Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
MMP23B	8510	broad.mit.edu	37	1	1566850	1566850	+	5'Flank	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1566850delC	uc001agp.2	+						MMP23B_uc001agq.2_5'Flank|MMP23B_uc001agr.2_5'Flank|MMP23B_uc009vki.2_5'Flank	NM_006983	NP_008914			matrix metalloproteinase 23B precursor						proteolysis|reproduction	endoplasmic reticulum membrane|integral to membrane|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	2942660	2942671	+	IGR	DEL	TGATGATGGTGG	-	-	rs138066330	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2942660_2942671delTGATGATGGTGG								ACTRT2 (3195 upstream) : FLJ42875 (33512 downstream)																																			---	---	---	---
PRDM16	63976	broad.mit.edu	37	1	3347778	3347778	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3347778delC	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397			PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)				T	EVI1	MDS|AML								---	---	---	---
TP73	7161	broad.mit.edu	37	1	3594255	3594255	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3594255delT	uc001akp.2	+						TP73_uc001akq.2_Intron	NM_005427	NP_005418			tumor protein p73 isoform a						cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mismatch repair|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of JUN kinase activity|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|protein tetramerization|response to gamma radiation|response to X-ray	chromatin|cytosol|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|metal ion binding|p53 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|transcription repressor activity			ovary(1)|lung(1)	2	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)														---	---	---	---
ACOT7	11332	broad.mit.edu	37	1	6390127	6390128	+	Intron	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6390127_6390128delGT	uc001ams.2	-						ACOT7_uc010nzq.1_Intron|ACOT7_uc001amt.2_Intron|ACOT7_uc001amu.2_Intron|ACOT7_uc001amv.2_Intron|ACOT7_uc001amq.2_Intron|ACOT7_uc001amr.2_Intron	NM_181864	NP_863654			acyl-CoA thioesterase 7 isoform hBACHb							mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity				0	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)														---	---	---	---
TAS1R1	80835	broad.mit.edu	37	1	6623774	6623775	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6623774_6623775insA	uc001ant.2	+						TAS1R1_uc001anu.2_Intron|TAS1R1_uc001anv.2_Intron|TAS1R1_uc001anw.2_Intron	NM_138697	NP_619642			sweet taste receptor T1r isoform b						sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7006248	7006249	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7006248_7006249insT	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7757346	7757347	+	Intron	DEL	TA	-	-	rs139369522		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7757346_7757347delTA	uc001aoi.2	+						CAMTA1_uc010nzv.1_Intron|CAMTA1_uc001aok.3_Intron	NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7758711	7758712	+	Intron	DEL	CT	-	-	rs35555090		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7758711_7758712delCT	uc001aoi.2	+						CAMTA1_uc010nzv.1_Intron|CAMTA1_uc001aok.3_Intron	NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	9586318	9586319	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9586318_9586319insT								SPSB1 (156730 upstream) : SLC25A33 (13209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	9690766	9690777	+	IGR	DEL	GTGTGTGTGTGT	-	-	rs112968701		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9690766_9690777delGTGTGTGTGTGT								TMEM201 (15831 upstream) : PIK3CD (21013 downstream)																																			---	---	---	---
KIF1B	23095	broad.mit.edu	37	1	10424560	10424560	+	Intron	DEL	C	-	-	rs34869052		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10424560delC	uc001aqx.3	+						KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron	NM_015074	NP_055889			kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	10903903	10903903	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10903903delC								CASZ1 (47196 upstream) : C1orf127 (102630 downstream)																																			---	---	---	---
FBXO6	26270	broad.mit.edu	37	1	11729794	11729795	+	Intron	INS	-	AC	AC	rs150680437	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11729794_11729795insAC	uc001aso.2	+							NM_018438	NP_060908			F-box only protein 6						DNA damage checkpoint|DNA repair|ER-associated protein catabolic process|response to unfolded protein|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	glycoprotein binding			lung(1)	1	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.25e-06)|COAD - Colon adenocarcinoma(227;0.000251)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	11830668	11830668	+	5'Flank	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11830668delT	uc001asz.2	+											RecName: Full=Uncharacterized protein C1orf167;																														---	---	---	---
CLCN6	1185	broad.mit.edu	37	1	11874305	11874306	+	Intron	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11874305_11874306delTT	uc001ate.3	+						CLCN6_uc009vne.1_Intron|CLCN6_uc009vnf.1_Intron|CLCN6_uc009vng.1_Intron|CLCN6_uc009vnh.1_Intron|CLCN6_uc010oat.1_Intron|CLCN6_uc010oau.1_Intron	NM_001286	NP_001277			chloride channel 6 isoform ClC-6a						cell volume homeostasis|signal transduction	endosome membrane|integral to membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
TNFRSF8	943	broad.mit.edu	37	1	12141714	12141715	+	Intron	INS	-	A	A	rs112852724		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12141714_12141715insA	uc001atq.2	+						TNFRSF8_uc010obc.1_Intron	NM_001243	NP_001234			tumor necrosis factor receptor superfamily,						cellular response to mechanical stimulus|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of TRAIL biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	cytoplasm|integral to membrane|plasma membrane				skin(2)|ovary(1)|pancreas(1)|central_nervous_system(1)	5	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
TNFRSF1B	7133	broad.mit.edu	37	1	12240358	12240359	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12240358_12240359insT	uc001att.2	+						TNFRSF1B_uc001atu.2_Intron|TNFRSF1B_uc009vnk.2_Intron	NM_001066	NP_001057			tumor necrosis factor receptor 2 precursor						apoptosis	extracellular region|integral to membrane|membrane raft|plasma membrane	tumor necrosis factor receptor activity			liver(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)|Infliximab(DB00065)													---	---	---	---
TNFRSF1B	7133	broad.mit.edu	37	1	12245361	12245366	+	Intron	DEL	CTTTTT	-	-	rs3835514		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12245361_12245366delCTTTTT	uc001att.2	+						TNFRSF1B_uc001atu.2_Intron|TNFRSF1B_uc009vnk.2_Intron	NM_001066	NP_001057			tumor necrosis factor receptor 2 precursor						apoptosis	extracellular region|integral to membrane|membrane raft|plasma membrane	tumor necrosis factor receptor activity			liver(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)|Infliximab(DB00065)													---	---	---	---
VPS13D	55187	broad.mit.edu	37	1	12388603	12388603	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12388603delT	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc001aty.1_Intron	NM_015378	NP_056193			vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)														---	---	---	---
VPS13D	55187	broad.mit.edu	37	1	12468371	12468372	+	Intron	DEL	AG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12468371_12468372delAG	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc009vnl.2_Intron|VPS13D_uc010obd.1_5'Flank	NM_015378	NP_056193			vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	13955909	13955909	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13955909delA								PDPN (11459 upstream) : PRDM2 (70826 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	14153898	14153898	+	IGR	DEL	G	-	-	rs34028828		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14153898delG								PRDM2 (2326 upstream) : KAZ (771315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	14298091	14298091	+	IGR	DEL	T	-	-	rs35726794		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14298091delT								PRDM2 (146519 upstream) : KAZ (627122 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	14665517	14665517	+	IGR	DEL	A	-	-	rs35833377		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14665517delA								PRDM2 (513945 upstream) : KAZ (259696 downstream)																																			---	---	---	---
SPEN	23013	broad.mit.edu	37	1	16194934	16194934	+	Intron	DEL	T	-	-	rs35701730		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16194934delT	uc001axk.1	+							NM_015001	NP_055816			spen homolog, transcriptional regulator						interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)														---	---	---	---
NBPF1	55672	broad.mit.edu	37	1	16926278	16926278	+	Intron	DEL	A	-	-	rs67762891		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16926278delA	uc009vos.1	-						NBPF1_uc001aza.3_RNA	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)														---	---	---	---
KIAA0090	23065	broad.mit.edu	37	1	19548906	19548906	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19548906delA	uc001bbo.2	-						KIAA0090_uc001bbn.2_5'Flank|KIAA0090_uc001bbp.2_Intron|KIAA0090_uc001bbq.2_Intron|KIAA0090_uc001bbr.2_Intron	NM_015047	NP_055862			hypothetical protein LOC23065 precursor							integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	20153413	20153413	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20153413delC								RNF186 (11642 upstream) : OTUD3 (55475 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	20781077	20781078	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20781077_20781078delTG								VWA5B1 (99690 upstream) : CAMK2N1 (27807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	22663921	22663928	+	IGR	DEL	CCATCCAT	-	-	rs140828904		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22663921_22663928delCCATCCAT								WNT4 (193536 upstream) : ZBTB40 (114416 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	23679964	23679964	+	IGR	DEL	C	-	-	rs142707590		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23679964delC								HNRNPR (9111 upstream) : ZNF436 (5978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	24545552	24545552	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24545552delT								LOC284632 (7372 upstream) : GRHL3 (100329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	24624257	24624257	+	IGR	DEL	G	-	-	rs10718284		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24624257delG								LOC284632 (86077 upstream) : GRHL3 (21624 downstream)																																			---	---	---	---
PDIK1L	149420	broad.mit.edu	37	1	26442693	26442694	+	Intron	INS	-	A	A	rs112534527		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26442693_26442694insA	uc010oew.1	+						PDIK1L_uc001blj.3_Intron|PDIK1L_uc009vsb.2_Intron	NM_152835	NP_690048			PDLIM1 interacting kinase 1 like							nucleus	ATP binding|protein serine/threonine kinase activity				0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00239)|all_lung(284;0.00366)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000735)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	27524960	27524960	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27524960delT								SLC9A1 (43509 upstream) : WDTC1 (36047 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	29818787	29818787	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29818787delT								PTPRU (165472 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	31125468	31125469	+	IGR	DEL	GT	-	-	rs35546520		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31125468_31125469delGT								None (None upstream) : MATN1 (58657 downstream)																																			---	---	---	---
PUM1	9698	broad.mit.edu	37	1	31484012	31484013	+	Intron	DEL	AC	-	-	rs71964070		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31484012_31484013delAC	uc001bsi.1	-						PUM1_uc001bsh.1_Intron|PUM1_uc001bsj.1_Intron|PUM1_uc010oga.1_Intron|PUM1_uc001bsk.1_Intron|PUM1_uc010ogb.1_Intron	NM_014676	NP_055491			pumilio 1 isoform 2						cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)														---	---	---	---
PUM1	9698	broad.mit.edu	37	1	31508243	31508243	+	Intron	DEL	A	-	-	rs145331151		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31508243delA	uc001bsi.1	-						PUM1_uc001bsh.1_Intron|PUM1_uc001bsj.1_Intron|PUM1_uc010oga.1_Intron|PUM1_uc001bsk.1_Intron|PUM1_uc010ogb.1_Intron	NM_014676	NP_055491			pumilio 1 isoform 2						cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	31580928	31580928	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31580928delT								PUM1 (42165 upstream) : NKAIN1 (71665 downstream)																																			---	---	---	---
SNRNP40	9410	broad.mit.edu	37	1	31761013	31761014	+	Intron	INS	-	A	A	rs77118467		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31761013_31761014insA	uc001bso.2	-						SNRNP40_uc010oge.1_Intron	NM_004814	NP_004805			WD repeat domain 57 (U5 snRNP specific)							catalytic step 2 spliceosome|cytoplasm|nucleoplasm|small nucleolar ribonucleoprotein complex|U5 snRNP	protein binding				0																		---	---	---	---
ZCCHC17	51538	broad.mit.edu	37	1	31804163	31804163	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31804163delT	uc001bsp.1	+						ZCCHC17_uc001bsq.1_Intron|ZCCHC17_uc010ogf.1_Intron|ZCCHC17_uc009vtu.1_Intron|ZCCHC17_uc001bsr.1_Intron|ZCCHC17_uc009vtv.1_Intron	NM_016505	NP_057589			zinc finger, CCHC domain containing 17							nucleolus	RNA binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)														---	---	---	---
FABP3	2170	broad.mit.edu	37	1	31848109	31848110	+	5'Flank	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31848109_31848110insT	uc001bss.1	-							NM_004102	NP_004093			fatty acid binding protein 3						negative regulation of cell proliferation					ovary(1)	1		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0185)|READ - Rectum adenocarcinoma(331;0.149)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	32350770	32350771	+	IGR	INS	-	A	A	rs138626594		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32350770_32350771insA								SPOCD1 (69190 upstream) : PTP4A2 (23022 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	32455635	32455636	+	IGR	DEL	TC	-	-	rs36075711		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32455635_32455636delTC								PTP4A2 (51647 upstream) : KHDRBS1 (23855 downstream)																																			---	---	---	---
FNDC5	252995	broad.mit.edu	37	1	33336883	33336883	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33336883delC	uc001bwg.2	-						FNDC5_uc001bwf.1_5'Flank	NM_153756	NP_715637			fibronectin type III domain containing 5							integral to membrane|peroxisomal membrane				ovary(1)	1		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)																---	---	---	---
PHC2	1912	broad.mit.edu	37	1	33879900	33879900	+	Intron	DEL	T	-	-	rs34218458		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33879900delT	uc009vuh.1	-						PHC2_uc001bxi.1_Intron	NM_198040	NP_932157			polyhomeotic-like 2 isoform a						multicellular organismal development	PcG protein complex	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	34863967	34863967	+	IGR	DEL	A	-	-	rs143926635		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34863967delA								C1orf94 (179238 upstream) : MIR552 (271233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	35514175	35514175	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35514175delT								ZMYM6 (16606 upstream) : ZMYM1 (30797 downstream)																																			---	---	---	---
ZMYM4	9202	broad.mit.edu	37	1	35817869	35817872	+	Intron	DEL	CGCA	-	-	rs139368964	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35817869_35817872delCGCA	uc001byt.2	+						ZMYM4_uc009vuu.2_Intron|ZMYM4_uc001byu.2_Intron	NM_005095	NP_005086			zinc finger protein 262						multicellular organismal development		DNA binding|zinc ion binding			large_intestine(2)|ovary(1)|kidney(1)|skin(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	36161384	36161384	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36161384delA								PSMB2 (54241 upstream) : C1orf216 (18093 downstream)																																			---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39573000	39573001	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39573000_39573001insT	uc010ois.1	+							NM_012090	NP_036222			microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
PPIE	10450	broad.mit.edu	37	1	40204803	40204805	+	Intron	DEL	CTT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40204803_40204805delCTT	uc001cds.1	+						PPIE_uc001cdt.1_Intron|PPIE_uc010oiy.1_Intron|PPIE_uc001cdu.1_Intron|PPIE_uc001cdv.2_Intron|PPIE_uc001cdw.2_Intron	NM_006112	NP_006103			peptidylprolyl isomerase E isoform 1						protein folding|regulation of transcription, DNA-dependent	catalytic step 2 spliceosome	cyclosporin A binding|nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|protein binding|RNA binding				0	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	40305413	40305413	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40305413delA								BMP8B (50880 upstream) : TRIT1 (1295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	40720118	40720119	+	IGR	INS	-	T	T	rs149273803		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40720118_40720119insT								TMCO2 (2753 upstream) : ZMPSTE24 (3614 downstream)																																			---	---	---	---
FOXJ3	22887	broad.mit.edu	37	1	42773229	42773229	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42773229delT	uc001che.2	-						FOXJ3_uc001chf.2_Intron|FOXJ3_uc001chg.2_Intron|FOXJ3_uc001chh.1_Intron	NM_014947	NP_055762			forkhead box J3						embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
ST3GAL3	6487	broad.mit.edu	37	1	44353728	44353729	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44353728_44353729insA	uc001ckc.2	+						ST3GAL3_uc009vwu.1_Intron|ST3GAL3_uc010okj.1_Intron|ST3GAL3_uc001cjz.2_Intron|ST3GAL3_uc001cka.2_Intron|ST3GAL3_uc001ckb.2_Intron|ST3GAL3_uc001ckd.2_Intron|ST3GAL3_uc001cke.2_Intron|ST3GAL3_uc001ckf.2_Intron|ST3GAL3_uc001ckg.2_Intron|ST3GAL3_uc001ckh.2_Intron|ST3GAL3_uc001cki.2_Intron|ST3GAL3_uc009vwv.2_Intron|ST3GAL3_uc001ckj.2_Intron|ST3GAL3_uc009vww.2_Intron|ST3GAL3_uc001ckk.2_Intron|ST3GAL3_uc009vwy.2_Intron|ST3GAL3_uc009vwx.2_Intron|ST3GAL3_uc001ckm.2_Intron|ST3GAL3_uc001ckl.2_Intron|ST3GAL3_uc009vwz.2_Intron|ST3GAL3_uc001ckn.2_Intron|ST3GAL3_uc001ckp.2_Intron|ST3GAL3_uc001cko.2_Intron|ST3GAL3_uc009vxa.2_Intron|ST3GAL3_uc001ckq.2_Intron|ST3GAL3_uc001ckr.2_Intron|ST3GAL3_uc009vxb.2_Intron	NM_006279	NP_006270			sialyltransferase 6 isoform j						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	N-acetyllactosaminide alpha-2,3-sialyltransferase activity			ovary(3)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)																---	---	---	---
ERI3	79033	broad.mit.edu	37	1	44700616	44700617	+	Intron	INS	-	TTT	TTT	rs114313394	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44700616_44700617insTTT	uc001clt.2	-						ERI3_uc010okv.1_Intron|ERI3_uc009vxg.2_Intron|ERI3_uc010okw.1_Intron|ERI3_uc001clu.2_Intron	NM_024066	NP_076971			prion protein interacting protein							intracellular	exonuclease activity|metal ion binding|nucleic acid binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
GPBP1L1	60313	broad.mit.edu	37	1	46105726	46105726	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46105726delA	uc001coq.2	-							NM_021639	NP_067652			GC-rich promoter binding protein 1-like 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
BTF3L4	91408	broad.mit.edu	37	1	52532517	52532518	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52532517_52532518insA	uc001ctk.2	+						BTF3L4_uc001ctl.2_Intron|BTF3L4_uc010onh.1_Intron|BTF3L4_uc001ctm.2_Intron	NM_152265	NP_689478			basic transcription factor 3-like 4 isoform 1											large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	53622848	53622849	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53622848_53622849insT								SLC1A7 (14559 upstream) : CPT2 (39252 downstream)																																			---	---	---	---
USP24	23358	broad.mit.edu	37	1	55643838	55643838	+	Intron	DEL	A	-	-	rs67284766		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55643838delA	uc001cyg.3	-							NM_015306	NP_056121			ubiquitin specific protease 24						ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	56881858	56881859	+	IGR	INS	-	T	T	rs143119215	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56881858_56881859insT								None (None upstream) : PPAP2B (78574 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	59096307	59096308	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59096307_59096308delAC								TACSTD2 (53141 upstream) : MYSM1 (29282 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	60935392	60935393	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60935392_60935393delAC								C1orf87 (395966 upstream) : NFIA (607553 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	61039285	61039285	+	IGR	DEL	T	-	-	rs72448794		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61039285delT								C1orf87 (499859 upstream) : NFIA (503661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	65504622	65504623	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65504622_65504623delTG								JAK1 (72003 upstream) : MIR101-1 (19494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	67278154	67278155	+	IGR	DEL	TG	-	-	rs145043858		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67278154_67278155delTG								INSL5 (11215 upstream) : WDR78 (419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	68777873	68777884	+	IGR	DEL	TCTCTCTCTCTC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68777873_68777884delTCTCTCTCTCTC								WLS (79620 upstream) : RPE65 (116623 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	73187459	73187461	+	IGR	DEL	TTC	-	-	rs72110095		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73187459_73187461delTTC								NEGR1 (439054 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	74065744	74065744	+	IGR	DEL	G	-	-	rs74841387		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74065744delG								None (None upstream) : LRRIQ3 (425960 downstream)																																			---	---	---	---
SLC44A5	204962	broad.mit.edu	37	1	75680572	75680573	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75680572_75680573insT	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910			solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4																		---	---	---	---
ST6GALNAC5	81849	broad.mit.edu	37	1	77472990	77472990	+	Intron	DEL	C	-	-	rs114931747	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77472990delC	uc001dhi.2	+						ST6GALNAC5_uc010ori.1_Intron|ST6GALNAC5_uc009wbw.2_Intron	NM_030965	NP_112227			sialyltransferase 7E						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			pancreas(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	79756339	79756339	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79756339delT								ELTD1 (283844 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	81205489	81205489	+	IGR	DEL	C	-	-	rs112438912		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81205489delC								None (None upstream) : LPHN2 (566356 downstream)																																			---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	82438609	82438610	+	Intron	INS	-	C	C	rs141337897		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82438609_82438610insC	uc001dit.3	+						LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Intron|LPHN2_uc001div.2_Intron|LPHN2_uc009wcd.2_Intron|LPHN2_uc001diw.2_Intron|LPHN2_uc009wce.1_Intron	NM_012302	NP_036434			latrophilin 2 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	82850370	82850370	+	IGR	DEL	A	-	-	rs139106848		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82850370delA								LPHN2 (392264 upstream) : None (None downstream)																																			---	---	---	---
DDAH1	23576	broad.mit.edu	37	1	86011814	86011815	+	Intron	INS	-	AA	AA	rs111839145		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86011814_86011815insAA	uc001dlc.2	-							NM_001134445	NP_001127917			dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	86761843	86761843	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86761843delT								COL24A1 (139397 upstream) : ODF2L (52569 downstream)																																			---	---	---	---
HS2ST1	9653	broad.mit.edu	37	1	87544815	87544816	+	Intron	INS	-	T	T	rs11454448		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87544815_87544816insT	uc010osk.1	+						HS2ST1_uc001dmc.3_Intron|LOC339524_uc001dme.1_Intron	NM_012262	NP_036394			heparan sulfate 2-O-sulfotransferase 1 isoform							Golgi membrane|integral to membrane				central_nervous_system(1)	1		Lung NSC(277;0.153)		all cancers(265;0.00699)|Epithelial(280;0.0261)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	87922720	87922720	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87922720delA								LMO4 (108117 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	88614131	88614154	+	IGR	DEL	GAAGGAAGGAAGGAAGGAAGGAAG	-	-	rs71664185		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88614131_88614154delGAAGGAAGGAAGGAAGGAAGGAAG								LMO4 (799528 upstream) : PKN2 (535768 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	91195976	91195976	+	IGR	DEL	A	-	-	rs142704812		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91195976delA								BARHL2 (13182 upstream) : ZNF644 (184884 downstream)																																			---	---	---	---
CCDC18	343099	broad.mit.edu	37	1	93694236	93694236	+	Intron	DEL	T	-	-	rs72226483		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93694236delT	uc001dpq.2	+						CCDC18_uc009wdl.1_Intron	NM_206886	NP_996769			sarcoma antigen NY-SAR-41											ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)														---	---	---	---
BCAR3	8412	broad.mit.edu	37	1	94065133	94065134	+	Intron	INS	-	ATCA	ATCA	rs10658715		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94065133_94065134insATCA	uc001dpz.2	-						BCAR3_uc001dqa.2_Intron|BCAR3_uc001dqb.2_Intron|BCAR3_uc001dpy.2_Intron|uc009wdn.2_RNA	NM_003567	NP_003558			breast cancer antiestrogen resistance 3						response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)														---	---	---	---
ABCA4	24	broad.mit.edu	37	1	94462064	94462064	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94462064delA	uc001dqh.2	-							NM_000350	NP_000341			ATP-binding cassette, sub-family A member 4						phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	95179100	95179101	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95179100_95179101delAC	uc001dqu.2	-											Homo sapiens cDNA clone IMAGE:4795773.																														---	---	---	---
PALMD	54873	broad.mit.edu	37	1	100113883	100113883	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100113883delC	uc001dsg.2	+						PALMD_uc001dsf.2_Intron	NM_017734	NP_060204			palmdelphin						regulation of cell shape	cytoplasm|membrane				ovary(2)|pancreas(1)	3		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	100793325	100793329	+	IGR	DEL	TGGTT	-	-	rs57043276		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100793325_100793329delTGGTT								RTCD1 (35002 upstream) : CDC14A (17255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	101007813	101007813	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101007813delA								GPR88 (231 upstream) : VCAM1 (177484 downstream)																																			---	---	---	---
OLFM3	118427	broad.mit.edu	37	1	102301278	102301278	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102301278delG	uc001duf.2	-						OLFM3_uc001dug.2_Intron|OLFM3_uc001duh.2_Intron|OLFM3_uc001dui.2_Intron|OLFM3_uc001duj.2_Intron|OLFM3_uc001due.2_Intron	NM_058170	NP_477518			olfactomedin 3							extracellular region				ovary(2)|skin(1)	3		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	102666607	102666608	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102666607_102666608delGT								OLFM3 (203817 upstream) : COL11A1 (675416 downstream)																																			---	---	---	---
COL11A1	1301	broad.mit.edu	37	1	103504042	103504043	+	Intron	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103504042_103504043delGA	uc001dul.2	-						COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845			alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	103667429	103667433	+	IGR	DEL	TCTTT	-	-	rs148819615		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103667429_103667433delTCTTT								COL11A1 (93377 upstream) : RNPC3 (401145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	103667435	103667436	+	IGR	INS	-	T	T	rs5776682		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103667435_103667436insT								COL11A1 (93383 upstream) : RNPC3 (401142 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	104658356	104658359	+	IGR	DEL	TGTG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104658356_104658359delTGTG								AMY1A (451184 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	104757355	104757356	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104757355_104757356insA								AMY1A (550183 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	105050599	105050600	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105050599_105050600delAC								AMY1A (843427 upstream) : None (None downstream)																																			---	---	---	---
KIAA1324	57535	broad.mit.edu	37	1	109685578	109685578	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109685578delT	uc001dwq.2	+						KIAA1324_uc009wex.1_Intron|KIAA1324_uc009wey.2_Intron|KIAA1324_uc010ovg.1_Intron	NM_020775	NP_065826			hypothetical protein LOC57535 precursor						macroautophagy|positive regulation of vacuole organization|regulation of apoptosis	integral to plasma membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	5		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	111131498	111131499	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111131498_111131499delTG								KCNA10 (69701 upstream) : KCNA2 (4704 downstream)																																			---	---	---	---
ADORA3	140	broad.mit.edu	37	1	112065141	112065141	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112065141delT	uc001ebg.3	-							NM_001081976	NP_001075445			adenosine A3 receptor isoform 3						activation of adenylate cyclase activity|inflammatory response|regulation of heart contraction	integral to plasma membrane	adenosine receptor activity, G-protein coupled			ovary(2)|large_intestine(1)|skin(1)	4		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	113384743	113384743	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113384743delT	uc001ecw.1	-											Homo sapiens cDNA FLJ36116 fis, clone TESTI2022338.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	113553981	113553981	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113553981delA								SLC16A1 (55006 upstream) : LRIG2 (61850 downstream)																																			---	---	---	---
MAGI3	260425	broad.mit.edu	37	1	113980428	113980429	+	Intron	INS	-	TTCTTCTTC	TTCTTCTTC	rs72069932		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113980428_113980429insTTCTTCTTC	uc001edk.2	+						MAGI3_uc001edh.3_Intron|MAGI3_uc001edi.3_Intron|MAGI3_uc010owm.1_Intron	NM_001142782	NP_001136254			membrane-associated guanylate kinase-related  3						apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
BCAS2	10286	broad.mit.edu	37	1	115113685	115113685	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115113685delT	uc001efa.2	-						DENND2C_uc001eez.2_Intron	NM_005872	NP_005863			breast carcinoma amplified sequence 2						mRNA processing|RNA splicing, via transesterification reactions	nucleolus|spliceosomal complex	protein binding			large_intestine(1)	1	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
TSPAN2	10100	broad.mit.edu	37	1	115616271	115616272	+	Intron	INS	-	T	T	rs113271777		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115616271_115616272insT	uc001eft.2	-							NM_005725	NP_005716			tetraspan 2							integral to membrane					0	Lung SC(450;0.211)	all_cancers(81;2.9e-07)|all_epithelial(167;1.42e-06)|all_lung(203;6.72e-06)|Lung NSC(69;1.13e-05)|Acute lymphoblastic leukemia(138;0.191)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)														---	---	---	---
C1orf161	126868	broad.mit.edu	37	1	116661000	116661000	+	Intron	DEL	A	-	-	rs71686471		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116661000delA	uc001egc.1	+							NM_152367	NP_689580			hypothetical protein LOC126868												0	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)														---	---	---	---
SPAG17	200162	broad.mit.edu	37	1	118521884	118521884	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118521884delA	uc001ehk.2	-							NM_206996	NP_996879			sperm associated antigen 17							cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	119214951	119214955	+	IGR	DEL	AAGAA	-	-	rs67159206		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119214951_119214955delAAGAA								SPAG17 (487103 upstream) : TBX15 (210711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	119289467	119289467	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119289467delA								SPAG17 (561619 upstream) : TBX15 (136199 downstream)																																			---	---	---	---
TBX15	6913	broad.mit.edu	37	1	119529221	119529222	+	Intron	DEL	TC	-	-	rs35782617		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119529221_119529222delTC	uc001ehl.1	-							NM_152380	NP_689593			T-box 15							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|pancreas(1)	2	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	119994122	119994123	+	IGR	INS	-	C	C	rs140905191	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119994122_119994123insC								HSD3B2 (5002 upstream) : HSD3B1 (55703 downstream)																																			---	---	---	---
NOTCH2	4853	broad.mit.edu	37	1	120557662	120557664	+	Intron	DEL	AAC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120557662_120557664delAAC	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719			notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)				N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	1	121117839	121117840	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121117839_121117840insT	uc001eis.2	+							NM_001042758	NP_001036223			SLIT-ROBO Rho GTPase activating protein 2																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	121140484	121140484	+	IGR	DEL	A	-	-	rs111761276		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121140484delA								FCGR1B (204540 upstream) : LOC647121 (120426 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	121402303	121402303	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121402303delC								LOC647121 (88617 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142575206	142575207	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142575206_142575207delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142635221	142635222	+	Intron	INS	-	G	G	rs140870989		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142635221_142635222insG	uc001eiw.1	+						uc001eix.1_RNA					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142793865	142793865	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142793865delT	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143142454	143142456	+	Intron	DEL	TTG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143142454_143142456delTTG	uc001eiw.1	+						uc001ejf.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143169463	143169463	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143169463delC	uc001eiw.1	+						uc001ejg.1_5'Flank					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143275166	143275166	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143275166delA								None (None upstream) : LOC100286793 (372473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143502292	143502294	+	IGR	DEL	AAC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143502292_143502294delAAC								None (None upstream) : LOC100286793 (145345 downstream)																																			---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	144913569	144913570	+	Intron	INS	-	A	A	rs111359341		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144913569_144913570insA	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001emc.1_Intron|PDE4DIP_uc001emd.1_Intron|PDE4DIP_uc001emb.1_Intron|PDE4DIP_uc001eme.1_Intron|PDE4DIP_uc001emf.1_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
PDE4DIP	9659	broad.mit.edu	37	1	145024587	145024590	+	Intron	DEL	ACAT	-	-	rs67086497		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145024587_145024590delACAT	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459			phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145060137	145060138	+	Intron	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145060137_145060138delCT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145109259	145109260	+	Intron	INS	-	A	A	rs150048477	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109259_145109260insA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145206289	145206290	+	Intron	INS	-	T	T	rs11401869		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145206289_145206290insT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'Flank|NOTCH2NL_uc001emn.3_5'Flank|NOTCH2NL_uc001emm.3_5'Flank|NOTCH2NL_uc001emo.2_5'Flank|NOTCH2NL_uc010oyh.1_5'Flank					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145237179	145237179	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145237179delA	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145272466	145272466	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145272466delT	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145499619	145499619	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145499619delC	uc001emp.3	+						LIX1L_uc009wiu.1_RNA	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	148349431	148349432	+	5'Flank	INS	-	G	G	rs67020224		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148349431_148349432insG	uc001eqf.2	-						LOC200030_uc001eqe.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'Flank|uc010paw.1_5'Flank	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	148851645	148851646	+	IGR	INS	-	TA	TA	rs141935458	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148851645_148851646insTA								NBPF16 (93334 upstream) : LOC645166 (76640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149239465	149239465	+	IGR	DEL	C	-	-	rs11284561		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149239465delC								LOC645166 (286411 upstream) : LOC388692 (40011 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149296399	149296400	+	IGR	DEL	AA	-	-	rs66607845		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149296399_149296400delAA								LOC388692 (4657 upstream) : FCGR1C (72894 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149744369	149744370	+	IGR	INS	-	ACACAC	ACACAC	rs142746947	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149744369_149744370insACACAC								HIST2H2BF (345140 upstream) : FCGR1A (9880 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	150494721	150494724	+	IGR	DEL	AAAA	-	-	rs150431177		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150494721_150494724delAAAA								ECM1 (8457 upstream) : ADAMTSL4 (27174 downstream)																																			---	---	---	---
GOLPH3L	55204	broad.mit.edu	37	1	150636481	150636482	+	Intron	INS	-	T	T	rs143298898		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150636481_150636482insT	uc001evj.2	-						GOLPH3L_uc010pci.1_Intron	NM_018178	NP_060648			Golgi phosphoprotein 3-like							Golgi cisterna membrane				ovary(1)	1	all_cancers(9;3.09e-52)|all_epithelial(9;4.47e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000615)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;1.2e-23)|all cancers(9;4.81e-23)|OV - Ovarian serous cystadenocarcinoma(6;1.93e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
CTSK	1513	broad.mit.edu	37	1	150779544	150779545	+	Intron	DEL	TC	-	-	rs72340399		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150779544_150779545delTC	uc001evp.1	-						CTSK_uc001evq.1_Intron|CTSK_uc009wma.1_Intron	NM_000396	NP_000387			cathepsin K preproprotein						proteolysis	lysosome	cysteine-type endopeptidase activity|protein binding			skin(1)	1	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	151309567	151309568	+	IGR	INS	-	A	A	rs150328838		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151309567_151309568insA								PI4KB (9434 upstream) : RFX5 (3548 downstream)																																			---	---	---	---
TUFT1	7286	broad.mit.edu	37	1	151518484	151518485	+	Intron	INS	-	TC	TC	rs145600399		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151518484_151518485insTC	uc001eyl.2	+						TUFT1_uc001eym.2_Intron|TUFT1_uc010pdf.1_Intron|TUFT1_uc010pdg.1_Intron	NM_020127	NP_064512			tuftelin 1 isoform 1						bone mineralization|odontogenesis	cytoplasm|extracellular region	structural constituent of tooth enamel				0	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
TUFT1	7286	broad.mit.edu	37	1	151529850	151529857	+	Intron	DEL	AATCATCA	-	-	rs151327344		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151529850_151529857delAATCATCA	uc001eyl.2	+						TUFT1_uc001eym.2_Intron|TUFT1_uc010pdf.1_Intron|TUFT1_uc010pdg.1_Intron	NM_020127	NP_064512			tuftelin 1 isoform 1						bone mineralization|odontogenesis	cytoplasm|extracellular region	structural constituent of tooth enamel				0	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---
SMCP	4184	broad.mit.edu	37	1	152853465	152853466	+	Intron	DEL	CA	-	-	rs112714610		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152853465_152853466delCA	uc001fat.2	+							NM_030663	NP_109588			sperm mitochondria-associated cysteine-rich						penetration of zona pellucida|sperm motility	mitochondrial membrane					0	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	153901377	153901377	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153901377delA	uc001fdc.1	+											full-length cDNA clone CS0CAP002YE12 of Thymus of Homo sapiens (human).																														---	---	---	---
DCST2	127579	broad.mit.edu	37	1	154994340	154994341	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154994340_154994341insT	uc001fgm.2	-						DCST2_uc009wpb.2_Intron	NM_144622	NP_653223			DC-STAMP domain containing 2							integral to membrane				ovary(2)|central_nervous_system(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)															---	---	---	---
ASH1L	55870	broad.mit.edu	37	1	155394770	155394770	+	Intron	DEL	T	-	-	rs7531890	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155394770delT	uc009wqq.2	-						ASH1L_uc001fkt.2_Intron	NM_018489	NP_060959			absent, small, or homeotic 1-like						cell-cell signaling|DNA packaging|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromosome|Golgi apparatus|nucleus|tight junction	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	11	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)															---	---	---	---
PAQR6	79957	broad.mit.edu	37	1	156213223	156213223	+	3'UTR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156213223delT	uc001fnu.1	-	8					PAQR6_uc010phf.1_3'UTR|PAQR6_uc001fny.1_3'UTR|PAQR6_uc001fnv.1_3'UTR|PAQR6_uc010phg.1_3'UTR|PAQR6_uc001fnx.1_3'UTR|PAQR6_uc001fnw.1_3'UTR|PAQR6_uc001fnz.1_3'UTR|PAQR6_uc010phh.1_3'UTR|PAQR6_uc001foa.1_3'UTR|PAQR6_uc001fob.1_RNA	NM_198406	NP_940798			progestin and adipoQ receptor family member VI							integral to membrane	receptor activity				0	Hepatocellular(266;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	156578342	156578342	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156578342delT								GPATCH4 (7072 upstream) : HAPLN2 (10744 downstream)																																	OREG0013877	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	1	157862483	157862483	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157862483delA								CD5L (50849 upstream) : KIRREL (100580 downstream)																																			---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158588377	158588377	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158588377delC	uc001fst.1	-							NM_003126	NP_003117			spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	160647008	160647015	+	IGR	DEL	GTGTGTGC	-	-	rs71090318		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160647008_160647015delGTGTGTGC								SLAMF1 (29927 upstream) : CD48 (1523 downstream)																																			---	---	---	---
ITLN2	142683	broad.mit.edu	37	1	160923383	160923383	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160923383delC	uc001fxd.2	-						ITLN2_uc009wts.2_Intron|ITLN2_uc010pju.1_Intron	NM_080878	NP_543154			intelectin 2 precursor						signal transduction	extracellular region	receptor binding|sugar binding			ovary(1)	1	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)															---	---	---	---
NOS1AP	9722	broad.mit.edu	37	1	162220856	162220857	+	Intron	INS	-	TTTG	TTTG	rs147232385	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162220856_162220857insTTTG	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512			nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	163535157	163535157	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163535157delG								NUF2 (209604 upstream) : PBX1 (993645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	163990569	163990569	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163990569delA								NUF2 (665016 upstream) : PBX1 (538233 downstream)																																			---	---	---	---
LOC400794	400794	broad.mit.edu	37	1	165552004	165552005	+	5'Flank	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165552004_165552005delTG	uc001gdc.2	-						LOC400794_uc001gdd.2_5'Flank	NR_026744				Homo sapiens cDNA FLJ35813 fis, clone TESTI2006067.												0																		---	---	---	---
ALDH9A1	223	broad.mit.edu	37	1	165649468	165649469	+	Intron	DEL	AC	-	-	rs142442065		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165649468_165649469delAC	uc001gdh.1	-						ALDH9A1_uc010pky.1_Intron|ALDH9A1_uc010pkz.1_Intron|ALDH9A1_uc010pla.1_Intron	NM_000696	NP_000687			aldehyde dehydrogenase 9A1						carnitine biosynthetic process|cellular aldehyde metabolic process|hormone metabolic process|neurotransmitter biosynthetic process	cytosol|plasma membrane	3-chloroallyl aldehyde dehydrogenase activity|4-trimethylammoniobutyraldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aminobutyraldehyde dehydrogenase activity				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				NADH(DB00157)													---	---	---	---
FAM78B	149297	broad.mit.edu	37	1	166128707	166128707	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166128707delA	uc001gdr.2	-						FAM78B_uc010plc.1_Intron	NM_001017961	NP_001017961			hypothetical protein LOC149297											central_nervous_system(1)|skin(1)	2	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	166460336	166460337	+	IGR	DEL	AA	-	-	rs148392426		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166460336_166460337delAA								FAM78B (324130 upstream) : FMO9P (112816 downstream)																																			---	---	---	---
KLHL20	27252	broad.mit.edu	37	1	173742411	173742411	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173742411delT	uc001gjc.2	+						KLHL20_uc010pmr.1_Intron|KLHL20_uc009wwf.2_Intron	NM_014458	NP_055273			kelch-like 20						cytoskeleton organization|negative regulation of apoptosis|proteasomal ubiquitin-dependent protein catabolic process|response to interferon-alpha	actin cytoskeleton|cell surface|Cul3-RING ubiquitin ligase complex|Golgi apparatus|perinuclear region of cytoplasm|PML body	actin binding|interferon-gamma binding|ubiquitin-protein ligase activity			ovary(1)	1																		---	---	---	---
DARS2	55157	broad.mit.edu	37	1	173819743	173819744	+	Intron	INS	-	T	T	rs66665709		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173819743_173819744insT	uc001gjh.1	+							NM_018122	NP_060592			aspartyl-tRNA synthetase 2, mitochondrial						tRNA aminoacylation for protein translation	mitochondrial matrix|nucleus	aspartate-tRNA ligase activity|ATP binding|nucleic acid binding			central_nervous_system(2)	2					L-Aspartic Acid(DB00128)													---	---	---	---
RABGAP1L	9910	broad.mit.edu	37	1	174545701	174545701	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174545701delT	uc001gjx.2	+							NM_014857	NP_055672			RAB GTPase activating protein 1-like isoform A						regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4																		---	---	---	---
TNN	63923	broad.mit.edu	37	1	175094931	175094932	+	Intron	INS	-	TCCT	TCCT	rs143232303	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175094931_175094932insTCCT	uc001gkl.1	+							NM_022093	NP_071376			tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	175857626	175857627	+	IGR	INS	-	T	T	rs75318195		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175857626_175857627insT								TNR (144874 upstream) : RFWD2 (56340 downstream)																																	OREG0013999	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	1	177882255	177882256	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177882255_177882256delCA								FAM5B (630698 upstream) : SEC16B (15233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	179233752	179233753	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179233752_179233753delCA								ABL2 (34933 upstream) : SOAT1 (29264 downstream)																																			---	---	---	---
CEP350	9857	broad.mit.edu	37	1	179985795	179985796	+	Intron	INS	-	TT	TT	rs75981929		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179985795_179985796insTT	uc001gnt.2	+						CEP350_uc009wxl.2_Intron|CEP350_uc001gnu.2_Intron	NM_014810	NP_055625			centrosome-associated protein 350							centrosome|nucleus|spindle				ovary(4)	4																		---	---	---	---
ACBD6	84320	broad.mit.edu	37	1	180360660	180360660	+	Intron	DEL	C	-	-	rs35715929		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180360660delC	uc001gog.2	-							NM_032360	NP_115736			acyl-coenzyme A binding domain containing 6							cytoplasm|nucleus	fatty-acyl-CoA binding			ovary(1)	1																		---	---	---	---
ACBD6	84320	broad.mit.edu	37	1	180445123	180445123	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180445123delA	uc001gog.2	-							NM_032360	NP_115736			acyl-coenzyme A binding domain containing 6							cytoplasm|nucleus	fatty-acyl-CoA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	181062783	181062784	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181062783_181062784insT								IER5 (2806 upstream) : CACNA1E (389932 downstream)																																			---	---	---	---
RGL1	23179	broad.mit.edu	37	1	183897297	183897298	+	3'UTR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183897297_183897298insA	uc001gqo.2	+	18					RGL1_uc001gqm.2_3'UTR|RGL1_uc010pog.1_3'UTR|RGL1_uc010poh.1_3'UTR|RGL1_uc010poi.1_3'UTR	NM_015149	NP_055964			ral guanine nucleotide dissociation						cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11																		---	---	---	---
FAM129A	116496	broad.mit.edu	37	1	184808691	184808692	+	Intron	INS	-	TC	TC			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184808691_184808692insTC	uc001gra.2	-						FAM129A_uc001grb.1_Intron|FAM129A_uc009wyh.1_Intron|FAM129A_uc009wyi.1_Intron	NM_052966	NP_443198			niban protein isoform 2						negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	186675811	186675812	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186675811_186675812delCA								PTGS2 (26252 upstream) : PLA2G4A (122220 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	188394553	188394554	+	IGR	INS	-	TG	TG	rs139937433	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188394553_188394554insTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	188515193	188515194	+	IGR	INS	-	T	T	rs145381330	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:188515193_188515194insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191138638	191138639	+	IGR	INS	-	T	T	rs145484894	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191138638_191138639insT								FAM5C (691879 upstream) : RGS18 (988953 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	191758075	191758075	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:191758075delA								None (None upstream) : RGS18 (369517 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	192259041	192259042	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192259041_192259042insA								RGS18 (104098 upstream) : RGS21 (27080 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	195725345	195725346	+	IGR	INS	-	T	T	rs111937275		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195725345_195725346insT								None (None upstream) : KCNT2 (469567 downstream)																																			---	---	---	---
CFH	3075	broad.mit.edu	37	1	196698083	196698086	+	Intron	DEL	TCTG	-	-	rs77302817		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196698083_196698086delTCTG	uc001gtj.3	+							NM_000186	NP_000177			complement factor H isoform a precursor						complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6																		---	---	---	---
DENND1B	163486	broad.mit.edu	37	1	197514113	197514114	+	Intron	INS	-	GGAAGAA	GGAAGAA	rs146556758	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197514113_197514114insGGAAGAA	uc010ppe.1	-						DENND1B_uc010ppf.1_Intron	NM_001142795	NP_001136267			DENN/MADD domain containing 1B isoform 1							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	198095354	198095355	+	IGR	INS	-	A	A	rs139606811	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198095354_198095355insA								LHX9 (193639 upstream) : NEK7 (30753 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200833330	200833330	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200833330delA								CAMSAP1L1 (3501 upstream) : GPR25 (8836 downstream)																																			---	---	---	---
PKP1	5317	broad.mit.edu	37	1	201257427	201257427	+	Intron	DEL	A	-	-	rs35477170		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201257427delA	uc001gwd.2	+						PKP1_uc001gwe.2_Intron|PKP1_uc009wzm.2_Intron	NM_000299	NP_000290			plakophilin 1 isoform 1b						cell adhesion|cellular component disassembly involved in apoptosis|multicellular organismal development	desmosome|intermediate filament|nucleus	intermediate filament binding|signal transducer activity|structural constituent of epidermis			ovary(2)	2																		---	---	---	---
NAV1	89796	broad.mit.edu	37	1	201712000	201712001	+	Intron	INS	-	C	C	rs145905084	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201712000_201712001insC	uc001gwu.2	+						NAV1_uc001gwv.1_Intron|NAV1_uc001gww.1_Intron|NAV1_uc001gwx.2_Intron	NM_020443	NP_065176			neuron navigator 1						cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4																		---	---	---	---
LGR6	59352	broad.mit.edu	37	1	202173671	202173672	+	Intron	INS	-	AC	AC	rs142174158	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202173671_202173672insAC	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron	NM_001017403	NP_001017403			leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10																		---	---	---	---
PIK3C2B	5287	broad.mit.edu	37	1	204431486	204431488	+	Intron	DEL	TGG	-	-	rs61761705		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204431486_204431488delTGG	uc001haw.2	-						PIK3C2B_uc010pqv.1_Intron|PIK3C2B_uc001hax.1_Intron|PIK3C2B_uc009xbd.1_Intron	NM_002646	NP_002637			phosphoinositide-3-kinase, class 2 beta						cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	206949773	206949774	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206949773_206949774delGT								IL10 (3739 upstream) : IL19 (22441 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	207150944	207150945	+	IGR	INS	-	TTCA	TTCA	rs142910716	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207150944_207150945insTTCA								FCAMR (6974 upstream) : C1orf116 (40921 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	207273399	207273414	+	IGR	DEL	ATGTGTGTGTGTGTGT	-	-	rs57088528		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207273399_207273414delATGTGTGTGTGTGTGT								C4BPB (64 upstream) : C4BPA (4097 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	207397525	207397526	+	IGR	INS	-	TC	TC	rs143193903	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207397525_207397526insTC								C4BPA (79217 upstream) : CD55 (97291 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	207457182	207457182	+	IGR	DEL	T	-	-	rs67483935		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207457182delT								C4BPA (138874 upstream) : CD55 (37635 downstream)																																			---	---	---	---
PLXNA2	5362	broad.mit.edu	37	1	208365653	208365654	+	Intron	DEL	GT	-	-	rs71936470		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208365653_208365654delGT	uc001hgz.2	-							NM_025179	NP_079455			plexin A2 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	208804022	208804023	+	IGR	INS	-	CCCCATTTC	CCCCATTTC	rs146012148	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208804022_208804023insCCCCATTTC								PLXNA2 (386357 upstream) : LOC642587 (798145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	212647427	212647430	+	IGR	DEL	AGAG	-	-	rs111271470		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212647427_212647430delAGAG								NENF (27708 upstream) : ATF3 (91267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	213545218	213545218	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213545218delG								RPS6KC1 (98411 upstream) : PROX1 (616068 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	213681874	213681877	+	IGR	DEL	TGTG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213681874_213681877delTGTG								RPS6KC1 (235067 upstream) : PROX1 (479409 downstream)																																			---	---	---	---
SMYD2	56950	broad.mit.edu	37	1	214459039	214459040	+	Intron	INS	-	TGT	TGT	rs147794277	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214459039_214459040insTGT	uc010ptx.1	+						SMYD2_uc009xdj.2_Intron|SMYD2_uc010ptw.1_Intron|SMYD2_uc009xdl.1_Intron	NM_020197	NP_064582			SET and MYND domain containing 2						negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	cytosol|nucleus	histone methyltransferase activity (H3-K36 specific)|p53 binding|RNA polymerase II core binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)														---	---	---	---
USH2A	7399	broad.mit.edu	37	1	216434610	216434611	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216434610_216434611insA	uc001hku.1	-						USH2A_uc001hkv.2_Intron	NM_206933	NP_996816			usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---
Unknown	0	broad.mit.edu	37	1	216616025	216616026	+	IGR	INS	-	A	A	rs67375336		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216616025_216616026insA								USH2A (19287 upstream) : ESRRG (60562 downstream)																																			---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	216703474	216703476	+	Intron	DEL	AAG	-	-	rs6669134		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216703474_216703476delAAG	uc001hkw.1	-						ESRRG_uc001hky.1_Intron|ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron|ESRRG_uc001hkx.1_Intron|ESRRG_uc009xdo.1_Intron|ESRRG_uc001hle.1_Intron	NM_001438	NP_001429			estrogen-related receptor gamma isoform 1						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	216851584	216851584	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216851584delC	uc001hkw.1	-						ESRRG_uc001hky.1_Intron|ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron|ESRRG_uc001hkx.1_Intron|ESRRG_uc009xdo.1_Intron|ESRRG_uc001hle.1_Intron	NM_001438	NP_001429			estrogen-related receptor gamma isoform 1						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	217157390	217157390	+	Intron	DEL	T	-	-	rs34161434		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217157390delT	uc010puc.1	-						ESRRG_uc001hkz.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318			estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
SPATA17	128153	broad.mit.edu	37	1	217834608	217834609	+	Intron	INS	-	AG	AG	rs138820269	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217834608_217834609insAG	uc001hlh.1	+						SPATA17_uc009xdr.1_Intron|SPATA17_uc001hli.2_Intron	NM_138796	NP_620151			spermatogenesis associated 17							cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	218878349	218878350	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218878349_218878350delTG								TGFB2 (260390 upstream) : LYPLAL1 (468842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	219521205	219521205	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219521205delA								LYPLAL1 (134999 upstream) : SLC30A10 (337564 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	219636088	219636089	+	IGR	INS	-	AC	AC	rs112329853		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219636088_219636089insAC								LYPLAL1 (249882 upstream) : SLC30A10 (222680 downstream)																																			---	---	---	---
MOSC2	54996	broad.mit.edu	37	1	220946026	220946027	+	Intron	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220946026_220946027delGT	uc001hmq.2	+						MOSC2_uc001hmr.2_Intron|MOSC2_uc009xdx.2_Intron	NM_017898	NP_060368			MOCO sulphurase C-terminal domain containing 2							mitochondrial outer membrane|peroxisome	molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.00499)|all cancers(67;0.204)														---	---	---	---
TAF1A	9015	broad.mit.edu	37	1	222754127	222754128	+	Intron	INS	-	G	G	rs74148136		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222754127_222754128insG	uc009xdz.1	-						TAF1A_uc001hni.1_Intron|TAF1A_uc001hnj.2_Intron|TAF1A_uc001hnk.2_Intron|TAF1A_uc010pur.1_Intron	NM_139352	NP_647603			TBP-associated factor 1A isoform 2						regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	RNA polymerase I transcription factor complex	DNA binding				0				GBM - Glioblastoma multiforme(131;0.0186)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	223663366	223663366	+	IGR	DEL	C	-	-	rs11345618		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223663366delC								C1orf65 (94554 upstream) : CAPN8 (51606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	224530184	224530191	+	IGR	DEL	TCTCTCTG	-	-	rs59776293		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224530184_224530191delTCTCTCTG								NVL (12312 upstream) : CNIH4 (14404 downstream)																																			---	---	---	---
SRP9	6726	broad.mit.edu	37	1	225973720	225973720	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225973720delT	uc001hpg.2	+						SRP9_uc001hpf.3_Intron|SRP9_uc001hph.2_Intron|SRP9_uc001hpi.3_Intron|SRP9_uc001hpj.1_Intron	NM_003133	NP_003124			signal recognition particle 9kDa isoform 2						negative regulation of translational elongation|SRP-dependent cotranslational protein targeting to membrane	cytosol|signal recognition particle receptor complex|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding				0																		---	---	---	---
CABC1	56997	broad.mit.edu	37	1	227166619	227166619	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227166619delC	uc001hqm.1	+						CABC1_uc001hqn.1_Intron|CABC1_uc009xeq.1_Intron|CABC1_uc010pvq.1_Intron|CABC1_uc010pvr.1_Intron|CABC1_uc001hqo.1_Intron	NM_020247	NP_064632			chaperone, ABC1 activity of bc1 complex like						cell death	mitochondrion	ATP binding|protein serine/threonine kinase activity				0		Prostate(94;0.0771)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	227176260	227176261	+	IGR	INS	-	AAG	AAG	rs149824611	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227176260_227176261insAAG								CABC1 (1014 upstream) : CDC42BPA (1306 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	227717338	227717339	+	IGR	INS	-	TTG	TTG	rs138147737	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227717338_227717339insTTG								CDC42BPA (211512 upstream) : ZNF678 (33905 downstream)																																			---	---	---	---
C1orf69	200205	broad.mit.edu	37	1	228359770	228359772	+	Intron	DEL	TTT	-	-	rs71710690		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228359770_228359772delTTT	uc001hsl.3	+						C1orf69_uc010pvw.1_5'Flank	NM_001010867	NP_001010867			hypothetical protein LOC200205 precursor						glycine catabolic process|heme biosynthetic process	mitochondrion	aminomethyltransferase activity				0		Prostate(94;0.0405)																---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228394309	228394309	+	5'Flank	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228394309delG	uc009xez.1	+						OBSCN_uc001hsn.2_5'Flank|uc001hsm.1_RNA	NM_001098623	NP_001092093			obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	229038493	229038494	+	IGR	INS	-	TATG	TATG			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229038493_229038494insTATG								RHOU (156084 upstream) : RAB4A (368385 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	229725987	229725988	+	IGR	DEL	AA	-	-	rs35234048		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229725987_229725988delAA								ABCB10 (31545 upstream) : TAF5L (2880 downstream)																																			---	---	---	---
GALNT2	2590	broad.mit.edu	37	1	230244588	230244589	+	Intron	INS	-	CCGA	CCGA	rs147793301	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230244588_230244589insCCGA	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472			polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)																---	---	---	---
DISC1	27185	broad.mit.edu	37	1	231942408	231942409	+	Intron	INS	-	CTCT	CTCT	rs147339198	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231942408_231942409insCTCT	uc001huz.2	+						TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pwr.1_Intron|DISC1_uc010pws.1_Intron|DISC1_uc010pwt.1_Intron|DISC1_uc010pwu.1_Intron|DISC1_uc010pwv.1_Intron|DISC1_uc010pww.1_Intron|DISC1_uc010pwx.1_Intron|DISC1_uc010pwy.1_Intron|DISC1_uc010pwz.1_Intron|DISC1_uc010pxa.1_Intron|DISC1_uc001huy.2_Intron|DISC1_uc010pxb.1_Intron|DISC1_uc010pxc.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132			disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	233077171	233077172	+	IGR	INS	-	AC	AC	rs151059249	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233077171_233077172insAC								KIAA1383 (131079 upstream) : C1orf57 (9198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	233649029	233649029	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233649029delC								KIAA1804 (128136 upstream) : KCNK1 (100721 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	233662064	233662065	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233662064_233662065insA								KIAA1804 (141171 upstream) : KCNK1 (87685 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234668009	234668012	+	5'Flank	DEL	AGAG	-	-	rs60571713		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234668009_234668012delAGAG	uc001hwe.2	-											Homo sapiens cDNA clone IMAGE:4816129.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	234684338	234684339	+	IGR	INS	-	TAAG	TAAG	rs149206922	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234684338_234684339insTAAG								TARBP1 (69489 upstream) : IRF2BP2 (55678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	235179967	235179967	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235179967delA								IRF2BP2 (434696 upstream) : TOMM20 (92693 downstream)																																			---	---	---	---
MTR	4548	broad.mit.edu	37	1	236970483	236970483	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236970483delT	uc001hyi.3	+						MTR_uc010pxv.1_Intron|MTR_uc010pxw.1_Intron|MTR_uc010pxx.1_Intron|MTR_uc010pxy.1_Intron	NM_000254	NP_000245			5-methyltetrahydrofolate-homocysteine						nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)													---	---	---	---
MTR	4548	broad.mit.edu	37	1	237004947	237004948	+	Intron	INS	-	TT	TT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237004947_237004948insTT	uc001hyi.3	+						MTR_uc010pxw.1_Intron|MTR_uc010pxx.1_Intron|MTR_uc010pxy.1_Intron	NM_000254	NP_000245			5-methyltetrahydrofolate-homocysteine						nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	237166713	237166713	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237166713delT								MTR (99433 upstream) : RYR2 (38989 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	239319424	239319424	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239319424delG								LOC339535 (670107 upstream) : CHRM3 (230441 downstream)																																			---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240618143	240618147	+	Intron	DEL	AATTC	-	-	rs66770323		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240618143_240618147delAATTC	uc010pyd.1	+						FMN2_uc010pye.1_Intron|FMN2_uc010pyg.1_Intron|FMN2_uc001hyr.2_5'Flank	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
RGS7	6000	broad.mit.edu	37	1	241031418	241031421	+	Intron	DEL	GAAA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241031418_241031421delGAAA	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron|RGS7_uc001hyt.2_Intron	NM_002924	NP_002915			regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)															---	---	---	---
WDR64	128025	broad.mit.edu	37	1	241838340	241838341	+	Intron	INS	-	C	C	rs140435520	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241838340_241838341insC	uc001hze.1	+											RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)															---	---	---	---
AKT3	10000	broad.mit.edu	37	1	244000744	244000744	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244000744delT	uc001iab.1	-						AKT3_uc001hzz.1_Intron	NM_005465	NP_005456			AKT3 kinase isoform 1						signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)															---	---	---	---
C1orf101	257044	broad.mit.edu	37	1	244770268	244770268	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244770268delG	uc001iam.2	+						C1orf101_uc001iak.1_Intron|C1orf101_uc001ial.2_Intron|C1orf101_uc010pym.1_Intron|C1orf101_uc010pyn.1_Intron	NM_001130957	NP_001124429			hypothetical protein LOC257044 isoform 1							integral to membrane				ovary(1)|breast(1)	2	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)															---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245830611	245830611	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245830611delG	uc001ibf.1	+						KIF26B_uc001ibg.1_Intron|KIF26B_uc001ibh.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
SMYD3	64754	broad.mit.edu	37	1	245988158	245988159	+	Intron	INS	-	A	A	rs34891255		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245988158_245988159insA	uc001ibl.2	-						SMYD3_uc001ibk.2_Intron|SMYD3_uc001ibi.2_Intron|SMYD3_uc001ibj.2_Intron	NM_022743	NP_073580			SET and MYND domain containing 3							cytoplasm|nucleus	histone-lysine N-methyltransferase activity|protein binding|zinc ion binding				0	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)														---	---	---	---
CNST	163882	broad.mit.edu	37	1	246820767	246820767	+	Intron	DEL	A	-	-	rs35451640		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246820767delA	uc001ibp.2	+							NM_152609	NP_689822			hypothetical protein LOC163882 isoform 1						positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0																		---	---	---	---
C1orf150	148823	broad.mit.edu	37	1	247684628	247684633	+	Intron	DEL	TCTCCC	-	-	rs71642417		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247684628_247684633delTCTCCC	uc009xgw.2	+						C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron					Homo sapiens cDNA FLJ41804 fis, clone NOVAR2000710.												0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	32006	32007	+	IGR	DEL	TA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32006_32007delTA								None (None upstream) : FAM110C (9602 downstream)																																			---	---	---	---
SNTG2	54221	broad.mit.edu	37	2	1083973	1083973	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1083973delC	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841			syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	1599220	1599221	+	IGR	INS	-	ACAC	ACAC	rs150120102	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1599220_1599221insACAC								TPO (52722 upstream) : PXDN (36439 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	2580595	2580596	+	IGR	DEL	AC	-	-	rs66515268		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2580595_2580596delAC								MYT1L (245550 upstream) : TSSC1 (612145 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	2647948	2647950	+	IGR	DEL	ACA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2647948_2647950delACA								MYT1L (312903 upstream) : TSSC1 (544791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	2910966	2910967	+	Intron	INS	-	T	T	rs144550035	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2910966_2910967insT	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	3001540	3001540	+	Intron	DEL	C	-	-	rs71386809		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3001540delC	uc002qxh.1	-											Homo sapiens cDNA FLJ37991 fis, clone CTONG2011765.																														---	---	---	---
TSSC1	7260	broad.mit.edu	37	2	3318418	3318419	+	Intron	DEL	TT	-	-	rs78553502		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3318418_3318419delTT	uc002qxj.2	-						TSSC1_uc002qxi.2_Intron	NM_003310	NP_003301			tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	5518009	5518009	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5518009delG								None (None upstream) : SOX11 (314790 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5876335	5876336	+	IGR	INS	-	TGTG	TGTG	rs142654585	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5876335_5876336insTGTG								SOX11 (34819 upstream) : LOC150622 (196483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	6299591	6299591	+	IGR	DEL	T	-	-	rs78895504		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6299591delT								LOC400940 (171227 upstream) : CMPK2 (680912 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	6301718	6301718	+	IGR	DEL	A	-	-	rs113559810		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6301718delA								LOC400940 (173354 upstream) : CMPK2 (678785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	6973334	6973345	+	IGR	DEL	GAAAGAGAAAGA	-	-	rs6146613	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6973334_6973345delGAAAGAGAAAGA								LOC400940 (844970 upstream) : CMPK2 (7158 downstream)																																			---	---	---	---
RNF144A	9781	broad.mit.edu	37	2	7146886	7146889	+	Intron	DEL	AGAC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7146886_7146889delAGAC	uc002qys.2	+						RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561			ring finger protein 144							Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	7194303	7194304	+	IGR	DEL	AG	-	-	rs140811973		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7194303_7194304delAG								RNF144A (9996 upstream) : LOC339788 (868254 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7338432	7338433	+	IGR	INS	-	CCAT	CCAT	rs142617260	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7338432_7338433insCCAT								RNF144A (154125 upstream) : LOC339788 (724125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7908031	7908032	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7908031_7908032delCA								RNF144A (723724 upstream) : LOC339788 (154526 downstream)																																			---	---	---	---
TAF1B	9014	broad.mit.edu	37	2	10045836	10045837	+	Intron	INS	-	A	A	rs142462943	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10045836_10045837insA	uc002qzz.2	+						TAF1B_uc010exc.2_Intron|TAF1B_uc002qzy.3_Intron|TAF1B_uc010yja.1_Intron|TAF1B_uc010exd.2_Intron	NM_005680	NP_005671			TBP-associated factor 1B						termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|breast(1)|pancreas(1)	3	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
C2orf48	348738	broad.mit.edu	37	2	10295728	10295728	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10295728delT	uc002rai.1	+							NM_182626	NP_872432			hypothetical protein LOC348738												0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)														---	---	---	---
C2orf48	348738	broad.mit.edu	37	2	10325405	10325406	+	Intron	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10325405_10325406delGA	uc002rai.1	+							NM_182626	NP_872432			hypothetical protein LOC348738												0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)														---	---	---	---
NTSR2	23620	broad.mit.edu	37	2	11809587	11809587	+	Intron	DEL	C	-	-	rs7425038		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11809587delC	uc002rbq.3	-							NM_012344	NP_036476			neurotensin receptor 2						sensory perception	integral to plasma membrane					0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)													---	---	---	---
LPIN1	23175	broad.mit.edu	37	2	11857824	11857824	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11857824delT	uc010yjm.1	+							NM_145693	NP_663731			lipin 1						fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	13310627	13310627	+	IGR	DEL	C	-	-	rs67482140		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:13310627delC								TRIB2 (427771 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	14513417	14513417	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14513417delG	uc002rby.2	-											Homo sapiens cDNA clone IMAGE:5263003.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	15261599	15261611	+	IGR	DEL	AAACACTAGGACA	-	-	rs72045890		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15261599_15261611delAAACACTAGGACA								FAM84A (470666 upstream) : NBAS (45421 downstream)																																			---	---	---	---
NBAS	51594	broad.mit.edu	37	2	15483096	15483097	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15483096_15483097insA	uc002rcc.1	-						NBAS_uc010exl.1_Intron|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993			neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	16194479	16194479	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16194479delG								MYCN (107351 upstream) : FAM49A (539422 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16551311	16551311	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16551311delT								MYCN (464183 upstream) : FAM49A (182590 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16630134	16630135	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16630134_16630135insT								MYCN (543006 upstream) : FAM49A (103766 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	16654174	16654175	+	IGR	DEL	TG	-	-	rs34840662		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16654174_16654175delTG								MYCN (567046 upstream) : FAM49A (79726 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	17226498	17226499	+	IGR	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17226498_17226499delGA								FAM49A (379402 upstream) : RAD51AP2 (465487 downstream)																																			---	---	---	---
SMC6	79677	broad.mit.edu	37	2	17858609	17858609	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17858609delC	uc002rco.2	-						SMC6_uc010exo.2_Intron|SMC6_uc002rcn.2_Intron	NM_001142286	NP_001135758			SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	18050163	18050163	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18050163delT								MSGN1 (51797 upstream) : KCNS3 (8951 downstream)																																			---	---	---	---
PUM2	23369	broad.mit.edu	37	2	20532170	20532170	+	Intron	DEL	A	-	-	rs34916773		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20532170delA	uc002rdu.1	-						PUM2_uc010yjz.1_Intron	NM_015317	NP_056132			pumilio homolog 2						regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
C2orf43	60526	broad.mit.edu	37	2	21018340	21018341	+	Intron	INS	-	G	G	rs35793008		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21018340_21018341insG	uc002rec.2	-						C2orf43_uc002rea.1_Intron|C2orf43_uc002reb.1_Intron|C2orf43_uc010yka.1_Intron|C2orf43_uc010ykb.1_Intron|C2orf43_uc010ykc.1_Intron|C2orf43_uc010ykd.1_Intron|C2orf43_uc010yke.1_Intron|C2orf43_uc010ykf.1_Intron	NM_021925	NP_068744			hypothetical protein LOC60526												0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	22332378	22332379	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22332378_22332379insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	22833657	22833658	+	IGR	DEL	TT	-	-	rs76266785		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22833657_22833658delTT								None (None upstream) : KLHL29 (921797 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23389435	23389435	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23389435delG								None (None upstream) : KLHL29 (366020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23684846	23684847	+	IGR	INS	-	TTTT	TTTT	rs73921825		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23684846_23684847insTTTT								None (None upstream) : KLHL29 (70608 downstream)																																			---	---	---	---
ATAD2B	54454	broad.mit.edu	37	2	24022676	24022676	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24022676delA	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc002rei.3_Intron|ATAD2B_uc002rej.3_Intron	NM_017552	NP_060022			ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
NCOA1	8648	broad.mit.edu	37	2	24976239	24976239	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24976239delA	uc002rfk.2	+						NCOA1_uc010eye.2_Intron|NCOA1_uc002rfi.2_Intron|NCOA1_uc002rfj.2_Intron|NCOA1_uc002rfl.2_Intron|NCOA1_uc010eyf.2_Intron	NM_003743	NP_003734			nuclear receptor coactivator 1 isoform 1										PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							T	PAX3	alveolar rhadomyosarcoma								---	---	---	---
ADCY3	109	broad.mit.edu	37	2	25043917	25043917	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25043917delC	uc002rfs.3	-						ADCY3_uc002rfr.3_Intron|ADCY3_uc010ykm.1_Intron	NM_004036	NP_004027			adenylate cyclase 3						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)																	---	---	---	---
DNMT3A	1788	broad.mit.edu	37	2	25513190	25513191	+	Intron	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25513190_25513191delTT	uc002rgc.2	-						DNMT3A_uc002rgd.2_Intron|DNMT3A_uc010eyi.2_Intron|DNMT3A_uc002rge.2_Intron|DNMT3A_uc002rgf.2_Intron	NM_022552	NP_072046			DNA cytosine methyltransferase 3 alpha isoform						regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							Mis|F|N|S		AML								---	---	---	---
Unknown	0	broad.mit.edu	37	2	27054054	27054054	+	IGR	DEL	T	-	-	rs112435752		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27054054delT								CENPA (30122 upstream) : DPYSL5 (16915 downstream)																																			---	---	---	---
PPM1G	5496	broad.mit.edu	37	2	27620180	27620182	+	Intron	DEL	AAG	-	-	rs143518117		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27620180_27620182delAAG	uc002rkl.2	-						PPM1G_uc002rkm.2_Intron	NM_002707	NP_002698			protein phosphatase 1G						cell cycle arrest|protein dephosphorylation	cytoplasm|nucleus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	28582130	28582130	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28582130delG								BRE (20365 upstream) : FOSL2 (33649 downstream)																																			---	---	---	---
ALK	238	broad.mit.edu	37	2	29448023	29448023	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29448023delG	uc002rmy.2	-						ALK_uc010ymo.1_5'Flank	NM_004304	NP_004295			anaplastic lymphoma kinase precursor						protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	2	30193567	30193567	+	IGR	DEL	T	-	-	rs11307957		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30193567delT								ALK (49135 upstream) : YPEL5 (176183 downstream)																																			---	---	---	---
GALNT14	79623	broad.mit.edu	37	2	31199488	31199489	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31199488_31199489delTG	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron|GALNT14_uc010ezo.1_Intron|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848			N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
GALNT14	79623	broad.mit.edu	37	2	31208016	31208017	+	Intron	INS	-	TGAA	TGAA	rs138304703	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31208016_31208017insTGAA	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron|GALNT14_uc010ezo.1_Intron|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848			N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	31539127	31539128	+	IGR	INS	-	AAAACAAAACA	AAAACAAAACA	rs147757167	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31539127_31539128insAAAACAAAACA								EHD3 (47868 upstream) : XDH (18060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	32078880	32078880	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32078880delA								SRD5A2 (272840 upstream) : MEMO1 (14016 downstream)																																			---	---	---	---
