDH5 (305398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	66734662	66734662	+	IGR	DEL	A	-	-	rs72111865		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66734662delA								CMTM4 (4052 upstream) : DYNC1LI2 (20137 downstream)																																			---	---	---	---
CTCF	10664	broad.mit.edu	37	16	67657535	67657536	+	Intron	INS	-	A	A	rs74617932		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67657535_67657536insA	uc002etl.2	+						CTCF_uc010cek.2_Intron	NM_006565	NP_006556			CCCTC-binding factor						chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)														---	---	---	---
NFATC3	4775	broad.mit.edu	37	16	68243742	68243743	+	Intron	DEL	AC	-	-	rs76078635		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68243742_68243743delAC	uc002evo.1	+						NFATC3_uc010vkm.1_Intron|NFATC3_uc010vkn.1_Intron|NFATC3_uc010vkp.1_Intron|NFATC3_uc010vkq.1_Intron|NFATC3_uc002evm.1_Intron|NFATC3_uc002evn.1_Intron|NFATC3_uc010vks.1_Intron|NFATC3_uc010vkt.1_Intron|NFATC3_uc010vkv.1_Intron|NFATC3_uc010vkw.1_Intron|NFATC3_uc010vky.1_Intron|NFATC3_uc010vkz.1_Intron|NFATC3_uc010vlb.1_Intron|NFATC3_uc010vlc.1_Intron	NM_173165	NP_775188			nuclear factor of activated T-cells,						inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)														---	---	---	---
TMCO7	79613	broad.mit.edu	37	16	69039173	69039174	+	Intron	DEL	TG	-	-	rs72147401		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69039173_69039174delTG	uc002ewi.3	+							NM_024562	NP_078838			transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)														---	---	---	---
TMCO7	79613	broad.mit.edu	37	16	69073538	69073539	+	Intron	INS	-	AAACA	AAACA	rs143723155	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69073538_69073539insAAACA	uc002ewi.3	+							NM_024562	NP_078838			transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	69535294	69535297	+	IGR	DEL	GTGT	-	-	rs71385612		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69535294_69535297delGTGT								CYB5B (35127 upstream) : NFAT5 (63700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	72346806	72346807	+	IGR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72346806_72346807delCA								PMFBP1 (140457 upstream) : ZFHX3 (469981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	73702206	73702206	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73702206delT								HTA (574536 upstream) : PSMD7 (628475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	73907877	73907877	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73907877delA								HTA (780207 upstream) : PSMD7 (422804 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	74106941	74106944	+	IGR	DEL	TCTC	-	-	rs72558290		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74106941_74106944delTCTC								HTA (979271 upstream) : PSMD7 (223737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	74154170	74154170	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74154170delT								None (None upstream) : PSMD7 (176511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	74650771	74650772	+	IGR	INS	-	T	T	rs146859646	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74650771_74650772insT								GLG1 (9729 upstream) : RFWD3 (4526 downstream)																																			---	---	---	---
MLKL	197259	broad.mit.edu	37	16	74724951	74724952	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74724951_74724952insT	uc002fdb.2	-						MLKL_uc002fdc.2_Intron	NM_152649	NP_689862			mixed lineage kinase domain-like isoform 1								ATP binding|protein binding|protein kinase activity			stomach(2)	2																		---	---	---	---
ZNRF1	84937	broad.mit.edu	37	16	75070467	75070467	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75070467delT	uc002fdk.2	+						ZNRF1_uc010vmz.1_Intron|ZNRF1_uc002fdl.1_Intron|ZNRF1_uc010cgr.1_Intron	NM_032268	NP_115644			zinc and ring finger protein 1							cell junction|endosome|lysosome|synaptic vesicle membrane	ligase activity|protein binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	79584234	79584235	+	IGR	INS	-	GA	GA	rs142589558	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79584234_79584235insGA								WWOX (337671 upstream) : MAF (43511 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	79701059	79701059	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79701059delA								MAF (66437 upstream) : DYNLRB2 (873795 downstream)																																			---	---	---	---
BCMO1	53630	broad.mit.edu	37	16	81300375	81300375	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81300375delC	uc002fgn.1	+						BCMO1_uc010vnp.1_Intron	NM_017429	NP_059125			beta-carotene 15,15'-monooxygenase						retinoid metabolic process|steroid metabolic process	cytosol	beta-carotene 15,15'-monooxygenase activity|metal ion binding|monooxygenase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	81335642	81335645	+	IGR	DEL	TCCA	-	-	rs141836056		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81335642_81335645delTCCA								BCMO1 (10895 upstream) : GAN (12926 downstream)																																			---	---	---	---
CMIP	80790	broad.mit.edu	37	16	81729522	81729523	+	Intron	INS	-	GA	GA	rs143909462	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81729522_81729523insGA	uc002fgp.2	+						CMIP_uc002fgq.1_Intron|CMIP_uc010vnq.1_Intron|CMIP_uc002fgr.1_Intron|CMIP_uc010vnr.1_Intron	NM_198390	NP_938204			c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	84950725	84950730	+	IGR	DEL	GTGTGT	-	-	rs10563401		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84950725_84950730delGTGTGT								CRISPLD2 (7609 upstream) : ZDHHC7 (57337 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85169222	85169223	+	IGR	DEL	GT	-	-	rs66928428		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85169222_85169223delGT								FAM92B (23108 upstream) : KIAA0182 (475806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86323721	86323721	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86323721delA								IRF8 (367512 upstream) : LOC732275 (41735 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86621486	86621488	+	IGR	DEL	CAA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86621486_86621488delCAA								FOXL1 (6183 upstream) : FBXO31 (741456 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	86621736	86621738	+	IGR	DEL	ATC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86621736_86621738delATC								FOXL1 (6433 upstream) : FBXO31 (741206 downstream)																																			---	---	---	---
BANP	54971	broad.mit.edu	37	16	87998325	87998326	+	Intron	INS	-	C	C	rs144789837	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87998325_87998326insC	uc010vow.1	+						BANP_uc002fkp.2_Intron|BANP_uc002fkq.2_Intron|BANP_uc002fks.3_Intron|BANP_uc002fko.1_Intron|BANP_uc010vov.1_Intron	NM_017869	NP_060339			BTG3 associated nuclear protein isoform a						cell cycle|chromatin modification|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0				BRCA - Breast invasive adenocarcinoma(80;0.00551)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	88447305	88447306	+	IGR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88447305_88447306delCA								BANP (336382 upstream) : ZNF469 (46573 downstream)																																			---	---	---	---
CBFA2T3	863	broad.mit.edu	37	16	88974750	88974751	+	Intron	DEL	AA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88974750_88974751delAA	uc002fmm.1	-						CBFA2T3_uc002fml.1_Intron|CBFA2T3_uc010cif.1_Intron|CBFA2T3_uc002fmn.1_Intron	NM_005187	NP_005178			myeloid translocation gene on chromosome 16						cell proliferation|granulocyte differentiation	Golgi membrane|nucleolus|nucleoplasm	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(3)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0275)				T	RUNX1	AML								---	---	---	---
ANKRD11	29123	broad.mit.edu	37	16	89384976	89384977	+	Intron	INS	-	T	T	rs142062197	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89384976_89384977insT	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fnd.2_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron|uc010vpi.1_5'Flank|ANKRD11_uc002fnf.1_Intron	NM_013275	NP_037407			ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)														---	---	---	---
ANKRD11	29123	broad.mit.edu	37	16	89446967	89446968	+	Intron	INS	-	C	C	rs140999471	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89446967_89446968insC	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fnd.2_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron	NM_013275	NP_037407			ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)														---	---	---	---
ANKRD11	29123	broad.mit.edu	37	16	89450946	89450947	+	Intron	INS	-	TGGGA	TGGGA	rs147103535	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89450946_89450947insTGGGA	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fnd.2_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron	NM_013275	NP_037407			ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	896744	896744	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:896744delC								NXN (13734 upstream) : TIMM22 (3613 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	1130000	1130005	+	IGR	DEL	TGTGCA	-	-	rs55866246		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1130000_1130005delTGTGCA								ABR (39384 upstream) : TUSC5 (52952 downstream)																																			---	---	---	---
SMG6	23293	broad.mit.edu	37	17	2075742	2075743	+	Intron	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2075742_2075743delCA	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045			Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4																		---	---	---	---
SPNS3	201305	broad.mit.edu	37	17	4348671	4348672	+	Intron	DEL	TT	-	-	rs113799983		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4348671_4348672delTT	uc002fxt.2	+						SPNS3_uc002fxu.2_Intron	NM_182538	NP_872344			spinster homolog 3						lipid transport|transmembrane transport	integral to membrane				large_intestine(1)	1																		---	---	---	---
USP6	9098	broad.mit.edu	37	17	5027196	5027197	+	Intron	DEL	GT	-	-	rs11870478	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5027196_5027197delGT	uc002gau.1	+						ZNF232_uc002gat.2_5'Flank	NM_004505	NP_004496			ubiquitin specific protease 6						protein deubiquitination|regulation of vesicle-mediated transport|ubiquitin-dependent protein catabolic process	lysosome|plasma membrane|recycling endosome	calmodulin binding|cysteine-type endopeptidase activity|nucleic acid binding|protein binding|Rab GTPase activator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			skin(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)	5								T	COL1A1|CDH11|ZNF9|OMD	aneurysmal bone cysts								---	---	---	---
ZNF594	84622	broad.mit.edu	37	17	5084035	5084036	+	3'UTR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5084035_5084036insA	uc010cla.1	-	2						NM_032530	NP_115919			zinc finger protein 594						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
ZNF594	84622	broad.mit.edu	37	17	5094104	5094105	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5094104_5094105insT	uc010cla.1	-						uc002gbf.1_5'Flank|uc002gbg.1_5'Flank	NM_032530	NP_115919			zinc finger protein 594						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
NUP88	4927	broad.mit.edu	37	17	5311339	5311339	+	Intron	DEL	T	-	-	rs75401881		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5311339delT	uc002gbo.1	-						NUP88_uc010vsx.1_Intron|NUP88_uc010cle.1_Intron|NUP88_uc010vsy.1_Intron	NM_002532	NP_002523			nucleoporin 88kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	transporter activity			kidney(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	6140056	6140057	+	IGR	INS	-	A	A	rs77774644		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6140056_6140057insA								WSCD1 (112311 upstream) : AIPL1 (187003 downstream)																																			---	---	---	---
GABARAP	11337	broad.mit.edu	37	17	7145230	7145233	+	Intron	DEL	AATC	-	-	rs75210172		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7145230_7145233delAATC	uc002gfb.2	-						PHF23_uc002gfa.2_5'Flank|PHF23_uc010vtt.1_5'Flank|PHF23_uc010cma.2_5'Flank	NM_007278	NP_009209			GABA(A) receptor-associated protein						protein targeting|synaptic transmission	autophagic vacuole membrane|Golgi membrane|microtubule|plasma membrane	beta-tubulin binding|GABA receptor binding				0																		---	---	---	---
ATP1B2	482	broad.mit.edu	37	17	7553038	7553038	+	5'Flank	DEL	T	-	-	rs74960396		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7553038delT	uc002gif.1	+							NM_001678	NP_001669			Na+/K+ -ATPase beta 2 subunit						ATP biosynthetic process|blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|sodium:potassium-exchanging ATPase activity	p.0?(2)|p.?(1)		central_nervous_system(1)|pancreas(1)	2		all_cancers(10;0.000178)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;2.55e-06)|READ - Rectum adenocarcinoma(115;0.168)														---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577112	7577113	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577112_7577113delCA	uc002gim.2	-	8	1019_1020	c.825_826delTG	c.(823-828)TGTGCCfs	p.C275fs	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Frame_Shift_Del_p.C275fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Frame_Shift_Del_p.C143fs|TP53_uc010cng.1_Frame_Shift_Del_p.C143fs|TP53_uc002gii.1_Frame_Shift_Del_p.C143fs|TP53_uc010cnh.1_Frame_Shift_Del_p.C275fs|TP53_uc010cni.1_Frame_Shift_Del_p.C275fs|TP53_uc002gij.2_Frame_Shift_Del_p.C275fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	275_276	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		A -> V (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> D (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> G (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C275Y(44)|p.C275F(33)|p.A276P(13)|p.A276S(9)|p.C275G(7)|p.C275W(7)|p.0?(7)|p.A276T(7)|p.C275R(6)|p.C275C(4)|p.C275fs*70(2)|p.C275fs*31(2)|p.?(2)|p.C275S(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.A276fs*68(1)|p.R273_C275delRVC(1)|p.C275_A276ins10(1)|p.V274_P278del(1)|p.C275*(1)|p.F270_D281del12(1)|p.A276fs*31(1)|p.C275_R283delCACPGRDRR(1)|p.A276fs*70(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.A276_C277delAC(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275fs*20(1)|p.A276fs*29(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	7783322	7783323	+	IGR	INS	-	AG	AG	rs147435051	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7783322_7783323insAG								CYB5D1 (17724 upstream) : CHD3 (4800 downstream)																																			---	---	---	---
GAS7	8522	broad.mit.edu	37	17	9957479	9957480	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9957479_9957480insT	uc002gmg.1	-						GAS7_uc010coh.1_Intron	NM_201433	NP_958839			growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2								T	MLL	AML*								---	---	---	---
Unknown	0	broad.mit.edu	37	17	10749956	10749958	+	IGR	DEL	TGA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10749956_10749958delTGA								PIRT (8538 upstream) : SHISA6 (394782 downstream)																																			---	---	---	---
SHISA6	388336	broad.mit.edu	37	17	11359584	11359584	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11359584delG	uc002gna.3	+						SHISA6_uc002gnb.3_Intron|SHISA6_uc010com.2_Intron	NM_207386	NP_997269			shisa homolog 6							integral to membrane				breast(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	13526175	13526175	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13526175delC								HS3ST3A1 (20931 upstream) : CDRT15P (401640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	14815887	14815887	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14815887delA								HS3ST3B1 (566395 upstream) : PMP22 (317210 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	14999038	14999038	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14999038delA								HS3ST3B1 (749546 upstream) : PMP22 (134059 downstream)																																			---	---	---	---
COPS3	8533	broad.mit.edu	37	17	17182193	17182193	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17182193delT	uc002grd.2	-						COPS3_uc010vwv.1_Intron|COPS3_uc010vww.1_Intron	NM_003653	NP_003644			COP9 constitutive photomorphogenic homolog						cullin deneddylation|response to light stimulus|signal transduction	cytoplasm|signalosome	protein binding			skin(1)	1																		---	---	---	---
RAI1	10743	broad.mit.edu	37	17	17631360	17631361	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17631360_17631361delTG	uc002grm.2	+							NM_030665	NP_109590			retinoic acid induced 1							cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	20762103	20762104	+	IGR	DEL	TG	-	-	rs34059908		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20762103_20762104delTG								LGALS9B (391255 upstream) : CCDC144NL (4606 downstream)																																			---	---	---	---
CCDC144NL	339184	broad.mit.edu	37	17	20768495	20768496	+	3'UTR	INS	-	CCATATA	CCATATA	rs144158503	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20768495_20768496insCCATATA	uc002gyf.2	-	4						NM_001004306	NP_001004306			coiled-coil domain containing 144 family,												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	21174552	21174552	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21174552delT								C17orf103 (17974 upstream) : MAP2K3 (13416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21250069	21250069	+	IGR	DEL	C	-	-	rs66672846		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21250069delC								MAP2K3 (31520 upstream) : KCNJ12 (29630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21251144	21251145	+	IGR	INS	-	ACA	ACA	rs143825959		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21251144_21251145insACA								MAP2K3 (32595 upstream) : KCNJ12 (28554 downstream)																																			---	---	---	---
KCNJ12	3768	broad.mit.edu	37	17	21306688	21306690	+	Intron	DEL	ACA	-	-	rs144651249	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21306688_21306690delACA	uc002gyv.1	+							NM_021012	NP_066292			potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21349799	21349800	+	IGR	INS	-	T	T	rs149320743		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21349799_21349800insT								KCNJ12 (26620 upstream) : C17orf51 (81772 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21522035	21522035	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21522035delT								C17orf51 (44304 upstream) : FAM27L (303335 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21547444	21547445	+	IGR	INS	-	TT	TT			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21547444_21547445insTT								C17orf51 (69713 upstream) : FAM27L (277925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21561699	21561700	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21561699_21561700insA								C17orf51 (83968 upstream) : FAM27L (263670 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21668928	21668931	+	IGR	DEL	CTGT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21668928_21668931delCTGT								C17orf51 (191197 upstream) : FAM27L (156439 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21886548	21886548	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21886548delG								FAM27L (60045 upstream) : FLJ36000 (17514 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25303549	25303550	+	IGR	DEL	TA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25303549_25303550delTA								None (None upstream) : WSB1 (317556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25333720	25333721	+	IGR	INS	-	TTTA	TTTA	rs150576098	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25333720_25333721insTTTA								None (None upstream) : WSB1 (287385 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	26032496	26032497	+	IGR	DEL	TG	-	-	rs66620949		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26032496_26032497delTG								LGALS9 (55911 upstream) : NOS2 (51296 downstream)																																			---	---	---	---
SSH2	85464	broad.mit.edu	37	17	28143345	28143345	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28143345delT	uc002heo.1	-						SSH2_uc010wbh.1_Intron|SSH2_uc002hep.1_Intron|SSH2_uc002her.2_Intron|SSH2_uc010csc.1_Intron	NM_033389	NP_203747			slingshot 2						actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2																		---	---	---	---
MYO1D	4642	broad.mit.edu	37	17	30856543	30856544	+	Intron	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30856543_30856544delGT	uc002hho.1	-							NM_015194	NP_056009			myosin ID							myosin complex	actin binding|ATP binding|calmodulin binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3			BRCA - Breast invasive adenocarcinoma(9;0.0362)															---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31394162	31394162	+	Intron	DEL	C	-	-	rs59520303		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31394162delC	uc002hhu.2	-						ACCN1_uc002hht.2_Intron	NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	33232352	33232352	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33232352delT								TMEM132E (266016 upstream) : CCT6B (22588 downstream)																																			---	---	---	---
UNC45B	146862	broad.mit.edu	37	17	33515961	33515961	+	3'UTR	DEL	T	-	-	rs112397414		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33515961delT	uc002hja.2	+	20					UNC45B_uc002hjb.2_3'UTR|UNC45B_uc002hjc.2_3'UTR|UNC45B_uc010cto.2_3'UTR	NM_173167	NP_775259			cardiomyopathy associated 4 isoform 1						cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)																---	---	---	---
SLFN12	55106	broad.mit.edu	37	17	33761383	33761383	+	5'Flank	DEL	A	-	-	rs71375409		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33761383delA	uc002hji.3	-						SLFN12_uc002hjj.3_5'Flank|SLFN12_uc010cts.2_5'Flank	NM_018042	NP_060512			schlafen family member 12								ATP binding			skin(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	36380011	36380012	+	Intron	DEL	TA	-	-	rs145241426		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36380011_36380012delTA	uc002hpx.2	-											Homo sapiens cDNA FLJ43844 fis, clone TESTI4006308, highly  similar to Puromycin-sensitive aminopeptidase (EC 3.4.11.-).																														---	---	---	---
IKZF3	22806	broad.mit.edu	37	17	37995406	37995406	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37995406delT	uc002hsu.2	-						IKZF3_uc002htd.2_Intron|IKZF3_uc010cwd.2_Intron|IKZF3_uc002hsv.2_Intron|IKZF3_uc010cwe.2_Intron|IKZF3_uc010cwf.2_Intron|IKZF3_uc010cwg.2_Intron|IKZF3_uc002hsw.2_Intron|IKZF3_uc002hsx.2_Intron|IKZF3_uc002hsy.2_Intron|IKZF3_uc002hsz.2_Intron|IKZF3_uc002hta.2_Intron|IKZF3_uc002htb.2_Intron|IKZF3_uc010cwh.2_Intron|IKZF3_uc002htc.2_Intron	NM_012481	NP_036613			aiolos isoform 1						B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)															---	---	---	---