BIRC6	57448	broad.mit.edu	37	2	32782014	32782015	+	Intron	INS	-	AAAG	AAAG	rs143735249	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32782014_32782015insAAAG	uc010ezu.2	+							NM_016252	NP_057336			baculoviral IAP repeat-containing 6						anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	33793126	33793126	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33793126delA								RASGRP3 (3329 upstream) : FAM98A (15603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	35467221	35467222	+	IGR	INS	-	TAAAAG	TAAAAG	rs145608853	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35467221_35467222insTAAAAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	36001503	36001504	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36001503_36001504insT								None (None upstream) : CRIM1 (581893 downstream)																																			---	---	---	---
STRN	6801	broad.mit.edu	37	2	37174045	37174046	+	Intron	INS	-	T	T	rs78079149		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37174045_37174046insT	uc002rpn.2	-						STRN_uc010ezx.2_Intron	NM_003162	NP_003153			striatin, calmodulin binding protein						dendrite development|locomotory behavior|negative regulation of cell proliferation|tight junction assembly|Wnt receptor signaling pathway	cytoplasm|dendritic spine|neuronal cell body|postsynaptic density|postsynaptic membrane|tight junction	armadillo repeat domain binding|calmodulin binding|estrogen receptor binding|protein complex binding|protein phosphatase 2A binding			skin(1)	1		Ovarian(717;0.0129)|all_hematologic(82;0.21)																---	---	---	---
PRKD3	23683	broad.mit.edu	37	2	37506664	37506665	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37506664_37506665insA	uc002rqd.2	-						PRKD3_uc002rqe.1_5'Flank|PRKD3_uc002rqf.1_Intron	NM_005813	NP_005804			protein kinase D3						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction	cytoplasm|membrane|nucleus	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(2)|ovary(1)|central_nervous_system(1)	4		all_hematologic(82;0.21)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	38000709	38000710	+	IGR	DEL	CC	-	-	rs66510206		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38000709_38000710delCC								CDC42EP3 (101383 upstream) : FAM82A1 (151752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	41264387	41264387	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41264387delA								SLC8A1 (524812 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	41622887	41622887	+	IGR	DEL	G	-	-	rs115092009	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41622887delG								SLC8A1 (883312 upstream) : PKDCC (652274 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	41876509	41876509	+	IGR	DEL	A	-	-	rs34771791		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41876509delA								None (None upstream) : PKDCC (398652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42088559	42088559	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42088559delA								None (None upstream) : PKDCC (186602 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	42103619	42103619	+	5'Flank	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42103619delT	uc002rse.2	+						uc010fao.1_5'Flank					Homo sapiens cDNA FLJ44450 fis, clone UTERU2022981.																														---	---	---	---
MTA3	57504	broad.mit.edu	37	2	42758907	42758907	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42758907delT	uc002rso.1	+							NM_020744	NP_065795			metastasis associated 1 family, member 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2																		---	---	---	---
C2orf34	79823	broad.mit.edu	37	2	44913532	44913532	+	Intron	DEL	A	-	-	rs35238467		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44913532delA	uc002rum.2	+							NM_024766	NP_079042			hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
PRKCE	5581	broad.mit.edu	37	2	46072515	46072515	+	Intron	DEL	T	-	-	rs5830874		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46072515delT	uc002rut.2	+						PRKCE_uc002ruu.2_Intron	NM_005400	NP_005391			protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)															---	---	---	---
PRKCE	5581	broad.mit.edu	37	2	46301567	46301568	+	Intron	DEL	CC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46301567_46301568delCC	uc002rut.2	+							NM_005400	NP_005391			protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	46680417	46680418	+	IGR	INS	-	A	A	rs150001581	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46680417_46680418insA								EPAS1 (66582 upstream) : LOC388946 (26286 downstream)																																			---	---	---	---
MSH2	4436	broad.mit.edu	37	2	47875623	47875624	+	Intron	DEL	AA	-	-	rs67472391		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47875623_47875624delAA	uc002rvz.2	+							NM_000251	NP_000242			mutS homolog 2						B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding			large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)					D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	2	49936465	49936466	+	IGR	INS	-	TG	TG	rs142742661	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49936465_49936466insTG								FSHR (554835 upstream) : NRXN1 (209178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	50084235	50084235	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50084235delA								FSHR (702605 upstream) : NRXN1 (61409 downstream)																																			---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50417997	50417997	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50417997delT	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron	NM_138735	NP_620072			neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	51661543	51661543	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51661543delA								NRXN1 (401869 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	51997074	51997074	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51997074delG								NRXN1 (737400 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	52100716	52100719	+	IGR	DEL	ACAC	-	-	rs72383151		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52100716_52100719delACAC								NRXN1 (841042 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	52788201	52788202	+	IGR	INS	-	T	T	rs140304091	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:52788201_52788202insT								None (None upstream) : None (None downstream)																																			---	---	---	---
CCDC88A	55704	broad.mit.edu	37	2	55621261	55621261	+	Intron	DEL	A	-	-	rs141527355		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55621261delA	uc002ryv.2	-						CCDC88A_uc010yoz.1_Intron|CCDC88A_uc010ypa.1_Intron	NM_001135597	NP_001129069			coiled-coil domain containing 88A isoform 1						activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	58492498	58492498	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58492498delC								FANCL (23983 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	59224367	59224368	+	Intron	DEL	GA	-	-	rs1024767	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59224367_59224368delGA	uc002rzy.2	+						uc002rzz.2_Intron					Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	59526300	59526301	+	IGR	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59526300_59526301delTC								None (None upstream) : None (None downstream)																																			---	---	---	---
USP34	9736	broad.mit.edu	37	2	61638516	61638516	+	Intron	DEL	A	-	-	rs35518324		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61638516delA	uc002sbe.2	-							NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	61826229	61826230	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61826229_61826230insA								XPO1 (60811 upstream) : FAM161A (225755 downstream)																																			---	---	---	---
COMMD1	150684	broad.mit.edu	37	2	62181822	62181823	+	Intron	INS	-	T	T	rs76665085		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62181822_62181823insT	uc002sbp.2	+							NM_152516	NP_689729			MURR1						copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity			ovary(1)	1	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)															---	---	---	---
COMMD1	150684	broad.mit.edu	37	2	62328755	62328756	+	Intron	DEL	TA	-	-	rs66732767	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62328755_62328756delTA	uc002sbp.2	+						uc002sbr.2_Intron	NM_152516	NP_689729			MURR1						copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity			ovary(1)	1	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	62489506	62489507	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62489506_62489507insT								B3GNT2 (37642 upstream) : TMEM17 (237849 downstream)																																			---	---	---	---
EHBP1	23301	broad.mit.edu	37	2	62957828	62957831	+	Intron	DEL	AGAC	-	-	rs56754146		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62957828_62957831delAGAC	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc010fcq.1_Intron|EHBP1_uc002sbx.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron|EHBP1_uc002sca.2_Intron	NM_015252	NP_056067			EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)											Hereditary_Prostate_Cancer				---	---	---	---
Unknown	0	broad.mit.edu	37	2	63885801	63885801	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63885801delT								LOC388955 (35642 upstream) : UGP2 (182297 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	65116072	65116074	+	IGR	DEL	CCT	-	-	rs142836571		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65116072_65116074delCCT								SERTAD2 (235026 upstream) : SLC1A4 (99505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	66528680	66528681	+	IGR	DEL	AA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66528680_66528681delAA								SPRED2 (869024 upstream) : MEIS1 (133851 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	67826646	67826647	+	IGR	INS	-	T	T	rs138518531		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67826646_67826647insT								ETAA1 (189113 upstream) : C1D (442686 downstream)																																			---	---	---	---
CNRIP1	25927	broad.mit.edu	37	2	68550077	68550078	+	5'Flank	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68550077_68550078insA	uc002sek.3	-						CNRIP1_uc002sej.3_5'Flank	NM_015463	NP_056278			cannabinoid receptor interacting protein 1								protein binding			liver(1)	1																		---	---	---	---
APLF	200558	broad.mit.edu	37	2	68711824	68711824	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68711824delA	uc002sep.2	+						APLF_uc010fdf.2_Intron	NM_173545	NP_775816			aprataxin and PNKP like factor						double-strand break repair|single strand break repair	cytosol|nucleus	3'-5' exonuclease activity|DNA-(apurinic or apyrimidinic site) lyase activity|endodeoxyribonuclease activity|metal ion binding|nucleotide binding|protein binding			ovary(2)	2																		---	---	---	---
GFPT1	2673	broad.mit.edu	37	2	69561493	69561493	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69561493delT	uc002sfh.2	-							NM_002056	NP_002047			glucosamine-fructose-6-phosphate						dolichol-linked oligosaccharide biosynthetic process|energy reserve metabolic process|fructose 6-phosphate metabolic process|glutamine metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	glutamine-fructose-6-phosphate transaminase (isomerizing) activity|sugar binding			skin(1)	1																		---	---	---	---
NFU1	27247	broad.mit.edu	37	2	69627009	69627009	+	Intron	DEL	T	-	-	rs68065411		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69627009delT	uc002sfk.2	-						NFU1_uc002sfj.2_Intron|NFU1_uc002sfl.2_Intron|NFU1_uc002sfm.2_Intron|NFU1_uc010fdi.2_Intron	NM_001002755	NP_001002755			HIRA interacting protein 5 isoform 2						iron-sulfur cluster assembly	cytosol|mitochondrion|nucleus	4 iron, 4 sulfur cluster binding|iron ion binding|protein binding				0																		---	---	---	---
OR7E91P	79315	broad.mit.edu	37	2	71248792	71248792	+	5'Flank	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71248792delG	uc002sho.2	+						OR7E91P_uc010fdz.2_5'Flank	NR_002185				Homo sapiens olfactory receptor, family 7, subfamily E, member 91 pseudogene, mRNA (cDNA clone IMAGE:3996998).												0																		---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71845697	71845698	+	Intron	DEL	TT	-	-	rs142924504		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71845697_71845698delTT	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485			dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71845734	71845735	+	Intron	INS	-	GTGT	GTGT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71845734_71845735insGTGT	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485			dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71904059	71904060	+	Intron	INS	-	TGTG	TGTG	rs142417673	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71904059_71904060insTGTG	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485			dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	72098488	72098489	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72098488_72098489insA								DYSF (184596 upstream) : CYP26B1 (257878 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	72267860	72267860	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72267860delA								DYSF (353968 upstream) : CYP26B1 (88507 downstream)																																			---	---	---	---
CYP26B1	56603	broad.mit.edu	37	2	72368381	72368382	+	Intron	INS	-	T	T	rs3835743		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72368381_72368382insT	uc002sih.1	-						CYP26B1_uc010yra.1_Intron|CYP26B1_uc010yrb.1_Intron	NM_019885	NP_063938			cytochrome P450, family 26, subfamily b,						cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			skin(2)	2																		---	---	---	---
EXOC6B	23233	broad.mit.edu	37	2	72620190	72620191	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72620190_72620191insA	uc010fep.2	-							NM_015189	NP_056004			SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2																		---	---	---	---
EXOC6B	23233	broad.mit.edu	37	2	72745613	72745616	+	Intron	DEL	GTGT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72745613_72745616delGTGT	uc010fep.2	-						EXOC6B_uc002sij.2_Intron	NM_015189	NP_056004			SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2																		---	---	---	---
ALMS1	7840	broad.mit.edu	37	2	73804525	73804526	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73804525_73804526insT	uc002sje.1	+						ALMS1_uc002sjf.1_Intron|ALMS1_uc002sjh.1_Intron	NM_015120	NP_055935			Alstrom syndrome 1						G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9																		---	---	---	---
ACTG2	72	broad.mit.edu	37	2	74121833	74121856	+	Intron	DEL	AGCTTGGTCCTGAAGTAAGGACCA	-	-	rs138144149		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74121833_74121856delAGCTTGGTCCTGAAGTAAGGACCA	uc002sjw.2	+						ACTG2_uc010fex.1_Intron|ACTG2_uc010fey.2_Intron|ACTG2_uc010yrn.1_Intron	NM_001615	NP_001606			actin, gamma 2 propeptide						muscle contraction	cytoskeleton|cytosol	ATP binding				0																		---	---	---	---
ACTG2	72	broad.mit.edu	37	2	74129168	74129169	+	Intron	INS	-	TG	TG	rs12105227	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74129168_74129169insTG	uc002sjw.2	+						ACTG2_uc010fex.1_Intron|ACTG2_uc010fey.2_Intron|ACTG2_uc010yrn.1_Intron	NM_001615	NP_001606			actin, gamma 2 propeptide						muscle contraction	cytoskeleton|cytosol	ATP binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	75001009	75001009	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75001009delA								SEMA4F (91824 upstream) : HK2 (58773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	75560921	75560921	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75560921delA								TACR1 (134276 upstream) : FAM176A (158523 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	76566965	76566965	+	IGR	DEL	C	-	-	rs58599343		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76566965delC								C2orf3 (628854 upstream) : LRRTM4 (407893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	76806185	76806185	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76806185delG								C2orf3 (868074 upstream) : LRRTM4 (168673 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	78265754	78265754	+	Intron	DEL	A	-	-	rs79420087		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78265754delA	uc002snu.3	-											Homo sapiens cDNA clone IMAGE:4816654.																														---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	79829478	79829478	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79829478delA	uc010yse.1	+						CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	80073113	80073114	+	Intron	INS	-	A	A	rs141112889	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80073113_80073114insA	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	83878910	83878913	+	IGR	DEL	TGTG	-	-	rs142287438		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83878910_83878913delTGTG								None (None upstream) : FUNDC2P2 (638893 downstream)																																			---	---	---	---
ATOH8	84913	broad.mit.edu	37	2	85998218	85998218	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85998218delG	uc002sqn.2	+						ATOH8_uc002sqm.3_Intron	NM_032827	NP_116216			atonal homolog 8						cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0																		---	---	---	---
IMMT	10989	broad.mit.edu	37	2	86400703	86400704	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86400703_86400704insA	uc002sqz.3	-						IMMT_uc002sqy.3_5'Flank|IMMT_uc002srb.3_Intron|IMMT_uc002sra.3_Intron|IMMT_uc010ytd.1_Intron|IMMT_uc010yte.1_Intron|IMMT_uc002src.1_5'Flank|IMMT_uc002srd.2_Intron|IMMT_uc002sre.3_Intron|IMMT_uc010ytf.1_Intron|IMMT_uc010fgs.1_Intron	NM_006839	NP_006830			inner membrane protein, mitochondrial isoform 1							integral to mitochondrial inner membrane	protein binding			skin(1)	1																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87561278	87561279	+	Intron	INS	-	AAC	AAC			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87561278_87561279insAAC	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87593349	87593351	+	Intron	DEL	ATG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87593349_87593351delATG	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87593377	87593388	+	Intron	DEL	ATGAAAAATGAT	-	-	rs148398193		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87593377_87593388delATGAAAAATGAT	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	88279395	88279395	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88279395delA								RMND5A (240629 upstream) : KRCC1 (47329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	88316232	88316232	+	IGR	DEL	T	-	-	rs67056958		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88316232delT								RMND5A (277466 upstream) : KRCC1 (10492 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	88623831	88623831	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88623831delA								THNSL2 (137686 upstream) : FOXI3 (123895 downstream)																																			---	---	---	---
FLJ40330	645784	broad.mit.edu	37	2	89074228	89074229	+	Intron	INS	-	TGG	TGG	rs5832738		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89074228_89074229insTGG	uc002stf.2	+						FLJ40330_uc010fhf.2_Intron|FLJ40330_uc010fhg.2_Intron|FLJ40330_uc010fhh.2_Intron					Homo sapiens mRNA; cDNA DKFZp434J1630 (from clone DKFZp434J1630).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	90476425	90476437	+	IGR	DEL	TGGCTGGCTGGCC	-	-	rs146133358	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90476425_90476437delTGGCTGGCTGGCC								None (None upstream) : None (None downstream)																																			---	---	---	---
LOC654342	654342	broad.mit.edu	37	2	91842719	91842720	+	Intron	INS	-	T	T	rs146839621		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91842719_91842720insT	uc002sts.3	-						LOC654342_uc002stt.2_Intron|LOC654342_uc010yub.1_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	91857931	91857931	+	IGR	DEL	T	-	-	rs1818340		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91857931delT								LOC654342 (9956 upstream) : GGT8P (105437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92178561	92178563	+	IGR	DEL	ATG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92178561_92178563delATG								FKSG73 (48067 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92241572	92241572	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92241572delC								FKSG73 (111078 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92275980	92275981	+	IGR	INS	-	A	A	rs75160116		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92275980_92275981insA								FKSG73 (145486 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	96598418	96598419	+	Intron	DEL	TG	-	-	rs112122851		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96598418_96598419delTG	uc002sva.1	-						uc010yug.1_Intron					Homo sapiens cDNA FLJ41632 fis, clone FCBBF1000297, highly  similar to Human protein immuno-reactive with anti-PTH polyclonal antibodies mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	96777540	96777541	+	IGR	INS	-	G	G	rs149117590	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96777540_96777541insG								GPAT2 (75818 upstream) : ADRA2B (1085 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	97244855	97244856	+	IGR	INS	-	A	A	rs139315060	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97244855_97244856insA								ARID5A (26485 upstream) : KIAA1310 (14060 downstream)																																			---	---	---	---
FER1L5	90342	broad.mit.edu	37	2	97310237	97310238	+	Intron	DEL	AG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97310237_97310238delAG	uc010fia.2	+						FER1L5_uc002swr.2_Intron	NM_001113382	NP_001106853			fer-1-like 5 isoform 2							integral to membrane				ovary(1)	1																		---	---	---	---
FAM178B	51252	broad.mit.edu	37	2	97609498	97609498	+	Intron	DEL	C	-	-	rs11308714		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97609498delC	uc002sxl.3	-						FAM178B_uc002sxk.3_Intron	NM_001122646	NP_001116118			hypothetical protein LOC51252 isoform A												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	97721279	97721279	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97721279delC								FAM178B (68978 upstream) : FAHD2B (28045 downstream)																																			---	---	---	---
ANKRD36	375248	broad.mit.edu	37	2	97829004	97829011	+	Intron	DEL	AAAAATAA	-	-	rs113581951		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97829004_97829011delAAAAATAA	uc010yva.1	+						ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron|ANKRD36_uc002sxq.1_RNA	NM_001164315	NP_001157787			ankyrin repeat domain 36												0																		---	---	---	---
TMEM131	23505	broad.mit.edu	37	2	98382336	98382336	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98382336delA	uc002syh.3	-							NM_015348	NP_056163			RW1 protein							integral to membrane				ovary(4)|central_nervous_system(2)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	98648351	98648351	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98648351delG								TMEM131 (35997 upstream) : VWA3B (55244 downstream)																																			---	---	---	---
MGAT4A	11320	broad.mit.edu	37	2	99265375	99265376	+	Intron	INS	-	G	G	rs72545187		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99265375_99265376insG	uc002sze.2	-						MGAT4A_uc010yvm.1_Intron|MGAT4A_uc010fil.2_Intron	NM_012214	NP_036346			alpha-1,3-mannosyl-glycoprotein						N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			skin(1)	1																		---	---	---	---
C2orf55	343990	broad.mit.edu	37	2	99452997	99452997	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99452997delA	uc002szf.1	-							NM_207362	NP_997245			hypothetical protein LOC343990												0																		---	---	---	---
LYG1	129530	broad.mit.edu	37	2	99914183	99914184	+	Intron	INS	-	T	T	rs146611019	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99914183_99914184insT	uc002szy.2	-						MRPL30_uc002szl.1_Intron|LYG1_uc010yvo.1_Intron	NM_174898	NP_777558			lysozyme g-like protein 1 precursor						cell wall macromolecule catabolic process|peptidoglycan catabolic process	extracellular region	lysozyme activity				0																		---	---	---	---
REV1	51455	broad.mit.edu	37	2	100060311	100060311	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100060311delT	uc002tad.2	-						REV1_uc002tac.2_Intron|REV1_uc002tae.1_Intron	NM_016316	NP_057400			REV1-like isoform 1						DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2													DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
AFF3	3899	broad.mit.edu	37	2	100289512	100289512	+	Intron	DEL	T	-	-	rs149522615		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100289512delT	uc002tag.2	-						AFF3_uc002taf.2_Intron|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Intron|AFF3_uc002tah.1_Intron	NM_002285	NP_002276			AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6																		---	---	---	---
NPAS2	4862	broad.mit.edu	37	2	101455741	101455741	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101455741delC	uc002tap.1	+						NPAS2_uc010yvt.1_Intron	NM_002518	NP_002509			neuronal PAS domain protein 2						central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	102100416	102100416	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102100416delT								RFX8 (9251 upstream) : MAP4K4 (214072 downstream)																																			---	---	---	---
MAP4K4	9448	broad.mit.edu	37	2	102479998	102479998	+	Intron	DEL	A	-	-	rs2072205	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102479998delA	uc002tbg.2	+						MAP4K4_uc002tbc.2_Intron|MAP4K4_uc002tbd.2_Intron|MAP4K4_uc002tbe.2_Intron|MAP4K4_uc002tbf.2_Intron|MAP4K4_uc010yvy.1_Intron|MAP4K4_uc002tbh.2_Intron|MAP4K4_uc002tbi.2_Intron|MAP4K4_uc010yvz.1_Intron|MAP4K4_uc002tbk.2_Intron|MAP4K4_uc002tbl.2_5'Flank	NM_145687	NP_663720			mitogen-activated protein kinase kinase kinase						intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
IL18RAP	8807	broad.mit.edu	37	2	103054177	103054177	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103054177delT	uc002tbx.2	+						IL18RAP_uc010fiz.2_Intron	NM_003853	NP_003844			interleukin 18 receptor accessory protein						cell surface receptor linked signaling pathway|inflammatory response|innate immune response	integral to membrane	transmembrane receptor activity			skin(3)|ovary(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	104028549	104028550	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104028549_104028550delCA								TMEM182 (594413 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	104065450	104065450	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104065450delA								TMEM182 (631314 upstream) : LOC150568 (985355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	104372054	104372054	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104372054delA								TMEM182 (937918 upstream) : LOC150568 (678751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	104690804	104690805	+	IGR	INS	-	AATA	AATA	rs140638806	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:104690804_104690805insAATA								None (None upstream) : LOC150568 (360000 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105047545	105047546	+	IGR	DEL	TG	-	-	rs72083884		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105047545_105047546delTG								None (None upstream) : LOC150568 (3259 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105393573	105393574	+	IGR	INS	-	T	T	rs144022137	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105393573_105393574insT								LOC150568 (264359 upstream) : POU3F3 (78395 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	105394404	105394405	+	IGR	INS	-	A	A	rs150809299	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105394404_105394405insA								LOC150568 (265190 upstream) : POU3F3 (77564 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	106152549	106152550	+	IGR	INS	-	CC	CC	rs139805548	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106152549_106152550insCC								FHL2 (97319 upstream) : NCK2 (208804 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	106269967	106269967	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106269967delG								FHL2 (214737 upstream) : NCK2 (91387 downstream)																																			---	---	---	---
UXS1	80146	broad.mit.edu	37	2	106743197	106743197	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106743197delC	uc002tdm.2	-						UXS1_uc002tdl.2_Intron|UXS1_uc002tdn.2_Intron|UXS1_uc002tdo.2_Intron|UXS1_uc010ywh.1_Intron	NM_025076	NP_079352			UDP-glucuronate decarboxylase 1						cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	107128931	107128932	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107128931_107128932delGT								RGPD3 (44130 upstream) : ST6GAL2 (289126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	107327498	107327499	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107327498_107327499delTG								RGPD3 (242697 upstream) : ST6GAL2 (90559 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	107374263	107374264	+	IGR	INS	-	TC	TC	rs142317157	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107374263_107374264insTC								RGPD3 (289462 upstream) : ST6GAL2 (43794 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	107559809	107559809	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107559809delA								ST6GAL2 (56246 upstream) : LOC729121 (879711 downstream)																																			---	---	---	---
BUB1	699	broad.mit.edu	37	2	111409948	111409948	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111409948delT	uc002tgc.2	-						BUB1_uc010yxh.1_Intron|BUB1_uc010fkb.2_Intron	NM_004336	NP_004327			budding uninhibited by benzimidazoles 1						apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)														---	---	---	---
ACOXL	55289	broad.mit.edu	37	2	111713007	111713010	+	Intron	DEL	CTCT	-	-	rs112266435		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111713007_111713010delCTCT	uc002tgr.3	+						ACOXL_uc010fkc.2_Intron|ACOXL_uc010yxk.1_Intron	NM_001105516	NP_001098986			acyl-Coenzyme A oxidase-like 2						fatty acid beta-oxidation	peroxisome	acyl-CoA dehydrogenase activity|acyl-CoA oxidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	113214555	113214555	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113214555delC								RGPD8 (22493 upstream) : TTL (25188 downstream)																																			---	---	---	---
CBWD2	150472	broad.mit.edu	37	2	114217481	114217481	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114217481delA	uc002tju.2	+						CBWD2_uc010yxw.1_Intron|CBWD2_uc002tjv.2_Intron|CBWD2_uc010fkv.2_Intron	NM_172003	NP_742000			COBW domain-containing protein 2								ATP binding|protein binding				0																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	115898503	115898504	+	Intron	INS	-	A	A	rs150857057		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115898503_115898504insA	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	115956898	115956901	+	Intron	DEL	TGTA	-	-	rs140356228		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:115956898_115956901delTGTA	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	118514036	118514037	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118514036_118514037delTG								None (None upstream) : DDX18 (58218 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	118522800	118522800	+	IGR	DEL	A	-	-	rs35686869		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118522800delA								None (None upstream) : DDX18 (49455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119187911	119187912	+	IGR	INS	-	A	A	rs72840838	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119187911_119187912insA								INSIG2 (320315 upstream) : EN1 (411836 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119546029	119546030	+	IGR	DEL	AG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119546029_119546030delAG								INSIG2 (678433 upstream) : EN1 (53718 downstream)																																			---	---	---	---
PCDP1	200373	broad.mit.edu	37	2	120324132	120324132	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120324132delC	uc002tmb.2	+						PCDP1_uc010yyq.1_Intron	NM_001029996	NP_001025167			primary ciliary dyskinesia protein 1							cilium	calmodulin binding				0	Colorectal(110;0.196)																	---	---	---	---
EPB41L5	57669	broad.mit.edu	37	2	120853918	120853921	+	Intron	DEL	AAAT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120853918_120853921delAAAT	uc002tmg.2	+						EPB41L5_uc010flk.2_Intron|EPB41L5_uc010fll.2_Intron|EPB41L5_uc002tmh.3_Intron|EPB41L5_uc010flm.2_Intron	NM_020909	NP_065960			erythrocyte membrane protein band 4.1 like 5							cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1																		---	---	---	---
RALB	5899	broad.mit.edu	37	2	121019758	121019759	+	Intron	INS	-	G	G	rs141350543	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121019758_121019759insG	uc002tmk.2	+						RALB_uc010yys.1_Intron|RALB_uc002tml.2_Intron|RALB_uc002tmm.2_Intron|RALB_uc010yyt.1_Intron	NM_002881	NP_002872			v-ral simian leukemia viral oncogene homolog B						apoptosis|cell cycle|cytokinesis|nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of exocyst assembly|regulation of exocyst localization	cytosol|midbody|plasma membrane	GTP binding|GTPase activity|protein binding			lung(3)	3		Prostate(154;0.122)																---	---	---	---
CLASP1	23332	broad.mit.edu	37	2	122383674	122383675	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122383674_122383675insA	uc002tnc.2	-						CLASP1_uc010yyz.1_Intron|CLASP1_uc010yza.1_Intron|CLASP1_uc010yzb.1_Intron|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tng.1_Intron	NM_015282	NP_056097			CLIP-associating protein 1 isoform 1						axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	123358874	123358875	+	IGR	DEL	GT	-	-	rs71945972		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123358874_123358875delGT								TSN (833448 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	123633149	123633149	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123633149delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126241787	126241788	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126241787_126241788insT								CNTNAP5 (568926 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126844014	126844014	+	IGR	DEL	A	-	-	rs72068622		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126844014delA								None (None upstream) : GYPC (569670 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	126917543	126917543	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:126917543delA								None (None upstream) : GYPC (496141 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	127409770	127409770	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127409770delA								None (None upstream) : GYPC (3914 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	130280318	130280319	+	IGR	INS	-	TTTG	TTTG	rs141036511	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130280318_130280319insTTTG								None (None upstream) : LOC389033 (400116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	130574197	130574197	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130574197delT								None (None upstream) : LOC389033 (106238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	131541875	131541876	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131541875_131541876delAC								FAM123C (16168 upstream) : ARHGEF4 (130910 downstream)																																			---	---	---	---
LOC150786	150786	broad.mit.edu	37	2	132122120	132122120	+	5'Flank	DEL	C	-	-	rs5834289		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132122120delC	uc002tsr.2	-							NM_001077637	NP_001071105			RAB6C-like						protein transport|small GTPase mediated signal transduction		GTP binding				0				BRCA - Breast invasive adenocarcinoma(221;0.078)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	132531280	132531280	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132531280delG								C2orf27A (6303 upstream) : C2orf27B (21254 downstream)																																			---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133000118	133000118	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133000118delA	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133107763	133107764	+	IGR	INS	-	C	C	rs143923523	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133107763_133107764insC								NCRNA00164 (92221 upstream) : GPR39 (66383 downstream)																																			---	---	---	---
HNMT	3176	broad.mit.edu	37	2	138752776	138752776	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138752776delA	uc002tvc.2	+						HNMT_uc002tvf.2_Intron	NM_006895	NP_008826			histamine N-methyltransferase isoform 1						respiratory gaseous exchange	cytoplasm	histamine N-methyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	139401353	139401354	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139401353_139401354insT								SPOPL (70550 upstream) : NXPH2 (25375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	140235206	140235206	+	IGR	DEL	G	-	-	rs67668912		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140235206delG								NXPH2 (697395 upstream) : LRP1B (753790 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	140812601	140812602	+	IGR	INS	-	CA	CA	rs142997671	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140812601_140812602insCA								None (None upstream) : LRP1B (176394 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	147092626	147092627	+	IGR	INS	-	TT	TT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147092626_147092627insTT								None (None upstream) : PABPC1P2 (251998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	147886364	147886364	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:147886364delT								PABPC1P2 (537807 upstream) : ACVR2A (715722 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	151461791	151461791	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151461791delA								RND3 (117611 upstream) : RBM43 (642938 downstream)																																			---	---	---	---
NEB	4703	broad.mit.edu	37	2	152413293	152413294	+	Intron	INS	-	A	A	rs144700502	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152413293_152413294insA	uc010fnx.2	-						NEB_uc002txr.2_Intron	NM_004543	NP_004534			nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	157078518	157078519	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157078518_157078519insA	uc002tyw.2	-											Homo sapiens cDNA clone IMAGE:5209417.																														---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160303054	160303054	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160303054delA	uc002uao.2	-						BAZ2B_uc002uap.2_Intron|BAZ2B_uc002uas.1_Intron|BAZ2B_uc002uau.1_Intron|BAZ2B_uc002uaq.1_Intron|BAZ2B_uc002uat.3_Intron|BAZ2B_uc010fop.1_Intron	NM_013450	NP_038478			bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
LY75	4065	broad.mit.edu	37	2	160726954	160726955	+	Intron	INS	-	CC	CC	rs145218007	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160726954_160726955insCC	uc002ubc.3	-						LY75_uc002ubb.3_Intron|LY75_uc010fos.2_Intron	NM_002349	NP_002340			lymphocyte antigen 75 precursor						endocytosis|immune response|inflammatory response	integral to plasma membrane	receptor activity|sugar binding				0				COAD - Colon adenocarcinoma(177;0.132)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	165125690	165125692	+	IGR	DEL	CCA	-	-	rs150855682		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165125690_165125692delCCA								FIGN (533177 upstream) : GRB14 (223641 downstream)																																			---	---	---	---
SLC38A11	151258	broad.mit.edu	37	2	165780148	165780148	+	Intron	DEL	A	-	-	rs75890713		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165780148delA	uc002ucv.1	-						SLC38A11_uc002ucu.1_Intron|SLC38A11_uc002ucw.1_Intron	NM_173512	NP_775783			solute carrier family 38, member 11						amino acid transport|sodium ion transport	integral to membrane				ovary(1)	1																		---	---	---	---
SCN2A	6326	broad.mit.edu	37	2	166208457	166208457	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166208457delA	uc002udc.2	+						SCN2A_uc002udd.2_Intron|SCN2A_uc002ude.2_Intron	NM_001040142	NP_001035232			sodium channel, voltage-gated, type II, alpha						myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)													---	---	---	---
TTC21B	79809	broad.mit.edu	37	2	166769554	166769555	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166769554_166769555insT	uc002udk.2	-							NM_024753	NP_079029			tetratricopeptide repeat domain 21B							cilium axoneme|cytoplasm|cytoskeleton	binding			ovary(2)|pancreas(2)|breast(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	167520878	167520879	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167520878_167520879delCA								SCN7A (170161 upstream) : XIRP2 (224118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	168507778	168507785	+	IGR	DEL	GTGTGCGC	-	-	rs143066467	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168507778_168507785delGTGTGCGC								XIRP2 (391519 upstream) : B3GALT1 (167397 downstream)																																			---	---	---	---
LASS6	253782	broad.mit.edu	37	2	169592232	169592232	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169592232delA	uc002ueb.1	+						LASS6_uc002uec.1_Intron	NM_203463	NP_982288			longevity assurance homolog 6							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			skin(1)	1																		---	---	---	---
ABCB11	8647	broad.mit.edu	37	2	169825626	169825627	+	Intron	INS	-	A	A	rs143389472		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169825626_169825627insA	uc002ueo.1	-						ABCB11_uc010zda.1_Intron|ABCB11_uc010zdb.1_Intron	NM_003742	NP_003733			ATP-binding cassette, sub-family B (MDR/TAP),						bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	169913018	169913018	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169913018delA								ABCB11 (25185 upstream) : DHRS9 (8281 downstream)																																			---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170151164	170151165	+	In_Frame_Ins	INS	-	ACT	ACT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170151164_170151165insACT	uc002ues.2	-	5	696_697	c.483_484insAGT	c.(481-486)insAGT	p.161_162insS	LRP2_uc010zdf.1_In_Frame_Ins_p.161_162insS	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	161_162	LDL-receptor class A 4.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	170957502	170957502	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170957502delT								UBR3 (16865 upstream) : MYO3B (77153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	171832470	171832471	+	IGR	INS	-	CTGGACC	CTGGACC	rs144189347	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171832470_171832471insCTGGACC								GORASP2 (8831 upstream) : TLK1 (14862 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	172514007	172514010	+	IGR	DEL	AGGG	-	-	rs142890851	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172514007_172514010delAGGG								CYBRD1 (99364 upstream) : DYNC1I2 (29972 downstream)																																			---	---	---	---
ZAK	51776	broad.mit.edu	37	2	173949152	173949153	+	Intron	INS	-	A	A	rs75183680		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173949152_173949153insA	uc002uhz.2	+						ZAK_uc002uhx.2_Intron|ZAK_uc002uhy.2_Intron|ZAK_uc010zei.1_Intron	NM_016653	NP_057737			MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)															---	---	---	---
ZAK	51776	broad.mit.edu	37	2	174093543	174093544	+	Intron	INS	-	CTT	CTT	rs142200997	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174093543_174093544insCTT	uc002uhz.2	+						uc002uib.2_Intron	NM_016653	NP_057737			MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	174257615	174257615	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174257615delG								CDCA7 (23897 upstream) : SP3 (515644 downstream)																																			---	---	---	---
OLA1	29789	broad.mit.edu	37	2	175064467	175064470	+	Intron	DEL	TTCA	-	-	rs74487209		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175064467_175064470delTTCA	uc002uih.2	-						OLA1_uc002uii.2_Intron|OLA1_uc010fqq.2_Intron|OLA1_uc002uij.2_Intron|OLA1_uc002uik.2_Intron|OLA1_uc010fqr.2_Intron	NM_013341	NP_037473			Obg-like ATPase 1 isoform 1						ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2																		---	---	---	---
GPR155	151556	broad.mit.edu	37	2	175314863	175314863	+	Intron	DEL	A	-	-	rs71407118		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175314863delA	uc002uit.2	-						GPR155_uc002uiu.2_Intron|GPR155_uc002uiv.2_Intron|GPR155_uc010fqs.2_Intron	NM_001033045	NP_001028217			G protein-coupled receptor 155 isoform 9						intracellular signal transduction|transmembrane transport	integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	176597991	176597992	+	IGR	INS	-	T	T	rs143208391	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176597991_176597992insT								ATP5G3 (551501 upstream) : KIAA1715 (192418 downstream)																																			---	---	---	---
HOXD10	3236	broad.mit.edu	37	2	176982750	176982750	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176982750delG	uc002ukj.2	+							NM_002148	NP_002139			homeobox D10							nucleus	sequence-specific DNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	177452779	177452780	+	IGR	INS	-	AC	AC	rs68047741		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177452779_177452780insAC								MTX2 (250028 upstream) : MIR1246 (12928 downstream)																																			---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178678686	178678688	+	Intron	DEL	AGG	-	-	rs10534752		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178678686_178678688delAGG	uc002ulq.2	-						PDE11A_uc002ulp.2_Intron|PDE11A_uc002ulr.2_Intron|PDE11A_uc002uls.1_Intron|PDE11A_uc002ult.1_Intron|PDE11A_uc002ulu.1_Intron	NM_016953	NP_058649			phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178765494	178765495	+	Intron	INS	-	A	A	rs137961420	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178765494_178765495insA	uc002ulq.2	-						PDE11A_uc002ulr.2_Intron|PDE11A_uc002uls.1_Intron|PDE11A_uc002ult.1_Intron|PDE11A_uc002ulu.1_Intron	NM_016953	NP_058649			phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
OSBPL6	114880	broad.mit.edu	37	2	179208476	179208476	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179208476delA	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron|OSBPL6_uc002ulz.2_Intron|OSBPL6_uc002uma.2_Intron	NM_032523	NP_115912			oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	179926217	179926217	+	IGR	DEL	T	-	-	rs35345290		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179926217delT								CCDC141 (11431 upstream) : SESTD1 (40204 downstream)																																			---	---	---	---
UBE2E3	10477	broad.mit.edu	37	2	181883326	181883330	+	Intron	DEL	TTTTT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181883326_181883330delTTTTT	uc002unq.1	+						UBE2E3_uc002unr.1_Intron|UBE2E3_uc010fri.1_Intron	NM_182678	NP_872619			ubiquitin-conjugating enzyme E2E 3						protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|regulation of growth	cytoplasm|nucleolus	ATP binding|protein binding|ubiquitin-protein ligase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	182068757	182068757	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182068757delT	uc002uns.1	+											Homo sapiens cDNA FLJ43011 fis, clone BRTHA2015853.																														---	---	---	---
ITGA4	3676	broad.mit.edu	37	2	182382978	182382978	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182382978delG	uc002unu.2	+						ITGA4_uc010frj.1_Intron	NM_000885	NP_000876			integrin alpha 4 precursor						blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)													---	---	---	---
PDE1A	5136	broad.mit.edu	37	2	183357712	183357712	+	Intron	DEL	A	-	-	rs34670464		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183357712delA	uc002uos.2	-						PDE1A_uc010zfp.1_Intron|PDE1A_uc002uoq.1_Intron|PDE1A_uc010zfq.1_Intron|PDE1A_uc002uov.1_Intron	NM_001003683	NP_001003683			phosphodiesterase 1A isoform 2						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)															---	---	---	---
NCKAP1	10787	broad.mit.edu	37	2	183796035	183796036	+	Intron	DEL	AT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183796035_183796036delAT	uc002upc.2	-						NCKAP1_uc002upb.2_Intron	NM_013436	NP_038464			NCK-associated protein 1 isoform 1						apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	184387432	184387433	+	IGR	INS	-	T	T	rs139780945	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184387432_184387433insT								NUP35 (361025 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	184731108	184731109	+	IGR	INS	-	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184731108_184731109insG								NUP35 (704701 upstream) : ZNF804A (731984 downstream)																																			---	---	---	---
ZNF804A	91752	broad.mit.edu	37	2	185728282	185728282	+	Intron	DEL	A	-	-	rs72403729		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185728282delA	uc002uph.2	+							NM_194250	NP_919226			zinc finger protein 804A							intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	186480266	186480267	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186480266_186480267delTG								ZNF804A (676054 upstream) : ZC3H15 (870618 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	187448206	187448207	+	IGR	INS	-	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187448206_187448207insC								ZC3H15 (74121 upstream) : ITGAV (6583 downstream)																																			---	---	---	---
ITGAV	3685	broad.mit.edu	37	2	187499187	187499188	+	Intron	INS	-	A	A	rs150218431	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187499187_187499188insA	uc002upq.2	+						ITGAV_uc010frs.2_Intron|ITGAV_uc010zfv.1_Intron	NM_002210	NP_002201			integrin alpha-V isoform 1 precursor						angiogenesis|axon guidance|blood coagulation|cell-matrix adhesion|entry of bacterium into host cell|entry of symbiont into host cell by promotion of host phagocytosis|entry of virus into host cell|ERK1 and ERK2 cascade|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|positive regulation of cell adhesion|positive regulation of cell proliferation|regulation of apoptotic cell clearance	integrin complex	receptor activity|transforming growth factor beta binding			ovary(2)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)														---	---	---	---
FAM171B	165215	broad.mit.edu	37	2	187586617	187586618	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187586617_187586618insA	uc002ups.2	+						FAM171B_uc002upr.1_Intron	NM_177454	NP_803237			KIAA1946							integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	188450018	188450019	+	IGR	INS	-	A	A	rs55881028	byFrequency;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188450018_188450019insA								TFPI (30799 upstream) : GULP1 (706585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	193380611	193380612	+	IGR	INS	-	G	G	rs35486946		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193380611_193380612insG								TMEFF2 (320967 upstream) : PCGEM1 (233959 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	193457195	193457196	+	IGR	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193457195_193457196delCT								TMEFF2 (397551 upstream) : PCGEM1 (157375 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	196049177	196049178	+	IGR	INS	-	T	T	rs76379247		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196049177_196049178insT								None (None upstream) : SLC39A10 (472354 downstream)																																			---	---	---	---
FAM126B	285172	broad.mit.edu	37	2	201927376	201927376	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201927376delA	uc002uws.3	-						FAM126B_uc002uwu.2_Intron|FAM126B_uc002uwv.2_Intron|FAM126B_uc002uww.1_Intron	NM_173822	NP_776183			hypothetical protein LOC285172							intracellular				ovary(1)	1																		---	---	---	---
BMPR2	659	broad.mit.edu	37	2	203340983	203340984	+	Intron	INS	-	TG	TG	rs139880763	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203340983_203340984insTG	uc002uzf.3	+						BMPR2_uc010ftr.2_Intron	NM_001204	NP_001195			bone morphogenetic protein receptor type II						anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity			ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9																		---	---	---	---
NBEAL1	65065	broad.mit.edu	37	2	203916268	203916268	+	Intron	DEL	A	-	-	rs11305453		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203916268delA	uc002uzt.3	+						NBEAL1_uc002uzq.3_Intron|NBEAL1_uc010zid.1_Intron|NBEAL1_uc010zie.1_Intron	NM_001114132	NP_001107604			neurobeachin-like 1 isoform 3								binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	205125223	205125223	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205125223delT								ICOS (298927 upstream) : PARD3B (285293 downstream)																																			---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	205514941	205514941	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205514941delC	uc002var.1	+						PARD3B_uc010fub.1_Intron|PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
PARD3B	117583	broad.mit.edu	37	2	206361097	206361097	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206361097delC	uc002var.1	+						PARD3B_uc002vao.1_Intron|PARD3B_uc002vap.1_Intron|PARD3B_uc002vaq.1_Intron	NM_152526	NP_689739			par-3 partitioning defective 3 homolog B isoform						cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	207121869	207121869	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207121869delC								GPR1 (39098 upstream) : ZDBF2 (17654 downstream)																																			---	---	---	---
UNC80	285175	broad.mit.edu	37	2	210644204	210644205	+	Intron	INS	-	T	T	rs150841568	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210644204_210644205insT	uc010zjc.1	+						UNC80_uc002vdj.1_Intron	NM_032504	NP_115893			chromosome 2 open reading frame 21 isoform 1							integral to membrane					0																		---	---	---	---
VWC2L	402117	broad.mit.edu	37	2	215419770	215419770	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215419770delA	uc002vet.2	+						VWC2L_uc010zjl.1_Intron	NM_001080500	NP_001073969			von Willebrand factor C domain-containing							extracellular region					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	215504076	215504076	+	IGR	DEL	G	-	-	rs149203917		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215504076delG								VWC2L (63423 upstream) : BARD1 (89199 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	216674579	216674580	+	Intron	INS	-	A	A	rs34767937		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216674579_216674580insA	uc002vfm.1	-						uc002vfn.1_Intron					Homo sapiens cDNA FLJ34546 fis, clone HLUNG2008959.																														---	---	---	---
PECR	55825	broad.mit.edu	37	2	216899234	216899234	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216899234delT	uc010zjq.1	-											Synthetic construct DNA, clone: pF1KB6394, Homo sapiens PECR gene for peroxisomal trans-2-enoyl-CoA reductase, without stop codon, in Flexi system.						fatty acid biosynthetic process|regulation of apoptosis	peroxisome	binding|trans-2-enoyl-CoA reductase (NADPH) activity				0		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)											OREG0015178	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	2	217771013	217771013	+	IGR	DEL	A	-	-	rs71967033		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217771013delA								TNP1 (46231 upstream) : DIRC3 (377735 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	219020335	219020336	+	IGR	INS	-	TTTG	TTTG	rs148319110	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219020335_219020336insTTTG								CXCR2 (18360 upstream) : CXCR1 (7234 downstream)																																			---	---	---	---
IHH	3549	broad.mit.edu	37	2	219923410	219923411	+	Intron	INS	-	AGA	AGA	rs141417126	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219923410_219923411insAGA	uc002vjo.1	-						hsa-mir-3131|MI0014151_RNA	NM_002181	NP_002172			Indian hedgehog homolog precursor						cell-cell signaling|intein-mediated protein splicing|proteolysis	extracellular space|plasma membrane	cholesterol binding|patched binding|peptidase activity			breast(1)	1		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000188)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	220529978	220529978	+	IGR	DEL	T	-	-	rs36005680		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220529978delT								SLC4A3 (23277 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	222477261	222477261	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222477261delG								EPHA4 (38339 upstream) : PAX3 (587346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	222906781	222906782	+	IGR	INS	-	A	A	rs34806017		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222906781_222906782insA								EPHA4 (467859 upstream) : PAX3 (157825 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	225278694	225278697	+	IGR	DEL	AACA	-	-	rs34412327		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225278694_225278697delAACA								FAM124B (11983 upstream) : CUL3 (56172 downstream)																																			---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225661983	225661983	+	Intron	DEL	T	-	-	rs113535092		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225661983delT	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504			dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	225987960	225987963	+	IGR	DEL	CTCC	-	-	rs111455986	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225987960_225987963delCTCC								DOCK10 (80630 upstream) : KIAA1486 (277639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	227432301	227432301	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227432301delC								KIAA1486 (836830 upstream) : IRS1 (163733 downstream)																																			---	---	---	---
MFF	56947	broad.mit.edu	37	2	228207712	228207712	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228207712delA	uc002vos.2	+						MFF_uc002vot.2_Intron|MFF_uc002vou.2_Intron|MFF_uc002vov.2_Intron|MFF_uc002vow.2_Intron|MFF_uc002vox.2_Intron|MFF_uc002voy.2_Intron|MFF_uc002voz.2_Intron	NM_020194	NP_064579			mitochondrial fission factor							integral to membrane|mitochondrial outer membrane				large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	229380205	229380206	+	IGR	DEL	TG	-	-	rs10524395	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229380205_229380206delTG								SPHKAP (333844 upstream) : PID1 (508484 downstream)																																			---	---	---	---
ITM2C	81618	broad.mit.edu	37	2	231741203	231741204	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231741203_231741204insT	uc002vqz.2	+						ITM2C_uc002vra.2_Intron|ITM2C_uc002vrb.2_Intron|ITM2C_uc002vrc.2_Intron|ITM2C_uc002vrd.2_Intron	NM_030926	NP_112188			integral membrane protein 2C isoform 1						negative regulation of neuron projection development|neuron differentiation	Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	beta-amyloid binding				0		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;8.47e-12)|all cancers(144;3.44e-09)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	232238607	232238607	+	IGR	DEL	A	-	-	rs35285848		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232238607delA								ARMC9 (1 upstream) : B3GNT7 (21728 downstream)																																			---	---	---	---
NGEF	25791	broad.mit.edu	37	2	233747763	233747766	+	Intron	DEL	ACAC	-	-	rs66854547		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233747763_233747766delACAC	uc002vts.2	-						NGEF_uc010zmm.1_Intron|NGEF_uc010fyg.1_Intron	NM_019850	NP_062824			neuronal guanine nucleotide exchange factor						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)|skin(1)	7		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)														---	---	---	---
USP40	55230	broad.mit.edu	37	2	234398497	234398499	+	Intron	DEL	CAG	-	-	rs111497673		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234398497_234398499delCAG	uc010zmr.1	-						USP40_uc002vul.2_5'Flank|USP40_uc010zms.1_Intron|USP40_uc002vun.2_Intron	NM_018218	NP_060688			ubiquitin thioesterase 40						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)|breast(1)	3		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	235441998	235441999	+	IGR	INS	-	A	A	rs34418332		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235441998_235441999insA								ARL4C (36305 upstream) : SH3BP4 (418629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	235735092	235735095	+	IGR	DEL	TTTT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235735092_235735095delTTTT								ARL4C (329399 upstream) : SH3BP4 (125533 downstream)																																			---	---	---	---
ASB18	401036	broad.mit.edu	37	2	237172198	237172198	+	Intron	DEL	A	-	-	rs75672843		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237172198delA	uc010znh.1	-							NM_212556	NP_997721			ankyrin repeat and SOCS box-containing 18						intracellular signal transduction					ovary(1)	1		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	237210965	237210965	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237210965delT								ASB18 (37977 upstream) : IQCA1 (21829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237817467	237817468	+	IGR	INS	-	G	G	rs142727201	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237817467_237817468insG								CXCR7 (326475 upstream) : COPS8 (176616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	237992322	237992322	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237992322delA	uc002vwf.1	-						COPS8_uc010fys.1_5'Flank|COPS8_uc002vwg.2_5'Flank|COPS8_uc002vwh.2_5'Flank|COPS8_uc002vwi.2_5'Flank					Homo sapiens cDNA FLJ14571 fis, clone NT2RM4000532.																														---	---	---	---
COL6A3	1293	broad.mit.edu	37	2	238278484	238278485	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238278484_238278485insT	uc002vwl.2	-						COL6A3_uc002vwo.2_Intron|COL6A3_uc010znj.1_Intron	NM_004369	NP_004360			alpha 3 type VI collagen isoform 1 precursor						axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	239622276	239622277	+	IGR	INS	-	CA	CA	rs150793772	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239622276_239622277insCA								ASB1 (261386 upstream) : TWIST2 (134396 downstream)																																			---	---	---	---
HDAC4	9759	broad.mit.edu	37	2	240294146	240294146	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240294146delC	uc002vyk.3	-						HDAC4_uc010fza.2_Intron	NM_006037	NP_006028			histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	241248595	241248596	+	IGR	INS	-	TATC	TATC	rs141356115		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241248595_241248596insTATC								OTOS (168522 upstream) : GPC1 (126519 downstream)																																			---	---	---	---
GPC1	2817	broad.mit.edu	37	2	241377480	241377480	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241377480delA	uc002vyw.3	+							NM_002081	NP_002072			glypican 1 precursor						axon guidance	anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			breast(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)												OREG0015351	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ATG4B	23192	broad.mit.edu	37	2	242584363	242584363	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242584363delA	uc002wbv.2	+						ATG4B_uc002wbu.2_Intron|ATG4B_uc002wbw.2_Intron|ATG4B_uc010zox.1_Intron|ATG4B_uc010zoy.1_Intron|ATG4B_uc010fzp.2_Intron	NM_013325	NP_037457			APG4 autophagy 4 homolog B isoform a						autophagic vacuole assembly|protein transport|proteolysis	cytoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.44e-33)|all cancers(36;5.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.75e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0848)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	242806945	242806946	+	IGR	INS	-	GTG	GTG			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242806945_242806946insGTG								PDCD1 (5887 upstream) : C2orf85 (4940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	242808066	242808067	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242808066_242808067delTG								PDCD1 (7008 upstream) : C2orf85 (3819 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	650309	650309	+	Intron	DEL	A	-	-	rs67625824		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:650309delA	uc003boy.1	+											Homo sapiens cDNA FLJ44328 fis, clone TRACH3002871.																														---	---	---	---
SUMF1	285362	broad.mit.edu	37	3	3983375	3983376	+	Intron	INS	-	AGG	AGG	rs147916847	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3983375_3983376insAGG	uc003bps.1	-							NM_182760				sulfatase modifying factor 1 isoform 1							endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)														---	---	---	---
ITPR1	3708	broad.mit.edu	37	3	4535571	4535571	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4535571delT	uc003bqa.2	+						ITPR1_uc010hbz.2_Intron|ITPR1_uc010hca.1_Intron|ITPR1_uc011asu.1_Intron	NM_001099952	NP_001093422			inositol 1,4,5-triphosphate receptor, type 1						activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)														---	---	---	---
EDEM1	9695	broad.mit.edu	37	3	5226468	5226468	+	5'Flank	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5226468delT	uc003bqi.2	+						EDEM1_uc011asz.1_5'Flank|EDEM1_uc003bqh.2_5'Flank	NM_014674	NP_055489			ER degradation enhancer, mannosidase alpha-like						ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			ovary(2)|breast(1)	3				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	5359976	5359976	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5359976delG								EDEM1 (98327 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	6760479	6760479	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6760479delA	uc003bqj.1	+											Homo sapiens clone P1 NTera2D1 teratocarcinoma mRNA.																														---	---	---	---
GRM7	2917	broad.mit.edu	37	3	6996901	6996901	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6996901delT	uc003bqm.2	+						GRM7_uc011ata.1_Intron|GRM7_uc011atb.1_Intron|GRM7_uc010hcf.2_Intron|GRM7_uc011atc.1_Intron|GRM7_uc010hcg.2_Intron|GRM7_uc003bql.2_Intron	NM_000844	NP_000835			glutamate receptor, metabotropic 7 isoform a						negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)													---	---	---	---
GRM7	2917	broad.mit.edu	37	3	7699257	7699257	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7699257delT	uc003bqm.2	+						GRM7_uc011ata.1_Intron|GRM7_uc011atb.1_Intron|GRM7_uc010hcf.2_Intron|GRM7_uc011atc.1_Intron|GRM7_uc010hcg.2_Intron|GRM7_uc003bql.2_Intron|GRM7_uc003bqn.1_Intron	NM_000844	NP_000835			glutamate receptor, metabotropic 7 isoform a						negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)													---	---	---	---
SRGAP3	9901	broad.mit.edu	37	3	9036673	9036673	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9036673delT	uc003brf.1	-						SRGAP3_uc003brg.1_Intron	NM_014850	NP_055665			SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---
Unknown	0	broad.mit.edu	37	3	9300897	9300898	+	IGR	INS	-	A	A	rs144390616	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9300897_9300898insA								SRGAP3 (9586 upstream) : LOC440944 (90476 downstream)																																			---	---	---	---
LHFPL4	375323	broad.mit.edu	37	3	9550925	9550926	+	Intron	INS	-	C	C	rs146924256	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9550925_9550926insC	uc003bry.2	-							NM_198560	NP_940962			lipoma HMGIC fusion partner-like 4							integral to membrane				ovary(2)|skin(1)	3	Medulloblastoma(99;0.227)																	---	---	---	---
ATP2B2	491	broad.mit.edu	37	3	10532640	10532640	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10532640delT	uc003bvt.2	-						ATP2B2_uc003bvv.2_Intron|ATP2B2_uc003bvw.2_Intron|ATP2B2_uc010hdp.2_Intron	NM_001001331	NP_001001331			plasma membrane calcium ATPase 2 isoform 1						ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	11162571	11162574	+	IGR	DEL	CCAG	-	-	rs10539677		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11162571_11162574delCCAG								SLC6A1 (81637 upstream) : HRH1 (16205 downstream)																																			---	---	---	---
ATG7	10533	broad.mit.edu	37	3	11354029	11354029	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11354029delT	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386			APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	13230886	13230893	+	IGR	DEL	AAGCTAAT	-	-	rs113390399		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13230886_13230893delAAGCTAAT								IQSEC1 (116269 upstream) : NUP210 (126844 downstream)																																			---	---	---	---
XPC	7508	broad.mit.edu	37	3	14199157	14199157	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14199157delG	uc011ave.1	-						XPC_uc011avf.1_Intron|XPC_uc011avg.1_Intron	NM_004628	NP_004619			xeroderma pigmentosum, complementation group C						nucleotide-excision repair, DNA damage recognition|nucleotide-excision repair, DNA damage removal	cytoplasm|nucleoplasm|XPC complex	bubble DNA binding|damaged DNA binding|loop DNA binding|protein binding|single-stranded DNA binding			ovary(2)|breast(1)	3								Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		NER	Xeroderma_Pigmentosum				---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17533934	17533934	+	Intron	DEL	T	-	-	rs35021712		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17533934delT	uc003cbf.2	-						TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
KAT2B	8850	broad.mit.edu	37	3	20111021	20111022	+	Intron	INS	-	T	T	rs113347043		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20111021_20111022insT	uc003cbq.2	+							NM_003884	NP_003875			K(lysine) acetyltransferase 2B						cell cycle arrest|cellular response to insulin stimulus|chromatin remodeling|histone H3 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|negative regulation of cell proliferation|transcription initiation from RNA polymerase I promoter	Ada2/Gcn5/Ada3 transcription activator complex|chromatin remodeling complex|PCAF complex	cyclin-dependent protein kinase inhibitor activity|histone acetyltransferase activity|histone deacetylase binding|protein kinase binding|transcription coactivator activity|transcription factor binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	20276354	20276355	+	IGR	INS	-	ATAGAATAGA	ATAGAATAGA	rs145204888	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20276354_20276355insATAGAATAGA								SGOL1 (48671 upstream) : None (None downstream)																																			---	---	---	---
RARB	5915	broad.mit.edu	37	3	25423902	25423903	+	Intron	INS	-	C	C	rs142139973	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25423902_25423903insC	uc011awl.1	+							NM_016152	NP_057236			retinoic acid receptor, beta isoform 2						embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)													---	---	---	---
SLC4A7	9497	broad.mit.edu	37	3	27509892	27509892	+	Intron	DEL	T	-	-	rs149497516	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27509892delT	uc011aww.1	-						SLC4A7_uc011awu.1_Intron|SLC4A7_uc011awv.1_Intron|SLC4A7_uc003cdu.3_Intron|SLC4A7_uc011awx.1_Intron|SLC4A7_uc011awy.1_Intron|SLC4A7_uc011awz.1_Intron|SLC4A7_uc011axa.1_Intron|SLC4A7_uc011axb.1_Intron|SLC4A7_uc010hfm.2_Intron	NM_003615	NP_003606			solute carrier family 4, sodium bicarbonate							apical plasma membrane|basolateral plasma membrane|integral to membrane|stereocilium	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	28168481	28168482	+	IGR	INS	-	T	T	rs143142128	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28168481_28168482insT								EOMES (404275 upstream) : CMC1 (114642 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	29226312	29226313	+	IGR	DEL	AG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29226312_29226313delAG								ZCWPW2 (659682 upstream) : RBMS3 (96630 downstream)																																			---	---	---	---
RBMS3	27303	broad.mit.edu	37	3	29825391	29825391	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:29825391delT	uc003cel.2	+						RBMS3_uc003cek.2_Intron|RBMS3_uc010hfq.2_Intron|RBMS3_uc003cem.2_Intron|RBMS3_uc010hfr.2_Intron	NM_001003793	NP_001003793			RNA binding motif, single stranded interacting							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)																---	---	---	---
Unknown	0	broad.mit.edu	37	3	30537724	30537724	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30537724delT								RBMS3 (491105 upstream) : TGFBR2 (110270 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	30966003	30966003	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30966003delG								GADL1 (29850 upstream) : STT3B (608488 downstream)																																			---	---	---	---
SUSD5	26032	broad.mit.edu	37	3	33210577	33210577	+	Intron	DEL	A	-	-	rs36050361		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33210577delA	uc003cfo.1	-							NM_015551	NP_056366			sushi domain containing 5 precursor						cell adhesion	integral to membrane	hyaluronic acid binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	35344380	35344381	+	IGR	INS	-	GTCCT	GTCCT	rs148394908	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35344380_35344381insGTCCT								None (None upstream) : ARPP21 (336700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	35505568	35505569	+	IGR	INS	-	A	A	rs142356171	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35505568_35505569insA								None (None upstream) : ARPP21 (175512 downstream)																																			---	---	---	---
ARPP21	10777	broad.mit.edu	37	3	35822071	35822071	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35822071delA	uc003cgb.2	+						ARPP21_uc003cga.2_Intron|ARPP21_uc011axy.1_Intron|ARPP21_uc003cgf.2_Intron|ARPP21_uc003cgg.2_Intron	NM_016300	NP_057384			cyclic AMP-regulated phosphoprotein, 21 kD							cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3																		---	---	---	---
TRANK1	9881	broad.mit.edu	37	3	36877799	36877805	+	Intron	DEL	GGAGCCA	-	-	rs71947865		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36877799_36877805delGGAGCCA	uc003cgj.2	-							NM_014831	NP_055646			lupus brain antigen 1						DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	37008952	37008953	+	IGR	DEL	AA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37008952_37008953delAA								TRANK1 (106541 upstream) : EPM2AIP1 (18405 downstream)																																			---	---	---	---
C3orf35	339883	broad.mit.edu	37	3	37437219	37437219	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37437219delA	uc003cgy.1	+						C3orf35_uc003cgz.1_Intron					Homo sapiens mRNA for AP20 region protein (APRG1 gene), isoform A.							integral to membrane				central_nervous_system(1)	1																		---	---	---	---
DLEC1	9940	broad.mit.edu	37	3	38126069	38126070	+	Intron	DEL	GG	-	-	rs147653328		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38126069_38126070delGG	uc003cho.1	+						DLEC1_uc003chp.1_Intron|DLEC1_uc010hgv.1_Intron|DLEC1_uc010hgw.1_Intron|DLEC1_uc003chq.1_Intron	NM_007335	NP_031361			deleted in lung and esophageal cancer 1 isoform						negative regulation of cell proliferation	cytoplasm				ovary(2)|pancreas(2)|central_nervous_system(2)|skin(2)|breast(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)														---	---	---	---
SLC22A14	9389	broad.mit.edu	37	3	38349606	38349607	+	Intron	INS	-	A	A	rs140782408	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38349606_38349607insA	uc010hhc.1	+						SLC22A14_uc003cia.2_3'UTR|SLC22A14_uc003cib.2_Intron|SLC22A14_uc011ayo.1_Intron	NM_004803	NP_004794			organic cation transporter like 4							integral to plasma membrane	organic cation transmembrane transporter activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)														---	---	---	---
MYRIP	25924	broad.mit.edu	37	3	40275085	40275086	+	Intron	INS	-	CT	CT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40275085_40275086insCT	uc003cka.2	+						MYRIP_uc010hhu.2_Intron|MYRIP_uc010hhv.2_Intron|MYRIP_uc010hhw.2_Intron|MYRIP_uc011ayz.1_Intron|uc003ckb.2_Intron	NM_015460	NP_056275			myosin VIIA and Rab interacting protein						intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)														---	---	---	---
MYRIP	25924	broad.mit.edu	37	3	40276484	40276484	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40276484delA	uc003cka.2	+						MYRIP_uc010hhu.2_Intron|MYRIP_uc010hhv.2_Intron|MYRIP_uc010hhw.2_Intron|MYRIP_uc011ayz.1_Intron|uc003ckb.2_Intron	NM_015460	NP_056275			myosin VIIA and Rab interacting protein						intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	40485139	40485142	+	Intron	DEL	AAGG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40485139_40485142delAAGG	uc003cke.3	-											Homo sapiens hypothetical protein FLJ36665, mRNA (cDNA clone IMAGE:5299018).																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	40530690	40530690	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40530690delT								ZNF619 (576 upstream) : ZNF620 (16840 downstream)																																			---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41356306	41356307	+	Intron	INS	-	TG	TG	rs140196162	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41356306_41356307insTG	uc003ckv.3	-							NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	42415942	42415942	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42415942delC								CCK (108280 upstream) : LYZL4 (22635 downstream)																																			---	---	---	---
LYZL4	131375	broad.mit.edu	37	3	42449196	42449197	+	Intron	DEL	AA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42449196_42449197delAA	uc003cle.2	-							NM_144634	NP_653235			lysozyme-like 4 precursor						cell wall macromolecule catabolic process	extracellular region	lysozyme activity			central_nervous_system(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.222)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	42533063	42533073	+	IGR	DEL	TTTGTTTGTTT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42533063_42533073delTTTGTTTGTTT								LYZL4 (80998 upstream) : VIPR1 (11031 downstream)																																			---	---	---	---
SEC22C	9117	broad.mit.edu	37	3	42591051	42591052	+	Intron	INS	-	AG	AG	rs146586236	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42591051_42591052insAG	uc003clh.2	-						SEC22C_uc011azo.1_Intron|SEC22C_uc010hic.2_Intron|SEC22C_uc003cli.2_Intron	NM_004206	NP_004197			SEC22 vesicle trafficking protein homolog C						ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane					0				KIRC - Kidney renal clear cell carcinoma(284;0.222)														---	---	---	---
NKTR	4820	broad.mit.edu	37	3	42686470	42686471	+	Intron	INS	-	TG	TG	rs138562958	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42686470_42686471insTG	uc003clo.2	+						NKTR_uc003clp.2_Intron|NKTR_uc011azp.1_Intron|NKTR_uc003cls.2_Intron	NM_005385	NP_005376			natural killer-tumor recognition sequence						protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)														---	---	---	---
CCR3	1232	broad.mit.edu	37	3	46298443	46298444	+	Intron	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46298443_46298444delCA	uc003cpg.1	+						CCR3_uc003cpi.1_Intron|CCR3_uc003cpj.1_Intron|CCR3_uc003cpk.1_Intron|CCR3_uc010hjb.1_Intron|CCR3_uc003cpl.1_Intron	NM_178329	NP_847899			CC chemokine receptor 3 isoform 1						cell adhesion|cellular defense response|chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cAMP nucleotide second messenger|inflammatory response|interspecies interaction between organisms|positive regulation of angiogenesis	integral to plasma membrane				ovary(3)|lung(3)|breast(1)|kidney(1)	8				BRCA - Breast invasive adenocarcinoma(193;0.00119)|KIRC - Kidney renal clear cell carcinoma(197;0.0183)|Kidney(197;0.0216)														---	---	---	---
LTF	4057	broad.mit.edu	37	3	46487788	46487804	+	Intron	DEL	TTGCACCCTTAAAATTA	-	-	rs56343354		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46487788_46487804delTTGCACCCTTAAAATTA	uc003cpq.2	-						LTF_uc003fzr.2_Intron|LTF_uc010hjh.2_Intron|LTF_uc003cpr.2_Intron	NM_002343	NP_002334			lactotransferrin precursor						cellular iron ion homeostasis|defense response to bacterium|humoral immune response|iron ion transport	extracellular region|stored secretory granule	ferric iron binding|heparin binding|protein binding|serine-type endopeptidase activity			central_nervous_system(2)|ovary(1)|lung(1)	4				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)	Pefloxacin(DB00487)													---	---	---	---
CSPG5	10675	broad.mit.edu	37	3	47622336	47622336	+	5'Flank	DEL	T	-	-	rs67158383		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47622336delT	uc003crp.3	-						CSPG5_uc003crn.2_5'Flank|CSPG5_uc003cro.3_5'Flank|CSPG5_uc011bbb.1_5'Flank	NM_006574	NP_006565			chondroitin sulfate proteoglycan 5 (neuroglycan						cell differentiation|intracellular transport|nervous system development|regulation of growth	endoplasmic reticulum membrane|Golgi-associated vesicle membrane|integral to plasma membrane|membrane fraction	growth factor activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)														---	---	---	---
SPINK8	646424	broad.mit.edu	37	3	48363303	48363303	+	Intron	DEL	A	-	-	rs112637469		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48363303delA	uc003csq.1	-							NM_001080525	NP_001073994			serine peptidase inhibitor, Kazal type 8							extracellular region	serine-type endopeptidase inhibitor activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)														---	---	---	---
DAG1	1605	broad.mit.edu	37	3	49560544	49560544	+	Intron	DEL	C	-	-	rs111848447		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49560544delC	uc003cxc.3	+							NM_004393	NP_004384			dystroglycan 1 preproprotein						cytoskeletal anchoring at plasma membrane|interspecies interaction between organisms|microtubule anchoring|negative regulation of cell migration|negative regulation of MAPKKK cascade|negative regulation of protein kinase B signaling cascade	basement membrane|contractile ring|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|extracellular space|filopodium|integral to membrane|integral to membrane of membrane fraction|lamellipodium|nucleoplasm	actin binding|alpha-actinin binding|calcium ion binding|laminin-1 binding|receptor activity|structural constituent of muscle|tubulin binding|vinculin binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)														---	---	---	---
TRAIP	10293	broad.mit.edu	37	3	49891279	49891280	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49891279_49891280insA	uc003cxs.1	-						TRAIP_uc010hla.1_Intron|TRAIP_uc011bcx.1_Intron	NM_005879	NP_005870			TRAF interacting protein						cell proliferation|induction of apoptosis	perinuclear region of cytoplasm	protein binding|zinc ion binding			lung(4)|upper_aerodigestive_tract(1)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
DOCK3	1795	broad.mit.edu	37	3	51250623	51250623	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51250623delA	uc011bds.1	+							NM_004947	NP_004938			dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)														---	---	---	---
TEX264	51368	broad.mit.edu	37	3	51726080	51726080	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51726080delC	uc010hls.2	+						TEX264_uc003dbk.3_Intron|TEX264_uc010hlt.2_Intron|TEX264_uc003dbl.3_Intron|TEX264_uc003dbm.3_Intron	NM_001129884	NP_001123356			testis expressed 264 precursor							extracellular region					0				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	51802706	51802706	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51802706delA								GRM2 (50083 upstream) : IQCF6 (9872 downstream)																																			---	---	---	---
PHF7	51533	broad.mit.edu	37	3	52448283	52448283	+	Intron	DEL	A	-	-	rs3832250		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52448283delA	uc003ddy.2	+						PHF7_uc003ddz.2_Intron	NM_016483	NP_057567			PHD finger protein 7 isoform 1							nucleus	zinc ion binding			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)														---	---	---	---
STAB1	23166	broad.mit.edu	37	3	52537166	52537166	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52537166delG	uc003dej.2	+						STAB1_uc003dei.1_Intron	NM_015136	NP_055951			stabilin 1 precursor						cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)														---	---	---	---
SFMBT1	51460	broad.mit.edu	37	3	52939820	52939820	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52939820delT	uc003dgf.2	-						SFMBT1_uc010hmr.2_Intron|SFMBT1_uc003dgg.2_Intron|SFMBT1_uc003dgh.2_Intron	NM_001005159	NP_001005159			Scm-like with four mbt domains 1						regulation of transcription, DNA-dependent	nucleus				ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)														---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54511269	54511270	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54511269_54511270insT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54791446	54791446	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54791446delA	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	55322208	55322208	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55322208delT								CACNA2D3 (213626 upstream) : WNT5A (177536 downstream)																																			---	---	---	---
ERC2	26059	broad.mit.edu	37	3	55949378	55949378	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55949378delA	uc003dhr.1	-						ERC2_uc003dhq.1_Intron|ERC2_uc003dht.1_Intron	NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56043425	56043426	+	Intron	INS	-	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56043425_56043426insG	uc003dhr.1	-						ERC2_uc003dht.1_Intron	NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
ARHGEF3	50650	broad.mit.edu	37	3	56960888	56960889	+	Intron	INS	-	C	C	rs145504804	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56960888_56960889insC	uc003dih.2	-							NM_001128615	NP_001122087			Rho guanine nucleotide exchange factor 3 isoform						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)														---	---	---	---
DNAH12	201625	broad.mit.edu	37	3	57525343	57525343	+	Intron	DEL	T	-	-	rs11359818		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57525343delT	uc003dit.2	-						DNAH12_uc003diu.2_Intron	NM_178504	NP_848599			dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	61465793	61465793	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61465793delA								FHIT (228660 upstream) : PTPRG (81450 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	61504583	61504583	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61504583delT								FHIT (267450 upstream) : PTPRG (42660 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	63779849	63779850	+	IGR	DEL	AC	-	-	rs34728435		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:63779849_63779850delAC								SNTN (128968 upstream) : C3orf49 (25191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	64912017	64912017	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64912017delT	uc003dml.2	+											Homo sapiens cDNA FLJ25194 fis, clone REC04095.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	66059179	66059179	+	IGR	DEL	A	-	-	rs67283612		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66059179delA								MAGI1 (34670 upstream) : SLC25A26 (60106 downstream)																																			---	---	---	---
EIF4E3	317649	broad.mit.edu	37	3	71743540	71743540	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71743540delA	uc003dov.3	-						EIF4E3_uc011bgc.1_Intron|EIF4E3_uc003dox.2_Intron|EIF4E3_uc011bgd.1_Intron|EIF4E3_uc010hoc.2_Intron	NM_001134651	NP_001128123			eukaryotic translation initiation factor 4E						regulation of translation	cytoplasm|mRNA cap binding complex	translation initiation factor activity				0		Prostate(10;0.0166)		BRCA - Breast invasive adenocarcinoma(55;2.56e-05)|Epithelial(33;2.9e-05)|Lung(16;9.28e-05)|LUSC - Lung squamous cell carcinoma(21;0.00227)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	72018080	72018083	+	IGR	DEL	ACAA	-	-	rs72322976		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72018080_72018083delACAA								PROK2 (183723 upstream) : RYBP (405668 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	72518465	72518465	+	IGR	DEL	T	-	-	rs148522003		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72518465delT								RYBP (22691 upstream) : SHQ1 (279965 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	73368306	73368306	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73368306delT								PPP4R2 (253295 upstream) : PDZRN3 (63346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	74750535	74750536	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74750535_74750536insA								CNTN3 (180192 upstream) : FAM86D (720169 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75107141	75107141	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75107141delT								CNTN3 (536798 upstream) : FAM86D (363564 downstream)																																			---	---	---	---
ZNF717	100131827	broad.mit.edu	37	3	75761328	75761328	+	Intron	DEL	A	-	-	rs146502045		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75761328delA	uc003dpw.3	-											Homo sapiens cDNA FLJ41782 fis, clone IMR322018192, weakly  similar to ZINC FINGER PROTEIN 90.						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	77981894	77981894	+	IGR	DEL	A	-	-	rs113782078		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77981894delA								ROBO2 (285233 upstream) : ROBO1 (664494 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	78247065	78247066	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78247065_78247066delAC								ROBO2 (550404 upstream) : ROBO1 (399322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	80323291	80323291	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80323291delC								ROBO1 (506232 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	80983429	80983432	+	IGR	DEL	TGTT	-	-	rs10537099		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80983429_80983432delTGTT								None (None upstream) : GBE1 (555418 downstream)																																			---	---	---	---
GBE1	2632	broad.mit.edu	37	3	81552753	81552753	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81552753delT	uc003dqg.2	-							NM_000158	NP_000149			glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)										Glycogen_Storage_Disease_type_IV				---	---	---	---
Unknown	0	broad.mit.edu	37	3	82299306	82299307	+	Intron	INS	-	T	T	rs144673295		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82299306_82299307insT	uc003dqh.1	+											Homo sapiens cDNA clone IMAGE:5271111.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	84627355	84627356	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84627355_84627356insA								None (None upstream) : CADM2 (380777 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	87592316	87592319	+	IGR	DEL	AGAA	-	-	rs10618500		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87592316_87592319delAGAA								POU1F1 (266579 upstream) : HTR1F (439407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	88569552	88569552	+	IGR	DEL	T	-	-	rs112768320		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88569552delT								C3orf38 (362439 upstream) : EPHA3 (587122 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	88631780	88631780	+	IGR	DEL	T	-	-	rs62741360		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88631780delT								C3orf38 (424667 upstream) : EPHA3 (524894 downstream)																																			---	---	---	---
EPHA3	2042	broad.mit.edu	37	3	89501058	89501059	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89501058_89501059delTG	uc003dqy.2	+						EPHA3_uc010hon.1_Intron	NM_005233	NP_005224			ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	90456805	90456806	+	IGR	INS	-	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90456805_90456806insC								EPHA3 (925523 upstream) : None (None downstream)																																			---	---	---	---
NSUN3	63899	broad.mit.edu	37	3	93844903	93844904	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93844903_93844904insA	uc003drl.1	+							NM_022072	NP_071355			NOL1/NOP2/Sun domain family, member 3								methyltransferase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	94930795	94930796	+	IGR	INS	-	AAC	AAC	rs112399466		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94930795_94930796insAAC								LOC255025 (35716 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	96155054	96155055	+	IGR	INS	-	AGTT	AGTT	rs147792309	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96155054_96155055insAGTT								None (None upstream) : EPHA6 (378370 downstream)																																			---	---	---	---
FILIP1L	11259	broad.mit.edu	37	3	99788739	99788739	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99788739delT	uc003dtm.2	-						C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Intron	NM_182909	NP_878913			filamin A interacting protein 1-like isoform 1							cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1																		---	---	---	---
TBC1D23	55773	broad.mit.edu	37	3	99976953	99976956	+	5'Flank	DEL	TATC	-	-	rs1552387		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99976953_99976956delTATC	uc003dtt.2	+						TBC1D23_uc003dts.2_5'Flank	NM_018309	NP_060779			TBC1 domain family, member 23							intracellular	Rab GTPase activator activity			ovary(1)|liver(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	102916696	102916697	+	IGR	INS	-	A	A	rs138639026	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102916696_102916697insA								ZPLD1 (718011 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	103514986	103514987	+	IGR	INS	-	GT	GT	rs143170940	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103514986_103514987insGT								None (None upstream) : None (None downstream)																																			---	---	---	---
LOC100302640	100302640	broad.mit.edu	37	3	106842667	106842668	+	Intron	INS	-	A	A	rs35066907		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:106842667_106842668insA	uc003dwf.3	-						LOC100302640_uc011bhk.1_Intron					Homo sapiens cDNA clone IMAGE:5284861.												0																		---	---	---	---
BBX	56987	broad.mit.edu	37	3	107239651	107239651	+	5'Flank	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107239651delT	uc010hpr.2	+						BBX_uc003dwk.3_5'Flank|BBX_uc003dwl.3_5'Flank	NM_001142568	NP_001136040			HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)															---	---	---	---
BBX	56987	broad.mit.edu	37	3	107360979	107360979	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107360979delT	uc010hpr.2	+						BBX_uc003dwk.3_Intron|BBX_uc003dwl.3_Intron	NM_001142568	NP_001136040			HMG-BOX transcription factor BBX isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(3;0.112)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	110674472	110674472	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110674472delC								None (None upstream) : PVRL3 (116393 downstream)																																			---	---	---	---
ATP6V1A	523	broad.mit.edu	37	3	113477332	113477333	+	Intron	INS	-	G	G	rs143219475	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113477332_113477333insG	uc003eao.2	+						ATP6V1A_uc011bik.1_Intron	NM_001690	NP_001681			ATPase, H+ transporting, lysosomal V1 subunit A						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(2)|skin(1)	3																		---	---	---	---
ARHGAP31	57514	broad.mit.edu	37	3	119016360	119016361	+	Intron	INS	-	AC	AC	rs76570394		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119016360_119016361insAC	uc003ecj.3	+							NM_020754	NP_065805			Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2																		---	---	---	---
STXBP5L	9515	broad.mit.edu	37	3	120913360	120913361	+	Intron	DEL	AA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120913360_120913361delAA	uc003eec.3	+						STXBP5L_uc011bji.1_Intron	NM_014980	NP_055795			syntaxin binding protein 5-like						exocytosis|protein transport	cytoplasm|integral to membrane|plasma membrane				ovary(7)|skin(2)	9				GBM - Glioblastoma multiforme(114;0.0694)														---	---	---	---
CASR	846	broad.mit.edu	37	3	121961753	121961753	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121961753delA	uc003eev.3	+						CASR_uc003eew.3_Intron	NM_000388	NP_000379			calcium-sensing receptor precursor						anatomical structure morphogenesis|calcium ion import|cellular calcium ion homeostasis|chemosensory behavior|detection of calcium ion|ossification	integral to plasma membrane	G-protein coupled receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(2)|upper_aerodigestive_tract(1)	7				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)													---	---	---	---
MYLK	4638	broad.mit.edu	37	3	123344348	123344348	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123344348delC	uc003ego.2	-						uc003egk.2_Intron|MYLK_uc010hrr.2_Intron|MYLK_uc011bjv.1_Intron|MYLK_uc011bjw.1_Intron|MYLK_uc003egp.2_Intron|MYLK_uc003egq.2_Intron|MYLK_uc003egr.2_Intron|MYLK_uc003egs.2_Intron	NM_053025	NP_444253			myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)														---	---	---	---
KALRN	8997	broad.mit.edu	37	3	124260760	124260761	+	Intron	INS	-	TT	TT	rs149863806	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124260760_124260761insTT	uc003ehg.2	+						KALRN_uc003ehi.2_Intron	NM_001024660	NP_001019831			kalirin, RhoGEF kinase isoform 1						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	125125012	125125013	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125125012_125125013delTG								ZNF148 (30814 upstream) : SNX4 (40482 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	125357923	125357924	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125357923_125357924insA								OSBPL11 (43542 upstream) : MIR548I1 (151323 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	125484510	125484510	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125484510delC								OSBPL11 (170129 upstream) : MIR548I1 (24737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	125723907	125723913	+	IGR	DEL	GTAACAC	-	-	rs113512316		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125723907_125723913delGTAACAC								ROPN1B (21613 upstream) : SLC41A3 (1288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	125937828	125937828	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125937828delA								ALDH1L1 (38343 upstream) : KLF15 (123650 downstream)																																			---	---	---	---
CHST13	166012	broad.mit.edu	37	3	126254401	126254404	+	Intron	DEL	AGAC	-	-	rs112509881		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126254401_126254404delAGAC	uc003eja.2	+							NM_152889	NP_690849			carbohydrate sulfotransferase 13						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.151)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	127044032	127044033	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127044032_127044033insA	uc003ejj.2	-											Homo sapiens, clone IMAGE:4618125, mRNA.																														---	---	---	---
TMCC1	23023	broad.mit.edu	37	3	129611371	129611371	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129611371delT	uc003emz.3	-						TMCC1_uc010htg.2_Intron|uc003ena.1_5'Flank|uc003enb.1_5'Flank	NM_001017395	NP_001017395			transmembrane and coiled-coil domain family 1							integral to membrane				skin(1)	1																		---	---	---	---
COL6A6	131873	broad.mit.edu	37	3	130338186	130338187	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130338186_130338187insA	uc010htl.2	+						COL6A6_uc003eni.3_Intron	NM_001102608	NP_001096078			collagen type VI alpha 6 precursor						axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8																		---	---	---	---
BFSP2	8419	broad.mit.edu	37	3	133156474	133156477	+	Intron	DEL	AAAG	-	-	rs141969388		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133156474_133156477delAAAG	uc003epn.1	+						uc003epo.2_Intron	NM_003571	NP_003562			phakinin						response to stimulus|visual perception	cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	133928509	133928509	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133928509delA								RYK (-41077 upstream) : RYK (-52531 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	134055143	134055144	+	IGR	INS	-	A	A	rs58907680		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134055143_134055144insA								RYK (85557 upstream) : AMOTL2 (15550 downstream)																																			---	---	---	---
AMOTL2	51421	broad.mit.edu	37	3	134093744	134093747	+	Intron	DEL	TGTG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134093744_134093747delTGTG	uc003eqf.2	-						AMOTL2_uc003eqg.1_5'Flank|AMOTL2_uc003eqh.1_5'Flank	NM_016201	NP_057285			angiomotin like 2											large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	134294203	134294210	+	IGR	DEL	CTCCCTCC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134294203_134294210delCTCCCTCC								CEP63 (351 upstream) : KY (24557 downstream)																																			---	---	---	---
KY	339855	broad.mit.edu	37	3	134342658	134342658	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134342658delC	uc010hty.2	-						KY_uc011blw.1_Intron|KY_uc011blx.1_Intron|KY_uc003eqr.1_5'Flank	NM_178554	NP_848649			kyphoscoliosis peptidase							cytoskeleton|Z disc	peptidase activity			ovary(2)	2																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134635602	134635605	+	Intron	DEL	AGCC	-	-	rs148131642		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134635602_134635605delAGCC	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron	NM_004441	NP_004432			ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
EPHB1	2047	broad.mit.edu	37	3	134674865	134674866	+	Intron	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134674865_134674866delCT	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron	NM_004441	NP_004432			ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30																		---	---	---	---
PPP2R3A	5523	broad.mit.edu	37	3	135729101	135729101	+	Intron	DEL	T	-	-	rs35997478		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135729101delT	uc003eqv.1	+						PPP2R3A_uc011blz.1_Intron	NM_002718	NP_002709			protein phosphatase 2, regulatory subunit B'',						protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7																		---	---	---	---
STAG1	10274	broad.mit.edu	37	3	136141988	136141989	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136141988_136141989insA	uc003era.1	-						STAG1_uc003erb.1_Intron|STAG1_uc003erc.1_Intron|STAG1_uc010hua.1_Intron	NM_005862	NP_005853			stromal antigen 1						cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	136510962	136510962	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136510962delT								STAG1 (39717 upstream) : TMEM22 (26899 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	137194416	137194417	+	IGR	INS	-	TCTT	TCTT	rs147963670	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137194416_137194417insTCTT								IL20RB (464496 upstream) : SOX14 (289162 downstream)																																			---	---	---	---
PRR23C	389152	broad.mit.edu	37	3	138764570	138764571	+	5'Flank	INS	-	C	C	rs146632407	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138764570_138764571insC	uc011bmt.1	-							NM_001134657	NP_001128129			proline rich 23C											skin(1)	1																		---	---	---	---
CLSTN2	64084	broad.mit.edu	37	3	140197626	140197627	+	Intron	INS	-	GGA	GGA	rs149744032	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140197626_140197627insGGA	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414			calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7															HNSCC(16;0.037)			---	---	---	---
Unknown	0	broad.mit.edu	37	3	140392293	140392294	+	IGR	INS	-	G	G	rs150351795	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140392293_140392294insG								CLSTN2 (105376 upstream) : TRIM42 (4587 downstream)																																			---	---	---	---
TRIM42	287015	broad.mit.edu	37	3	140405273	140405274	+	Intron	DEL	AT	-	-	rs57001204		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140405273_140405274delAT	uc003eto.1	+							NM_152616	NP_689829			tripartite motif-containing 42							intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	140449802	140449803	+	IGR	INS	-	A	A	rs146217463		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140449802_140449803insA								TRIM42 (29811 upstream) : SLC25A36 (210859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	141384854	141384857	+	IGR	DEL	GAGG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141384854_141384857delGAGG								RASA2 (53657 upstream) : RNF7 (72194 downstream)																																			---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	142989946	142989947	+	Intron	INS	-	G	G	rs146775319	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142989946_142989947insG	uc003evn.2	-							NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143348415	143348416	+	Intron	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143348415_143348416delGT	uc003evn.2	-						SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
SLC9A9	285195	broad.mit.edu	37	3	143438808	143438808	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143438808delA	uc003evn.2	-						SLC9A9_uc011bnk.1_Intron	NM_173653	NP_775924			solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	143876944	143876944	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143876944delT								C3orf58 (165735 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	144383452	144383452	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144383452delT								C3orf58 (672243 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	144955375	144955375	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144955375delT								None (None upstream) : PLOD2 (831853 downstream)																																			---	---	---	---
PLOD2	5352	broad.mit.edu	37	3	145792498	145792498	+	Intron	DEL	A	-	-	rs3840208		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145792498delA	uc003evs.1	-						PLOD2_uc003evq.1_Intron|PLOD2_uc011bnm.1_Intron|PLOD2_uc003evr.1_Intron	NM_000935	NP_000926			procollagen-lysine, 2-oxoglutarate 5-dioxygenase						protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2					Vitamin C(DB00126)													---	---	---	---
PLSCR2	57047	broad.mit.edu	37	3	146213571	146213574	+	Intron	DEL	TAGG	-	-	rs72286809		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146213571_146213574delTAGG	uc003evv.1	-						PLSCR2_uc003evw.1_Intron	NM_020359	NP_065092			phospholipid scramblase 2						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity				0																		---	---	---	---
PLSCR1	5359	broad.mit.edu	37	3	146248484	146248485	+	Intron	DEL	AG	-	-	rs113202031		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146248484_146248485delAG	uc003evx.3	-						PLSCR1_uc003evy.3_Intron|PLSCR1_uc011bnn.1_Intron|PLSCR1_uc003evz.3_Intron|PLSCR1_uc003ewa.2_Intron	NM_021105	NP_066928			phospholipid scramblase 1						phospholipid scrambling|platelet activation|response to virus	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity|SH3 domain binding			ovary(2)	2																		---	---	---	---
PLSCR1	5359	broad.mit.edu	37	3	146252955	146252959	+	Intron	DEL	AAGTA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146252955_146252959delAAGTA	uc003evx.3	-						PLSCR1_uc003evy.3_Intron|PLSCR1_uc011bnn.1_Intron|PLSCR1_uc003evz.3_Intron|PLSCR1_uc003ewa.2_Intron	NM_021105	NP_066928			phospholipid scramblase 1						phospholipid scrambling|platelet activation|response to virus	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity|SH3 domain binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	146893984	146893985	+	IGR	INS	-	A	A	rs112799435		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146893984_146893985insA								PLSCR5 (569981 upstream) : ZIC4 (209852 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	147940591	147940591	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147940591delT								ZIC1 (806087 upstream) : AGTR1 (475067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	148300718	148300719	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148300718_148300719insA								None (None upstream) : AGTR1 (114939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	150177614	150177616	+	IGR	DEL	AAA	-	-	rs62832066		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150177614_150177616delAAA								TSC22D2 (1 upstream) : SERP1 (82165 downstream)																																			---	---	---	---
CLRN1OS	116933	broad.mit.edu	37	3	150639599	150639600	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150639599_150639600delAC	uc011bny.1	+											Homo sapiens usher critical region protein (UCRP) pseudogene mRNA, complete sequence.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	152765909	152765909	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152765909delA								P2RY1 (210068 upstream) : RAP2B (114120 downstream)																																			---	---	---	---
KCNAB1	7881	broad.mit.edu	37	3	155872007	155872018	+	Intron	DEL	AGTAGTGCAGAT	-	-	rs67436029		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155872007_155872018delAGTAGTGCAGAT	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron	NM_172160	NP_751892			potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
KCNAB1	7881	broad.mit.edu	37	3	155894945	155894945	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155894945delT	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Intron	NM_172160	NP_751892			potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)															---	---	---	---
GFM1	85476	broad.mit.edu	37	3	158400564	158400564	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158400564delA	uc003fce.2	+						GFM1_uc003fcf.2_Intron|GFM1_uc003fcg.2_Intron	NM_024996	NP_079272			G elongation factor, mitochondrial 1 precursor						mitochondrial translational elongation	mitochondrion	GTP binding|GTPase activity|translation elongation factor activity			ovary(3)|central_nervous_system(1)	4			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)															---	---	---	---
IFT80	57560	broad.mit.edu	37	3	160109856	160109856	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160109856delA	uc011boy.1	-						IFT80_uc003fda.2_Intron|IFT80_uc003fdd.1_Intron|IFT80_uc003fde.1_Intron	NM_020800	NP_065851			WD repeat domain 56							cilium axoneme|microtubule basal body				ovary(1)	1			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	161111992	161111992	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161111992delG								C3orf57 (22121 upstream) : OTOL1 (102604 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	162135140	162135140	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162135140delA								OTOL1 (913412 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	162198799	162198800	+	IGR	DEL	TT	-	-	rs138131396		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162198799_162198800delTT								OTOL1 (977071 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	162482105	162482105	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162482105delT	uc003feg.2	+											Homo sapiens, clone IMAGE:2905387, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	162742580	162742581	+	Intron	INS	-	T	T	rs146007052	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162742580_162742581insT	uc003feg.2	+											Homo sapiens, clone IMAGE:2905387, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	162934584	162934585	+	Intron	INS	-	T	T	rs144901325	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162934584_162934585insT	uc003feg.2	+						uc003feh.2_Intron					Homo sapiens, clone IMAGE:2905387, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	163287071	163287072	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163287071_163287072insT								None (None upstream) : MIR1263 (602187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	165852538	165852539	+	IGR	INS	-	T	T	rs150708241	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165852538_165852539insT								BCHE (297285 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166037006	166037007	+	IGR	INS	-	TTG	TTG	rs139285976	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166037006_166037007insTTG								BCHE (481753 upstream) : ZBBX (921074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	166074733	166074734	+	IGR	INS	-	CT	CT	rs147743041	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166074733_166074734insCT								BCHE (519480 upstream) : ZBBX (883347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	167657027	167657035	+	IGR	DEL	ATGTTAACC	-	-	rs145801824		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167657027_167657035delATGTTAACC								SERPINI1 (113671 upstream) : GOLIM4 (70619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	168131723	168131723	+	IGR	DEL	T	-	-	rs67916914		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168131723delT								GOLIM4 (318306 upstream) : MIR551B (137919 downstream)																																			---	---	---	---
MECOM	2122	broad.mit.edu	37	3	169208539	169208539	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169208539delG	uc011bpj.1	-						MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982			MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14																		---	---	---	---
LRRIQ4	344657	broad.mit.edu	37	3	169547281	169547282	+	Intron	INS	-	C	C	rs72209660		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169547281_169547282insC	uc003fgb.2	+							NM_001080460	NP_001073929			leucine-rich repeats and IQ motif containing 4												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	169743639	169743640	+	IGR	INS	-	T	T	rs5854363		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169743639_169743640insT								SEC62 (27480 upstream) : GPR160 (12095 downstream)																																			---	---	---	---
SKIL	6498	broad.mit.edu	37	3	170079531	170079531	+	Intron	DEL	T	-	-	rs67258909		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170079531delT	uc003fgu.2	+						SKIL_uc011bps.1_Intron|SKIL_uc003fgv.2_Intron|SKIL_uc003fgw.2_Intron	NM_005414	NP_005405			SKI-like isoform 1						cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity			ovary(2)|skin(1)	3	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---
SLC7A14	57709	broad.mit.edu	37	3	170292786	170292786	+	Intron	DEL	A	-	-	rs5854380		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170292786delA	uc003fgz.2	-						CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000			solute carrier family 7 (cationic amino acid							integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	171646935	171646935	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171646935delT								TMEM212 (69827 upstream) : FNDC3B (110483 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	173035187	173035188	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173035187_173035188delCA								SPATA16 (176155 upstream) : NLGN1 (81056 downstream)																																			---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173898700	173898701	+	Intron	INS	-	A	A	rs139631329	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173898700_173898701insA	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747			neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	174917546	174917549	+	Intron	DEL	TGAT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174917546_174917549delTGAT	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	175849609	175849610	+	IGR	INS	-	A	A	rs145978548	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175849609_175849610insA								NAALADL2 (326183 upstream) : TBL1XR1 (888933 downstream)																																			---	---	---	---
KCNMB2	10242	broad.mit.edu	37	3	178340645	178340646	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178340645_178340646insT	uc003fjd.2	+						uc003fjb.1_Intron|uc003fjc.1_Intron|KCNMB2_uc003fje.2_Intron|KCNMB2_uc003fjf.2_Intron	NM_181361	NP_852006			calcium-activated potassium channel beta 2						detection of calcium ion|platelet activation|regulation of action potential in neuron|regulation of vasoconstriction	voltage-gated potassium channel complex	calcium-activated potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(1)	1	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)															---	---	---	---
ACTL6A	86	broad.mit.edu	37	3	179279799	179279799	+	5'Flank	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179279799delT	uc003fjw.2	+						ACTL6A_uc003fjx.2_5'Flank|ACTL6A_uc003fjy.2_5'Flank	NM_004301	NP_004292			actin-like 6A isoform 1						chromatin remodeling|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|nervous system development|regulation of growth|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	Ino80 complex|npBAF complex|NuA4 histone acetyltransferase complex|plasma membrane|SWI/SNF complex	ATP binding|chromatin binding			ovary(1)	1	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)															---	---	---	---
PEX5L	51555	broad.mit.edu	37	3	179747525	179747526	+	Intron	INS	-	G	G	rs150776389	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179747525_179747526insG	uc003fki.1	-						PEX5L_uc003fkj.1_Intron|PEX5L_uc010hxd.1_Intron|PEX5L_uc011bqg.1_Intron|PEX5L_uc011bqh.1_Intron	NM_016559	NP_057643			peroxisomal biogenesis factor 5-like						protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	179893172	179893172	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179893172delG								PEX5L (138655 upstream) : TTC14 (426746 downstream)																																			---	---	---	---
CCDC39	339829	broad.mit.edu	37	3	180402382	180402382	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180402382delT	uc003fkn.2	-											Homo sapiens cDNA FLJ58733 complete cds, moderately similar to Coiled-coil domain-containing protein 39.						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	180462991	180462992	+	Intron	INS	-	T	T	rs139635906	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180462991_180462992insT	uc003fko.2	-											Homo sapiens mRNA; cDNA DKFZp434A128 (from clone DKFZp434A128).																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	180804225	180804225	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180804225delC								DNAJC19 (96695 upstream) : SOX2OT (477284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	181140986	181140986	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181140986delA								DNAJC19 (433456 upstream) : SOX2OT (140523 downstream)																																			---	---	---	---
SOX2OT	347689	broad.mit.edu	37	3	181279950	181279950	+	5'Flank	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181279950delT	uc003fkv.2	+											Homo sapiens cDNA FLJ12764 fis, clone NT2RP2001506.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	182030573	182030573	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182030573delA								SOX2OT (571570 upstream) : ATP11B (480718 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	182278252	182278253	+	IGR	INS	-	T	T	rs150580436	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182278252_182278253insT								SOX2OT (819249 upstream) : ATP11B (233038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	183301160	183301161	+	IGR	INS	-	C	C	rs146919489	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183301160_183301161insC								KLHL6 (27661 upstream) : KLHL24 (52250 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	184897210	184897210	+	Intron	DEL	A	-	-	rs76486664		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184897210delA	uc003fpe.2	+											Homo sapiens hypothetical LOC339926, mRNA (cDNA clone IMAGE:4838153).																														---	---	---	---
MASP1	5648	broad.mit.edu	37	3	187008539	187008540	+	Intron	INS	-	T	T	rs145257678	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187008539_187008540insT	uc003frh.1	-						MASP1_uc003fri.2_Intron|MASP1_uc003frj.2_Intron|MASP1_uc003frk.1_Intron|MASP1_uc011bse.1_Intron|uc003frl.2_5'Flank	NM_001879	NP_001870			mannan-binding lectin serine protease 1 isoform						complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	187329938	187329938	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187329938delA								RTP4 (240571 upstream) : SST (56758 downstream)																																			---	---	---	---
LPP	4026	broad.mit.edu	37	3	188500527	188500528	+	Intron	INS	-	A	A	rs66466869		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188500527_188500528insA	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
Unknown	0	broad.mit.edu	37	3	191335748	191335748	+	IGR	DEL	A	-	-	rs145026808		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191335748delA								PYDC2 (156505 upstream) : FGF12 (523936 downstream)																																			---	---	---	---
FGF12	2257	broad.mit.edu	37	3	192090888	192090888	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192090888delT	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360			fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	192809085	192809085	+	IGR	DEL	A	-	-	rs148018208		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192809085delA								C3orf59 (173135 upstream) : HRASLS (149833 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	192952895	192952895	+	IGR	DEL	T	-	-	rs112216555		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192952895delT								C3orf59 (316945 upstream) : HRASLS (6023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	193779818	193779818	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193779818delA	uc003ftp.3	-											Homo sapiens cDNA clone IMAGE:4828668.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	193850849	193850849	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193850849delT								LOC100128023 (138822 upstream) : HES1 (3085 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	193861585	193861586	+	IGR	INS	-	T	T	rs7631208		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193861585_193861586insT								HES1 (5189 upstream) : LOC100131551 (155838 downstream)																																			---	---	---	---
SDHAP2	727956	broad.mit.edu	37	3	195414994	195414995	+	Intron	INS	-	C	C	rs146201388	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195414994_195414995insC	uc003fuw.2	+						SDHAP2_uc003fuv.2_Intron					SubName: Full=cDNA FLJ16373 fis, clone THYMU3000269, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	195443377	195443377	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195443377delA								MIR570 (17009 upstream) : MUC20 (4376 downstream)																																			---	---	---	---
MUC20	200958	broad.mit.edu	37	3	195459206	195459217	+	Intron	DEL	TCTTTTTCTTTC	-	-	rs113233054		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195459206_195459217delTCTTTTTCTTTC	uc010hzo.2	+						MUC20_uc010hzp.2_Intron	NM_152673	NP_689886			mucin 20 isoform L						protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)														---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195473656	195473659	+	3'UTR	DEL	AGAG	-	-	rs55663092		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195473656_195473659delAGAG	uc011bto.1	-	26					MUC4_uc010hzq.2_3'UTR|MUC4_uc003fuz.2_3'UTR|MUC4_uc003fva.2_3'UTR|MUC4_uc003fvb.2_3'UTR|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_3'UTR|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_3'UTR|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_3'UTR|MUC4_uc011bti.1_3'UTR|MUC4_uc011btj.1_3'UTR|MUC4_uc011btk.1_3'UTR|MUC4_uc011btl.1_3'UTR|MUC4_uc011btm.1_3'UTR|MUC4_uc011btn.1_3'UTR|MUC4_uc003fvo.2_3'UTR|MUC4_uc003fvp.2_3'UTR	NM_018406	NP_060876			mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	196072035	196072036	+	IGR	INS	-	T	T	rs112237343		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196072035_196072036insT								TM4SF19 (6777 upstream) : UBXN7 (8335 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	196420920	196420920	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196420920delA								LRRC33 (32048 upstream) : C3orf34 (12229 downstream)																																			---	---	---	---
SENP5	205564	broad.mit.edu	37	3	196644244	196644245	+	Intron	DEL	AG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196644244_196644245delAG	uc003fwz.3	+						SENP5_uc011bty.1_Intron	NM_152699	NP_689912			SUMO1/sentrin specific peptidase 5						cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)														---	---	---	---
DLG1	1739	broad.mit.edu	37	3	196864850	196864851	+	Intron	INS	-	A	A	rs149558826	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196864850_196864851insA	uc003fxo.3	-						DLG1_uc011bub.1_Intron|DLG1_uc011buc.1_Intron|DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron|DLG1_uc011buf.1_Intron|DLG1_uc003fxp.2_Intron|DLG1_uc010iam.1_Intron|DLG1_uc010ian.2_Intron	NM_001098424	NP_001091894			discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)														---	---	---	---
BDH1	622	broad.mit.edu	37	3	197295633	197295633	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197295633delA	uc003fxu.2	-							NM_203315	NP_976060			3-hydroxybutyrate dehydrogenase, type 1						cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)													---	---	---	---
LMLN	89782	broad.mit.edu	37	3	197744008	197744009	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197744008_197744009insA	uc011buo.1	+						LMLN_uc003fyt.2_Intron|LMLN_uc010iar.2_Intron|LMLN_uc010ias.2_Intron|LMLN_uc003fyu.2_Intron	NM_033029	NP_149018			leishmanolysin-like isoform 2						cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)														---	---	---	---
POLN	353497	broad.mit.edu	37	4	2204091	2204091	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2204091delG	uc003ger.2	-						POLN_uc010ich.1_Intron|POLN_uc011bvi.1_Intron	NM_181808	NP_861524			DNA-directed DNA polymerase nu						DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)										DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					---	---	---	---
Unknown	0	broad.mit.edu	37	4	3573841	3573841	+	IGR	DEL	C	-	-	rs33967104		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3573841delC								LRPAP1 (39617 upstream) : ADRA2C (194234 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3600945	3600946	+	IGR	DEL	TA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3600945_3600946delTA								LRPAP1 (66721 upstream) : ADRA2C (167129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3604862	3604863	+	IGR	INS	-	CT	CT	rs140129696	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3604862_3604863insCT								LRPAP1 (70638 upstream) : ADRA2C (163212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3621819	3621820	+	IGR	INS	-	G	G	rs141462966	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3621819_3621820insG								LRPAP1 (87595 upstream) : ADRA2C (146255 downstream)																																			---	---	---	---
PPP2R2C	5522	broad.mit.edu	37	4	6540877	6540878	+	Intron	DEL	AG	-	-	rs60307837	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6540877_6540878delAG	uc011bwd.1	-						PPP2R2C_uc011bwe.1_Intron	NM_181876	NP_870991			gamma isoform of regulatory subunit B55, protein						signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7726210	7726211	+	Intron	INS	-	TGATGG	TGATGG	rs141913593	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7726210_7726211insTGATGG	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	8521425	8521425	+	IGR	DEL	A	-	-	rs11375192		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8521425delA								C4orf23 (26167 upstream) : GPR78 (60866 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	8929324	8929324	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8929324delC								HMX1 (55781 upstream) : LOC650293 (22153 downstream)																																			---	---	---	---
SLC2A9	56606	broad.mit.edu	37	4	9999958	9999959	+	Intron	INS	-	ACA	ACA	rs141024192	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9999958_9999959insACA	uc003gmc.2	-						SLC2A9_uc003gmd.2_Intron	NM_020041	NP_064425			solute carrier family 2, member 9 protein						glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3																		---	---	---	---
CLNK	116449	broad.mit.edu	37	4	10587781	10587782	+	Intron	INS	-	GCG	GCG	rs151012328	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10587781_10587782insGCG	uc003gmo.3	-						CLNK_uc003gmp.2_Intron	NM_052964	NP_443196			mast cell immunoreceptor signal transducer						immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	10700847	10700848	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10700847_10700848delTG								CLNK (14461 upstream) : MIR572 (669603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	12675006	12675006	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:12675006delT								None (None upstream) : HSP90AB2P (660031 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	14101768	14101769	+	IGR	DEL	TG	-	-	rs139067623		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14101768_14101769delTG								BOD1L (472440 upstream) : CPEB2 (903753 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	14428344	14428344	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14428344delA								BOD1L (799016 upstream) : CPEB2 (577178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	16159783	16159784	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16159783_16159784insT								PROM1 (74160 upstream) : TAPT1 (2344 downstream)																																			---	---	---	---
FAM184B	27146	broad.mit.edu	37	4	17700041	17700042	+	Intron	INS	-	AAC	AAC	rs145657676	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17700041_17700042insAAC	uc003gpm.3	-							NM_015688	NP_056503			hypothetical protein LOC27146											central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	18107211	18107212	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18107211_18107212insT								LCORL (83826 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	19270021	19270027	+	IGR	DEL	TGGCAAA	-	-	rs66493643		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19270021_19270027delTGGCAAA								None (None upstream) : SLIT2 (985208 downstream)																																			---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	20876724	20876725	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20876724_20876725insA	uc003gqe.2	-						KCNIP4_uc003gqf.1_Intron|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqh.1_Intron|KCNIP4_uc003gqi.1_Intron|KCNIP4_uc010iel.2_Intron|KCNIP4_uc003gqd.3_Intron	NM_147182	NP_671711			Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	21613382	21613382	+	Intron	DEL	G	-	-	rs35185970		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21613382delG	uc003gqh.1	-						KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175			Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	22881190	22881191	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22881190_22881191insT								GBA3 (59999 upstream) : PPARGC1A (912454 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	24155846	24155860	+	IGR	DEL	TGTGTTCTACCACAG	-	-	rs66617471		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24155846_24155860delTGTGTTCTACCACAG								PPARGC1A (264146 upstream) : MIR573 (365955 downstream)																																			---	---	---	---
LGI2	55203	broad.mit.edu	37	4	25026765	25026766	+	Intron	INS	-	A	A	rs150087103	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25026765_25026766insA	uc003grf.2	-							NM_018176	NP_060646			leucine-rich repeat LGI family, member 2							extracellular region					0		Breast(46;0.173)																---	---	---	---
TBC1D19	55296	broad.mit.edu	37	4	26727023	26727023	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26727023delT	uc003gsf.3	+						TBC1D19_uc010iew.2_Intron|TBC1D19_uc011bxu.1_Intron	NM_018317	NP_060787			TBC1 domain family, member 19							intracellular	Rab GTPase activator activity			breast(1)	1		Breast(46;0.0503)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	27965903	27965907	+	IGR	DEL	TGTCT	-	-	rs10706821		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:27965903_27965907delTGTCT								STIM2 (940095 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	30354695	30354695	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30354695delT								None (None upstream) : PCDH7 (367342 downstream)																																			---	---	---	---
PCDH7	5099	broad.mit.edu	37	4	30850988	30850988	+	Intron	DEL	T	-	-	rs34043230		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30850988delT	uc011bxx.1	+						PCDH7_uc011bxw.1_Intron	NM_002589	NP_002580			protocadherin 7 isoform a precursor						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	31807999	31808002	+	IGR	DEL	GCTG	-	-	rs80330937		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31807999_31808002delGCTG								PCDH7 (659578 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32148512	32148512	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32148512delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	32358309	32358309	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32358309delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	33860530	33860531	+	IGR	INS	-	T	T	rs148369092	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33860530_33860531insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	35472617	35472618	+	IGR	DEL	TG	-	-	rs142153610		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:35472617_35472618delTG								None (None upstream) : ARAP2 (477226 downstream)																																			---	---	---	---
ARAP2	116984	broad.mit.edu	37	4	36064256	36064257	+	Intron	DEL	GT	-	-	rs35262444		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36064256_36064257delGT	uc003gso.2	-											Homo sapiens cDNA clone IMAGE:5296543.						regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
DTHD1	401124	broad.mit.edu	37	4	36290040	36290041	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36290040_36290041insT	uc011bxy.1	+							NM_001136536	NP_001130008			death domain containing 1						signal transduction						0																		---	---	---	---
PGM2	55276	broad.mit.edu	37	4	37833424	37833424	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37833424delG	uc011byb.1	+						PGM2_uc011bya.1_Intron|PGM2_uc011byc.1_Intron	NM_018290	NP_060760			phosphoglucomutase 2						glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity|phosphopentomutase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	38204591	38204591	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38204591delT								TBC1D1 (63798 upstream) : FLJ13197 (409731 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	38738945	38738945	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38738945delT								KLF3 (35817 upstream) : TLR10 (35318 downstream)																																			---	---	---	---
FAM114A1	92689	broad.mit.edu	37	4	38936016	38936017	+	Intron	INS	-	TGGA	TGGA			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38936016_38936017insTGGA	uc003gtn.2	+						FAM114A1_uc011byh.1_Intron|FAM114A1_uc010ifi.2_Intron	NM_138389	NP_612398			hypothetical protein LOC92689							cytoplasm				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	39382941	39382941	+	IGR	DEL	T	-	-	rs113862853		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39382941delT								RFC1 (14946 upstream) : KLB (25532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	40732575	40732576	+	IGR	INS	-	AG	AG	rs146912327	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40732575_40732576insAG								RBM47 (99935 upstream) : NSUN7 (19338 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	42266714	42266715	+	IGR	INS	-	A	A	rs111801841		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42266714_42266715insA								BEND4 (111819 upstream) : SHISA3 (133141 downstream)																																			---	---	---	---
GRXCR1	389207	broad.mit.edu	37	4	42993652	42993652	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42993652delA	uc003gwt.2	+							NM_001080476	NP_001073945			glutaredoxin, cysteine rich 1						cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	43562093	43562094	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43562093_43562094insA								GRXCR1 (529420 upstream) : KCTD8 (613828 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	43987563	43987563	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43987563delT								GRXCR1 (954890 upstream) : KCTD8 (188359 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	44105803	44105804	+	IGR	DEL	TT	-	-	rs113915335		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44105803_44105804delTT								None (None upstream) : KCTD8 (70118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	45731364	45731364	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45731364delA								None (None upstream) : GABRG1 (306425 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	52794209	52794210	+	IGR	DEL	TT	-	-	rs139654425		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52794209_52794210delTT								DCUN1D4 (11208 upstream) : LRRC66 (65657 downstream)																																			---	---	---	---
SCFD2	152579	broad.mit.edu	37	4	54222745	54222745	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54222745delC	uc003gzu.2	-						SCFD2_uc010igm.2_Intron	NM_152540	NP_689753			sec1 family domain containing 2						protein transport|vesicle docking involved in exocytosis					ovary(2)|pancreas(1)	3			GBM - Glioblastoma multiforme(3;1.07e-26)|LUSC - Lung squamous cell carcinoma(32;0.0134)															---	---	---	---
CLOCK	9575	broad.mit.edu	37	4	56391102	56391102	+	Intron	DEL	A	-	-	rs139559391		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56391102delA	uc003haz.1	-						CLOCK_uc003hba.1_Intron	NM_004898	NP_004889			clock						circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)															---	---	---	---
KIAA1211	57482	broad.mit.edu	37	4	57089542	57089542	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57089542delT	uc003hbk.2	+							NM_020722	NP_065773			hypothetical protein LOC57482											ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)																	---	---	---	---
Unknown	0	broad.mit.edu	37	4	58843882	58843883	+	IGR	INS	-	G	G	rs72604067		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58843882_58843883insG								IGFBP7 (867343 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	58976583	58976583	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58976583delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59416502	59416510	+	IGR	DEL	TGAATATTA	-	-	rs71990671		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59416502_59416510delTGAATATTA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	61227031	61227035	+	IGR	DEL	AAAAA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61227031_61227035delAAAAA								None (None upstream) : LPHN3 (839939 downstream)																																			---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62638782	62638782	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62638782delA	uc010ihh.2	+						LPHN3_uc003hcq.3_Intron|LPHN3_uc003hcs.1_Intron	NM_015236	NP_056051			latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	69890093	69890094	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69890093_69890094insT								UGT2A3 (72584 upstream) : UGT2B7 (72099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	70444214	70444216	+	IGR	DEL	CTC	-	-	rs35744028		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70444214_70444216delCTC								UGT2B4 (52482 upstream) : UGT2A1 (9920 downstream)																																			---	---	---	---
MOBKL1A	92597	broad.mit.edu	37	4	71829744	71829745	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71829744_71829745insA	uc003hfw.2	+						MOBKL1A_uc003hfv.1_Intron|MOBKL1A_uc011cba.1_Intron	NM_173468	NP_775739			MOB1, Mps One Binder kinase activator-like 1A						hippo signaling cascade|protein autophosphorylation	cytoplasm|nucleus	kinase activator activity|kinase binding|metal ion binding				0		all_hematologic(202;0.21)	Lung(101;0.235)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	71949718	71949719	+	IGR	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71949718_71949719delTC								DCK (53091 upstream) : SLC4A4 (103284 downstream)																																			---	---	---	---
SLC4A4	8671	broad.mit.edu	37	4	72363880	72363880	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72363880delA	uc003hfy.2	+						SLC4A4_uc010iic.2_Intron|SLC4A4_uc010iib.2_Intron|SLC4A4_uc003hfz.2_Intron|SLC4A4_uc003hgc.3_Intron|SLC4A4_uc010iid.2_Intron	NM_001098484	NP_001091954			solute carrier family 4, sodium bicarbonate							basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	73751823	73751823	+	IGR	DEL	A	-	-	rs139356592		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73751823delA								ADAMTS3 (317307 upstream) : COX18 (168593 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	74839861	74839861	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74839861delC								CXCL1 (102908 upstream) : PF4 (6935 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	76270537	76270537	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76270537delA								PARM1 (295214 upstream) : RCHY1 (133818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	76400391	76400391	+	IGR	DEL	C	-	-	rs75563157		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76400391delC								PARM1 (425068 upstream) : RCHY1 (3964 downstream)																																			---	---	---	---
ART3	419	broad.mit.edu	37	4	77014708	77014708	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77014708delA	uc003hjo.2	+						ART3_uc003hjk.2_Intron|ART3_uc010ija.1_Intron|ART3_uc003hjn.2_Intron|ART3_uc003hjp.2_Intron|ART3_uc010ijb.2_Intron|ART3_uc003hjq.2_Intron|ART3_uc003hjr.2_Intron|ART3_uc010ijc.2_Intron|ART3_uc010ijd.2_Intron	NM_001130016	NP_001123488			ADP-ribosyltransferase 3 isoform a						protein ADP-ribosylation	anchored to membrane|integral to plasma membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity			ovary(2)	2			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	78150724	78150724	+	IGR	DEL	G	-	-	rs35176072		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78150724delG								CCNG2 (59514 upstream) : CXCL13 (282183 downstream)																																			---	---	---	---
CNOT6L	246175	broad.mit.edu	37	4	78645493	78645494	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78645493_78645494insA	uc011ccd.1	-						CNOT6L_uc003hks.2_Intron	NM_144571	NP_653172			CCR4-NOT transcription complex, subunit 6-like						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	exonuclease activity|protein binding			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	79533362	79533362	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79533362delA								ANXA3 (1760 upstream) : BMP2K (164170 downstream)																																			---	---	---	---
NAA11	84779	broad.mit.edu	37	4	80249425	80249426	+	5'Flank	INS	-	T	T	rs149501439	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80249425_80249426insT	uc003hlt.3	-							NM_032693	NP_116082			alpha-N-acetyltransferase 1B							cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
C4orf22	255119	broad.mit.edu	37	4	81320202	81320202	+	Intron	DEL	C	-	-	rs146979711		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81320202delC	uc003hmf.2	+						C4orf22_uc010ijp.2_Intron	NM_152770	NP_689983			hypothetical protein LOC255119											skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	83391655	83391656	+	IGR	INS	-	CT	CT	rs148094743	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83391655_83391656insCT								ENOPH1 (9412 upstream) : TMEM150C (13948 downstream)																																			---	---	---	---
TMEM150C	441027	broad.mit.edu	37	4	83406549	83406550	+	3'UTR	INS	-	TG	TG	rs144382768	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83406549_83406550insTG	uc003hmy.1	-	8					TMEM150C_uc011ccj.1_3'UTR	NM_001080506	NP_001073975			transmembrane protein 150C							integral to membrane				ovary(1)	1																		---	---	---	---
SEC31A	22872	broad.mit.edu	37	4	83795454	83795454	+	Intron	DEL	A	-	-	rs36077690		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83795454delA	uc003hnf.2	-						SEC31A_uc003hne.2_5'Flank|SEC31A_uc011ccl.1_Intron|SEC31A_uc003hnl.2_Intron|SEC31A_uc003hng.2_Intron|SEC31A_uc003hnh.2_Intron|SEC31A_uc003hni.2_Intron|SEC31A_uc003hnj.2_Intron|SEC31A_uc011ccm.1_Intron|SEC31A_uc011ccn.1_Intron|SEC31A_uc003hnk.2_Intron|SEC31A_uc003hnm.2_Intron|SEC31A_uc003hnn.1_Intron|SEC31A_uc003hno.2_Intron	NM_001077207	NP_001070675			SEC31 homolog A isoform 1						COPII vesicle coating|post-translational protein modification|protein N-linked glycosylation via asparagine|protein transport|response to calcium ion	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|perinuclear region of cytoplasm	calcium-dependent protein binding		SEC31A/JAK2(4)|SEC31A/ALK(3)	haematopoietic_and_lymphoid_tissue(4)|soft_tissue(3)|breast(1)	8		Hepatocellular(203;0.114)																---	---	---	---
COPS4	51138	broad.mit.edu	37	4	83980842	83980843	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83980842_83980843insT	uc003hoa.2	+						COPS4_uc003hob.2_Intron|COPS4_uc010ijw.2_Intron|COPS4_uc010ijx.2_Intron	NM_016129	NP_057213			COP9 signalosome subunit 4						cullin deneddylation	cytoplasm|signalosome	protein binding			kidney(1)	1		Hepatocellular(203;0.114)																---	---	---	---
PTPN13	5783	broad.mit.edu	37	4	87545048	87545048	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87545048delC	uc003hpz.2	+						PTPN13_uc003hpy.2_Intron|PTPN13_uc003hqa.2_Intron|PTPN13_uc003hqb.2_Intron	NM_080683	NP_542414			protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	88512079	88512080	+	IGR	INS	-	AC	AC	rs142377310	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88512079_88512080insAC								SPARCL1 (61424 upstream) : DSPP (17601 downstream)																																			---	---	---	---
C4orf37	285555	broad.mit.edu	37	4	98978632	98978632	+	Intron	DEL	A	-	-	rs34699729		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98978632delA	uc003htt.1	-							NM_174952	NP_777612			hypothetical protein LOC285555												0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	99112235	99112235	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99112235delT								C4orf37 (47844 upstream) : RAP1GDS1 (70292 downstream)																																			---	---	---	---
EIF4E	1977	broad.mit.edu	37	4	99849870	99849870	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99849870delG	uc003hue.2	-						EIF4E_uc011cea.1_Intron|EIF4E_uc011ceb.1_Intron|EIF4E_uc011cec.1_Intron	NM_001968	NP_001959			eukaryotic translation initiation factor 4E						G1/S transition of mitotic cell cycle|insulin receptor signaling pathway|interspecies interaction between organisms|mRNA export from nucleus|nuclear-transcribed mRNA poly(A) tail shortening|positive regulation of mitotic cell cycle|regulation of translation	cytoplasmic mRNA processing body|cytosol|eukaryotic translation initiation factor 4F complex|mRNA cap binding complex|RNA-induced silencing complex	protein binding|RNA cap binding|translation initiation factor activity			lung(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)|LUSC - Lung squamous cell carcinoma(721;0.00227)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	100068232	100068233	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100068232_100068233insT	uc003hum.1	+						ADH4_uc011ced.1_5'Flank|ADH4_uc003hun.2_5'Flank					Homo sapiens full length insert cDNA clone ZD94A03.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	101085262	101085262	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101085262delT								LOC256880 (211642 upstream) : DDIT4L (21767 downstream)																																			---	---	---	---
EMCN	51705	broad.mit.edu	37	4	101343980	101343980	+	Intron	DEL	T	-	-	rs71878999		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101343980delT	uc003hvr.2	-						EMCN_uc011cel.1_Intron|EMCN_uc011cem.1_Intron	NM_016242	NP_057326			endomucin isoform 1							extracellular region|integral to membrane|plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)														---	---	---	---
EMCN	51705	broad.mit.edu	37	4	101380461	101380462	+	Intron	INS	-	AT	AT	rs151082590	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101380461_101380462insAT	uc003hvr.2	-						EMCN_uc011cel.1_Intron|EMCN_uc011cem.1_Intron	NM_016242	NP_057326			endomucin isoform 1							extracellular region|integral to membrane|plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	101741357	101741357	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101741357delA								EMCN (302107 upstream) : PPP3CA (203230 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	105735623	105735624	+	IGR	DEL	AA	-	-	rs111313515		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105735623_105735624delAA								CXXC4 (319565 upstream) : TET2 (332319 downstream)																																			---	---	---	---
TET2	54790	broad.mit.edu	37	4	106141755	106141755	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106141755delA	uc003hxk.2	+						TET2_uc011cez.1_Intron|TET2_uc010ilp.1_Intron|TET2_uc003hxi.1_Intron	NM_001127208	NP_001120680			tet oncogene family member 2 isoform a						cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)				Mis N|F		MDS								---	---	---	---
TBCK	93627	broad.mit.edu	37	4	107143664	107143665	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107143664_107143665insT	uc010ilv.2	-						TBCK_uc003hyb.2_Intron|TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907			TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	107708462	107708463	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107708462_107708463insT								AIMP1 (438083 upstream) : DKK2 (134497 downstream)																																			---	---	---	---
PAPSS1	9061	broad.mit.edu	37	4	108633840	108633840	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108633840delC	uc003hyk.2	-						PAPSS1_uc011cfh.1_Intron	NM_005443	NP_005434			3'-phosphoadenosine 5'-phosphosulfate synthase						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process|skeletal system development|sulfate assimilation|xenobiotic metabolic process	cytosol	adenylylsulfate kinase activity|ATP binding|sulfate adenylyltransferase (ATP) activity			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	110955421	110955421	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110955421delA								EGF (22010 upstream) : ELOVL6 (14809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	113664674	113664677	+	IGR	DEL	CTTT	-	-	rs77490918		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113664674_113664677delCTTT								LARP7 (85933 upstream) : ANK2 (74562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	114786889	114786889	+	IGR	DEL	A	-	-	rs56982195		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114786889delA								CAMK2D (103806 upstream) : ARSJ (34551 downstream)																																			---	---	---	---
NDST4	64579	broad.mit.edu	37	4	115829696	115829696	+	Intron	DEL	T	-	-	rs11292247		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115829696delT	uc003ibu.2	-						NDST4_uc010imw.2_Intron	NM_022569	NP_072091			heparan sulfate N-deacetylase/N-sulfotransferase							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	118244113	118244114	+	IGR	INS	-	AC	AC	rs139952064	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118244113_118244114insAC								TRAM1L1 (237377 upstream) : NDST3 (710659 downstream)																																			---	---	---	---
NDST3	9348	broad.mit.edu	37	4	119096758	119096758	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119096758delA	uc003ibx.2	+						NDST3_uc011cgf.1_Intron	NM_004784	NP_004775			N-deacetylase/N-sulfotransferase (heparan							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1																		---	---	---	---
SEC24D	9871	broad.mit.edu	37	4	119691493	119691494	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119691493_119691494insA	uc003ici.3	-						SEC24D_uc003icj.3_Intron|SEC24D_uc003icl.2_Intron|SEC24D_uc010imz.1_Intron	NM_014822	NP_055637			Sec24-related protein D						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0																		---	---	---	---
PDE5A	8654	broad.mit.edu	37	4	120484959	120484959	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120484959delA	uc003idh.2	-						PDE5A_uc003idf.2_Intron|PDE5A_uc003idg.2_Intron	NM_001083	NP_001074			phosphodiesterase 5A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|zinc ion binding				0					Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Vardenafil(DB00862)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	120822034	120822034	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120822034delT								PDE5A (272053 upstream) : MAD2L1 (158545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	120841449	120841449	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120841449delA								PDE5A (291468 upstream) : MAD2L1 (139130 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	129262921	129262922	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129262921_129262922insT								PGRMC2 (53973 upstream) : PHF17 (467857 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	133192473	133192474	+	IGR	INS	-	T	T	rs148117808	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:133192473_133192474insT								None (None upstream) : PCDH10 (877996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	136857482	136857483	+	IGR	INS	-	CTTA	CTTA	rs148700506	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:136857482_136857483insCTTA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137409885	137409887	+	IGR	DEL	AGA	-	-	rs33982196		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137409885_137409887delAGA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	138686254	138686254	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138686254delT								PCDH18 (232606 upstream) : SLC7A11 (398994 downstream)																																			---	---	---	---
C4orf49	84709	broad.mit.edu	37	4	140199738	140199739	+	Intron	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140199738_140199739delGT	uc003ihr.1	-							NM_032623	NP_116012			ovary-specific acidic protein							integral to membrane				central_nervous_system(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	144065197	144065197	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144065197delG								INPP4B (297593 upstream) : USP38 (40873 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	144872711	144872712	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:144872711_144872712insT	uc003ijl.2	+											Homo sapiens cDNA clone IMAGE:5268630.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	150690943	150690945	+	Intron	DEL	AAA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150690943_150690945delAAA	uc003ill.2	-											Homo sapiens cDNA clone IMAGE:5295442.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	150959642	150959643	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150959642_150959643insT								None (None upstream) : DCLK2 (40437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	152690041	152690042	+	IGR	INS	-	TGTTTTA	TGTTTTA	rs146077778	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152690041_152690042insTGTTTTA								PET112L (7895 upstream) : FBXW7 (552369 downstream)																																			---	---	---	---
FBXW7	55294	broad.mit.edu	37	4	153406768	153406768	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153406768delA	uc003ims.2	-						FBXW7_uc011cii.1_Intron|FBXW7_uc003imt.2_Intron|FBXW7_uc003imu.2_Intron	NM_033632	NP_361014			F-box and WD repeat domain containing 7 isoform						interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)						Mis|N|D|F		colorectal|endometrial|T-ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	4	153463543	153463543	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153463543delT								FBXW7 (7200 upstream) : TMEM154 (83728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	154047055	154047055	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154047055delG								FHDC1 (146207 upstream) : TRIM2 (27215 downstream)																																			---	---	---	---
SFRP2	6423	broad.mit.edu	37	4	154712391	154712400	+	5'Flank	DEL	GGCGTCCCCT	-	-	rs72189043		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154712391_154712400delGGCGTCCCCT	uc003inv.1	-							NM_003013	NP_003004			secreted frizzled-related protein 2 precursor						brain development|cardiac left ventricle morphogenesis|cell-cell signaling|dermatome development|hemopoietic stem cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|negative regulation of cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|outflow tract morphogenesis|patterning of blood vessels|positive regulation of angiogenesis|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell adhesion mediated by integrin|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of fat cell differentiation|positive regulation of peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter|regulation of stem cell division|sclerotome development	cytoplasm|extracellular matrix|extracellular space|plasma membrane	fibronectin binding|integrin binding|PDZ domain binding|receptor agonist activity|Wnt receptor activity|Wnt-protein binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.093)	Renal(120;0.117)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	158456748	158456748	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158456748delC								GRIA2 (169524 upstream) : LOC340017 (36894 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	160027852	160027852	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160027852delT								C4orf45 (3747 upstream) : RAPGEF2 (161146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	160969203	160969205	+	IGR	DEL	AAC	-	-	rs112582181		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160969203_160969205delAAC								RAPGEF2 (687904 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	161364115	161364115	+	IGR	DEL	T	-	-	rs147340748		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161364115delT								None (None upstream) : FSTL5 (940936 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	162003695	162003695	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162003695delT								None (None upstream) : FSTL5 (301356 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	162068774	162068774	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162068774delA								None (None upstream) : FSTL5 (236277 downstream)																																			---	---	---	---
TLL1	7092	broad.mit.edu	37	4	166793851	166793851	+	5'Flank	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166793851delT	uc003irh.1	+						TLL1_uc011cjn.1_5'Flank|TLL1_uc011cjo.1_5'Flank	NM_012464	NP_036596			tolloid-like 1 precursor						cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)														---	---	---	---
C4orf27	54969	broad.mit.edu	37	4	170657990	170657990	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170657990delA	uc003isl.3	-							NM_017867	NP_060337			hypothetical protein LOC54969							nucleus				ovary(1)|pancreas(1)	2		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.018)|LUSC - Lung squamous cell carcinoma(193;0.116)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	170775066	170775066	+	IGR	DEL	T	-	-	rs113773679		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170775066delT								C4orf27 (95973 upstream) : MFAP3L (132684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	171566771	171566772	+	IGR	INS	-	T	T	rs141149331	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:171566771_171566772insT								AADAT (555399 upstream) : None (None downstream)																																			---	---	---	---
LOC285501	285501	broad.mit.edu	37	4	178787804	178787804	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178787804delA	uc010iru.2	+							NR_028342				Homo sapiens cDNA clone IMAGE:4828874.												0		all_lung(41;6.03e-08)|Lung NSC(41;4.26e-07)|Breast(14;0.00066)|Melanoma(52;0.00168)|Prostate(90;0.0129)|all_hematologic(60;0.0202)|Renal(120;0.0246)|Colorectal(36;0.0508)|Hepatocellular(41;0.236)		all cancers(43;9.24e-25)|Epithelial(43;6.28e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.29e-10)|LUSC - Lung squamous cell carcinoma(1;2.61e-05)|Lung(1;3.22e-05)|GBM - Glioblastoma multiforme(59;0.000185)|Colorectal(24;0.000244)|STAD - Stomach adenocarcinoma(60;0.000777)|COAD - Colon adenocarcinoma(29;0.000884)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	182341765	182341766	+	IGR	INS	-	TCA	TCA	rs141475653	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:182341765_182341766insTCA								None (None upstream) : MGC45800 (718393 downstream)																																			---	---	---	---
ODZ3	55714	broad.mit.edu	37	4	183457469	183457469	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183457469delT	uc003ivd.1	+							NM_001080477	NP_001073946			odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	184952062	184952062	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184952062delT								STOX2 (13187 upstream) : ENPP6 (57798 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	188185835	188185835	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:188185835delA								FAT1 (537985 upstream) : ZFP42 (731090 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190573499	190573500	+	IGR	INS	-	A	A	rs112523340		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190573499_190573500insA								None (None upstream) : FRG1 (288474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190578533	190578534	+	IGR	INS	-	TA	TA	rs139065125		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190578533_190578534insTA								None (None upstream) : FRG1 (283440 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190675417	190675419	+	IGR	DEL	CAA	-	-	rs112837284		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190675417_190675419delCAA								None (None upstream) : FRG1 (186555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190917343	190917343	+	IGR	DEL	G	-	-	rs151260771		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190917343delG								TUBB4Q (11319 upstream) : LOC653545 (91223 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3081076	3081079	+	IGR	DEL	TGTG	-	-	rs145774886		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3081076_3081079delTGTG								C5orf38 (325564 upstream) : IRX1 (515089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3276160	3276160	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3276160delC								C5orf38 (520648 upstream) : IRX1 (320008 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4456662	4456662	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4456662delA								IRX1 (855146 upstream) : LOC340094 (577810 downstream)																																			---	---	---	---
ADAMTS16	170690	broad.mit.edu	37	5	5184450	5184451	+	Intron	INS	-	TG	TG	rs151128802	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5184450_5184451insTG	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc003jdj.1_Intron	NM_139056	NP_620687			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	5658234	5658234	+	IGR	DEL	A	-	-	rs4634323		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5658234delA								KIAA0947 (167897 upstream) : FLJ33360 (652320 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	6512133	6512133	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6512133delA								UBE2QL1 (19428 upstream) : LOC255167 (70154 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	6812918	6812919	+	IGR	INS	-	A	A	rs143853790		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6812918_6812919insA								PAPD7 (55757 upstream) : ADCY2 (583424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	6850303	6850305	+	IGR	DEL	GAT	-	-	rs138660792		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6850303_6850305delGAT								PAPD7 (93142 upstream) : ADCY2 (546038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	6888535	6888535	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6888535delG								PAPD7 (131374 upstream) : ADCY2 (507808 downstream)																																			---	---	---	---
ADCY2	108	broad.mit.edu	37	5	7493526	7493526	+	Intron	DEL	G	-	-	rs113111865		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7493526delG	uc003jdz.1	+							NM_020546	NP_065433			adenylate cyclase 2						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	8401674	8401675	+	Intron	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8401674_8401675delCA	uc003jeh.1	-											Homo sapiens cDNA clone IMAGE:5297486.																														---	---	---	---
SEMA5A	9037	broad.mit.edu	37	5	9267454	9267454	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9267454delA	uc003jek.2	-							NM_003966	NP_003957			semaphorin 5A precursor						cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	10587380	10587380	+	IGR	DEL	T	-	-	rs67111138		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10587380delT								ROPN1L (122243 upstream) : DAP (91963 downstream)																																			---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11109850	11109850	+	Intron	DEL	C	-	-	rs61754605		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11109850delC	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	13637900	13637900	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13637900delT								None (None upstream) : DNAH5 (52537 downstream)																																			---	---	---	---
TRIO	7204	broad.mit.edu	37	5	14253171	14253171	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14253171delA	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc011cna.1_Intron	NM_007118	NP_009049			triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)																	---	---	---	---
FBXL7	23194	broad.mit.edu	37	5	15577704	15577705	+	Intron	DEL	TG	-	-	rs34405217		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15577704_15577705delTG	uc003jfn.1	+							NM_012304	NP_036436			F-box and leucine-rich repeat protein 7						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3																		---	---	---	---
MARCH11	441061	broad.mit.edu	37	5	16151759	16151760	+	Intron	DEL	TG	-	-	rs71605525		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16151759_16151760delTG	uc003jfo.2	-							NM_001102562	NP_001096032			membrane-associated ring finger (C3HC4) 11							cytoplasmic vesicle membrane|integral to membrane	ligase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	16411710	16411711	+	IGR	INS	-	AG	AG	rs145742923		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16411710_16411711insAG								MARCH11 (231813 upstream) : ZNF622 (39918 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	17339553	17339553	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17339553delT								BASP1 (62618 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	17641017	17641018	+	IGR	DEL	AC	-	-	rs144100170		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17641017_17641018delAC								BASP1 (364082 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	20964125	20964126	+	IGR	DEL	AC	-	-	rs138619860		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20964125_20964126delAC								CDH18 (975818 upstream) : GUSBP1 (377816 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	21057318	21057318	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21057318delA								None (None upstream) : GUSBP1 (284624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	21071165	21071165	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21071165delT								None (None upstream) : GUSBP1 (270777 downstream)																																			---	---	---	---
CDH12	1010	broad.mit.edu	37	5	21916620	21916620	+	Intron	DEL	T	-	-	rs113750015		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21916620delT	uc010iuc.2	-						CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Intron	NM_004061	NP_004052			cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	24236501	24236504	+	IGR	DEL	GTGT	-	-	rs71856865		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24236501_24236504delGTGT								PRDM9 (707797 upstream) : CDH10 (250706 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	24416419	24416420	+	IGR	DEL	GT	-	-	rs147893128		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24416419_24416420delGT								PRDM9 (887715 upstream) : CDH10 (70790 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	26259336	26259336	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26259336delG								None (None upstream) : CDH9 (621373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	26291959	26291960	+	IGR	INS	-	TG	TG	rs138311788	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26291959_26291960insTG								None (None upstream) : CDH9 (588749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	27434009	27434009	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27434009delG								CDH9 (395320 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	30044678	30044679	+	IGR	INS	-	AAG	AAG	rs139313211	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30044678_30044679insAAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	30252512	30252512	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30252512delC								None (None upstream) : CDH6 (941284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	30392886	30392886	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30392886delC								None (None upstream) : CDH6 (800910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	31380176	31380179	+	IGR	DEL	TTTG	-	-	rs34736523		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31380176_31380179delTTTG								CDH6 (54939 upstream) : RNASEN (20423 downstream)																																			---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	31657349	31657349	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31657349delT	uc003jhl.2	+							NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	32199484	32199487	+	IGR	DEL	GTGT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32199484_32199487delGTGT								GOLPH3 (25059 upstream) : MTMR12 (27625 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	34538401	34538401	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34538401delA								C1QTNF3 (495084 upstream) : RAI14 (118032 downstream)																																			---	---	---	---