IKZF3	22806	broad.mit.edu	37	17	37997431	37997432	+	Intron	INS	-	A	A	rs111702386		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37997431_37997432insA	uc002hsu.2	-						IKZF3_uc002htd.2_Intron|IKZF3_uc010cwd.2_Intron|IKZF3_uc002hsv.2_Intron|IKZF3_uc010cwe.2_Intron|IKZF3_uc010cwf.2_Intron|IKZF3_uc010cwg.2_Intron|IKZF3_uc002hsw.2_Intron|IKZF3_uc002hsx.2_Intron|IKZF3_uc002hsy.2_Intron|IKZF3_uc002hsz.2_Intron|IKZF3_uc002hta.2_Intron|IKZF3_uc002htb.2_Intron|IKZF3_uc010cwh.2_Intron|IKZF3_uc002htc.2_Intron	NM_012481	NP_036613			aiolos isoform 1						B cell activation|mesoderm development|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(2)|kidney(2)|skin(2)	6	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)															---	---	---	---
KRTAP2-4	85294	broad.mit.edu	37	17	39223354	39223355	+	5'Flank	INS	-	G	G	rs143745401		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39223354_39223355insG	uc002hvy.2	-							NM_033184	NP_149440			keratin associated protein 2-4							keratin filament					0		Breast(137;0.000496)|Myeloproliferative disorder(1115;0.204)	STAD - Stomach adenocarcinoma(17;0.000371)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	39266245	39266245	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39266245delT								KRTAP4-9 (3507 upstream) : KRTAP4-11 (7191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	41792491	41792491	+	IGR	DEL	T	-	-	rs67913335		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41792491delT								MEOX1 (53229 upstream) : SOST (38608 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	42205840	42205841	+	IGR	INS	-	A	A	rs75687320	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42205840_42205841insA								HDAC5 (4826 upstream) : C17orf53 (13485 downstream)																																			---	---	---	---
UBTF	7343	broad.mit.edu	37	17	42292020	42292021	+	Intron	INS	-	CTT	CTT	rs146494340	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42292020_42292021insCTT	uc002igb.2	-						UBTF_uc002igc.2_Intron|UBTF_uc010czs.2_Intron|UBTF_uc002igd.2_Intron|UBTF_uc010czt.2_Intron|UBTF_uc002ige.2_Intron	NM_014233	NP_055048			upstream binding transcription factor, RNA						positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)														---	---	---	---
ADAM11	4185	broad.mit.edu	37	17	42838552	42838553	+	Intron	DEL	TG	-	-	rs141028048		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42838552_42838553delTG	uc002ihh.2	+						ADAM11_uc010wjd.1_Intron	NM_002390	NP_002381			ADAM metallopeptidase domain 11 preproprotein						integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			pancreas(1)	1		Prostate(33;0.0959)																---	---	---	---
NMT1	4836	broad.mit.edu	37	17	43165823	43165823	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43165823delG	uc002ihz.2	+						NMT1_uc002iia.2_Intron	NM_021079	NP_066565			N-myristoyltransferase 1						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals|N-terminal protein myristoylation|protein lipoylation	actin cytoskeleton|cell junction|cytosol	glycylpeptide N-tetradecanoyltransferase activity				0		Prostate(33;0.155)																---	---	---	---
MAPT	4137	broad.mit.edu	37	17	43999853	43999854	+	Intron	DEL	AC	-	-	rs72189754		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43999853_43999854delAC	uc002ijr.3	+						MAPT_uc010dau.2_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519			microtubule-associated protein tau isoform 1						cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)																---	---	---	---
MAPT	4137	broad.mit.edu	37	17	44069147	44069148	+	Intron	INS	-	T	T	rs114790373	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44069147_44069148insT	uc002ijr.3	+						MAPT_uc010dau.2_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519			microtubule-associated protein tau isoform 1						cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)																---	---	---	---
KIAA1267	284058	broad.mit.edu	37	17	44217662	44217662	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44217662delA	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258			hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)																---	---	---	---
KPNB1	3837	broad.mit.edu	37	17	45750134	45750134	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45750134delT	uc002ilt.1	+						KPNB1_uc010wkw.1_Intron|KPNB1_uc010wkx.1_Intron	NM_002265	NP_002256			karyopherin beta 1						DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|protein import into nucleus, translocation|ribosomal protein import into nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein domain specific binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	46727238	46727238	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46727238delA								MIR196A1 (17317 upstream) : PRAC (71854 downstream)																																			---	---	---	---
TTLL6	284076	broad.mit.edu	37	17	46872692	46872692	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46872692delA	uc010wlo.1	-						TTLL6_uc002iob.2_5'Flank|TTLL6_uc010dbi.2_5'Flank|TTLL6_uc002ioc.2_Intron|TTLL6_uc002iod.2_Intron	NM_001130918	NP_001124390			tubulin tyrosine ligase-like family, member 6							cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	47945188	47945189	+	IGR	INS	-	C	C	rs146650807	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47945188_47945189insC								TAC4 (19809 upstream) : DLX4 (101373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	48088282	48088283	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48088282_48088283insT								DLX3 (15694 upstream) : ITGA3 (45057 downstream)																																			---	---	---	---
TMEM92	162461	broad.mit.edu	37	17	48351529	48351529	+	5'Flank	DEL	G	-	-	rs113094850		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48351529delG	uc002iqn.1	+							NM_153229	NP_694961			transmembrane protein 92 precursor							integral to membrane					0																		---	---	---	---
RSAD1	55316	broad.mit.edu	37	17	48555889	48555889	+	5'Flank	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48555889delC	uc002iqw.1	+						RSAD1_uc010wmp.1_5'Flank|RSAD1_uc010wmq.1_5'Flank	NM_018346	NP_060816			radical S-adenosyl methionine domain containing						porphyrin biosynthetic process	mitochondrion	4 iron, 4 sulfur cluster binding|coproporphyrinogen oxidase activity|metal ion binding				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)													OREG0024566	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
CA10	56934	broad.mit.edu	37	17	49993501	49993502	+	Intron	INS	-	AC	AC	rs141187699	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49993501_49993502insAC	uc002itw.3	-						CA10_uc002itv.3_Intron|CA10_uc002itx.3_Intron|CA10_uc002ity.3_Intron|CA10_uc002itz.2_Intron	NM_020178	NP_064563			carbonic anhydrase X						brain development					ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	50364094	50364095	+	IGR	INS	-	TTC	TTC	rs139211712	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50364094_50364095insTTC								CA10 (126717 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	50512121	50512122	+	IGR	DEL	GA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50512121_50512122delGA								CA10 (274744 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	50868442	50868443	+	IGR	INS	-	TTA	TTA	rs138405566	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50868442_50868443insTTA								CA10 (631065 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	50877934	50877937	+	IGR	DEL	TGAC	-	-	rs146020841		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50877934_50877937delTGAC								CA10 (640557 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	51308962	51308963	+	IGR	DEL	CA	-	-	rs4563079		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51308962_51308963delCA								None (None upstream) : KIF2B (591276 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	53537811	53537812	+	IGR	INS	-	C	C	rs145552440	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53537811_53537812insC								MMD (38470 upstream) : TMEM100 (259178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	53555600	53555600	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53555600delT								MMD (56259 upstream) : TMEM100 (241390 downstream)																																			---	---	---	---
SCPEP1	59342	broad.mit.edu	37	17	55067301	55067301	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55067301delA	uc002iuv.3	+						SCPEP1_uc010dcl.2_Intron|SCPEP1_uc010wnk.1_Intron	NM_021626	NP_067639			serine carboxypeptidase 1 precursor						proteolysis	extracellular region	serine-type carboxypeptidase activity			skin(1)	1	Breast(9;2.86e-08)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	56206526	56206526	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56206526delT								DYNLL2 (38908 upstream) : OR4D1 (25989 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	61007830	61007830	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61007830delC								MARCH10 (122125 upstream) : MIR633 (13746 downstream)																																			---	---	---	---
TANC2	26115	broad.mit.edu	37	17	61376449	61376450	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61376449_61376450insA	uc002jal.3	+						TANC2_uc010wpe.1_Intron	NM_025185	NP_079461			tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	61986603	61986603	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61986603delT								CSH2 (12616 upstream) : CSHL1 (362 downstream)																																			---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	63826586	63826586	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63826586delC	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	65305752	65305753	+	IGR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65305752_65305753delCA								HELZ (64433 upstream) : PSMD12 (30867 downstream)																																			---	---	---	---
SLC16A6	9120	broad.mit.edu	37	17	66265043	66265043	+	3'UTR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66265043delA	uc002jgz.1	-	6					ARSG_uc002jhc.2_Intron|SLC16A6_uc002jha.1_3'UTR	NM_004694	NP_004685			solute carrier family 16, member 6							integral to plasma membrane|membrane fraction	monocarboxylic acid transmembrane transporter activity|symporter activity				0	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	66813169	66813170	+	IGR	INS	-	AGAG	AGAG	rs143247635	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66813169_66813170insAGAG								FAM20A (216074 upstream) : ABCA8 (50263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68490133	68490134	+	IGR	INS	-	GTGTGT	GTGTGT			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68490133_68490134insGTGTGT								KCNJ2 (313952 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68501046	68501049	+	IGR	DEL	ATCT	-	-	rs150949135	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68501046_68501049delATCT								KCNJ2 (324865 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68547129	68547130	+	IGR	INS	-	TG	TG	rs144010401	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68547129_68547130insTG								KCNJ2 (370948 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69114656	69114656	+	Intron	DEL	T	-	-	rs11357418		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69114656delT	uc002jis.3	-											Homo sapiens cDNA clone IMAGE:5267277.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	69670928	69670929	+	IGR	DEL	AC	-	-	rs72531417		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69670928_69670929delAC								None (None upstream) : SOX9 (446232 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70405250	70405251	+	Intron	DEL	CT	-	-	rs71925423		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70405250_70405251delCT	uc002jix.2	-						uc002jiz.1_Intron|uc002jiy.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																														---	---	---	---
SLC39A11	201266	broad.mit.edu	37	17	70685564	70685579	+	Intron	DEL	AGCAATTCCACTCCTG	-	-	rs72404858		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70685564_70685579delAGCAATTCCACTCCTG	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron	NM_001159770	NP_001153242			solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	71112935	71112936	+	IGR	INS	-	T	T	rs140874775	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71112935_71112936insT								SLC39A11 (24082 upstream) : SSTR2 (48224 downstream)																																			---	---	---	---
C17orf80	55028	broad.mit.edu	37	17	71230598	71230598	+	Intron	DEL	A	-	-	rs145569577		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71230598delA	uc002jjm.3	+						FAM104A_uc002jjj.3_5'Flank|FAM104A_uc002jji.3_5'Flank|C17orf80_uc010wqu.1_Intron|C17orf80_uc010dfj.2_Intron|C17orf80_uc002jjk.1_Intron|C17orf80_uc002jjl.3_Intron	NM_017941	NP_060411			lung cancer-related protein 8 isoform a							integral to membrane				skin(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)															---	---	---	---
CDC42EP4	23580	broad.mit.edu	37	17	71285706	71285707	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71285706_71285707insA	uc002jjn.2	-						CDC42EP4_uc002jjo.2_Intron|CDC42EP4_uc002jjp.1_Intron	NM_012121	NP_036253			Cdc42 effector protein 4						positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|cytoplasm|endomembrane system|membrane|microtubule cytoskeleton	GTP-Rho binding				0			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	71935390	71935391	+	IGR	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71935390_71935391delAC								C17orf54 (110714 upstream) : RPL38 (264404 downstream)																																			---	---	---	---
TTYH2	94015	broad.mit.edu	37	17	72212667	72212670	+	Intron	DEL	CTCA	-	-	rs59447364	byFrequency;by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72212667_72212670delCTCA	uc002jkc.2	+						TTYH2_uc010wqw.1_Intron	NM_032646	NP_116035			tweety 2 isoform 1							chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4																		---	---	---	---
CD300LD	100131439	broad.mit.edu	37	17	72577315	72577316	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72577315_72577316insA	uc002jkz.2	-							NM_001115152	NP_001108624			CD300 molecule-like family member d precursor							integral to membrane|plasma membrane	receptor activity				0																		---	---	---	---
CD300LF	146722	broad.mit.edu	37	17	72704287	72704287	+	Intron	DEL	A	-	-	rs75863875		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72704287delA	uc002jlg.2	-						RAB37_uc002jlc.2_Intron|RAB37_uc010dfu.2_Intron|RAB37_uc002jld.2_Intron|CD300LF_uc002jlf.2_5'Flank|CD300LF_uc010dfw.2_5'Flank|CD300LF_uc002jlh.2_Intron|CD300LF_uc002jli.2_Intron|CD300LF_uc010wra.1_Intron|CD300LF_uc002jlj.1_5'Flank	NM_139018	NP_620587			NK inhibitory receptor precursor							integral to membrane|plasma membrane	receptor activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
KIAA0195	9772	broad.mit.edu	37	17	73476176	73476176	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73476176delA	uc002jnz.3	+						KIAA0195_uc010wsa.1_Intron	NM_014738	NP_055553			hypothetical protein LOC9772						ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	74791573	74791573	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74791573delA								MFSD11 (16237 upstream) : MGAT5B (73225 downstream)																																			---	---	---	---
SEPT9	10801	broad.mit.edu	37	17	75306065	75306065	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75306065delT	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron	NM_001113491	NP_001106963			septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)															---	---	---	---
SEPT9	10801	broad.mit.edu	37	17	75328382	75328383	+	Intron	INS	-	A	A	rs149314450	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75328382_75328383insA	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron	NM_001113491	NP_001106963			septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)															---	---	---	---
SEPT9	10801	broad.mit.edu	37	17	75480593	75480594	+	Intron	INS	-	TGA	TGA	rs149437503	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75480593_75480594insTGA	uc002jts.3	+						SEPT9_uc010wtk.1_Intron|SEPT9_uc002jtt.3_Intron|SEPT9_uc002jtu.3_Intron|SEPT9_uc002jtv.2_Intron|SEPT9_uc002jtw.2_Intron|SEPT9_uc010wtl.1_Intron|SEPT9_uc002jty.3_Intron|SEPT9_uc010wtm.1_Intron|SEPT9_uc010wtn.1_Intron|SEPT9_uc010dhd.2_Intron	NM_001113491	NP_001106963			septin 9 isoform a						cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	75577820	75577821	+	IGR	INS	-	T	T	rs34899659		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75577820_75577821insT								SEPT9 (81144 upstream) : FLJ45079 (297288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	75959319	75959319	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75959319delA								FLJ45079 (79150 upstream) : TNRC6C (40999 downstream)																																			---	---	---	---
TK1	7083	broad.mit.edu	37	17	76178006	76178007	+	Intron	INS	-	T	T	rs12602793		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76178006_76178007insT	uc002juw.2	-						TK1_uc002jux.2_Intron	NM_003258	NP_003249			thymidine kinase 1						DNA replication|protein homotetramerization|pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|thymidine kinase activity|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.0804)|Lung(188;0.23)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	76617144	76617144	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76617144delC								DNAH17 (148288 upstream) : CYTH1 (52987 downstream)																																			---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77245782	77245782	+	Intron	DEL	C	-	-	rs35378711		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77245782delC	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
SLC26A11	284129	broad.mit.edu	37	17	78198000	78198001	+	Intron	DEL	GA	-	-	rs66665713		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78198000_78198001delGA	uc002jyb.1	+						SLC26A11_uc002jyc.1_Intron|SLC26A11_uc002jyd.1_Intron|SLC26A11_uc010dhv.1_Intron	NM_173626	NP_775897			solute carrier family 26, member 11							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|plasma membrane	anion:anion antiporter activity|secondary active sulfate transmembrane transporter activity				0	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)															---	---	---	---
SLC26A11	284129	broad.mit.edu	37	17	78212058	78212058	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78212058delA	uc002jyb.1	+						SLC26A11_uc002jyc.1_Intron|SLC26A11_uc002jyd.1_Intron|SLC26A11_uc010dhv.1_Intron	NM_173626	NP_775897			solute carrier family 26, member 11							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|plasma membrane	anion:anion antiporter activity|secondary active sulfate transmembrane transporter activity				0	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	78242444	78242445	+	Intron	INS	-	TCTA	TCTA	rs147226702	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78242444_78242445insTCTA	uc002jye.1	+						uc002jyf.2_Intron					Homo sapiens mRNA for KIAA1618 protein, partial cds.																														---	---	---	---
NPTX1	4884	broad.mit.edu	37	17	78443175	78443176	+	3'UTR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78443175_78443176delCA	uc002jyp.1	-	5						NM_002522	NP_002513			neuronal pentraxin I precursor						central nervous system development|synaptic transmission|transport	transport vesicle	metal ion binding				0	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)															---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78608513	78608514	+	Intron	INS	-	GC	GC			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78608513_78608514insGC	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78666078	78666079	+	Intron	INS	-	GTTAT	GTTAT	rs71367010		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78666078_78666079insGTTAT	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78702247	78702248	+	Intron	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78702247_78702248delGT	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78766486	78766486	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78766486delA	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
TSPAN10	83882	broad.mit.edu	37	17	79608643	79608644	+	5'Flank	INS	-	GA	GA	rs144965665	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79608643_79608644insGA	uc010die.2	+						TSPAN10_uc002kaw.1_5'Flank|TSPAN10_uc010did.1_5'Flank	NM_031945	NP_114151			tetraspanin 10							integral to membrane				ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)															---	---	---	---
HGS	9146	broad.mit.edu	37	17	79652968	79652969	+	Intron	INS	-	T	T	rs140617080	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79652968_79652969insT	uc002kbg.2	+						ARL16_uc002kbe.2_5'Flank|ARL16_uc002kbf.2_5'Flank|HGS_uc010wus.1_Intron	NM_004712	NP_004703			hepatocyte growth factor-regulated tyrosine						cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of cell proliferation|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of JAK-STAT cascade|regulation of protein catabolic process	cytosol|early endosome membrane|multivesicular body membrane	metal ion binding|protein domain specific binding			ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)															---	---	---	---
B3GNTL1	146712	broad.mit.edu	37	17	80984749	80984749	+	Intron	DEL	A	-	-	rs11346067		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80984749delA	uc002kgg.1	-						B3GNTL1_uc002kgf.1_Intron	NM_001009905	NP_001009905			UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)															---	---	---	---
B3GNTL1	146712	broad.mit.edu	37	17	81005318	81005318	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:81005318delA	uc002kgg.1	-						B3GNTL1_uc002kgf.1_Intron	NM_001009905	NP_001009905			UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	966757	966757	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:966757delA								ADCYAP1 (54586 upstream) : C18orf2 (287633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	1751056	1751056	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1751056delT								C18orf2 (343875 upstream) : METTL4 (786469 downstream)																																			---	---	---	---
LPIN2	9663	broad.mit.edu	37	18	2969037	2969037	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2969037delG	uc002klo.2	-							NM_014646	NP_055461			lipin 2						fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	3310544	3310545	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3310544_3310545insA								MYL12B (32264 upstream) : TGIF1 (101527 downstream)																																			---	---	---	---
PTPRM	5797	broad.mit.edu	37	18	7871071	7871071	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7871071delG	uc002knn.3	+						PTPRM_uc010dkv.2_Intron	NM_002845	NP_002836			protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)																---	---	---	---