RAI14	26064	broad.mit.edu	37	5	34654018	34654019	+	5'Flank	DEL	AA	-	-	rs148233261		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34654018_34654019delAA	uc003jir.2	+						RAI14_uc010iur.2_5'Flank|RAI14_uc011coj.1_5'Flank	NM_015577	NP_056392			retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)																	---	---	---	---
RAI14	26064	broad.mit.edu	37	5	34753480	34753480	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34753480delG	uc003jir.2	+						RAI14_uc010iur.2_Intron|RAI14_uc011coj.1_Intron|RAI14_uc010ius.1_Intron|RAI14_uc003jis.2_Intron|RAI14_uc003jit.2_Intron|RAI14_uc011cok.1_Intron	NM_015577	NP_056392			retinoic acid induced 14 isoform a							cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)																	---	---	---	---
Unknown	0	broad.mit.edu	37	5	38003142	38003142	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38003142delA								GDNF (163360 upstream) : EGFLAM (255391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	38724353	38724354	+	IGR	INS	-	CACA	CACA	rs149977215	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38724353_38724354insCACA								LIFR (128846 upstream) : OSMR (121774 downstream)																																			---	---	---	---
CARD6	84674	broad.mit.edu	37	5	40847906	40847906	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40847906delT	uc003jmg.2	+							NM_032587	NP_115976			caspase recruitment domain family, member 6						apoptosis|regulation of apoptosis	intracellular				ovary(2)|skin(2)|lung(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	40894760	40894760	+	IGR	DEL	T	-	-	rs11338570		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40894760delT								CARD6 (39306 upstream) : C7 (14839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	42100849	42100849	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42100849delT								FBXO4 (159186 upstream) : GHR (323177 downstream)																																			---	---	---	---
GHR	2690	broad.mit.edu	37	5	42443714	42443715	+	Intron	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42443714_42443715delGT	uc003jmt.2	+						uc003jmu.2_Intron|uc003jmv.1_Intron	NM_000163	NP_000154			growth hormone receptor precursor						2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)													---	---	---	---
ITGA2	3673	broad.mit.edu	37	5	52372888	52372889	+	Intron	DEL	AT	-	-	rs3212597		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52372888_52372889delAT	uc003joy.2	+						ITGA2_uc011cqa.1_Intron|ITGA2_uc011cqb.1_Intron|ITGA2_uc011cqc.1_Intron|ITGA2_uc011cqd.1_Intron|ITGA2_uc011cqe.1_Intron	NM_002203	NP_002194			integrin alpha 2 precursor						axon guidance|blood coagulation|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|organ morphogenesis	integrin complex	collagen binding|identical protein binding|receptor activity			lung(1)	1		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)																---	---	---	---
Unknown	0	broad.mit.edu	37	5	53112756	53112757	+	IGR	INS	-	T	T	rs142202797	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53112756_53112757insT								NDUFS4 (133585 upstream) : ARL15 (67857 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	53987290	53987291	+	IGR	INS	-	AC	AC	rs147114919	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53987290_53987291insAC								SNX18 (144875 upstream) : ESM1 (286405 downstream)																																			---	---	---	---
GZMK	3003	broad.mit.edu	37	5	54325281	54325281	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54325281delG	uc003jpl.1	+							NM_002104	NP_002095			granzyme K precursor						proteolysis	extracellular region	serine-type endopeptidase activity				0		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)																---	---	---	---
SLC38A9	153129	broad.mit.edu	37	5	54962427	54962427	+	Intron	DEL	A	-	-	rs35594073		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54962427delA	uc003jqf.2	-						SLC38A9_uc003jqd.2_Intron|SLC38A9_uc010ivx.2_Intron|SLC38A9_uc003jqe.2_Intron|SLC38A9_uc010ivy.2_Intron	NM_173514	NP_775785			solute carrier family 38, member 9						amino acid transport|sodium ion transport	integral to membrane					0		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)																---	---	---	---
SLC38A9	153129	broad.mit.edu	37	5	54994771	54994772	+	Intron	INS	-	CAAA	CAAA	rs141792256	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54994771_54994772insCAAA	uc003jqf.2	-						SLC38A9_uc010ivy.2_Intron	NM_173514	NP_775785			solute carrier family 38, member 9						amino acid transport|sodium ion transport	integral to membrane					0		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)																---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58294034	58294034	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58294034delA	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jrt.2_Intron|PDE4D_uc003jru.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc010iwi.1_Intron|PDE4D_uc003jrs.2_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58501027	58501028	+	Intron	INS	-	T	T	rs142227475	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58501027_58501028insT	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc010iwi.1_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
MAST4	375449	broad.mit.edu	37	5	66373021	66373021	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66373021delT	uc003jut.1	+						MAST4_uc003jus.2_Intron|MAST4_uc003juu.1_Intron|MAST4_uc011cra.1_Intron|MAST4_uc010ixa.2_Intron|MAST4_uc003juv.2_Intron|MAST4_uc003juw.2_Intron	NM_015183	NP_055998			microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	68144427	68144427	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68144427delA								PIK3R1 (546780 upstream) : SLC30A5 (245391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	71264113	71264113	+	IGR	DEL	T	-	-	rs35721700		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71264113delT								CARTPT (247241 upstream) : MAP1B (139005 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	72622543	72622544	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72622543_72622544delTG								TMEM174 (151575 upstream) : FOXD1 (119543 downstream)																																			---	---	---	---
IQGAP2	10788	broad.mit.edu	37	5	75711768	75711768	+	Intron	DEL	A	-	-	rs71604286		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75711768delA	uc003kek.2	+							NM_006633	NP_006624			IQ motif containing GTPase activating protein 2						small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)														---	---	---	---
HOMER1	9456	broad.mit.edu	37	5	78737118	78737118	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78737118delG	uc003kfy.2	-						HOMER1_uc010jab.2_Intron|HOMER1_uc010jac.2_Intron|HOMER1_uc010jad.2_Intron	NM_004272	NP_004263			homer 1						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane					0		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)														---	---	---	---
RASGRF2	5924	broad.mit.edu	37	5	80462683	80462683	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80462683delA	uc003kha.1	+						RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840			Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	82680334	82680335	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82680334_82680335delAC								XRCC4 (30757 upstream) : VCAN (87158 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	84223778	84223779	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:84223778_84223779delTG								EDIL3 (543167 upstream) : None (None downstream)																																			---	---	---	---
MEF2C	4208	broad.mit.edu	37	5	88038706	88038707	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88038706_88038707insT	uc003kjj.2	-						MEF2C_uc003kji.2_Intron|MEF2C_uc003kjk.2_Intron|MEF2C_uc003kjm.2_Intron|MEF2C_uc003kjl.2_Intron	NM_002397	NP_002388			myocyte enhancer factor 2C isoform 1						apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			lung(3)|breast(2)|ovary(1)|large_intestine(1)	7		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)											HNSCC(66;0.2)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	89657132	89657132	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89657132delA								None (None upstream) : CETN3 (32399 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	90634235	90634236	+	IGR	INS	-	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90634235_90634236insG								GPR98 (174203 upstream) : ARRDC3 (30305 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	90992084	90992085	+	IGR	INS	-	T	T	rs140307123	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90992084_90992085insT								LOC100129716 (275553 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	91765104	91765105	+	IGR	DEL	CA	-	-	rs34889690		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91765104_91765105delCA								None (None upstream) : FLJ42709 (979960 downstream)																																			---	---	---	---
FLJ42709	441094	broad.mit.edu	37	5	92791549	92791550	+	Intron	INS	-	CACA	CACA	rs148016646	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:92791549_92791550insCACA	uc003kkc.2	-						FLJ42709_uc003kkd.2_Intron|FLJ42709_uc011cud.1_Intron|FLJ42709_uc003kke.2_Intron|FLJ42709_uc011cue.1_Intron|FLJ42709_uc010jbb.1_Intron|FLJ42709_uc003kkf.2_Intron|FLJ42709_uc003kkg.2_Intron					Homo sapiens cDNA FLJ38400 fis, clone FEBRA2008159.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	97622708	97622709	+	IGR	DEL	GT	-	-	rs112532523		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97622708_97622709delGT								None (None upstream) : RGMB (482290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	99095119	99095120	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99095119_99095120insT								CHD1 (832881 upstream) : LOC100133050 (620089 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	103825039	103825040	+	IGR	INS	-	T	T	rs143621541	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103825039_103825040insT								NUDT12 (926549 upstream) : RAB9BP1 (610135 downstream)																																			---	---	---	---
EFNA5	1946	broad.mit.edu	37	5	106845019	106845019	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106845019delT	uc003kol.2	-						EFNA5_uc010jbr.1_Intron	NM_001962	NP_001953			ephrin-A5 precursor						cell-cell signaling	anchored to plasma membrane|caveola|extracellular space	ephrin receptor binding				0		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)														---	---	---	---
FER	2241	broad.mit.edu	37	5	108311359	108311362	+	Intron	DEL	AGTG	-	-	rs142192511		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108311359_108311362delAGTG	uc003kop.1	+						FER_uc011cvg.1_Intron	NM_005246	NP_005237			fer (fps/fes related) tyrosine kinase						intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	110159875	110159875	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110159875delC								SLC25A46 (61393 upstream) : TSLP (245903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	111830456	111830456	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111830456delG								FLJ11235 (73783 upstream) : APC (212762 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	114052650	114052650	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114052650delC	uc003kqr.1	-											Homo sapiens cDNA FLJ40367 fis, clone TESTI2034785.																														---	---	---	---
SEMA6A	57556	broad.mit.edu	37	5	115814626	115814629	+	Intron	DEL	GTGT	-	-	rs113477307		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115814626_115814629delGTGT	uc010jck.2	-						SEMA6A_uc003krx.3_Intron|SEMA6A_uc003krw.3_5'Flank|SEMA6A_uc010jcj.2_Intron	NM_020796	NP_065847			sema domain, transmembrane domain (TM), and						apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	120321007	120321007	+	IGR	DEL	T	-	-	rs142947993	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120321007delT								PRR16 (298045 upstream) : FTMT (866643 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	123960348	123960348	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123960348delG								None (None upstream) : ZNF608 (12262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	124131484	124131485	+	IGR	DEL	TC	-	-	rs35047798		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124131484_124131485delTC								ZNF608 (46984 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	124480108	124480109	+	IGR	INS	-	T	T	rs140762506	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:124480108_124480109insT								ZNF608 (395608 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	125575758	125575759	+	IGR	INS	-	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125575758_125575759insG								None (None upstream) : GRAMD3 (120029 downstream)																																			---	---	---	---
MEGF10	84466	broad.mit.edu	37	5	126775114	126775116	+	Intron	DEL	TAA	-	-	rs149689882		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126775114_126775116delTAA	uc003kuh.3	+						MEGF10_uc003kui.3_Intron	NM_032446	NP_115822			multiple EGF-like-domains 10 precursor						cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)														---	---	---	---
FBN2	2201	broad.mit.edu	37	5	127611135	127611135	+	Intron	DEL	T	-	-	rs72152773		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127611135delT	uc003kuu.2	-							NM_001999	NP_001990			fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	133523060	133523060	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133523060delA								SKP1 (10336 upstream) : PPP2CA (9089 downstream)																																			---	---	---	---
SPOCK1	6695	broad.mit.edu	37	5	136501031	136501032	+	Intron	INS	-	G	G	rs144495713	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136501031_136501032insG	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589			sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
CTNNA1	1495	broad.mit.edu	37	5	138217450	138217451	+	Intron	INS	-	TTG	TTG	rs139374336	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138217450_138217451insTTG	uc003ldh.2	+						CTNNA1_uc011cyx.1_Intron|CTNNA1_uc011cyy.1_Intron|CTNNA1_uc003ldi.2_Intron|CTNNA1_uc003ldj.2_Intron|CTNNA1_uc003ldl.2_Intron	NM_001903	NP_001894			catenin, alpha 1						adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding			breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
TMCO6	55374	broad.mit.edu	37	5	140017559	140017560	+	5'Flank	INS	-	CTTT	CTTT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140017559_140017560insCTTT	uc003lgl.2	+						TMCO6_uc011czj.1_5'Flank|TMCO6_uc003lgm.2_5'Flank|TMCO6_uc010jft.2_5'Flank	NM_018502	NP_060972			transmembrane and coiled-coil domains 6						protein import into nucleus	cytoplasm|nuclear pore	binding|protein transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	140440747	140440747	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140440747delA								PCDHB1 (7235 upstream) : PCDHB2 (33490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	141642450	141642450	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141642450delT								NDFIP1 (108444 upstream) : SPRY4 (47542 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	141853184	141853184	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141853184delT								SPRY4 (148564 upstream) : FGF1 (118560 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	144307611	144307612	+	IGR	INS	-	A	A	rs138562752	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:144307611_144307612insA								KCTD16 (450667 upstream) : PRELID2 (830970 downstream)																																			---	---	---	---
IRGM	345611	broad.mit.edu	37	5	150224715	150224716	+	5'Flank	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150224715_150224716delGT	uc010jhk.2	+							NM_001145805	NP_001139277			immunity-related GTPase family, M						autophagy|inflammatory response|innate immune response	autophagic vacuole membrane|cell projection|Golgi membrane|phagocytic cup|phagocytic vesicle membrane	GTP binding|hydrolase activity, acting on acid anhydrides				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	151196192	151196193	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151196192_151196193insT								G3BP1 (11279 upstream) : GLRA1 (5882 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	154749135	154749136	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154749135_154749136delAC								KIF4B (351450 upstream) : SGCD (385927 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	156401452	156401452	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156401452delC								TIMD4 (11186 upstream) : HAVCR1 (55079 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	156493067	156493068	+	IGR	DEL	AA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156493067_156493068delAA								HAVCR1 (6937 upstream) : HAVCR2 (19775 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	157950876	157950876	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157950876delT								CLINT1 (664708 upstream) : EBF1 (172048 downstream)																																			---	---	---	---
LOC285627	285627	broad.mit.edu	37	5	158881909	158881909	+	Intron	DEL	T	-	-	rs71903126		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158881909delT	uc011deb.1	-							NR_027110				Homo sapiens hypothetical protein LOC285627, mRNA (cDNA clone IMAGE:4837428).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	165830936	165830937	+	IGR	INS	-	T	T	rs112842214		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165830936_165830937insT								None (None upstream) : ODZ2 (880906 downstream)																																			---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	167234643	167234645	+	Intron	DEL	AAG	-	-	rs35024694		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167234643_167234645delAAG	uc010jjd.2	+						ODZ2_uc003lzq.2_Intron|ODZ2_uc003lzr.3_Intron	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168572463	168572463	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168572463delA	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053			slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
TLX3	30012	broad.mit.edu	37	5	170737735	170737736	+	Intron	DEL	GG	-	-	rs2914336		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170737735_170737736delGG	uc003mbf.2	+						uc003mbe.1_5'Flank	NM_021025	NP_066305			T-cell leukemia homeobox 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)					T	BCL11B	T-ALL								---	---	---	---
FGF18	8817	broad.mit.edu	37	5	170876393	170876410	+	Intron	DEL	GTGTGTGTGTGTGAGAGA	-	-	rs72212268	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170876393_170876410delGTGTGTGTGTGTGAGAGA	uc003mbk.2	+							NM_003862	NP_003853			fibroblast growth factor 18 precursor						cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell proliferation	extracellular space|nucleolus	growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	171087966	171087969	+	IGR	DEL	GTAG	-	-	rs5873274		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171087966_171087969delGTAG								FGF18 (203804 upstream) : FBXW11 (200587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	180180265	180180265	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180180265delC								OR2Y1 (13207 upstream) : MGAT1 (37278 downstream)																																			---	---	---	---
MGAT1	4245	broad.mit.edu	37	5	180224843	180224844	+	Intron	INS	-	TCTTCACA	TCTTCACA	rs148804538	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180224843_180224844insTCTTCACA	uc003mmg.3	-						MGAT1_uc010jlf.2_Intron|MGAT1_uc010jlg.2_Intron|MGAT1_uc003mmh.3_Intron|MGAT1_uc010jlh.2_Intron|MGAT1_uc003mmi.3_Intron	NM_002406	NP_002397			mannosyl (alpha-1,3-)-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(1)	1	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
LOC285768	285768	broad.mit.edu	37	6	994379	994382	+	Intron	DEL	TATG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:994379_994382delTATG	uc011dhp.1	-						LOC285768_uc010jnf.1_Intron|LOC285768_uc003mtj.2_Intron	NR_027115				Homo sapiens cDNA clone IMAGE:5272115.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	2301577	2301577	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2301577delG								GMDS (55731 upstream) : C6orf195 (321395 downstream)																																			---	---	---	---
SLC22A23	63027	broad.mit.edu	37	6	3337681	3337681	+	Intron	DEL	T	-	-	rs112272605		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3337681delT	uc003mvm.3	-						SLC22A23_uc003mvn.3_Intron|SLC22A23_uc003mvo.3_Intron|SLC22A23_uc003mvp.1_Intron|SLC22A23_uc010jnn.2_Intron|SLC22A23_uc010jno.2_Intron	NM_015482	NP_056297			solute carrier family 22, member 23 isoform a						ion transport	integral to membrane	transmembrane transporter activity			ovary(1)	1	Ovarian(93;0.0493)	all_hematologic(90;0.0905)																---	---	---	---
LYRM4	57128	broad.mit.edu	37	6	5143452	5143453	+	Intron	INS	-	GTGGAGTCTGATGCCGT	GTGGAGTCTGATGCCGT	rs147146820	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5143452_5143453insGTGGAGTCTGATGCCGT	uc003mwp.2	-						LYRM4_uc010jnu.2_Intron|LYRM4_uc003mwq.2_Intron|uc003mwn.1_Intron	NM_020408	NP_065141			LYR motif containing 4 isoform 1							mitochondrion|nucleus					0	Ovarian(93;0.11)	all_hematologic(90;0.0901)																---	---	---	---
FARS2	10667	broad.mit.edu	37	6	5551220	5551220	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5551220delT	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558			phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	5788092	5788092	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5788092delT								FARS2 (16276 upstream) : NRN1 (210143 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	6080756	6080757	+	IGR	DEL	AC	-	-	rs35447426		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6080756_6080757delAC								NRN1 (73123 upstream) : F13A1 (63555 downstream)																																			---	---	---	---
LOC285780	285780	broad.mit.edu	37	6	6501170	6501171	+	Intron	INS	-	A	A	rs144408418	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6501170_6501171insA	uc003mww.3	-						LOC285780_uc003mwx.2_Intron	NR_026970				Homo sapiens cDNA FLJ33708 fis, clone BRAWH2007862.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	6674709	6674710	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6674709_6674710delGT								LY86 (19493 upstream) : RREB1 (433478 downstream)																																			---	---	---	---
TXNDC5	81567	broad.mit.edu	37	6	7940747	7940750	+	Intron	DEL	AGAG	-	-	rs144264776		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7940747_7940750delAGAG	uc003mxw.2	-							NM_001145549	NP_001139021			thioredoxin domain containing 5 isoform 3						anti-apoptosis|cell redox homeostasis|cellular membrane organization|glycerol ether metabolic process|post-Golgi vesicle-mediated transport	endoplasmic reticulum lumen|lysosomal lumen	electron carrier activity|isomerase activity|protein disulfide oxidoreductase activity				0	Ovarian(93;0.0398)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	8677248	8677249	+	Intron	INS	-	TG	TG	rs144599606	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8677248_8677249insTG	uc003mye.2	+											Homo sapiens, clone IMAGE:5539086, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	9591736	9591736	+	IGR	DEL	A	-	-	rs34980570		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9591736delA								HULC (937659 upstream) : TFAP2A (805181 downstream)																																			---	---	---	---
GCNT2	2651	broad.mit.edu	37	6	10494109	10494120	+	Intron	DEL	GCACACCTATAA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10494109_10494120delGCACACCTATAA	uc010jol.2	+						GCNT2_uc010jom.2_Intron					SubName: Full=Glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group); SubName: Full=Putative uncharacterized protein GCNT2;							Golgi membrane|integral to membrane	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity			ovary(2)	2	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	10644450	10644451	+	IGR	INS	-	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10644450_10644451insC								GCNT2 (14850 upstream) : C6orf52 (27202 downstream)																																			---	---	---	---
C6orf52	347744	broad.mit.edu	37	6	10694494	10694494	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10694494delA	uc011dij.1	-						C6orf52_uc011dik.1_Intron|C6orf52_uc003mzf.3_Intron|C6orf52_uc011dil.1_Intron|PAK1IP1_uc003mzg.2_5'Flank	NM_001145020	NP_001138492			hypothetical protein LOC347744												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	11929676	11929677	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11929676_11929677delCA								C6orf105 (150396 upstream) : HIVEP1 (83047 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	12388514	12388515	+	IGR	DEL	AC	-	-	rs60855752	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12388514_12388515delAC								EDN1 (91088 upstream) : PHACTR1 (328373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	15025713	15025714	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15025713_15025714insA								CD83 (888567 upstream) : JARID2 (220020 downstream)																																			---	---	---	---
JARID2	3720	broad.mit.edu	37	6	15520920	15520921	+	3'UTR	INS	-	CA	CA	rs72837838		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15520920_15520921insCA	uc003nbj.2	+	18					JARID2_uc011div.1_3'UTR	NM_004973	NP_004964			jumonji, AT rich interactive domain 2 protein						central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)																---	---	---	---
Unknown	0	broad.mit.edu	37	6	16038050	16038050	+	IGR	DEL	T	-	-	rs71639702		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16038050delT								DTNBP1 (374779 upstream) : MYLIP (91267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	17317117	17317117	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17317117delT								RBM24 (23020 upstream) : CAP2 (76619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	18075018	18075018	+	IGR	DEL	G	-	-	rs77451626		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18075018delG								KIF13A (87219 upstream) : NHLRC1 (45700 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	18742657	18742657	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18742657delT								MIR548A1 (170546 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	19313637	19313638	+	IGR	INS	-	GT	GT	rs147790214	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19313637_19313638insGT								MIR548A1 (741526 upstream) : ID4 (523979 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	20333571	20333572	+	IGR	INS	-	T	T	rs35666000		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20333571_20333572insT								MBOAT1 (120901 upstream) : E2F3 (68565 downstream)																																			---	---	---	---
SOX4	6659	broad.mit.edu	37	6	21596501	21596501	+	3'UTR	DEL	A	-	-	rs71835017		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21596501delA	uc003ndi.2	+	1						NM_003107	NP_003098			SRY (sex determining region Y)-box 4						canonical Wnt receptor signaling pathway|cardiac ventricle formation|cellular response to glucose stimulus|DNA damage response, detection of DNA damage|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|glial cell development|glial cell proliferation|limb bud formation|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein export from nucleus|negative regulation of protein ubiquitination|neural tube formation|neuroepithelial cell differentiation|noradrenergic neuron differentiation|positive regulation of apoptosis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell proliferation|positive regulation of insulin secretion|positive regulation of N-terminal peptidyl-lysine acetylation|positive regulation of translation|pro-B cell differentiation|protein stabilization|skeletal system development|spinal cord motor neuron differentiation|sympathetic nervous system development|T cell differentiation	mitochondrion|nucleus	core promoter sequence-specific DNA binding|protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|RNA polymerase II transcription coactivator activity				0	Ovarian(93;0.163)		all cancers(50;0.0751)|Epithelial(50;0.155)															---	---	---	---
FLJ22536	401237	broad.mit.edu	37	6	22051689	22051689	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22051689delT	uc003ndj.2	+						FLJ22536_uc011djk.1_Intron|FLJ22536_uc003ndl.2_Intron	NR_015410				Homo sapiens cDNA FLJ12803 fis, clone NT2RP2002172.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	22876514	22876515	+	IGR	INS	-	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22876514_22876515insC								HDGFL1 (305765 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	26709593	26709593	+	IGR	DEL	A	-	-	rs149660104		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26709593delA								ZNF322A (49630 upstream) : GUSBL1 (129673 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	27878351	27878352	+	IGR	DEL	TG	-	-	rs111499911		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27878351_27878352delTG								HIST1H2BO (16682 upstream) : OR2B2 (673 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	28091430	28091433	+	Intron	DEL	CACA	-	-	rs10536780		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28091430_28091433delCACA	uc010jqw.1	-						uc003nkk.1_Intron|uc003nkl.1_Intron|ZSCAN16_uc011dky.1_5'Flank|ZSCAN16_uc003nkm.2_5'Flank					SubName: Full=cDNA FLJ45995 fis, clone SKNMC2003639;																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	29663190	29663191	+	IGR	INS	-	T	T	rs71550150		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29663190_29663191insT								ZFP57 (14303 upstream) : HLA-F (27926 downstream)																																			---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29798581	29798582	+	3'UTR	INS	-	ATTTGTTCATGCCT	ATTTGTTCATGCCT	rs1704		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29798581_29798582insATTTGTTCATGCCT	uc003nnw.2	+	8					HLA-G_uc011dmb.1_Intron|HLA-G_uc003raj.3_3'UTR|HLA-G_uc003nnz.3_3'UTR|HLA-G_uc010jrn.2_3'UTR|HLA-G_uc003nny.3_RNA|HLA-G_uc003ran.1_Intron	NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29933334	29933336	+	Intron	DEL	TTG	-	-	rs79460057		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29933334_29933336delTTG	uc011dmb.1	+							NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
ABCF1	23	broad.mit.edu	37	6	30554696	30554696	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30554696delG	uc003nql.2	+						ABCF1_uc003nqm.2_Intron|ABCF1_uc010jsb.2_Intron	NM_001025091	NP_001020262			ATP-binding cassette, sub-family F, member 1						inflammatory response|translational initiation	nuclear envelope|nuclear envelope|nucleoplasm|nucleoplasm|polysomal ribosome	ATP binding|ATP binding|ATPase activity|protein binding|ribosome binding|translation activator activity|translation factor activity, nucleic acid binding			ovary(2)	2																		---	---	---	---
PSORS1C1	170679	broad.mit.edu	37	6	31094314	31094314	+	Intron	DEL	A	-	-	rs34047849		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31094314delA	uc003nsl.1	+						PSORS1C1_uc010jsj.1_Intron|PSORS1C1_uc003nsn.1_Intron	NM_014068	NP_054787			SEEK1 protein											ovary(1)	1																		---	---	---	---
PSORS1C1	170679	broad.mit.edu	37	6	31095620	31095620	+	Intron	DEL	G	-	-	rs11349600		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31095620delG	uc003nsl.1	+						PSORS1C1_uc010jsj.1_Intron|PSORS1C1_uc003nsn.1_Intron	NM_014068	NP_054787			SEEK1 protein											ovary(1)	1																		---	---	---	---
PSORS1C3	100130889	broad.mit.edu	37	6	31143128	31143128	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31143128delG	uc011dnh.1	-							NR_026816				Homo sapiens psoriasis susceptibility 1 candidate 3 (PSORS1C3) mRNA, complete cds.												0																		---	---	---	---
PSORS1C3	100130889	broad.mit.edu	37	6	31146315	31146316	+	5'Flank	INS	-	GATC	GATC	rs143488460	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31146315_31146316insGATC	uc011dnh.1	-							NR_026816				Homo sapiens psoriasis susceptibility 1 candidate 3 (PSORS1C3) mRNA, complete cds.												0																		---	---	---	---
HLA-B	3106	broad.mit.edu	37	6	31325404	31325404	+	5'Flank	DEL	C	-	-	rs33931933		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31325404delC	uc003nth.2	-						HLA-C_uc003ntb.2_5'Flank|HLA-B_uc010jsm.1_5'Flank|HLA-B_uc011dnk.1_5'Flank|HLA-B_uc003ntf.2_5'Flank|HLA-B_uc003ntg.1_5'Flank|HLA-B_uc003nti.1_5'Flank|HLA-B_uc010jsn.1_5'Flank|HLA-B_uc010jso.2_5'Flank	NM_005514	NP_005505			major histocompatibility complex, class I, B						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0														Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	6	32674025	32674026	+	IGR	INS	-	G	G	rs137880071	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32674025_32674026insG								HLA-DQB1 (39559 upstream) : HLA-DQA2 (35137 downstream)																																			---	---	---	---
HLA-DPB1	3115	broad.mit.edu	37	6	33070206	33070207	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33070206_33070207insA	uc011dqp.1	+							NM_002121	NP_002112			major histocompatibility complex, class II, DP						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to membrane|lysosomal membrane|MHC class II protein complex				ovary(1)	1																		---	---	---	---
MDGA1	266727	broad.mit.edu	37	6	37654208	37654209	+	Intron	INS	-	TT	TT	rs35643390		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37654208_37654209insTT	uc003onu.1	-							NM_153487	NP_705691			MAM domain containing						brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2																		---	---	---	---
ZFAND3	60685	broad.mit.edu	37	6	38091379	38091379	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38091379delC	uc003onx.2	+							NM_021943	NP_068762			zinc finger, AN1-type domain 3								DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	39011025	39011043	+	IGR	DEL	GGGAAGATAGAGGGCTGTG	-	-	rs72462529		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39011025_39011043delGGGAAGATAGAGGGCTGTG								DNAH8 (12458 upstream) : GLP1R (5514 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	39124537	39124538	+	IGR	INS	-	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39124537_39124538insG								C6orf64 (41672 upstream) : KCNK5 (32210 downstream)																																			---	---	---	---
KIF6	221458	broad.mit.edu	37	6	39324052	39324052	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39324052delT	uc003oot.2	-						KIF6_uc003oos.2_Intron|KIF6_uc010jwz.1_Intron|KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464			kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	40290014	40290015	+	IGR	INS	-	G	G	rs139375943	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40290014_40290015insG								MOCS1 (387760 upstream) : TDRG1 (56148 downstream)																																			---	---	---	---
LRFN2	57497	broad.mit.edu	37	6	40552554	40552555	+	Intron	INS	-	T	T	rs111498485		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40552554_40552555insT	uc003oph.1	-							NM_020737	NP_065788			leucine rich repeat and fibronectin type III							cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)																	---	---	---	---
Unknown	0	broad.mit.edu	37	6	41721682	41721683	+	IGR	INS	-	T	T	rs143618494	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41721682_41721683insT								PGC (6561 upstream) : FRS3 (16231 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	42459509	42459510	+	IGR	INS	-	TTTG	TTTG	rs149912291	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42459509_42459510insTTTG								TRERF1 (39644 upstream) : UBR2 (72548 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	42465198	42465198	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42465198delT								TRERF1 (45333 upstream) : UBR2 (66860 downstream)																																			---	---	---	---
PRPH2	5961	broad.mit.edu	37	6	42680465	42680465	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42680465delT	uc003osk.2	-							NM_000322	NP_000313			peripherin 2						cell adhesion|visual perception	integral to membrane				ovary(4)|central_nervous_system(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.00178)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0904)															---	---	---	---
KIAA0240	23506	broad.mit.edu	37	6	42827130	42827130	+	Intron	DEL	A	-	-	rs75646319		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42827130delA	uc003osn.1	+						KIAA0240_uc011duw.1_Intron|KIAA0240_uc003osp.1_Intron	NM_015349	NP_056164			hypothetical protein LOC23506											ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	43203403	43203404	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43203403_43203404delGT								C6orf108 (6192 upstream) : TTBK1 (7818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	43262057	43262059	+	IGR	DEL	CAC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43262057_43262059delCAC								TTBK1 (6060 upstream) : SLC22A7 (3939 downstream)																																			---	---	---	---
XPO5	57510	broad.mit.edu	37	6	43504155	43504155	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43504155delA	uc003ovp.2	-							NM_020750	NP_065801			exportin 5						gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	43710121	43710124	+	IGR	DEL	TCAA	-	-	rs147191481		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43710121_43710124delTCAA								MRPS18A (54593 upstream) : VEGFA (27829 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	43806315	43806316	+	IGR	INS	-	TAAG	TAAG	rs143492193	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43806315_43806316insTAAG								VEGFA (52094 upstream) : LOC100132354 (52449 downstream)																																	OREG0017459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	6	43957987	43957987	+	IGR	DEL	G	-	-	rs71671506		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43957987delG								LOC100132354 (52044 upstream) : C6orf223 (10352 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	44433843	44433843	+	IGR	DEL	T	-	-	rs34518772		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44433843delT								CDC5L (19064 upstream) : SUPT3H (343211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	45586896	45586896	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45586896delT								RUNX2 (68078 upstream) : CLIC5 (279294 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	49351022	49351022	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49351022delT								None (None upstream) : MUT (47972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	50151129	50151129	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50151129delA								DEFB112 (134765 upstream) : TFAP2D (530128 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	51136614	51136617	+	IGR	DEL	AAGG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51136614_51136617delAAGG								TFAP2B (321289 upstream) : PKHD1 (343528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	52474780	52474780	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52474780delA								TRAM2 (32918 upstream) : LOC730101 (54419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	52485785	52485786	+	IGR	INS	-	CT	CT	rs1160861		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52485785_52485786insCT								TRAM2 (43923 upstream) : LOC730101 (43413 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	53053310	53053310	+	IGR	DEL	A	-	-	rs35652916		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53053310delA								GCM1 (39686 upstream) : ELOVL5 (78886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	53464105	53464105	+	Intron	DEL	A	-	-	rs35418618		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53464105delA	uc003pby.1	-						uc003pbz.1_Intron|uc003pca.1_Intron					Homo sapiens cDNA FLJ43138 fis, clone CTONG3007244.																														---	---	---	---
LRRC1	55227	broad.mit.edu	37	6	53668386	53668387	+	Intron	INS	-	TG	TG	rs150574296	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53668386_53668387insTG	uc003pcd.1	+							NM_018214	NP_060684			leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	54499836	54499837	+	IGR	INS	-	A	A	rs147717488	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54499836_54499837insA								TINAG (244886 upstream) : FAM83B (211732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	54877528	54877529	+	IGR	DEL	AC	-	-	rs71715479		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54877528_54877529delAC								FAM83B (70711 upstream) : HCRTR2 (131973 downstream)																																			---	---	---	---
DST	667	broad.mit.edu	37	6	56789932	56789932	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56789932delT	uc003pdf.2	-							NM_001144769	NP_001138241			dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)															---	---	---	---
BEND6	221336	broad.mit.edu	37	6	56829306	56829307	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56829306_56829307insT	uc010kab.2	+						BEND6_uc003pdg.2_Intron	NM_152731	NP_689944			BEN domain containing 6												0																		---	---	---	---
KIAA1586	57691	broad.mit.edu	37	6	56909522	56909523	+	5'Flank	INS	-	AC	AC	rs147733571	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56909522_56909523insAC	uc003pdj.2	+						KIAA1586_uc011dxm.1_5'Flank	NM_020931	NP_065982			hypothetical protein LOC57691								nucleic acid binding				0	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)															---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57217028	57217028	+	Intron	DEL	A	-	-	rs66943114		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57217028delA	uc003pdx.2	+						PRIM2_uc003pdw.2_Intron	NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57296457	57296457	+	Intron	DEL	T	-	-	rs72873546		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57296457delT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57335858	57335859	+	Intron	INS	-	T	T	rs143024775	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57335858_57335859insT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57353602	57353602	+	Intron	DEL	A	-	-	rs68013861		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57353602delA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57360174	57360175	+	Intron	DEL	TG	-	-	rs145904207		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57360174_57360175delTG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57369333	57369334	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57369333_57369334insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57385850	57385851	+	Intron	INS	-	TCCTGA	TCCTGA	rs139159987		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57385850_57385851insTCCTGA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57420085	57420086	+	Intron	INS	-	GCAATA	GCAATA	rs10678736		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57420085_57420086insGCAATA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57432404	57432405	+	Intron	INS	-	TT	TT	rs147084165		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57432404_57432405insTT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57435592	57435593	+	Intron	INS	-	TG	TG	rs141506251		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57435592_57435593insTG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57436887	57436890	+	Intron	DEL	ACTC	-	-	rs149977851		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57436887_57436890delACTC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57474616	57474626	+	Intron	DEL	AGAATCACCTG	-	-	rs11267103		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57474616_57474626delAGAATCACCTG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57489445	57489446	+	Intron	DEL	CT	-	-	rs75214338		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57489445_57489446delCT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57534677	57534678	+	IGR	INS	-	ACTT	ACTT	rs138374545		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57534677_57534678insACTT								PRIM2 (21302 upstream) : GUSBL2 (711481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57538773	57538773	+	IGR	DEL	G	-	-	rs10707154		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57538773delG								PRIM2 (25398 upstream) : GUSBL2 (707386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57545076	57545077	+	IGR	INS	-	TT	TT	rs78884481		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57545076_57545077insTT								PRIM2 (31701 upstream) : GUSBL2 (701082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57553339	57553340	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57553339_57553340insA								PRIM2 (39964 upstream) : GUSBL2 (692819 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57559507	57559509	+	IGR	DEL	ATT	-	-	rs148750618		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57559507_57559509delATT								PRIM2 (46132 upstream) : GUSBL2 (686650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57565371	57565372	+	IGR	INS	-	CTA	CTA	rs149489760		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57565371_57565372insCTA								PRIM2 (51996 upstream) : GUSBL2 (680787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	57596115	57596116	+	IGR	INS	-	T	T	rs5010283	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57596115_57596116insT								PRIM2 (82740 upstream) : GUSBL2 (650043 downstream)																																			---	---	---	---
KHDRBS2	202559	broad.mit.edu	37	6	62399315	62399315	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62399315delG	uc003peg.2	-							NM_152688	NP_689901			KH domain-containing, RNA-binding, signal						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)														---	---	---	---
EYS	346007	broad.mit.edu	37	6	66259895	66259896	+	Intron	INS	-	CAG	CAG	rs143153413	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66259895_66259896insCAG	uc011dxu.1	-						EYS_uc003peq.2_Intron|EYS_uc003per.1_Intron|EYS_uc010kaj.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	66354272	66354272	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66354272delA	uc011dxu.1	-						EYS_uc003peq.2_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	66389123	66389123	+	Intron	DEL	A	-	-	rs34416868		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66389123delA	uc011dxu.1	-						EYS_uc003peq.2_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	66901781	66901782	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66901781_66901782insT								MCART3P (402406 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	69067567	69067568	+	IGR	INS	-	T	T	rs142985672	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69067567_69067568insT								None (None upstream) : BAI3 (278064 downstream)																																			---	---	---	---
COL19A1	1310	broad.mit.edu	37	6	70740082	70740082	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70740082delC	uc003pfc.1	+						COL19A1_uc010kam.1_Intron	NM_001858	NP_001849			alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4																		---	---	---	---
COL9A1	1297	broad.mit.edu	37	6	70990435	70990436	+	Intron	INS	-	C	C	rs149151375	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70990435_70990436insC	uc003pfg.3	-						COL9A1_uc003pfe.3_5'Flank|COL9A1_uc003pff.3_Intron	NM_001851	NP_001842			alpha 1 type IX collagen isoform 1 precursor						axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	75560075	75560075	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75560075delT								None (None upstream) : COL12A1 (233968 downstream)																																			---	---	---	---
FILIP1	27145	broad.mit.edu	37	6	76194780	76194781	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76194780_76194781insA	uc003pia.2	-						FILIP1_uc003phy.1_Intron|FILIP1_uc010kbe.2_Intron	NM_015687	NP_056502			filamin A interacting protein 1											skin(3)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	76936877	76936877	+	IGR	DEL	A	-	-	rs67215436		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76936877delA								IMPG1 (154542 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	77123455	77123456	+	IGR	INS	-	A	A	rs140593210	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:77123455_77123456insA								IMPG1 (341120 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	78150131	78150131	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78150131delC								None (None upstream) : HTR1B (21817 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	78917239	78917239	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78917239delC								HTR1B (744119 upstream) : IRAK1BP1 (659950 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	81102579	81102580	+	IGR	DEL	CT	-	-	rs150913214		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81102579_81102580delCT								BCKDHB (46592 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	84154719	84154720	+	IGR	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84154719_84154720delGA								ME1 (13940 upstream) : PRSS35 (67554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	85044016	85044016	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85044016delA								KIAA1009 (106681 upstream) : TBX18 (353065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	85514204	85514204	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85514204delT								TBX18 (40305 upstream) : NT5E (645098 downstream)																																			---	---	---	---
RNGTT	8732	broad.mit.edu	37	6	89436722	89436722	+	Intron	DEL	G	-	-	rs71554793		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89436722delG	uc003pmr.2	-						RNGTT_uc003pms.2_Intron|RNGTT_uc011dzu.1_Intron|RNGTT_uc003pmt.2_Intron	NM_003800	NP_003791			RNA guanylyltransferase and 5'-phosphatase						interspecies interaction between organisms|mRNA capping|transcription from RNA polymerase II promoter|viral reproduction	nucleoplasm	GTP binding|mRNA guanylyltransferase activity|polynucleotide 5'-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			upper_aerodigestive_tract(1)	1		all_cancers(76;4.07e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;6.86e-05)		BRCA - Breast invasive adenocarcinoma(108;0.151)														---	---	---	---
GABRR1	2569	broad.mit.edu	37	6	89888376	89888389	+	3'UTR	DEL	CATGGGTGGGTCCT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89888376_89888389delCATGGGTGGGTCCT	uc003pna.2	-	10					GABRR1_uc011dzv.1_3'UTR	NM_002042	NP_002033			gamma-aminobutyric acid (GABA) receptor, rho 1						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			pancreas(1)	1		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Picrotoxin(DB00466)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	93485363	93485364	+	IGR	DEL	TT	-	-	rs74684047		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93485363_93485364delTT								None (None upstream) : EPHA7 (464378 downstream)																																			---	---	---	---
EPHA7	2045	broad.mit.edu	37	6	93952901	93952901	+	3'UTR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93952901delA	uc003poe.2	-	17					EPHA7_uc003pof.2_3'UTR|EPHA7_uc011eac.1_3'UTR	NM_004440	NP_004431			ephrin receptor EphA7 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)														---	---	---	---
TSG1	643432	broad.mit.edu	37	6	94428783	94428784	+	Intron	INS	-	T	T	rs75200512		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:94428783_94428784insT	uc003poh.2	+						TSG1_uc003poj.2_Intron|TSG1_uc010kci.1_Intron|TSG1_uc003poi.2_Intron|TSG1_uc003pok.2_RNA|TSG1_uc003pol.1_Intron|TSG1_uc003pom.1_RNA					Homo sapiens tumor suppressor gene locus (TSG1) mRNA, alternatively spliced isoform A.												0																		---	---	---	---
TSG1	643432	broad.mit.edu	37	6	94443853	94443853	+	Intron	DEL	T	-	-	rs112421771		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:94443853delT	uc003poh.2	+						TSG1_uc003poj.2_Intron|TSG1_uc010kci.1_Intron|TSG1_uc003poi.2_Intron|TSG1_uc003pok.2_Intron|TSG1_uc003pol.1_Intron|TSG1_uc003pom.1_Intron					Homo sapiens tumor suppressor gene locus (TSG1) mRNA, alternatively spliced isoform A.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	94487787	94487789	+	IGR	DEL	CTC	-	-	rs142909115		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:94487787_94487789delCTC								TSG1 (1588 upstream) : None (None downstream)																																			---	---	---	---
C6orf167	253714	broad.mit.edu	37	6	97607825	97607827	+	Intron	DEL	TTT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97607825_97607827delTTT	uc003ppb.2	-						C6orf167_uc011eaf.1_Intron	NM_198468	NP_940870			hypothetical protein LOC253714						double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)														---	---	---	---
C6orf167	253714	broad.mit.edu	37	6	97656844	97656844	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97656844delC	uc003ppb.2	-						C6orf167_uc011eaf.1_Intron	NM_198468	NP_940870			hypothetical protein LOC253714						double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	99048285	99048285	+	IGR	DEL	A	-	-	rs112304977		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99048285delA								MIR2113 (575788 upstream) : POU3F2 (234295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	99514295	99514295	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99514295delT								FBXL4 (118446 upstream) : C6orf168 (206499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	105362254	105362254	+	IGR	DEL	T	-	-	rs35221285		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105362254delT								HACE1 (54460 upstream) : LIN28B (42669 downstream)																																			---	---	---	---
LIN28B	389421	broad.mit.edu	37	6	105432334	105432335	+	Intron	INS	-	T	T	rs59560098		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105432334_105432335insT	uc003pqv.1	+						LIN28B_uc010kda.1_Intron	NM_001004317	NP_001004317			lin-28 homolog B						miRNA catabolic process|pre-miRNA processing|regulation of transcription, DNA-dependent|RNA 3'-end processing	cytoplasm|nucleus	DNA binding|protein binding|RNA binding|zinc ion binding				0		all_cancers(87;0.00346)|Acute lymphoblastic leukemia(125;2.26e-08)|all_hematologic(75;2.79e-06)|all_epithelial(87;0.204)																---	---	---	---
SCML4	256380	broad.mit.edu	37	6	108073988	108073988	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108073988delA	uc010kdf.2	-						SCML4_uc003prz.3_Intron|SCML4_uc011eam.1_Intron|SCML4_uc003psa.3_Intron	NM_198081	NP_932347			sex comb on midleg-like 4						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	108283049	108283049	+	IGR	DEL	T	-	-	rs76538889		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108283049delT								SEC63 (3567 upstream) : OSTM1 (79566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	108468925	108468925	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108468925delA	uc003psf.1	+											Homo sapiens clone c222389 mRNA sequence.																														---	---	---	---
FOXO3	2309	broad.mit.edu	37	6	108960185	108960185	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108960185delT	uc003psk.2	+						FOXO3_uc003psn.2_Intron|FOXO3_uc003psm.2_Intron|FOXO3_uc011ean.1_Intron	NM_201559	NP_963853			forkhead box O3A						antral ovarian follicle growth|apoptosis|embryo development|glucose homeostasis|induction of apoptosis|initiation of primordial ovarian follicle growth|insulin receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|oocyte maturation|ovulation from ovarian follicle|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding			central_nervous_system(4)|lung(2)	6		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)														---	---	---	---
PPIL6	285755	broad.mit.edu	37	6	109751636	109751636	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109751636delT	uc003ptg.3	-						PPIL6_uc010kdo.2_Intron|PPIL6_uc010kdp.2_Intron	NM_173672	NP_775943			peptidylprolyl isomerase-like 6 isoform 1						protein folding		peptidyl-prolyl cis-trans isomerase activity				0		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	112296077	112296078	+	IGR	INS	-	T	T	rs72105987		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112296077_112296078insT								FYN (101450 upstream) : WISP3 (79200 downstream)																																			---	---	---	---
C6orf225	619208	broad.mit.edu	37	6	112411410	112411411	+	Intron	INS	-	TCTA	TCTA	rs146814849	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112411410_112411411insTCTA	uc003pvs.2	+						TUBE1_uc003pvq.2_5'Flank|TUBE1_uc003pvr.2_5'Flank	NM_001033564	NP_001028736			hypothetical protein LOC619208												0																		---	---	---	---
LAMA4	3910	broad.mit.edu	37	6	112517182	112517183	+	Intron	INS	-	TATAT	TATAT	rs141806890	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112517182_112517183insTATAT	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676			laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	112600986	112600986	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112600986delT								LAMA4 (25158 upstream) : RFPL4B (67546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	113495893	113495893	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113495893delA								RFPL4B (823395 upstream) : MARCKS (682634 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	114075204	114075204	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114075204delA								None (None upstream) : MARCKS (103323 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	114367161	114367162	+	Intron	INS	-	CACACACACA	CACACACACA	rs149465328	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114367161_114367162insCACACACACA	uc003pwf.2	+											Homo sapiens, clone IMAGE:5770470, mRNA.																														---	---	---	---
HS3ST5	222537	broad.mit.edu	37	6	114402523	114402523	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114402523delA	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840			heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	116395510	116395510	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116395510delT								FRK (13589 upstream) : NT5DC1 (26489 downstream)																																			---	---	---	---
DCBLD1	285761	broad.mit.edu	37	6	117814785	117814785	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117814785delG	uc003pxs.2	+						GOPC_uc003pxq.1_Intron|DCBLD1_uc003pxr.1_Intron	NM_173674	NP_775945			discoidin, CUB and LCCL domain containing 1						cell adhesion	integral to membrane				ovary(1)	1		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)														---	---	---	---
DCBLD1	285761	broad.mit.edu	37	6	117816351	117816352	+	Intron	INS	-	CA	CA	rs140785312	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117816351_117816352insCA	uc003pxs.2	+						GOPC_uc003pxq.1_Intron|DCBLD1_uc003pxr.1_Intron	NM_173674	NP_775945			discoidin, CUB and LCCL domain containing 1						cell adhesion	integral to membrane				ovary(1)	1		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)														---	---	---	---
GOPC	57120	broad.mit.edu	37	6	117898192	117898193	+	Intron	INS	-	ACAT	ACAT	rs149670655	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117898192_117898193insACAT	uc003pxu.2	-						GOPC_uc003pxv.2_Intron|GOPC_uc010keg.1_5'Flank	NM_020399	NP_065132			golgi associated PDZ and coiled-coil motif						apical protein localization|cytoplasmic sequestering of CFTR protein|ER to Golgi vesicle-mediated transport|Golgi to plasma membrane transport|protein homooligomerization|protein transport	cell junction|dendrite|Golgi membrane|postsynaptic density|postsynaptic membrane|trans-Golgi network transport vesicle	cystic fibrosis transmembrane conductance regulator binding			ovary(1)	1		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)				O	ROS1	glioblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	6	119204234	119204235	+	IGR	INS	-	A	A	rs36162403		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119204234_119204235insA								C6orf204 (172996 upstream) : ASF1A (11006 downstream)																																			---	---	---	---
MAN1A1	4121	broad.mit.edu	37	6	119548011	119548011	+	Intron	DEL	T	-	-	rs138524984		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119548011delT	uc003pym.1	-						MAN1A1_uc010kei.1_Intron	NM_005907	NP_005898			mannosidase, alpha, class 1A, member 1						post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum|ER-Golgi intermediate compartment|Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			ovary(2)|central_nervous_system(1)|skin(1)	4		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	120392921	120392922	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120392921_120392922insT								MAN1A1 (721995 upstream) : None (None downstream)																																			---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	124821484	124821484	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:124821484delT	uc003pzo.2	+						NKAIN2_uc003pzn.1_Intron|NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	125785508	125785509	+	IGR	INS	-	A	A	rs143815323	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125785508_125785509insA								HDDC2 (162226 upstream) : HEY2 (283271 downstream)																																			---	---	---	---
LAMA2	3908	broad.mit.edu	37	6	129207581	129207581	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129207581delA	uc003qbn.2	+						LAMA2_uc003qbo.2_Intron	NM_000426	NP_000417			laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)														---	---	---	---
AKAP7	9465	broad.mit.edu	37	6	131511786	131511786	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131511786delA	uc003qck.2	+						AKAP7_uc011ebz.1_Intron|AKAP7_uc003qcl.1_Intron	NM_016377	NP_057461			A-kinase anchor protein 7 isoform gamma						intracellular signal transduction|ion transport	apical plasma membrane|intracellular|lateral plasma membrane	protein kinase A binding			ovary(2)	2	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	133208477	133208477	+	IGR	DEL	G	-	-	rs67138813		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133208477delG								RPS12 (69775 upstream) : LOC285735 (200742 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	134829222	134829224	+	IGR	DEL	TTC	-	-	rs35899720		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134829222_134829224delTTC								SGK1 (190026 upstream) : ALDH8A1 (409305 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	135496618	135496619	+	IGR	DEL	TG	-	-	rs71816901		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135496618_135496619delTG								HBS1L (120582 upstream) : MYB (5834 downstream)																																			---	---	---	---
PDE7B	27115	broad.mit.edu	37	6	136453063	136453063	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136453063delC	uc003qgp.2	+						uc003qgq.1_Intron|PDE7B_uc003qgr.2_Intron	NM_018945	NP_061818			phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)													---	---	---	---
FAM54A	113115	broad.mit.edu	37	6	136570284	136570284	+	5'UTR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136570284delC	uc010kgp.1	-	2					FAM54A_uc003qgt.1_5'UTR|FAM54A_uc003qgu.1_5'UTR	NM_001099286	NP_001092756			DUF729 domain containing 1											skin(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00228)|OV - Ovarian serous cystadenocarcinoma(155;0.00504)														---	---	---	---
NHSL1	57224	broad.mit.edu	37	6	138885789	138885789	+	Intron	DEL	A	-	-	rs71874048		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138885789delA	uc003qhx.2	-							NM_020464	NP_065197			NHS-like 1 isoform 1												0																		---	---	---	---
UTRN	7402	broad.mit.edu	37	6	145094115	145094116	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145094115_145094116insT	uc003qkt.2	+							NM_007124	NP_009055			utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	145821146	145821147	+	IGR	INS	-	T	T	rs147138579	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145821146_145821147insT								UTRN (646978 upstream) : EPM2A (125299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	147292095	147292095	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147292095delG	uc003qlt.1	-						uc003qlu.1_Intron|uc003qlv.2_Intron					Homo sapiens cDNA FLJ34275 fis, clone FEBRA2003454.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	147740001	147740001	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147740001delC								STXBP5 (31294 upstream) : SAMD5 (90062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	148367541	148367541	+	IGR	DEL	A	-	-	rs59276956		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148367541delA								SAMD5 (476384 upstream) : SASH1 (296188 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	149036066	149036066	+	IGR	DEL	T	-	-	rs113676974		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149036066delT								SASH1 (162882 upstream) : UST (32205 downstream)																																			---	---	---	---
TAB2	23118	broad.mit.edu	37	6	149585614	149585615	+	Intron	INS	-	T	T	rs147851333	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149585614_149585615insT	uc011eec.1	+							NM_015093	NP_055908			mitogen-activated protein kinase kinase kinase 7						activation of MAPK activity|heart development|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	K63-linked polyubiquitin binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	150877361	150877361	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150877361delT								IYD (151597 upstream) : PLEKHG1 (43638 downstream)																																			---	---	---	---
MTHFD1L	25902	broad.mit.edu	37	6	151200436	151200437	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151200436_151200437insT	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron|MTHFD1L_uc003qoa.1_Intron|MTHFD1L_uc010kil.1_Intron	NM_015440	NP_056255			methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)														---	---	---	---
AKAP12	9590	broad.mit.edu	37	6	151659591	151659591	+	Intron	DEL	T	-	-	rs112231477		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151659591delT	uc011eep.1	+						AKAP12_uc003qoe.2_Intron|AKAP12_uc003qof.2_Intron|AKAP12_uc010kim.2_Intron	NM_005100	NP_005091			A kinase (PRKA) anchor protein 12 isoform 1						G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)														---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152508863	152508864	+	Intron	INS	-	GA	GA	rs71556246		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152508863_152508864insGA	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc011eez.1_5'Flank|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	6	153665194	153665195	+	IGR	INS	-	A	A	rs150581755	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153665194_153665195insA								RGS17 (212805 upstream) : OPRM1 (666441 downstream)																																			---	---	---	---
IPCEF1	26034	broad.mit.edu	37	6	154625204	154625205	+	Intron	INS	-	AA	AA	rs147621072	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154625204_154625205insAA	uc003qpx.2	-						IPCEF1_uc003qpw.2_Intron|IPCEF1_uc010kjh.2_Intron	NM_015553	NP_056368			phosphoinositide-binding protein PIP3-E isoform						response to oxidative stress	cytoplasm|plasma membrane	oxygen transporter activity|peroxidase activity				0																		---	---	---	---
TIAM2	26230	broad.mit.edu	37	6	155386113	155386114	+	Intron	INS	-	AG	AG	rs142496930	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155386113_155386114insAG	uc003qqb.2	+							NM_012454	NP_036586			T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)														---	---	---	---
SYNJ2	8871	broad.mit.edu	37	6	158446847	158446847	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158446847delG	uc003qqx.1	+						SYNJ2_uc011efm.1_Intron|SYNJ2_uc003qqw.1_Intron|SYNJ2_uc003qqy.1_Intron|SYNJ2_uc011efn.1_Intron|SYNJ2_uc010kjo.1_Intron	NM_003898	NP_003889			synaptojanin 2								nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)														---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162153124	162153124	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162153124delT	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron|PARK2_uc011egf.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	164344074	164344074	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164344074delT								QKI (349182 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	167342834	167342834	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167342834delA								RPS6KA2 (67063 upstream) : RNASET2 (174 downstream)																																			---	---	---	---
CCR6	1235	broad.mit.edu	37	6	167506596	167506596	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167506596delG	uc003qvl.2	+							NM_031409	NP_113597			chemokine (C-C motif) receptor 6						cellular defense response|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|humoral immune response	integral to plasma membrane	C-C chemokine receptor activity			ovary(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	167622568	167622569	+	IGR	DEL	GG	-	-	rs66877303		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167622568_167622569delGG								TCP10L2 (26173 upstream) : UNC93A (82234 downstream)																																			---	---	---	---
TCP10	6953	broad.mit.edu	37	6	167778339	167778340	+	Intron	INS	-	A	A	rs147507926		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167778339_167778340insA	uc003qvu.2	-							NM_004610	NP_004601			t-complex 10							cytosol				breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	168148375	168148376	+	IGR	INS	-	GGGAGGAAGGA	GGGAGGAAGGA	rs139574811	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168148375_168148376insGGGAGGAAGGA								TCP10 (350377 upstream) : C6orf123 (36845 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	493160	493161	+	IGR	INS	-	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:493160_493161insG								FAM20C (192449 upstream) : PDGFA (43738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	571816	571816	+	IGR	DEL	A	-	-	rs35424118		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:571816delA								PDGFA (12335 upstream) : PRKAR1B (17571 downstream)																																			---	---	---	---
SUN1	23353	broad.mit.edu	37	7	887835	887836	+	Intron	INS	-	A	A	rs74208471		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:887835_887836insA	uc011jvp.1	+						SUN1_uc003sje.1_Intron|SUN1_uc003sjf.2_Intron|SUN1_uc011jvq.1_Intron|SUN1_uc003sjg.2_Intron|SUN1_uc011jvr.1_5'Flank|SUN1_uc003sji.2_5'Flank	NM_001130965	NP_001124437			unc-84 homolog A isoform a						cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	2658691	2658692	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2658691_2658692insA								IQCE (4324 upstream) : TTYH3 (12911 downstream)																																			---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3934183	3934184	+	Intron	INS	-	T	T	rs143216877	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3934183_3934184insT	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	4643071	4643072	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4643071_4643072delAC								SDK1 (334442 upstream) : FOXK1 (40316 downstream)																																			---	---	---	---
GRID2IP	392862	broad.mit.edu	37	7	6548254	6548254	+	Intron	DEL	G	-	-	rs68111541		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6548254delG	uc011jwx.1	-							NM_001145118	NP_001138590			glutamate receptor, ionotropic, delta 2 (Grid2)						actin cytoskeleton organization	cell junction|postsynaptic membrane	actin binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	7084921	7084922	+	IGR	INS	-	C	C	rs59655133	by1000genomes;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7084921_7084922insC								C7orf28B (219060 upstream) : C1GALT1 (137324 downstream)																																			---	---	---	---
COL28A1	340267	broad.mit.edu	37	7	7413336	7413337	+	Intron	INS	-	T	T	rs35277875		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7413336_7413337insT	uc003src.1	-						COL28A1_uc011jxe.1_Intron	NM_001037763	NP_001032852			collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	9928878	9928879	+	IGR	INS	-	A	A	rs140855678	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9928878_9928879insA								PER4 (253431 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	12207458	12207458	+	IGR	DEL	T	-	-	rs151136839		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12207458delT								THSD7A (335634 upstream) : TMEM106B (43390 downstream)																																			---	---	---	---
VWDE	221806	broad.mit.edu	37	7	12442924	12442924	+	Intron	DEL	C	-	-	rs60945084		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12442924delC	uc003ssj.2	-						VWDE_uc011jxl.1_Intron|VWDE_uc011jxm.1_Intron	NM_001135924	NP_001129396			von Willebrand factor D and EGF domains							extracellular region					0																		---	---	---	---
TMEM195	392636	broad.mit.edu	37	7	15249017	15249017	+	Intron	DEL	G	-	-	rs10716450		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15249017delG	uc003stb.1	-							NM_001004320	NP_001004320			transmembrane protein 195						ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0																		---	---	---	---
TMEM195	392636	broad.mit.edu	37	7	15343061	15343062	+	Intron	INS	-	A	A	rs141119048	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15343061_15343062insA	uc003stb.1	-							NM_001004320	NP_001004320			transmembrane protein 195						ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	19148353	19148362	+	IGR	DEL	GTGTGTGTGT	-	-	rs147796633		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19148353_19148362delGTGTGTGTGT								HDAC9 (111369 upstream) : TWIST1 (6731 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	19877633	19877634	+	IGR	INS	-	G	G	rs35660756		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19877633_19877634insG								TMEM196 (64417 upstream) : MACC1 (296654 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	22789871	22789872	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22789871_22789872delTG								IL6 (18252 upstream) : TOMM7 (62382 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	22936607	22936607	+	IGR	DEL	G	-	-	rs11356993		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22936607delG								SNORD93 (40303 upstream) : FAM126A (44280 downstream)																																			---	---	---	---
FAM126A	84668	broad.mit.edu	37	7	23033305	23033306	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23033305_23033306delAC	uc003svm.3	-						FAM126A_uc003svn.3_Intron|FAM126A_uc011jyr.1_Intron	NM_032581	NP_115970			family with sequence similarity 126, member A							cytoplasm|membrane	signal transducer activity			central_nervous_system(1)	1																		---	---	---	---
IGF2BP3	10643	broad.mit.edu	37	7	23371479	23371479	+	Intron	DEL	A	-	-	rs35506768		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23371479delA	uc003swg.2	-						IGF2BP3_uc003swf.2_Intron	NM_006547	NP_006538			insulin-like growth factor 2 mRNA binding						anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			ovary(2)	2																		---	---	---	---
STK31	56164	broad.mit.edu	37	7	23933222	23933223	+	Intron	INS	-	GT	GT	rs138007377	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23933222_23933223insGT	uc003swv.1	+											SubName: Full=Putative uncharacterized protein STK31;								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	24061496	24061497	+	IGR	INS	-	T	T	rs147551044	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24061496_24061497insT								STK31 (117131 upstream) : NPY (262312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	24357077	24357077	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24357077delG								NPY (25600 upstream) : MPP6 (256008 downstream)																																			---	---	---	---
DFNA5	1687	broad.mit.edu	37	7	24747303	24747304	+	Intron	DEL	AC	-	-	rs66969664		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24747303_24747304delAC	uc010kus.1	-						DFNA5_uc003swz.2_Intron|DFNA5_uc003sxa.1_Intron|DFNA5_uc010kut.1_Intron	NM_001127453	NP_001120925			deafness, autosomal dominant 5 protein isoform						sensory perception of sound					ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	25704354	25704354	+	5'Flank	DEL	T	-	-	rs11342250		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25704354delT	uc003sxp.1	-											Homo sapiens cDNA FLJ32817 fis, clone TESTI2002877.																														---	---	---	---
LOC441204	441204	broad.mit.edu	37	7	26442999	26442999	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26442999delT	uc003sxy.1	+						LOC441204_uc003sxz.2_5'Flank					Homo sapiens cDNA FLJ31922 fis, clone NT2RP7005219.												0																		---	---	---	---
C7orf71	285941	broad.mit.edu	37	7	26682035	26682036	+	Intron	DEL	GC	-	-	rs72595043		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26682035_26682036delGC	uc003syb.2	+						C7orf71_uc011jzh.1_Intron	NM_001145531	NP_001139003			hypothetical protein LOC285941												0																		---	---	---	---
HIBADH	11112	broad.mit.edu	37	7	27649611	27649611	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27649611delT	uc003szf.2	-						HIBADH_uc003szg.2_Intron|HIBADH_uc003szh.2_Intron|HIBADH_uc003szi.2_Intron	NM_152740	NP_689953			3-hydroxyisobutyrate dehydrogenase precursor						branched chain family amino acid catabolic process|pentose-phosphate shunt|valine metabolic process	mitochondrial matrix	3-hydroxyisobutyrate dehydrogenase activity|NAD binding|phosphogluconate dehydrogenase (decarboxylating) activity			ovary(2)	2			GBM - Glioblastoma multiforme(3;0.0368)		NADH(DB00157)													---	---	---	---
CREB5	9586	broad.mit.edu	37	7	28511771	28511771	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28511771delA	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron	NM_182898	NP_878901			cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2																		---	---	---	---
WIPF3	644150	broad.mit.edu	37	7	29944372	29944372	+	3'UTR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29944372delT	uc003taj.1	+	7						NM_001080529	NP_001073998			WAS/WASL interacting protein family, member 3											ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	30970255	30970258	+	IGR	DEL	GTGT	-	-	rs71557476		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30970255_30970258delGTGT								AQP1 (5124 upstream) : GHRHR (33378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	34934027	34934027	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34934027delT								NPSR1 (16083 upstream) : DPY19L1 (27054 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	35495783	35495785	+	IGR	DEL	TCT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35495783_35495785delTCT								TBX20 (202541 upstream) : HERPUD2 (176487 downstream)																																			---	---	---	---
EEPD1	80820	broad.mit.edu	37	7	36312112	36312113	+	Intron	INS	-	TT	TT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36312112_36312113insTT	uc003tfa.2	+							NM_030636	NP_085139			endonuclease/exonuclease/phosphatase family						DNA repair		DNA binding				0																		---	---	---	---
AOAH	313	broad.mit.edu	37	7	36761440	36761441	+	Intron	INS	-	TT	TT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36761440_36761441insTT	uc003tfh.3	-						AOAH_uc010kxf.2_Intron|AOAH_uc011kba.1_Intron	NM_001637	NP_001628			acyloxyacyl hydrolase precursor						inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	38071827	38071828	+	IGR	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38071827_38071828delCT								EPDR1 (80288 upstream) : STARD3NL (146105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	38138874	38138875	+	IGR	INS	-	A	A	rs149111958	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38138874_38138875insA								EPDR1 (147335 upstream) : STARD3NL (79058 downstream)																																			---	---	---	---
POU6F2	11281	broad.mit.edu	37	7	39250695	39250696	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39250695_39250696insA	uc003thb.1	+						POU6F2_uc010kxo.2_Intron	NM_007252	NP_009183			POU class 6 homeobox 2 isoform 1						central nervous system development|ganglion mother cell fate determination|transcription from RNA polymerase II promoter|visual perception		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1																		---	---	---	---
RALA	5898	broad.mit.edu	37	7	39663246	39663257	+	5'UTR	DEL	CTCCTCCTCCTC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39663246_39663257delCTCCTCCTCCTC	uc003thd.2	+	1						NM_005402	NP_005393			ras related v-ral simian leukemia viral oncogene						actin cytoskeleton reorganization|cell cycle|chemotaxis|cytokinesis|exocytosis|interspecies interaction between organisms|membrane raft localization|nerve growth factor receptor signaling pathway|positive regulation of filopodium assembly|Ras protein signal transduction|regulation of exocytosis	cell surface|cleavage furrow|cytosol|midbody|plasma membrane	Edg-2 lysophosphatidic acid receptor binding|GTP binding|GTPase activity			lung(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	41120939	41120939	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41120939delA								C7orf10 (220582 upstream) : INHBA (607664 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	41216900	41216901	+	IGR	DEL	TG	-	-	rs143890458		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41216900_41216901delTG								C7orf10 (316543 upstream) : INHBA (511702 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	41651508	41651508	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41651508delT								C7orf10 (751151 upstream) : INHBA (77095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	42611986	42611987	+	IGR	DEL	CT	-	-	rs71562063		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42611986_42611987delCT								GLI3 (335368 upstream) : C7orf25 (336887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	44595993	44595994	+	IGR	INS	-	TTTGTTT	TTTGTTT	rs139087388	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44595993_44595994insTTTGTTT								NPC1L1 (15079 upstream) : DDX56 (9410 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	44781157	44781157	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44781157delG								OGDH (32489 upstream) : ZMIZ2 (7023 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	45341258	45341258	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45341258delC								RAMP3 (117411 upstream) : ADCY1 (272481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	45538568	45538568	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45538568delT								RAMP3 (314721 upstream) : ADCY1 (75171 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	47636680	47636681	+	IGR	DEL	GT	-	-	rs144286571		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47636680_47636681delGT								TNS3 (14938 upstream) : C7orf65 (58161 downstream)																																			---	---	---	---
PKD1L1	168507	broad.mit.edu	37	7	47893365	47893365	+	Intron	DEL	A	-	-	rs72458724		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47893365delA	uc003tny.1	-							NM_138295	NP_612152			polycystin-1L1						cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11																		---	---	---	---
ZPBP	11055	broad.mit.edu	37	7	50067687	50067688	+	Intron	INS	-	AAAATTAT	AAAATTAT	rs138138498	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50067687_50067688insAAAATTAT	uc003tou.2	-						ZPBP_uc011kci.1_Intron|ZPBP_uc010kyw.2_Intron	NM_007009	NP_008940			zona pellucida binding protein isoform 1						binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)																	---	---	---	---
IKZF1	10320	broad.mit.edu	37	7	50346858	50346858	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50346858delT	uc003tow.3	+						IKZF1_uc003tox.3_Intron|IKZF1_uc003toy.3_5'Flank|IKZF1_uc011kck.1_5'Flank|IKZF1_uc003tov.1_Intron	NM_006060	NP_006051			zinc finger protein, subfamily 1A, 1 (Ikaros)						cell cycle|chromatin modification|mesoderm development	cytoplasm|nucleus	zinc ion binding			haematopoietic_and_lymphoid_tissue(147)|lung(1)	148	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)						D		ALL								---	---	---	---
DDC	1644	broad.mit.edu	37	7	50628740	50628743	+	5'UTR	DEL	CTCT	-	-	rs3837091		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50628740_50628743delCTCT	uc003tpf.3	-	1					DDC_uc003tpg.3_Intron	NM_000790	NP_000781			dopa decarboxylase (aromatic L-amino acid						cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)													---	---	---	---