RALBP1	10928	broad.mit.edu	37	18	9493553	9493554	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9493553_9493554insT	uc002kob.2	+						RALBP1_uc002koc.2_Intron	NM_006788	NP_006779			ralA binding protein 1						chemotaxis|positive regulation of Cdc42 GTPase activity|small GTPase mediated signal transduction|transport	cytosol|membrane	ATPase activity, coupled to movement of substances|Rac GTPase activator activity|Rac GTPase binding|Ral GTPase binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	9660790	9660790	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9660790delG								PPP4R1 (46190 upstream) : RAB31 (47438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10020660	10020660	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10020660delA								VAPA (60643 upstream) : APCDD1 (433965 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	12284789	12284790	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12284789_12284790insT								CIDEA (7197 upstream) : TUBB6 (23450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	14324421	14324421	+	IGR	DEL	C	-	-	rs151275135	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14324421delC								ZNF519 (191992 upstream) : LOC284233 (13001 downstream)																																			---	---	---	---
CXADRP3	440224	broad.mit.edu	37	18	14489289	14489291	+	Intron	DEL	GTG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14489289_14489291delGTG	uc010xai.1	-							NR_024076				Homo sapiens cDNA clone IMAGE:30390722, containing frame-shift errors.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	19812116	19812119	+	IGR	DEL	CACT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19812116_19812119delCACT								GATA6 (29889 upstream) : CTAGE1 (181445 downstream)																																			---	---	---	---
TTC39C	125488	broad.mit.edu	37	18	21601072	21601073	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21601072_21601073insA	uc002kuw.2	+						TTC39C_uc002kuu.2_Intron	NM_001135993	NP_001129465			tetratricopeptide repeat domain 39C isoform 1								binding			ovary(1)	1																		---	---	---	---
OSBPL1A	114876	broad.mit.edu	37	18	21868729	21868729	+	Intron	DEL	A	-	-	rs71683234		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21868729delA	uc002kve.2	-						OSBPL1A_uc010xbc.1_Intron|OSBPL1A_uc002kvf.3_Intron	NM_080597	NP_542164			oxysterol-binding protein-like 1A isoform B						cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)																	---	---	---	---
CHST9	83539	broad.mit.edu	37	18	24534327	24534327	+	Intron	DEL	A	-	-	rs16943049	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24534327delA	uc002kwd.2	-						C18orf16_uc010xbm.1_Intron|CHST9_uc002kwc.2_Intron|CHST9_uc002kwe.2_Intron	NM_031422	NP_113610			GalNAc-4-sulfotransferase 2						carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)																	---	---	---	---
Unknown	0	broad.mit.edu	37	18	27898362	27898363	+	IGR	INS	-	AA	AA			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27898362_27898363insAA								MIR302F (19436 upstream) : DSC3 (671690 downstream)																																			---	---	---	---
SLC39A6	25800	broad.mit.edu	37	18	33702614	33702615	+	Intron	DEL	GT	-	-	rs71914483		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33702614_33702615delGT	uc010dmy.2	-						SLC39A6_uc002kzj.2_Intron	NM_012319	NP_036451			solute carrier family 39 (zinc transporter),							integral to membrane|lamellipodium membrane	zinc ion transmembrane transporter activity			ovary(1)|pancreas(1)	2																		---	---	---	---
FHOD3	80206	broad.mit.edu	37	18	34285911	34285920	+	Intron	DEL	TGTGTGTGTG	-	-	rs35263680		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34285911_34285920delTGTGTGTGTG	uc002kzt.1	+						FHOD3_uc002kzr.1_Intron|FHOD3_uc002kzs.1_Intron|FHOD3_uc010dmz.1_Intron|FHOD3_uc010dna.1_Intron	NM_025135	NP_079411			formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)																---	---	---	---
FHOD3	80206	broad.mit.edu	37	18	34292807	34292807	+	Intron	DEL	A	-	-	rs111496299		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34292807delA	uc002kzt.1	+						FHOD3_uc002kzs.1_Intron|FHOD3_uc010dmz.1_Intron|FHOD3_uc010dna.1_Intron	NM_025135	NP_079411			formin homology 2 domain containing 3						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding			skin(3)|large_intestine(2)|breast(2)|ovary(1)	8		all_epithelial(2;0.0181)|Colorectal(2;0.0195)																---	---	---	---
KIAA1328	57536	broad.mit.edu	37	18	34493487	34493506	+	Intron	DEL	TTAGAGGAAAGCAACTGCCT	-	-	rs144800655	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34493487_34493506delTTAGAGGAAAGCAACTGCCT	uc002kzz.2	+						uc002laa.2_Intron	NM_020776	NP_065827			hypothetical protein LOC57536											central_nervous_system(1)	1				COAD - Colon adenocarcinoma(74;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	36488367	36488367	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36488367delA								None (None upstream) : LOC647946 (298521 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	37917086	37917087	+	IGR	INS	-	GT	GT	rs144138237	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37917086_37917087insGT								LOC647946 (536804 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	38286559	38286560	+	IGR	INS	-	CACA	CACA	rs147702957	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38286559_38286560insCACA								LOC647946 (906277 upstream) : KC6 (773678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	39666651	39666653	+	IGR	DEL	AAC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39666651_39666653delAAC								PIK3C3 (5207 upstream) : RIT2 (656540 downstream)																																			---	---	---	---
SETBP1	26040	broad.mit.edu	37	18	42606764	42606765	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42606764_42606765delTG	uc010dni.2	+							NM_015559	NP_056374			SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)										Schinzel-Giedion_syndrome				---	---	---	---
KIAA1632	57724	broad.mit.edu	37	18	43468062	43468063	+	Intron	INS	-	T	T	rs1075748		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43468062_43468063insT	uc002lbm.2	-						KIAA1632_uc010xcq.1_Intron|KIAA1632_uc010xcr.1_Intron|KIAA1632_uc010xcs.1_Intron|KIAA1632_uc002lbn.2_Intron	NM_020964	NP_066015			hypothetical protein LOC57724						autophagy						0																		---	---	---	---
KIAA0427	9811	broad.mit.edu	37	18	46294127	46294127	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46294127delA	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron|KIAA0427_uc002lde.3_Intron	NM_014772	NP_055587			hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	46396100	46396100	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46396100delG								KIAA0427 (6522 upstream) : SMAD7 (50124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	47153091	47153092	+	IGR	INS	-	A	A	rs141198242	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47153091_47153092insA								LIPG (33815 upstream) : ACAA2 (156783 downstream)																																			---	---	---	---
DCC	1630	broad.mit.edu	37	18	50524257	50524257	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50524257delC	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206			netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)														---	---	---	---
C18orf54	162681	broad.mit.edu	37	18	51907328	51907329	+	3'UTR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51907328_51907329insA	uc002lfn.3	+	8					C18orf54_uc002lfo.3_3'UTR	NM_173529	NP_775800			hypothetical protein LOC162681 precursor							extracellular region				ovary(1)|skin(1)	2				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)														---	---	---	---
TCF4	6925	broad.mit.edu	37	18	53116437	53116438	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53116437_53116438insT	uc002lfz.2	-						TCF4_uc002lfy.2_Intron|TCF4_uc010xdx.1_Intron|TCF4_uc010dph.1_Intron|TCF4_uc010xdy.1_Intron|TCF4_uc002lga.2_Intron|TCF4_uc010dpi.2_Intron|TCF4_uc002lgc.3_Intron	NM_003199	NP_003190			transcription factor 4 isoform b						positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)														---	---	---	---
MALT1	10892	broad.mit.edu	37	18	56353255	56353257	+	Intron	DEL	TTG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56353255_56353257delTTG	uc002lhm.1	+						MALT1_uc002lhn.1_Intron	NM_006785	NP_006776			mucosa associated lymphoid tissue lymphoma						activation of NF-kappaB-inducing kinase activity|anti-apoptosis|nuclear export|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of protein ubiquitination|positive regulation of T cell cytokine production|protein oligomerization|proteolysis|T cell receptor signaling pathway	CBM complex|cytosol|nucleus|perinuclear region of cytoplasm	cysteine-type endopeptidase activity|protein self-association|signal transducer activity|ubiquitin-protein ligase activity			ovary(2)|lung(1)|central_nervous_system(1)	4								T	BIRC3	MALT								---	---	---	---
CCBE1	147372	broad.mit.edu	37	18	57298146	57298146	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57298146delG	uc002lib.2	-							NM_133459	NP_597716			collagen and calcium binding EGF domains 1						lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	59454627	59454627	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59454627delC								CDH20 (232262 upstream) : RNF152 (27677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	59686113	59686114	+	IGR	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59686113_59686114delAG								RNF152 (125809 upstream) : PIGN (25346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	61514053	61514053	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61514053delT								SERPINB7 (41450 upstream) : SERPINB2 (40886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	62933652	62933652	+	IGR	DEL	A	-	-	rs74171759		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62933652delA								None (None upstream) : CDH7 (483836 downstream)																																			---	---	---	---
CDH7	1005	broad.mit.edu	37	18	63482006	63482006	+	Intron	DEL	A	-	-	rs146003873		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63482006delA	uc002ljz.2	+						CDH7_uc002lka.2_Intron|CDH7_uc002lkb.2_Intron	NM_033646	NP_387450			cadherin 7, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	63748103	63748103	+	IGR	DEL	C	-	-	rs35732325		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63748103delC								CDH7 (199929 upstream) : CDH19 (423218 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	65687209	65687210	+	IGR	INS	-	TGTG	TGTG	rs138753475	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65687209_65687210insTGTG								DSEL (503242 upstream) : TMX3 (653717 downstream)																																			---	---	---	---
DOK6	220164	broad.mit.edu	37	18	67106397	67106398	+	Intron	INS	-	GAATC	GAATC	rs141840318	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67106397_67106398insGAATC	uc002lkl.2	+							NM_152721	NP_689934			docking protein 6								insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	68921433	68921434	+	IGR	INS	-	A	A	rs146672934	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68921433_68921434insA								SOCS6 (923999 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	70246805	70246805	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70246805delA								CBLN2 (35082 upstream) : NETO1 (162746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	70399737	70399738	+	IGR	DEL	AA	-	-	rs77248136		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70399737_70399738delAA								CBLN2 (188014 upstream) : NETO1 (9813 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	72129902	72129902	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72129902delA								FAM69C (5399 upstream) : CNDP2 (33695 downstream)																																			---	---	---	---
ZADH2	284273	broad.mit.edu	37	18	72913186	72913186	+	3'UTR	DEL	T	-	-	rs67264905		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72913186delT	uc002llx.2	-	2					ZADH2_uc010dqv.2_3'UTR	NM_175907	NP_787103			zinc binding alcohol dehydrogenase domain							peroxisome	oxidoreductase activity|zinc ion binding				0		Esophageal squamous(42;0.131)|Prostate(75;0.155)		READ - Rectum adenocarcinoma(2;0.0276)|BRCA - Breast invasive adenocarcinoma(31;0.216)														---	---	---	---
ZNF516	9658	broad.mit.edu	37	18	74183212	74183212	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74183212delA	uc002lme.2	-											Synthetic construct DNA, clone: pF1KSDA0222, Homo sapiens ZNF516 gene for zinc finger protein 516, complete cds, without stop codon, in Flexi system.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	75455550	75455551	+	IGR	DEL	TT	-	-	rs142549873	byFrequency	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75455550_75455551delTT								GALR1 (473456 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	76304634	76304635	+	IGR	INS	-	T	T	rs72544555		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76304634_76304635insT								None (None upstream) : SALL3 (435640 downstream)																																			---	---	---	---
SGTA	6449	broad.mit.edu	37	19	2759821	2759821	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2759821delG	uc002lwi.1	-							NM_003021	NP_003012			small glutamine-rich tetratricopeptide						interspecies interaction between organisms	cytoplasm	protein binding			ovary(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	6407208	6407208	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6407208delA	uc010dur.1	+											SubName: Full=Putative uncharacterized protein ENSP00000381236; Flags: Fragment;																														---	---	---	---
C3	718	broad.mit.edu	37	19	6708701	6708701	+	Intron	DEL	T	-	-	rs113766053		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6708701delT	uc002mfm.2	-							NM_000064	NP_000055			complement component 3 precursor						complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)														---	---	---	---
ARHGEF18	23370	broad.mit.edu	37	19	7478485	7478486	+	Intron	INS	-	A	A	rs151051322	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7478485_7478486insA	uc010xjm.1	+						ARHGEF18_uc002mgh.2_Intron	NM_015318	NP_056133			Rho/Rac guanine nucleotide exchange factor 18						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	8737838	8737839	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8737838_8737839insT								ADAMTS10 (62250 upstream) : ACTL9 (69912 downstream)																																			---	---	---	---
LPPR2	64748	broad.mit.edu	37	19	11466559	11466560	+	Intron	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11466559_11466560delGT	uc002mre.1	+						LPPR2_uc002mrf.1_Intron	NM_022737	NP_073574			lipid phosphate phosphatase-related protein type							integral to membrane	phosphatidate phosphatase activity			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	12241007	12241008	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12241007_12241008insA								ZNF788 (15516 upstream) : ZNF20 (1795 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	12529206	12529206	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12529206delA								ZNF799 (17172 upstream) : ZNF443 (11315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	12679563	12679564	+	IGR	INS	-	A	A	rs113486258		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12679563_12679564insA								ZNF709 (17207 upstream) : ZNF490 (7356 downstream)																																			---	---	---	---
DAND5	199699	broad.mit.edu	37	19	13078359	13078359	+	5'Flank	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13078359delA	uc002mwc.1	+						DAND5_uc010dyz.1_Intron	NM_152654	NP_689867			dante precursor							extracellular region				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(19;1.87e-18)															---	---	---	---
ASF1B	55723	broad.mit.edu	37	19	14247338	14247339	+	5'UTR	INS	-	G	G	rs140252988	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14247338_14247339insG	uc002mye.2	-	1					uc002myf.2_5'Flank	NM_018154	NP_060624			anti-silencing function 1B						cell differentiation|chromatin modification|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	15010893	15010893	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15010893delC								OR7A17 (18726 upstream) : OR7C2 (41408 downstream)																																			---	---	---	---
CASP14	23581	broad.mit.edu	37	19	15163609	15163610	+	Intron	INS	-	CA	CA	rs140888936	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15163609_15163610insCA	uc010dzv.1	+						CASP14_uc002naf.2_Intron	NM_012114	NP_036246			caspase 14 precursor						apoptosis|cell differentiation|epidermis development|proteolysis	cytoplasm|nucleus	cysteine-type endopeptidase activity			skin(2)|ovary(1)|lung(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	18295831	18295832	+	IGR	INS	-	T	T	rs112250145		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18295831_18295832insT								PIK3R2 (6904 upstream) : MPV17L2 (8208 downstream)																																			---	---	---	---
ELL	8178	broad.mit.edu	37	19	18573062	18573063	+	Intron	DEL	TA	-	-	rs1560121	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18573062_18573063delTA	uc002njh.2	-						ELL_uc010ebq.2_Intron|ELL_uc002njg.2_Intron	NM_006532	NP_006523			elongation factor RNA polymerase II						positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)				T	MLL	AL								---	---	---	---
CRTC1	23373	broad.mit.edu	37	19	18851063	18851063	+	Intron	DEL	A	-	-	rs111732669		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18851063delA	uc002nkb.3	+						CRTC1_uc010ebv.2_Intron	NM_015321	NP_056136			mucoepidermoid carcinoma translocated 1 isoform						interspecies interaction between organisms|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	cAMP response element binding protein binding|protein binding		CRTC1/MAML2(516)	salivary_gland(474)|lung(35)|thyroid(4)|breast(3)|skin(2)|ovary(1)	519																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	21880722	21880723	+	IGR	INS	-	AG	AG			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21880722_21880723insAG								ZNF429 (141654 upstream) : ZNF100 (26121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	24037976	24037979	+	IGR	DEL	ATTA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24037976_24037979delATTA								RPSAP58 (27059 upstream) : ZNF254 (178268 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28567200	28567200	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28567200delG								LOC148189 (282352 upstream) : LOC148145 (888840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29309299	29309300	+	IGR	INS	-	G	G	rs137972667	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29309299_29309300insG								None (None upstream) : LOC148145 (146740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29506553	29506554	+	IGR	DEL	CC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29506553_29506554delCC								LOC148145 (46498 upstream) : UQCRFS1 (191613 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	30344207	30344207	+	IGR	DEL	T	-	-	rs150294311		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30344207delT								CCNE1 (28989 upstream) : C19orf2 (70344 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	30662423	30662424	+	IGR	DEL	TG	-	-	rs71883776		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30662423_30662424delTG								C19orf2 (155812 upstream) : ZNF536 (200904 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31314240	31314240	+	IGR	DEL	C	-	-	rs35866362		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31314240delC								ZNF536 (265275 upstream) : DKFZp566F0947 (326543 downstream)																																			---	---	---	---
TSHZ3	57616	broad.mit.edu	37	19	31829752	31829753	+	Intron	INS	-	T	T	rs146059675	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31829752_31829753insT	uc002nsy.3	-							NM_020856	NP_065907			zinc finger protein 537						negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)																	---	---	---	---
TSHZ3	57616	broad.mit.edu	37	19	31834529	31834530	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31834529_31834530insT	uc002nsy.3	-							NM_020856	NP_065907			zinc finger protein 537						negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)																	---	---	---	---
TSHZ3	57616	broad.mit.edu	37	19	31834680	31834681	+	Intron	INS	-	T	T	rs151313241	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31834680_31834681insT	uc002nsy.3	-							NM_020856	NP_065907			zinc finger protein 537						negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	31990554	31990555	+	IGR	INS	-	TGTG	TGTG	rs139306644	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31990554_31990555insTGTG								TSHZ3 (150364 upstream) : ZNF507 (845959 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	32496345	32496346	+	IGR	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32496345_32496346insG								TSHZ3 (656155 upstream) : ZNF507 (340168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	33803099	33803099	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33803099delA								LOC80054 (7137 upstream) : CEBPG (61510 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	33811274	33811276	+	IGR	DEL	CAT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33811274_33811276delCAT								LOC80054 (15312 upstream) : CEBPG (53333 downstream)																																			---	---	---	---
PEPD	5184	broad.mit.edu	37	19	33964442	33964443	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33964442_33964443delAC	uc002nur.3	-						PEPD_uc010xrr.1_Intron|PEPD_uc010xrs.1_Intron	NM_000285	NP_000276			prolidase isoform 1						cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(2)	2	Esophageal squamous(110;0.137)																	---	---	---	---
MAG	4099	broad.mit.edu	37	19	35789931	35789943	+	Intron	DEL	CACCACACACCCA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35789931_35789943delCACCACACACCCA	uc002nyy.1	+						MAG_uc002nyx.1_Intron|MAG_uc010eds.1_Intron|MAG_uc002nyz.1_Intron	NM_002361	NP_002352			myelin associated glycoprotein isoform a						blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	36448398	36448398	+	IGR	DEL	T	-	-	rs74172775		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36448398delT								LRFN3 (12303 upstream) : SDHAF1 (37703 downstream)																																			---	---	---	---
SPTBN4	57731	broad.mit.edu	37	19	41061823	41061824	+	Intron	INS	-	A	A	rs148222208	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41061823_41061824insA	uc002ony.2	+						SPTBN4_uc002onx.2_Intron|SPTBN4_uc002onz.2_Intron|SPTBN4_uc010egx.2_Intron|SPTBN4_uc002ooa.2_Intron	NM_020971	NP_066022			spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)															---	---	---	---
NAPA	8775	broad.mit.edu	37	19	48011927	48011927	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48011927delT	uc002pha.1	-						NAPA_uc002phb.1_Intron|NAPA_uc002phc.1_Intron|NAPA_uc002phd.1_Intron|NAPA_uc010elf.1_Intron|NAPA_uc010elg.1_Intron|NAPA_uc002phe.2_Intron	NM_003827	NP_003818			N-ethylmaleimide-sensitive factor attachment						cellular membrane fusion|intra-Golgi vesicle-mediated transport|post-Golgi vesicle-mediated transport	cytosol					0		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000466)|all cancers(93;0.000739)|Epithelial(262;0.0168)|GBM - Glioblastoma multiforme(486;0.049)														---	---	---	---
CARD8	22900	broad.mit.edu	37	19	48741669	48741669	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48741669delA	uc002pie.3	-						CARD8_uc002pii.3_Frame_Shift_Del_p.F60fs|CARD8_uc002pij.1_RNA|CARD8_uc010xzi.1_Intron|CARD8_uc010xzj.1_Frame_Shift_Del_p.F60fs|CARD8_uc010xzk.1_5'UTR|CARD8_uc002pif.3_Intron|CARD8_uc002pig.3_5'UTR|CARD8_uc002pih.3_Intron|CARD8_uc010xzl.1_Intron|CARD8_uc010xzm.1_Frame_Shift_Del_p.F60fs	NM_014959	NP_055774			caspase recruitment domain family, member 8						negative regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion	cytoplasm|nucleus	caspase activator activity|NACHT domain binding|protein homodimerization activity				0		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)														---	---	---	---