GRB10	2887	broad.mit.edu	37	7	50778873	50778873	+	Intron	DEL	A	-	-	rs145916507		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50778873delA	uc003tpi.2	-						GRB10_uc003tpj.2_Intron|GRB10_uc003tpk.2_Intron|GRB10_uc010kzb.2_Intron|GRB10_uc003tpl.2_Intron|GRB10_uc003tpm.2_Intron|GRB10_uc003tpn.2_Intron	NM_005311	NP_005302			growth factor receptor-bound protein 10 isoform						insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)													Russell-Silver_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	7	53522220	53522220	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53522220delT								POM121L12 (417603 upstream) : HPVC1 (746697 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53590387	53590388	+	IGR	DEL	AA	-	-	rs141402595		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53590387_53590388delAA								POM121L12 (485770 upstream) : HPVC1 (678529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54685119	54685119	+	IGR	DEL	A	-	-	rs78376059		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54685119delA								VSTM2A (46932 upstream) : SEC61G (134822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54925861	54925861	+	IGR	DEL	A	-	-	rs34392506		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54925861delA								SEC61G (98922 upstream) : EGFR (160864 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55355207	55355208	+	IGR	INS	-	A	A	rs111931400		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55355207_55355208insA								EGFR (80177 upstream) : LANCL2 (77933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	56790844	56790844	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56790844delT								DKFZp434L192 (225867 upstream) : ZNF479 (396484 downstream)																																			---	---	---	---
ZNF479	90827	broad.mit.edu	37	7	57201115	57201115	+	Intron	DEL	A	-	-	rs150875740		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57201115delA	uc010kzo.2	-							NM_033273	NP_150376			zinc finger protein 479						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	57345654	57345658	+	IGR	DEL	TTATT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57345654_57345658delTTATT								ZNF479 (138083 upstream) : ZNF716 (164225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57635123	57635123	+	IGR	DEL	C	-	-	rs78649440		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57635123delC								ZNF716 (101858 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57645044	57645045	+	IGR	INS	-	C	C	rs144754515		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57645044_57645045insC								ZNF716 (111779 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61241882	61241882	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61241882delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61555835	61555836	+	IGR	INS	-	TCAA	TCAA			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61555835_61555836insTCAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61775963	61775964	+	IGR	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61775963_61775964delGA								None (None upstream) : LOC643955 (975708 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61888263	61888264	+	IGR	DEL	TT	-	-	rs113587082		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61888263_61888264delTT								None (None upstream) : LOC643955 (863408 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61889810	61889810	+	IGR	DEL	T	-	-	rs112965445		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61889810delT								None (None upstream) : LOC643955 (861862 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62331447	62331447	+	IGR	DEL	T	-	-	rs113467873		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62331447delT								None (None upstream) : LOC643955 (420225 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63023116	63023116	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63023116delC								LOC100287704 (210965 upstream) : ZNF727 (482705 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63133452	63133452	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63133452delA								LOC100287704 (321301 upstream) : ZNF727 (372369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64521140	64521140	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64521140delC	uc003ttt.1	+						uc010kzt.1_Intron					Homo sapiens cDNA clone IMAGE:4215179, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	64714112	64714115	+	IGR	DEL	TCTA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64714112_64714115delTCTA								INTS4L1 (19513 upstream) : ZNF92 (124653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65087146	65087147	+	IGR	INS	-	A	A	rs145938950	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65087146_65087147insA								ZNF92 (221149 upstream) : INTS4L2 (25630 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65658724	65658725	+	IGR	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65658724_65658725delTC								CRCP (39173 upstream) : TPST1 (11534 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	66320732	66320732	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66320732delC								LOC729156 (10919 upstream) : C7orf42 (65471 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	66362569	66362570	+	IGR	INS	-	A	A	rs150757967	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66362569_66362570insA								LOC729156 (52756 upstream) : C7orf42 (23633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	66954512	66954513	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66954512_66954513insA								STAG3L4 (168000 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67729509	67729510	+	IGR	INS	-	TGTGCA	TGTGCA	rs149593356	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67729509_67729510insTGTGCA								STAG3L4 (942997 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68049019	68049020	+	IGR	INS	-	T	T	rs113113969		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68049019_68049020insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68132853	68132853	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68132853delA								None (None upstream) : AUTS2 (931052 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68373117	68373118	+	IGR	INS	-	A	A	rs77123728		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68373117_68373118insA								None (None upstream) : AUTS2 (690787 downstream)																																			---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69340022	69340022	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69340022delT	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69402317	69402317	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69402317delT	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
AUTS2	26053	broad.mit.edu	37	7	69517129	69517129	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69517129delA	uc003tvw.3	+						AUTS2_uc003tvv.3_Intron|AUTS2_uc003tvx.3_Intron	NM_015570	NP_056385			autism susceptibility candidate 2 isoform 1											ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	70283039	70283040	+	IGR	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70283039_70283040delGA								AUTS2 (25155 upstream) : WBSCR17 (314749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	70286585	70286586	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70286585_70286586insA								AUTS2 (28701 upstream) : WBSCR17 (311203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	70378497	70378500	+	IGR	DEL	CTTC	-	-	rs144373450		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70378497_70378500delCTTC								AUTS2 (120613 upstream) : WBSCR17 (219289 downstream)																																			---	---	---	---
EIF4H	7458	broad.mit.edu	37	7	73592024	73592024	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73592024delT	uc003uad.1	+						RFC2_uc011kfa.1_Intron|EIF4H_uc011kfg.1_Intron|EIF4H_uc010lbm.2_Intron|EIF4H_uc003uae.1_Intron|EIF4H_uc003uaf.1_Intron	NM_022170	NP_071496			eukaryotic translation initiation factor 4H						interspecies interaction between organisms|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex|perinuclear region of cytoplasm	nucleotide binding|protein binding|translation initiation factor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	74058690	74058691	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74058690_74058691insA								GTF2IRD1 (41772 upstream) : GTF2I (13339 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	75783894	75783894	+	IGR	DEL	A	-	-	rs35582872		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75783894delA								MDH2 (87966 upstream) : SRRM3 (47322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	80332433	80332434	+	IGR	INS	-	ATAG	ATAG	rs146254079	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80332433_80332434insATAG								CD36 (23841 upstream) : SEMA3C (39421 downstream)																																			---	---	---	---
SEMA3C	10512	broad.mit.edu	37	7	80539971	80539972	+	Intron	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80539971_80539972delTT	uc003uhj.2	-						SEMA3C_uc011kgw.1_Intron|SEMA3C_uc011kgx.1_Intron	NM_006379	NP_006370			semaphorin 3C precursor						immune response|response to drug	membrane	receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	82091583	82091583	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82091583delA								CACNA2D1 (18552 upstream) : PCLO (291738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	82198254	82198254	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82198254delT								CACNA2D1 (125223 upstream) : PCLO (185067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	82829907	82829907	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82829907delT								PCLO (37710 upstream) : SEMA3E (163315 downstream)																																			---	---	---	---
SEMA3D	223117	broad.mit.edu	37	7	84647491	84647492	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84647491_84647492insT	uc003uic.2	-						SEMA3D_uc010led.2_Intron|SEMA3D_uc003uib.2_Intron	NM_152754	NP_689967			semaphorin 3D precursor						cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5																		---	---	---	---
SEMA3D	223117	broad.mit.edu	37	7	84804315	84804318	+	Intron	DEL	AGTT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84804315_84804318delAGTT	uc010lee.1	-							NM_152754	NP_689967			semaphorin 3D precursor						cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	85264648	85264649	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85264648_85264649insT								SEMA3D (448477 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85489402	85489402	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85489402delA								SEMA3D (673231 upstream) : GRM3 (783828 downstream)																																			---	---	---	---
KIAA1324L	222223	broad.mit.edu	37	7	86677560	86677560	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86677560delA	uc011kha.1	-							NM_001142749	NP_001136221			hypothetical protein LOC222223 isoform 1							integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)																	---	---	---	---
ADAM22	53616	broad.mit.edu	37	7	87573454	87573454	+	Intron	DEL	T	-	-	rs113907480		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87573454delT	uc003ujn.2	+						ADAM22_uc003uji.1_Intron|ADAM22_uc003ujj.1_Intron|ADAM22_uc003ujk.1_Intron|ADAM22_uc003ujl.1_Intron|ADAM22_uc003ujm.2_Intron|ADAM22_uc003ujo.2_Intron|ADAM22_uc003ujp.1_Intron	NM_021723	NP_068369			ADAM metallopeptidase domain 22 isoform 1						cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
ADAM22	53616	broad.mit.edu	37	7	87657121	87657122	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87657121_87657122insT	uc003ujn.2	+						ADAM22_uc003uji.1_Intron|ADAM22_uc003ujj.1_Intron|ADAM22_uc003ujk.1_Intron|ADAM22_uc003ujl.1_Intron|ADAM22_uc003ujm.2_Intron|ADAM22_uc003ujo.2_Intron|ADAM22_uc003ujp.1_Intron	NM_021723	NP_068369			ADAM metallopeptidase domain 22 isoform 1						cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	88159561	88159561	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88159561delA								STEAP4 (223352 upstream) : ZNF804B (229192 downstream)																																			---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88738409	88738410	+	Intron	INS	-	T	T	rs140214628	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88738409_88738410insT	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	89045502	89045503	+	IGR	INS	-	TATGA	TATGA	rs142130001	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89045502_89045503insTATGA								ZNF804B (79158 upstream) : DPY19L2P4 (703211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	89400621	89400621	+	IGR	DEL	A	-	-	rs149134506		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89400621delA								ZNF804B (434277 upstream) : DPY19L2P4 (348093 downstream)																																			---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90097872	90097873	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90097872_90097873insT	uc003ukt.1	+							NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90749852	90749852	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90749852delT	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90799375	90799375	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90799375delG	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90836506	90836506	+	3'UTR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90836506delA	uc003uky.2	+	15					CDK14_uc003ukz.1_3'UTR|CDK14_uc010les.1_3'UTR|CDK14_uc011khl.1_3'UTR	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	90922586	90922587	+	IGR	INS	-	AA	AA	rs144239736	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90922586_90922587insAA								FZD1 (24455 upstream) : MTERF (508873 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	91075440	91075440	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91075440delT								FZD1 (177309 upstream) : MTERF (356020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	91200382	91200383	+	IGR	DEL	TT	-	-	rs137945048		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91200382_91200383delTT								FZD1 (302251 upstream) : MTERF (231077 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	91250123	91250126	+	IGR	DEL	CACA	-	-	rs72469940		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91250123_91250126delCACA								FZD1 (351992 upstream) : MTERF (181334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	91341488	91341489	+	IGR	DEL	AG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91341488_91341489delAG								FZD1 (443357 upstream) : MTERF (89971 downstream)																																			---	---	---	---
AKAP9	10142	broad.mit.edu	37	7	91662564	91662564	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91662564delA	uc003ulg.2	+						AKAP9_uc003ule.2_Intron|AKAP9_uc003ulf.2_Intron|AKAP9_uc003uli.2_Intron	NM_005751	NP_005742			A-kinase anchor protein 9 isoform 2						G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)					T	BRAF	papillary thyroid								---	---	---	---
FAM133B	257415	broad.mit.edu	37	7	92221918	92221919	+	5'Flank	DEL	CC	-	-	rs68159250		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92221918_92221919delCC	uc003umc.2	-						FAM133B_uc003umb.2_5'Flank|FAM133B_uc003umd.2_5'Flank	NM_152789	NP_690002			hypothetical protein LOC257415 isoform 1											ovary(1)	1	all_cancers(62;7.39e-11)|all_epithelial(64;7.03e-10)|Breast(17;0.00201)|all_lung(186;0.0384)|Lung NSC(181;0.053)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;9.78e-06)|all cancers(6;1.67e-05)|Epithelial(20;0.113)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	93031182	93031182	+	IGR	DEL	T	-	-	rs79325405		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93031182delT								CCDC132 (42845 upstream) : CALCR (22617 downstream)																																			---	---	---	---
GNGT1	2792	broad.mit.edu	37	7	93353687	93353688	+	Intron	INS	-	A	A	rs138891853	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93353687_93353688insA	uc003umx.1	+											Homo sapiens guanine nucleotide binding protein gamma 1 (GNG1) mRNA, complete cds.						G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	95319891	95319892	+	IGR	INS	-	A	A	rs68088732		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95319891_95319892insA								PDK4 (93966 upstream) : DYNC1I1 (81926 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	95332659	95332659	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95332659delA								PDK4 (106734 upstream) : DYNC1I1 (69159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	95379707	95379708	+	IGR	DEL	AC	-	-	rs1817412	byFrequency	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95379707_95379708delAC								PDK4 (153782 upstream) : DYNC1I1 (22110 downstream)																																			---	---	---	---
DYNC1I1	1780	broad.mit.edu	37	7	95691744	95691744	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95691744delT	uc003uoc.3	+						DYNC1I1_uc003uod.3_Intron|DYNC1I1_uc003uob.2_Intron|DYNC1I1_uc003uoe.3_Intron|DYNC1I1_uc010lfl.2_Intron	NM_004411	NP_004402			dynein, cytoplasmic 1, intermediate chain 1						vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	96552182	96552183	+	IGR	INS	-	G	G	rs145559655	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96552182_96552183insG								SHFM1 (212979 upstream) : DLX6AS (45645 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	96570611	96570611	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96570611delA								SHFM1 (231408 upstream) : DLX6AS (27217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	97624103	97624103	+	IGR	DEL	A	-	-	rs113620608		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97624103delA								OCM2 (4687 upstream) : LMTK2 (112094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	97691787	97691787	+	IGR	DEL	T	-	-	rs113461630		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97691787delT								OCM2 (72371 upstream) : LMTK2 (44410 downstream)																																			---	---	---	---
TECPR1	25851	broad.mit.edu	37	7	97858974	97858974	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97858974delC	uc003upg.2	-						TECPR1_uc003uph.1_Intron	NM_015395	NP_056210			tectonin beta-propeller repeat containing 1							integral to membrane	protein binding			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	98344575	98344575	+	IGR	DEL	A	-	-	rs34591921		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98344575delA								NPTX2 (85394 upstream) : TMEM130 (99537 downstream)																																			---	---	---	---
TRRAP	8295	broad.mit.edu	37	7	98572508	98572509	+	Intron	INS	-	T	T	rs141110387	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98572508_98572509insT	uc003upp.2	+						TRRAP_uc011kis.1_Intron|TRRAP_uc003upr.2_Intron	NM_003496	NP_003487			transformation/transcription domain-associated						histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
EMID2	136227	broad.mit.edu	37	7	101086219	101086220	+	Intron	DEL	TG	-	-	rs35488814		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101086219_101086220delTG	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714			EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	101967963	101967964	+	IGR	INS	-	A	A	rs138796949	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101967963_101967964insA								SH2B2 (5786 upstream) : SPDYE6 (18229 downstream)																																			---	---	---	---
ORAI2	80228	broad.mit.edu	37	7	102085745	102085745	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102085745delT	uc010lhz.1	+						ORAI2_uc003uzj.2_Intron|ORAI2_uc003uzk.2_Intron|ORAI2_uc011kks.1_Intron	NM_001126340	NP_001119812			ORAI calcium release-activated calcium modulator							integral to membrane	protein binding			ovary(1)|kidney(1)	2																		---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104010144	104010144	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104010144delA	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron	NM_199000	NP_945351			lipoma HMGIC fusion partner-like 3							integral to membrane					0																		---	---	---	---
PRKAR2B	5577	broad.mit.edu	37	7	106732690	106732691	+	Intron	INS	-	TGTG	TGTG	rs34502492		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106732690_106732691insTGTG	uc003vdx.2	+							NM_002736	NP_002727			cAMP-dependent protein kinase, regulatory						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1																		---	---	---	---
COG5	10466	broad.mit.edu	37	7	107003259	107003260	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107003259_107003260insA	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_Intron	NM_181733	NP_859422			component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	108307767	108307767	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108307767delT								DNAJB9 (92475 upstream) : C7orf66 (216273 downstream)																																			---	---	---	---
C7orf53	286006	broad.mit.edu	37	7	112123721	112123721	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112123721delA	uc011kmq.1	+						C7orf53_uc003vgl.2_Intron|C7orf53_uc003vgm.2_Intron	NM_001134468	NP_001127940			hypothetical protein LOC286006							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	113718545	113718546	+	IGR	INS	-	A	A	rs111964299		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113718545_113718546insA								PPP1R3A (159463 upstream) : FOXP2 (7836 downstream)																																			---	---	---	---
TFEC	22797	broad.mit.edu	37	7	115797706	115797706	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115797706delA	uc011kmw.1	-											SubName: Full=cDNA FLJ55256, highly similar to Homo sapiens transcription factor EC (TFEC), transcript variant 1, mRNA;							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	116590324	116590335	+	IGR	DEL	CTCCTTCCTTCA	-	-	rs148256377		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116590324_116590335delCTCCTTCCTTCA								CAPZA2 (31012 upstream) : ST7OT1 (2168 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118029592	118029593	+	IGR	INS	-	A	A	rs140418635	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118029592_118029593insA								ANKRD7 (146810 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118857937	118857938	+	IGR	INS	-	TG	TG			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118857937_118857938insTG								ANKRD7 (975155 upstream) : None (None downstream)																																			---	---	---	---
IQUB	154865	broad.mit.edu	37	7	123112898	123112899	+	Intron	INS	-	T	T	rs150287542	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123112898_123112899insT	uc003vkn.2	-						IQUB_uc003vko.2_Intron|IQUB_uc010lkt.2_Intron|IQUB_uc003vkp.1_Intron	NM_178827	NP_849149			IQ motif and ubiquitin domain containing											ovary(3)|large_intestine(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	123225690	123225691	+	IGR	DEL	TG	-	-	rs35317220		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123225690_123225691delTG								NDUFA5 (27732 upstream) : ASB15 (16230 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	123781554	123781561	+	Intron	DEL	TGTGTGTG	-	-	rs111711458		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123781554_123781561delTGTGTGTG	uc011koc.1	+											Homo sapiens disrupted in Rett 1 mRNA sequence.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	123905516	123905516	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123905516delC	uc011koc.1	+											Homo sapiens disrupted in Rett 1 mRNA sequence.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	125646793	125646793	+	IGR	DEL	A	-	-	rs35294585		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125646793delA								None (None upstream) : GRM8 (431859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	125814292	125814292	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125814292delG								None (None upstream) : GRM8 (264360 downstream)																																			---	---	---	---
GRM8	2918	broad.mit.edu	37	7	126821616	126821616	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126821616delA	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron	NM_000845	NP_000836			glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)										HNSCC(24;0.065)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	127214374	127214375	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127214374_127214375insT								ZNF800 (181607 upstream) : GCC1 (6308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	132831590	132831591	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132831590_132831591delGT								CHCHD3 (64762 upstream) : EXOC4 (106232 downstream)																																			---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	132940735	132940735	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132940735delT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vri.2_Intron|EXOC4_uc003vrj.2_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133391822	133391822	+	Intron	DEL	T	-	-	rs76290083		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133391822delT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
SLC35B4	84912	broad.mit.edu	37	7	133977899	133977900	+	3'UTR	INS	-	ACACAC	ACACAC	rs145404989	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133977899_133977900insACACAC	uc003vrn.2	-	10					SLC35B4_uc010lmk.2_3'UTR|SLC35B4_uc010lml.1_Intron	NM_032826	NP_116215			solute carrier family 35, member B4							Golgi membrane|integral to membrane	UDP-N-acetylglucosamine transmembrane transporter activity|UDP-xylose transmembrane transporter activity			skin(1)	1																		---	---	---	---
NUP205	23165	broad.mit.edu	37	7	135295749	135295750	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135295749_135295750insT	uc003vsw.2	+							NM_015135	NP_055950			nucleoporin 205kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
CREB3L2	64764	broad.mit.edu	37	7	137568996	137568996	+	Intron	DEL	T	-	-	rs113133425		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137568996delT	uc003vtw.2	-						CREB3L2_uc003vtv.2_Intron	NM_194071	NP_919047			cAMP responsive element binding protein 3-like						chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160								T	FUS	fibromyxoid sarcoma								---	---	---	---
AKR1D1	6718	broad.mit.edu	37	7	137789443	137789444	+	Intron	INS	-	AT	AT	rs59354928		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137789443_137789444insAT	uc003vtz.2	+						AKR1D1_uc011kqb.1_Intron|AKR1D1_uc011kqc.1_Intron|AKR1D1_uc011kqd.1_Intron|AKR1D1_uc011kqe.1_Intron|AKR1D1_uc011kqf.1_Intron|AKR1D1_uc010lmy.1_Intron	NM_005989	NP_005980			aldo-keto reductase family 1, member D1						androgen metabolic process|bile acid biosynthetic process|bile acid catabolic process|C21-steroid hormone metabolic process|cholesterol catabolic process|digestion	cytosol	aldo-keto reductase (NADP) activity|delta4-3-oxosteroid 5beta-reductase activity|steroid binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	138073462	138073463	+	IGR	INS	-	AA	AA	rs33980116		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138073462_138073463insAA								AKR1D1 (270412 upstream) : TRIM24 (71616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	140194141	140194142	+	IGR	DEL	TG	-	-	rs143970342		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140194141_140194142delTG								MKRN1 (14772 upstream) : DENND2A (24085 downstream)																																			---	---	---	---
KIAA1147	57189	broad.mit.edu	37	7	141388470	141388470	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141388470delC	uc003vwk.2	-							NM_001080392	NP_001073861			hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	141548266	141548267	+	IGR	INS	-	GT	GT	rs140548133	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141548266_141548267insGT								PRSS37 (6981 upstream) : OR9A4 (70409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	142465862	142465862	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142465862delT	uc011krr.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_Intron|uc003wan.1_Intron|TRY6_uc011kso.1_5'Flank					SubName: Full=V_segment translation product; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	143645046	143645046	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143645046delT								OR2F2 (11768 upstream) : OR2F1 (11111 downstream)																																			---	---	---	---
TPK1	27010	broad.mit.edu	37	7	144377568	144377568	+	Intron	DEL	G	-	-	rs11305202		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144377568delG	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890			thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	144845747	144845750	+	IGR	DEL	AAAC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144845747_144845750delAAAC								TPK1 (312601 upstream) : CNTNAP2 (967703 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	144952010	144952010	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144952010delT								TPK1 (418864 upstream) : CNTNAP2 (861443 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	145099009	145099010	+	IGR	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:145099009_145099010delCT								TPK1 (565863 upstream) : CNTNAP2 (714443 downstream)																																			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147091843	147091843	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147091843delA	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147595427	147595427	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147595427delT	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	148017043	148017043	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148017043delG	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
EZH2	2146	broad.mit.edu	37	7	148557346	148557346	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148557346delA	uc003wfd.1	-						EZH2_uc011kug.1_Intron|EZH2_uc003wfb.1_Intron|EZH2_uc003wfc.1_Intron|EZH2_uc011kuh.1_Intron|EZH2_uc011kui.1_Intron|EZH2_uc011kuj.1_Intron	NM_004456	NP_004447			enhancer of zeste 2 isoform a						negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)					Mis		DLBCL								---	---	---	---
ZNF212	7988	broad.mit.edu	37	7	148950289	148950294	+	Intron	DEL	TTTGTC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148950289_148950294delTTTGTC	uc003wfp.2	+							NM_012256	NP_036388			zinc finger protein 212						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)															---	---	---	---
ABCB8	11194	broad.mit.edu	37	7	150739616	150739616	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150739616delT	uc003wil.3	+						ABCB8_uc010lpx.2_Intron|ABCB8_uc011kvd.1_Intron|ABCB8_uc003wim.3_Intron|ABCB8_uc003wik.3_Intron	NM_007188	NP_009119			ATP-binding cassette, sub-family B, member 8							ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	152267089	152267089	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152267089delT								LOC100128822 (104461 upstream) : XRCC2 (76500 downstream)																																			---	---	---	---
ACTR3B	57180	broad.mit.edu	37	7	152532140	152532141	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152532140_152532141insT	uc003wle.1	+						ACTR3B_uc003wlf.1_Intron|ACTR3B_uc003wlg.1_Intron|ACTR3B_uc011kvp.1_Intron	NM_020445	NP_065178			actin-related protein 3-beta isoform 1						regulation of actin filament polymerization	cell projection|cytoplasm|cytoskeleton	actin binding|ATP binding				0		all_hematologic(28;0.0592)|Prostate(32;0.191)	OV - Ovarian serous cystadenocarcinoma(82;0.0287)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0434)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	154702668	154702668	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154702668delC								DPP6 (16674 upstream) : LOC100132707 (17559 downstream)																																			---	---	---	---
RBM33	155435	broad.mit.edu	37	7	155491065	155491065	+	Intron	DEL	A	-	-	rs11349179		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155491065delA	uc010lqk.1	+						RBM33_uc003wme.2_Intron|RBM33_uc011kvv.1_5'Flank	NM_053043	NP_444271			RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	155584767	155584768	+	IGR	INS	-	T	T	rs147360748		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155584767_155584768insT								RBM33 (10588 upstream) : SHH (7968 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	156113951	156113952	+	IGR	INS	-	CTT	CTT	rs144799821	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156113951_156113952insCTT								SHH (508984 upstream) : C7orf4 (219233 downstream)																																			---	---	---	---
LMBR1	64327	broad.mit.edu	37	7	156617818	156617819	+	Intron	INS	-	TTT	TTT	rs137950622	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156617818_156617819insTTT	uc003wmw.3	-						LMBR1_uc003wmx.3_Intron|LMBR1_uc010lqn.2_Intron|LMBR1_uc011kvx.1_Intron|LMBR1_uc010lqo.2_Intron	NM_022458	NP_071903			limb region 1 protein							integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	156710358	156710360	+	IGR	DEL	TTT	-	-	rs111433089		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156710358_156710360delTTT								LMBR1 (24456 upstream) : NOM1 (32057 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	157084074	157084074	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157084074delA								UBE3C (22009 upstream) : DNAJB6 (45636 downstream)																																			---	---	---	---
PTPRN2	5799	broad.mit.edu	37	7	157425837	157425837	+	Intron	DEL	T	-	-	rs11289433		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157425837delT	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838			protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)														---	---	---	---
WDR60	55112	broad.mit.edu	37	7	158708373	158708375	+	Intron	DEL	CGT	-	-	rs72184687		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158708373_158708375delCGT	uc003woe.3	+						WDR60_uc010lqv.2_Intron|WDR60_uc010lqw.2_Intron	NM_018051	NP_060521			WD repeat domain 60											ovary(2)|breast(1)|central_nervous_system(1)	4	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	25964	25964	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25964delA								None (None upstream) : OR4F21 (90124 downstream)																																			---	---	---	---
FBXO25	26260	broad.mit.edu	37	8	382436	382437	+	Intron	INS	-	G	G	rs61012540		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:382436_382437insG	uc003wox.2	+						FBXO25_uc003woy.2_Intron|FBXO25_uc003woz.2_Intron	NM_183421	NP_904357			F-box only protein 25 isoform 1							nucleus|SCF ubiquitin ligase complex	actin binding|ubiquitin-protein ligase activity			lung(1)	1		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	1419854	1419855	+	IGR	INS	-	TCT	TCT	rs151213886	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1419854_1419855insTCT								ERICH1 (738628 upstream) : DLGAP2 (29714 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2221670	2221671	+	IGR	INS	-	T	T	rs144046390	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2221670_2221671insT								MYOM2 (128291 upstream) : CSMD1 (571205 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	2447802	2447802	+	RNA	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2447802delA	uc003wqa.2	-	5		c.979delT								Homo sapiens cDNA clone IMAGE:4830065.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	2772041	2772042	+	IGR	INS	-	CA	CA	rs142757974	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2772041_2772042insCA								MYOM2 (678662 upstream) : CSMD1 (20834 downstream)																																			---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3248698	3248699	+	Intron	INS	-	C	C	rs139520888	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3248698_3248699insC	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Intron	NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3589565	3589566	+	Intron	INS	-	A	A	rs145613676	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3589565_3589566insA	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3763816	3763816	+	Intron	DEL	A	-	-	rs67199666		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3763816delA	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	4977286	4977299	+	IGR	DEL	CACTTTTATGAGGA	-	-	rs72388815		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4977286_4977299delCACTTTTATGAGGA								CSMD1 (124958 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	5257371	5257372	+	IGR	DEL	TG	-	-	rs35939436		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5257371_5257372delTG								CSMD1 (405043 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	5584943	5584947	+	IGR	DEL	TCTTG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5584943_5584947delTCTTG								CSMD1 (732615 upstream) : MCPH1 (679174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	6151566	6151566	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6151566delA								None (None upstream) : MCPH1 (112555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	6520247	6520247	+	IGR	DEL	C	-	-	rs75265324		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6520247delC								MCPH1 (14222 upstream) : AGPAT5 (45631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	6716236	6716237	+	IGR	INS	-	A	A	rs147020999	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6716236_6716237insA								XKR5 (23199 upstream) : DEFB1 (11860 downstream)																																			---	---	---	---
SGK223	157285	broad.mit.edu	37	8	8208412	8208419	+	Intron	DEL	ATGGATGG	-	-	rs142430789		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8208412_8208419delATGGATGG	uc003wsh.3	-							NM_001080826	NP_001074295			pragmin								ATP binding|non-membrane spanning protein tyrosine kinase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	8454301	8454302	+	IGR	DEL	AA	-	-	rs34564014		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8454301_8454302delAA								SGK223 (215044 upstream) : CLDN23 (105364 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	8460857	8460858	+	IGR	INS	-	GT	GT	rs112264765		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8460857_8460858insGT								SGK223 (221600 upstream) : CLDN23 (98808 downstream)																																			---	---	---	---
ERI1	90459	broad.mit.edu	37	8	8870835	8870837	+	Intron	DEL	AAA	-	-	rs34377572		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8870835_8870837delAAA	uc011kwu.1	+						ERI1_uc003wsk.2_Intron	NM_153332	NP_699163			three prime histone mRNA exonuclease 1						gene silencing by RNA|rRNA 3'-end processing	cytoplasm|histone pre-mRNA 3'end processing complex|nucleolus	3'-5' exonuclease activity|histone pre-mRNA stem-loop binding|metal ion binding|ribosome binding|rRNA binding				0					Adenosine monophosphate(DB00131)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	9258993	9258993	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9258993delT								PPP1R3B (249909 upstream) : TNKS (154452 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9672046	9672047	+	IGR	INS	-	CCTCT	CCTCT	rs137862760	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9672046_9672047insCCTCT								TNKS (32191 upstream) : LOC157627 (85527 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	11785382	11785383	+	IGR	INS	-	AG	AG	rs144426028		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11785382_11785383insAG								CTSB (59736 upstream) : DEFB136 (46065 downstream)																																			---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12367935	12367936	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12367935_12367936insA	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12415163	12415163	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12415163delA	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	12522651	12522651	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12522651delA	uc003wvy.3	-						uc003wwc.3_Intron					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	12619506	12619506	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12619506delA								LONRF1 (6514 upstream) : LOC340357 (4066 downstream)																																			---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13066255	13066256	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13066255_13066256delAC	uc003wwm.2	-						DLC1_uc003wwl.1_Intron	NM_182643	NP_872584			deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
DLC1	10395	broad.mit.edu	37	8	13216504	13216504	+	Intron	DEL	G	-	-	rs5889439		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13216504delG	uc003wwm.2	-						DLC1_uc003wwn.2_Intron|DLC1_uc011kxy.1_Intron	NM_182643	NP_872584			deleted in liver cancer 1 isoform 1						actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	13511607	13511607	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13511607delC								C8orf48 (85811 upstream) : SGCZ (435767 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	13558199	13558200	+	IGR	INS	-	A	A	rs147994417	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13558199_13558200insA								C8orf48 (132403 upstream) : SGCZ (389174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	13687546	13687546	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13687546delT								C8orf48 (261750 upstream) : SGCZ (259828 downstream)																																			---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	14069160	14069161	+	Intron	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14069160_14069161delGA	uc003wwq.2	-						SGCZ_uc010lss.2_Intron	NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	14077255	14077255	+	Intron	DEL	A	-	-	rs113937978		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14077255delA	uc003wwq.2	-						SGCZ_uc010lss.2_Intron	NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	14158569	14158570	+	Intron	INS	-	ATC	ATC	rs150748696	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14158569_14158570insATC	uc003wwq.2	-						SGCZ_uc010lss.2_Intron	NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	14210583	14210608	+	Intron	DEL	CATGAGTTTGAAATCTTGTTCTTACA	-	-	rs67374918		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14210583_14210608delCATGAGTTTGAAATCTTGTTCTTACA	uc003wwq.2	-						SGCZ_uc010lss.2_Intron	NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	16304928	16304929	+	IGR	INS	-	CA	CA	rs145927628		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16304928_16304929insCA								MSR1 (254628 upstream) : FGF20 (545405 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	18314359	18314360	+	IGR	INS	-	C	C	rs78972488		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18314359_18314360insC								NAT2 (55636 upstream) : PSD3 (70454 downstream)																																			---	---	---	---
PSD3	23362	broad.mit.edu	37	8	18473532	18473533	+	Intron	INS	-	GAC	GAC	rs138237041	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18473532_18473533insGAC	uc003wza.2	-						PSD3_uc003wyx.3_Intron|PSD3_uc003wyy.2_Intron|PSD3_uc003wyz.2_Intron	NM_015310	NP_056125			ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)														---	---	---	---
PSD3	23362	broad.mit.edu	37	8	18864767	18864770	+	Intron	DEL	AAAT	-	-	rs113627938		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18864767_18864770delAAAT	uc003wza.2	-							NM_015310	NP_056125			ADP-ribosylation factor guanine nucleotide						regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	18934990	18934991	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18934990_18934991insA								PSD3 (63794 upstream) : SH2D4A (236216 downstream)																																			---	---	---	---
CSGALNACT1	55790	broad.mit.edu	37	8	19360477	19360477	+	Intron	DEL	A	-	-	rs10707764		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19360477delA	uc011kyn.1	-						CSGALNACT1_uc011kyo.1_Intron|CSGALNACT1_uc003wzg.2_Intron|CSGALNACT1_uc011kyp.1_Intron|CSGALNACT1_uc003wzh.2_Intron	NM_001130518	NP_001123990			chondroitin sulfate						anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	19645261	19645261	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19645261delA								CSGALNACT1 (29879 upstream) : INTS10 (29657 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	21123817	21123818	+	IGR	DEL	CA	-	-	rs111718311		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21123817_21123818delCA								None (None upstream) : GFRA2 (425712 downstream)																																			---	---	---	---
DOK2	9046	broad.mit.edu	37	8	21671866	21671869	+	Intron	DEL	CACA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21671866_21671869delCACA	uc003wzx.1	-							NM_003974	NP_003965			docking protein 2						blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	22563780	22563781	+	IGR	INS	-	T	T	rs71206539		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22563780_22563781insT								EGR3 (12965 upstream) : PEBP4 (6984 downstream)																																			---	---	---	---
PEBP4	157310	broad.mit.edu	37	8	22776442	22776443	+	Intron	INS	-	CACATGTGCA	CACATGTGCA	rs141376967	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22776442_22776443insCACATGTGCA	uc003xcn.1	-							NM_144962	NP_659399			phosphatidylethanolamine-binding protein 4							lysosome				ovary(1)|large_intestine(1)|breast(1)|skin(1)	4		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)												OREG0018626	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
TNFRSF10C	8794	broad.mit.edu	37	8	22952870	22952882	+	Intron	DEL	CTGACCATCTGAG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22952870_22952882delCTGACCATCTGAG	uc003xcx.2	+											Homo sapiens hypothetical protein MGC31957, mRNA (cDNA clone MGC:12787 IMAGE:4039959), complete cds.						apoptosis	anchored to membrane|integral to plasma membrane	TRAIL binding|transmembrane receptor activity				0		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	23341963	23341964	+	IGR	DEL	TT	-	-	rs10534730		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23341963_23341964delTT								ENTPD4 (26719 upstream) : SLC25A37 (44399 downstream)																																			---	---	---	---
EBF2	64641	broad.mit.edu	37	8	25878273	25878273	+	Intron	DEL	T	-	-	rs150532383		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25878273delT	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron	NM_022659	NP_073150			early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)														---	---	---	---
PPP2R2A	5520	broad.mit.edu	37	8	26087446	26087447	+	Intron	DEL	AC	-	-	rs72113015		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26087446_26087447delAC	uc003xek.2	+							NM_002717	NP_002708			alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)														---	---	---	---
ADRA1A	148	broad.mit.edu	37	8	26663818	26663818	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26663818delT	uc003xfh.1	-						ADRA1A_uc003xfc.1_Intron|ADRA1A_uc010lul.1_Intron|ADRA1A_uc003xfd.1_Intron|ADRA1A_uc003xfe.1_Intron|ADRA1A_uc010lum.1_Intron|ADRA1A_uc003xff.1_Intron|ADRA1A_uc003xfg.1_Intron	NM_000680	NP_000671			alpha-1A-adrenergic receptor isoform 1						activation of phospholipase C activity|aging|apoptosis|calcium ion transport into cytosol|cell-cell signaling|intracellular protein kinase cascade|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of synaptic transmission, GABAergic|positive regulation of action potential|positive regulation of cardiac muscle contraction|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase C signaling cascade|positive regulation of vasoconstriction|response to drug|response to hormone stimulus|response to stress|smooth muscle contraction	integral to plasma membrane	alpha1-adrenergic receptor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amphetamine(DB00182)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Carvedilol(DB01136)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Maprotiline(DB00934)|Mephentermine(DB01365)|Metaraminol(DB00610)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Midodrine(DB00211)|Nefazodone(DB01149)|Nicergoline(DB00699)|Nilutamide(DB00665)|Norepinephrine(DB00368)|Norgestrel(DB00506)|Oxymetazoline(DB00935)|Perphenazine(DB00850)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Prazosin(DB00457)|Promazine(DB00420)|Promethazine(DB01069)|Propericiazine(DB01608)|Propiomazine(DB00777)|Pseudoephedrine(DB00852)|Risperidone(DB00734)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioridazine(DB00679)|Tolazoline(DB00797)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Ziprasidone(DB00246)													---	---	---	---
SCARA3	51435	broad.mit.edu	37	8	27511088	27511089	+	Intron	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27511088_27511089delGT	uc003xga.1	+						SCARA3_uc003xgb.1_Intron	NM_016240	NP_057324			scavenger receptor class A, member 3 isoform 1						response to oxidative stress|UV protection	collagen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	scavenger receptor activity			skin(2)|ovary(1)|breast(1)	4		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0219)|Colorectal(74;0.148)														---	---	---	---
ELP3	55140	broad.mit.edu	37	8	27992447	27992447	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27992447delT	uc003xgo.3	+						ELP3_uc003xgn.3_Intron|ELP3_uc011laq.1_Intron|ELP3_uc011lar.1_Intron|ELP3_uc011las.1_Intron|ELP3_uc011lat.1_Intron	NM_018091	NP_060561			elongation protein 3 homolog						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	histone acetyltransferase activity|iron-sulfur cluster binding|metal ion binding|phosphorylase kinase regulator activity|protein binding				0		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	29231386	29231386	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29231386delG								DUSP4 (23201 upstream) : C8orf75 (347392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	29637080	29637081	+	Intron	INS	-	AG	AG			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29637080_29637081insAG	uc003xho.2	+						uc003xhp.2_Intron					Homo sapiens, clone IMAGE:4861097, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	29672404	29672405	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29672404_29672405delCA								C8orf75 (66779 upstream) : LOC286135 (106624 downstream)																																			---	---	---	---
LOC286135	286135	broad.mit.edu	37	8	29809697	29809697	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29809697delT	uc003xhq.3	+							NR_024473				Homo sapiens mRNA; cDNA DKFZp686I2037 (from clone DKFZp686I2037).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	30824856	30824857	+	IGR	INS	-	TG	TG	rs140593680	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30824856_30824857insTG								TEX15 (78634 upstream) : PURG (28464 downstream)																																			---	---	---	---
PURG	29942	broad.mit.edu	37	8	30885488	30885488	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30885488delA	uc003xim.1	-							NM_001015508	NP_001015508			purine-rich element binding protein G isoform B							nucleus	DNA binding				0				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)														---	---	---	---
WRN	7486	broad.mit.edu	37	8	30908593	30908593	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30908593delT	uc003xio.3	+							NM_000553	NP_000544			Werner syndrome protein						base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)				Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				---	---	---	---
WRN	7486	broad.mit.edu	37	8	30933236	30933236	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30933236delA	uc003xio.3	+							NM_000553	NP_000544			Werner syndrome protein						base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	7		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)				Mis|N|F|S			osteosarcoma|meningioma|others		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Werner_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	8	31397387	31397387	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31397387delT								WRN (366111 upstream) : NRG1 (99881 downstream)																																			---	---	---	---
NRG1	3084	broad.mit.edu	37	8	31706047	31706048	+	Intron	DEL	TC	-	-	rs72344434		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31706047_31706048delTC	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32248623	32248624	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32248623_32248624delTG	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	32963290	32963290	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32963290delT								NRG1 (340732 upstream) : FUT10 (265056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	32987254	32987254	+	IGR	DEL	G	-	-	rs79881775		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32987254delG								NRG1 (364696 upstream) : FUT10 (241092 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	33076066	33076067	+	IGR	INS	-	T	T	rs147657064	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33076066_33076067insT								NRG1 (453508 upstream) : FUT10 (152279 downstream)																																			---	---	---	---
FUT10	84750	broad.mit.edu	37	8	33318706	33318729	+	Intron	DEL	AGGAAGGGAGGGAGGGAGGGAGGG	-	-	rs34506024	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33318706_33318729delAGGAAGGGAGGGAGGGAGGGAGGG	uc003xje.2	-						FUT10_uc003xjd.2_Intron|FUT10_uc011lbi.1_Intron|FUT10_uc003xjf.2_Intron|FUT10_uc003xjg.2_Intron|FUT10_uc003xjh.2_Intron|FUT10_uc003xji.1_Intron	NM_032664	NP_116053			fucosyltransferase 10						embryo development|fertilization|hemopoiesis|L-fucose catabolic process|nervous system development|protein folding|protein glycosylation|protein targeting|wound healing	Golgi cisterna membrane|integral to membrane	alpha(1,3)-fucosyltransferase activity			ovary(1)|pancreas(1)	2				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	33510771	33510772	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33510771_33510772delGT								DUSP26 (53332 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	33531541	33531542	+	IGR	DEL	TT	-	-	rs35801124		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33531541_33531542delTT								DUSP26 (74102 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	33814717	33814717	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33814717delT								DUSP26 (357278 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34484010	34484010	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34484010delA								None (None upstream) : UNC5D (608965 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34795626	34795627	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34795626_34795627insT								None (None upstream) : UNC5D (297348 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	34983818	34983819	+	IGR	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34983818_34983819delCT								None (None upstream) : UNC5D (109156 downstream)																																			---	---	---	---
UNC5D	137970	broad.mit.edu	37	8	35275323	35275323	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35275323delT	uc003xjr.1	+							NM_080872	NP_543148			unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)														---	---	---	---
UNC5D	137970	broad.mit.edu	37	8	35294886	35294886	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35294886delA	uc003xjr.1	+							NM_080872	NP_543148			unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	36523176	36523176	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36523176delC								UNC5D (870996 upstream) : KCNU1 (118666 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	36582633	36582633	+	IGR	DEL	A	-	-	rs33913598		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36582633delA								UNC5D (930453 upstream) : KCNU1 (59209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	37401819	37401820	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37401819_37401820delAC								KCNU1 (608178 upstream) : ZNF703 (151481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	37588922	37588923	+	Intron	INS	-	A	A	rs77124769		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37588922_37588923insA	uc003xka.1	+											Homo sapiens cDNA clone IMAGE:4827062.																														---	---	---	---
TACC1	6867	broad.mit.edu	37	8	38656124	38656125	+	Intron	INS	-	GT	GT	rs142520406	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38656124_38656125insGT	uc010lwp.2	+						TACC1_uc011lby.1_Intron|TACC1_uc003xma.2_Intron|TACC1_uc003xlz.2_Intron|TACC1_uc003xmc.3_Intron|TACC1_uc011lbz.1_Intron|TACC1_uc003xmb.3_Intron|TACC1_uc003xme.1_Intron|TACC1_uc003xmd.1_Intron|TACC1_uc010lwo.1_Intron|TACC1_uc003xmf.3_Intron|TACC1_uc011lca.1_Intron|TACC1_uc011lcb.1_Intron	NM_006283	NP_006274			transforming, acidic coiled-coil containing						cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)															---	---	---	---
ADAM32	203102	broad.mit.edu	37	8	38975171	38975172	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38975171_38975172insT	uc003xmt.3	+						ADAM32_uc011lch.1_Intron|ADAM32_uc003xmu.3_Intron	NM_145004	NP_659441			a disintegrin and metalloprotease domain 32						proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)															---	---	---	---
ADAM2	2515	broad.mit.edu	37	8	39680620	39680620	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39680620delT	uc003xnj.2	-						ADAM2_uc003xnk.2_Intron|ADAM2_uc011lck.1_Intron|ADAM2_uc003xnl.2_Intron	NM_001464	NP_001455			ADAM metallopeptidase domain 2 proprotein						cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	40382052	40382052	+	IGR	DEL	A	-	-	rs34754331		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40382052delA								C8orf4 (369231 upstream) : ZMAT4 (6064 downstream)																																			---	---	---	---
SFRP1	6422	broad.mit.edu	37	8	41133029	41133029	+	Intron	DEL	T	-	-	rs34725036		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41133029delT	uc003xnt.2	-							NM_003012	NP_003003			secreted frizzled-related protein 1 precursor						brain development|canonical Wnt receptor signaling pathway|cellular response to BMP stimulus|cellular response to estradiol stimulus|cellular response to fibroblast growth factor stimulus|cellular response to heparin|cellular response to hypoxia|cellular response to interleukin-1|cellular response to prostaglandin E stimulus|cellular response to starvation|cellular response to transforming growth factor beta stimulus|cellular response to tumor necrosis factor|cellular response to vitamin D|DNA fragmentation involved in apoptotic nuclear change|dorsal/ventral axis specification|hemopoietic progenitor cell differentiation|hemopoietic stem cell differentiation|menstrual cycle phase|negative regulation of androgen receptor signaling pathway|negative regulation of B cell differentiation|negative regulation of bone remodeling|negative regulation of canonical Wnt receptor signaling pathway involved in controlling type B pancreatic cell proliferation|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cysteine-type endopeptidase activity|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast apoptosis|negative regulation of fibroblast proliferation|negative regulation of insulin secretion|negative regulation of ossification|negative regulation of osteoblast proliferation|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|osteoblast differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell growth|positive regulation of epithelial cell proliferation|positive regulation of fat cell differentiation|positive regulation of fibroblast apoptosis|positive regulation of focal adhesion assembly|positive regulation of non-canonical Wnt receptor signaling pathway|positive regulation of Rac GTPase activity|positive regulation of smoothened signaling pathway|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|regulation of angiogenesis|regulation of cell cycle process|response to drug|response to organic cyclic compound|vasculature development	cell surface|cytosol|extracellular space|plasma membrane|proteinaceous extracellular matrix	cysteine-type endopeptidase activity|drug binding|frizzled binding|heparin binding|identical protein binding|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	43794879	43794879	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43794879delC								POTEA (576551 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	47711784	47711784	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47711784delA								None (None upstream) : BEYLA (40724 downstream)																																			---	---	---	---
KIAA0146	23514	broad.mit.edu	37	8	48460486	48460487	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48460486_48460487insT	uc003xqd.2	+						KIAA0146_uc011lcz.1_Intron|KIAA0146_uc011lda.1_Intron|KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron	NM_001080394	NP_001073863			hypothetical protein LOC23514												0		Lung NSC(58;0.175)																---	---	---	---
KIAA0146	23514	broad.mit.edu	37	8	48641015	48641015	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48641015delA	uc003xqd.2	+						KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_Intron|KIAA0146_uc003xqg.1_Intron	NM_001080394	NP_001073863			hypothetical protein LOC23514												0		Lung NSC(58;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	48897438	48897439	+	IGR	INS	-	A	A	rs76507798		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48897438_48897439insA								MCM4 (7370 upstream) : UBE2V2 (23556 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	49398751	49398751	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49398751delC								UBE2V2 (424299 upstream) : EFCAB1 (224600 downstream)																																			---	---	---	---
C8orf22	492307	broad.mit.edu	37	8	49983431	49983432	+	5'Flank	DEL	GA	-	-	rs1628843	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49983431_49983432delGA	uc003xqq.3	+							NM_001007176	NP_001007177			hypothetical protein LOC492307												0		all_cancers(86;0.0452)|all_epithelial(80;0.000863)|Lung NSC(129;0.0019)|all_lung(136;0.00502)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	50200085	50200085	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50200085delC								C8orf22 (211444 upstream) : SNTG1 (622264 downstream)																																			---	---	---	---
SNTG1	54212	broad.mit.edu	37	8	50907264	50907264	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50907264delT	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron	NM_018967	NP_061840			syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)																---	---	---	---
SNTG1	54212	broad.mit.edu	37	8	51299302	51299303	+	Intron	DEL	TT	-	-	rs150658885		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51299302_51299303delTT	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840			syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	53013995	53013996	+	IGR	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53013995_53013996delTT								PCMTD1 (202260 upstream) : ST18 (9396 downstream)																																			---	---	---	---
RB1CC1	9821	broad.mit.edu	37	8	53622407	53622407	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53622407delT	uc003xre.3	-						RB1CC1_uc003xrf.3_Intron	NM_014781	NP_055596			Rb1-inducible coiled coil protein 1 isoform 1						autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	53858524	53858524	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53858524delT								NPBWR1 (5071 upstream) : OPRK1 (279752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	54939338	54939339	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54939338_54939339insT								TCEA1 (4330 upstream) : LYPLA1 (19600 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	54948737	54948737	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54948737delC								TCEA1 (13729 upstream) : LYPLA1 (10202 downstream)																																			---	---	---	---
XKR4	114786	broad.mit.edu	37	8	56185703	56185712	+	Intron	DEL	TGTGTGTGTG	-	-	rs143531883		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56185703_56185712delTGTGTGTGTG	uc003xsf.2	+							NM_052898	NP_443130			XK, Kell blood group complex subunit-related							integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)															---	---	---	---
LYN	4067	broad.mit.edu	37	8	56910676	56910676	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56910676delT	uc003xsk.3	+						LYN_uc003xsl.3_Intron	NM_002350	NP_002341			Yamaguchi sarcoma viral (v-yes-1) oncogene						erythrocyte differentiation|interspecies interaction between organisms|leukocyte migration|platelet activation|positive regulation of cellular component movement|positive regulation of stress-activated protein kinase signaling cascade|positive regulation of tyrosine phosphorylation of STAT protein|response to DNA damage stimulus|T cell costimulation	cytosol|Golgi apparatus|membrane raft|nucleus|perinuclear region of cytoplasm	ATP binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|receptor signaling protein tyrosine kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)															---	---	---	---
TOX	9760	broad.mit.edu	37	8	59793968	59793969	+	Intron	INS	-	G	G	rs142566353	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59793968_59793969insG	uc003xtw.1	-							NM_014729	NP_055544			thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	60805275	60805275	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60805275delC								TOX (773508 upstream) : CA8 (296148 downstream)																																			---	---	---	---
ASPH	444	broad.mit.edu	37	8	62437915	62437916	+	Intron	INS	-	CA	CA			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62437915_62437916insCA	uc003xuj.2	-						ASPH_uc011leg.1_Intron	NM_004318	NP_004309			aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	62867192	62867193	+	IGR	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62867192_62867193delTC								ASPH (239993 upstream) : NKAIN3 (294308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	65012819	65012820	+	IGR	INS	-	AC	AC			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65012819_65012820insAC								YTHDF3 (887474 upstream) : MIR124-2 (278886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	65138149	65138149	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65138149delG								None (None upstream) : MIR124-2 (153557 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	66487206	66487206	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66487206delT								CYP7B1 (775858 upstream) : ARMC1 (27866 downstream)																																			---	---	---	---
ADHFE1	137872	broad.mit.edu	37	8	67349781	67349781	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67349781delC	uc003xwb.3	+						ADHFE1_uc003xwd.3_Intron|ADHFE1_uc003xwc.3_Intron|ADHFE1_uc003xwe.3_Intron|ADHFE1_uc003xwf.3_Intron|ADHFE1_uc011les.1_Intron|ADHFE1_uc011leq.1_Intron|ADHFE1_uc011ler.1_Intron	NM_144650	NP_653251			alcohol dehydrogenase, iron containing, 1						2-oxoglutarate metabolic process|molecular hydrogen transport	mitochondrial matrix	hydroxyacid-oxoacid transhydrogenase activity|metal ion binding			ovary(1)|lung(1)|breast(1)|skin(1)	4		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	68272946	68272947	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68272946_68272947delTG								ARFGEF1 (17034 upstream) : CPA6 (61459 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	68278156	68278156	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68278156delT								ARFGEF1 (22244 upstream) : CPA6 (56250 downstream)																																			---	---	---	---
C8orf34	116328	broad.mit.edu	37	8	69728373	69728374	+	Intron	INS	-	TG	TG	rs138646973	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69728373_69728374insTG	uc010lyz.2	+						C8orf34_uc003xyb.2_Intron	NM_052958	NP_443190			hypothetical protein LOC116328						signal transduction		cAMP-dependent protein kinase regulator activity			large_intestine(1)	1			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	71780606	71780606	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71780606delT								XKR9 (132430 upstream) : EYA1 (329064 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	72877248	72877248	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72877248delA	uc011lff.1	+						uc003xyy.2_Intron					Homo sapiens cDNA FLJ41321 fis, clone BRAMY2045299.																														---	---	---	---
KCNB2	9312	broad.mit.edu	37	8	73645226	73645226	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73645226delA	uc003xzb.2	+							NM_004770	NP_004761			potassium voltage-gated channel, Shab-related						regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	73868922	73868923	+	IGR	INS	-	AC	AC	rs150421085	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73868922_73868923insAC								KCNB2 (18340 upstream) : TERF1 (52174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	74037956	74037956	+	IGR	DEL	C	-	-	rs71934225		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74037956delC								C8orf84 (32449 upstream) : RPL7 (164919 downstream)																																			---	---	---	---
STAU2	27067	broad.mit.edu	37	8	74591906	74591907	+	Intron	INS	-	AGG	AGG	rs150763417	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74591906_74591907insAGG	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron|STAU2_uc003xzo.2_Intron|STAU2_uc003xzp.2_Intron|STAU2_uc011lfi.1_Intron|STAU2_uc003xzq.2_Intron|STAU2_uc010lzk.2_Intron|STAU2_uc010lzl.1_Intron|STAU2_uc003xzs.2_Intron|STAU2_uc003xzr.2_Intron	NM_014393	NP_055208			staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	75887313	75887314	+	IGR	DEL	TT	-	-	rs72183421		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75887313_75887314delTT								PI15 (120051 upstream) : CRISPLD1 (9529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	75972668	75972669	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75972668_75972669insA								CRISPLD1 (25877 upstream) : HNF4G (347514 downstream)																																			---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77602962	77602963	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77602962_77602963delAC	uc003yav.2	+						ZFHX4_uc003yat.1_Intron|ZFHX4_uc003yau.1_Intron	NM_024721	NP_078997			zinc finger homeodomain 4							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78295686	78295687	+	IGR	INS	-	A	A	rs144819074		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78295686_78295687insA								PEX2 (383162 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	80224987	80224987	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80224987delA								IL7 (507229 upstream) : STMN2 (298393 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81803840	81803841	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81803840_81803841delGT								ZNF704 (16824 upstream) : PAG1 (76207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	81856482	81856483	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81856482_81856483insT								ZNF704 (69466 upstream) : PAG1 (23565 downstream)																																			---	---	---	---
FABP4	2167	broad.mit.edu	37	8	82391970	82391970	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82391970delT	uc003ycd.2	-							NM_001442	NP_001433			fatty acid binding protein 4, adipocyte						triglyceride catabolic process	cytoplasm|nucleus|soluble fraction	fatty acid binding|protein binding|transporter activity			breast(1)	1			Epithelial(68;0.213)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	83875440	83875441	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83875440_83875441insT								None (None upstream) : None (None downstream)																																			---	---	---	---
RALYL	138046	broad.mit.edu	37	8	85341814	85341814	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85341814delT	uc003ycq.3	+						RALYL_uc003ycr.3_Intron|RALYL_uc003ycs.3_Intron|RALYL_uc010lzy.2_Intron|RALYL_uc003yct.3_Intron	NM_001100392	NP_001093862			RALY RNA binding protein-like isoform 2								identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
CA13	377677	broad.mit.edu	37	8	86309303	86309304	+	Intron	DEL	GT	-	-	rs3989411		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86309303_86309304delGT	uc003ydf.1	+											Homo sapiens cDNA FLJ36434 fis, clone THYMU2012002.						one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	86494162	86494163	+	IGR	INS	-	AC	AC	rs142574125	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86494162_86494163insAC								CA2 (100441 upstream) : REXO1L1 (74401 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	87105849	87105849	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87105849delT								PSKH2 (23998 upstream) : ATP6V0D2 (5290 downstream)																																			---	---	---	---
CNBD1	168975	broad.mit.edu	37	8	88017598	88017598	+	Intron	DEL	A	-	-	rs75404601		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88017598delA	uc003ydy.2	+							NM_173538	NP_775809			cyclic nucleotide binding domain containing 1											ovary(3)	3																		---	---	---	---
MMP16	4325	broad.mit.edu	37	8	89160006	89160007	+	Intron	INS	-	TG	TG	rs140880358	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89160006_89160007insTG	uc003yeb.3	-						MMP16_uc003yec.2_Intron	NM_005941	NP_005932			matrix metalloproteinase 16 isoform 1						collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	90128696	90128699	+	IGR	DEL	ATAA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90128696_90128699delATAA								MMP16 (788979 upstream) : RIPK2 (641276 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	90241771	90241771	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90241771delT								MMP16 (902054 upstream) : RIPK2 (528204 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	90581907	90581908	+	IGR	INS	-	T	T	rs138324284	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90581907_90581908insT								None (None upstream) : RIPK2 (188067 downstream)																																			---	---	---	---
DPY19L4	286148	broad.mit.edu	37	8	95768113	95768113	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95768113delA	uc003ygx.2	+							NM_181787	NP_861452			dpy-19-like 4							integral to membrane				ovary(2)	2	Breast(36;3.85e-06)																	---	---	---	---
PTDSS1	9791	broad.mit.edu	37	8	97291685	97291685	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97291685delA	uc003yht.1	+						PTDSS1_uc003yhu.1_Intron	NM_014754	NP_055569			phosphatidylserine synthase 1						phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	97398106	97398107	+	IGR	INS	-	TC	TC	rs140086814	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97398106_97398107insTC								PTDSS1 (51332 upstream) : SDC2 (107775 downstream)																																			---	---	---	---
PGCP	10404	broad.mit.edu	37	8	98045854	98045854	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98045854delT	uc003yhw.2	+							NM_016134	NP_057218			plasma glutamate carboxypeptidase precursor						peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity			upper_aerodigestive_tract(1)	1	Breast(36;1.86e-05)																	---	---	---	---
VPS13B	157680	broad.mit.edu	37	8	100620543	100620544	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100620543_100620544insT	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron	NM_017890	NP_060360			vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	101806503	101806503	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101806503delT								PABPC1 (72188 upstream) : YWHAZ (124301 downstream)																																			---	---	---	---
NCALD	83988	broad.mit.edu	37	8	102819114	102819114	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102819114delA	uc003ykf.2	-						NCALD_uc003ykg.2_Intron|NCALD_uc003ykh.2_Intron|NCALD_uc003yki.2_Intron|NCALD_uc003ykj.2_Intron|NCALD_uc003ykk.2_Intron|NCALD_uc003ykl.2_Intron	NM_001040628	NP_001035718			neurocalcin delta						synaptic transmission|vesicle-mediated transport	clathrin coat of trans-Golgi network vesicle|cytosol	actin binding|calcium ion binding|clathrin binding|tubulin binding				0	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	103732216	103732226	+	IGR	DEL	TTCTCCAACTC	-	-	rs36212769		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103732216_103732226delTTCTCCAACTC								KLF10 (64233 upstream) : AZIN1 (106311 downstream)																																			---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106558796	106558797	+	Intron	INS	-	AA	AA	rs77729823		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106558796_106558797insAA	uc003ymd.2	+							NM_012082	NP_036214			zinc finger protein, multitype 2						blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
OXR1	55074	broad.mit.edu	37	8	107283521	107283522	+	Intron	INS	-	G	G	rs140459843	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107283521_107283522insG	uc003ymf.2	+							NM_018002	NP_060472			oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)													OREG0018927	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
OXR1	55074	broad.mit.edu	37	8	107298155	107298159	+	Intron	DEL	TAATC	-	-	rs113257074		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107298155_107298159delTAATC	uc003ymf.2	+							NM_018002	NP_060472			oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)															---	---	---	---
OXR1	55074	broad.mit.edu	37	8	107369458	107369458	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107369458delT	uc003ymf.2	+							NM_018002	NP_060472			oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)															---	---	---	---
OXR1	55074	broad.mit.edu	37	8	107390729	107390731	+	Intron	DEL	TTG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107390729_107390731delTTG	uc003ymf.2	+							NM_018002	NP_060472			oxidation resistance 1 isoform 1						cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	108020096	108020096	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108020096delA								ABRA (237624 upstream) : ANGPT1 (241615 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	108060119	108060120	+	IGR	INS	-	AA	AA	rs33969304		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108060119_108060120insAA								ABRA (277647 upstream) : ANGPT1 (201591 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	111848573	111848574	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111848573_111848574insA								KCNV1 (860497 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	113011854	113011854	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113011854delT								None (None upstream) : CSMD3 (223307 downstream)																																			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113323557	113323557	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113323557delA	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron|CSMD3_uc003ynw.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116163769	116163770	+	IGR	INS	-	T	T	rs10567378		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116163769_116163770insT								None (None upstream) : TRPS1 (256955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	116919319	116919319	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116919319delA								TRPS1 (238091 upstream) : EIF3H (737737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117377988	117377989	+	IGR	INS	-	T	T	rs145777022	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117377988_117377989insT								TRPS1 (696760 upstream) : EIF3H (279067 downstream)																																			---	---	---	---
SLC30A8	169026	broad.mit.edu	37	8	118054599	118054599	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118054599delT	uc010mcz.2	+						SLC30A8_uc011lia.1_Intron|SLC30A8_uc003yog.2_Intron	NM_173851	NP_776250			solute carrier family 30 member 8						insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	119829865	119829869	+	IGR	DEL	CCATC	-	-	rs143507502		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119829865_119829869delCCATC								SAMD12 (195631 upstream) : TNFRSF11B (105928 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	120532109	120532109	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120532109delT								NOV (95431 upstream) : ENPP2 (37210 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122427884	122427884	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122427884delA								SNTB1 (603575 upstream) : HAS2 (197387 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123140766	123140766	+	5'Flank	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123140766delT	uc003ypj.2	-											Homo sapiens, clone IMAGE:5466006, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	125191890	125191891	+	IGR	INS	-	GT	GT	rs139741594	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125191890_125191891insGT								FER1L6 (59589 upstream) : TMEM65 (131270 downstream)																																			---	---	---	---
MTSS1	9788	broad.mit.edu	37	8	125676071	125676073	+	Intron	DEL	CAT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125676071_125676073delCAT	uc003yrk.2	-						MTSS1_uc003yrj.2_Intron|MTSS1_uc003yrl.2_Intron	NM_014751	NP_055566			metastasis suppressor 1						actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	126688165	126688165	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126688165delT								TRIB1 (237523 upstream) : FAM84B (876522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	126845581	126845582	+	IGR	INS	-	T	T	rs10649507		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126845581_126845582insT								TRIB1 (394939 upstream) : FAM84B (719105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	127957916	127957916	+	IGR	DEL	A	-	-	rs34946808		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127957916delA								FAM84B (387450 upstream) : LOC727677 (344146 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129132271	129132271	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129132271delA								PVT1 (18773 upstream) : MIR1208 (30091 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	132126575	132126575	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132126575delT								ADCY8 (73740 upstream) : EFR3A (789784 downstream)																																			---	---	---	---
HHLA1	10086	broad.mit.edu	37	8	133086577	133086577	+	Intron	DEL	T	-	-	rs78748313		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133086577delT	uc011liy.1	-						HHLA1_uc003yth.2_Intron	NM_001145095	NP_001138567			HERV-H LTR-associating 1							extracellular region					0																		---	---	---	---
WISP1	8840	broad.mit.edu	37	8	134213813	134213813	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134213813delG	uc003yub.2	+						WISP1_uc003yuc.2_Intron|WISP1_uc010meb.2_Intron|WISP1_uc010mec.2_Intron|WISP1_uc010med.2_Intron	NM_003882	NP_003873			WNT1 inducible signaling pathway protein 1						cell adhesion|cell-cell signaling|regulation of cell growth|Wnt receptor signaling pathway	extracellular region|soluble fraction	insulin-like growth factor binding			central_nervous_system(1)|kidney(1)	2	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	134719596	134719596	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134719596delG								ST3GAL1 (135413 upstream) : ZFAT (770437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134896558	134896559	+	IGR	INS	-	AGGA	AGGA	rs55686208		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134896558_134896559insAGGA								ST3GAL1 (312375 upstream) : ZFAT (593474 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	136710745	136710746	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136710745_136710746delAC								KHDRBS3 (50899 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	138785834	138785835	+	IGR	INS	-	CAGAAGTCCT	CAGAAGTCCT	rs139579312	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138785834_138785835insCAGAAGTCCT								None (None upstream) : FAM135B (356433 downstream)																																			---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139237780	139237781	+	Intron	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139237780_139237781delGT	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996			hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139390978	139390978	+	Intron	DEL	T	-	-	rs71974107		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139390978delT	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996			hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139632653	139632653	+	Intron	DEL	A	-	-	rs72262908		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139632653delA	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139743907	139743908	+	Intron	DEL	GT	-	-	rs3862309	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139743907_139743908delGT	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
COL22A1	169044	broad.mit.edu	37	8	139817510	139817511	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139817510_139817511delTG	uc003yvd.2	-							NM_152888	NP_690848			collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	140005454	140005454	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140005454delA								COL22A1 (79218 upstream) : KCNK9 (607628 downstream)																																			---	---	---	---