CTU1	90353	broad.mit.edu	37	19	51606094	51606095	+	Intron	INS	-	T	T	rs146759382	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51606094_51606095insT	uc010eop.2	-							NM_145232	NP_660275			ATP binding domain 3						tRNA thio-modification|tRNA wobble uridine modification	cytosol	ATP binding|protein binding|transferase activity|tRNA binding				0																		---	---	---	---
NKG7	4818	broad.mit.edu	37	19	51878099	51878099	+	5'Flank	DEL	C	-	-	rs111900810		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51878099delC	uc002pwj.2	-						NKG7_uc002pwk.2_5'Flank	NM_005601	NP_005592			natural killer cell group 7 sequence							integral to plasma membrane				central_nervous_system(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000211)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)														---	---	---	---
ZNF577	84765	broad.mit.edu	37	19	52377740	52377741	+	Intron	INS	-	A	A	rs113238422		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52377740_52377741insA	uc010yde.1	-						ZNF577_uc010ydd.1_Intron|ZNF577_uc002pxx.3_Intron|ZNF577_uc002pxv.2_Intron|ZNF577_uc002pxw.2_Intron	NM_032679	NP_116068			zinc finger protein 577 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)														---	---	---	---
ZNF83	55769	broad.mit.edu	37	19	53193001	53193004	+	Intron	DEL	CTCT	-	-	rs10544917		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53193001_53193004delCTCT	uc010epz.2	-						ZNF83_uc010eqb.1_Intron	NM_001105554	NP_001099024			zinc finger protein 83 isoform b							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)														---	---	---	---
MIR520A	574467	broad.mit.edu	37	19	54193347	54193348	+	5'Flank	DEL	TG	-	-	rs145791727		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54193347_54193348delTG	hsa-mir-520a|MI0003149	+																							0																		---	---	---	---
NLRP9	338321	broad.mit.edu	37	19	56242730	56242730	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56242730delA	uc002qly.2	-							NM_176820	NP_789790			NLR family, pyrin domain containing 9							cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)														---	---	---	---
ZNF587	84914	broad.mit.edu	37	19	58277359	58277360	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58277359_58277360insT	uc002qqb.2	+							NM_032828	NP_116217			zinc finger protein 587						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)														---	---	---	---
DEFB125	245938	broad.mit.edu	37	20	73037	73037	+	Intron	DEL	T	-	-	rs71725843		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:73037delT	uc002wcw.2	+							NM_153325	NP_697020			defensin, beta 125 preproprotein						defense response to bacterium	extracellular region				ovary(1)|central_nervous_system(1)|skin(1)	3		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.156)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	109158	109159	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:109158_109159insA								DEFB125 (31863 upstream) : DEFB126 (14093 downstream)																																			---	---	---	---
CSNK2A1	1457	broad.mit.edu	37	20	516384	516385	+	Intron	DEL	AA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:516384_516385delAA	uc002wdw.1	-						CSNK2A1_uc002wdx.1_Intron|CSNK2A1_uc002wdy.1_Intron	NM_177559	NP_808227			casein kinase II alpha 1 subunit isoform a						axon guidance|Wnt receptor signaling pathway	cytosol|NuRD complex|plasma membrane|Sin3 complex	ATP binding|protein N-terminus binding|protein serine/threonine kinase activity			ovary(1)	1		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	714218	714227	+	IGR	DEL	AAAACAAAAC	-	-	rs112383211		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:714218_714227delAAAACAAAAC								SRXN1 (57395 upstream) : C20orf54 (26498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	757915	757916	+	IGR	INS	-	A	A	rs148871580	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:757915_757916insA								C20orf54 (8687 upstream) : FAM110A (56440 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1544380	1544381	+	IGR	DEL	GA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1544380_1544381delGA								SIRPD (6037 upstream) : SIRPB1 (649 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	2059211	2059212	+	IGR	INS	-	A	A	rs147782796	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2059211_2059212insA								PDYN (84508 upstream) : STK35 (23316 downstream)																																			---	---	---	---
TMC2	117532	broad.mit.edu	37	20	2577363	2577364	+	Intron	INS	-	TG	TG	rs35706954		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2577363_2577364insTG	uc002wgf.1	+						TMC2_uc002wgg.1_Intron|TMC2_uc010zpw.1_Intron|TMC2_uc010zpx.1_Intron	NM_080751	NP_542789			transmembrane cochlear-expressed protein 2							integral to membrane				ovary(3)	3																		---	---	---	---
ATRN	8455	broad.mit.edu	37	20	3533082	3533083	+	Intron	INS	-	TA	TA	rs145628082	by1000genomes;by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3533082_3533083insTA	uc002wim.2	+						ATRN_uc002wil.2_Intron	NM_139321	NP_647537			attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	5377356	5377357	+	IGR	INS	-	A	A	rs11478151		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5377356_5377357insA								PROKR2 (79978 upstream) : LOC149837 (101861 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	5647085	5647085	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5647085delC								GPCPD1 (55413 upstream) : C20orf196 (83958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	5673907	5673907	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5673907delA								GPCPD1 (82235 upstream) : C20orf196 (57136 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	6324868	6324869	+	IGR	INS	-	T	T	rs138450026	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6324868_6324869insT								FERMT1 (220677 upstream) : BMP2 (423876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	6777865	6777866	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6777865_6777866insT								BMP2 (16955 upstream) : None (None downstream)																																			---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8832360	8832360	+	Intron	DEL	T	-	-	rs11479187		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8832360delT	uc002wnb.2	+						PLCB1_uc002wna.2_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	9046471	9046472	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9046471_9046472insA								PLCB1 (180926 upstream) : PLCB4 (3229 downstream)																																			---	---	---	---
C20orf94	128710	broad.mit.edu	37	20	10495728	10495730	+	Intron	DEL	TTT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10495728_10495730delTTT	uc010zre.1	+							NM_001009608	NP_001009608			hypothetical protein LOC128710								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	11192290	11192291	+	IGR	DEL	TA	-	-	rs60865372		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11192290_11192291delTA								JAG1 (537596 upstream) : BTBD3 (679186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11822609	11822610	+	IGR	INS	-	T	T	rs141191484	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11822609_11822610insT								None (None upstream) : BTBD3 (48867 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11969916	11969917	+	IGR	INS	-	T	T	rs143561959	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11969916_11969917insT								BTBD3 (62674 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12062095	12062096	+	IGR	INS	-	ATCTATCAATC	ATCTATCAATC	rs33940241		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12062095_12062096insATCTATCAATC								BTBD3 (154853 upstream) : SPTLC3 (927531 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12627415	12627419	+	IGR	DEL	AAGCT	-	-	rs11469023		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12627415_12627419delAAGCT								BTBD3 (720173 upstream) : SPTLC3 (362208 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	13812024	13812024	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13812024delT								C20orf7 (14152 upstream) : SEL1L2 (18028 downstream)																																			---	---	---	---
SEL1L2	80343	broad.mit.edu	37	20	13858953	13858954	+	Intron	INS	-	T	T	rs145988853		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13858953_13858954insT	uc010gcf.2	-						SEL1L2_uc002woq.3_Intron|SEL1L2_uc010zrl.1_Intron|SEL1L2_uc002wor.2_Intron	NM_025229	NP_079505			sel-1 suppressor of lin-12-like 2 precursor							integral to membrane	binding			ovary(2)	2																		---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15150271	15150271	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15150271delA	uc002wou.2	+						MACROD2_uc002wot.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15654748	15654749	+	Intron	INS	-	T	T	rs138154797	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15654748_15654749insT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15973878	15973879	+	Intron	INS	-	GT	GT	rs71339382		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15973878_15973879insGT	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron|MACROD2_uc002wpd.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	16246202	16246204	+	IGR	DEL	CTC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16246202_16246204delCTC								MACROD2 (212363 upstream) : KIF16B (6545 downstream)																																			---	---	---	---
KIF16B	55614	broad.mit.edu	37	20	16437088	16437089	+	Intron	DEL	AC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16437088_16437089delAC	uc002wpg.1	-						KIF16B_uc010gch.1_Intron|KIF16B_uc010gci.1_Intron|KIF16B_uc010gcj.1_Intron	NM_024704	NP_078980			kinesin-like motor protein C20orf23						cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8																		---	---	---	---
BFSP1	631	broad.mit.edu	37	20	17506908	17506908	+	Intron	DEL	T	-	-	rs73617206		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17506908delT	uc002wpo.2	-						BFSP1_uc002wpp.2_Intron|BFSP1_uc010zrn.1_Intron|BFSP1_uc010zro.1_Intron	NM_001195	NP_001186			filensin isoform 1							cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1																		---	---	---	---
SNX5	27131	broad.mit.edu	37	20	17947027	17947028	+	Intron	INS	-	A	A	rs72357135		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17947027_17947028insA	uc002wqc.2	-						C20orf72_uc002wqh.2_5'Flank|SNX5_uc002wqd.2_Intron|SNX5_uc002wqe.2_Intron|SNX5_uc010zrt.1_Intron	NM_014426	NP_055241			sorting nexin 5						cell communication|pinocytosis|protein transport	cytoplasmic vesicle membrane|early endosome membrane|extrinsic to endosome membrane|extrinsic to internal side of plasma membrane|macropinocytic cup|phagocytic cup|ruffle	phosphatidylinositol binding			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	17983998	17983999	+	IGR	INS	-	AAAC	AAAC	rs139046239	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17983998_17983999insAAAC								C20orf72 (12239 upstream) : OVOL2 (20797 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	18306512	18306513	+	Intron	INS	-	CCAG	CCAG	rs113068091		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18306512_18306513insCCAG	uc002wqn.2	-											Homo sapiens cDNA clone IMAGE:5296922.																														---	---	---	---
DTD1	92675	broad.mit.edu	37	20	18708104	18708105	+	Intron	INS	-	C	C	rs140211273	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18708104_18708105insC	uc002wrf.3	+							NM_080820	NP_543010			D-tyrosyl-tRNA deacylase 1						D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds			ovary(2)	2																		---	---	---	---
SLC24A3	57419	broad.mit.edu	37	20	19250399	19250400	+	Intron	INS	-	AT	AT	rs142102931	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19250399_19250400insAT	uc002wrl.2	+						LOC100130264_uc010zsd.1_Intron	NM_020689	NP_065740			solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1																		---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20110938	20110939	+	Intron	INS	-	A	A	rs74180981		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20110938_20110939insA	uc002wru.2	+						C20orf26_uc010gcw.1_Intron|C20orf26_uc010zse.1_Intron|C20orf26_uc010zsf.1_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	20733219	20733220	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20733219_20733220insT								RALGAPA2 (39953 upstream) : PLK1S1 (373404 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	20827526	20827528	+	IGR	DEL	CAC	-	-	rs140520706		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20827526_20827528delCAC								RALGAPA2 (134260 upstream) : PLK1S1 (279096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	21269292	21269292	+	IGR	DEL	T	-	-	rs6047358	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21269292delT								PLK1S1 (42036 upstream) : XRN2 (14650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22605088	22605089	+	IGR	DEL	GT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22605088_22605089delGT								FOXA2 (38987 upstream) : SSTR4 (410968 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	23799462	23799462	+	IGR	DEL	A	-	-	rs147365596		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23799462delA								CST1 (67888 upstream) : CST2 (4942 downstream)																																			---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25756137	25756137	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25756137delC	uc010zth.1	-						FAM182B_uc002wvd.1_Intron|FAM182B_uc002wve.2_Intron|FAM182B_uc010zti.1_Intron	NR_027061				Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	26145851	26145851	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26145851delA								C20orf191 (51174 upstream) : MIR663 (42971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26206435	26206435	+	IGR	DEL	T	-	-	rs143738104		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26206435delT								MIR663 (17521 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29465614	29465614	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29465614delT								None (None upstream) : FRG1B (146265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	31475877	31475877	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31475877delT	uc010zub.1	+							NM_001143967	NP_001137439			EF-hand calcium binding domain 8																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	31502706	31502707	+	Intron	INS	-	T	T	rs139204955	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31502706_31502707insT	uc010zub.1	+							NM_001143967	NP_001137439			EF-hand calcium binding domain 8																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	31853812	31853812	+	IGR	DEL	G	-	-	rs66605039		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31853812delG								PLUNC (22698 upstream) : C20orf114 (17129 downstream)																																			---	---	---	---
SNTA1	6640	broad.mit.edu	37	20	32002934	32002935	+	Intron	DEL	AT	-	-	rs150856287		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32002934_32002935delAT	uc002wzd.1	-						SNTA1_uc010zuf.1_Intron	NM_003098	NP_003089			acidic alpha 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|sarcolemma	actin binding|calmodulin binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	32513469	32513474	+	IGR	DEL	AGGGAA	-	-	rs141318305	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32513469_32513474delAGGGAA								CHMP4B (71300 upstream) : RALY (68258 downstream)																																			---	---	---	---
RALY	22913	broad.mit.edu	37	20	32578783	32578784	+	5'Flank	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32578783_32578784insT	uc002xab.2	+						RALY_uc010zui.1_5'Flank|RALY_uc002xac.2_5'Flank|RALY_uc002xad.2_5'Flank|RALY_uc002xae.1_5'Flank	NM_016732	NP_057951			RNA binding protein (autoantigenic,							catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
ITCH	83737	broad.mit.edu	37	20	33022980	33022981	+	Intron	INS	-	T	T	rs112216796		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33022980_33022981insT	uc010geu.1	+						ITCH_uc002xak.2_Intron|ITCH_uc010zuj.1_Intron	NM_031483	NP_113671			itchy homolog E3 ubiquitin protein ligase						apoptosis|entry of virus into host cell|inflammatory response|innate immune response|negative regulation of apoptosis|negative regulation of defense response to virus|negative regulation of JNK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K29-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cell growth|regulation of protein deubiquitination|response to virus	cytosol|nucleus|plasma membrane	CXCR chemokine receptor binding|ribonucleoprotein binding|ubiquitin-protein ligase activity			breast(4)|lung(1)|central_nervous_system(1)	6																		---	---	---	---
DYNLRB1	83658	broad.mit.edu	37	20	33119278	33119278	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33119278delT	uc002xal.2	+						DYNLRB1_uc010zuk.1_Intron|DYNLRB1_uc002xam.2_Intron|DYNLRB1_uc002xan.2_Intron	NM_014183	NP_054902			Roadblock-1						microtubule-based movement|transport|visual behavior	centrosome|cytoplasmic dynein complex|microtubule	microtubule motor activity				0																		---	---	---	---
PIGU	128869	broad.mit.edu	37	20	33153618	33153619	+	Intron	DEL	CA	-	-	rs149085522		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33153618_33153619delCA	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron	NM_080476	NP_536724			phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0																		---	---	---	---
PIGU	128869	broad.mit.edu	37	20	33155607	33155608	+	Intron	DEL	CT	-	-	rs137859705		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33155607_33155608delCT	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron	NM_080476	NP_536724			phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0																		---	---	---	---
EDEM2	55741	broad.mit.edu	37	20	33753791	33753792	+	Intron	INS	-	TT	TT	rs144008742	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33753791_33753792insTT	uc010zuv.1	-							NM_018217	NP_060687			ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00936)															---	---	---	---
EDEM2	55741	broad.mit.edu	37	20	33794278	33794281	+	Intron	DEL	AAAA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33794278_33794281delAAAA	uc010zuv.1	-							NM_018217	NP_060687			ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00936)															---	---	---	---
C20orf118	140711	broad.mit.edu	37	20	35503709	35503709	+	5'Flank	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35503709delT	uc002xgg.1	+							NM_080628	NP_542195			hypothetical protein LOC140711												0		Myeloproliferative disorder(115;0.00874)																---	---	---	---
C20orf132	140699	broad.mit.edu	37	20	35782110	35782111	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35782110_35782111insT	uc010zvu.1	-						C20orf132_uc002xgk.2_Intron|C20orf132_uc002xgm.2_Intron|C20orf132_uc002xgn.2_Intron	NM_152503	NP_689716			hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36579302	36579302	+	IGR	DEL	T	-	-	rs113879349		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36579302delT								VSTM2L (5557 upstream) : KIAA0406 (32123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	36580375	36580376	+	IGR	INS	-	T	T	rs11482927		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36580375_36580376insT								VSTM2L (6630 upstream) : KIAA0406 (31049 downstream)																																			---	---	---	---
LBP	3929	broad.mit.edu	37	20	36976721	36976721	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36976721delT	uc002xic.1	+							NM_004139	NP_004130			lipopolysaccharide-binding protein precursor						acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	37219188	37219189	+	IGR	INS	-	TT	TT	rs149648510		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37219188_37219189insTT								ADIG (2084 upstream) : SLC32A1 (133916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37256953	37256953	+	IGR	DEL	T	-	-	rs112317328		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37256953delT								ADIG (39849 upstream) : SLC32A1 (96152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37271358	37271373	+	IGR	DEL	TCCATCCATCCATCCT	-	-	rs11274734	byFrequency;by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37271358_37271373delTCCATCCATCCATCCT								ADIG (54254 upstream) : SLC32A1 (81732 downstream)																																			---	---	---	---
PPP1R16B	26051	broad.mit.edu	37	20	37449201	37449202	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37449201_37449202insA	uc002xje.2	+						PPP1R16B_uc010ggb.1_Intron	NM_015568	NP_056383			protein phosphatase 1 regulatory inhibitor						regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	37784230	37784231	+	IGR	INS	-	T	T	rs72423341		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37784230_37784231insT								DHX35 (115867 upstream) : LOC339568 (58193 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37969317	37969321	+	IGR	DEL	CATTG	-	-	rs112580864		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37969317_37969321delCATTG								LOC339568 (115926 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	39423737	39423738	+	IGR	INS	-	CA	CA	rs142017640	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39423737_39423738insCA								MAFB (105861 upstream) : TOP1 (233724 downstream)																																			---	---	---	---
TOP1	7150	broad.mit.edu	37	20	39702825	39702825	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39702825delT	uc002xjl.2	+						TOP1_uc010gge.1_Intron	NM_003286	NP_003277			DNA topoisomerase I						DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding			breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)			T	NUP98	AML*								---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	40858496	40858496	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40858496delT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41477310	41477310	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41477310delT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	41921588	41921588	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41921588delG								PTPRT (103031 upstream) : SFRS6 (164916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	41955352	41955361	+	IGR	DEL	ACACACACAC	-	-	rs112933643		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41955352_41955361delACACACACAC								PTPRT (136795 upstream) : SFRS6 (131143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	42096687	42096688	+	IGR	INS	-	T	T	rs71337803		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42096687_42096688insT								SFRS6 (4445 upstream) : L3MBTL (39662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	42128322	42128323	+	IGR	INS	-	CAGA	CAGA	rs146695650	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42128322_42128323insCAGA								SFRS6 (36080 upstream) : L3MBTL (8027 downstream)																																			---	---	---	---
L3MBTL	26013	broad.mit.edu	37	20	42177159	42177159	+	3'UTR	DEL	C	-	-	rs5841504		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42177159delC	uc002xkn.1	+	15					SGK2_uc002xkq.1_Intron	NM_032107	NP_115479			l(3)mbt-like isoform II						chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
MYBL2	4605	broad.mit.edu	37	20	42304401	42304402	+	Intron	INS	-	TGTG	TGTG	rs139927212	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42304401_42304402insTGTG	uc002xlb.1	+						MYBL2_uc010zwj.1_Intron|MYBL2_uc002xla.1_Intron	NM_002466	NP_002457			MYB-related protein B							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
TOX2	84969	broad.mit.edu	37	20	42657274	42657277	+	Intron	DEL	ACAG	-	-	rs147560856		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42657274_42657277delACAG	uc002xlf.3	+						TOX2_uc010ggo.2_Intron|TOX2_uc002xle.3_Intron|TOX2_uc010ggp.2_Intron|TOX2_uc002xlg.2_Intron	NM_001098798	NP_001092268			TOX high mobility group box family member 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	42822621	42822622	+	IGR	INS	-	TGAA	TGAA	rs143569276	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42822621_42822622insTGAA								JPH2 (6403 upstream) : C20orf111 (2515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	43800122	43800123	+	IGR	DEL	TC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43800122_43800123delTC								WFDC12 (47016 upstream) : PI3 (3417 downstream)																																			---	---	---	---
CDH22	64405	broad.mit.edu	37	20	44809566	44809567	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44809566_44809567delTG	uc002xrm.2	-						CDH22_uc010ghk.1_Intron	NM_021248	NP_067071			cadherin 22 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)																---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45534221	45534221	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45534221delT	uc002xsm.2	+						EYA2_uc010ghp.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
SULF2	55959	broad.mit.edu	37	20	46383767	46383767	+	Intron	DEL	G	-	-	rs11086225		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46383767delG	uc002xto.2	-						SULF2_uc002xtr.2_Intron|SULF2_uc002xtq.2_Intron|SULF2_uc010ghv.1_Intron	NM_018837	NP_061325			sulfatase 2 isoform a precursor						bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	46521230	46521230	+	IGR	DEL	A	-	-	rs111582435		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46521230delA								SULF2 (105870 upstream) : LOC284749 (467424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	46839998	46839999	+	IGR	INS	-	A	A	rs142774759	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46839998_46839999insA								SULF2 (424638 upstream) : LOC284749 (148655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	47134333	47134333	+	IGR	DEL	C	-	-	rs71337444		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47134333delC								LOC284749 (134952 upstream) : PREX1 (106460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	47148461	47148461	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47148461delA								LOC284749 (149080 upstream) : PREX1 (92332 downstream)																																			---	---	---	---
PREX1	57580	broad.mit.edu	37	20	47396175	47396176	+	Intron	INS	-	T	T	rs147630061	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47396175_47396176insT	uc002xtw.1	-							NM_020820	NP_065871			phosphatidylinositol-3,4,						actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	47464792	47464793	+	IGR	INS	-	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47464792_47464793insG								PREX1 (20372 upstream) : ARFGEF2 (73482 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48351597	48351597	+	IGR	DEL	T	-	-	rs139962090		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48351597delT								B4GALT5 (21176 upstream) : SLC9A8 (77653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48543334	48543335	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48543334_48543335insA								SPATA2 (11254 upstream) : RNF114 (9579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48591817	48591817	+	IGR	DEL	T	-	-	rs111371954		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48591817delT								RNF114 (21397 upstream) : SNAI1 (7710 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48913890	48913891	+	Intron	DEL	TG	-	-	rs146221339		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48913890_48913891delTG	uc002xvk.2	+											Homo sapiens cDNA FLJ33286 fis, clone ASTRO2014174.																														---	---	---	---
PTPN1	5770	broad.mit.edu	37	20	49154761	49154762	+	Intron	INS	-	A	A	rs112347623		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49154761_49154762insA	uc002xvl.2	+						PTPN1_uc010zys.1_Intron	NM_002827	NP_002818			protein tyrosine phosphatase, non-receptor type						blood coagulation|interferon-gamma-mediated signaling pathway|negative regulation of insulin receptor signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytosol|endoplasmic reticulum membrane	protein tyrosine phosphatase activity|zinc ion binding				0		Lung NSC(126;0.163)			Clodronate(DB00720)|Tiludronate(DB01133)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	49778597	49778598	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49778597_49778598insA								KCNG1 (138922 upstream) : NFATC2 (229168 downstream)																																			---	---	---	---
NFATC2	4773	broad.mit.edu	37	20	50145898	50145898	+	Intron	DEL	T	-	-	rs113599722		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50145898delT	uc002xwd.2	-						NFATC2_uc002xwc.2_Intron|NFATC2_uc010zyv.1_Intron|NFATC2_uc010zyw.1_Intron|NFATC2_uc010zyx.1_Intron|NFATC2_uc010zyy.1_Intron|NFATC2_uc010zyz.1_Intron|NFATC2_uc002xwe.2_Intron	NM_173091	NP_775114			nuclear factor of activated T-cells,						B cell receptor signaling pathway|positive regulation of B cell proliferation|response to DNA damage stimulus|response to drug	actin cytoskeleton|nucleus|plasma membrane	protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Hepatocellular(150;0.248)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	51269514	51269514	+	IGR	DEL	C	-	-	rs10713948		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51269514delC								ZFP64 (460990 upstream) : TSHZ2 (319363 downstream)																																			---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51701912	51701913	+	Intron	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51701912_51701913delAG	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51748853	51748853	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51748853delT	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
TSHZ2	128553	broad.mit.edu	37	20	51867030	51867031	+	Intron	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51867030_51867031insA	uc002xwo.2	+							NM_173485	NP_775756			teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52429168	52429173	+	IGR	DEL	AAAAAG	-	-	rs6013804		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52429168_52429173delAAAAAG								ZNF217 (218367 upstream) : SUMO1P1 (61869 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52552199	52552200	+	IGR	INS	-	CTTCC	CTTCC	rs68064141	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52552199_52552200insCTTCC								SUMO1P1 (59951 upstream) : BCAS1 (7879 downstream)																																			---	---	---	---
BCAS1	8537	broad.mit.edu	37	20	52681447	52681447	+	Intron	DEL	C	-	-	rs5841973		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52681447delC	uc002xws.2	-						BCAS1_uc002xwt.2_Intron|BCAS1_uc010gil.1_Intron|BCAS1_uc010zzc.1_Intron	NM_003657	NP_003648			breast carcinoma amplified sequence 1							cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52710278	52710279	+	IGR	INS	-	C	C	rs58416962	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52710278_52710279insC								BCAS1 (22974 upstream) : CYP24A1 (59709 downstream)																																			---	---	---	---
PFDN4	5203	broad.mit.edu	37	20	52822486	52822487	+	5'Flank	INS	-	TC	TC	rs142131479	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52822486_52822487insTC	uc002xwx.2	+							NM_002623	NP_002614			prefoldin subunit 4						'de novo' posttranslational protein folding	prefoldin complex	chaperone binding|unfolded protein binding				0	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		Colorectal(105;0.124)|STAD - Stomach adenocarcinoma(23;0.206)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52920970	52920970	+	IGR	DEL	T	-	-	rs113048481		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52920970delT								PFDN4 (84479 upstream) : DOK5 (171287 downstream)																																			---	---	---	---
DOK5	55816	broad.mit.edu	37	20	53097671	53097674	+	Intron	DEL	ATCT	-	-	rs72455631		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53097671_53097674delATCT	uc002xwy.2	+						DOK5_uc010gin.2_Intron|DOK5_uc002xwz.2_Intron	NM_018431	NP_060901			docking protein 5								insulin receptor binding			ovary(1)	1			Colorectal(105;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	53439795	53439795	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53439795delT								DOK5 (172086 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53913578	53913578	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53913578delC								DOK5 (645869 upstream) : CBLN4 (658919 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55429169	55429170	+	IGR	INS	-	CCTC	CCTC	rs144835700	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55429169_55429170insCCTC								TFAP2C (214833 upstream) : BMP7 (314639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55447624	55447625	+	IGR	INS	-	G	G	rs139274238	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55447624_55447625insG								TFAP2C (233288 upstream) : BMP7 (296184 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55704929	55704930	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55704929_55704930insA								TFAP2C (490593 upstream) : BMP7 (38879 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56052521	56052522	+	IGR	INS	-	AG	AG	rs144746200	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56052521_56052522insAG								RBM38 (68137 upstream) : CTCFL (11358 downstream)																																			---	---	---	---
ZBP1	81030	broad.mit.edu	37	20	56197370	56197370	+	5'Flank	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56197370delA	uc002xyo.2	-						ZBP1_uc010gjm.2_5'Flank|ZBP1_uc002xyp.2_5'Flank|ZBP1_uc010zzn.1_5'Flank	NM_030776	NP_110403			Z-DNA binding protein 1 isoform a							cytoplasm|nucleus	double-stranded RNA adenosine deaminase activity|left-handed Z-DNA binding|RNA binding			ovary(2)	2	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)													OREG0026068	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	20	56388782	56388782	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56388782delC								PMEPA1 (102241 upstream) : C20orf85 (337201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56559421	56559421	+	IGR	DEL	A	-	-	rs80083069		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56559421delA								PMEPA1 (272880 upstream) : C20orf85 (166562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	57104949	57104949	+	Intron	DEL	T	-	-	rs150113339		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57104949delT	uc002xzg.1	+											Homo sapiens cDNA FLJ30075 fis, clone BGGI11000285.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	57130928	57130943	+	Intron	DEL	CCATCCATCCATCCAT	-	-	rs151225850		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57130928_57130943delCCATCCATCCATCCAT	uc002xzg.1	+											Homo sapiens cDNA FLJ30075 fis, clone BGGI11000285.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	57220035	57220035	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57220035delA								APCDD1L (130086 upstream) : STX16 (6274 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	57256770	57256770	+	IGR	DEL	A	-	-	rs34654741		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57256770delA								STX16 (2190 upstream) : NPEPL1 (7421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	57528015	57528015	+	IGR	DEL	A	-	-	rs79705152		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57528015delA								GNAS (41766 upstream) : TH1L (28296 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	57973698	57973699	+	IGR	INS	-	TC	TC	rs150072927	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57973698_57973699insTC								EDN3 (72652 upstream) : PHACTR3 (178865 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	58526247	58526247	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58526247delG								C20orf177 (3688 upstream) : CDH26 (7235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	59290771	59290772	+	IGR	DEL	AA	-	-	rs150057673		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59290771_59290772delAA								MIR646 (407146 upstream) : CDH4 (536787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	59339298	59339299	+	IGR	INS	-	ACACACAC	ACACACAC			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59339298_59339299insACACACAC								MIR646 (455673 upstream) : CDH4 (488260 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	59725522	59725522	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59725522delT								MIR646 (841897 upstream) : CDH4 (102037 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60414587	60414588	+	Intron	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60414587_60414588delTG	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
SS18L1	26039	broad.mit.edu	37	20	60745949	60745950	+	Intron	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60745949_60745950insT	uc002ycb.2	+						SS18L1_uc011aaa.1_Intron|SS18L1_uc002ybz.1_Intron|SS18L1_uc002yca.1_Intron|SS18L1_uc002ycc.1_Intron	NM_198935	NP_945173			SS18-like protein 1						chromatin modification|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed chromosome kinetochore				ovary(2)	2	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)					T	SSX1	synovial sarcoma								---	---	---	---
OSBPL2	9885	broad.mit.edu	37	20	60853573	60853573	+	Intron	DEL	T	-	-	rs11475539		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60853573delT	uc002yck.1	+						OSBPL2_uc002ycl.1_Intron|OSBPL2_uc011aah.1_Intron|OSBPL2_uc002ycm.1_5'Flank	NM_144498	NP_653081			oxysterol-binding protein-like protein 2 isoform						lipid transport		lipid binding			ovary(1)|central_nervous_system(1)	2	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)															---	---	---	---
CABLES2	81928	broad.mit.edu	37	20	60970363	60970364	+	Intron	INS	-	C	C	rs143254957	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60970363_60970364insC	uc002ycv.2	-							NM_031215	NP_112492			Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)															---	---	---	---
C20orf200	253868	broad.mit.edu	37	20	61144699	61144700	+	Intron	INS	-	G	G	rs150279870	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61144699_61144700insG	uc002ycz.1	-						C20orf200_uc002ycy.2_Intron|C20orf166_uc011aaj.1_5'Flank	NM_152757	NP_689970			hypothetical protein LOC253868												0	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;7.17e-06)															---	---	---	---
GMEB2	26205	broad.mit.edu	37	20	62233677	62233677	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62233677delG	uc002yfp.1	-						GMEB2_uc002yfo.1_Intron|GMEB2_uc002yfq.1_Intron	NM_012384	NP_036516			glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding				0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	62481656	62481656	+	IGR	DEL	T	-	-	rs71333720		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62481656delT								ZBTB46 (19059 upstream) : C20orf135 (10910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9434584	9434584	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9434584delC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9473199	9473199	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9473199delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10426013	10426013	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10426013delA								None (None upstream) : TPTE (480730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10786167	10786171	+	IGR	DEL	GGAAT	-	-	rs28970962		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10786167_10786171delGGAAT								None (None upstream) : TPTE (120572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10842718	10842722	+	IGR	DEL	GAATG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10842718_10842722delGAATG								None (None upstream) : TPTE (64021 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10887093	10887094	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10887093_10887094insA								None (None upstream) : TPTE (19649 downstream)																																			---	---	---	---
BAGE2	85319	broad.mit.edu	37	21	11046071	11046078	+	Intron	DEL	AAAAAAAC	-	-	rs138926240		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11046071_11046078delAAAAAAAC	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	11161749	11161750	+	IGR	INS	-	G	G	rs139498648	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11161749_11161750insG								BAGE (62812 upstream) : None (None downstream)																																			---	---	---	---
C21orf99	149992	broad.mit.edu	37	21	14439999	14439999	+	Intron	DEL	T	-	-	rs142238235		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14439999delT	uc002yja.3	+							NR_026916				Homo sapiens C21orf99 protein (C21orf99) mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	20169079	20169080	+	IGR	DEL	CA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20169079_20169080delCA								TMPRSS15 (393109 upstream) : None (None downstream)																																			---	---	---	---
ITSN1	6453	broad.mit.edu	37	21	35260248	35260248	+	Intron	DEL	T	-	-	rs11343877		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35260248delT	uc002yta.1	+						DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Intron|ITSN1_uc002ytj.2_Intron|ITSN1_uc010gmm.1_Intron	NM_003024	NP_003015			intersectin 1 isoform ITSN-l						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	35357409	35357410	+	IGR	INS	-	CAC	CAC			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35357409_35357410insCAC								ATP5O (69251 upstream) : MRPS6 (88413 downstream)																																			---	---	---	---
DOPEY2	9980	broad.mit.edu	37	21	37598595	37598595	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37598595delT	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron	NM_005128	NP_005119			pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
CLDN14	23562	broad.mit.edu	37	21	37910929	37910929	+	Intron	DEL	G	-	-	rs35288869		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37910929delG	uc002yvn.1	-						CLDN14_uc002yvo.1_Intron	NM_001146078	NP_001139550			claudin 14						calcium-independent cell-cell adhesion|protein complex assembly|tight junction assembly	endoplasmic reticulum|integral to membrane|tight junction	identical protein binding|structural molecule activity				0																		---	---	---	---
HLCS	3141	broad.mit.edu	37	21	38358521	38358521	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38358521delC	uc002yvs.2	-							NM_000411	NP_000402			holocarboxylase synthetase						cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)													---	---	---	---
SH3BGR	6450	broad.mit.edu	37	21	40846816	40846817	+	Intron	INS	-	GT	GT	rs143845691	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40846816_40846817insGT	uc002yya.2	+						SH3BGR_uc002yxz.2_Intron	NM_007341	NP_031367			SH3-binding domain and glutamic acid-rich						protein complex assembly	cytosol	SH3 domain binding|SH3/SH2 adaptor activity				0		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	41380768	41380768	+	IGR	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41380768delT								PCP4 (79448 upstream) : DSCAM (3575 downstream)																																			---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	41547707	41547708	+	Intron	INS	-	AC	AC	rs7279225	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41547707_41547708insAC	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	42080050	42080050	+	Intron	DEL	A	-	-	rs111425714		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42080050delA	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	44756431	44756431	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44756431delA								CRYAA (163518 upstream) : SIK1 (77967 downstream)																																			---	---	---	---
AIRE	326	broad.mit.edu	37	21	45702840	45702840	+	5'Flank	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45702840delT	uc002zei.2	+							NM_000383	NP_000374			autoimmune regulator isoform 1						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|histone binding|transcription regulatory region DNA binding|translation regulator activity|zinc ion binding			skin(1)	1				Colorectal(79;0.0806)										Autoimmune_PolyEndocrinopathy_Candidiasis_Ectodermal_Dystrophy				---	---	---	---
TRPM2	7226	broad.mit.edu	37	21	45843708	45843710	+	Intron	DEL	GAG	-	-	rs143108860		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45843708_45843710delGAG	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron|uc011afe.1_Intron|TRPM2_uc011aff.1_5'Flank	NM_003307	NP_003298			transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	17047835	17047843	+	IGR	DEL	CAGCCAAGT	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17047835_17047843delCAGCCAAGT								OR11H1 (598031 upstream) : CCT8L2 (23805 downstream)																																			---	---	---	---
BCL2L13	23786	broad.mit.edu	37	22	18112585	18112586	+	Intron	DEL	AC	-	-	rs112377267		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18112585_18112586delAC	uc002zmu.2	+						ATP6V1E1_uc002zmr.1_5'Flank|ATP6V1E1_uc002zms.1_5'Flank|ATP6V1E1_uc002zmt.1_5'Flank	NM_015367	NP_056182			BCL2-like 13 (apoptosis facilitator)						induction of apoptosis	integral to membrane|mitochondrial membrane|nucleus	caspase activator activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4		all_epithelial(15;0.123)		Lung(27;0.199)														---	---	---	---
MICAL3	57553	broad.mit.edu	37	22	18309648	18309649	+	Intron	INS	-	G	G	rs143286483	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18309648_18309649insG	uc002zng.3	-						MICAL3_uc011agl.1_Intron	NM_015241	NP_056056			microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	19617928	19617930	+	IGR	DEL	TCT	-	-	rs113051747		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19617928_19617930delTCT								LOC150185 (63566 upstream) : SEPT5 (84057 downstream)																																	OREG0026298	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MAPK1	5594	broad.mit.edu	37	22	22203908	22203908	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22203908delT	uc002zvn.2	-						MAPK1_uc002zvo.2_Intron|MAPK1_uc010gtk.1_Intron	NM_002745	NP_002736			mitogen-activated protein kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)													---	---	---	---