KCNK9	51305	broad.mit.edu	37	8	140691781	140691781	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140691781delA	uc003yvf.1	-						KCNK9_uc003yvg.1_Intron	NM_016601	NP_057685			potassium channel, subfamily K, member 9							integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)															---	---	---	---
TRAPPC9	83696	broad.mit.edu	37	8	141034499	141034499	+	Intron	DEL	T	-	-	rs145409811		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141034499delT	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc010mel.1_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844			trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	141528393	141528394	+	IGR	INS	-	TGA	TGA	rs150493115	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141528393_141528394insTGA								CHRAC1 (1141 upstream) : EIF2C2 (12871 downstream)																																			---	---	---	---
FLJ43860	389690	broad.mit.edu	37	8	142470463	142470463	+	Intron	DEL	T	-	-	rs35086656		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142470463delT	uc003ywi.2	-						FLJ43860_uc011ljs.1_Intron|FLJ43860_uc010meu.1_Intron	NM_207414	NP_997297			hypothetical protein LOC389690								binding				0	all_cancers(97;7.79e-15)|all_epithelial(106;4.52e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	143088902	143088902	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143088902delA								MIR1302-7 (221228 upstream) : NCRNA00051 (190815 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144255277	144255281	+	IGR	DEL	GAAAA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144255277_144255281delGAAAA								LY6H (13224 upstream) : GPIHBP1 (39787 downstream)																																			---	---	---	---
RHPN1	114822	broad.mit.edu	37	8	144459224	144459233	+	Intron	DEL	GTGTGTGCGC	-	-	rs66539754	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144459224_144459233delGTGTGTGCGC	uc003yyb.2	+							NM_052924	NP_443156			rhophilin 1						signal transduction	intracellular				large_intestine(1)	1	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)															---	---	---	---
HSF1	3297	broad.mit.edu	37	8	145530604	145530605	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145530604_145530605delTG	uc003zbt.3	+						HSF1_uc003zbu.3_Intron	NM_005526	NP_005517			heat shock transcription factor 1							cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.12e-39)|all cancers(56;9.11e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0547)|Colorectal(110;0.055)															---	---	---	---
ZNF251	90987	broad.mit.edu	37	8	145979332	145979334	+	Intron	DEL	CCA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145979332_145979334delCCA	uc003zdv.3	-							NM_138367	NP_612376			zinc finger protein 251						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;7.54e-38)|all cancers(56;6.19e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.198)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	146131473	146131473	+	IGR	DEL	A	-	-	rs5895833		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146131473delA								COMMD5 (4627 upstream) : ZNF16 (24273 downstream)																																			---	---	---	---
ZNF16	7564	broad.mit.edu	37	8	146169229	146169229	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146169229delT	uc003zet.2	-						ZNF16_uc003zeu.2_Intron	NM_001029976	NP_001025147			zinc finger protein 16						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)														---	---	---	---
DOCK8	81704	broad.mit.edu	37	9	400949	400950	+	Intron	INS	-	CCT	CCT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:400949_400950insCCT	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc010mgw.1_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272			dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	1568215	1568215	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1568215delT								DMRT2 (510662 upstream) : SMARCA2 (447127 downstream)																																			---	---	---	---
FLJ35024	401491	broad.mit.edu	37	9	2428507	2428507	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2428507delG	uc003zhh.1	-						FLJ35024_uc003zhi.2_Intron					Homo sapiens cDNA FLJ35024 fis, clone OCBBF2015233.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	3184820	3184821	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3184820_3184821insT								KIAA0020 (340690 upstream) : RFX3 (39828 downstream)																																			---	---	---	---
RFX3	5991	broad.mit.edu	37	9	3453729	3453730	+	Intron	DEL	AG	-	-	rs36111393		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3453729_3453730delAG	uc003zhr.2	-						RFX3_uc010mhd.2_Intron|RFX3_uc003zhs.1_Intron|RFX3_uc003zht.1_Intron|RFX3_uc010mhe.1_Intron	NM_134428	NP_602304			regulatory factor X3 isoform b						cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)														---	---	---	---
GLIS3	169792	broad.mit.edu	37	9	3931286	3931286	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3931286delA	uc003zhw.1	-						GLIS3_uc003zhx.1_Intron|GLIS3_uc010mhf.1_Intron|GLIS3_uc003zhv.1_Intron|GLIS3_uc003zhy.1_Intron|GLIS3_uc003zhz.1_Intron	NM_152629	NP_689842			GLIS family zinc finger 3 isoform b						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter		DNA binding|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)														---	---	---	---
SLC1A1	6505	broad.mit.edu	37	9	4556918	4556920	+	Intron	DEL	ACA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4556918_4556920delACA	uc003zij.1	+						C9orf68_uc003zik.2_Intron	NM_004170	NP_004161			solute carrier family 1, member 1						D-aspartate import|L-glutamate import|synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	7212269	7212270	+	IGR	INS	-	AG	AG	rs147671369	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7212269_7212270insAG								KDM4C (36622 upstream) : C9orf123 (584223 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	7356426	7356426	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7356426delA								KDM4C (180779 upstream) : C9orf123 (440067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	12970894	12970901	+	IGR	DEL	CATCTAAT	-	-	rs67495222		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12970894_12970901delCATCTAAT								C9orf150 (147836 upstream) : MPDZ (134808 downstream)																																			---	---	---	---
FREM1	158326	broad.mit.edu	37	9	14893168	14893169	+	Intron	DEL	TC	-	-	rs111567401		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14893168_14893169delTC	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403			FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	19204120	19204137	+	IGR	DEL	AAAGAAAGAAAGAAAGAG	-	-	rs72022769		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19204120_19204137delAAAGAAAGAAAGAAAGAG								PLIN2 (76547 upstream) : DENND4C (86565 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	20627502	20627503	+	IGR	INS	-	A	A	rs77483246		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20627502_20627503insA								MLLT3 (4988 upstream) : KIAA1797 (30806 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	21184227	21184228	+	IGR	INS	-	CTT	CTT	rs141493542	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21184227_21184228insCTT								IFNA21 (17568 upstream) : IFNA4 (2390 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	26563650	26563651	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26563650_26563651delCA								TUSC1 (884794 upstream) : C9orf82 (277033 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	27853347	27853348	+	IGR	INS	-	AAG	AAG	rs142415102	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27853347_27853348insAAG								C9orf72 (279505 upstream) : LINGO2 (95180 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	29290399	29290399	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29290399delG								MIR873 (401446 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	30576544	30576544	+	IGR	DEL	T	-	-	rs139405056		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30576544delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32804761	32804762	+	IGR	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32804761_32804762delGA								TMEM215 (15564 upstream) : APTX (167847 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32819691	32819692	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32819691_32819692insT								TMEM215 (30494 upstream) : APTX (152917 downstream)																																			---	---	---	---
CD72	971	broad.mit.edu	37	9	35610316	35610319	+	Intron	DEL	AGTG	-	-	rs143610624		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35610316_35610319delAGTG	uc003zxb.2	-						CD72_uc003zxc.1_Intron|CD72_uc010mkt.1_Intron	NM_001782	NP_001773			CD72 molecule						axon guidance|cell adhesion	integral to plasma membrane	receptor binding|sugar binding|transmembrane receptor activity				0			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
Unknown	0	broad.mit.edu	37	9	43394869	43394869	+	IGR	DEL	A	-	-	rs34120325		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:43394869delA								LOC642929 (249385 upstream) : FAM75A6 (229635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	45377715	45377715	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:45377715delG								FAM27C (386224 upstream) : FAM27A (349314 downstream)																																			---	---	---	---
LOC442421	442421	broad.mit.edu	37	9	66496197	66496197	+	5'Flank	DEL	G	-	-	rs79383207		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66496197delG	uc004aee.1	+						LOC442421_uc004aed.1_5'Flank					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	68688163	68688165	+	IGR	DEL	GTG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68688163_68688165delGTG								FAM27B (893974 upstream) : MIR1299 (314074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68810603	68810603	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68810603delT								None (None upstream) : MIR1299 (191636 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69514762	69514762	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69514762delA								ANKRD20A4 (89654 upstream) : LOC100133920 (136599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69814659	69814660	+	IGR	INS	-	T	T	rs147599302	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69814659_69814660insT								LOC100133920 (149710 upstream) : FOXD4L5 (361049 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69817201	69817201	+	IGR	DEL	G	-	-	rs111588152		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69817201delG								LOC100133920 (152252 upstream) : FOXD4L5 (358508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69840103	69840104	+	IGR	INS	-	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69840103_69840104insC								LOC100133920 (175154 upstream) : FOXD4L5 (335605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69959201	69959202	+	IGR	INS	-	T	T	rs143401728		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69959201_69959202insT								LOC100133920 (294252 upstream) : FOXD4L5 (216507 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69989891	69989892	+	IGR	INS	-	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69989891_69989892insC								LOC100133920 (324942 upstream) : FOXD4L5 (185817 downstream)																																			---	---	---	---
FAM189A2	9413	broad.mit.edu	37	9	72005007	72005007	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72005007delA	uc010mon.1	+						FAM189A2_uc004ahg.2_Intron|FAM189A2_uc010moo.1_Intron	NM_001127608	NP_001121080			chromosome 9 open reading frame 61 precursor							integral to membrane					0																		---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73280118	73280118	+	Intron	DEL	G	-	-	rs140993598	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73280118delG	uc004aid.2	-						TRPM3_uc004ahu.2_Intron|TRPM3_uc004ahv.2_Intron|TRPM3_uc004ahw.2_Intron|TRPM3_uc004ahx.2_Intron|TRPM3_uc004ahy.2_Intron|TRPM3_uc004ahz.2_Intron|TRPM3_uc004aia.2_Intron|TRPM3_uc004aib.2_Intron|TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron	NM_001007471	NP_001007472			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73666850	73666851	+	Intron	INS	-	G	G	rs150509905	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73666850_73666851insG	uc004aid.2	-						TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron|TRPM3_uc004aii.2_Intron	NM_001007471	NP_001007472			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
TMC1	117531	broad.mit.edu	37	9	75190824	75190825	+	Intron	DEL	CA	-	-	rs34081096		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75190824_75190825delCA	uc004aiz.1	+						TMC1_uc010moz.1_5'Flank	NM_138691	NP_619636			transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1																		---	---	---	---
RORB	6096	broad.mit.edu	37	9	77263887	77263887	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77263887delT	uc004aji.2	+						RORB_uc004ajh.2_Intron	NM_006914	NP_008845			RAR-related orphan receptor B						eye photoreceptor cell development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|visual perception	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
VPS13A	23230	broad.mit.edu	37	9	80028677	80028678	+	Intron	INS	-	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80028677_80028678insG	uc004akr.2	+						VPS13A_uc004aks.2_Intron	NM_033305	NP_150648			vacuolar protein sorting 13A isoform A						Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	80831080	80831080	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80831080delT								GNAQ (184888 upstream) : CEP78 (19911 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	81817684	81817684	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81817684delT								PSAT1 (872677 upstream) : TLE4 (369194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	82174551	82174551	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:82174551delT								None (None upstream) : TLE4 (12327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	83736093	83736093	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:83736093delG								None (None upstream) : TLE1 (462507 downstream)																																			---	---	---	---
FRMD3	257019	broad.mit.edu	37	9	86027063	86027064	+	Intron	INS	-	T	T	rs146479862	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86027063_86027064insT	uc004ams.1	-						FRMD3_uc004amr.1_Intron	NM_174938	NP_777598			FERM domain containing 3							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	89208846	89208846	+	IGR	DEL	T	-	-	rs59814981		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89208846delT								ZCCHC6 (239468 upstream) : GAS1 (350433 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	89867601	89867601	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89867601delA	uc004apb.1	-											Homo sapiens cDNA clone IMAGE:30346008.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	90473900	90473900	+	IGR	DEL	G	-	-	rs34537969		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90473900delG								CTSL3 (72101 upstream) : C9orf79 (23841 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	90761586	90761586	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90761586delT								CDK20 (171919 upstream) : SPIN1 (241254 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91256181	91256182	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91256181_91256182delGT								NXNL2 (65478 upstream) : LOC286238 (5912 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	91345968	91345971	+	IGR	DEL	CATC	-	-	rs142457291	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91345968_91345971delCATC								LOC286238 (78893 upstream) : C9orf47 (259807 downstream)																																			---	---	---	---
SYK	6850	broad.mit.edu	37	9	93603839	93603841	+	Intron	DEL	GTA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93603839_93603841delGTA	uc004aqz.2	+						SYK_uc004aqy.2_Intron|SYK_uc004ara.2_Intron|SYK_uc004arb.2_Intron|SYK_uc004arc.2_Intron|SYK_uc011ltr.1_5'Flank|SYK_uc011lts.1_5'Flank|SYK_uc011ltt.1_5'Flank	NM_003177	NP_003168			spleen tyrosine kinase isoform 1						cell proliferation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|neutrophil chemotaxis|organ morphogenesis|platelet activation|protein complex assembly	cytosol|T cell receptor complex	ATP binding|integrin binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5								T	ETV6|ITK	MDS|peripheral T-cell lymphoma								---	---	---	---
ROR2	4920	broad.mit.edu	37	9	94529362	94529363	+	Intron	INS	-	T	T	rs7855073	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94529362_94529363insT	uc004arj.1	-						ROR2_uc004ari.1_Intron|ROR2_uc004ark.2_Intron	NM_004560	NP_004551			receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	95692901	95692901	+	IGR	DEL	A	-	-	rs34786112		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95692901delA								ANKRD19 (41928 upstream) : FGD3 (16700 downstream)																																			---	---	---	---
FANCC	2176	broad.mit.edu	37	9	97919409	97919410	+	Intron	INS	-	T	T	rs145604731	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97919409_97919410insT	uc004avh.2	-						FANCC_uc004avi.3_Intron|FANCC_uc010mrm.1_Intron|FANCC_uc011lul.1_Intron	NM_000136	NP_000127			Fanconi anemia, complementation group C						protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)						D|Mis|N|F|S			AML|leukemia		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
Unknown	0	broad.mit.edu	37	9	99891269	99891272	+	Intron	DEL	ACAC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99891269_99891272delACAC	uc004aww.1	-											Homo sapiens cDNA FLJ34611 fis, clone KIDNE2014112.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	101694419	101694419	+	IGR	DEL	A	-	-	rs143687089		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101694419delA								GALNT12 (82061 upstream) : COL15A1 (11719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	102649622	102649623	+	Intron	DEL	AG	-	-	rs144017787		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102649622_102649623delAG	uc004baj.3	-											Homo sapiens hypothetical gene supported by BC030123, mRNA (cDNA clone IMAGE:4815474).																														---	---	---	---
TMEFF1	8577	broad.mit.edu	37	9	103236412	103236413	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103236412_103236413delTG	uc004baz.1	+						TMEFF1_uc004bay.1_Intron	NM_003692	NP_003683			transmembrane protein with EGF-like and two						multicellular organismal development	integral to membrane|plasma membrane					0		Acute lymphoblastic leukemia(62;0.0452)																---	---	---	---
Unknown	0	broad.mit.edu	37	9	104696148	104696148	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104696148delA								GRIN3A (195286 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	104853786	104853786	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104853786delT								GRIN3A (352924 upstream) : CYLC2 (903807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	106374496	106374497	+	IGR	INS	-	C	C	rs34294564		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106374496_106374497insC								CYLC2 (593726 upstream) : SMC2 (482044 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	106720287	106720287	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106720287delT								CYLC2 (939517 upstream) : SMC2 (136254 downstream)																																			---	---	---	---
ABCA1	19	broad.mit.edu	37	9	107650340	107650343	+	Intron	DEL	GTGT	-	-	rs112631865		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107650340_107650343delGTGT	uc004bcl.2	-						ABCA1_uc004bcm.2_Intron	NM_005502	NP_005493			ATP-binding cassette, sub-family A member 1						Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	109001942	109001943	+	Intron	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109001942_109001943delTC	uc004bcw.2	+											Homo sapiens, clone IMAGE:5538960, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	110324694	110324695	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110324694_110324695insT								KLF4 (72647 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	111160697	111160697	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111160697delA								KLF4 (908650 upstream) : ACTL7B (456174 downstream)																																			---	---	---	---
IKBKAP	8518	broad.mit.edu	37	9	111687784	111687784	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111687784delC	uc004bdm.3	-						IKBKAP_uc011lwc.1_Intron|IKBKAP_uc010mtq.2_Intron	NM_003640	NP_003631			inhibitor of kappa light polypeptide gene						immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	112091226	112091226	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112091226delA								EPB41L4B (8205 upstream) : PTPN3 (46748 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	112348680	112348681	+	IGR	INS	-	TTAGCA	TTAGCA	rs142307566	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112348680_112348681insTTAGCA								PTPN3 (88087 upstream) : PALM2 (54391 downstream)																																			---	---	---	---
PALM2-AKAP2	445815	broad.mit.edu	37	9	112581984	112581985	+	Intron	DEL	TA	-	-	rs113678587		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112581984_112581985delTA	uc004bei.2	+						PALM2_uc004bef.2_Intron|PALM2_uc004beg.2_Intron|PALM2_uc004beh.3_Intron|PALM2-AKAP2_uc004bek.3_Intron|PALM2-AKAP2_uc004bej.3_Intron	NM_001136562	NP_001130034			A kinase (PRKA) anchor protein 2 isoform 2								enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6																		---	---	---	---
C9orf152	401546	broad.mit.edu	37	9	112962382	112962385	+	3'UTR	DEL	AGAG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112962382_112962385delAGAG	uc011lwk.1	-	2						NM_001012993	NP_001013011			hypothetical protein LOC401546												0																		---	---	---	---
ZNF618	114991	broad.mit.edu	37	9	116759633	116759633	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116759633delC	uc004bid.2	+						ZNF618_uc004bib.1_Intron|ZNF618_uc004bic.2_Intron|ZNF618_uc011lxi.1_Intron|ZNF618_uc011lxj.1_Intron	NM_133374	NP_588615			zinc finger protein 618						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119450921	119450922	+	Intron	INS	-	G	G	rs140178434	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119450921_119450922insG	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron|ASTN2_uc004bjp.1_5'Flank|ASTN2_uc004bjq.1_5'Flank|ASTN2_uc011lxr.1_5'Flank|ASTN2_uc011lxs.1_5'Flank|ASTN2_uc011lxt.1_5'Flank|ASTN2_uc004bjv.1_5'Flank|TRIM32_uc004bjx.2_Intron|TRIM32_uc004bjw.2_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119879648	119879648	+	Intron	DEL	A	-	-	rs36042622		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119879648delA	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	121037839	121037841	+	IGR	DEL	TGT	-	-	rs142469637	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121037839_121037841delTGT								TLR4 (558075 upstream) : DBC1 (891067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	123085852	123085852	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123085852delG								MIR147 (78524 upstream) : CDK5RAP2 (65296 downstream)																																			---	---	---	---
PHF19	26147	broad.mit.edu	37	9	123626719	123626719	+	Intron	DEL	A	-	-	rs68126529		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123626719delA	uc004bks.1	-						PHF19_uc011lyf.1_Intron|PHF19_uc004bkr.2_Intron	NM_015651	NP_056466			PHD finger protein 19 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|breast(1)	2																		---	---	---	---
GSN	2934	broad.mit.edu	37	9	123974924	123974926	+	Intron	DEL	TTT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123974924_123974926delTTT	uc004bld.1	+							NM_198252	NP_937895			gelsolin isoform b						actin filament polymerization|actin filament severing|barbed-end actin filament capping|cellular component disassembly involved in apoptosis|cilium morphogenesis	actin cytoskeleton|cytosol	actin binding|calcium ion binding|protein binding			breast(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	124204990	124204991	+	IGR	INS	-	GT	GT	rs148747239	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124204990_124204991insGT								STOM (72445 upstream) : GGTA1 (2278 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	124280942	124280944	+	IGR	DEL	CAT	-	-	rs148694012		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124280942_124280944delCAT								GGTA1 (18636 upstream) : DAB2IP (48455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	125095504	125095507	+	IGR	DEL	AGAG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125095504_125095507delAGAG								MRRF (9764 upstream) : PTGS1 (37302 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	125520727	125520727	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125520727delT								OR1L6 (7667 upstream) : OR5C1 (30485 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	126747790	126747791	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126747790_126747791delTG								DENND1A (55373 upstream) : LHX2 (26098 downstream)																																			---	---	---	---
NEK6	10783	broad.mit.edu	37	9	127032802	127032803	+	Intron	INS	-	A	A	rs150847752	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127032802_127032803insA	uc004bog.2	+						NEK6_uc004bof.2_Intron|NEK6_uc004boh.2_Intron|NEK6_uc010mwj.2_Intron|NEK6_uc010mwk.2_Intron	NM_014397	NP_055212			NIMA-related kinase 6 isoform 2						apoptosis|cell division|chromosome segregation|mitosis|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of mitotic metaphase/anaphase transition	cytoplasm|nucleus	ATP binding|kinesin binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|kidney(1)	3																		---	---	---	---
MAPKAP1	79109	broad.mit.edu	37	9	128295735	128295736	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128295735_128295736insT	uc004bpv.2	-						MAPKAP1_uc011lzt.1_Intron|MAPKAP1_uc010mwz.2_Intron|MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron|MAPKAP1_uc004bqa.2_Intron	NM_001006617	NP_001006618			mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	128967563	128967564	+	IGR	INS	-	TG	TG	rs143016700	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128967563_128967564insTG								PBX3 (237910 upstream) : FAM125B (121564 downstream)																																			---	---	---	---
FAM125B	89853	broad.mit.edu	37	9	129217067	129217068	+	Intron	INS	-	T	T	rs151329438		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129217067_129217068insT	uc004bqh.1	+						FAM125B_uc011lzy.1_Intron|FAM125B_uc010mxd.2_Intron	NM_033446	NP_258257			hypothetical protein LOC89853 isoform 1						protein transport	late endosome membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	129338622	129338625	+	IGR	DEL	ACAC	-	-	rs142610629		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129338622_129338625delACAC								FAM125B (64923 upstream) : LMX1B (38123 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	130896942	130896943	+	IGR	INS	-	T	T	rs138659103	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130896942_130896943insT								LOC389791 (4031 upstream) : LCN2 (14789 downstream)																																			---	---	---	---
DNM1	1759	broad.mit.edu	37	9	131006221	131006222	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131006221_131006222delTG	uc011mau.1	+						DNM1_uc011mat.1_Intron|DNM1_uc004bub.1_Intron|DNM1_uc004buc.1_Intron|DNM1_uc004bud.3_Intron	NM_004408	NP_004399			dynamin 1 isoform 1						receptor-mediated endocytosis	microtubule	GTP binding|GTPase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	131055252	131055253	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131055252_131055253delAC								C9orf119 (3985 upstream) : TRUB2 (16143 downstream)																																			---	---	---	---
FNBP1	23048	broad.mit.edu	37	9	132651910	132651910	+	3'UTR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132651910delG	uc004byw.1	-	17					FNBP1_uc011mbv.1_3'UTR|FNBP1_uc011mbw.1_3'UTR|FNBP1_uc004bza.2_3'UTR|FNBP1_uc004byv.1_RNA|FNBP1_uc011mbu.1_3'UTR	NM_015033	NP_055848			formin binding protein 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|lysosome|plasma membrane	identical protein binding|lipid binding				0		Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)				T	MLL	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	9	133312272	133312273	+	IGR	INS	-	A	A	rs145250971	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133312272_133312273insA								NCS1 (312689 upstream) : ASS1 (7821 downstream)																																			---	---	---	---
FUBP3	8939	broad.mit.edu	37	9	133501293	133501293	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133501293delG	uc004bzr.1	+						FUBP3_uc004bzs.1_Intron	NM_003934	NP_003925			far upstream element (FUSE) binding protein 3						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000279)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	134244874	134244875	+	IGR	INS	-	T	T	rs113014378		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134244874_134244875insT								PPAPDC3 (60225 upstream) : BAT2L1 (24725 downstream)																																			---	---	---	---
BAT2L1	84726	broad.mit.edu	37	9	134298670	134298670	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134298670delG	uc004cam.1	+											SubName: Full=BAT2L protein;								protein binding				0																		---	---	---	---
RALGDS	5900	broad.mit.edu	37	9	136010663	136010663	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136010663delA	uc011mcw.1	-						RALGDS_uc004ccs.2_Intron	NM_001042368	NP_001035827			ral guanine nucleotide dissociation stimulator						nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	Ral guanyl-nucleotide exchange factor activity			large_intestine(1)|lung(1)|ovary(1)	3				OV - Ovarian serous cystadenocarcinoma(145;3.66e-06)|Epithelial(140;2.77e-05)				T	CIITA	PMBL|Hodgkin Lymphona|								---	---	---	---
Unknown	0	broad.mit.edu	37	9	136377042	136377048	+	IGR	DEL	GTGTGTG	-	-	rs67226025		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136377042_136377048delGTGTGTG								SLC2A6 (32766 upstream) : TMEM8C (2711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	136454746	136454747	+	IGR	DEL	GC	-	-	rs34872367		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136454746_136454747delGC								FAM163B (9401 upstream) : DBH (46738 downstream)																																			---	---	---	---
VAV2	7410	broad.mit.edu	37	9	136798604	136798611	+	Intron	DEL	TGGATGGA	-	-	rs111702861		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136798604_136798611delTGGATGGA	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870			vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)														---	---	---	---
NCRNA00094	266655	broad.mit.edu	37	9	136890415	136890416	+	5'Flank	INS	-	CTC	CTC	rs112868547	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136890415_136890416insCTC	uc004ceu.2	+							NR_015427				Homo sapiens cDNA FLJ35348 fis, clone PROST2016918.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	137415518	137415519	+	IGR	INS	-	T	T	rs141862754	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137415518_137415519insT								RXRA (83087 upstream) : COL5A1 (118133 downstream)																																			---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137718426	137718427	+	Intron	INS	-	TGGA	TGGA	rs10668122		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137718426_137718427insTGGA	uc004cfe.2	+						uc004cff.2_Intron	NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	138099253	138099254	+	IGR	INS	-	CCAG	CCAG	rs150702217	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138099253_138099254insCCAG								OLFM1 (86222 upstream) : KIAA0649 (272394 downstream)																																			---	---	---	---
ADARB2	105	broad.mit.edu	37	10	1488262	1488262	+	Intron	DEL	G	-	-	rs67200636		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1488262delG	uc009xhq.2	-							NM_018702	NP_061172			adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)														---	---	---	---
ADARB2	105	broad.mit.edu	37	10	1689608	1689609	+	Intron	DEL	AT	-	-	rs67306977		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1689608_1689609delAT	uc009xhq.2	-							NM_018702	NP_061172			adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	1946281	1946282	+	IGR	INS	-	AC	AC	rs146719190	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1946281_1946282insAC								ADARB2 (166563 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3284624	3284627	+	IGR	DEL	TGTG	-	-	rs72436318		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3284624_3284627delTGTG								PITRM1 (69621 upstream) : KLF6 (533562 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	4194468	4194469	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4194468_4194469insT								KLF6 (366995 upstream) : LOC100216001 (426975 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6046607	6046608	+	IGR	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6046607_6046608delTT								IL15RA (26465 upstream) : IL2RA (6898 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6356133	6356133	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6356133delA								PFKFB3 (78628 upstream) : PRKCQ (112972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6799710	6799710	+	IGR	DEL	G	-	-	rs138408986		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6799710delG								PRKCQ (177472 upstream) : SFMBT2 (404539 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6803518	6803518	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6803518delT								PRKCQ (181280 upstream) : SFMBT2 (400731 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6953741	6953744	+	IGR	DEL	TCTT	-	-	rs60499960		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6953741_6953744delTCTT								PRKCQ (331503 upstream) : SFMBT2 (250505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	10532056	10532056	+	IGR	DEL	A	-	-	rs5783155		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10532056delA								None (None upstream) : SFTA1P (294346 downstream)																																			---	---	---	---
SFTA1P	207107	broad.mit.edu	37	10	10829509	10829509	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:10829509delG	uc001ikf.1	-							NR_027082				Homo sapiens surfactant associated protein F mRNA, partial sequence.												0																		---	---	---	---
CELF2	10659	broad.mit.edu	37	10	11100431	11100432	+	Intron	INS	-	G	G	rs1291835		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11100431_11100432insG	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron	NM_001025077	NP_001020248			CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	12348261	12348261	+	IGR	DEL	T	-	-	rs67052211		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12348261delT								CDC123 (55674 upstream) : CAMK1D (43322 downstream)																																			---	---	---	---
CAMK1D	57118	broad.mit.edu	37	10	12557417	12557418	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12557417_12557418insT	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718			calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)														---	---	---	---
PRPF18	8559	broad.mit.edu	37	10	13655422	13655427	+	Intron	DEL	AATACA	-	-	rs113230755		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13655422_13655427delAATACA	uc001imp.2	+						PRPF18_uc001imq.2_Intron	NM_003675	NP_003666			PRP18 pre-mRNA processing factor 18 homolog						mRNA processing|RNA splicing	nuclear speck|spliceosomal complex				central_nervous_system(1)	1																		---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	14444460	14444461	+	Intron	INS	-	TGAA	TGAA	rs137902116	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14444460_14444461insTGAA	uc001imv.2	-						FRMD4A_uc001imw.1_Intron					Homo sapiens mRNA for KIAA1294 protein, partial cds.							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
ITGA8	8516	broad.mit.edu	37	10	15572278	15572278	+	Intron	DEL	G	-	-	rs75316024		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15572278delG	uc001ioc.1	-						ITGA8_uc010qcb.1_Intron	NM_003638	NP_003629			integrin, alpha 8 precursor						cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	15979234	15979235	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15979234_15979235insT								FAM188A (76715 upstream) : PTER (499732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	16339187	16339188	+	IGR	INS	-	AAGGG	AAGGG	rs146043941	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16339187_16339188insAAGGG								FAM188A (436668 upstream) : PTER (139779 downstream)																																			---	---	---	---
ST8SIA6	338596	broad.mit.edu	37	10	17456160	17456160	+	Intron	DEL	C	-	-	rs74587334		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17456160delC	uc001ipd.2	-						ST8SIA6_uc010qce.1_Intron	NM_001004470	NP_001004470			ST8 alpha-N-acetyl-neuraminide						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1																		---	---	---	---
CACNB2	783	broad.mit.edu	37	10	18801703	18801704	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18801703_18801704insA	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron|CACNB2_uc009xkb.1_Intron|CACNB2_uc010qcm.1_Intron|CACNB2_uc001ipz.2_Intron|CACNB2_uc001ipy.2_Intron|CACNB2_uc010qcn.1_Intron|CACNB2_uc010qco.1_Intron|CACNB2_uc001iqa.2_Intron	NM_201596	NP_963890			calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
CACNB2	783	broad.mit.edu	37	10	18825203	18825204	+	Intron	DEL	GG	-	-	rs7098625		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18825203_18825204delGG	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron|CACNB2_uc001ipz.2_Intron|CACNB2_uc001ipy.2_Intron|CACNB2_uc010qco.1_Intron|CACNB2_uc001iqa.2_Intron|NSUN6_uc001iqb.2_Intron	NM_201596	NP_963890			calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
NSUN6	221078	broad.mit.edu	37	10	18848738	18848744	+	Intron	DEL	GAAAAGA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18848738_18848744delGAAAAGA	uc010qcp.1	-							NM_182543	NP_872349			NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2																		---	---	---	---
PLXDC2	84898	broad.mit.edu	37	10	20166423	20166423	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20166423delT	uc001iqg.1	+						PLXDC2_uc001iqh.1_Intron	NM_032812	NP_116201			plexin domain containing 2 precursor							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
PLXDC2	84898	broad.mit.edu	37	10	20343326	20343329	+	Intron	DEL	ATGG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20343326_20343329delATGG	uc001iqg.1	+						PLXDC2_uc001iqh.1_Intron	NM_032812	NP_116201			plexin domain containing 2 precursor							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
C10orf67	256815	broad.mit.edu	37	10	23636651	23636651	+	5'Flank	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23636651delG	uc010qcx.1	-							NM_153714	NP_714925			hypothetical protein LOC256815												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	23921353	23921353	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23921353delA								OTUD1 (190045 upstream) : KIAA1217 (62322 downstream)																																			---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24738253	24738254	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24738253_24738254insT	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron|KIAA1217_uc001irw.2_5'Flank|uc009xkk.1_5'Flank	NM_019590	NP_062536			sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24742182	24742193	+	Intron	DEL	ACTATCTATTTG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24742182_24742193delACTATCTATTTG	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron|KIAA1217_uc001irw.2_Intron	NM_019590	NP_062536			sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
THNSL1	79896	broad.mit.edu	37	10	25307245	25307245	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25307245delA	uc001isi.3	+						ENKUR_uc001isg.1_5'Flank|ENKUR_uc001ish.1_Intron	NM_024838	NP_079114			threonine synthase-like 1						threonine biosynthetic process		ATP binding|pyridoxal phosphate binding|shikimate kinase activity|threonine synthase activity			pancreas(1)	1					L-Threonine(DB00156)|Pyridoxal Phosphate(DB00114)													---	---	---	---
GPR158	57512	broad.mit.edu	37	10	25502502	25502502	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25502502delT	uc001isj.2	+							NM_020752	NP_065803			G protein-coupled receptor 158 precursor							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	26684527	26684528	+	IGR	INS	-	TG	TG	rs142639507	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26684527_26684528insTG								GAD2 (91036 upstream) : APBB1IP (42738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	28714322	28714323	+	IGR	INS	-	A	A	rs112555131		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28714322_28714323insA								MPP7 (122327 upstream) : WAC (107104 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	29492465	29492468	+	IGR	DEL	AGAG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29492465_29492468delAGAG								BAMBI (520597 upstream) : LYZL1 (85522 downstream)																																			---	---	---	---
LOC387647	387647	broad.mit.edu	37	10	29719433	29719436	+	Intron	DEL	TCTC	-	-	rs71492595		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29719433_29719436delTCTC	uc001iuo.1	+						LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron					Homo sapiens cDNA FLJ31518 fis, clone NT2RI2000064.												0																		---	---	---	---
SVIL	6840	broad.mit.edu	37	10	29914000	29914001	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29914000_29914001insA	uc001iut.1	-						SVIL_uc001iuu.1_Intron|SVIL_uc009xld.1_Intron	NM_021738	NP_068506			supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	30784959	30784959	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30784959delT								MAP3K8 (34198 upstream) : LYZL2 (115750 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	32050713	32050724	+	IGR	DEL	GAAGGAAGGAAA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32050713_32050724delGAAGGAAGGAAA								ZEB1 (232586 upstream) : ARHGAP12 (44501 downstream)																																			---	---	---	---
EPC1	80314	broad.mit.edu	37	10	32622696	32622697	+	Intron	INS	-	GAG	GAG	rs143617806	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32622696_32622697insGAG	uc001iwg.1	-						EPC1_uc001iwi.3_Intron|EPC1_uc009xlt.2_Intron|EPC1_uc001iwh.1_Intron	NM_025209	NP_079485			enhancer of polycomb 1						histone H2A acetylation|histone H4 acetylation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear membrane|Piccolo NuA4 histone acetyltransferase complex				ovary(3)|central_nervous_system(1)	4		Prostate(175;0.0199)																---	---	---	---
C10orf68	79741	broad.mit.edu	37	10	32895360	32895361	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32895360_32895361insA	uc001iwn.3	+						C10orf68_uc001iwl.1_Intron|C10orf68_uc001iwm.1_Intron	NM_024688	NP_078964			chromosome 10 open reading frame 68											skin(2)|ovary(1)	3																		---	---	---	---
PARD3	56288	broad.mit.edu	37	10	35017385	35017385	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35017385delA	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565			partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	35145437	35145437	+	IGR	DEL	T	-	-	rs10708611		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35145437delT								PARD3 (41514 upstream) : CUL2 (153371 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	36165786	36165787	+	IGR	INS	-	TG	TG	rs150654346	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:36165786_36165787insTG								FZD8 (235424 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	37807981	37807981	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37807981delT								ANKRD30A (286486 upstream) : ZNF248 (282466 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38795544	38795545	+	IGR	INS	-	GAATG	GAATG			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38795544_38795545insGAATG								LOC399744 (54464 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38875908	38875908	+	IGR	DEL	A	-	-	rs111727033		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38875908delA								LOC399744 (134828 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42631641	42631641	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42631641delA								None (None upstream) : LOC441666 (195674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42772710	42772710	+	IGR	DEL	A	-	-	rs57895969		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42772710delA								None (None upstream) : LOC441666 (54605 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42816472	42816481	+	IGR	DEL	CATTCCATTA	-	-	rs12572099	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42816472_42816481delCATTCCATTA								None (None upstream) : LOC441666 (10834 downstream)																																			---	---	---	---
ZNF487	642819	broad.mit.edu	37	10	43957905	43957906	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43957905_43957906insT	uc010qfb.1	+							NR_026693				SubName: Full=cDNA FLJ52643, weakly similar to Zinc finger protein 11B;												0																		---	---	---	---
ZNF487	642819	broad.mit.edu	37	10	43970963	43970963	+	Intron	DEL	A	-	-	rs79443027		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43970963delA	uc010qfb.1	+							NR_026693				SubName: Full=cDNA FLJ52643, weakly similar to Zinc finger protein 11B;												0																		---	---	---	---
ZNF487	642819	broad.mit.edu	37	10	43975420	43975432	+	Intron	DEL	TTTCTTTCTTTCC	-	-	rs58100645		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43975420_43975432delTTTCTTTCTTTCC	uc010qfb.1	+							NR_026693				SubName: Full=cDNA FLJ52643, weakly similar to Zinc finger protein 11B;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	44478894	44478894	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44478894delG								HNRNPA3P1 (193029 upstream) : CXCL12 (386713 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	44557236	44557237	+	IGR	DEL	AA	-	-	rs34244797		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44557236_44557237delAA								HNRNPA3P1 (271371 upstream) : CXCL12 (308370 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	45778585	45778585	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45778585delC								LOC100133308 (128541 upstream) : OR13A1 (19517 downstream)																																			---	---	---	---
ANUBL1	93550	broad.mit.edu	37	10	46118874	46118875	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46118874_46118875delTG	uc001jcp.3	-						ANUBL1_uc001jcl.3_Intron|ANUBL1_uc001jcm.3_Intron|ANUBL1_uc009xmu.2_Intron|ANUBL1_uc001jcn.3_Intron|ANUBL1_uc001jco.3_Intron	NM_001128324	NP_001121796			AN1, ubiquitin-like, homolog								zinc ion binding				0																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47071617	47071618	+	Intron	INS	-	AAT	AAT	rs28858072		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47071617_47071618insAAT	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47109455	47109456	+	Intron	INS	-	C	C	rs71868789		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47109455_47109456insC	uc001jed.3	-						uc001jef.2_Intron					Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
C10orf72	196740	broad.mit.edu	37	10	50273328	50273328	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50273328delC	uc001jhf.2	-							NM_001031746	NP_001026916			hypothetical protein LOC196740 isoform 1							integral to membrane|plasma membrane					0																		---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55785260	55785260	+	Intron	DEL	T	-	-	rs34002454		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55785260delT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045			protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55968728	55968728	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55968728delT	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045			protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	56257004	56257004	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56257004delA	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045			protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
IPMK	253430	broad.mit.edu	37	10	60009899	60009899	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60009899delT	uc001jkb.2	-							NM_152230	NP_689416			inositol polyphosphate multikinase							nucleus	ATP binding|inositol trisphosphate 6-kinase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	61294425	61294426	+	IGR	INS	-	AC	AC	rs138615875	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61294425_61294426insAC								FAM13C (171764 upstream) : SLC16A9 (116096 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	61349289	61349289	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61349289delC								FAM13C (226628 upstream) : SLC16A9 (61233 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	61768576	61768576	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61768576delA								C10orf40 (47905 upstream) : ANK3 (19584 downstream)																																			---	---	---	---
ANK3	288	broad.mit.edu	37	10	62420677	62420678	+	Intron	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62420677_62420678delCA	uc001jkz.3	-							NM_001149	NP_001140			ankyrin 3 isoform 2						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	63305259	63305260	+	IGR	INS	-	A	A	rs111810264		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63305259_63305260insA								TMEM26 (92051 upstream) : C10orf107 (117459 downstream)																																			---	---	---	---
ARID5B	84159	broad.mit.edu	37	10	63753735	63753735	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63753735delA	uc001jlt.1	+						ARID5B_uc010qil.1_Intron	NM_032199	NP_115575			AT rich interactive domain 5B (MRF1-like)						liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)																	---	---	---	---
ARID5B	84159	broad.mit.edu	37	10	63806561	63806562	+	Intron	INS	-	TTT	TTT	rs151024543	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63806561_63806562insTTT	uc001jlt.1	+						ARID5B_uc010qil.1_Intron|ARID5B_uc001jlu.1_5'Flank	NM_032199	NP_115575			AT rich interactive domain 5B (MRF1-like)						liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	65391865	65391865	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65391865delA								REEP3 (9894 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	67505212	67505212	+	IGR	DEL	A	-	-	rs11350272		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67505212delA								ANXA2P3 (918578 upstream) : CTNNA3 (174513 downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	67989486	67989486	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67989486delT	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	71557373	71557374	+	IGR	INS	-	A	A	rs145782445	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71557373_71557374insA								C10orf35 (164026 upstream) : COL13A1 (4270 downstream)																																			---	---	---	---
COL13A1	1305	broad.mit.edu	37	10	71645085	71645086	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71645085_71645086insA	uc001jpr.1	+						COL13A1_uc001jqj.1_Intron|COL13A1_uc001jps.1_Intron|COL13A1_uc001jpt.1_Intron|COL13A1_uc001jpu.1_Intron|COL13A1_uc001jpv.1_Intron|COL13A1_uc001jpx.1_Intron|COL13A1_uc001jpw.1_Intron|COL13A1_uc001jpy.1_Intron|COL13A1_uc001jpz.1_Intron|COL13A1_uc001jqa.1_Intron|COL13A1_uc001jqc.1_Intron|COL13A1_uc001jqb.1_Intron|COL13A1_uc001jql.2_Intron|COL13A1_uc001jqd.1_Intron|COL13A1_uc001jqe.1_Intron|COL13A1_uc001jqf.1_Intron|COL13A1_uc001jqg.1_Intron|COL13A1_uc001jqh.1_Intron|COL13A1_uc001jqi.1_Intron|COL13A1_uc010qjf.1_Intron|COL13A1_uc001jqk.1_Intron	NM_005203	NP_005194			alpha 1 type XIII collagen isoform 1						cell differentiation|cell-cell adhesion|cell-matrix adhesion|endochondral ossification|morphogenesis of a branching structure	collagen type XIII|integral to membrane	extracellular matrix structural constituent|heparin binding|protein binding			ovary(1)	1					Atorvastatin(DB01076)|Simvastatin(DB00641)													---	---	---	---
CDH23	64072	broad.mit.edu	37	10	73236002	73236002	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73236002delT	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jrv.2_Intron|CDH23_uc009xql.2_Intron	NM_022124	NP_071407			cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11																		---	---	---	---
SPOCK2	9806	broad.mit.edu	37	10	73822296	73822297	+	3'UTR	DEL	CA	-	-	rs111643095		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73822296_73822297delCA	uc001jso.1	-	11					SPOCK2_uc001jsp.2_3'UTR|uc001jsq.1_RNA	NM_014767	NP_055582			sparc/osteonectin, cwcv and kazal-like domains						extracellular matrix organization|regulation of cell differentiation|signal transduction|synapse assembly	proteinaceous extracellular matrix	calcium ion binding				0																		---	---	---	---
SYNPO2L	79933	broad.mit.edu	37	10	75410185	75410185	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75410185delT	uc001jut.3	-						SYNPO2L_uc001jus.3_Intron	NM_001114133	NP_001107605			synaptopodin 2-like isoform a							cytoplasm|cytoskeleton	actin binding			ovary(1)	1	Prostate(51;0.0112)																	---	---	---	---
POLR3A	11128	broad.mit.edu	37	10	79792230	79792230	+	5'Flank	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79792230delA	uc001jzn.2	-						RPS24_uc001jzo.2_5'Flank|RPS24_uc010qlo.1_5'Flank|RPS24_uc001jzp.2_5'Flank|RPS24_uc001jzq.2_5'Flank|RPS24_uc001jzs.2_5'Flank|RPS24_uc001jzt.2_5'Flank	NM_007055	NP_008986			polymerase (RNA) III (DNA directed) polypeptide						innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	80635283	80635283	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80635283delC								RPS24 (818713 upstream) : LOC283050 (67801 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	82901791	82901791	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82901791delT								SH2D4B (495475 upstream) : NRG3 (733279 downstream)																																			---	---	---	---
NRG3	10718	broad.mit.edu	37	10	84312791	84312792	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84312791_84312792delAC	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848			neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	85723763	85723764	+	IGR	INS	-	TA	TA			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85723763_85723764insTA								NRG3 (976828 upstream) : GHITM (175421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	85850755	85850756	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85850755_85850756delAC								None (None upstream) : GHITM (48429 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	86844043	86844043	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86844043delT								FAM190B (565767 upstream) : GRID1 (515269 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	87263440	87263440	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87263440delA								FAM190B (985164 upstream) : GRID1 (95872 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	88337331	88337331	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88337331delT								WAPAL (55790 upstream) : OPN4 (76983 downstream)																																			---	---	---	---
BMPR1A	657	broad.mit.edu	37	10	88620527	88620527	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88620527delA	uc001kdy.2	+							NM_004329	NP_004320			bone morphogenetic protein receptor, type IA						BMP signaling pathway|immune response|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	integral to membrane|plasma membrane	ATP binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta receptor activity			lung(3)|large_intestine(1)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	8								Mis|N|F			gastrointestinal polyps			Hereditary_Mixed_Polyposis_syndrome_type_2|Juvenile_Polyposis				---	---	---	---
Unknown	0	broad.mit.edu	37	10	90940624	90940625	+	IGR	INS	-	A	A	rs147555863	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90940624_90940625insA								FAS (165083 upstream) : CH25H (25071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	92848592	92848593	+	IGR	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92848592_92848593delTT								ANKRD1 (167560 upstream) : NUDT9P1 (63168 downstream)																																			---	---	---	---
LOC100188947	100188947	broad.mit.edu	37	10	93069514	93069514	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93069514delC	uc010qnl.1	-							NR_024467				Homo sapiens, clone IMAGE:6063621, mRNA.												0																		---	---	---	---
TMEM20	159371	broad.mit.edu	37	10	95655751	95655751	+	Intron	DEL	T	-	-	rs72382112		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95655751delT	uc001kjg.1	+						TMEM20_uc001kji.2_Intron|TMEM20_uc001kjf.1_Intron|TMEM20_uc001kjh.2_Intron|TMEM20_uc010qnw.1_Intron|TMEM20_uc001kjj.2_Intron	NM_001134658	NP_001128130			transmembrane protein 20 isoform 1							integral to membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;3.46e-05)|Renal(717;0.018)|Ovarian(717;0.0228)|all_hematologic(284;0.189)		STAD - Stomach adenocarcinoma(243;0.00345)														---	---	---	---
PLCE1	51196	broad.mit.edu	37	10	95901455	95901455	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95901455delG	uc001kjk.2	+						PLCE1_uc010qnx.1_Intron|PLCE1_uc001kjm.2_Intron	NM_016341	NP_057425			phospholipase C, epsilon 1 isoform 1						activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	96158991	96158991	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96158991delT								NOC3L (36308 upstream) : TBC1D12 (3195 downstream)																																			---	---	---	---
BLNK	29760	broad.mit.edu	37	10	97997110	97997110	+	Intron	DEL	T	-	-	rs66998041		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97997110delT	uc001kls.3	-						BLNK_uc001kme.3_Intron|BLNK_uc001klt.3_Intron|BLNK_uc009xvc.2_Intron|BLNK_uc001klu.3_Intron|BLNK_uc001klv.3_Intron|BLNK_uc001klw.3_Intron|BLNK_uc001klx.3_Intron|BLNK_uc001kly.3_Intron|BLNK_uc001klz.3_Intron|BLNK_uc001kma.3_Intron|BLNK_uc001kmb.3_Intron|BLNK_uc001kmc.3_Intron|BLNK_uc001kmd.3_Intron|BLNK_uc009xvd.2_Intron	NM_013314	NP_037446			B-cell linker isoform 1						B cell differentiation|humoral immune response|inflammatory response|intracellular signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(2)	2		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)														---	---	---	---
TLL2	7093	broad.mit.edu	37	10	98168300	98168300	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98168300delC	uc001kml.1	-						TLL2_uc009xvf.1_Intron	NM_012465	NP_036597			tolloid-like 2 precursor						cell differentiation|multicellular organismal development|proteolysis	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)														---	---	---	---
SLIT1	6585	broad.mit.edu	37	10	98817507	98817507	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98817507delT	uc001kmw.2	-						SLIT1_uc009xvh.1_Intron	NM_003061	NP_003052			slit homolog 1 precursor						axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)														---	---	---	---
SLIT1	6585	broad.mit.edu	37	10	98937738	98937741	+	Intron	DEL	AAAC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98937738_98937741delAAAC	uc001kmw.2	-						SLIT1_uc009xvh.1_Intron|ARHGAP19_uc001kmy.2_Intron|SLIT1_uc001kmz.2_Intron	NM_003061	NP_003052			slit homolog 1 precursor						axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)														---	---	---	---
CRTAC1	55118	broad.mit.edu	37	10	99650053	99650053	+	Intron	DEL	G	-	-	rs138293893		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99650053delG	uc001kou.1	-						CRTAC1_uc001kov.2_Intron|CRTAC1_uc001kot.1_Intron	NM_018058	NP_060528			cartilage acidic protein 1 precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	99846731	99846731	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99846731delG								CRTAC1 (56146 upstream) : C10orf28 (47650 downstream)																																			---	---	---	---
C10orf76	79591	broad.mit.edu	37	10	103670898	103670899	+	Intron	DEL	AA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103670898_103670899delAA	uc009xwy.1	-						C10orf76_uc009xwx.1_Intron	NM_024541	NP_078817			hypothetical protein LOC79591							integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	103933980	103933980	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103933980delT								NOLC1 (10353 upstream) : ELOVL3 (52163 downstream)																																			---	---	---	---
SUFU	51684	broad.mit.edu	37	10	104357916	104357916	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104357916delT	uc001kvy.1	+						SUFU_uc001kvw.1_Intron|SUFU_uc001kvx.2_Intron|SUFU_uc009xxe.1_Intron|SUFU_uc009xxf.1_Intron	NM_016169	NP_057253			suppressor of fused						negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)				D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				---	---	---	---
Unknown	0	broad.mit.edu	37	10	104425166	104425167	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104425166_104425167insA								TRIM8 (7090 upstream) : ARL3 (8323 downstream)																																			---	---	---	---
PDCD11	22984	broad.mit.edu	37	10	105199296	105199297	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105199296_105199297insA	uc001kwy.1	+							NM_014976	NP_055791			programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	107450476	107450477	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107450476_107450477insT								SORCS3 (425483 upstream) : SORCS1 (882945 downstream)																																			---	---	---	---
SMC3	9126	broad.mit.edu	37	10	112355981	112355981	+	Intron	DEL	A	-	-	rs66754857		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112355981delA	uc001kze.2	+							NM_005445	NP_005436			structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	113107405	113107406	+	IGR	INS	-	A	A	rs113763501		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113107405_113107406insA								ADRA2A (266745 upstream) : GPAM (802216 downstream)																																			---	---	---	---
AFAP1L2	84632	broad.mit.edu	37	10	116113454	116113454	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116113454delA	uc001lbn.2	-						AFAP1L2_uc001lbo.2_Intron|AFAP1L2_uc010qse.1_Intron|AFAP1L2_uc001lbp.2_Intron|AFAP1L2_uc001lbr.1_Intron	NM_001001936	NP_001001936			KIAA1914 protein isoform 1						inflammatory response|positive regulation of epidermal growth factor receptor signaling pathway|positive regulation of interleukin-8 production|positive regulation of transcription, DNA-dependent|regulation of interleukin-6 production|regulation of mitotic cell cycle	cytoplasm	protein tyrosine kinase activator activity|SH2 domain binding|SH3 domain binding			ovary(1)|breast(1)	2		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	116960828	116960829	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116960828_116960829insT	uc001lcg.2	+							NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117416005	117416006	+	Intron	INS	-	GT	GT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117416005_117416006insGT	uc001lcg.2	+						ATRNL1_uc010qsm.1_Intron|ATRNL1_uc010qsn.1_Intron	NM_207303	NP_997186			attractin-like 1 precursor							integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
SLC18A2	6571	broad.mit.edu	37	10	119028559	119028560	+	Intron	INS	-	C	C	rs146198632	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119028559_119028560insC	uc001ldd.1	+						SLC18A2_uc009xyy.1_Intron	NM_003054	NP_003045			solute carrier family 18 (vesicular monoamine),						neurotransmitter secretion	clathrin sculpted monoamine transport vesicle membrane|integral to plasma membrane|membrane fraction	monoamine transmembrane transporter activity				0		Colorectal(252;0.19)		all cancers(201;0.029)	Alseroxylon(DB00386)|Reserpine(DB00206)|Tetrabenazine(DB04844)													---	---	---	---
EMX2OS	196047	broad.mit.edu	37	10	119246216	119246216	+	RNA	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119246216delA	uc001ldf.2	-	3		c.4613delT			EMX2OS_uc001ldg.2_RNA					Homo sapiens cDNA FLJ41539 fis, clone BRTHA2018165.												0																		---	---	---	---
CASC2	255082	broad.mit.edu	37	10	119922745	119922745	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119922745delA	uc001ldm.3	+						CASC2_uc009xzc.2_Intron	NR_026939				Homo sapiens mRNA for IGM1 protein.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	120196575	120196577	+	IGR	DEL	CTT	-	-	rs75941672		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120196575_120196577delCTT								C10orf84 (94736 upstream) : PRLHR (156339 downstream)																																			---	---	---	---
ATE1	11101	broad.mit.edu	37	10	123680036	123680037	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123680036_123680037insA	uc001lfp.2	-						ATE1_uc001lfq.2_Intron|ATE1_uc010qtr.1_Intron|ATE1_uc010qts.1_Intron|ATE1_uc010qtt.1_Intron|ATE1_uc001lfr.2_Intron|ATE1_uc009xzu.2_Intron	NM_007041	NP_008972			arginyltransferase 1 isoform 2						protein arginylation	cytoplasm|nucleus	acyltransferase activity|arginyltransferase activity				0		all_neural(114;0.061)|Lung NSC(174;0.095)|all_lung(145;0.124)|Breast(234;0.212)																---	---	---	---
TACC2	10579	broad.mit.edu	37	10	123875919	123875919	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123875919delG	uc001lfv.2	+						TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Intron|TACC2_uc010qtv.1_Intron|TACC2_uc001lfx.2_Intron	NM_206862	NP_996744			transforming, acidic coiled-coil containing							microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)																---	---	---	---
TACC2	10579	broad.mit.edu	37	10	123879453	123879453	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123879453delG	uc001lfv.2	+						TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Intron|TACC2_uc010qtv.1_Intron|TACC2_uc001lfx.2_Intron	NM_206862	NP_996744			transforming, acidic coiled-coil containing							microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)																---	---	---	---
Unknown	0	broad.mit.edu	37	10	124463160	124463161	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124463160_124463161delAC								C10orf120 (3822 upstream) : FLJ46361 (53049 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	126854430	126854430	+	IGR	DEL	T	-	-	rs150689909		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126854430delT								CTBP2 (4806 upstream) : LOC100169752 (408510 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	128434463	128434464	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128434463_128434464insA								C10orf90 (75384 upstream) : DOCK1 (159559 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	128439280	128439280	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128439280delT								C10orf90 (80201 upstream) : DOCK1 (154743 downstream)																																			---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	128893925	128893926	+	Intron	INS	-	TG	TG	rs138739275	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128893925_128893926insTG	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	129020632	129020633	+	Intron	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129020632_129020633delCT	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	129319472	129319473	+	IGR	INS	-	AAA	AAA	rs11818499		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129319472_129319473insAAA								DOCK1 (68691 upstream) : NPS (28140 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130566908	130566908	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130566908delT								MKI67 (642440 upstream) : MGMT (698546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132269501	132269502	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132269501_132269502delGT								GLRX3 (286717 upstream) : TCERG1L (621154 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132728787	132728819	+	IGR	DEL	CTCCTCCTGTGGCTCCGTCATGAGCACCTCCTC	-	-	rs138565287	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132728787_132728819delCTCCTCCTGTGGCTCCGTCATGAGCACCTCCTC								GLRX3 (746003 upstream) : TCERG1L (161837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132765536	132765536	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132765536delA								GLRX3 (782752 upstream) : TCERG1L (125120 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133198610	133198610	+	IGR	DEL	G	-	-	rs34083572		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133198610delG								TCERG1L (88626 upstream) : PPP2R2D (549350 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133549918	133549919	+	IGR	INS	-	AAA	AAA	rs35368670		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133549918_133549919insAAA								TCERG1L (439934 upstream) : PPP2R2D (198041 downstream)																																			---	---	---	---
STK32C	282974	broad.mit.edu	37	10	134144023	134144023	+	Intron	DEL	T	-	-	rs71694648		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134144023delT	uc010quu.1	-						STK32C_uc009ybc.1_Intron|STK32C_uc009ybd.1_Intron|LRRC27_uc001llf.2_5'Flank|LRRC27_uc010quv.1_5'Flank|LRRC27_uc010quw.1_5'Flank|LRRC27_uc001llg.2_5'Flank|LRRC27_uc001lli.2_5'Flank	NM_173575	NP_775846			serine/threonine kinase 32C								ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|breast(1)	5		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	134206096	134206098	+	IGR	DEL	TGG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206096_134206098delTGG								LRRC27 (11086 upstream) : PWWP2B (4604 downstream)																																			---	---	---	---
PWWP2B	170394	broad.mit.edu	37	10	134223839	134223839	+	Intron	DEL	G	-	-	rs35790891		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134223839delG	uc001lll.3	+						PWWP2B_uc009ybe.2_Intron	NM_138499	NP_612508			PWWP domain containing 2 isoform 1												0		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)														---	---	---	---
C10orf91	170393	broad.mit.edu	37	10	134257482	134257482	+	5'Flank	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134257482delC	uc001llm.2	+							NM_173541	NP_775812			hypothetical protein LOC170393											ovary(1)	1		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;6.95e-05)|Epithelial(32;0.000142)|all cancers(32;0.000162)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	134824696	134824697	+	IGR	INS	-	TG	TG	rs144042034	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134824696_134824697insTG								C10orf93 (68632 upstream) : GPR123 (59736 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	134824772	134824773	+	IGR	DEL	GC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134824772_134824773delGC								C10orf93 (68708 upstream) : GPR123 (59660 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	134879385	134879388	+	IGR	DEL	TGGA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134879385_134879388delTGGA								C10orf93 (123321 upstream) : GPR123 (5045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	135474657	135474658	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135474657_135474658delCA								FRG2B (34358 upstream) : LOC653544 (15621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	187926	187928	+	IGR	DEL	AAG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:187926_187928delAAG								LOC100133161 (48774 upstream) : SCGB1C1 (5152 downstream)																																			---	---	---	---
AP2A2	161	broad.mit.edu	37	11	968433	968444	+	Intron	DEL	CCCATCCCCGTC	-	-	rs36207972		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:968433_968444delCCCATCCCCGTC	uc001lss.2	+						AP2A2_uc001lst.1_Intron|AP2A2_uc009yco.1_Intron	NM_012305	NP_036437			adaptor-related protein complex 2, alpha 2						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|cytosol	lipid binding|protein transporter activity				0		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	2288069	2288070	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2288069_2288070insA								TH (95034 upstream) : ASCL2 (1659 downstream)																																			---	---	---	---
ART1	417	broad.mit.edu	37	11	3680214	3680215	+	Intron	INS	-	C	C	rs140021907	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3680214_3680215insC	uc001lye.1	+						ART1_uc009yeb.1_Intron	NM_004314	NP_004305			ADP-ribosyltransferase 1 precursor						protein ADP-ribosylation	anchored to membrane|integral to plasma membrane|sarcoplasmic reticulum membrane	NAD(P)+-protein-arginine ADP-ribosyltransferase activity|NAD+ ADP-ribosyltransferase activity				0		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0351)|LUSC - Lung squamous cell carcinoma(625;0.195)	Becaplermin(DB00102)													---	---	---	---
STIM1	6786	broad.mit.edu	37	11	4094279	4094280	+	Intron	DEL	TT	-	-	rs147016752		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4094279_4094280delTT	uc001lyv.2	+						STIM1_uc009yef.2_Intron|STIM1_uc009yeg.2_Intron	NM_003156	NP_003147			stromal interaction molecule 1 precursor						activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	5045937	5045937	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5045937delC								OR51L1 (24779 upstream) : OR52J3 (21819 downstream)																																			---	---	---	---
OR51B5	282763	broad.mit.edu	37	11	5375703	5375710	+	Intron	DEL	AAAAGTCC	-	-	rs72334686		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5375703_5375710delAAAAGTCC	uc001maq.1	-						HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_001005567	NP_001005567			olfactory receptor, family 51, subfamily B,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
SYT9	143425	broad.mit.edu	37	11	7419643	7419643	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7419643delC	uc001mfe.2	+						SYT9_uc001mfd.2_Intron|SYT9_uc009yfi.2_Intron	NM_175733	NP_783860			synaptotagmin IX							cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)														---	---	---	---
SYT9	143425	broad.mit.edu	37	11	7419644	7419644	+	Intron	DEL	T	-	-	rs146421218		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7419644delT	uc001mfe.2	+						SYT9_uc001mfd.2_Intron|SYT9_uc009yfi.2_Intron	NM_175733	NP_783860			synaptotagmin IX							cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)														---	---	---	---
ST5	6764	broad.mit.edu	37	11	8755868	8755869	+	Intron	INS	-	T	T	rs75773242		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8755868_8755869insT	uc001mgt.2	-						ST5_uc009yfr.2_Intron|ST5_uc001mgu.2_Intron|ST5_uc001mgv.2_Intron|ST5_uc010rbq.1_Intron|ST5_uc001mgw.1_Intron	NM_213618	NP_998783			suppression of tumorigenicity 5 isoform 1						positive regulation of ERK1 and ERK2 cascade		protein binding			upper_aerodigestive_tract(1)	1				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)														---	---	---	---
ZNF143	7702	broad.mit.edu	37	11	9525190	9525190	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9525190delT	uc001mhr.2	+						ZNF143_uc009yfu.2_Intron|ZNF143_uc010rby.1_Intron	NM_003442	NP_003433			zinc finger protein 143						regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)														---	---	---	---
WEE1	7465	broad.mit.edu	37	11	9606609	9606610	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9606609_9606610insA	uc001mhs.2	+						WEE1_uc001mht.2_Intron	NM_003390	NP_003381			WEE1 tyrosine kinase isoform 1						blood coagulation|cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|S phase of mitotic cell cycle	nucleoplasm	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	5				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	9637717	9637718	+	IGR	DEL	TG	-	-	rs72123087		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9637717_9637718delTG								WEE1 (26406 upstream) : SWAP70 (47910 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	9664426	9664427	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9664426_9664427insT								WEE1 (53115 upstream) : SWAP70 (21201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	10726666	10726667	+	IGR	INS	-	A	A	rs149629117	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10726666_10726667insA								MRVI1 (11131 upstream) : CTR9 (46144 downstream)																																			---	---	---	---
GALNTL4	374378	broad.mit.edu	37	11	11535533	11535533	+	Intron	DEL	C	-	-	rs11298207		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11535533delC	uc001mjo.2	-							NM_198516	NP_940918			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)														---	---	---	---
DKK3	27122	broad.mit.edu	37	11	12030645	12030645	+	5'Flank	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12030645delC	uc001mju.2	-						DKK3_uc010rcf.1_5'Flank|DKK3_uc001mjv.2_5'Flank|DKK3_uc001mjw.2_Intron|DKK3_uc010rcg.1_Intron|DKK3_uc001mjx.2_Intron	NM_001018057	NP_001018067			dickkopf homolog 3 precursor						adrenal gland development|anatomical structure morphogenesis|negative regulation of aldosterone biosynthetic process|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cortisol biosynthetic process|negative regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	extracellular space				breast(1)	1				Epithelial(150;0.000502)														---	---	---	---
TEAD1	7003	broad.mit.edu	37	11	12804646	12804647	+	Intron	DEL	TG	-	-	rs34564715		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12804646_12804647delTG	uc001mkj.3	+							NM_021961	NP_068780			TEA domain family member 1						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	13284344	13284344	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13284344delG								RASSF10 (251697 upstream) : ARNTL (14981 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15571621	15571622	+	IGR	DEL	TC	-	-	rs57046327		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15571621_15571622delTC								INSC (302869 upstream) : SOX6 (416374 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15586517	15586517	+	IGR	DEL	G	-	-	rs5789899		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15586517delG								INSC (317765 upstream) : SOX6 (401479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15613542	15613543	+	IGR	INS	-	C	C	rs144012435	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15613542_15613543insC								INSC (344790 upstream) : SOX6 (374453 downstream)																																			---	---	---	---
SOX6	55553	broad.mit.edu	37	11	16377765	16377766	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16377765_16377766insA	uc001mme.2	-						SOX6_uc001mmd.2_Intron|SOX6_uc001mmf.2_Intron|SOX6_uc001mmg.2_Intron|SOX6_uc001mmh.1_Intron|SOX6_uc009ygs.2_Intron|SOX6_uc001mmi.3_Intron|SOX6_uc001mmj.2_Intron	NM_001145819	NP_001139291			SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3																		---	---	---	---
PLEKHA7	144100	broad.mit.edu	37	11	17023440	17023440	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17023440delA	uc001mmo.2	-						PLEKHA7_uc010rcu.1_Intron	NM_175058	NP_778228			pleckstrin homology domain containing, family A						epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3																		---	---	---	---
PLEKHA7	144100	broad.mit.edu	37	11	17027875	17027875	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17027875delA	uc001mmo.2	-						PLEKHA7_uc010rcu.1_Intron	NM_175058	NP_778228			pleckstrin homology domain containing, family A						epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	17650580	17650583	+	Intron	DEL	TGGA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17650580_17650583delTGGA	uc001mnh.1	+											SubName: Full=Putative uncharacterized protein OTOG;																														---	---	---	---
SERGEF	26297	broad.mit.edu	37	11	17918751	17918751	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17918751delA	uc001mnm.2	-						SERGEF_uc009yhd.2_Intron|SERGEF_uc001mnn.2_Intron|SERGEF_uc010rcz.1_Intron	NM_012139	NP_036271			deafness locus associated putative guanine						negative regulation of protein secretion|signal transduction	cytoplasm|nucleus	protein binding|Ran guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1																		---	---	---	---
SERGEF	26297	broad.mit.edu	37	11	18033792	18033792	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18033792delG	uc001mnm.2	-						SERGEF_uc009yhd.2_Intron|SERGEF_uc001mnn.2_Intron|SERGEF_uc010rcz.1_Intron|SERGEF_uc001mno.1_Intron	NM_012139	NP_036271			deafness locus associated putative guanine						negative regulation of protein secretion|signal transduction	cytoplasm|nucleus	protein binding|Ran guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	18984438	18984439	+	IGR	INS	-	AAC	AAC	rs141541063	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18984438_18984439insAAC								MRGPRX1 (27889 upstream) : MRGPRX2 (91566 downstream)																																			---	---	---	---
NAV2	89797	broad.mit.edu	37	11	19891330	19891330	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19891330delT	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron	NM_145117	NP_660093			neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---
NELL1	4745	broad.mit.edu	37	11	20960455	20960464	+	Intron	DEL	TCTCTCTCTC	-	-	rs72105364		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20960455_20960464delTCTCTCTCTC	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148			nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
ANO3	63982	broad.mit.edu	37	11	26528705	26528705	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26528705delC	uc001mqt.3	+						ANO3_uc010rdr.1_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron	NM_031418	NP_113606			transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	29050119	29050119	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29050119delA								METT5D1 (695065 upstream) : KCNA4 (981647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29563615	29563616	+	IGR	INS	-	A	A	rs148211015	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29563615_29563616insA								None (None upstream) : KCNA4 (468150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29624133	29624134	+	IGR	INS	-	TG	TG	rs72075276		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29624133_29624134insTG								None (None upstream) : KCNA4 (407632 downstream)																																			---	---	---	---
MPPED2	744	broad.mit.edu	37	11	30549685	30549686	+	Intron	INS	-	AC	AC	rs148984869	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30549685_30549686insAC	uc001msr.2	-						MPPED2_uc001msq.3_Intron|MPPED2_uc009yji.2_Intron	NM_001584	NP_001575			metallophosphoesterase domain containing 2						nervous system development		hydrolase activity|metal ion binding			skin(1)	1																		---	---	---	---
WT1	7490	broad.mit.edu	37	11	32411282	32411282	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32411282delT	uc001mtn.1	-						WT1_uc001mtl.1_Intron|WT1_uc001mtm.1_Intron|WT1_uc001mto.1_Intron|WT1_uc001mtp.1_Intron|WT1_uc001mtq.1_Intron|WT1_uc009yjs.1_Intron	NM_024426	NP_077744			Wilms tumor 1 isoform D						adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding		EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)					D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				---	---	---	---
Unknown	0	broad.mit.edu	37	11	33448799	33448801	+	IGR	DEL	AGA	-	-	rs147643162		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33448799_33448801delAGA								HIPK3 (72860 upstream) : C11orf41 (115076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	34067799	34067806	+	IGR	DEL	TTCCTTCC	-	-	rs10654103		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34067799_34067806delTTCCTTCC								LMO2 (153963 upstream) : CAPRIN1 (5424 downstream)																																			---	---	---	---
EHF	26298	broad.mit.edu	37	11	34678015	34678015	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34678015delT	uc001mvr.1	+						EHF_uc009yke.1_Intron|EHF_uc009ykf.1_Intron	NM_012153	NP_036285			ets homologous factor						cell proliferation|epithelial cell differentiation|multicellular organismal development|positive regulation of transcription, DNA-dependent		protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(20;0.117)	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	37558282	37558283	+	IGR	INS	-	A	A	rs11423946		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37558282_37558283insA								C11orf74 (861892 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	37615685	37615686	+	IGR	INS	-	T	T	rs150989246	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37615685_37615686insT								C11orf74 (919295 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	37627791	37627792	+	IGR	INS	-	A	A	rs147461255	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37627791_37627792insA								C11orf74 (931401 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	39334171	39334171	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39334171delA								None (None upstream) : LRRC4C (801582 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	41554374	41554375	+	IGR	INS	-	T	T	rs149159085	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:41554374_41554375insT								LRRC4C (73051 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	44755150	44755151	+	IGR	INS	-	TC	TC	rs142958097	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44755150_44755151insTC								CD82 (113837 upstream) : TSPAN18 (126728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	44874076	44874077	+	IGR	INS	-	GAAA	GAAA	rs139799846	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44874076_44874077insGAAA								CD82 (232763 upstream) : TSPAN18 (7802 downstream)																																			---	---	---	---
PHF21A	51317	broad.mit.edu	37	11	45952824	45952825	+	3'UTR	INS	-	AG	AG	rs141068891	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45952824_45952825insAG	uc001ncc.3	-	18					PHF21A_uc001ncb.3_3'UTR|PHF21A_uc009ykx.2_3'UTR|PHF21A_uc001nca.1_3'UTR	NM_001101802	NP_001095272			BRAF35/HDAC2 complex isoform a						blood coagulation|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
CREB3L1	90993	broad.mit.edu	37	11	46328327	46328327	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46328327delT	uc001ncf.2	+							NM_052854	NP_443086			cAMP responsive element binding protein 3-like						response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L1(6)	soft_tissue(6)|ovary(2)	8				GBM - Glioblastoma multiforme(35;0.0285)				T	FUS	myxofibrosarcoma								---	---	---	---
SLC39A13	91252	broad.mit.edu	37	11	47422830	47422830	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47422830delA	uc001nfd.2	+											RecName: Full=Zinc transporter ZIP13; AltName: Full=Zrt- and Irt-like protein 13;          Short=ZIP-13; AltName: Full=Solute carrier family 39 member 13; AltName: Full=LIV-1 subfamily of ZIP zinc transporter 9; AltName: Full=LZT-Hs9;						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity				0				Lung(87;0.0936)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	48388859	48388860	+	IGR	INS	-	GT	GT	rs141279013	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48388859_48388860insGT								OR4C45 (14860 upstream) : OR4A47 (121485 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	48827765	48827765	+	IGR	DEL	G	-	-	rs139382505		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48827765delG								OR4A47 (316493 upstream) : FOLH1 (340423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	49294999	49294999	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49294999delA								FOLH1 (64777 upstream) : LOC440040 (285081 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50526975	50526975	+	IGR	DEL	G	-	-	rs150724365	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50526975delG								LOC646813 (147172 upstream) : OR4A5 (884473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50699243	50699243	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50699243delG								LOC646813 (319440 upstream) : OR4A5 (712205 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50740370	50740371	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50740370_50740371insA								LOC646813 (360567 upstream) : OR4A5 (671077 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	51373688	51373688	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51373688delT								LOC646813 (993885 upstream) : OR4A5 (37760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	56208989	56208991	+	IGR	DEL	CCT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56208989_56208991delCCT								OR5R1 (23281 upstream) : OR5M9 (20956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	56580778	56580778	+	Intron	DEL	A	-	-	rs67308709		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56580778delA	uc001njg.1	-						uc001njh.1_Intron					Homo sapiens mRNA for hypothetical protein, complete cds, clone:Hsa11-digit22-05-16-R.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	56581638	56581639	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56581638_56581639delTG	uc001njg.1	-						uc001njh.1_Intron					Homo sapiens mRNA for hypothetical protein, complete cds, clone:Hsa11-digit22-05-16-R.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	58097521	58097521	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58097521delG								OR10W1 (61789 upstream) : OR5B17 (28079 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	58527873	58527873	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58527873delT								GLYAT (28426 upstream) : GLYATL2 (73669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	60455885	60455897	+	IGR	DEL	GTTTTAACCACTC	-	-	rs68109473		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60455885_60455897delGTTTTAACCACTC								C11orf64 (1266 upstream) : MS4A8B (11150 downstream)																																			---	---	---	---
PRPF19	27339	broad.mit.edu	37	11	60672109	60672120	+	Intron	DEL	AAAGGATATTAC	-	-	rs112411284		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60672109_60672120delAAAGGATATTAC	uc001nqf.2	-							NM_014502	NP_055317			PRP19/PSO4 pre-mRNA processing factor 19						DNA repair|protein polyubiquitination|spliceosome assembly	catalytic step 2 spliceosome|nuclear speck|spindle|ubiquitin ligase complex	DNA binding|identical protein binding|ubiquitin-ubiquitin ligase activity			ovary(1)	1																		---	---	---	---
CD6	923	broad.mit.edu	37	11	60750573	60750573	+	Intron	DEL	T	-	-	rs34513880		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60750573delT	uc001nqq.2	+						CD6_uc009yni.2_Intron|CD6_uc009ynj.2_Intron|CD6_uc001nqp.2_Intron|CD6_uc001nqr.2_Intron|CD6_uc001nqs.2_Intron|CD6_uc001nqt.2_Intron	NM_006725	NP_006716			CD6 molecule precursor						cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	61938139	61938141	+	IGR	DEL	TTG	-	-	rs34672057		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61938139_61938141delTTG								INCENP (17504 upstream) : SCGB1D1 (19569 downstream)																																			---	---	---	---
ASRGL1	80150	broad.mit.edu	37	11	62116441	62116441	+	Intron	DEL	G	-	-	rs35551368		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62116441delG	uc001nte.3	+						ASRGL1_uc001ntf.3_Intron|ASRGL1_uc001ntg.3_Intron	NM_025080	NP_079356			asparaginase-like 1						asparagine catabolic process via L-aspartate|protein maturation	cytoplasm|microtubule cytoskeleton|nucleus	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity				0					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)													---	---	---	---
BSCL2	26580	broad.mit.edu	37	11	62463940	62463940	+	Intron	DEL	A	-	-	rs35050222		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62463940delA	uc001nuo.1	-						BSCL2_uc009yoc.1_Intron|BSCL2_uc001nup.2_Intron|BSCL2_uc001nuq.1_Intron|BSCL2_uc001nur.3_Intron|BSCL2_uc009yod.2_Intron|BSCL2_uc001nut.3_Intron|HNRNPUL2_uc001nuu.1_Intron	NM_032667	NP_116056			seipin isoform 2						cell death	integral to endoplasmic reticulum membrane					0																		---	---	---	---
SLC22A25	387601	broad.mit.edu	37	11	62939389	62939389	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62939389delA	uc001nwr.1	-						SLC22A10_uc010rmo.1_Intron|SLC22A25_uc009yoq.1_Intron|SLC22A25_uc001nws.1_Intron|SLC22A25_uc001nwt.1_Intron	NM_199352	NP_955384			putative UST1-like organic anion transporter						transmembrane transport	integral to membrane				ovary(3)|skin(1)	4																		---	---	---	---
NRXN2	9379	broad.mit.edu	37	11	64383302	64383303	+	Intron	DEL	GT	-	-	rs146055795		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64383302_64383303delGT	uc001oap.2	-						NRXN2_uc001oar.2_Intron|NRXN2_uc001oas.2_Intron|NRXN2_uc001oao.2_Intron|NRXN2_uc001oaq.2_Intron	NM_138734	NP_620063			neurexin 2 isoform beta precursor						cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10																		---	---	---	---
NRXN2	9379	broad.mit.edu	37	11	64478748	64478749	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64478748_64478749delAC	uc001oar.2	-						NRXN2_uc001oas.2_Intron	NM_015080	NP_055895			neurexin 2 isoform alpha-1 precursor						cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10																		---	---	---	---
C11orf80	79703	broad.mit.edu	37	11	66601419	66601419	+	Intron	DEL	A	-	-	rs35972987		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66601419delA	uc001ojf.2	+						C11orf80_uc001ojg.2_Intron|C11orf80_uc001ojh.2_Intron|C11orf80_uc001oji.2_Intron|C11orf80_uc010rpl.1_Intron|C11orf80_uc001ojj.2_Intron	NM_024650	NP_078926			hypothetical protein LOC79703												0																		---	---	---	---
PC	5091	broad.mit.edu	37	11	66677458	66677458	+	5'Flank	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66677458delT	uc001ojn.1	-						PC_uc001ojo.1_Intron|PC_uc001ojp.1_Intron	NM_022172	NP_071504			pyruvate carboxylase precursor						gluconeogenesis|lipid biosynthetic process	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|pyruvate carboxylase activity			ovary(2)|lung(1)|kidney(1)	4		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)													---	---	---	---
KDM2A	22992	broad.mit.edu	37	11	66937119	66937119	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66937119delT	uc001ojw.2	+						KDM2A_uc001ojx.2_Intron	NM_012308	NP_036440			F-box and leucine-rich repeat protein 11						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	68760802	68760803	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68760802_68760803delTG								MRGPRD (12347 upstream) : MRGPRF (11060 downstream)																																			---	---	---	---
TPCN2	219931	broad.mit.edu	37	11	68839694	68839695	+	Intron	INS	-	C	C	rs148158094	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68839694_68839695insC	uc001oos.2	+						TPCN2_uc009ysk.1_Intron|TPCN2_uc001oor.2_Intron|TPCN2_uc010rqg.1_Intron|TPCN2_uc001oot.2_5'Flank	NM_139075	NP_620714			two pore segment channel 2						cellular calcium ion homeostasis|smooth muscle contraction	endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated calcium channel activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)															---	---	---	---
Unknown	0	broad.mit.edu	37	11	69442884	69442885	+	IGR	INS	-	CTT	CTT	rs147663327	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69442884_69442885insCTT								MYEOV (286435 upstream) : CCND1 (12988 downstream)																																			---	---	---	---
KRTAP5-10	387273	broad.mit.edu	37	11	71275410	71275410	+	5'Flank	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71275410delC	uc001oqt.1	+							NM_001012710	NP_001012728			keratin associated protein 5-10							keratin filament				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	71852422	71852422	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71852422delC								FOLR3 (1488 upstream) : FOLR1 (48180 downstream)																																			---	---	---	---
FAM168A	23201	broad.mit.edu	37	11	73118329	73118329	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73118329delG	uc001otz.1	-						FAM168A_uc001oty.1_Intron|FAM168A_uc009ytp.1_Intron	NM_015159	NP_055974			hypothetical protein LOC23201												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	75954233	75954234	+	IGR	INS	-	A	A	rs145996582	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75954233_75954234insA								WNT11 (32430 upstream) : PRKRIR (106770 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	76470517	76470517	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76470517delT								GUCY2E (37684 upstream) : TSKU (23768 downstream)																																			---	---	---	---
RSF1	51773	broad.mit.edu	37	11	77507216	77507216	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77507216delA	uc001oyn.2	-						RSF1_uc001oyo.1_Intron	NM_016578	NP_057662			remodeling and spacing factor 1						CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)															---	---	---	---
NDUFC2	4718	broad.mit.edu	37	11	77782052	77782052	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77782052delT	uc009yuw.2	-							NM_004549	NP_004540			NADH dehydrogenase (ubiquinone) 1, subcomplex						mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0	all_cancers(14;2.23e-19)|all_epithelial(13;7.49e-22)|Breast(9;6.38e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;2.15e-25)		Carvedilol(DB01136)|NADH(DB00157)													---	---	---	---
GAB2	9846	broad.mit.edu	37	11	78002783	78002784	+	Intron	INS	-	T	T	rs112307198		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78002783_78002784insT	uc001ozh.2	-						GAB2_uc001ozg.2_Intron	NM_080491	NP_536739			GRB2-associated binding protein 2 isoform a						osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)															---	---	---	---
ODZ4	26011	broad.mit.edu	37	11	78561106	78561107	+	Intron	INS	-	TGTG	TGTG	rs142162971	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78561106_78561107insTGTG	uc001ozl.3	-							NM_001098816	NP_001092286			odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4																		---	---	---	---
ODZ4	26011	broad.mit.edu	37	11	79005230	79005232	+	Intron	DEL	TAC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79005230_79005232delTAC	uc001ozl.3	-							NM_001098816	NP_001092286			odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	79302494	79302495	+	IGR	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79302494_79302495delTT								ODZ4 (150799 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	79443063	79443063	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79443063delG								ODZ4 (291368 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	79829797	79829797	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79829797delT								ODZ4 (678102 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	81418892	81418893	+	IGR	INS	-	AC	AC	rs79067200		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81418892_81418893insAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	81762767	81762768	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81762767_81762768insA	uc001ozo.1	-											Homo sapiens cDNA clone IMAGE:5298883.																														---	---	---	---
RAB30	27314	broad.mit.edu	37	11	82711058	82711060	+	Intron	DEL	CAT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82711058_82711060delCAT	uc001ozu.2	-						RAB30_uc009yve.2_Intron|RAB30_uc010rst.1_Intron|RAB30_uc001ozv.2_Intron|RAB30_uc009yvg.1_5'Flank	NM_014488	NP_055303			RAB30, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi stack|plasma membrane	GTP binding|GTPase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	86503834	86503834	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86503834delA								ME3 (120156 upstream) : PRSS23 (7657 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	89610778	89610778	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89610778delT								TRIM53 (26636 upstream) : TRIM49L (33803 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	89820742	89820742	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89820742delC								UBTFL1 (444 upstream) : NAALAD2 (47076 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	90230804	90230805	+	IGR	DEL	CA	-	-	rs149973660		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90230804_90230805delCA								CHORDC1 (274272 upstream) : MIR1261 (371484 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	90616808	90616808	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90616808delT								MIR1261 (14438 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	93366651	93366652	+	IGR	INS	-	AT	AT	rs74507591	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93366651_93366652insAT								C11orf75 (90105 upstream) : KIAA1731 (28164 downstream)																																			---	---	---	---
C11orf54	28970	broad.mit.edu	37	11	93481362	93481363	+	Intron	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93481362_93481363delTT	uc009ywi.2	+						C11orf54_uc001pee.1_Intron|C11orf54_uc001pef.2_Intron|C11orf54_uc001peg.2_Intron|C11orf54_uc001peh.2_Intron|C11orf54_uc001pei.2_Intron|C11orf54_uc001pej.2_5'Flank	NM_014039	NP_054758			hypothetical protein LOC28970							nucleus	hydrolase activity, acting on ester bonds|protein binding|zinc ion binding				0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	93643496	93643498	+	IGR	DEL	CAA	-	-	rs68023324		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93643496_93643498delCAA								C11orf90 (59828 upstream) : HEPHL1 (110880 downstream)																																			---	---	---	---
PANX1	24145	broad.mit.edu	37	11	93898236	93898236	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93898236delG	uc001per.2	+						PANX1_uc001peq.2_Intron	NM_015368	NP_056183			pannexin 1						positive regulation of interleukin-1 beta secretion|protein hexamerization|synaptic transmission	bleb|endoplasmic reticulum membrane|gap junction|integral to membrane	calcium channel activity|gap junction hemi-channel activity|leak channel activity|receptor binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	94613288	94613288	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94613288delA								AMOTL1 (3371 upstream) : CWC15 (82501 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	95264767	95264767	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95264767delC								SESN3 (299062 upstream) : FAM76B (237339 downstream)																																			---	---	---	---
MAML2	84441	broad.mit.edu	37	11	95738426	95738428	+	Intron	DEL	CTT	-	-	rs10554206		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95738426_95738428delCTT	uc001pfw.1	-							NM_032427	NP_115803			mastermind-like 2						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)						T	MECT1|CRTC3	salivary gland mucoepidermoid								---	---	---	---
Unknown	0	broad.mit.edu	37	11	96475238	96475238	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96475238delT								JRKL (348511 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	96487888	96487888	+	IGR	DEL	T	-	-	rs140884082		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96487888delT								JRKL (361161 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	97238307	97238310	+	IGR	DEL	AACA	-	-	rs3067098		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:97238307_97238310delAACA								None (None upstream) : None (None downstream)																																			---	---	---	---
PDGFD	80310	broad.mit.edu	37	11	103851208	103851209	+	Intron	INS	-	AATA	AATA			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103851208_103851209insAATA	uc001phq.2	-						PDGFD_uc001php.2_Intron	NM_025208	NP_079484			platelet derived growth factor D isoform 1						positive regulation of cell division	endoplasmic reticulum lumen|extracellular region|Golgi membrane	growth factor activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)														---	---	---	---
CASP5	838	broad.mit.edu	37	11	104887334	104887334	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104887334delA	uc010rva.1	-						CASP5_uc010ruz.1_Intron|CASP5_uc010rvb.1_Intron|CASP5_uc010rvc.1_Intron|CASP5_uc009yxh.2_Intron|CASP5_uc010rvd.1_Intron	NM_004347	NP_004338			caspase 5 isoform a precursor						apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding			ovary(2)|lung(1)	3		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)														---	---	---	---
KBTBD3	143879	broad.mit.edu	37	11	105922906	105922907	+	3'UTR	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105922906_105922907delGA	uc001pja.2	-	4					KBTBD3_uc001pjb.2_3'UTR|KBTBD3_uc009yxm.2_3'UTR	NM_198439	NP_940841			BTB and kelch domain containing 3											ovary(1)|central_nervous_system(1)	2		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	107846150	107846151	+	IGR	INS	-	TT	TT	rs150459032		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107846150_107846151insTT								RAB39 (11944 upstream) : CUL5 (33257 downstream)																																			---	---	---	---
EXPH5	23086	broad.mit.edu	37	11	108411634	108411635	+	Intron	INS	-	T	T	rs139061088	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108411634_108411635insT	uc001pkk.2	-						EXPH5_uc010rvy.1_5'Flank|EXPH5_uc010rvz.1_5'Flank|EXPH5_uc010rwa.1_Intron	NM_015065	NP_055880			exophilin 5 isoform a						intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	108526459	108526461	+	IGR	DEL	AAC	-	-	rs34437953		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108526459_108526461delAAC								EXPH5 (62085 upstream) : DDX10 (9355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	108819149	108819150	+	IGR	INS	-	A	A	rs139702708	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108819149_108819150insA								DDX10 (7503 upstream) : C11orf87 (473725 downstream)																																			---	---	---	---
RDX	5962	broad.mit.edu	37	11	110074988	110074988	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110074988delA	uc009yxy.2	-						RDX_uc009yxx.1_Intron|RDX_uc009yxz.2_Intron|RDX_uc009yya.2_Intron	NM_002906	NP_002897			radixin						actin filament capping	cleavage furrow|cytoskeleton|extrinsic to membrane|Golgi apparatus|nucleolus|plasma membrane	actin binding				0		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)														---	---	---	---
NCAM1	4684	broad.mit.edu	37	11	112951985	112951985	+	Intron	DEL	G	-	-	rs34420940		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112951985delG	uc009yyq.1	+						NCAM1_uc001pno.2_Intron	NM_001076682	NP_001070150			neural cell adhesion molecule 1 isoform 3						axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	113498828	113498828	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113498828delA								DRD2 (152415 upstream) : TMPRSS5 (59441 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	113583212	113583212	+	IGR	DEL	T	-	-	rs35166182		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113583212delT								TMPRSS5 (6144 upstream) : ZW10 (20699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	114487063	114487064	+	IGR	INS	-	ATA	ATA	rs150589010	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114487063_114487064insATA								FAM55D (20579 upstream) : FAM55B (62136 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	115651255	115651255	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115651255delT								CADM1 (276014 upstream) : BUD13 (967633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116253388	116253389	+	IGR	DEL	AA	-	-	rs71066479		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116253388_116253389delAA								CADM1 (878147 upstream) : BUD13 (365499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	116478901	116478901	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116478901delC								None (None upstream) : BUD13 (139987 downstream)																																			---	---	---	---
APOA4	337	broad.mit.edu	37	11	116695018	116695019	+	5'Flank	INS	-	T	T	rs146265351		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116695018_116695019insT	uc001pps.1	-							NM_000482	NP_000473			apolipoprotein A-IV precursor												0	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	117833036	117833039	+	IGR	DEL	GGAA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117833036_117833039delGGAA								TMPRSS13 (32921 upstream) : IL10RA (24067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	118292669	118292669	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118292669delA								ATP5L (12108 upstream) : MLL (14536 downstream)																																			---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120498506	120498506	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120498506delC	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron	NM_014619	NP_055434			glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120515840	120515845	+	Intron	DEL	GTGTGT	-	-	rs10566673		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120515840_120515845delGTGTGT	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron	NM_014619	NP_055434			glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	122411948	122411948	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122411948delT								LOC399959 (173481 upstream) : UBASH3B (114450 downstream)																																			---	---	---	---
ZNF202	7753	broad.mit.edu	37	11	123606319	123606319	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123606319delC	uc001pzd.1	-						ZNF202_uc001pze.1_Intron|ZNF202_uc001pzf.1_Intron	NM_003455	NP_003446			zinc finger protein 202						lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)														---	---	---	---
C11orf61	79684	broad.mit.edu	37	11	124648184	124648184	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124648184delT	uc001qba.1	-						C11orf61_uc001qaz.1_Intron|C11orf61_uc010sap.1_Intron|C11orf61_uc001qay.1_5'Flank	NM_024631	NP_078907			hypothetical protein LOC79684												0	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0079)														---	---	---	---
HEPACAM	220296	broad.mit.edu	37	11	124805204	124805205	+	Intron	DEL	TG	-	-	rs112123232		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124805204_124805205delTG	uc001qbk.2	-						HEPACAM_uc001qbl.1_Intron	NM_152722	NP_689935			hepatocyte cell adhesion molecule precursor						cell adhesion|cell cycle arrest|regulation of growth	cytoplasm|integral to membrane				pancreas(1)	1	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.54e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	126223249	126223252	+	Intron	DEL	AAAG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126223249_126223252delAAAG	uc001qdq.1	-						uc001qdr.1_Intron|ST3GAL4_uc001qds.2_5'Flank|ST3GAL4_uc001qdt.2_5'Flank|ST3GAL4_uc009zcc.2_5'Flank|ST3GAL4_uc009zcd.2_5'Flank|ST3GAL4_uc001qdu.2_5'Flank|ST3GAL4_uc001qdv.2_5'Flank					Homo sapiens cDNA FLJ39051 fis, clone NT2RP7011452.																														---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126327265	126327266	+	Intron	INS	-	GT	GT	rs145494595		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126327265_126327266insGT	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920			kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126640076	126640076	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126640076delT	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron|KIRREL3_uc001qed.3_Intron	NM_032531	NP_115920			kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	127769163	127769163	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127769163delA								KIRREL3 (895808 upstream) : ETS1 (559493 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	128205987	128205988	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128205987_128205988insT								None (None upstream) : ETS1 (122668 downstream)																																			---	---	---	---
ARHGAP32	9743	broad.mit.edu	37	11	128993935	128993936	+	Intron	INS	-	T	T	rs143474818	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128993935_128993936insT	uc009zcp.2	-						ARHGAP32_uc009zcq.1_Intron	NM_001142685	NP_001136157			Rho GTPase-activating protein isoform 1						cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	131021409	131021412	+	IGR	DEL	AAAT	-	-	rs10596145		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131021409_131021412delAAAT								SNX19 (235027 upstream) : NTM (218959 downstream)																																			---	---	---	---
OPCML	4978	broad.mit.edu	37	11	132546685	132546685	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132546685delA	uc001qgs.2	-						OPCML_uc001qgu.2_Intron|OPCML_uc010sck.1_Intron|OPCML_uc001qgt.2_Intron|OPCML_uc010scl.1_Intron	NM_002545	NP_002536			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
OPCML	4978	broad.mit.edu	37	11	133371630	133371630	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133371630delC	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	134435503	134435529	+	IGR	DEL	GGTGATGGTGATGATGGTGACAATGAA	-	-	rs61908899		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134435503_134435529delGGTGATGGTGATGATGGTGACAATGAA								B3GAT1 (153691 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	134623602	134623602	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134623602delT								B3GAT1 (341790 upstream) : None (None downstream)																																			---	---	---	---
B4GALNT3	283358	broad.mit.edu	37	12	589617	589622	+	Intron	DEL	CTGACC	-	-	rs67230202	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:589617_589622delCTGACC	uc001qii.1	+							NM_173593	NP_775864			beta							Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)															---	---	---	---
ERC1	23085	broad.mit.edu	37	12	1191194	1191197	+	Intron	DEL	TTGT	-	-	rs10560159		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1191194_1191197delTTGT	uc001qjb.2	+						ERC1_uc001qiz.2_Intron|ERC1_uc001qjc.2_Intron|ERC1_uc001qja.2_Intron|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Intron|ERC1_uc010sdv.1_5'Flank	NM_178040	NP_829884			RAB6-interacting protein 2 isoform epsilon						I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	2830046	2830047	+	IGR	DEL	GG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2830046_2830047delGG								CACNA1C (22931 upstream) : FKBP4 (74061 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	3160624	3160625	+	IGR	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3160624_3160625delTC								TEAD4 (10783 upstream) : TSPAN9 (25932 downstream)																																			---	---	---	---
TSPAN9	10867	broad.mit.edu	37	12	3381664	3381664	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3381664delT	uc001qlp.2	+							NM_006675	NP_006666			tetraspanin 9							integral to plasma membrane|membrane fraction				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)															---	---	---	---
C12orf4	57102	broad.mit.edu	37	12	4633681	4633681	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4633681delA	uc001qms.2	-						C12orf4_uc001qmt.2_Intron	NM_020374	NP_065107			hypothetical protein LOC57102												0			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)														---	---	---	---
MLF2	8079	broad.mit.edu	37	12	6868583	6868584	+	Intron	DEL	GC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6868583_6868584delGC	uc009zey.1	-							NM_005439	NP_005430			myeloid leukemia factor 2						defense response	cytoplasm|nucleus	protein binding			large_intestine(1)	1																		---	---	---	---
CLSTN3	9746	broad.mit.edu	37	12	7286820	7286820	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7286820delC	uc001qsr.2	+						CLSTN3_uc001qss.2_Intron	NM_014718	NP_055533			calsyntenin 3 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1																		---	---	---	---
RIMKLB	57494	broad.mit.edu	37	12	8922567	8922567	+	Intron	DEL	T	-	-	rs71909894		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8922567delT	uc001quu.2	+						RIMKLB_uc009zgf.1_Intron|RIMKLB_uc001qux.2_Intron|RIMKLB_uc010sgl.1_Intron|RIMKLB_uc001quw.2_Intron	NM_020734	NP_065785			ribosomal modification protein rimK-like family						protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	9296762	9296763	+	IGR	DEL	AG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9296762_9296763delAG								A2M (28204 upstream) : PZP (4674 downstream)																																			---	---	---	---
CLEC9A	283420	broad.mit.edu	37	12	10183773	10183773	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10183773delG	uc001qxa.2	+							NM_207345	NP_997228			C-type lectin domain family 9, member A						positive regulation of cytokine secretion|receptor-mediated endocytosis	cell surface|integral to membrane	receptor activity|sugar binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	11745452	11745452	+	IGR	DEL	A	-	-	rs71434194		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11745452delA								PRB2 (196954 upstream) : ETV6 (57336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	14164933	14164934	+	IGR	INS	-	T	T	rs140407873	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14164933_14164934insT								GRIN2B (31911 upstream) : ATF7IP (353677 downstream)																																			---	---	---	---
PLBD1	79887	broad.mit.edu	37	12	14673004	14673004	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14673004delA	uc001rcc.1	-							NM_024829	NP_079105			phospholipase B domain containing 1						lipid catabolic process	extracellular region	hydrolase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	15379684	15379684	+	IGR	DEL	A	-	-	rs112677516		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15379684delA								RERG (5380 upstream) : PTPRO (95803 downstream)																																			---	---	---	---
PLEKHA5	54477	broad.mit.edu	37	12	19304401	19304402	+	Intron	INS	-	ACAG	ACAG	rs150927345	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19304401_19304402insACAG	uc001reb.2	+						PLEKHA5_uc010sie.1_Intron|PLEKHA5_uc001rea.2_Intron|PLEKHA5_uc009zin.2_Intron|PLEKHA5_uc001rdz.3_Intron	NM_019012	NP_061885			pleckstrin homology domain containing, family A								1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	20102947	20102947	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20102947delT								AEBP2 (427774 upstream) : PDE3A (419250 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	20420864	20420864	+	IGR	DEL	T	-	-	rs76776423		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20420864delT								AEBP2 (745691 upstream) : PDE3A (101333 downstream)																																			---	---	---	---
GYS2	2998	broad.mit.edu	37	12	21698062	21698062	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21698062delT	uc001rfb.2	-							NM_021957	NP_068776			glycogen synthase 2						glucose metabolic process|glycogen biosynthetic process|response to glucose stimulus	cortical actin cytoskeleton|cytosol|ectoplasm|insoluble fraction|soluble fraction	glycogen (starch) synthase activity|protein homodimerization activity			lung(1)|skin(1)	2																		---	---	---	---
ABCC9	10060	broad.mit.edu	37	12	22013025	22013026	+	Intron	INS	-	A	A	rs147330648	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22013025_22013026insA	uc001rfi.1	-						ABCC9_uc001rfh.2_Intron|ABCC9_uc001rfj.1_Intron	NM_005691	NP_005682			ATP-binding cassette, sub-family C, member 9						defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	22131998	22131998	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22131998delA								ABCC9 (37662 upstream) : CMAS (67161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	22494466	22494467	+	Intron	INS	-	AA	AA			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22494466_22494467insAA	uc001rfp.1	-											full-length cDNA clone CS0DI081YP04 of Placenta Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	23361269	23361270	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23361269_23361270delTG								ETNK1 (517662 upstream) : SOX5 (323962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	23391646	23391648	+	IGR	DEL	ATG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23391646_23391648delATG								ETNK1 (548039 upstream) : SOX5 (293584 downstream)																																			---	---	---	---
SOX5	6660	broad.mit.edu	37	12	23855686	23855687	+	Intron	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23855686_23855687delGT	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_Intron|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Intron	NM_006940	NP_008871			SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
SOX5	6660	broad.mit.edu	37	12	23960049	23960052	+	Intron	DEL	CAAT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23960049_23960052delCAAT	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_Intron|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Intron|SOX5_uc001rga.2_Intron	NM_006940	NP_008871			SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
SOX5	6660	broad.mit.edu	37	12	23996142	23996142	+	Intron	DEL	A	-	-	rs35279483		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23996142delA	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_Intron|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Intron|SOX5_uc001rga.2_Intron	NM_006940	NP_008871			SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
SOX5	6660	broad.mit.edu	37	12	24582560	24582561	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24582560_24582561delAC	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534			SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
SOX5	6660	broad.mit.edu	37	12	24610972	24610972	+	Intron	DEL	T	-	-	rs35345972		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24610972delT	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534			SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
BCAT1	586	broad.mit.edu	37	12	24998153	24998154	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24998153_24998154insA	uc001rgd.3	-						BCAT1_uc001rgc.2_Intron|BCAT1_uc010six.1_Intron|BCAT1_uc010siy.1_Intron|BCAT1_uc001rge.3_Intron	NM_005504	NP_005495			branched chain aminotransferase 1, cytosolic						branched chain family amino acid biosynthetic process|branched chain family amino acid catabolic process|cell proliferation|G1/S transition of mitotic cell cycle	cytosol	L-isoleucine transaminase activity|L-leucine transaminase activity|L-valine transaminase activity			lung(1)|breast(1)	2	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Glutamic Acid(DB00142)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)|Pyridoxal Phosphate(DB00114)													---	---	---	---
LYRM5	144363	broad.mit.edu	37	12	25350759	25350760	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25350759_25350760insA	uc001rgo.2	+						CASC1_uc001rgk.2_5'Flank|CASC1_uc001rgm.3_5'Flank|CASC1_uc001rgl.2_5'Flank|CASC1_uc001rgj.2_5'Flank|CASC1_uc010sje.1_5'Flank|CASC1_uc010sjf.1_5'Flank|CASC1_uc010sjg.1_5'Flank|CASC1_uc010sjh.1_5'Flank|LYRM5_uc001rgn.2_Intron	NM_001001660	NP_001001660			LYR motif containing 5												0	all_cancers(2;4.75e-35)|all_epithelial(2;1.91e-37)|all_lung(3;1.07e-23)|Lung NSC(3;5.49e-23)|Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.0016)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;2.21e-21)|Epithelial(3;8.04e-19)|all cancers(3;2.26e-16)|STAD - Stomach adenocarcinoma(2;0.00138)															---	---	---	---
IFLTD1	160492	broad.mit.edu	37	12	25784330	25784330	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25784330delC	uc010sjj.1	-							NM_001145727	NP_001139199			intermediate filament tail domain containing 1							intermediate filament	structural molecule activity			ovary(2)|central_nervous_system(1)	3	all_lung(3;2.75e-22)|Lung NSC(3;1.77e-21)|all_hematologic(7;0.00656)|Colorectal(261;0.0847)																	---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26621158	26621160	+	Intron	DEL	AGA	-	-	rs72261218		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26621158_26621160delAGA	uc001rhg.2	-						ITPR2_uc009zjg.1_Intron	NM_002223	NP_002214			inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
CCDC91	55297	broad.mit.edu	37	12	28535795	28535795	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28535795delT	uc001riq.2	+						CCDC91_uc001rio.2_Intron|CCDC91_uc009zjk.2_Intron|CCDC91_uc001rip.1_Intron|CCDC91_uc001rir.2_Intron|CCDC91_uc009zjl.2_Intron	NM_018318	NP_060788			GGA binding partner						protein transport	Golgi apparatus|membrane				central_nervous_system(1)	1	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	29272424	29272424	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29272424delA								CCDC91 (569326 upstream) : FAR2 (29808 downstream)																																			---	---	---	---
ERGIC2	51290	broad.mit.edu	37	12	29497601	29497602	+	Intron	INS	-	A	A	rs11433070		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29497601_29497602insA	uc001riv.2	-						ERGIC2_uc001riw.2_Intron	NM_016570	NP_057654			PTX1 protein						vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane|nucleus				ovary(1)	1	Lung NSC(12;2.02e-08)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)|Lung SC(9;0.184)				Arsenic trioxide(DB01169)													---	---	---	---
ERGIC2	51290	broad.mit.edu	37	12	29514184	29514184	+	Intron	DEL	A	-	-	rs78517634		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29514184delA	uc001riv.2	-						ERGIC2_uc001riw.2_Intron	NM_016570	NP_057654			PTX1 protein						vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane|nucleus				ovary(1)	1	Lung NSC(12;2.02e-08)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)|Lung SC(9;0.184)				Arsenic trioxide(DB01169)													---	---	---	---
Unknown	0	broad.mit.edu	37	12	30584521	30584521	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30584521delA								TMTC1 (646829 upstream) : IPO8 (197402 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	31757311	31757312	+	IGR	INS	-	TTTG	TTTG	rs142820253	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31757311_31757312insTTTG								DENND5B (13359 upstream) : C12orf72 (42782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	31961228	31961228	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31961228delT								H3F3C (16053 upstream) : C12orf35 (151125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	31983139	31983139	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31983139delA								H3F3C (37964 upstream) : C12orf35 (129214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	32190758	32190761	+	IGR	DEL	TTTT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32190758_32190761delTTTT								C12orf35 (44727 upstream) : BICD1 (69424 downstream)																																			---	---	---	---
SYT10	341359	broad.mit.edu	37	12	33584853	33584853	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33584853delT	uc001rll.1	-						SYT10_uc009zju.1_Intron	NM_198992	NP_945343			synaptotagmin X							cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(1)|skin(1)	2	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	34336729	34336729	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34336729delG								ALG10 (155495 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38062268	38062268	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38062268delG								None (None upstream) : ALG10B (648289 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38142762	38142762	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38142762delC								None (None upstream) : ALG10B (567795 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38327546	38327546	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38327546delA								None (None upstream) : ALG10B (383011 downstream)																																			---	---	---	---
PPHLN1	51535	broad.mit.edu	37	12	42835329	42835329	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42835329delA	uc001rng.1	+						PPHLN1_uc001rmy.2_3'UTR|PPHLN1_uc001rne.2_3'UTR|PPHLN1_uc001rnb.2_3'UTR|PPHLN1_uc001rnd.2_3'UTR|PPHLN1_uc001rnc.2_3'UTR|PPHLN1_uc001rnf.2_3'UTR|PPHLN1_uc010skq.1_3'UTR|PPHLN1_uc010skr.1_Intron|PPHLN1_uc010sks.1_Intron|PPHLN1_uc010skt.1_Intron|PPHLN1_uc001rni.1_Intron|PPHLN1_uc001rnh.1_Intron|PPHLN1_uc010sku.1_Intron	NM_016488	NP_057572			periphilin 1 isoform 1						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)														---	---	---	---
TMEM117	84216	broad.mit.edu	37	12	44617930	44617931	+	Intron	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44617930_44617931delCA	uc001rod.2	+						TMEM117_uc001roe.2_Intron|TMEM117_uc009zkc.2_Intron	NM_032256	NP_115632			transmembrane protein 117							endoplasmic reticulum|integral to membrane					0	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)														---	---	---	---
NELL2	4753	broad.mit.edu	37	12	45129311	45129311	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45129311delC	uc001rog.2	-						NELL2_uc001rof.3_Intron|NELL2_uc001roh.2_Intron|NELL2_uc009zkd.2_Intron|NELL2_uc010skz.1_Intron|NELL2_uc010sla.1_Intron|NELL2_uc001roi.1_Intron|NELL2_uc010slb.1_Intron|NELL2_uc001roj.2_Intron	NM_001145108	NP_001138580			NEL-like protein 2 isoform b precursor						cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	45978373	45978373	+	IGR	DEL	G	-	-	rs147265592		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45978373delG								ANO6 (144186 upstream) : LOC400027 (141437 downstream)																																			---	---	---	---
SENP1	29843	broad.mit.edu	37	12	48438624	48438625	+	3'UTR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48438624_48438625delTG	uc001rqx.2	-	18					SENP1_uc001rqw.2_3'UTR|SENP1_uc001rqy.2_3'UTR|SENP1_uc001rqz.2_3'UTR|SENP1_uc009zkx.2_3'UTR	NM_014554	NP_055369			sentrin/SUMO-specific protease 1						activation of caspase activity|induction of apoptosis by extracellular signals|protein desumoylation|proteolysis	cytoplasm|nucleus	endopeptidase activity|SUMO-specific protease activity			pancreas(2)|lung(1)	3		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	50175980	50175980	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50175980delA								TMBIM6 (17263 upstream) : NCKAP5L (8949 downstream)																																			---	---	---	---
FAM186A	121006	broad.mit.edu	37	12	50791616	50791617	+	5'Flank	INS	-	TC	TC	rs146656977	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50791616_50791617insTC	uc001rwl.2	-							NM_001145475	NP_001138947			family with sequence similarity 186, member A												0																		---	---	---	---
SLC4A8	9498	broad.mit.edu	37	12	51855774	51855775	+	Intron	INS	-	A	A	rs147458552	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51855774_51855775insA	uc001rys.1	+						SLC4A8_uc010sni.1_Intron|SLC4A8_uc001rym.2_Intron|SLC4A8_uc001ryn.2_Intron|SLC4A8_uc001ryo.2_Intron|SLC4A8_uc001ryp.1_3'UTR|SLC4A8_uc010snj.1_Intron|SLC4A8_uc001ryq.3_Intron|SLC4A8_uc001ryr.2_Intron|SLC4A8_uc010snk.1_Intron	NM_001039960	NP_001035049			solute carrier family 4, sodium bicarbonate						bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	53280186	53280186	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53280186delT								KRT78 (37408 upstream) : KRT8 (10785 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	54305955	54305956	+	IGR	INS	-	A	A	rs139096427	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54305955_54305956insA								CALCOCO1 (184648 upstream) : HOXC13 (26620 downstream)																																			---	---	---	---
OR6C70	390327	broad.mit.edu	37	12	55866705	55866705	+	5'Flank	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55866705delA	uc010spn.1	-							NM_001005499	NP_001005499			olfactory receptor, family 6, subfamily C,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1																		---	---	---	---
CS	1431	broad.mit.edu	37	12	56677037	56677037	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56677037delT	uc001sks.1	-						CS_uc010sql.1_Intron|CS_uc001skr.1_Intron|CS_uc001skt.1_Intron|CS_uc010sqm.1_Intron	NM_004077	NP_004068			citrate synthase precursor						cellular carbohydrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	citrate (Si)-synthase activity				0		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)														---	---	---	---
NXPH4	11247	broad.mit.edu	37	12	57613513	57613513	+	Intron	DEL	A	-	-	rs11310666		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57613513delA	uc010srf.1	+						NXPH4_uc009zpj.2_Intron	NM_007224	NP_009155			neurexophilin 4 precursor						neuropeptide signaling pathway	extracellular region					0																		---	---	---	---
XRCC6BP1	91419	broad.mit.edu	37	12	58334852	58334852	+	5'Flank	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58334852delT	uc001sqp.2	+							NM_033276	NP_150592			XRCC6 binding protein 1						double-strand break repair via nonhomologous end joining	DNA-dependent protein kinase-DNA ligase 4 complex	DNA-dependent protein kinase activity|metal ion binding|metalloendopeptidase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	61107165	61107166	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:61107165_61107166insA								SLC16A7 (931758 upstream) : FAM19A2 (994877 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	63492276	63492277	+	IGR	INS	-	T	T	rs34496406		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63492276_63492277insT								PPM1H (163361 upstream) : AVPR1A (47939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	63671645	63671646	+	IGR	DEL	TG	-	-	rs36103346		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63671645_63671646delTG								AVPR1A (125055 upstream) : DPY19L2 (281047 downstream)																																			---	---	---	---
RASSF3	283349	broad.mit.edu	37	12	65019226	65019226	+	Intron	DEL	T	-	-	rs72381457		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65019226delT	uc001ssd.2	+						RASSF3_uc009zqn.2_Intron	NM_178169	NP_835463			Ras association (RalGDS/AF-6) domain family						signal transduction	cytoplasm|microtubule	identical protein binding				0			Lung(2;0.00133)|LUAD - Lung adenocarcinoma(6;0.0665)|LUSC - Lung squamous cell carcinoma(43;0.132)	GBM - Glioblastoma multiforme(28;0.0611)														---	---	---	---
RASSF3	283349	broad.mit.edu	37	12	65047350	65047350	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65047350delT	uc001ssd.2	+						RASSF3_uc009zqn.2_Intron|RASSF3_uc001sse.2_Intron	NM_178169	NP_835463			Ras association (RalGDS/AF-6) domain family						signal transduction	cytoplasm|microtubule	identical protein binding				0			Lung(2;0.00133)|LUAD - Lung adenocarcinoma(6;0.0665)|LUSC - Lung squamous cell carcinoma(43;0.132)	GBM - Glioblastoma multiforme(28;0.0611)														---	---	---	---
HELB	92797	broad.mit.edu	37	12	66730465	66730465	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66730465delG	uc001sti.2	+						HELB_uc010ssz.1_Intron|HELB_uc009zqt.1_Intron	NM_033647	NP_387467			helicase (DNA) B						DNA replication, synthesis of RNA primer		ATP binding|ATP-dependent 5'-3' DNA helicase activity|single-stranded DNA-dependent ATP-dependent DNA helicase activity			central_nervous_system(1)|pancreas(1)	2			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	68591955	68591960	+	IGR	DEL	TTGTTG	-	-	rs3052116		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68591955_68591960delTTGTTG								IFNG (38434 upstream) : IL26 (3169 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	73175753	73175754	+	IGR	INS	-	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73175753_73175754insG								TRHDE (116332 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	74259785	74259785	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74259785delC								None (None upstream) : ATXN7L3B (671766 downstream)																																			---	---	---	---
CAPS2	84698	broad.mit.edu	37	12	75735115	75735116	+	Intron	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75735115_75735116delTC	uc001sxm.3	-						CAPS2_uc009zsa.2_Intron|GLIPR1L1_uc001sxn.2_Intron|GLIPR1L1_uc001sxo.2_Intron					RecName: Full=Calcyphosin-2; AltName: Full=Calcyphosine-2;								calcium ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	79974859	79974859	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79974859delA								SYT1 (129072 upstream) : PAWR (10888 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	82564892	82564895	+	IGR	DEL	AAAG	-	-	rs6144781		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82564892_82564895delAAAG								PPFIA2 (411783 upstream) : CCDC59 (181195 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	82905295	82905295	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82905295delA								C12orf26 (32354 upstream) : TMTC2 (175639 downstream)																																			---	---	---	---
TMTC2	160335	broad.mit.edu	37	12	83269895	83269895	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83269895delT	uc001szt.2	+						TMTC2_uc001szr.1_Intron|TMTC2_uc001szs.1_Intron|TMTC2_uc010suk.1_Intron	NM_152588	NP_689801			transmembrane and tetratricopeptide repeat							endoplasmic reticulum|integral to membrane	binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	84629421	84629421	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84629421delC								None (None upstream) : SLC6A15 (623848 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	85012195	85012198	+	IGR	DEL	TCTT	-	-	rs72192023		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85012195_85012198delTCTT								None (None upstream) : SLC6A15 (241071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	86326658	86326658	+	IGR	DEL	T	-	-	rs112164338		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86326658delT								NTS (49895 upstream) : MGAT4C (46381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	87641856	87641857	+	IGR	DEL	CA	-	-	rs72184074		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:87641856_87641857delCA								MGAT4C (409175 upstream) : C12orf50 (731959 downstream)																																			---	---	---	---
TMTC3	160418	broad.mit.edu	37	12	88570612	88570612	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88570612delG	uc001tau.2	+						TMTC3_uc009zsm.2_Intron	NM_181783	NP_861448			transmembrane and tetratricopeptide repeat							integral to membrane	binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	89017881	89017881	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89017881delA								KITLG (43643 upstream) : DUSP6 (723958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	89806135	89806135	+	IGR	DEL	T	-	-	rs139936904		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89806135delT								DUSP6 (59839 upstream) : POC1B (7366 downstream)																																			---	---	---	---
POC1B	282809	broad.mit.edu	37	12	89880694	89880695	+	Intron	DEL	AC	-	-	rs72283253		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89880694_89880695delAC	uc001tbc.2	-						POC1B_uc001tba.2_Intron|POC1B_uc001tbb.2_Intron|POC1B_uc010sun.1_Intron|POC1B_uc009zsp.2_Intron|POC1B_uc009zsq.2_Intron	NM_172240	NP_758440			WD repeat domain 51B						cell projection organization	centriole|microtubule basal body				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	91894799	91894803	+	IGR	DEL	TAGTA	-	-	rs67596311		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91894799_91894803delTAGTA								DCN (317993 upstream) : BTG1 (484063 downstream)																																			---	---	---	---
TMCC3	57458	broad.mit.edu	37	12	95007646	95007646	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95007646delG	uc001tdj.2	-						TMCC3_uc001tdi.2_Intron	NM_020698	NP_065749			transmembrane and coiled-coil domain family 3							integral to membrane				ovary(1)|skin(1)	2																		---	---	---	---
NR2C1	7181	broad.mit.edu	37	12	95434969	95434969	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95434969delA	uc001tdm.3	-						NR2C1_uc010suu.1_Intron|NR2C1_uc001tdo.3_Intron|NR2C1_uc001tdn.3_Intron	NM_003297	NP_003288			nuclear receptor subfamily 2, group C, member 1						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	PML body	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1																		---	---	---	---
LTA4H	4048	broad.mit.edu	37	12	96415445	96415446	+	Intron	DEL	AC	-	-	rs139763800		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96415445_96415446delAC	uc001ten.1	-						LTA4H_uc010suy.1_Intron|LTA4H_uc010suz.1_Intron|LTA4H_uc010sva.1_Intron	NM_000895	NP_000886			leukotriene A4 hydrolase						hormone biosynthetic process|inflammatory response|leukotriene biosynthetic process|peptide catabolic process|prostanoid metabolic process|proteolysis	cytosol|nucleus	aminopeptidase activity|epoxide hydrolase activity|leukotriene-A4 hydrolase activity|metallopeptidase activity|protein binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	97756063	97756064	+	IGR	INS	-	CAAA	CAAA	rs140891991	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97756063_97756064insCAAA								NEDD1 (408602 upstream) : RMST (102735 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98622573	98622574	+	IGR	DEL	TT	-	-	rs61932729		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98622573_98622574delTT								RMST (663780 upstream) : LOC100128191 (284179 downstream)																																			---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	99761565	99761566	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99761565_99761566delTG	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
UTP20	27340	broad.mit.edu	37	12	101700103	101700103	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101700103delT	uc001tia.1	+							NM_014503	NP_055318			down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4																		---	---	---	---
IGF1	3479	broad.mit.edu	37	12	102798854	102798855	+	Intron	INS	-	CTTT	CTTT	rs139889639	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102798854_102798855insCTTT	uc001tjm.2	-						IGF1_uc001tjn.2_Intron|IGF1_uc001tjo.2_Intron	NM_001111283	NP_001104753			insulin-like growth factor 1 isoform 1						anti-apoptosis|bone mineralization involved in bone maturation|cellular component movement|DNA replication|glycolate metabolic process|muscle hypertrophy|myoblast differentiation|myoblast proliferation|myotube cell development|negative regulation of smooth muscle cell apoptosis|phosphatidylinositol-mediated signaling|platelet activation|platelet degranulation|positive regulation of activated T cell proliferation|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis|positive regulation of osteoblast differentiation|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of Ras protein signal transduction|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tyrosine phosphorylation of Stat5 protein|Ras protein signal transduction|regulation of multicellular organism growth|satellite cell maintenance involved in skeletal muscle regeneration	platelet alpha granule lumen	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|integrin binding			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
PAH	5053	broad.mit.edu	37	12	103241947	103241982	+	Intron	DEL	AGGACACCAAGAGATGGTAGGGGTTGAGGGTAGAGT	-	-	rs72314798	by1000genomes;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103241947_103241982delAGGACACCAAGAGATGGTAGGGGTTGAGGGTAGAGT	uc001tjq.1	-							NM_000277	NP_000268			phenylalanine hydroxylase						catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)													---	---	---	---
LOC253724	253724	broad.mit.edu	37	12	104303298	104303298	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104303298delA	uc010swf.1	-							NR_027249				Homo sapiens cDNA FLJ56788 complete cds, moderately similar to Mus musculus 5'-nucleotidase domain containing 3 (Nt5dc3), transcript variant 2, mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	104560850	104560851	+	IGR	DEL	TT	-	-	rs35752508		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104560850_104560851delTT								NFYB (28810 upstream) : TXNRD1 (45637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	108451701	108451702	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108451701_108451702insT								ASCL4 (281281 upstream) : WSCD2 (71809 downstream)																																			---	---	---	---
MYO1H	283446	broad.mit.edu	37	12	109849552	109849553	+	Intron	INS	-	CT	CT	rs146618593	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109849552_109849553insCT	uc010sxn.1	+							NM_001101421	NP_001094891			myosin 1H							myosin complex	motor activity				0																		---	---	---	---
MYO1H	283446	broad.mit.edu	37	12	109866611	109866611	+	Intron	DEL	T	-	-	rs56809636		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109866611delT	uc010sxn.1	+							NM_001101421	NP_001094891			myosin 1H							myosin complex	motor activity				0																OREG0022104	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	12	112070763	112070763	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112070763delT								ATXN2 (33283 upstream) : BRAP (9188 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	113958394	113958395	+	IGR	INS	-	CCA	CCA	rs145182985	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113958394_113958395insCCA								LHX5 (48517 upstream) : RBM19 (296148 downstream)																																			---	---	---	---
MED13L	23389	broad.mit.edu	37	12	116442285	116442286	+	Intron	INS	-	A	A	rs75236771		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116442285_116442286insA	uc001tvw.2	-							NM_015335	NP_056150			mediator complex subunit 13-like						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	117115283	117115284	+	IGR	INS	-	A	A	rs71442991		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117115283_117115284insA								MAP1LC3B2 (100858 upstream) : C12orf49 (38312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	117850642	117850643	+	IGR	DEL	AC	-	-	rs72292351		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117850642_117850643delAC								NOS1 (51060 upstream) : KSR2 (40174 downstream)																																			---	---	---	---
KSR2	283455	broad.mit.edu	37	12	118022862	118022863	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118022862_118022863delTG	uc001two.2	-							NM_173598	NP_775869			kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	119349523	119349523	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119349523delA								SUDS3 (493684 upstream) : SRRM4 (69873 downstream)																																			---	---	---	---
CCDC60	160777	broad.mit.edu	37	12	119796809	119796809	+	Intron	DEL	T	-	-	rs143852631	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119796809delT	uc001txe.2	+							NM_178499	NP_848594			coiled-coil domain containing 60											ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	121379979	121379986	+	IGR	DEL	GAATGAAT	-	-	rs71944823		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121379979_121379986delGAATGAAT								SPPL3 (37828 upstream) : C12orf27 (27655 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	121642295	121642299	+	IGR	DEL	GTTTT	-	-	rs144790580		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121642295_121642299delGTTTT								P2RX7 (18439 upstream) : P2RX4 (5365 downstream)																																			---	---	---	---
ANAPC5	51433	broad.mit.edu	37	12	121782385	121782385	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121782385delA	uc001uag.2	-						ANAPC5_uc001uah.2_Intron	NM_016237	NP_057321			anaphase-promoting complex subunit 5 isoform a						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			skin(3)|breast(2)|kidney(1)	6	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---
SETD8	387893	broad.mit.edu	37	12	123889739	123889740	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123889739_123889740insT	uc001uew.2	+						SETD8_uc001uex.2_Intron	NM_020382	NP_065115			SET domain-containing 8						cell division|mitosis|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	chromosome|nucleus	histone-lysine N-methyltransferase activity|p53 binding|transcription corepressor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)														---	---	---	---
SNRNP35	11066	broad.mit.edu	37	12	123947048	123947048	+	Intron	DEL	T	-	-	rs144727236		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123947048delT	uc001ufb.1	+						SNRNP35_uc010tar.1_Intron|SNRNP35_uc009zxz.2_Intron|SNRNP35_uc001ufc.1_Intron	NM_022717	NP_073208			small nuclear ribonucleoprotein 35kDa (U11/U12)						mRNA processing	U12-type spliceosomal complex	nucleotide binding|RNA binding				0																		---	---	---	---
SNRNP35	11066	broad.mit.edu	37	12	123951481	123951481	+	Intron	DEL	C	-	-	rs66499542		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123951481delC	uc001ufc.1	+											Homo sapiens cDNA FLJ40231 fis, clone TESTI2023025.						mRNA processing	U12-type spliceosomal complex	nucleotide binding|RNA binding				0																		---	---	---	---
RILPL1	353116	broad.mit.edu	37	12	123994110	123994111	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123994110_123994111insA	uc001ufe.2	-						RILPL1_uc001ufd.2_Intron|RILPL1_uc010tas.1_Intron	NM_178314	NP_847884			Rab interacting lysosomal protein-like 1						neuroprotection	cytosol					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)														---	---	---	---
ATP6V0A2	23545	broad.mit.edu	37	12	124239332	124239332	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124239332delA	uc001ufr.2	+							NM_012463	NP_036595			ATPase, H+ transporting, lysosomal V0 subunit						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)														---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124291735	124291738	+	Intron	DEL	CATC	-	-	rs34572646		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124291735_124291738delCATC	uc001uft.3	+						DNAH10_uc010tav.1_Intron|DNAH10_uc010taw.1_Intron	NM_207437	NP_997320			dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
DNAH10	196385	broad.mit.edu	37	12	124411747	124411747	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124411747delC	uc001uft.3	+						DNAH10_uc001ufu.3_Intron	NM_207437	NP_997320			dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---
ZNF664	144348	broad.mit.edu	37	12	124487946	124487947	+	Intron	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124487946_124487947delTT	uc001ufz.2	+						ZNF664_uc001uga.2_Intron|ZNF664_uc001ugb.2_Intron	NM_152437	NP_689650			zinc finger protein 664						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.000239)|OV - Ovarian serous cystadenocarcinoma(86;0.000247)|all cancers(50;0.00155)|BRCA - Breast invasive adenocarcinoma(302;0.249)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	125144569	125144569	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125144569delG								NCOR2 (92559 upstream) : SCARB1 (117606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	125219922	125219923	+	IGR	DEL	TG	-	-	rs111864268		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125219922_125219923delTG								NCOR2 (167912 upstream) : SCARB1 (42252 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	126559245	126559245	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126559245delC								TMEM132B (415656 upstream) : LOC100128554 (367782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	127277993	127277994	+	IGR	INS	-	TGTGTGTG	TGTGTGTG	rs147856536	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127277993_127277994insTGTGTGTG								LOC100128554 (320663 upstream) : None (None downstream)																																			---	---	---	---
TMEM132C	92293	broad.mit.edu	37	12	129040483	129040483	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129040483delA	uc001uhs.3	+							NM_001136103	NP_001129575			transmembrane protein 132C							integral to membrane				central_nervous_system(1)	1																		---	---	---	---
TMEM132C	92293	broad.mit.edu	37	12	129172483	129172483	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129172483delT	uc001uhs.3	+							NM_001136103	NP_001129575			transmembrane protein 132C							integral to membrane				central_nervous_system(1)	1																		---	---	---	---
TMEM132D	121256	broad.mit.edu	37	12	129581501	129581502	+	Intron	INS	-	CCA	CCA	rs148844249	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129581501_129581502insCCA	uc009zyl.1	-							NM_133448	NP_597705			transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	130560774	130560774	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130560774delA								LOC100190940 (33887 upstream) : FZD10 (86258 downstream)																																			---	---	---	---
STX2	2054	broad.mit.edu	37	12	131302436	131302439	+	Intron	DEL	GAAG	-	-	rs141455023		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131302436_131302439delGAAG	uc001uio.2	-						STX2_uc001uip.2_Intron|STX2_uc010tbj.1_Intron	NM_194356	NP_919337			syntaxin 2 isoform 2						acrosome reaction|ectoderm development|intracellular protein transport|organ morphogenesis|signal transduction	basolateral plasma membrane|integral to membrane|microsome|soluble fraction	calcium-dependent protein binding|SNAP receptor activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.79e-06)|all cancers(50;5.27e-05)|Epithelial(86;5.29e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	131813492	131813492	+	IGR	DEL	A	-	-	rs72507421		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131813492delA								LOC116437 (116017 upstream) : SFRS8 (382143 downstream)																																			---	---	---	---
ZDHHC20	253832	broad.mit.edu	37	13	22000747	22000747	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22000747delT	uc001uob.2	-						ZDHHC20_uc001uod.2_Intron|ZDHHC20_uc001uoc.2_Intron|ZDHHC20_uc001uoe.2_Intron|ZDHHC20_uc010tcs.1_Intron	NM_153251	NP_694983			zinc finger, DHHC-type containing 20							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)														---	---	---	---
FGF9	2254	broad.mit.edu	37	13	22271948	22271948	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22271948delT	uc001uog.2	+							NM_002010	NP_002001			fibroblast growth factor 9 precursor						cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|male gonad development|positive regulation of cell division	extracellular space	growth factor activity|heparin binding				0		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	22562992	22562992	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22562992delA								FGF9 (284352 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	22835928	22835928	+	Intron	DEL	T	-	-	rs12866172		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22835928delT	uc001uoi.2	+						uc001uoj.2_Intron					Homo sapiens cDNA FLJ30283 fis, clone BRACE2002807.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	23167880	23167881	+	IGR	INS	-	C	C	rs140892059	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23167880_23167881insC								FGF9 (889240 upstream) : SGCG (587179 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	23285258	23285258	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23285258delT								None (None upstream) : SGCG (469802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	23465675	23465675	+	IGR	DEL	G	-	-	rs1576603	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23465675delG								None (None upstream) : SGCG (289385 downstream)																																			---	---	---	---
SPATA13	221178	broad.mit.edu	37	13	24674883	24674883	+	Intron	DEL	T	-	-	rs35984887		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24674883delT	uc001upd.1	+						C1QTNF9_uc001upe.2_Intron	NM_153023	NP_694568			spermatogenesis associated 13						cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	25635740	25635749	+	IGR	DEL	AAAAAAACAC	-	-	rs67316529		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25635740_25635749delAAAAAAACAC								TPTE2P1 (93133 upstream) : PABPC3 (34527 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	25637270	25637276	+	IGR	DEL	TCAGTTT	-	-	rs148836181		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25637270_25637276delTCAGTTT								TPTE2P1 (94663 upstream) : PABPC3 (33000 downstream)																																			---	---	---	---
ATP8A2	51761	broad.mit.edu	37	13	25970123	25970123	+	Intron	DEL	A	-	-	rs57524918		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25970123delA	uc001uqk.2	+							NM_016529	NP_057613			ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)														---	---	---	---
ATP8A2	51761	broad.mit.edu	37	13	26380713	26380713	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26380713delG	uc001uqk.2	+						ATP8A2_uc010tdi.1_Intron|ATP8A2_uc010tdj.1_Intron|ATP8A2_uc010aaj.1_Intron	NM_016529	NP_057613			ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	28111743	28111743	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28111743delA								MTIF3 (87032 upstream) : LNX2 (8309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	28480188	28480188	+	Intron	DEL	A	-	-	rs66692736		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28480188delA	uc001urs.1	-											full-length cDNA clone CS0DJ004YL04 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	30499189	30499190	+	IGR	DEL	GA	-	-	rs67922841		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30499189_30499190delGA								UBL3 (74369 upstream) : KATNAL1 (277578 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	32037876	32037876	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32037876delT								B3GALTL (131467 upstream) : RXFP2 (275803 downstream)																																			---	---	---	---
FRY	10129	broad.mit.edu	37	13	32821160	32821160	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32821160delT	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463			furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)														---	---	---	---
STARD13	90627	broad.mit.edu	37	13	33934937	33934937	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33934937delT	uc001uux.2	-							NM_052851	NP_443083			StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	34794585	34794585	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34794585delA								RFC3 (253891 upstream) : NBEA (721871 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	34894160	34894161	+	IGR	DEL	TC	-	-	rs34486113		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:34894160_34894161delTC								RFC3 (353466 upstream) : NBEA (622295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	35342897	35342897	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35342897delA								RFC3 (802203 upstream) : NBEA (173559 downstream)																																			---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36433803	36433805	+	Intron	DEL	TCT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36433803_36433805delTCT	uc001uvf.2	-						uc001uvi.1_Intron	NM_004734	NP_004725			doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36449238	36449238	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36449238delT	uc001uvf.2	-						uc001uvi.1_Intron	NM_004734	NP_004725			doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36697577	36697578	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36697577_36697578insT	uc001uvf.2	-							NM_004734	NP_004725			doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
FREM2	341640	broad.mit.edu	37	13	39339850	39339851	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39339850_39339851insT	uc001uwv.2	+							NM_207361	NP_997244			FRAS1-related extracellular matrix protein 2						cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	39522096	39522097	+	IGR	DEL	CA	-	-	rs145635164		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39522096_39522097delCA								FREM2 (60831 upstream) : STOML3 (17966 downstream)																																			---	---	---	---
LHFP	10186	broad.mit.edu	37	13	40026064	40026065	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40026064_40026065delTG	uc001uxf.2	-							NM_005780	NP_005771			lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)				T	HMGA2	lipoma								---	---	---	---
Unknown	0	broad.mit.edu	37	13	40540119	40540119	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40540119delT								COG6 (174317 upstream) : LOC646982 (381154 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	40626355	40626356	+	IGR	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40626355_40626356delGA								COG6 (260553 upstream) : LOC646982 (294917 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	42096279	42096280	+	IGR	INS	-	TG	TG	rs57038356		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42096279_42096280insTG								C13orf15 (51266 upstream) : KIAA0564 (44682 downstream)																																			---	---	---	---
DGKH	160851	broad.mit.edu	37	13	42714063	42714063	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42714063delC	uc001uyl.1	+						DGKH_uc010tfh.1_Intron|DGKH_uc001uym.1_Intron|DGKH_uc010tfi.1_Intron|DGKH_uc010tfj.1_Intron|DGKH_uc001uyn.1_Intron|DGKH_uc001uyo.1_Intron|DGKH_uc001uyp.2_Intron	NM_178009	NP_821077			diacylglycerol kinase, eta isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation|protein oligomerization	endosome|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(2)	2		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	42942041	42942041	+	IGR	DEL	G	-	-	rs139425719		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42942041delG								AKAP11 (44639 upstream) : TNFSF11 (194831 downstream)																																			---	---	---	---
DNAJC15	29103	broad.mit.edu	37	13	43612937	43612938	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43612937_43612938insA	uc001uyy.2	+							NM_013238	NP_037370			DNAJ domain-containing							integral to membrane	heat shock protein binding				0		Lung NSC(96;4.3e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0737)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	44481168	44481168	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44481168delG								C13orf31 (13101 upstream) : LOC121838 (115303 downstream)																																			---	---	---	---
TSC22D1	8848	broad.mit.edu	37	13	45105717	45105718	+	Intron	INS	-	TTCTT	TTCTT	rs144287054	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45105717_45105718insTTCTT	uc001uzn.3	-						TSC22D1_uc001uzo.1_Intron	NM_183422	NP_904358			TSC22 domain family, member 1 isoform 1						transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)														---	---	---	---
GTF2F2	2963	broad.mit.edu	37	13	45701627	45701628	+	Intron	INS	-	T	T	rs34519885		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45701627_45701628insT	uc001uzw.2	+						GTF2F2_uc001uzv.2_Intron	NM_004128	NP_004119			general transcription factor IIF, polypeptide 2,						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	microtubule cytoskeleton|transcription factor TFIIF complex	ATP binding|ATP-dependent helicase activity|DNA binding|protein binding				0		Lung NSC(96;0.00115)|Prostate(109;0.00578)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000647)														---	---	---	---
GTF2F2	2963	broad.mit.edu	37	13	45795073	45795076	+	Intron	DEL	TGTG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45795073_45795076delTGTG	uc001uzw.2	+						GTF2F2_uc001uzv.2_Intron	NM_004128	NP_004119			general transcription factor IIF, polypeptide 2,						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	microtubule cytoskeleton|transcription factor TFIIF complex	ATP binding|ATP-dependent helicase activity|DNA binding|protein binding				0		Lung NSC(96;0.00115)|Prostate(109;0.00578)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000647)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	46481171	46481172	+	IGR	INS	-	GAG	GAG	rs140268819	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46481171_46481172insGAG								SIAH3 (55325 upstream) : ZC3H13 (48633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	46911456	46911456	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46911456delT								LCP1 (154997 upstream) : C13orf18 (4683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	47399296	47399296	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47399296delA								ESD (27929 upstream) : HTR2A (8217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	48232634	48232635	+	IGR	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48232634_48232635delTC								HTR2A (761584 upstream) : SUCLA2 (284157 downstream)																																			---	---	---	---
SUCLA2	8803	broad.mit.edu	37	13	48579188	48579188	+	Intron	DEL	A	-	-	rs150380058		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48579188delA	uc010tgd.1	-							NM_003850	NP_003841			succinate-CoA ligase, ADP-forming, beta subunit						succinyl-CoA pathway|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			central_nervous_system(1)	1		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	49171847	49171848	+	IGR	DEL	AC	-	-	rs146461492		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49171847_49171848delAC								RCBTB2 (61729 upstream) : CYSLTR2 (56017 downstream)																																			---	---	---	---
FNDC3A	22862	broad.mit.edu	37	13	49630323	49630323	+	Intron	DEL	A	-	-	rs77147643		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49630323delA	uc001vcm.2	+						FNDC3A_uc001vcl.1_Intron|FNDC3A_uc001vcn.2_Intron|FNDC3A_uc001vco.2_Intron	NM_001079673	NP_001073141			fibronectin type III domain containing 3A							Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)														---	---	---	---
DLEU1	10301	broad.mit.edu	37	13	50957420	50957420	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50957420delT	uc010adl.1	+						DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron|uc001vek.1_Intron|uc001vel.1_Intron|uc001vem.1_Intron|uc001ven.1_Intron|uc001veo.1_Intron|uc001vep.1_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0																		---	---	---	---
DLEU1	10301	broad.mit.edu	37	13	51054155	51054155	+	Intron	DEL	T	-	-	rs112089417		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51054155delT	uc001vee.1	+						DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron|uc001vel.1_Intron|uc001vem.1_Intron|uc001veq.1_Intron|uc001ver.2_Intron|uc001ves.1_Intron|uc001vet.1_Intron|uc001veu.2_Intron|uc001vev.2_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0																		---	---	---	---
DLEU7	220107	broad.mit.edu	37	13	51415874	51415876	+	Intron	DEL	AAA	-	-	rs35775383		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51415874_51415876delAAA	uc001vez.2	-						DLEU7_uc001vex.2_Intron|uc001vey.2_Intron	NM_198989	NP_945340			deleted in lymphocytic leukemia, 7												0		Acute lymphoblastic leukemia(7;1.03e-07)|Lung NSC(96;0.000818)|Breast(56;0.00122)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.25e-08)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	51881846	51881846	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51881846delT								FAM124A (26230 upstream) : SERPINE3 (33322 downstream)																																			---	---	---	---
ATP7B	540	broad.mit.edu	37	13	52571931	52571932	+	Intron	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52571931_52571932delGA	uc001vfw.2	-						ATP7B_uc010adv.2_Intron|ATP7B_uc001vfx.2_Intron|ATP7B_uc001vfy.2_Intron|ATP7B_uc010tgt.1_Intron|ATP7B_uc010tgu.1_Intron|ATP7B_uc010tgv.1_Intron	NM_000053	NP_000044			ATPase, Cu++ transporting, beta polypeptide						ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)										Wilson_disease				---	---	---	---
NEK5	341676	broad.mit.edu	37	13	52641110	52641110	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52641110delA	uc001vge.2	-							NM_199289	NP_954983			NIMA-related kinase 5								ATP binding|metal ion binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)	1		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)														---	---	---	---
TPTE2P3	220115	broad.mit.edu	37	13	53091650	53091650	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53091650delT	uc001vgw.2	+							NR_002793				Homo sapiens TPTE and PTEN homologous inositol lipid phosphatase pseudogene, mRNA (cDNA clone IMAGE:5298506), with apparent retained intron.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	53733544	53733545	+	IGR	INS	-	TT	TT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53733544_53733545insTT								OLFM4 (107358 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	53955095	53955095	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53955095delT								OLFM4 (328909 upstream) : MIR1297 (931012 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	54903879	54903879	+	IGR	DEL	A	-	-	rs34115712		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54903879delA								MIR1297 (17696 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	54923140	54923140	+	IGR	DEL	T	-	-	rs68002575		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54923140delT								MIR1297 (36957 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55130841	55130841	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55130841delA								MIR1297 (244658 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55377341	55377341	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55377341delG								MIR1297 (491158 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	55939615	55939616	+	IGR	INS	-	A	A	rs35324686		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55939615_55939616insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	56826248	56826248	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:56826248delT								None (None upstream) : PRR20C (888804 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57028402	57028403	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57028402_57028403insT								None (None upstream) : PRR20C (686649 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57035081	57035082	+	IGR	INS	-	AG	AG	rs144068491	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57035081_57035082insAG								None (None upstream) : PRR20C (679970 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	57241156	57241156	+	IGR	DEL	T	-	-	rs79580455		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:57241156delT								None (None upstream) : PRR20C (473896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	58314177	58314178	+	IGR	INS	-	T	T	rs149430866	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58314177_58314178insT								PCDH17 (11112 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	58759167	58759167	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58759167delC								PCDH17 (456102 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	60779985	60779985	+	IGR	DEL	A	-	-	rs34145829		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60779985delA								DIAPH3 (41866 upstream) : TDRD3 (190606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	61321747	61321747	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61321747delA								TDRD3 (173735 upstream) : PCDH20 (662074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	61329200	61329201	+	IGR	INS	-	TG	TG	rs139015179	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61329200_61329201insTG								TDRD3 (181188 upstream) : PCDH20 (654620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	61431746	61431747	+	IGR	DEL	TT	-	-	rs5804022		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61431746_61431747delTT								TDRD3 (283734 upstream) : PCDH20 (552074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	61578092	61578093	+	IGR	INS	-	A	A	rs147858111	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61578092_61578093insA								TDRD3 (430080 upstream) : PCDH20 (405728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62250081	62250082	+	IGR	INS	-	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62250081_62250082insC								PCDH20 (248002 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62707118	62707118	+	IGR	DEL	T	-	-	rs113066163		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62707118delT								PCDH20 (705039 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63339121	63339121	+	IGR	DEL	T	-	-	rs5804109		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63339121delT								None (None upstream) : OR7E156P (972447 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63561372	63561373	+	IGR	INS	-	C	C	rs147319345	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63561372_63561373insC								None (None upstream) : OR7E156P (750195 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	63629620	63629628	+	IGR	DEL	TAAGAAAAA	-	-	rs67126707		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63629620_63629628delTAAGAAAAA								None (None upstream) : OR7E156P (681940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	64456680	64456681	+	IGR	INS	-	A	A	rs138257946	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64456680_64456681insA								OR7E156P (139979 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	64870561	64870561	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:64870561delT								OR7E156P (553860 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	65227834	65227835	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65227834_65227835delAC								OR7E156P (911133 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	65606049	65606050	+	IGR	INS	-	T	T	rs111602775		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65606049_65606050insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	66852494	66852494	+	IGR	DEL	G	-	-	rs76541706		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66852494delG								None (None upstream) : PCDH9 (24473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69330525	69330525	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69330525delT								None (None upstream) : KLHL1 (944201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	70019121	70019122	+	IGR	INS	-	CTCTCCCA	CTCTCCCA	rs148083689	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70019121_70019122insCTCTCCCA								None (None upstream) : KLHL1 (255604 downstream)																																			---	---	---	---