TOP3B	8940	broad.mit.edu	37	22	22321534	22321534	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22321534delA	uc002zvs.2	-						TOP3B_uc010gtm.1_Intron|TOP3B_uc002zvr.2_Intron|TOP3B_uc010gtl.2_Intron|TOP3B_uc002zvt.3_Intron	NM_003935	NP_003926			topoisomerase (DNA) III beta						DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)														---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22554649	22554650	+	Intron	INS	-	AATGAATG	AATGAATG	rs141565549	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22554649_22554650insAATGAATG	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	23020683	23020684	+	Intron	INS	-	T	T	rs75466920		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23020683_23020684insT	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	23879722	23879723	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23879722_23879723delTG								ZDHHC8P1 (134923 upstream) : IGLL1 (35592 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	24078433	24078433	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24078433delA								LOC91316 (18823 upstream) : ZNF70 (2437 downstream)																																			---	---	---	---
SLC2A11	66035	broad.mit.edu	37	22	24224041	24224044	+	Intron	DEL	AGAG	-	-	rs142429769		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24224041_24224044delAGAG	uc002zyn.3	+						SLC2A11_uc002zyl.1_Intron|SLC2A11_uc002zym.3_Intron|SLC2A11_uc002zyo.3_Intron|SLC2A11_uc011ajc.1_Intron|SLC2A11_uc002zyp.3_Intron	NM_001024938	NP_001020109			glucose transporter protein 10 isoform c							integral to membrane|plasma membrane	sugar transmembrane transporter activity			ovary(1)	1																		---	---	---	---
DDT	1652	broad.mit.edu	37	22	24267079	24267079	+	Intron	DEL	C	-	-	rs34819965		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24267079delC	uc011ajf.1	-							NM_001355	NP_001346			D-dopachrome tautomerase						melanin biosynthetic process	cytoplasm	D-dopachrome decarboxylase activity|dopachrome isomerase activity|protein binding				0																		---	---	---	---
MYO18B	84700	broad.mit.edu	37	22	26220887	26220888	+	Intron	INS	-	CACACACATGAA	CACACACATGAA	rs151100218	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26220887_26220888insCACACACATGAA	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997			myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12																		---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26593119	26593120	+	Intron	INS	-	T	T	rs144403309	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26593119_26593120insT	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron	NM_021115	NP_066938			seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26736200	26736200	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26736200delA	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938			seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	27222719	27222720	+	IGR	DEL	TG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27222719_27222720delTG								MIAT (107770 upstream) : MN1 (921546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	29894103	29894103	+	IGR	DEL	C	-	-	rs35914977		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29894103delC								NEFH (6828 upstream) : THOC5 (10054 downstream)																																			---	---	---	---
SYN3	8224	broad.mit.edu	37	22	33370212	33370212	+	Intron	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33370212delC	uc003amx.2	-						SYN3_uc003amy.2_Intron|SYN3_uc003amz.2_Intron	NM_003490	NP_003481			synapsin III isoform IIIa						neurotransmitter secretion	cell junction|synaptic vesicle membrane	ATP binding|ligase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	34459454	34459454	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34459454delA								LARGE (140870 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	34898912	34898913	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34898912_34898913insA								LARGE (580328 upstream) : ISX (563216 downstream)																																			---	---	---	---
HMGXB4	10042	broad.mit.edu	37	22	35687897	35687898	+	Intron	INS	-	T	T	rs35118151		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35687897_35687898insT	uc003anl.2	+						HMGXB4_uc003ank.2_Intron	NM_001003681	NP_001003681			high-mobility group protein 2-like 1						endosome to lysosome transport|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	NURF complex	DNA binding			breast(1)|skin(1)	2																		---	---	---	---
CACNG2	10369	broad.mit.edu	37	22	37050030	37050039	+	Intron	DEL	TGTGTGTGTG	-	-	rs66548171		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37050030_37050039delTGTGTGTGTG	uc003aps.1	-							NM_006078	NP_006069			voltage-dependent calcium channel gamma-2						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	39962238	39962239	+	IGR	INS	-	TGA	TGA			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39962238_39962239insTGA								RPS19BP1 (33378 upstream) : CACNA1I (4519 downstream)																																			---	---	---	---
XPNPEP3	63929	broad.mit.edu	37	22	41339832	41339832	+	Intron	DEL	T	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41339832delT	uc011aoy.1	+							NM_022098				X-prolyl aminopeptidase (aminopeptidase P) 3,						cellular process	mitochondrion	aminopeptidase activity|manganese ion binding|metallopeptidase activity				0																		---	---	---	---
EP300	2033	broad.mit.edu	37	22	41529466	41529467	+	Intron	DEL	TT	-	-	rs116268732	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41529466_41529467delTT	uc003azl.3	+							NM_001429	NP_001420			E1A binding protein p300						apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64								T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				---	---	---	---
TSPO	706	broad.mit.edu	37	22	43552329	43552329	+	Intron	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43552329delG	uc003bdo.2	+						TSPO_uc003bdn.2_Intron	NM_007311	NP_009295			translocator protein isoform PBR-S												0		Ovarian(80;0.0694)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	49209293	49209294	+	IGR	INS	-	T	T	rs145487595	by1000genomes	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49209293_49209294insT								FAM19A5 (61551 upstream) : C22orf34 (598882 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49352748	49352749	+	IGR	INS	-	CAC	CAC	rs139876222		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49352748_49352749insCAC								FAM19A5 (205006 upstream) : C22orf34 (455427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49661319	49661319	+	IGR	DEL	G	-	-	rs112730461		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49661319delG								FAM19A5 (513577 upstream) : C22orf34 (146857 downstream)																																			---	---	---	---
C22orf34	348645	broad.mit.edu	37	22	49842942	49842943	+	Intron	DEL	AC	-	-	rs9616635		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49842942_49842943delAC	uc003biq.2	-											Homo sapiens cDNA FLJ42972 fis, clone BRSTN2019129.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	973946	973947	+	IGR	INS	-	AAAG	AAAG			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:973946_973947insAAAG								SHOX (353801 upstream) : CRLF2 (340940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	2054078	2054079	+	IGR	INS	-	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2054078_2054079insA								ASMT (292105 upstream) : DHRSX (83478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	2132391	2132394	+	IGR	DEL	GGAA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2132391_2132394delGGAA								ASMT (370418 upstream) : DHRSX (5163 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	2568005	2568008	+	Intron	DEL	TGGA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2568005_2568008delTGGA	uc004cqj.1	+											Homo sapiens cDNA FLJ13471 fis, clone PLACE1003566.																														---	---	---	---
CD99	4267	broad.mit.edu	37	X	2638660	2638661	+	Intron	DEL	GC	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2638660_2638661delGC	uc004cqm.2	+						CD99_uc010nda.2_Intron|CD99_uc004cqn.2_Intron|CD99_uc004cqo.2_Intron	NM_002414	NP_002405			CD99 antigen isoform a precursor						cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	23981142	23981142	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23981142delG								CXorf58 (23518 upstream) : KLHL15 (20694 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	56990050	56990053	+	IGR	DEL	CACA	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56990050_56990053delCACA								LOC550643 (146048 upstream) : SPIN3 (12752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	58535719	58535719	+	IGR	DEL	C	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:58535719delC								ZXDA (598652 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	87061481	87061482	+	IGR	DEL	AG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:87061481_87061482delAG								KLHL4 (136431 upstream) : CPXCR1 (940744 downstream)																																			---	---	---	---
CAPN6	827	broad.mit.edu	37	X	110491882	110491883	+	In_Frame_Ins	INS	-	GTT	GTT			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110491882_110491883insGTT	uc004epc.1	-	10	1566_1567	c.1398_1399insAAC	c.(1396-1401)insAAC	p.466_467insN	CAPN6_uc011msu.1_In_Frame_Ins_p.211_212insN	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6	466_467	Domain III.				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	116169036	116169037	+	IGR	INS	-	TGTG	TGTG	rs5903487		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:116169036_116169037insTGTG								CXorf61 (574899 upstream) : KLHL13 (862740 downstream)																																			---	---	---	---
THOC2	57187	broad.mit.edu	37	X	122745508	122745508	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122745508delA	uc004etu.2	-						THOC2_uc004etv.3_5'Flank|THOC2_uc010nqt.1_Intron|THOC2_uc004etw.1_Intron	NM_001081550	NP_001075019			THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3																		---	---	---	---
MCF2	4168	broad.mit.edu	37	X	138698757	138698757	+	Intron	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138698757delA	uc004fau.2	-						MCF2_uc004fav.2_Intron|MCF2_uc011mwl.1_Intron|MCF2_uc010nsh.1_Intron|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Intron|MCF2_uc004faw.2_Intron|MCF2_uc011mwo.1_Intron	NM_005369	NP_005360			MCF.2 cell line derived transforming sequence						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
CD99L2	83692	broad.mit.edu	37	X	149992564	149992566	+	Intron	DEL	AAG	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149992564_149992566delAAG	uc004fel.2	-						CD99L2_uc004fem.2_Intron|CD99L2_uc004fen.2_Intron|CD99L2_uc004feo.2_Intron|CD99L2_uc011myb.1_Intron	NM_031462	NP_113650			CD99 antigen-like 2 isoform E3'-E4'-E3-E4						cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9956897	9956899	+	IGR	DEL	GTG	-	-	rs112328349		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9956897_9956899delGTG								TTTY22 (306043 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9992532	9992532	+	IGR	DEL	A	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9992532delA								TTTY22 (341678 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9994811	9994816	+	IGR	DEL	AAATTC	-	-	rs79502907		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9994811_9994816delAAATTC								TTTY22 (343957 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10013385	10013385	+	IGR	DEL	G	-	-			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10013385delG								TTTY22 (362531 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10049888	10049889	+	IGR	INS	-	G	G	rs139978218		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10049888_10049889insG								TTTY22 (399034 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13402059	13402060	+	IGR	INS	-	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13402059_13402060insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	28780698	28780699	+	IGR	INS	-	AG	AG			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28780698_28780699insAG								None (None upstream) : None (None downstream)																																			---	---	---	---
KIAA0090	23065	broad.mit.edu	37	1	19550010	19550010	+	Silent	SNP	A	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19550010A>G	uc001bbo.2	-	19	2299	c.2256T>C	c.(2254-2256)CAT>CAC	p.H752H	KIAA0090_uc001bbn.2_5'Flank|KIAA0090_uc001bbp.2_Silent_p.H751H|KIAA0090_uc001bbq.2_Silent_p.H751H|KIAA0090_uc001bbr.2_Silent_p.H730H	NM_015047	NP_055862	Q8N766	K0090_HUMAN	hypothetical protein LOC23065 precursor	752	DUF1620.|Extracellular (Potential).					integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)														---	---	---	---
GJA4	2701	broad.mit.edu	37	1	35260067	35260067	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35260067G>A	uc001bya.2	+	2	341	c.253G>A	c.(253-255)GTC>ATC	p.V85I	GJA4_uc009vul.2_Missense_Mutation_p.V161I|GJA4_uc009vum.1_Missense_Mutation_p.V85I	NM_002060	NP_002051	P35212	CXA4_HUMAN	connexin 37	85	Helical; (Potential).				cell-cell junction assembly	integral to plasma membrane				central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)																---	---	---	---
GJA4	2701	broad.mit.edu	37	1	35260564	35260564	+	Silent	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35260564G>A	uc001bya.2	+	2	838	c.750G>A	c.(748-750)CCG>CCA	p.P250P	GJA4_uc009vul.2_Silent_p.P326P|GJA4_uc009vum.1_Silent_p.P250P	NM_002060	NP_002051	P35212	CXA4_HUMAN	connexin 37	250	Cytoplasmic (Potential).				cell-cell junction assembly	integral to plasma membrane				central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)																---	---	---	---
PGM1	5236	broad.mit.edu	37	1	64125354	64125354	+	3'UTR	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64125354G>A	uc001dbh.2	+	11					PGM1_uc010ooy.1_3'UTR|PGM1_uc010ooz.1_3'UTR	NM_002633	NP_002624			phosphoglucomutase 1						cellular calcium ion homeostasis|galactose catabolic process|glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity			ovary(2)|kidney(1)	3																		---	---	---	---
AP4B1	10717	broad.mit.edu	37	1	114442527	114442527	+	Silent	SNP	T	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114442527T>A	uc001eeb.2	-	5	1256	c.1113A>T	c.(1111-1113)ATA>ATT	p.I371I	uc001edv.1_RNA|AP4B1_uc001eec.2_Silent_p.I203I|AP4B1_uc001eed.2_Silent_p.I371I|AP4B1_uc010owp.1_Silent_p.I272I|AP4B1_uc001eea.1_Silent_p.I165I|AP4B1_uc001eee.1_5'Flank|AP4B1_uc010owq.1_Silent_p.I278I	NM_006594	NP_006585	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1	371					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|soluble fraction|trans-Golgi network	protein binding|protein transporter activity			ovary(3)|central_nervous_system(1)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
FLG2	388698	broad.mit.edu	37	1	152323455	152323455	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152323455G>T	uc001ezw.3	-	3	6880	c.6807C>A	c.(6805-6807)CAC>CAA	p.H2269Q	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	2269							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
PKLR	5313	broad.mit.edu	37	1	155264908	155264908	+	Silent	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155264908G>A	uc001fkb.3	-	5	732	c.693C>T	c.(691-693)ATC>ATT	p.I231I	RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Silent_p.I200I	NM_000298	NP_000289	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC isoform 1	231					endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity			skin(4)|ovary(1)	5	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)													---	---	---	---
RFWD2	64326	broad.mit.edu	37	1	176050367	176050367	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176050367T>C	uc001gku.1	-	11	1454	c.1198A>G	c.(1198-1200)ACT>GCT	p.T400A	RFWD2_uc001gkv.1_Missense_Mutation_p.T376A|RFWD2_uc001gkw.1_Missense_Mutation_p.T160A|RFWD2_uc009wwv.2_Missense_Mutation_p.T199A|RFWD2_uc001gkt.1_Missense_Mutation_p.T239A	NM_022457	NP_071902	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2 isoform a	400					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---
PAPPA2	60676	broad.mit.edu	37	1	176640176	176640176	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176640176T>C	uc001gkz.2	+	4	3226	c.2062T>C	c.(2062-2064)TTT>CTT	p.F688L	PAPPA2_uc001gky.1_Missense_Mutation_p.F688L|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	688	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16																		---	---	---	---
RGS18	64407	broad.mit.edu	37	1	192127818	192127818	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192127818A>T	uc001gsg.2	+	1	227	c.51A>T	c.(49-51)AAA>AAT	p.K17N		NM_130782	NP_570138	Q9NS28	RGS18_HUMAN	regulator of G-protein signalling 18	17					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)	3																		---	---	---	---
OR2T6	254879	broad.mit.edu	37	1	248551141	248551141	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248551141G>C	uc001iei.1	+	1	232	c.232G>C	c.(232-234)GTG>CTG	p.V78L		NM_001005471	NP_001005471	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T,	78	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
C2orf39	92749	broad.mit.edu	37	2	26654805	26654805	+	Silent	SNP	G	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26654805G>T	uc002rhg.2	+	7	893	c.819G>T	c.(817-819)CTG>CTT	p.L273L	C2orf39_uc010eym.1_RNA	NM_145038	NP_659475	Q96MC2	CC164_HUMAN	hypothetical protein LOC92749	273	Potential.										0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
C2orf63	130162	broad.mit.edu	37	2	55439896	55439896	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55439896C>G	uc002ryi.2	-	5	758	c.412G>C	c.(412-414)GAT>CAT	p.D138H	C2orf63_uc002ryh.2_Intron|C2orf63_uc002ryj.2_Missense_Mutation_p.D16H	NM_152385	NP_689598	Q8NHS4	CB063_HUMAN	hypothetical protein LOC130162 isoform 1	138							binding			ovary(2)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(58;0.179)|Lung(47;0.189)															---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141214034	141214034	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141214034G>C	uc002tvj.1	-	62	10925	c.9953C>G	c.(9952-9954)ACA>AGA	p.T3318R		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3318	Extracellular (Potential).|LDL-receptor class A 21.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
GALNT13	114805	broad.mit.edu	37	2	155099201	155099201	+	Intron	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155099201C>T	uc002tyr.3	+						GALNT13_uc002tyt.3_Intron|GALNT13_uc010foc.1_Intron	NM_052917	NP_443149			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179507029	179507029	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179507029T>C	uc010zfg.1	-	168	33013	c.32789A>G	c.(32788-32790)AAG>AGG	p.K10930R	TTN_uc010zfh.1_Missense_Mutation_p.K4625R|TTN_uc010zfi.1_Missense_Mutation_p.K4558R|TTN_uc010zfj.1_Missense_Mutation_p.K4433R|TTN_uc010fre.1_Missense_Mutation_p.K808R|TTN_uc002umw.1_Intron|TTN_uc002umx.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	11857							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
ERBB4	2066	broad.mit.edu	37	2	212285296	212285296	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212285296T>G	uc002veg.1	-	25	3103	c.3005A>C	c.(3004-3006)AAG>ACG	p.K1002T	ERBB4_uc002veh.1_Missense_Mutation_p.K1002T|ERBB4_uc010zji.1_Missense_Mutation_p.K992T|ERBB4_uc010zjj.1_Missense_Mutation_p.K992T	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	1002	Cytoplasmic (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)											TSP Lung(8;0.080)			---	---	---	---
PID1	55022	broad.mit.edu	37	2	229890725	229890725	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229890725G>A	uc002vpr.3	-	3	414	c.376C>T	c.(376-378)CGA>TGA	p.R126*	PID1_uc002vps.3_Nonsense_Mutation_p.R124*|PID1_uc002vpt.3_Nonsense_Mutation_p.R93*|PID1_uc002vpu.3_Nonsense_Mutation_p.R44*	NM_001100818	NP_001094288	Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	126	PID.					cytoplasm				breast(3)|skin(1)	4		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)														---	---	---	---
UGT1A6	54578	broad.mit.edu	37	2	234602413	234602413	+	Silent	SNP	T	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234602413T>C	uc002vuv.3	+	1	902	c.763T>C	c.(763-765)TTA>CTA	p.L255L	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Silent_p.L255L	NM_001072	NP_001063	P19224	UD16_HUMAN	UDP glycosyltransferase 1 family, polypeptide A6	255					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity				0		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)														---	---	---	---
UGT1A4	54657	broad.mit.edu	37	2	234627925	234627925	+	Silent	SNP	C	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234627925C>G	uc002vux.2	+	1	488	c.459C>G	c.(457-459)CCC>CCG	p.P153P	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Silent_p.P153P	NM_007120	NP_009051	P22310	UD14_HUMAN	UDP glycosyltransferase 1 family, polypeptide A4	153					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;3.49e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000504)|Lung(119;0.0026)|LUSC - Lung squamous cell carcinoma(224;0.00624)	Imipramine(DB00458)|Lamotrigine(DB00555)|Paricalcitol(DB00910)|Trifluoperazine(DB00831)													---	---	---	---
NDUFA10	4705	broad.mit.edu	37	2	240923056	240923056	+	Intron	SNP	C	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240923056C>A	uc002vyn.2	-						NDUFA10_uc010fzc.1_Missense_Mutation_p.G390C	NM_004544	NP_004535			NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transport	mitochondrial matrix|mitochondrial respiratory chain complex I	ATP binding|NADH dehydrogenase (ubiquinone) activity|phosphotransferase activity, alcohol group as acceptor			central_nervous_system(1)	1		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)	NADH(DB00157)													---	---	---	---
CHL1	10752	broad.mit.edu	37	3	384718	384718	+	Intron	SNP	A	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:384718A>G	uc003bou.2	+						CHL1_uc003bot.2_Intron|CHL1_uc003bow.1_Intron|CHL1_uc011asi.1_Intron	NM_006614	NP_006605			cell adhesion molecule with homology to L1CAM						axon guidance|cell adhesion|signal transduction	integral to membrane|plasma membrane|proteinaceous extracellular matrix		p.?(1)		skin(5)|central_nervous_system(4)|large_intestine(2)|ovary(1)	12		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)														---	---	---	---
PLCL2	23228	broad.mit.edu	37	3	17052724	17052724	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17052724A>G	uc011awc.1	+	5	1967	c.1862A>G	c.(1861-1863)CAG>CGG	p.Q621R	PLCL2_uc011awd.1_Missense_Mutation_p.Q503R	NM_001144382	NP_001137854	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2 isoform 1	629	PI-PLC Y-box.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4																		---	---	---	---
ALAS1	211	broad.mit.edu	37	3	52245362	52245362	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52245362G>A	uc003dcy.1	+	10	1731	c.1394G>A	c.(1393-1395)CGG>CAG	p.R465Q	ALAS1_uc003dcz.1_Missense_Mutation_p.R465Q|ALAS1_uc011bec.1_Missense_Mutation_p.R482Q	NM_000688	NP_000679	P13196	HEM1_HUMAN	5-aminolevulinate synthase 1 precursor	465					heme biosynthetic process	mitochondrial matrix	5-aminolevulinate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(2)|upper_aerodigestive_tract(1)	3				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.000583)|KIRC - Kidney renal clear cell carcinoma(197;0.000751)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)													---	---	---	---
LRTM1	57408	broad.mit.edu	37	3	54958662	54958662	+	Silent	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54958662C>T	uc003dhl.2	-	2	722	c.588G>A	c.(586-588)GAG>GAA	p.E196E	CACNA2D3_uc003dhf.2_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron	NM_020678	NP_065729	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	196	Extracellular (Potential).|LRRCT.					integral to membrane					0				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)														---	---	---	---
ROBO2	6092	broad.mit.edu	37	3	77671489	77671489	+	Silent	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77671489C>T	uc003dpy.3	+	23	4309	c.3666C>T	c.(3664-3666)GAC>GAT	p.D1222D	ROBO2_uc003dpz.2_Silent_p.D1226D|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Silent_p.D1226D	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	1222	Cytoplasmic (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78988072	78988072	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78988072G>A	uc003dqe.2	-	4	386	c.178C>T	c.(178-180)CGT>TGT	p.R60C	ROBO1_uc003dqb.2_Missense_Mutation_p.R21C|ROBO1_uc003dqc.2_Missense_Mutation_p.R21C|ROBO1_uc003dqd.2_Missense_Mutation_p.R21C	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	60	Extracellular (Potential).				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
CP	1356	broad.mit.edu	37	3	148927145	148927145	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148927145G>A	uc003ewy.3	-	4	887	c.634C>T	c.(634-636)CAT>TAT	p.H212Y	CP_uc011bnr.1_RNA|CP_uc003ewx.3_5'UTR|CP_uc003ewz.2_Missense_Mutation_p.H212Y|CP_uc010hvf.1_5'Flank	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	212	F5/8 type A 1.|Plastocyanin-like 2.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)													---	---	---	---
CLDN16	10686	broad.mit.edu	37	3	190122676	190122676	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190122676C>T	uc003fsi.2	+	3	621	c.553C>T	c.(553-555)CGC>TGC	p.R185C	CLDN16_uc010hze.2_Intron	NM_006580	NP_006571	Q9Y5I7	CLD16_HUMAN	claudin 16	185	Cytoplasmic (Potential).				calcium-independent cell-cell adhesion|cellular metal ion homeostasis|excretion	integral to membrane|tight junction	identical protein binding|magnesium ion transmembrane transporter activity|structural molecule activity			ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)														---	---	---	---
STX18	53407	broad.mit.edu	37	4	4422605	4422605	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4422605C>T	uc003gic.2	-	10	982	c.898G>A	c.(898-900)GAA>AAA	p.E300K		NM_016930	NP_058626	Q9P2W9	STX18_HUMAN	syntaxin 18	300	t-SNARE coiled-coil homology.|Cytoplasmic (Potential).				ER to Golgi vesicle-mediated transport|intracellular protein transport	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	SNAP receptor activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.0534)														---	---	---	---
C4orf50	389197	broad.mit.edu	37	4	5961286	5961286	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5961286C>T	uc003git.1	-	7	737	c.647G>A	c.(646-648)GGT>GAT	p.G216D		NM_207405	NP_997288	Q6ZRC1	CD050_HUMAN	hypothetical protein LOC389197	216										pancreas(2)|breast(1)	3																		---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79369321	79369321	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79369321C>T	uc003hlb.2	+	44	6565	c.6125C>T	c.(6124-6126)CCT>CTT	p.P2042L		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2041	CSPG 8.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
AFF1	4299	broad.mit.edu	37	4	88029444	88029444	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88029444C>G	uc003hqj.3	+	10	1896	c.1489C>G	c.(1489-1491)CCC>GCC	p.P497A	AFF1_uc011ccz.1_Missense_Mutation_p.P504A|AFF1_uc003hqk.3_Missense_Mutation_p.P497A|AFF1_uc011cda.1_Missense_Mutation_p.P135A	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	497						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)														---	---	---	---
IL2	3558	broad.mit.edu	37	4	123375011	123375011	+	Intron	SNP	A	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123375011A>C	uc003ier.2	-							NM_000586	NP_000577			interleukin 2 precursor						anti-apoptosis|cell adhesion|cell-cell signaling|immune response|natural killer cell activation|negative regulation of B cell apoptosis|positive regulation of activated T cell proliferation|positive regulation of B cell proliferation|positive regulation of cell growth|positive regulation of interleukin-17 production|positive regulation of tyrosine phosphorylation of Stat5 protein|T cell differentiation	extracellular space	cytokine activity|growth factor activity|interleukin-2 receptor binding|kinase activator activity			skin(1)	1				LUSC - Lung squamous cell carcinoma(721;0.185)				T	TNFRSF17	intestinal T-cell lymphoma								---	---	---	---
FAT4	79633	broad.mit.edu	37	4	126337595	126337595	+	Intron	SNP	T	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126337595T>A	uc003ifj.3	+						FAT4_uc011cgp.1_Intron	NM_024582	NP_078858			FAT tumor suppressor homolog 4 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18																		---	---	---	---
WDR17	116966	broad.mit.edu	37	4	177087274	177087274	+	Splice_Site	SNP	G	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177087274G>C	uc003iuj.2	+	24	3219	c.3063_splice	c.e24-1	p.C1021_splice	WDR17_uc003iuk.2_Splice_Site_p.C997_splice|WDR17_uc003ium.3_Intron|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Splice_Site_p.C240_splice	NM_170710	NP_733828			WD repeat domain 17 isoform 1											ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)														---	---	---	---
ODZ3	55714	broad.mit.edu	37	4	183650188	183650188	+	Silent	SNP	G	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183650188G>C	uc003ivd.1	+	13	2476	c.2439G>C	c.(2437-2439)CGG>CGC	p.R813R	ODZ3_uc003ive.1_Silent_p.R219R	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	813	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)														---	---	---	---
TRIO	7204	broad.mit.edu	37	5	14280512	14280512	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14280512G>A	uc003jff.2	+	3	320	c.314G>A	c.(313-315)AGG>AAG	p.R105K	TRIO_uc003jfg.2_RNA|TRIO_uc011cna.1_Missense_Mutation_p.R56K	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	105	CRAL-TRIO.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)																	---	---	---	---
CDH10	1008	broad.mit.edu	37	5	24491827	24491827	+	Silent	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24491827G>A	uc003jgr.1	-	11	2066	c.1734C>T	c.(1732-1734)AGC>AGT	p.S578S	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	578	Cadherin 5.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)											HNSCC(23;0.051)			---	---	---	---
RXFP3	51289	broad.mit.edu	37	5	33937559	33937559	+	Silent	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33937559G>A	uc003jic.1	+	1	1071	c.714G>A	c.(712-714)ACG>ACA	p.T238T		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	238	Extracellular (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
PTCD2	79810	broad.mit.edu	37	5	71627121	71627121	+	Silent	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71627121G>A	uc003kcb.2	+	4	397	c.387G>A	c.(385-387)GAG>GAA	p.E129E	PTCD2_uc011csf.1_5'UTR|PTCD2_uc003kcc.2_5'UTR|PTCD2_uc011csg.1_Intron|PTCD2_uc011csh.1_Intron|PTCD2_uc003kcd.2_RNA	NM_024754	NP_079030	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	129											0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)														---	---	---	---
GMPR	2766	broad.mit.edu	37	6	16254938	16254938	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16254938G>C	uc003nbs.2	+	4	551	c.437G>C	c.(436-438)CGT>CCT	p.R146P		NM_006877	NP_006868	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	146					nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage|response to cold	cytosol	GMP reductase activity|metal ion binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)																---	---	---	---
CAP2	10486	broad.mit.edu	37	6	17543332	17543332	+	Silent	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17543332G>A	uc003ncb.2	+	11	1410	c.1167G>A	c.(1165-1167)GTG>GTA	p.V389V	CAP2_uc010jpk.1_RNA|CAP2_uc011dja.1_Silent_p.V363V|CAP2_uc011djb.1_Silent_p.V325V|CAP2_uc011djc.1_Silent_p.V277V|CAP2_uc011djd.1_Silent_p.V129V	NM_006366	NP_006357	P40123	CAP2_HUMAN	adenylyl cyclase-associated protein 2	389	C-CAP/cofactor C-like.				activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)															---	---	---	---
COL11A2	1302	broad.mit.edu	37	6	33148932	33148932	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33148932G>A	uc003ocx.1	-	9	1363	c.1135C>T	c.(1135-1137)CGA>TGA	p.R379*	COL11A2_uc003ocy.1_Nonsense_Mutation_p.R293*|COL11A2_uc003ocz.1_Nonsense_Mutation_p.R272*	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	379	Nonhelical region.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5																		---	---	---	---
OGFRL1	79627	broad.mit.edu	37	6	72011497	72011497	+	Silent	SNP	A	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72011497A>G	uc003pfx.1	+	7	1264	c.1101A>G	c.(1099-1101)AAA>AAG	p.K367K		NM_024576	NP_078852	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	367						membrane	receptor activity				0																		---	---	---	---
DOPEY1	23033	broad.mit.edu	37	6	83849723	83849723	+	Silent	SNP	C	T	T	rs138371141		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83849723C>T	uc003pjs.1	+	22	5385	c.5125C>T	c.(5125-5127)CTG>TTG	p.L1709L	DOPEY1_uc011dyy.1_Silent_p.L1700L|DOPEY1_uc010kbl.1_Silent_p.L1700L|DOPEY1_uc003pjt.2_RNA	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1	1709					protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)														---	---	---	---
POU3F2	5454	broad.mit.edu	37	6	99284016	99284016	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99284016G>T	uc003ppe.2	+	1	1437	c.1267G>T	c.(1267-1269)GAG>TAG	p.E423*		NM_005604	NP_005595	P20265	PO3F2_HUMAN	POU domain, class 3, transcription factor 2	423					positive regulation of cell proliferation		identical protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)														---	---	---	---
NMBR	4829	broad.mit.edu	37	6	142409697	142409697	+	Silent	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142409697C>T	uc003qiu.2	-	1	240	c.99G>A	c.(97-99)TCG>TCA	p.S33S		NM_002511	NP_002502	P28336	NMBR_HUMAN	neuromedin B receptor	33	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger	cytoplasm|integral to plasma membrane	bombesin receptor activity			central_nervous_system(3)|breast(1)	4	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152454496	152454496	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152454496C>G	uc010kiw.2	-	143	26518	c.25916G>C	c.(25915-25917)GGA>GCA	p.G8639A	SYNE1_uc010kiv.2_Missense_Mutation_p.G3163A|SYNE1_uc003qos.3_Missense_Mutation_p.G3163A|SYNE1_uc003qot.3_Missense_Mutation_p.G8591A|SYNE1_uc003qou.3_Missense_Mutation_p.G8639A|SYNE1_uc003qop.3_Missense_Mutation_p.G824A|SYNE1_uc011eez.1_Missense_Mutation_p.G841A|SYNE1_uc003qoq.3_Missense_Mutation_p.G841A|SYNE1_uc003qor.3_Missense_Mutation_p.G1562A	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8639	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
MYCT1	80177	broad.mit.edu	37	6	153019200	153019200	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153019200A>C	uc003qpd.3	+	1	171	c.163A>C	c.(163-165)AGT>CGT	p.S55R	MYCT1_uc010kjc.1_Missense_Mutation_p.S55R|MYCT1_uc003qpc.3_Missense_Mutation_p.S55R	NM_025107	NP_079383	Q8N699	MYCT1_HUMAN	myc target 1	55						nucleus				ovary(1)	1		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)														---	---	---	---
TCP1	6950	broad.mit.edu	37	6	160206998	160206998	+	Missense_Mutation	SNP	G	C	C	rs138621617		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160206998G>C	uc003qsr.2	-	4	546	c.311C>G	c.(310-312)GCA>GGA	p.A104G	TCP1_uc003qss.2_5'UTR|TCP1_uc010kjz.2_Missense_Mutation_p.A104G|TCP1_uc003qst.2_Intron|SNORA29_uc003qsv.1_5'Flank	NM_030752	NP_110379	P17987	TCPA_HUMAN	T-complex protein 1 isoform a	104					'de novo' posttranslational protein folding|tubulin complex assembly	cell junction|Golgi apparatus	ATP binding|unfolded protein binding			breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(65;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)														---	---	---	---
NUPL2	11097	broad.mit.edu	37	7	23224721	23224721	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23224721C>T	uc003svu.2	+	2	413	c.154C>T	c.(154-156)CAG>TAG	p.Q52*	NUPL2_uc003svv.2_RNA|NUPL2_uc003svw.2_Intron|NUPL2_uc011jyw.1_RNA|NUPL2_uc003svx.2_5'UTR	NM_007342	NP_031368	O15504	NUPL2_HUMAN	nucleoporin like 2	52					carbohydrate metabolic process|glucose transport|mRNA transport|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nuclear pore	nuclear export signal receptor activity|nucleic acid binding|zinc ion binding			skin(2)|ovary(1)	3																		---	---	---	---
C7orf10	79783	broad.mit.edu	37	7	40899961	40899961	+	Silent	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40899961G>A	uc003thn.1	+	14	1245	c.1200G>A	c.(1198-1200)CCG>CCA	p.P400P	C7orf10_uc003thm.1_Silent_p.P396P|C7orf10_uc003tho.1_Silent_p.P352P|C7orf10_uc003thp.1_RNA	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13	407							transferase activity			ovary(2)	2																		---	---	---	---
SEMA3E	9723	broad.mit.edu	37	7	82997007	82997007	+	Silent	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82997007C>T	uc003uhy.1	-	17	2689	c.2223G>A	c.(2221-2223)AAG>AAA	p.K741K		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	741	Arg/Lys-rich (basic).				axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)																---	---	---	---
ABCB1	5243	broad.mit.edu	37	7	87150134	87150134	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87150134T>G	uc003uiz.1	-	23	3162	c.2744A>C	c.(2743-2745)AAG>ACG	p.K915T	ABCB1_uc011khc.1_Missense_Mutation_p.K851T	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	915	ABC transmembrane type-1 2.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)													---	---	---	---
PPP1R9A	55607	broad.mit.edu	37	7	94539432	94539432	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94539432A>T	uc003unp.2	+	2	289	c.7A>T	c.(7-9)AAA>TAA	p.K3*	PPP1R9A_uc010lfj.2_Nonsense_Mutation_p.K3*|PPP1R9A_uc011kif.1_Nonsense_Mutation_p.K3*|PPP1R9A_uc003unq.2_Nonsense_Mutation_p.K3*|PPP1R9A_uc011kig.1_Nonsense_Mutation_p.K3*	NM_017650	NP_060120	Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	3	Actin-binding.					cell junction|synapse|synaptosome	actin binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)												HNSCC(28;0.073)			---	---	---	---
SLC25A13	10165	broad.mit.edu	37	7	95750584	95750584	+	Silent	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95750584C>T	uc003uof.3	-	18	2138	c.1947G>A	c.(1945-1947)GGG>GGA	p.G649G	SLC25A13_uc003uog.3_Silent_p.G650G|SLC25A13_uc011kik.1_Silent_p.G541G	NM_014251	NP_055066	Q9UJS0	CMC2_HUMAN	solute carrier family 25, member 13 isoform 2	649					ATP biosynthetic process|gluconeogenesis|malate-aspartate shuttle|response to calcium ion	integral to plasma membrane|mitochondrial inner membrane	calcium ion binding|L-aspartate transmembrane transporter activity|L-glutamate transmembrane transporter activity			central_nervous_system(3)|skin(1)	4	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)													---	---	---	---
KCND2	3751	broad.mit.edu	37	7	119915287	119915287	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119915287G>A	uc003vjj.1	+	1	1566	c.601G>A	c.(601-603)GCG>ACG	p.A201T		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	201	Helical; Name=Segment S1; (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)																	---	---	---	---
FLNC	2318	broad.mit.edu	37	7	128498473	128498473	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128498473T>C	uc003vnz.3	+	48	8283	c.8074T>C	c.(8074-8076)TAC>CAC	p.Y2692H	FLNC_uc003voa.3_Missense_Mutation_p.Y2659H	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	2692	Interaction with INPPL1.|Filamin 24.|Self-association site, tail (By similarity).				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12																		---	---	---	---
TPK1	27010	broad.mit.edu	37	7	144150762	144150762	+	Intron	SNP	A	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144150762A>C	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890			thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)													---	---	---	---
GIMAP8	155038	broad.mit.edu	37	7	150174787	150174787	+	Silent	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150174787C>T	uc003whj.2	+	5	2247	c.1917C>T	c.(1915-1917)AAC>AAT	p.N639N		NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	639	Potential.					endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)														---	---	---	---
TUSC3	7991	broad.mit.edu	37	8	15508312	15508312	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15508312G>A	uc003wwt.2	+	3	625	c.415G>A	c.(415-417)GTT>ATT	p.V139I	TUSC3_uc003wwr.2_Missense_Mutation_p.V139I|TUSC3_uc003wws.2_Missense_Mutation_p.V139I|TUSC3_uc003wwu.2_Missense_Mutation_p.V139I|TUSC3_uc003wwv.2_Missense_Mutation_p.V139I|TUSC3_uc003www.2_Missense_Mutation_p.V139I|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Missense_Mutation_p.V139I	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	139					cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)														---	---	---	---
RPS20	6224	broad.mit.edu	37	8	56986310	56986310	+	Silent	SNP	T	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56986310T>G	uc003xsn.2	-	3	319	c.121A>C	c.(121-123)AGA>CGA	p.R41R	RPS20_uc003xsm.2_Silent_p.R41R	NM_001023	NP_001014	P60866	RS20_HUMAN	ribosomal protein S20 isoform 2	41					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.155)	Epithelial(17;0.00117)|all cancers(17;0.00879)															---	---	---	---
PREX2	80243	broad.mit.edu	37	8	69030879	69030879	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69030879G>A	uc003xxv.1	+	27	3448	c.3421G>A	c.(3421-3423)GGT>AGT	p.G1141S		NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1141					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17																		---	---	---	---
CRISPLD1	83690	broad.mit.edu	37	8	75932289	75932289	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75932289C>T	uc003yan.2	+	12	1594	c.1219C>T	c.(1219-1221)CAT>TAT	p.H407Y	CRISPLD1_uc011lfk.1_Missense_Mutation_p.H219Y|CRISPLD1_uc011lfl.1_Missense_Mutation_p.H219Y	NM_031461	NP_113649	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain	407	LCCL 2.					extracellular region				ovary(1)|central_nervous_system(1)	2	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)															---	---	---	---
SLC30A8	169026	broad.mit.edu	37	8	118183309	118183309	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118183309A>G	uc003yoh.2	+	7	1096	c.866A>G	c.(865-867)GAG>GGG	p.E289G	SLC30A8_uc010mcz.2_Missense_Mutation_p.E240G|SLC30A8_uc011lia.1_Missense_Mutation_p.E240G|SLC30A8_uc003yog.2_Missense_Mutation_p.E240G	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	289	Cytoplasmic (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)															---	---	---	---
PGM5	5239	broad.mit.edu	37	9	71094402	71094402	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71094402C>T	uc004agr.2	+	8	1457	c.1228C>T	c.(1228-1230)CGG>TGG	p.R410W		NM_021965	NP_068800	Q15124	PGM5_HUMAN	phosphoglucomutase 5	410					cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity	p.R410Q(1)		ovary(1)|pancreas(1)	2																		---	---	---	---
C9orf71	169693	broad.mit.edu	37	9	71152191	71152191	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71152191C>T	uc004agt.2	-	2	550	c.497G>A	c.(496-498)CGA>CAA	p.R166Q	uc004ags.1_RNA	NM_153237	NP_694969	Q8N6L7	CI071_HUMAN	hypothetical protein LOC169693	166						integral to membrane					0																		---	---	---	---
GABBR2	9568	broad.mit.edu	37	9	101243267	101243267	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101243267G>A	uc004ays.2	-	5	901	c.745C>T	c.(745-747)CGG>TGG	p.R249W		NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor	249	Extracellular (Potential).				negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)													---	---	---	---
TRUB2	26995	broad.mit.edu	37	9	131077872	131077872	+	Missense_Mutation	SNP	C	T	T	rs140486544		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131077872C>T	uc004buq.1	-	4	362	c.352G>A	c.(352-354)GAT>AAT	p.D118N		NM_015679	NP_056494	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase homolog 2	118					pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(1)	1																		---	---	---	---
SPTAN1	6709	broad.mit.edu	37	9	131394520	131394520	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131394520G>T	uc004bvl.3	+	52	6975	c.6862G>T	c.(6862-6864)GTG>TTG	p.V2288L	SPTAN1_uc004bvm.3_Missense_Mutation_p.V2293L|SPTAN1_uc004bvn.3_Missense_Mutation_p.V2268L|SPTAN1_uc004bvo.3_Missense_Mutation_p.V55L|SPTAN1_uc004bvp.3_Missense_Mutation_p.V31L	NM_003127	NP_003118	Q13813	SPTA2_HUMAN	spectrin, alpha, non-erythrocytic 1	2288	Spectrin 23.				actin filament capping|axon guidance|cellular component disassembly involved in apoptosis	cytosol|intracellular membrane-bounded organelle|membrane fraction|microtubule cytoskeleton|spectrin	actin binding|calcium ion binding|calmodulin binding|structural constituent of cytoskeleton			breast(5)|ovary(4)|pancreas(1)	10																		---	---	---	---
DHTKD1	55526	broad.mit.edu	37	10	12149982	12149982	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12149982C>T	uc001ild.3	+	12	2221	c.2122C>T	c.(2122-2124)CAC>TAC	p.H708Y		NM_018706	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain	708					glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			ovary(1)|central_nervous_system(1)	2		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)															---	---	---	---
IFIT5	24138	broad.mit.edu	37	10	91177577	91177577	+	Silent	SNP	T	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91177577T>G	uc010qnh.1	+	2	852	c.621T>G	c.(619-621)GCT>GCG	p.A207A	IFIT5_uc010qng.1_Silent_p.A159A	NM_012420	NP_036552	Q13325	IFIT5_HUMAN	interferon-induced protein with	207	TPR 4.						binding				0																		---	---	---	---
TNNI2	7136	broad.mit.edu	37	11	1862411	1862411	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1862411C>T	uc010qxe.1	+	5	449	c.427C>T	c.(427-429)CAG>TAG	p.Q143*	TNNI2_uc010qxc.1_Nonsense_Mutation_p.Q141*|TNNI2_uc010qxd.1_Nonsense_Mutation_p.Q141*	NM_001145841	NP_001139313	P48788	TNNI2_HUMAN	fast-twitch skeletal muscle troponin I isoform	143					muscle filament sliding|positive regulation of transcription, DNA-dependent|skeletal muscle contraction	cytosol|nucleus|troponin complex	actin binding|troponin T binding				0		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)														---	---	---	---
SLC22A18	5002	broad.mit.edu	37	11	2943338	2943338	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2943338C>G	uc001lwx.2	+	9	1089	c.871C>G	c.(871-873)CAG>GAG	p.Q291E	SLC22A18_uc001lwy.2_Missense_Mutation_p.Q291E|SLC22A18_uc001lwz.2_Missense_Mutation_p.Q193E	NM_183233	NP_899056	Q96BI1	S22AI_HUMAN	tumor suppressing subtransferable candidate 5	291	Helical; (Potential).				excretion|organic cation transport	apical plasma membrane|cytoplasmic part|integral to membrane|nuclear envelope	drug:hydrogen antiporter activity|symporter activity|ubiquitin protein ligase binding			central_nervous_system(2)|ovary(1)	3		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)														---	---	---	---
UBQLN3	50613	broad.mit.edu	37	11	5529162	5529162	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5529162G>T	uc001may.1	-	2	1713	c.1627C>A	c.(1627-1629)CTC>ATC	p.L543I	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_5'Flank|OR51B5_uc001maq.1_5'Flank	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN	ubiquilin 3	543										ovary(3)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
OR52B2	255725	broad.mit.edu	37	11	6190615	6190615	+	Silent	SNP	A	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6190615A>C	uc010qzy.1	-	1	942	c.942T>G	c.(940-942)ACT>ACG	p.T314T		NM_001004052	NP_001004052	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B,	314	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19954883	19954883	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19954883G>A	uc010rdm.1	+	8	1523	c.1162G>A	c.(1162-1164)GTG>ATG	p.V388M	NAV2_uc001mpp.2_Missense_Mutation_p.V301M|NAV2_uc001mpr.3_Missense_Mutation_p.V365M	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	388						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
OR5D18	219438	broad.mit.edu	37	11	55587672	55587672	+	Silent	SNP	T	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587672T>G	uc010rin.1	+	1	567	c.567T>G	c.(565-567)TCT>TCG	p.S189S		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	189	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)																---	---	---	---
OR10AG1	282770	broad.mit.edu	37	11	55735170	55735170	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55735170T>G	uc010rit.1	-	1	770	c.770A>C	c.(769-771)CAG>CCG	p.Q257P		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	257	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)																	---	---	---	---
OR8H2	390151	broad.mit.edu	37	11	55873254	55873254	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55873254T>G	uc010riy.1	+	1	736	c.736T>G	c.(736-738)TTG>GTG	p.L246V		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	246	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)														HNSCC(53;0.14)			---	---	---	---
ATL3	25923	broad.mit.edu	37	11	63398784	63398784	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63398784C>T	uc001nxk.1	-	12	1543	c.1267G>A	c.(1267-1269)GAA>AAA	p.E423K	ATL3_uc010rms.1_Missense_Mutation_p.E405K|ATL3_uc010rmr.1_Missense_Mutation_p.E81K	NM_015459	NP_056274	Q6DD88	ATLA3_HUMAN	atlastin 3	423	Cytoplasmic.				endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding			pancreas(1)	1																		---	---	---	---
LTBP3	4054	broad.mit.edu	37	11	65320461	65320461	+	Intron	SNP	A	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65320461A>T	uc001oej.2	-						LTBP3_uc010roi.1_Intron|LTBP3_uc001oei.2_Intron|LTBP3_uc010roj.1_Intron|LTBP3_uc010rok.1_Intron	NM_001130144	NP_001123616			latent transforming growth factor beta binding							extracellular region	calcium ion binding|growth factor binding			central_nervous_system(2)|lung(1)	3																		---	---	---	---
NEU3	10825	broad.mit.edu	37	11	74716711	74716711	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74716711A>T	uc001ovw.2	+	3	716	c.560A>T	c.(559-561)AAG>ATG	p.K187M	NEU3_uc001ovv.2_Missense_Mutation_p.K177M|NEU3_uc010rrl.1_Missense_Mutation_p.K78M	NM_006656	NP_006647	A8K327	A8K327_HUMAN	sialidase 3	187										ovary(2)	2																		---	---	---	---
FAM55D	54827	broad.mit.edu	37	11	114442147	114442147	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114442147A>G	uc001ppc.2	-	6	1329	c.1148T>C	c.(1147-1149)CTT>CCT	p.L383P	FAM55D_uc001ppd.2_Missense_Mutation_p.L99P	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1	383						extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)														---	---	---	---
OPCML	4978	broad.mit.edu	37	11	132290138	132290138	+	Silent	SNP	A	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132290138A>C	uc001qgs.2	-	7	1037	c.987T>G	c.(985-987)GCT>GCG	p.A329A	OPCML_uc001qgu.2_Silent_p.A322A|OPCML_uc010sck.1_Silent_p.A338A|OPCML_uc001qgt.2_Silent_p.A328A|OPCML_uc010scl.1_Silent_p.A288A	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion	329					cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
PZP	5858	broad.mit.edu	37	12	9311060	9311060	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9311060C>G	uc001qvl.2	-	26	3279	c.3250G>C	c.(3250-3252)GGC>CGC	p.G1084R	PZP_uc009zgl.2_Missense_Mutation_p.G870R	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5																		---	---	---	---
PTPRR	5801	broad.mit.edu	37	12	71078534	71078534	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71078534T>G	uc001swi.1	-	9	1725	c.1309A>C	c.(1309-1311)AAA>CAA	p.K437Q	PTPRR_uc001swh.1_Missense_Mutation_p.K192Q|PTPRR_uc009zrs.2_Missense_Mutation_p.K286Q|PTPRR_uc010stq.1_Missense_Mutation_p.K325Q|PTPRR_uc010str.1_Missense_Mutation_p.K286Q	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	437	Tyrosine-protein phosphatase.|Cytoplasmic (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)														---	---	---	---
PCDH9	5101	broad.mit.edu	37	13	66878829	66878829	+	Silent	SNP	T	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66878829T>C	uc001vik.2	-	5	4364	c.3672A>G	c.(3670-3672)CAA>CAG	p.Q1224Q	PCDH9_uc010aei.2_RNA|PCDH9_uc001vil.2_Silent_p.Q1190Q|PCDH9_uc010thl.1_Silent_p.Q1182Q	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	1224	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)														---	---	---	---
DCT	1638	broad.mit.edu	37	13	95131263	95131263	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95131263G>A	uc001vlv.3	-	1	674	c.247C>T	c.(247-249)CGT>TGT	p.R83C	DCT_uc010afh.2_Missense_Mutation_p.R83C	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1	83	Lumenal, melanosome (Potential).				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity	p.R83H(1)		ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)														---	---	---	---
G2E3	55632	broad.mit.edu	37	14	31074963	31074963	+	Silent	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31074963G>A	uc001wqk.2	+	11	1417	c.1263G>A	c.(1261-1263)GAG>GAA	p.E421E	G2E3_uc010tpe.1_Intron|G2E3_uc010tpf.1_Silent_p.E375E	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase	421	HECT.				apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
TMEM63C	57156	broad.mit.edu	37	14	77706958	77706958	+	Intron	SNP	A	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77706958A>C	uc001xtf.2	+						TMEM63C_uc010asq.1_Intron	NM_020431	NP_065164			transmembrane protein 63C							integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)														---	---	---	---
TMEM63C	57156	broad.mit.edu	37	14	77706960	77706960	+	Intron	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77706960C>T	uc001xtf.2	+						TMEM63C_uc010asq.1_Intron	NM_020431	NP_065164			transmembrane protein 63C							integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	78709689	78709689	+	RNA	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78709689G>A	uc001xum.1	+	2		c.1046G>A								Homo sapiens mRNA for KIAA0743 protein, partial cds.						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
ITPK1	3705	broad.mit.edu	37	14	93412807	93412807	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93412807G>C	uc001ybg.2	-	10	1059	c.770C>G	c.(769-771)CCG>CGG	p.P257R	ITPK1_uc001ybe.2_Missense_Mutation_p.P257R|ITPK1_uc001ybf.2_Missense_Mutation_p.P138R|ITPK1_uc001ybh.2_Missense_Mutation_p.P257R	NM_014216	NP_055031	Q13572	ITPK1_HUMAN	inositol 1,3,4-triphosphate 5/6 kinase isoform	257	ATP-grasp.				blood coagulation|inositol trisphosphate metabolic process|signal transduction	cytosol	ATP binding|hydrolase activity|inositol tetrakisphosphate 1-kinase activity|inositol-1,3,4-trisphosphate 5/6-kinase activity|isomerase activity|ligase activity|magnesium ion binding				0		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)														---	---	---	---
TCL1A	8115	broad.mit.edu	37	14	96180358	96180358	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96180358C>T	uc001yfc.3	-	1	176	c.46G>A	c.(46-48)GAC>AAC	p.D16N	uc001yfd.1_5'Flank|TCL1A_uc001yfb.3_Missense_Mutation_p.D16N	NM_001098725	NP_001092195	P56279	TCL1A_HUMAN	T-cell leukemia/lymphoma 1A	16				D->G: Greatly reduced binding to AKT1, AKT2 and AKT3. Abolishes nuclear transport of AKT1.	multicellular organismal development	endoplasmic reticulum|microsome				lung(1)	1		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)				T	TRA@	T-CLL								---	---	---	---
AHNAK2	113146	broad.mit.edu	37	14	105408582	105408582	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105408582G>C	uc010axc.1	-	7	13326	c.13206C>G	c.(13204-13206)GAC>GAG	p.D4402E	AHNAK2_uc001ypx.2_Missense_Mutation_p.D4302E	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4402						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)															---	---	---	---
PPIP5K1	9677	broad.mit.edu	37	15	43827178	43827178	+	Silent	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43827178G>A	uc001zrw.2	-	31	4179	c.3996C>T	c.(3994-3996)TCC>TCT	p.S1332S	PPIP5K1_uc001zrx.1_Silent_p.S1305S|PPIP5K1_uc001zru.2_Silent_p.S1307S|PPIP5K1_uc001zry.3_Silent_p.S1307S|PPIP5K1_uc001zrv.2_Silent_p.S1093S	NM_001130858	NP_001124330	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A	1332					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0																		---	---	---	---
NOX5	79400	broad.mit.edu	37	15	69340218	69340218	+	Silent	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69340218C>T	uc002ars.1	+	13	1886	c.1866C>T	c.(1864-1866)ATC>ATT	p.I622I	NOX5_uc002arp.1_Silent_p.I604I|NOX5_uc002arq.1_Silent_p.I576I|NOX5_uc010bid.1_Silent_p.I587I|NOX5_uc002arr.1_Silent_p.I594I|NOX5_uc010bie.1_Silent_p.I422I|NOX5_uc010bif.1_RNA	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	622	Extracellular (Potential).				angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2																		---	---	---	---
GOLGA6A	342096	broad.mit.edu	37	15	74372961	74372961	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74372961C>T	uc002axa.1	-	2	241	c.200G>A	c.(199-201)GGG>GAG	p.G67E		NM_001038640	NP_001033729	Q9NYA3	GOG6A_HUMAN	golgi autoantigen, golgin subfamily a, 6	67	Potential.										0																		---	---	---	---
NLRC3	197358	broad.mit.edu	37	16	3607671	3607671	+	Silent	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3607671C>T	uc010btn.2	-	7	2433	c.2022G>A	c.(2020-2022)GCG>GCA	p.A674A	NLRC3_uc010bto.1_5'Flank	NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN	NOD3 protein	674	LRR 3.				I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	9862812	9862812	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9862812T>A	uc002czo.3	-	12	3039	c.2491A>T	c.(2491-2493)AGC>TGC	p.S831C	GRIN2A_uc010uym.1_Missense_Mutation_p.S831C|GRIN2A_uc010uyn.1_Missense_Mutation_p.S674C|GRIN2A_uc002czr.3_Missense_Mutation_p.S831C	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	831	Helical; (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
PHLPP2	23035	broad.mit.edu	37	16	71689244	71689244	+	Silent	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71689244C>T	uc002fax.2	-	16	2490	c.2484G>A	c.(2482-2484)CCG>CCA	p.P828P	PHLPP2_uc002fav.2_RNA|PHLPP2_uc010cgf.2_Silent_p.P761P	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	828	PP2C-like.					cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
CDYL2	124359	broad.mit.edu	37	16	80667007	80667007	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80667007C>T	uc002ffs.2	-	3	848	c.743G>A	c.(742-744)CGG>CAG	p.R248Q		NM_152342	NP_689555	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	248						nucleus	catalytic activity|protein binding			central_nervous_system(1)	1																		---	---	---	---
MYH3	4621	broad.mit.edu	37	17	10549057	10549057	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10549057G>A	uc002gmq.1	-	11	1185	c.1108C>T	c.(1108-1110)CGA>TGA	p.R370*		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	370	Myosin head-like.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7																		---	---	---	---
CCR10	2826	broad.mit.edu	37	17	40832436	40832436	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40832436G>A	uc002iax.3	-	2	228	c.224C>T	c.(223-225)TCG>TTG	p.S75L	CNTNAP1_uc002iay.2_5'Flank|CNTNAP1_uc010wgs.1_5'Flank	NM_016602	NP_057686	P46092	CCR10_HUMAN	CC chemokine receptor 10	75	Cytoplasmic (Potential).					integral to plasma membrane					0		Breast(137;0.000153)		BRCA - Breast invasive adenocarcinoma(366;0.14)														---	---	---	---
MAP3K14	9020	broad.mit.edu	37	17	43344481	43344481	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43344481G>T	uc002iiw.1	-	14	2520	c.2411C>A	c.(2410-2412)TCC>TAC	p.S804Y	LOC100133991_uc010dah.2_RNA|LOC100133991_uc002iit.3_RNA|LOC100133991_uc010dai.2_RNA|MAP3K14_uc002iiu.1_Missense_Mutation_p.S334Y|MAP3K14_uc010daj.1_RNA|MAP3K14_uc002iiv.1_Missense_Mutation_p.S388Y	NM_003954	NP_003945	Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase	804					cellular response to mechanical stimulus|I-kappaB kinase/NF-kappaB cascade|immune response|positive regulation of I-kappaB kinase/NF-kappaB cascade|T cell costimulation	cytosol	ATP binding|MAP kinase kinase kinase activity|NF-kappaB-inducing kinase activity|protein binding			central_nervous_system(3)|breast(2)|lung(1)|ovary(1)|stomach(1)	8																		---	---	---	---
MAP3K14	9020	broad.mit.edu	37	17	43344507	43344507	+	Silent	SNP	G	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43344507G>C	uc002iiw.1	-	14	2494	c.2385C>G	c.(2383-2385)CTC>CTG	p.L795L	LOC100133991_uc010dah.2_RNA|LOC100133991_uc002iit.3_RNA|LOC100133991_uc010dai.2_RNA|MAP3K14_uc002iiu.1_Silent_p.L325L|MAP3K14_uc010daj.1_RNA|MAP3K14_uc002iiv.1_Silent_p.L379L	NM_003954	NP_003945	Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase	795					cellular response to mechanical stimulus|I-kappaB kinase/NF-kappaB cascade|immune response|positive regulation of I-kappaB kinase/NF-kappaB cascade|T cell costimulation	cytosol	ATP binding|MAP kinase kinase kinase activity|NF-kappaB-inducing kinase activity|protein binding			central_nervous_system(3)|breast(2)|lung(1)|ovary(1)|stomach(1)	8																		---	---	---	---
CACNA1G	8913	broad.mit.edu	37	17	48655755	48655755	+	Missense_Mutation	SNP	C	T	T	rs2301833		TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48655755C>T	uc002irk.1	+	9	2503	c.2131C>T	c.(2131-2133)CGG>TGG	p.R711W	CACNA1G_uc002iri.1_Missense_Mutation_p.R711W|CACNA1G_uc002irj.1_Missense_Mutation_p.R711W|CACNA1G_uc002irl.1_Missense_Mutation_p.R711W|CACNA1G_uc002irm.1_Missense_Mutation_p.R711W|CACNA1G_uc002irn.1_Missense_Mutation_p.R711W|CACNA1G_uc002iro.1_Missense_Mutation_p.R711W|CACNA1G_uc002irp.1_Missense_Mutation_p.R711W|CACNA1G_uc002irq.1_Missense_Mutation_p.R711W|CACNA1G_uc002irr.1_Missense_Mutation_p.R711W|CACNA1G_uc002irs.1_Missense_Mutation_p.R711W|CACNA1G_uc002irt.1_Missense_Mutation_p.R711W|CACNA1G_uc002irv.1_Missense_Mutation_p.R711W|CACNA1G_uc002irw.1_Missense_Mutation_p.R711W|CACNA1G_uc002iru.1_Missense_Mutation_p.R711W|CACNA1G_uc002irx.1_Missense_Mutation_p.R624W|CACNA1G_uc002iry.1_Missense_Mutation_p.R624W|CACNA1G_uc002irz.1_Missense_Mutation_p.R624W|CACNA1G_uc002isa.1_Missense_Mutation_p.R624W|CACNA1G_uc002isb.1_Missense_Mutation_p.R624W|CACNA1G_uc002isc.1_Missense_Mutation_p.R624W|CACNA1G_uc002isd.1_Missense_Mutation_p.R624W|CACNA1G_uc002ise.1_Missense_Mutation_p.R624W|CACNA1G_uc002isf.1_Missense_Mutation_p.R624W|CACNA1G_uc002isg.1_Missense_Mutation_p.R624W|CACNA1G_uc002ish.1_Missense_Mutation_p.R624W|CACNA1G_uc002isi.1_Missense_Mutation_p.R624W	NM_018896	NP_061496	O43497	CAC1G_HUMAN	voltage-dependent calcium channel alpha 1G	711	Cytoplasmic (Potential).				axon guidance	voltage-gated calcium channel complex	low voltage-gated calcium channel activity			breast(1)	1	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Ethosuximide(DB00593)|Flunarizine(DB04841)|Levetiracetam(DB01202)|Mibefradil(DB01388)|Pimozide(DB01100)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)													---	---	---	---
COX11	1353	broad.mit.edu	37	17	53040737	53040737	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53040737T>C	uc010wng.1	-	3	635	c.578A>G	c.(577-579)AAA>AGA	p.K193R	COX11_uc010wne.1_RNA|COX11_uc010wnf.1_RNA|COX11_uc002iue.2_RNA|COX11_uc010wnh.1_Missense_Mutation_p.K193R	NM_004375	NP_004366	Q9Y6N1	COX11_HUMAN	COX11 homolog, cytochrome c oxidase assembly	193	Mitochondrial intermembrane (Potential).|Mitochondrial matrix (Potential).				respiratory chain complex IV assembly|respiratory gaseous exchange	integral to membrane|mitochondrial inner membrane	copper ion binding|cytochrome-c oxidase activity|electron carrier activity			ovary(1)	1																		---	---	---	---
SLC16A5	9121	broad.mit.edu	37	17	73089886	73089886	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73089886C>A	uc002jmr.2	+	3	527	c.155C>A	c.(154-156)ACC>AAC	p.T52N	SLC16A5_uc002jms.1_Missense_Mutation_p.T52N|SLC16A5_uc002jmt.2_Missense_Mutation_p.T52N|SLC16A5_uc002jmu.2_Missense_Mutation_p.T52N|SLC16A5_uc010wrt.1_Missense_Mutation_p.T92N	NM_004695	NP_004686	O15375	MOT6_HUMAN	solute carrier family 16, member 5	52	Extracellular (Potential).				organic anion transport	integral to plasma membrane|membrane fraction	secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)													---	---	---	---
SIGLEC15	284266	broad.mit.edu	37	18	43422081	43422081	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43422081C>T	uc002lbl.1	+	6	1065	c.916C>T	c.(916-918)CAG>TAG	p.Q306*	SIGLEC15_uc010xcp.1_RNA	NM_213602	NP_998767	Q6ZMC9	SIG15_HUMAN	sialic acid binding Ig-like lectin 15 precursor	306	Cytoplasmic (Potential).					integral to membrane					0																		---	---	---	---
TRAPPC5	126003	broad.mit.edu	37	19	7747404	7747404	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7747404G>A	uc002mhi.1	+	2	335	c.265G>A	c.(265-267)GTC>ATC	p.V89I	TRAPPC5_uc002mhj.1_Missense_Mutation_p.V89I|TRAPPC5_uc002mhk.1_Missense_Mutation_p.V89I	NM_001042462	NP_001035927	Q8IUR0	TPPC5_HUMAN	trafficking protein particle complex 5	89					vesicle-mediated transport	endoplasmic reticulum	guanylate cyclase activity|heme binding				0																		---	---	---	---
OR7A5	26659	broad.mit.edu	37	19	14938689	14938689	+	Missense_Mutation	SNP	C	T	T	rs112260964	byFrequency	TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14938689C>T	uc002mzw.2	-	1	588	c.365G>A	c.(364-366)CGG>CAG	p.R122Q	OR7A5_uc010xoa.1_Missense_Mutation_p.R122Q	NM_017506	NP_059976	Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(2)	2																		---	---	---	---
INSL3	3640	broad.mit.edu	37	19	17927697	17927697	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17927697G>A	uc002nhm.1	-	2	367	c.362C>T	c.(361-363)ACC>ATC	p.T121I	INSL3_uc010ebf.1_Missense_Mutation_p.P153S|INSL3_uc010ebg.1_RNA	NM_005543	NP_005534	P51460	INSL3_HUMAN	insulin-like 3 precursor	121					cell-cell signaling|spermatogenesis	soluble fraction	hormone activity|insulin receptor binding|signal transducer activity				0																		---	---	---	---
CHST8	64377	broad.mit.edu	37	19	34180177	34180177	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34180177C>T	uc002nus.3	+	3	515	c.10C>T	c.(10-12)CGA>TGA	p.R4*	CHST8_uc002nut.3_Nonsense_Mutation_p.R4*|CHST8_uc002nuu.2_Nonsense_Mutation_p.R4*	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0)	4	Cytoplasmic (Potential).				carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)																	---	---	---	---
RBL1	5933	broad.mit.edu	37	20	35663825	35663825	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35663825C>T	uc002xgi.2	-	15	2069	c.1990G>A	c.(1990-1992)GAC>AAC	p.D664N	RBL1_uc010zvt.1_RNA|RBL1_uc002xgj.1_Missense_Mutation_p.D664N	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a	664	Pocket; binds T and E1A.|Spacer.				cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)																---	---	---	---
RBL1	5933	broad.mit.edu	37	20	35696518	35696518	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35696518C>G	uc002xgi.2	-	3	441	c.362G>C	c.(361-363)CGT>CCT	p.R121P	RBL1_uc010zvt.1_RNA|RBL1_uc002xgj.1_Missense_Mutation_p.R121P|RBL1_uc010gfv.1_RNA	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a	121					cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)																---	---	---	---
MATN4	8785	broad.mit.edu	37	20	43926705	43926705	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43926705C>T	uc002xnn.2	-	8	1619	c.1432G>A	c.(1432-1434)GTC>ATC	p.V478I	MATN4_uc002xno.2_Missense_Mutation_p.V437I|MATN4_uc002xnp.2_Missense_Mutation_p.V396I|MATN4_uc010zwr.1_Missense_Mutation_p.V426I|MATN4_uc002xnr.1_Missense_Mutation_p.V478I	NM_003833	NP_003824	O95460	MATN4_HUMAN	matrilin 4 isoform 1 precursor	519	VWFA 2.					extracellular region	protein binding				0		Myeloproliferative disorder(115;0.0122)																---	---	---	---
ICOSLG	23308	broad.mit.edu	37	21	45657066	45657066	+	Silent	SNP	G	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45657066G>T	uc002zee.2	-	3	224	c.90C>A	c.(88-90)GGC>GGA	p.G30G	ICOSLG_uc011afc.1_Intron|ICOSLG_uc002zef.2_Intron|ICOSLG_uc010gpp.1_Silent_p.G30G	NM_015259	NP_056074	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand precursor	30	Ig-like V-type.|Extracellular (Potential).				B cell activation|defense response|hyperosmotic response|positive regulation of activated T cell proliferation|signal transduction|T cell activation|T cell costimulation		receptor binding				0				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)														---	---	---	---
KRTAP12-3	386683	broad.mit.edu	37	21	46077995	46077995	+	Silent	SNP	C	T	T			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46077995C>T	uc002zft.2	+	1	147	c.99C>T	c.(97-99)TCC>TCT	p.S33S	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198697	NP_941970	P60328	KR123_HUMAN	keratin associated protein 12-3	33	4.|14 X 5 AA approximate repeats.					intermediate filament				central_nervous_system(1)	1																		---	---	---	---
FTHL17	53940	broad.mit.edu	37	X	31089536	31089536	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31089536G>A	uc004dcl.1	-	1	638	c.535C>T	c.(535-537)CGC>TGC	p.R179C		NM_031894	NP_114100	Q9BXU8	FHL17_HUMAN	ferritin, heavy polypeptide-like 17	179					cellular iron ion homeostasis|iron ion transport		ferric iron binding|oxidoreductase activity				0																		---	---	---	---
ZNF81	347344	broad.mit.edu	37	X	47775862	47775862	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47775862G>A	uc010nhy.1	+	6	2185	c.1817G>A	c.(1816-1818)GGG>GAG	p.G606E		NM_007137	NP_009068	P51508	ZNF81_HUMAN	zinc finger protein 81	606						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(315;0.0973)																---	---	---	---
MAGEE1	57692	broad.mit.edu	37	X	75649393	75649393	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4265-01A-01D-1126-08	TCGA-BR-4265-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75649393T>G	uc004ecm.1	+	1	1277	c.1070T>G	c.(1069-1071)CTG>CGG	p.L357R		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	357	Pro-rich.					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6																		---	---	---	---