KLHL1	57626	broad.mit.edu	37	13	70628858	70628858	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70628858delA	uc001vip.2	-						KLHL1_uc010thm.1_Intron	NM_020866	NP_065917			kelch-like 1 protein						actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)														---	---	---	---
DACH1	1602	broad.mit.edu	37	13	72309714	72309728	+	Intron	DEL	TGTATATGGGATATA	-	-	rs145391918	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72309714_72309728delTGTATATGGGATATA	uc010thn.1	-						DACH1_uc010tho.1_Intron|DACH1_uc010thp.1_Intron	NM_080759	NP_542937			dachshund homolog 1 isoform a						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)														---	---	---	---
DACH1	1602	broad.mit.edu	37	13	72340973	72340973	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:72340973delA	uc010thn.1	-						DACH1_uc010tho.1_Intron|DACH1_uc010thp.1_Intron	NM_080759	NP_542937			dachshund homolog 1 isoform a						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|nucleotide binding|protein binding			breast(1)	1		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)														---	---	---	---
KLF12	11278	broad.mit.edu	37	13	74522366	74522366	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74522366delT	uc001vjf.2	-						KLF12_uc010aeq.2_Intron|KLF12_uc001vjg.3_Intron	NM_007249	NP_009180			Kruppel-like factor 12						negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	74776443	74776443	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74776443delT								KLF12 (68049 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	75344746	75344746	+	IGR	DEL	T	-	-	rs11320570		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75344746delT								KLF12 (636352 upstream) : LOC647288 (467144 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	75585245	75585246	+	IGR	INS	-	C	C	rs143152982	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75585245_75585246insC								KLF12 (876851 upstream) : LOC647288 (226644 downstream)																																			---	---	---	---
TBC1D4	9882	broad.mit.edu	37	13	75965169	75965174	+	Intron	DEL	CACACA	-	-	rs140088019		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75965169_75965174delCACACA	uc001vjl.1	-						TBC1D4_uc010aer.2_Intron|TBC1D4_uc010aes.2_Intron	NM_014832	NP_055647			TBC1 domain family, member 4							cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	76063399	76063400	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76063399_76063400insA								TBC1D4 (7149 upstream) : COMMD6 (35950 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	76960006	76960006	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76960006delA								LMO7 (526002 upstream) : KCTD12 (494298 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	77206088	77206088	+	IGR	DEL	A	-	-	rs10706092		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77206088delA								LMO7 (772084 upstream) : KCTD12 (248216 downstream)																																			---	---	---	---
BTF3L1	690	broad.mit.edu	37	13	77501153	77501153	+	5'Flank	DEL	A	-	-	rs35634810		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77501153delA	uc001vkb.3	+							NR_026983				Homo sapiens basic transcription factor 3, like 1, mRNA (cDNA clone IMAGE:40013884).												0																		---	---	---	---
MYCBP2	23077	broad.mit.edu	37	13	77858372	77858373	+	Intron	INS	-	A	A	rs111730591		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77858372_77858373insA	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron	NM_015057	NP_055872			MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	78098287	78098287	+	IGR	DEL	A	-	-	rs34645611		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78098287delA								MYCBP2 (197110 upstream) : SCEL (11522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	81397788	81397788	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81397788delA								SPRY2 (482702 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	81541493	81541494	+	IGR	DEL	TG	-	-	rs144884156		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81541493_81541494delTG								SPRY2 (626407 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	81554858	81554858	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81554858delA								SPRY2 (639772 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	83260300	83260300	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83260300delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	83276675	83276676	+	IGR	INS	-	ACAC	ACAC	rs142090892	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83276675_83276676insACAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	83427265	83427266	+	IGR	INS	-	A	A	rs147180998	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83427265_83427266insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	83746281	83746281	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:83746281delC								None (None upstream) : SLITRK1 (705063 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	84725354	84725354	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84725354delT								SLITRK1 (268826 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85655211	85655211	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85655211delA								None (None upstream) : SLITRK6 (711711 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	87570489	87570489	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87570489delA								None (None upstream) : SLITRK5 (754381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	87863060	87863060	+	IGR	DEL	T	-	-	rs144269906	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87863060delT								None (None upstream) : SLITRK5 (461810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	88049618	88049618	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88049618delA								None (None upstream) : SLITRK5 (275252 downstream)																																			---	---	---	---
SLITRK5	26050	broad.mit.edu	37	13	88327211	88327212	+	Intron	INS	-	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88327211_88327212insG	uc001vln.2	+						SLITRK5_uc010tic.1_Intron	NM_015567	NP_056382			SLIT and NTRK-like family, member 5 precursor							integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	88924045	88924046	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88924045_88924046delGT								SLITRK5 (592177 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	88963687	88963690	+	IGR	DEL	CATC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88963687_88963690delCATC								SLITRK5 (631819 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	89184899	89184899	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89184899delA								SLITRK5 (853031 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	90259508	90259508	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:90259508delC								None (None upstream) : MIR622 (623928 downstream)																																			---	---	---	---
GPC5	2262	broad.mit.edu	37	13	92414564	92414564	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92414564delT	uc010tif.1	+							NM_004466	NP_004457			glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
GPC6	10082	broad.mit.edu	37	13	94061092	94061092	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94061092delA	uc001vlt.2	+						GPC6_uc010tig.1_Intron	NM_005708	NP_005699			glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)																---	---	---	---
Unknown	0	broad.mit.edu	37	13	95561836	95561836	+	Intron	DEL	T	-	-	rs34919417		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95561836delT	uc001vmc.2	+											Homo sapiens, clone IMAGE:5728875, mRNA.																														---	---	---	---
DNAJC3	5611	broad.mit.edu	37	13	96341182	96341183	+	Intron	DEL	GT	-	-	rs34039008		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96341182_96341183delGT	uc001vmq.2	+						DNAJC3_uc001vmp.2_Intron|DNAJC3_uc001vmr.2_Intron	NM_006260	NP_006251			DnaJ (Hsp40) homolog, subfamily C, member 3						protein folding|response to unfolded protein|response to virus		heat shock protein binding|protein kinase inhibitor activity|unfolded protein binding				0	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	97630484	97630484	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97630484delA								HS6ST3 (138673 upstream) : OXGR1 (7489 downstream)																																			---	---	---	---
FARP1	10160	broad.mit.edu	37	13	98930547	98930548	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98930547_98930548delTG	uc001vnj.2	+						FARP1_uc001vnh.2_Intron	NM_005766	NP_005757			FERM, RhoGEF, and pleckstrin domain protein 1						regulation of Rho protein signal transduction	cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)															---	---	---	---
STK24	8428	broad.mit.edu	37	13	99230992	99230993	+	5'Flank	INS	-	AAT	AAT	rs138611727	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99230992_99230993insAAT	uc001vnn.1	-						STK24_uc010tim.1_5'Flank	NM_001032296	NP_001027467			serine/threonine kinase 24 isoform b						cellular component disassembly involved in apoptosis|signal transduction	cytosol|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)|lung(1)	2	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	99432141	99432142	+	IGR	DEL	TG	-	-	rs35900391		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99432141_99432142delTG								SLC15A1 (27212 upstream) : DOCK9 (13599 downstream)																																			---	---	---	---
DOCK9	23348	broad.mit.edu	37	13	99664511	99664511	+	Intron	DEL	A	-	-	rs34279668		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99664511delA	uc001vnt.2	-						DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tit.1_Intron	NM_015296	NP_056111			dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
UBAC2	337867	broad.mit.edu	37	13	99868336	99868337	+	Intron	INS	-	TG	TG	rs7491404		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99868336_99868337insTG	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_001144072	NP_001137544			UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	100079460	100079461	+	IGR	INS	-	G	G	rs138965787	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100079460_100079461insG								UBAC2 (40709 upstream) : TM9SF2 (74267 downstream)																																			---	---	---	---
PCCA	5095	broad.mit.edu	37	13	101095704	101095704	+	Intron	DEL	A	-	-	rs75144360		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101095704delA	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron|PCCA_uc001vop.2_Intron	NM_000282	NP_000273			propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	101689280	101689280	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101689280delA								TMTC4 (362177 upstream) : NALCN (16850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	105058064	105058064	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105058064delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	105301112	105301112	+	IGR	DEL	C	-	-	rs78652651		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105301112delC								None (None upstream) : DAOA (817104 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	105575924	105575924	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105575924delA								None (None upstream) : DAOA (542292 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	105630200	105630200	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105630200delT								None (None upstream) : DAOA (488016 downstream)																																			---	---	---	---
DAOA	267012	broad.mit.edu	37	13	106132877	106132880	+	Intron	DEL	ATAG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106132877_106132880delATAG	uc001vqb.2	+						DAOA_uc010tjf.1_Intron|DAOA_uc001vpz.2_Intron|DAOA_uc010agd.2_Intron|DAOA_uc010tjg.1_Intron|DAOA_uc001vqc.2_Intron|DAOA_uc001vqe.2_Intron	NM_172370	NP_758958			D-amino acid oxidase activator isoform 1							Golgi apparatus					0	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	106489587	106489603	+	IGR	DEL	TTTTTTTTTTTTTTTTT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106489587_106489603delTTTTTTTTTTTTTTTTT								DAOA (346205 upstream) : EFNB2 (652495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	106643373	106643374	+	IGR	INS	-	TTGCA	TTGCA	rs59572153		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106643373_106643374insTTGCA								DAOA (499991 upstream) : EFNB2 (498724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	107127198	107127201	+	IGR	DEL	GTGT	-	-	rs66781704		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107127198_107127201delGTGT								DAOA (983816 upstream) : EFNB2 (14897 downstream)																																			---	---	---	---
EFNB2	1948	broad.mit.edu	37	13	107175033	107175034	+	Intron	INS	-	T	T	rs149519763	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107175033_107175034insT	uc001vqi.2	-							NM_004093	NP_004084			ephrin B2 precursor						cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)																	---	---	---	---
FAM155A	728215	broad.mit.edu	37	13	108002088	108002088	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108002088delA	uc001vql.2	-							NM_001080396	NP_001073865			family with sequence similarity 155, member A							integral to membrane	binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	108797882	108797883	+	IGR	DEL	AA	-	-	rs145874620		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108797882_108797883delAA								FAM155A (278422 upstream) : LIG4 (61911 downstream)																																			---	---	---	---
MYO16	23026	broad.mit.edu	37	13	109464647	109464647	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109464647delT	uc001vqt.1	+						MYO16_uc010agk.1_Intron|MYO16_uc001vqu.1_Intron	NM_015011	NP_055826			myosin heavy chain Myr 8						cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	109992881	109992881	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109992881delT								MYO16 (132526 upstream) : IRS2 (413305 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	110139281	110139281	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110139281delA								MYO16 (278926 upstream) : IRS2 (266905 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	110310142	110310143	+	IGR	INS	-	T	T	rs138971045	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110310142_110310143insT								MYO16 (449787 upstream) : IRS2 (96043 downstream)																																			---	---	---	---
COL4A2	1284	broad.mit.edu	37	13	111162964	111162965	+	Intron	DEL	TG	-	-	rs35675138		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111162964_111162965delTG	uc001vqx.2	+							NM_001846	NP_001837			alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	112882186	112882186	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112882186delG								SOX1 (156166 upstream) : C13orf28 (148483 downstream)																																			---	---	---	---
CUL4A	8451	broad.mit.edu	37	13	113900042	113900042	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113900042delT	uc010tjy.1	+						CUL4A_uc010tjx.1_Intron|CUL4A_uc010agu.2_Intron|CUL4A_uc010tjz.1_Intron	NM_001008895	NP_001008895			cullin 4A isoform 1						cell cycle arrest|DNA repair|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex	ubiquitin protein ligase binding			central_nervous_system(2)|skin(1)	3	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)															---	---	---	---
GRTP1	79774	broad.mit.edu	37	13	114006412	114006413	+	Intron	INS	-	T	T	rs35506468		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114006412_114006413insT	uc001vtn.2	-						GRTP1_uc010tkb.1_Intron|GRTP1_uc010tkc.1_Intron|GRTP1_uc010agv.1_Intron	NM_024719	NP_078995			growth hormone regulated TBC protein 1							intracellular	Rab GTPase activator activity				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)															---	---	---	---
DCUN1D2	55208	broad.mit.edu	37	13	114111202	114111203	+	3'UTR	INS	-	TATT	TATT	rs150449105	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114111202_114111203insTATT	uc001vtr.1	-	7					DCUN1D2_uc001vts.1_RNA|DCUN1D2_uc010agw.1_3'UTR	NM_001014283	NP_001014305			DCN1, defective in cullin neddylation 1, domain												0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.029)|GBM - Glioblastoma multiforme(44;0.234)															---	---	---	---
FAM70B	348013	broad.mit.edu	37	13	114489621	114489629	+	Intron	DEL	TCGTTACCC	-	-	rs61966730	by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114489621_114489629delTCGTTACCC	uc001vuh.2	+							NM_182614	NP_872420			family with sequence similarity 70, member B							integral to membrane					0	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.123)|all_epithelial(44;0.133)	all cancers(43;0.181)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	115038552	115038553	+	IGR	INS	-	GTTT	GTTT	rs144087135	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115038552_115038553insGTTT								CDC16 (402 upstream) : UPF3A (8525 downstream)																																			---	---	---	---
UPF3A	65110	broad.mit.edu	37	13	115062698	115062698	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115062698delT	uc001vup.2	+						UPF3A_uc001vuq.2_Intron|UPF3A_uc001vus.2_Intron|UPF3A_uc001vur.2_Intron|UPF3A_uc001vut.2_Intron|UPF3A_uc001vuu.2_Intron	NM_023011	NP_075387			UPF3 regulator of nonsense transcripts homolog A						mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation	cytoplasm|nucleus|plasma membrane	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			skin(1)	1	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	19067417	19067417	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19067417delC								None (None upstream) : OR11H12 (310177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19347241	19347241	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19347241delA								None (None upstream) : OR11H12 (30353 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19431583	19431583	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19431583delC								OR11H12 (53011 upstream) : POTEG (121782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19795722	19795723	+	IGR	DEL	AA	-	-	rs66743629		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19795722_19795723delAA								POTEG (210780 upstream) : P704P (188231 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20416180	20416180	+	IGR	DEL	A	-	-	rs78214322		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20416180delA								OR4K1 (11419 upstream) : OR4K15 (27498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20421348	20421349	+	IGR	INS	-	C	C	rs145206484	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20421348_20421349insC								OR4K1 (16587 upstream) : OR4K15 (22329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	20934319	20934319	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20934319delA								TMEM55B (4682 upstream) : PNP (3223 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	22536761	22536762	+	Intron	INS	-	GT	GT	rs147473765	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22536761_22536762insGT	uc001wbw.2	+						uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wcy.2_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																														---	---	---	---
SLC7A7	9056	broad.mit.edu	37	14	23271119	23271119	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23271119delG	uc001wgr.3	-						SLC7A7_uc001wgs.3_Intron|SLC7A7_uc001wgt.3_Intron|SLC7A7_uc001wgu.3_Intron|SLC7A7_uc001wgv.3_Intron	NM_003982	NP_003973			solute carrier family 7 member 7						blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	basolateral plasma membrane|integral to plasma membrane	amino acid transmembrane transporter activity			ovary(1)|breast(1)	2	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.00741)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	23666989	23666990	+	IGR	DEL	TT	-	-	rs71425067		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23666989_23666990delTT								SLC7A8 (14140 upstream) : HOMEZ (75854 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	24199147	24199147	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24199147delC								DHRS2 (84301 upstream) : C14orf165 (192312 downstream)																																			---	---	---	---
IRF9	10379	broad.mit.edu	37	14	24632007	24632007	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24632007delA	uc001wmq.2	+						RNF31_uc001wmp.2_Intron|IRF9_uc010alj.2_5'Flank	NM_006084	NP_006075			interferon-stimulated transcription factor 3,						interferon-gamma-mediated signaling pathway|response to virus|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|nucleoplasm	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00853)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	25706606	25706607	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25706606_25706607delCA								STXBP6 (187435 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	26112275	26112276	+	IGR	INS	-	AA	AA	rs140404351	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26112275_26112276insAA								STXBP6 (593104 upstream) : NOVA1 (802814 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	27729877	27729877	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27729877delA								NOVA1 (662917 upstream) : None (None downstream)																																			---	---	---	---
STRN3	29966	broad.mit.edu	37	14	31482100	31482101	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31482100_31482101insA	uc001wqu.2	-						STRN3_uc001wqv.2_Intron|STRN3_uc010tpj.1_Intron	NM_001083893	NP_001077362			nuclear autoantigen isoform 1						negative regulation of estrogen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus	cytoplasm|dendrite|Golgi apparatus|neuronal cell body|nucleoplasm|nucleus|plasma membrane|protein complex	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)														---	---	---	---
ARHGAP5	394	broad.mit.edu	37	14	32585200	32585200	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32585200delA	uc001wrl.2	+						ARHGAP5_uc001wrm.2_Intron|ARHGAP5_uc001wrn.2_Intron|ARHGAP5_uc001wro.2_Intron|ARHGAP5_uc001wrp.2_Intron	NM_001173	NP_001025226			Rho GTPase activating protein 5 isoform b						cell adhesion|Rho protein signal transduction	cytosol|membrane	GTP binding|GTPase activity|Rho GTPase activator activity|SH2 domain binding			ovary(4)|central_nervous_system(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	32930252	32930252	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32930252delA	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	33201464	33201465	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33201464_33201465delTG	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
NPAS3	64067	broad.mit.edu	37	14	33577401	33577402	+	Intron	INS	-	T	T	rs11383445		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33577401_33577402insT	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron	NM_173159	NP_071406			neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	34649555	34649558	+	IGR	DEL	AAAT	-	-	rs10565623		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34649555_34649558delAAAT								EGLN3 (229268 upstream) : C14orf147 (252587 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	36396768	36396768	+	IGR	DEL	T	-	-	rs147839178		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36396768delT								BRMS1L (55600 upstream) : MBIP (370996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	39043795	39043795	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39043795delC								CLEC14A (318221 upstream) : SEC23A (457328 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	40567345	40567345	+	IGR	DEL	A	-	-	rs5808063		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40567345delA								FBXO33 (665641 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	44063404	44063404	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:44063404delT								None (None upstream) : FSCB (909951 downstream)																																			---	---	---	---
MDGA2	161357	broad.mit.edu	37	14	47758508	47758511	+	Intron	DEL	ACAC	-	-	rs34267015		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47758508_47758511delACAC	uc001wwj.3	-						MDGA2_uc001wwi.3_Intron|MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970			MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6																		---	---	---	---
MDGA2	161357	broad.mit.edu	37	14	47858810	47858811	+	Intron	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47858810_47858811delCA	uc001wwj.3	-						MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970			MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	50029347	50029348	+	IGR	DEL	GT	-	-	rs71420139	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50029347_50029348delGT								None (None upstream) : SDCCAG1 (3679 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	51795446	51795446	+	IGR	DEL	A	-	-	rs113753363		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51795446delA								TMX1 (71076 upstream) : FRMD6 (160409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	52715051	52715051	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52715051delC								NID2 (179105 upstream) : PTGDR (19380 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	53946706	53946706	+	IGR	DEL	T	-	-	rs35737380		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53946706delT								DDHD1 (326660 upstream) : BMP4 (469751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	54322779	54322782	+	IGR	DEL	GAAG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54322779_54322782delGAAG								DDHD1 (702733 upstream) : BMP4 (93675 downstream)																																			---	---	---	---
SAMD4A	23034	broad.mit.edu	37	14	55034376	55034376	+	5'Flank	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55034376delT	uc001xbb.2	+						SAMD4A_uc001xba.2_5'Flank|SAMD4A_uc001xbc.2_5'Flank	NM_015589	NP_056404			sterile alpha motif domain containing 4 isoform						positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0																		---	---	---	---
GCH1	2643	broad.mit.edu	37	14	55350725	55350725	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55350725delC	uc001xbh.1	-						GCH1_uc001xbi.1_Intron|GCH1_uc001xbj.1_Intron|GCH1_uc001xbk.1_Intron|GCH1_uc010aol.1_Intron|GCH1_uc001xbl.1_Intron	NM_001024024	NP_001019195			GTP cyclohydrolase 1 isoform 1						dopamine biosynthetic process|GTP catabolic process|neuromuscular process controlling posture|nitric oxide biosynthetic process|positive regulation of nitric-oxide synthase activity|protein homooligomerization|response to interferon-gamma|response to lipopolysaccharide|response to pain|response to tumor necrosis factor|tetrahydrobiopterin biosynthetic process|tetrahydrofolate biosynthetic process	cytoplasmic vesicle|cytosol|nuclear membrane|protein complex	GTP binding|GTP cyclohydrolase I activity|protein homodimerization activity|zinc ion binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	56453034	56453035	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56453034_56453035insA								C14orf34 (189642 upstream) : PELI2 (132058 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	57191635	57191636	+	IGR	INS	-	A	A	rs72531405	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57191635_57191636insA								C14orf101 (75405 upstream) : OTX2 (75791 downstream)																																			---	---	---	---
C14orf37	145407	broad.mit.edu	37	14	58626001	58626001	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58626001delC	uc010tro.1	-							NM_001001872	NP_001001872			hypothetical protein LOC145407 precursor							integral to membrane	binding				0																		---	---	---	---
TIMM9	26520	broad.mit.edu	37	14	58878868	58878869	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58878868_58878869insT	uc010aph.2	-						TIMM9_uc001xds.2_Intron|TIMM9_uc010api.2_Intron	NM_012460	NP_036592			translocase of inner mitochondrial membrane 9						protein import into mitochondrial inner membrane|sensory perception of sound|transmembrane transport	mitochondrial inner membrane presequence translocase complex|mitochondrial intermembrane space protein transporter complex	zinc ion binding				0																		---	---	---	---
C14orf135	64430	broad.mit.edu	37	14	60626366	60626367	+	Intron	INS	-	AAGA	AAGA	rs150959748	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60626366_60626367insAAGA	uc001xeq.2	+						DHRS7_uc001xes.2_Intron|DHRS7_uc001xet.2_Intron|DHRS7_uc001xeu.2_Intron	NM_022495	NP_071940			hepatitis C virus F protein-binding protein 2							integral to membrane				ovary(2)	2		Myeloproliferative disorder(585;0.163)		OV - Ovarian serous cystadenocarcinoma(108;0.127)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	60829376	60829377	+	IGR	INS	-	A	A	rs149058801	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60829376_60829377insA								PPM1A (63573 upstream) : C14orf39 (73298 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	64309182	64309182	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64309182delT								SGPP1 (114426 upstream) : SYNE2 (10501 downstream)																																			---	---	---	---
C14orf50	145376	broad.mit.edu	37	14	65022566	65022567	+	Intron	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65022566_65022567delCT	uc001xhl.1	+							NM_172365	NP_758953			hypothetical protein LOC145376											skin(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00382)|all cancers(60;0.00427)|BRCA - Breast invasive adenocarcinoma(234;0.0488)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	66717555	66717555	+	IGR	DEL	A	-	-	rs78148858		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66717555delA								FUT8 (507594 upstream) : C14orf53 (235554 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	69483453	69483454	+	IGR	INS	-	T	T	rs149710582	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69483453_69483454insT								ACTN1 (37370 upstream) : DCAF5 (34184 downstream)																																			---	---	---	---
GALNTL1	57452	broad.mit.edu	37	14	69800666	69800667	+	Intron	INS	-	GCTGGGA	GCTGGGA	rs144003189	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69800666_69800667insGCTGGGA	uc010aqu.1	+						GALNTL1_uc001xla.1_Intron|GALNTL1_uc001xlb.1_Intron	NM_020692	NP_065743			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)														---	---	---	---
SLC39A9	55334	broad.mit.edu	37	14	69916563	69916564	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69916563_69916564delTG	uc001xle.2	+						SLC39A9_uc010aqx.2_Intron|SLC39A9_uc001xlf.3_Intron|SLC39A9_uc001xlg.3_Intron	NM_018375	NP_060845			solute carrier family 39 (zinc transporter),						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity				0				all cancers(60;0.00299)|BRCA - Breast invasive adenocarcinoma(234;0.0145)|OV - Ovarian serous cystadenocarcinoma(108;0.0373)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	70759881	70759882	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70759881_70759882delTG								ADAM21P1 (45363 upstream) : COX16 (31917 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	71311230	71311231	+	IGR	DEL	TG	-	-	rs151138464		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71311230_71311231delTG								MAP3K9 (35342 upstream) : PCNX (62891 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	71789214	71789214	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71789214delA								PCNX (207115 upstream) : SNORD56B (75840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	72365003	72365005	+	IGR	DEL	CTC	-	-	rs34777256		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72365003_72365005delCTC								SIPA1L1 (158885 upstream) : RGS6 (34151 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	73077323	73077323	+	RNA	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73077323delG	uc010arh.1	-	1		c.2481delC								Homo sapiens cDNA FLJ14079 fis, clone HEMBB1002134, weakly similar to ZINC-FINGER PROTEIN NEURO-D4.																														---	---	---	---
DPF3	8110	broad.mit.edu	37	14	73346412	73346412	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73346412delC	uc001xnc.2	-						DPF3_uc001xnf.2_Intron|DPF3_uc010ari.1_Intron|DPF3_uc010ttq.1_Intron	NM_012074	NP_036206			D4, zinc and double PHD fingers, family 3						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	75708026	75708026	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75708026delT								TMED10 (64677 upstream) : FOS (37455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	76025541	76025542	+	IGR	INS	-	TCC	TCC	rs146332207	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76025541_76025542insTCC								BATF (12214 upstream) : FLVCR2 (19398 downstream)																																			---	---	---	---
C14orf118	55668	broad.mit.edu	37	14	76668880	76668881	+	3'UTR	DEL	AC	-	-	rs113017104		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76668880_76668881delAC	uc001xsh.2	+	10					C14orf118_uc001xsi.2_3'UTR|C14orf118_uc001xsl.2_RNA|C14orf118_uc001xsn.1_RNA	NM_017926	NP_060396			hypothetical protein LOC55668 isoform 1											ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.0172)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	76678744	76678745	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76678744_76678745insA								C14orf118 (9611 upstream) : ESRRB (158945 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	77208956	77208957	+	IGR	DEL	AA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77208956_77208957delAA								ESRRB (240778 upstream) : VASH1 (19278 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	77431075	77431075	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77431075delA								C14orf166B (94430 upstream) : C14orf4 (59813 downstream)																																			---	---	---	---
ADCK1	57143	broad.mit.edu	37	14	78288389	78288389	+	Intron	DEL	G	-	-	rs145040372		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78288389delG	uc001xui.2	+						ADCK1_uc010tvo.1_Intron|ADCK1_uc001xuj.2_Intron	NM_020421	NP_065154			aarF domain containing kinase 1 isoform a							extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79699752	79699752	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79699752delC	uc001xun.2	+						NRXN3_uc001xum.1_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	80704418	80704419	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80704418_80704419insA	uc001xuw.1	+											Homo sapiens, clone IMAGE:5167652, mRNA.																														---	---	---	---
TSHR	7253	broad.mit.edu	37	14	81593887	81593887	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81593887delC	uc001xvd.1	+							NM_000369	NP_000360			thyroid stimulating hormone receptor isoform 1						cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						---	---	---	---
Unknown	0	broad.mit.edu	37	14	82642306	82642306	+	IGR	DEL	T	-	-	rs113710222		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82642306delT								SEL1L (642101 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85794450	85794450	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85794450delT								None (None upstream) : FLRT2 (202038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	90888441	90888441	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90888441delT								CALM1 (13831 upstream) : TTC7B (118492 downstream)																																			---	---	---	---
CATSPERB	79820	broad.mit.edu	37	14	92141431	92141431	+	Intron	DEL	A	-	-	rs34613565		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92141431delA	uc001xzs.1	-							NM_024764	NP_079040			cation channel, sperm-associated, beta						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)																---	---	---	---
ATXN3	4287	broad.mit.edu	37	14	92543284	92543284	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92543284delA	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron	NM_004993	NP_004984			ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)														---	---	---	---
SLC24A4	123041	broad.mit.edu	37	14	92911248	92911249	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92911248_92911249delAC	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron|SLC24A4_uc010auj.2_Intron|SLC24A4_uc010twn.1_Intron	NM_153646	NP_705932			solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	93229168	93229168	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93229168delA								LGMN (14156 upstream) : GOLGA5 (31482 downstream)																																			---	---	---	---
SERPINA11	256394	broad.mit.edu	37	14	94914101	94914101	+	Intron	DEL	T	-	-	rs35100186		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94914101delT	uc001ydd.1	-							NM_001080451	NP_001073920			serpin peptidase inhibitor, clade A (alpha-1						regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			kidney(1)	1				COAD - Colon adenocarcinoma(157;0.211)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	95131270	95131271	+	IGR	INS	-	TG	TG	rs145906975	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95131270_95131271insTG								SERPINA13 (17940 upstream) : GSC (103290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	95841286	95841287	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95841286_95841287insT								CLMN (55041 upstream) : C14orf139 (32319 downstream)																																			---	---	---	---
C14orf132	56967	broad.mit.edu	37	14	96545815	96545816	+	Intron	DEL	TG	-	-	rs147080298		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96545815_96545816delTG	uc001yff.3	+							NR_023938				Homo sapiens clone 25027 mRNA sequence.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	97532348	97532350	+	IGR	DEL	CTT	-	-	rs12891049		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97532348_97532350delCTT								VRK1 (184398 upstream) : C14orf64 (859597 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	97704278	97704278	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97704278delC								VRK1 (356328 upstream) : C14orf64 (687669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99133646	99133649	+	IGR	DEL	TTCT	-	-	rs139153769	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99133646_99133649delTTCT								C14orf64 (689185 upstream) : C14orf177 (44301 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99270688	99270689	+	IGR	INS	-	G	G	rs150220230	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99270688_99270689insG								C14orf177 (86591 upstream) : BCL11B (364938 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99353143	99353143	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99353143delG								C14orf177 (169046 upstream) : BCL11B (282484 downstream)																																			---	---	---	---
EML1	2009	broad.mit.edu	37	14	100359598	100359599	+	Intron	INS	-	A	A	rs138939988	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100359598_100359599insA	uc001ygs.2	+						EML1_uc010avt.1_Intron|EML1_uc010tww.1_Intron|EML1_uc001ygq.2_Intron|EML1_uc001ygr.2_Intron	NM_004434	NP_004425			echinoderm microtubule associated protein like 1							cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	100996667	100996668	+	IGR	INS	-	C	C	rs147084528	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100996667_100996668insC								WDR25 (29 upstream) : BEGAIN (6818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	101109245	101109245	+	IGR	DEL	A	-	-	rs111446774		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101109245delA								BEGAIN (73114 upstream) : C14orf70 (14360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	101584278	101584279	+	IGR	INS	-	TCCA	TCCA			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101584278_101584279insTCCA								MIR656 (51140 upstream) : DIO3OS (434281 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	101741288	101741292	+	IGR	DEL	CTTTT	-	-	rs113472046		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101741288_101741292delCTTTT								MIR656 (208150 upstream) : DIO3OS (277268 downstream)																																			---	---	---	---
DIO3OS	64150	broad.mit.edu	37	14	102022042	102022043	+	Intron	INS	-	ACAC	ACAC	rs10639366		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102022042_102022043insACAC	uc001ykd.1	-						DIO3OS_uc001ykb.1_5'Flank|DIO3OS_uc001ykc.1_5'Flank					Homo sapiens uterine-derived 14 kDa protein mRNA, complete cds.												0																		---	---	---	---
WDR20	91833	broad.mit.edu	37	14	102630705	102630706	+	Intron	INS	-	C	C	rs72520879		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102630705_102630706insC	uc001ykz.2	+						WDR20_uc001yky.1_Intron|WDR20_uc001yla.2_Intron|WDR20_uc001ylb.2_Intron|WDR20_uc010txu.1_Intron|WDR20_uc001ylc.2_Intron|WDR20_uc001yld.2_Intron|WDR20_uc001yle.2_Intron|WDR20_uc001ylf.2_Intron	NM_144574	NP_653175			WD repeat domain 20 isoform 2												0																		---	---	---	---
RCOR1	23186	broad.mit.edu	37	14	103166093	103166093	+	Intron	DEL	T	-	-	rs35514078		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103166093delT	uc001ymb.2	+							NM_015156	NP_055971			REST corepressor 1						blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding			ovary(1)	1																		---	---	---	---
CDC42BPB	9578	broad.mit.edu	37	14	103451550	103451550	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103451550delC	uc001ymi.1	-							NM_006035	NP_006026			CDC42-binding protein kinase beta						actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)														---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106094606	106094607	+	Intron	INS	-	C	C	rs151095596	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106094606_106094607insC	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106964892	106964892	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106964892delG	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	107060159	107060160	+	Intron	INS	-	T	T	rs146826802	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107060159_107060160insT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20088944	20088944	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20088944delA								None (None upstream) : GOLGA6L6 (648150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20303907	20303908	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20303907_20303908insT								None (None upstream) : GOLGA6L6 (433186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20418321	20418321	+	IGR	DEL	A	-	-	rs112397049		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20418321delA								None (None upstream) : GOLGA6L6 (318773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20484321	20484323	+	IGR	DEL	AAG	-	-	rs144074107		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20484321_20484323delAAG								None (None upstream) : GOLGA6L6 (252771 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20861502	20861503	+	IGR	INS	-	TTAT	TTAT	rs147659015	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20861502_20861503insTTAT								GOLGA8C (80476 upstream) : BCL8 (8553 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22100340	22100340	+	IGR	DEL	T	-	-	rs138282930		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22100340delT								CXADRP2 (83462 upstream) : LOC727924 (177692 downstream)																																			---	---	---	---
OR4N4	283694	broad.mit.edu	37	15	22373454	22373455	+	Intron	INS	-	TC	TC	rs144129226		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22373454_22373455insTC	uc001yuc.1	+						LOC727924_uc001yub.1_Intron	NM_001005241	NP_001005241			olfactory receptor, family 4, subfamily N,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	22394826	22394827	+	IGR	INS	-	A	A	rs142765197	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22394826_22394827insA								OR4N4 (11011 upstream) : OR4N3P (18875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22406001	22406001	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22406001delT								OR4N4 (22186 upstream) : OR4N3P (7701 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22409693	22409693	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22409693delA								OR4N4 (25878 upstream) : OR4N3P (4009 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	22572647	22572647	+	IGR	DEL	G	-	-	rs1965332		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22572647delG								MIR1268 (59367 upstream) : GOLGA8DP (129638 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	25039566	25039567	+	IGR	INS	-	AAAC	AAAC	rs140564761	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25039566_25039567insAAAC								C15orf2 (110974 upstream) : SNRPN (29227 downstream)																																			---	---	---	---
GABRB3	2562	broad.mit.edu	37	15	26873820	26873821	+	Intron	INS	-	AA	AA	rs151099008	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26873820_26873821insAA	uc001zaz.2	-						GABRB3_uc010uae.1_Intron|GABRB3_uc001zba.2_Intron|GABRB3_uc001zbb.2_Intron|GABRB3_uc001zbc.2_Intron	NM_000814	NP_000805			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	27834929	27834930	+	IGR	DEL	AC	-	-	rs144850768		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27834929_27834930delAC								GABRG3 (56795 upstream) : OCA2 (165095 downstream)																																			---	---	---	---
OCA2	4948	broad.mit.edu	37	15	28306678	28306679	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28306678_28306679insA	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266			oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)										Oculocutaneous_Albinism				---	---	---	---
Unknown	0	broad.mit.edu	37	15	28711740	28711741	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28711740_28711741delTG								GOLGA8G (74569 upstream) : WHAMML2 (270988 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	36769346	36769347	+	IGR	DEL	TG	-	-	rs72320148		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36769346_36769347delTG								ATPBD4 (930942 upstream) : C15orf41 (102465 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	37649694	37649695	+	IGR	DEL	AC	-	-	rs111696260		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37649694_37649695delAC								MEIS2 (256194 upstream) : TMCO5A (577132 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	39290189	39290189	+	IGR	DEL	C	-	-	rs5812074		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:39290189delC								C15orf53 (297950 upstream) : C15orf54 (252696 downstream)																																			---	---	---	---
BMF	90427	broad.mit.edu	37	15	40403020	40403020	+	5'Flank	DEL	C	-	-	rs36081508		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40403020delC	uc001zkw.2	-							NM_001003940	NP_001003940			Bcl2 modifying factor isoform bmf-1						activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria	cytosol|mitochondrial outer membrane|myosin complex|plasma membrane	protein binding			ovary(1)	1		all_cancers(109;4.18e-18)|all_epithelial(112;6.15e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0516)														---	---	---	---
PLA2G4E	123745	broad.mit.edu	37	15	42301269	42301269	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42301269delC	uc001zow.1	-							NM_001080490	NP_001073959			phospholipase A2, group 4E						phospholipid catabolic process	cytosol|lysosomal membrane	metal ion binding|phospholipase A2 activity				0		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	45081064	45081065	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45081064_45081065delAC								TRIM69 (21039 upstream) : C15orf43 (167838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	46167248	46167249	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46167248_46167249insA								SQRDL (183770 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	46588767	46588767	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46588767delC								SQRDL (605289 upstream) : SEMA6D (887636 downstream)																																			---	---	---	---
SEMA6D	80031	broad.mit.edu	37	15	47904059	47904059	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47904059delC	uc001zvw.2	+							NM_020858	NP_065909			semaphorin 6D isoform 1 precursor						axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---
FBN1	2200	broad.mit.edu	37	15	48916165	48916166	+	Intron	INS	-	AC	AC	rs139147539	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48916165_48916166insAC	uc001zwx.1	-							NM_000138	NP_000129			fibrillin 1 precursor						heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)														---	---	---	---
USP8	9101	broad.mit.edu	37	15	50721964	50721965	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50721964_50721965insT	uc001zym.3	+						USP8_uc001zyk.1_Intron|USP8_uc001zyl.3_Intron|USP8_uc001zyn.3_Intron|USP8_uc010ufh.1_Intron	NM_001128611	NP_001122083			ubiquitin specific peptidase 8						cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)														---	---	---	---
USP8	9101	broad.mit.edu	37	15	50779324	50779324	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50779324delA	uc001zym.3	+						USP8_uc001zyl.3_Intron|USP8_uc001zyn.3_Intron|USP8_uc010ufh.1_Intron	NM_001128611	NP_001122083			ubiquitin specific peptidase 8						cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	51730215	51730215	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51730215delT								GLDN (30008 upstream) : DMXL2 (9725 downstream)																																			---	---	---	---
MYO5A	4644	broad.mit.edu	37	15	52787690	52787690	+	Intron	DEL	A	-	-	rs35101302		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52787690delA	uc002aby.2	-						MYO5A_uc002abx.3_Intron|MYO5A_uc010uge.1_Intron	NM_000259	NP_000250			myosin VA isoform 1						actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)														---	---	---	---
MYO5A	4644	broad.mit.edu	37	15	52815441	52815448	+	Intron	DEL	CTTCACCA	-	-	rs11276886		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52815441_52815448delCTTCACCA	uc002aby.2	-						MYO5A_uc002abx.3_Intron|MYO5A_uc010uge.1_Intron	NM_000259	NP_000250			myosin VA isoform 1						actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	53579160	53579160	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53579160delA								ONECUT1 (496951 upstream) : WDR72 (226778 downstream)																																			---	---	---	---
UNC13C	440279	broad.mit.edu	37	15	54405283	54405284	+	Intron	INS	-	T	T	rs141765922	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54405283_54405284insT	uc002ack.2	+							NM_001080534	NP_001074003			unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	56078238	56078239	+	IGR	INS	-	AGGG	AGGG	rs113474289	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56078238_56078239insAGGG								PRTG (43061 upstream) : NEDD4 (40892 downstream)																																			---	---	---	---
NEDD4	4734	broad.mit.edu	37	15	56203234	56203235	+	Intron	INS	-	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56203234_56203235insC	uc002adj.2	-						NEDD4_uc002adl.2_Intron|NEDD4_uc002adi.2_Intron|NEDD4_uc010ugj.1_Intron|NEDD4_uc010bfm.2_Intron|NEDD4_uc002adk.2_Intron	NM_198400	NP_006145			neural precursor cell expressed, developmentally						development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	56327014	56327015	+	IGR	INS	-	T	T	rs146711695	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56327014_56327015insT								NEDD4 (41179 upstream) : RFX7 (52464 downstream)																																			---	---	---	---
ZNF280D	54816	broad.mit.edu	37	15	56922728	56922728	+	3'UTR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56922728delA	uc002adu.2	-	22					uc002ads.2_5'Flank|ZNF280D_uc002adv.2_3'UTR|ZNF280D_uc010bfq.2_3'UTR|ZNF280D_uc002adt.2_3'UTR|ZNF280D_uc010bfp.2_RNA	NM_017661	NP_060131			suppressor of hairy wing homolog 4 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)														---	---	---	---
RNF111	54778	broad.mit.edu	37	15	59325089	59325090	+	Intron	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59325089_59325090delCT	uc002afv.2	+						RNF111_uc002afs.2_Intron|RNF111_uc002aft.2_Intron|RNF111_uc002afu.2_Intron|RNF111_uc002afw.2_Intron	NM_017610	NP_060080			ring finger protein 111						multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)														---	---	---	---
MYO1E	4643	broad.mit.edu	37	15	59632671	59632671	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59632671delG	uc002aga.2	-							NM_004998	NP_004989			myosin IE						actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	59988011	59988012	+	IGR	INS	-	A	A	rs28518783		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59988011_59988012insA								BNIP2 (6369 upstream) : FOXB1 (308409 downstream)																																			---	---	---	---
RORA	6095	broad.mit.edu	37	15	61015576	61015577	+	Intron	INS	-	C	C	rs147824435	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61015576_61015577insC	uc002agx.2	-							NM_134261	NP_599023			RAR-related orphan receptor A isoform a						positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	61690652	61690654	+	IGR	DEL	GAA	-	-	rs67811320		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:61690652_61690654delGAA								RORA (169150 upstream) : VPS13C (453938 downstream)																																			---	---	---	---
HERC1	8925	broad.mit.edu	37	15	64063636	64063637	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64063636_64063637insT	uc002amp.2	-						HERC1_uc010uil.1_Intron|HERC1_uc010bgt.1_Intron	NM_003922	NP_003913			hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19																		---	---	---	---
HERC1	8925	broad.mit.edu	37	15	64078476	64078477	+	Intron	DEL	AA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64078476_64078477delAA	uc002amp.2	-						HERC1_uc010uil.1_Intron|HERC1_uc010bgt.1_Intron|HERC1_uc002amq.1_Intron	NM_003922	NP_003913			hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19																		---	---	---	---
HERC1	8925	broad.mit.edu	37	15	64094356	64094357	+	Intron	DEL	CA	-	-	rs34063656		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64094356_64094357delCA	uc002amp.2	-						HERC1_uc010uil.1_Intron|HERC1_uc010bgt.1_Intron|HERC1_uc002amq.1_Intron	NM_003922	NP_003913			hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19																		---	---	---	---
PARP16	54956	broad.mit.edu	37	15	65569011	65569012	+	Intron	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65569011_65569012delTT	uc002aoo.2	-						PARP16_uc002aop.2_Intron|PARP16_uc002aoq.2_Intron	NM_017851	NP_060321			poly (ADP-ribose) polymerase family, member 16							integral to membrane	NAD+ ADP-ribosyltransferase activity			lung(2)	2																		---	---	---	---
MEGF11	84465	broad.mit.edu	37	15	66241409	66241414	+	Intron	DEL	ACAATT	-	-	rs144371153		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66241409_66241414delACAATT	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821			multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	67221344	67221345	+	IGR	INS	-	AAGAGAGAAAGAA	AAGAGAGAAAGAA	rs72391344		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67221344_67221345insAAGAGAGAAAGAA								SMAD6 (147009 upstream) : SMAD3 (136850 downstream)																																			---	---	---	---
CORO2B	10391	broad.mit.edu	37	15	68932851	68932851	+	Intron	DEL	A	-	-	rs34183929		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68932851delA	uc002arj.3	+						CORO2B_uc010bic.2_Intron	NM_006091	NP_006082			coronin, actin binding protein, 2B						actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|skin(2)|large_intestine(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	69132012	69132013	+	IGR	DEL	AG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69132012_69132013delAG								ANP32A (18751 upstream) : NOX5 (90851 downstream)																																			---	---	---	---
GLCE	26035	broad.mit.edu	37	15	69531536	69531537	+	Intron	INS	-	TGT	TGT	rs139705444	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69531536_69531537insTGT	uc002ary.1	+							NM_015554	NP_056369			D-glucuronyl C5-epimerase						heparan sulfate proteoglycan biosynthetic process|heparin biosynthetic process	Golgi membrane|integral to membrane	UDP-glucuronate 5'-epimerase activity			ovary(2)	2																		---	---	---	---
GLCE	26035	broad.mit.edu	37	15	69563174	69563174	+	3'UTR	DEL	A	-	-	rs57502520		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69563174delA	uc002ary.1	+	5						NM_015554	NP_056369			D-glucuronyl C5-epimerase						heparan sulfate proteoglycan biosynthetic process|heparin biosynthetic process	Golgi membrane|integral to membrane	UDP-glucuronate 5'-epimerase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	70301156	70301156	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70301156delC								C15orf50 (165851 upstream) : TLE3 (39387 downstream)																																			---	---	---	---
MYO9A	4649	broad.mit.edu	37	15	72239625	72239625	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72239625delA	uc002atl.3	-						MYO9A_uc010biq.2_Intron|MYO9A_uc002atn.1_Intron	NM_006901	NP_008832			myosin IXA						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
NEO1	4756	broad.mit.edu	37	15	73544803	73544803	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73544803delG	uc002avm.3	+						NEO1_uc010ukx.1_Intron|NEO1_uc010uky.1_Intron|NEO1_uc010ukz.1_Intron|NEO1_uc002avn.3_Intron	NM_002499	NP_002490			neogenin homolog 1 precursor						axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	73608929	73608931	+	IGR	DEL	AAG	-	-	rs71442381		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73608929_73608931delAAG								NEO1 (11386 upstream) : HCN4 (3270 downstream)																																			---	---	---	---
CD276	80381	broad.mit.edu	37	15	73989908	73989909	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73989908_73989909insT	uc002avv.1	+						CD276_uc010bjd.1_Intron|CD276_uc002avu.1_Intron|CD276_uc002avw.1_Intron|CD276_uc010ulb.1_Intron	NM_001024736	NP_001019907			CD276 antigen isoform a						cell proliferation|immune response|positive regulation of interferon-gamma biosynthetic process|positive regulation of T cell proliferation|regulation of immune response|T cell activation	external side of plasma membrane|integral to membrane	receptor binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	74022263	74022263	+	IGR	DEL	G	-	-	rs5813718		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74022263delG								CD276 (15404 upstream) : C15orf59 (9880 downstream)																																			---	---	---	---
SCAPER	49855	broad.mit.edu	37	15	76669734	76669734	+	Intron	DEL	T	-	-	rs34538729		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76669734delT	uc002bby.2	-						SCAPER_uc010bkr.2_Intron|SCAPER_uc002bbx.2_Intron	NM_020843	NP_065894			S-phase cyclin A-associated protein in the ER							endoplasmic reticulum|nucleus	zinc ion binding			large_intestine(1)|lung(1)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	78177871	78177876	+	IGR	DEL	ACACAT	-	-	rs145763234	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78177871_78177876delACACAT								LINGO1 (189396 upstream) : LOC645752 (28683 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	81459965	81459966	+	IGR	DEL	GG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81459965_81459966delGG								C15orf26 (18450 upstream) : IL16 (15127 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	83907991	83907992	+	IGR	INS	-	A	A	rs79287118		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83907991_83907992insA								HDGFRP3 (31670 upstream) : BNC1 (16663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	84833704	84833705	+	IGR	INS	-	G	G	rs149594480	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84833704_84833705insG								ADAMTSL3 (125113 upstream) : LOC388152 (33895 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	85355114	85355115	+	IGR	DEL	AA	-	-	rs67815229		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85355114_85355115delAA								ZNF592 (5453 upstream) : ALPK3 (4796 downstream)																																			---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	85954677	85954677	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85954677delT	uc002blv.1	+						AKAP13_uc002bls.2_Intron|AKAP13_uc002blt.1_Intron|AKAP13_uc002blu.1_Intron	NM_007200	NP_009131			A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	88123596	88123597	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:88123596_88123597insA								NCRNA00052 (679 upstream) : NTRK3 (296391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	92732135	92732135	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92732135delA								SLCO3A1 (16470 upstream) : ST8SIA2 (205005 downstream)																																			---	---	---	---
ST8SIA2	8128	broad.mit.edu	37	15	92979287	92979289	+	Intron	DEL	TCT	-	-	rs113451001		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92979287_92979289delTCT	uc002bra.2	+						ST8SIA2_uc002brb.2_Intron	NM_006011	NP_006002			ST8 alpha-N-acetyl-neuraminide						axon guidance|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity				0	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	95217769	95217770	+	IGR	INS	-	T	T	rs35072262		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95217769_95217770insT								MCTP2 (190589 upstream) : LOC145820 (758552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	95315913	95315916	+	IGR	DEL	GTGA	-	-	rs149153833		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95315913_95315916delGTGA								MCTP2 (288733 upstream) : LOC145820 (660406 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	95672982	95672982	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95672982delT								MCTP2 (645802 upstream) : LOC145820 (303340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	97635405	97635406	+	IGR	INS	-	A	A	rs147165873	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97635405_97635406insA								SPATA8 (306561 upstream) : LOC91948 (650440 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	98922460	98922460	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98922460delA								ARRDC4 (405393 upstream) : FAM169B (57931 downstream)																																			---	---	---	---
IGF1R	3480	broad.mit.edu	37	15	99281054	99281055	+	Intron	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99281054_99281055delCT	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron	NM_000875	NP_000866			insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	1073958	1073958	+	IGR	DEL	A	-	-	rs56394513		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1073958delA								SOX8 (36980 upstream) : LOC146336 (40126 downstream)																																			---	---	---	---
LOC146336	146336	broad.mit.edu	37	16	1131476	1131477	+	5'Flank	INS	-	TGTC	TGTC	rs140056529	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1131476_1131477insTGTC	uc002cko.2	-						LOC146336_uc002ckp.1_5'Flank	NR_027242				SubName: Full=cDNA FLJ32252 fis, clone PROST1000167, weakly similar to SYNAPSIN I;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	1295709	1295709	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1295709delC								TPSAB1 (3155 upstream) : TPSD1 (10564 downstream)																																			---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7706008	7706017	+	Intron	DEL	TTGTAACTAC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7706008_7706017delTTGTAACTAC	uc002cys.2	+						A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc010uyb.1_Intron|A2BP1_uc002cyw.2_Intron|A2BP1_uc002cyy.2_Intron|A2BP1_uc002cyx.2_Intron|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	9062633	9062633	+	IGR	DEL	G	-	-	rs113694950		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9062633delG								USP7 (5292 upstream) : C16orf72 (122904 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	10418311	10418312	+	IGR	INS	-	A	A	rs142014662	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10418311_10418312insA								GRIN2A (141700 upstream) : ATF7IP2 (61600 downstream)																																			---	---	---	---
RSL1D1	26156	broad.mit.edu	37	16	11946652	11946655	+	5'Flank	DEL	TTTT	-	-	rs72524948		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11946652_11946655delTTTT	uc002dbp.1	-						RSL1D1_uc010buv.1_5'Flank|RSL1D1_uc010uyw.1_5'Flank|RSL1D1_uc010buw.2_5'Flank	NM_015659	NP_056474			ribosomal L1 domain containing 1						regulation of protein localization|translation	large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	12671251	12671253	+	IGR	DEL	ACC	-	-	rs72185754		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12671251_12671253delACC								SNX29 (3106 upstream) : CPPED1 (82404 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	12926996	12926997	+	IGR	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12926996_12926997delTT								CPPED1 (29252 upstream) : SHISA9 (68480 downstream)																																			---	---	---	---
ABCC1	4363	broad.mit.edu	37	16	16061616	16061616	+	Intron	DEL	A	-	-	rs148354096		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16061616delA	uc010bvi.2	+						ABCC1_uc010bvj.2_Intron|ABCC1_uc010bvk.2_Intron|ABCC1_uc010bvl.2_Intron|ABCC1_uc010bvm.2_Intron	NM_004996	NP_004987			ATP-binding cassette, sub-family C, member 1						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	16679642	16679642	+	IGR	DEL	T	-	-	rs11343123		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16679642delT								LOC339047 (235205 upstream) : XYLT1 (516541 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	17016048	17016048	+	IGR	DEL	T	-	-	rs141472507	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17016048delT								LOC339047 (571611 upstream) : XYLT1 (180135 downstream)																																			---	---	---	---
C16orf62	57020	broad.mit.edu	37	16	19692565	19692566	+	Intron	INS	-	G	G	rs138190966	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19692565_19692566insG	uc002dgn.1	+						C16orf62_uc002dgo.1_Intron|C16orf62_uc002dgp.1_Intron	NM_020314	NP_064710			hypothetical protein LOC57020							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	20157907	20157908	+	IGR	INS	-	ACACACACACACAG	ACACACACACACAG	rs148907052	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20157907_20157908insACACACACACACAG								GPR139 (72807 upstream) : GP2 (163904 downstream)																																			---	---	---	---
EEF2K	29904	broad.mit.edu	37	16	22246675	22246676	+	Intron	INS	-	T	T	rs143317003	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22246675_22246676insT	uc002dki.2	+						EEF2K_uc002dkh.2_Intron	NM_013302	NP_037434			elongation factor-2 kinase						insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	22625094	22625094	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22625094delT								LOC653786 (36908 upstream) : HS3ST2 (200766 downstream)																																			---	---	---	---
SCNN1G	6340	broad.mit.edu	37	16	23203399	23203400	+	Intron	INS	-	A	A	rs138716791	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23203399_23203400insA	uc002dlm.1	+							NM_001039	NP_001030			sodium channel, nonvoltage-gated 1, gamma						excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
SCNN1B	6338	broad.mit.edu	37	16	23318486	23318487	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23318486_23318487insA	uc002dln.2	+							NM_000336	NP_000327			sodium channel, nonvoltage-gated 1, beta						excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	25843859	25843859	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25843859delA	uc002dof.2	+							NM_006040	NP_006031			heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	27156874	27156875	+	IGR	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27156874_27156875delGA								C16orf82 (76388 upstream) : JMJD5 (57932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	27317565	27317566	+	IGR	INS	-	CAT	CAT	rs147601229	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27317565_27317566insCAT								NSMCE1 (37452 upstream) : IL4R (7685 downstream)																																			---	---	---	---
IL21R	50615	broad.mit.edu	37	16	27432057	27432057	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27432057delT	uc002doq.1	+						IL21R_uc002dor.1_Intron	NM_181078	NP_851564			interleukin 21 receptor precursor						natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)|lung(1)|breast(1)	4								T	BCL6	NHL								---	---	---	---
Unknown	0	broad.mit.edu	37	16	28271405	28271406	+	IGR	INS	-	TGTGTG	TGTGTG	rs138931229	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28271405_28271406insTGTGTG								XPO6 (48215 upstream) : SBK1 (32434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	28619162	28619162	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28619162delT	uc010vct.1	-						SULT1A1_uc002dqi.2_Intron|SULT1A1_uc002dqj.2_Intron|SULT1A1_uc002dqk.2_Intron|SULT1A1_uc002dql.2_Intron|SULT1A1_uc002dqm.2_Intron|SULT1A1_uc002dqn.2_Intron|SULT1A1_uc002dqo.2_Intron|SULT1A1_uc002dqp.2_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																														---	---	---	---
SH2B1	25970	broad.mit.edu	37	16	28858454	28858454	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28858454delC	uc002dri.2	+						uc010vct.1_Intron|TUFM_uc002drh.2_5'Flank	NM_001145795	NP_001139267			SH2B adaptor protein 1 isoform 1						blood coagulation|intracellular signal transduction	cytosol|membrane|nucleus	signal transducer activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	31038194	31038195	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31038194_31038195insT								STX1B (16365 upstream) : STX4 (6221 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	31220532	31220532	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31220532delT								PYCARD (6281 upstream) : TRIM72 (4883 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32283183	32283183	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32283183delA								HERC2P4 (119309 upstream) : TP53TG3B (401658 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32334601	32334601	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32334601delT								HERC2P4 (170727 upstream) : TP53TG3B (350240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32520111	32520111	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32520111delT								HERC2P4 (356237 upstream) : TP53TG3B (164730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32641120	32641121	+	IGR	INS	-	TT	TT	rs143610959	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32641120_32641121insTT								HERC2P4 (477246 upstream) : TP53TG3B (43720 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32818430	32818431	+	IGR	INS	-	TCA	TCA			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32818430_32818431insTCA								TP53TG3B (129552 upstream) : SLC6A10P (70366 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32820383	32820383	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32820383delT								TP53TG3B (131505 upstream) : SLC6A10P (68414 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32827123	32827124	+	IGR	DEL	GG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32827123_32827124delGG								TP53TG3B (138245 upstream) : SLC6A10P (61673 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32841148	32841149	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32841148_32841149insA								TP53TG3B (152270 upstream) : SLC6A10P (47648 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32846715	32846715	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32846715delA								TP53TG3B (157837 upstream) : SLC6A10P (42082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33040246	33040247	+	IGR	INS	-	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33040246_33040247insG								SLC6A10P (143783 upstream) : MIR1826 (925261 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33491349	33491350	+	IGR	INS	-	T	T	rs139014807		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33491349_33491350insT								SLC6A10P (594886 upstream) : MIR1826 (474158 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33523103	33523112	+	IGR	DEL	CATTCATATT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33523103_33523112delCATTCATATT								SLC6A10P (626640 upstream) : MIR1826 (442396 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33541941	33541941	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33541941delA								SLC6A10P (645478 upstream) : MIR1826 (423567 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33621973	33621973	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33621973delT								SLC6A10P (725510 upstream) : MIR1826 (343535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33895711	33895712	+	IGR	INS	-	TGG	TGG			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33895711_33895712insTGG								SLC6A10P (999248 upstream) : MIR1826 (69796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33909537	33909537	+	IGR	DEL	A	-	-	rs143949353	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33909537delA								None (None upstream) : MIR1826 (55971 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33960725	33960725	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33960725delG								None (None upstream) : MIR1826 (4783 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33997072	33997072	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33997072delA								MIR1826 (31480 upstream) : UBE2MP1 (406730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34004863	34004864	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34004863_34004864delAC								MIR1826 (39271 upstream) : UBE2MP1 (398938 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34181283	34181284	+	IGR	INS	-	A	A	rs145390987		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34181283_34181284insA								MIR1826 (215691 upstream) : UBE2MP1 (222518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34193888	34193890	+	IGR	DEL	TGA	-	-	rs148665731		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34193888_34193890delTGA								MIR1826 (228296 upstream) : UBE2MP1 (209912 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34794016	34794016	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34794016delA								LOC146481 (79049 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46463997	46463998	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46463997_46463998insA								None (None upstream) : ANKRD26P1 (39251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	47836738	47836739	+	IGR	INS	-	GT	GT	rs141312560	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47836738_47836739insGT								PHKB (101305 upstream) : ABCC12 (280145 downstream)																																			---	---	---	---
ABCC12	94160	broad.mit.edu	37	16	48130068	48130069	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48130068_48130069insA	uc002efc.1	-						ABCC12_uc002eey.1_Intron|ABCC12_uc002eez.1_Intron|ABCC12_uc002efa.1_Intron|ABCC12_uc002efb.1_Intron|ABCC12_uc002efd.1_Intron	NM_033226	NP_150229			ATP-binding cassette protein C12							integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	48813329	48813329	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48813329delT								N4BP1 (169209 upstream) : CBLN1 (498882 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	49098430	49098431	+	IGR	DEL	TG	-	-	rs111904142		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49098430_49098431delTG								N4BP1 (454310 upstream) : CBLN1 (213780 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	50023536	50023536	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50023536delA								ZNF423 (162618 upstream) : TMEM188 (35653 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	50296171	50296172	+	IGR	INS	-	TT	TT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50296171_50296172insTT								PAPD5 (26954 upstream) : ADCY7 (4290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52761209	52761210	+	IGR	INS	-	TGCTA	TGCTA	rs145028346	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52761209_52761210insTGCTA								TOX3 (179495 upstream) : CHD9 (327735 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	54382857	54382858	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54382857_54382858insT								IRX3 (62479 upstream) : IRX5 (582253 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	54474249	54474250	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54474249_54474250insT								IRX3 (153871 upstream) : IRX5 (490861 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	55011980	55011980	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55011980delT								IRX5 (43587 upstream) : IRX6 (346491 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	55508168	55508168	+	IGR	DEL	A	-	-	rs34412814		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55508168delA								IRX6 (143497 upstream) : MMP2 (4913 downstream)																																			---	---	---	---
MMP2	4313	broad.mit.edu	37	16	55520235	55520236	+	Intron	DEL	GT	-	-	rs141630290		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55520235_55520236delGT	uc002ehz.3	+						MMP2_uc010vhd.1_Intron|MMP2_uc010ccc.2_Intron	NM_004530	NP_004521			matrix metalloproteinase 2 isoform a						angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)													---	---	---	---
LOC283856	283856	broad.mit.edu	37	16	56165583	56165583	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56165583delA	uc002eis.1	-							NR_027078				Homo sapiens hypothetical protein LOC283856, mRNA (cDNA clone IMAGE:5263025).												0																		---	---	---	---
SLC12A3	6559	broad.mit.edu	37	16	56934967	56934968	+	Intron	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56934967_56934968delCT	uc010ccm.2	+						SLC12A3_uc002ekd.3_Intron|SLC12A3_uc010ccn.2_Intron	NM_001126108	NP_001119580			solute carrier family 12, member 3 isoform 3						sodium ion transmembrane transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)													---	---	---	---
NLRC5	84166	broad.mit.edu	37	16	57064527	57064538	+	Intron	DEL	GATGGATGGATG	-	-	rs72034702		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57064527_57064538delGATGGATGGATG	uc002ekk.1	+						NLRC5_uc010ccq.1_Intron|NLRC5_uc002ekn.2_Intron|NLRC5_uc002ekl.2_Intron|NLRC5_uc002ekm.2_Intron|NLRC5_uc010ccr.1_Intron	NM_032206	NP_115582			nucleotide-binding oligomerization domains 27						defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	57908271	57908271	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57908271delA								KIFC3 (11538 upstream) : CNGB1 (7973 downstream)																																			---	---	---	---
NDRG4	65009	broad.mit.edu	37	16	58510426	58510426	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58510426delT	uc002enm.2	+						NDRG4_uc002enk.2_Intron|NDRG4_uc010vif.1_Intron	NM_001130487	NP_001123959			NDRG family member 4 isoform 2						cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	58799169	58799169	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58799169delT								GOT2 (30923 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	59355208	59355208	+	IGR	DEL	A	-	-	rs75175109		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59355208delA								GOT2 (586962 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	60023666	60023667	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60023666_60023667delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	64913741	64913744	+	IGR	DEL	GTTT	-	-	rs113751206		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64913741_64913744delGTTT								None (None upstream) : CDH11 (66941 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	66963105	66963105	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66963105delT								RRAD (3666 upstream) : FAM96B (2854 downstream)																																			---	---	---	---
NFATC3	4775	broad.mit.edu	37	16	68229001	68229002	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68229001_68229002insA	uc002evo.1	+						NFATC3_uc010vkm.1_Intron|NFATC3_uc010vkn.1_Intron|NFATC3_uc010vkp.1_Intron|NFATC3_uc010vkq.1_Intron|NFATC3_uc002evm.1_Intron|NFATC3_uc002evn.1_Intron|NFATC3_uc010vks.1_Intron|NFATC3_uc010vkt.1_Intron|NFATC3_uc010vkv.1_Intron|NFATC3_uc010vkw.1_Intron|NFATC3_uc010vky.1_Intron|NFATC3_uc010vkz.1_Intron|NFATC3_uc010vlb.1_Intron|NFATC3_uc010vlc.1_Intron	NM_173165	NP_775188			nuclear factor of activated T-cells,						inflammatory response|transcription from RNA polymerase II promoter	nucleolus|plasma membrane	DNA binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)														---	---	---	---
CLEC18C	283971	broad.mit.edu	37	16	70123382	70123382	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70123382delT	uc002exy.2	+							NM_182619	NP_872425			secretory protein LOC348174 precursor							extracellular region	sugar binding				0																		---	---	---	---
TXNL4B	54957	broad.mit.edu	37	16	72121553	72121553	+	Intron	DEL	T	-	-	rs66623261		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72121553delT	uc002fca.2	-						TXNL4B_uc010cgl.2_Intron|TXNL4B_uc010vmn.1_Intron|TXNL4B_uc010vmo.1_Intron	NM_017853	NP_060323			thioredoxin-like 4B						mitosis|mRNA processing|RNA splicing	spliceosomal complex				ovary(1)	1																		---	---	---	---
PMFBP1	83449	broad.mit.edu	37	16	72199268	72199269	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72199268_72199269insA	uc002fcc.3	-						PMFBP1_uc002fcd.2_Intron|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Intron	NM_031293	NP_112583			polyamine modulated factor 1 binding protein 1											ovary(2)	2		Ovarian(137;0.179)																---	---	---	---
ZFHX3	463	broad.mit.edu	37	16	72911266	72911274	+	Intron	DEL	TGTTGTTGG	-	-	rs71871911		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72911266_72911274delTGTTGTTGG	uc002fck.2	-						ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816			zinc finger homeobox 3 isoform A						muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	73758850	73758850	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73758850delC								HTA (631180 upstream) : PSMD7 (571831 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	76089386	76089387	+	IGR	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76089386_76089387delTC								TERF2IP (398058 upstream) : CNTNAP4 (221789 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	76627823	76627826	+	IGR	DEL	TTTT	-	-	rs5818005		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76627823_76627826delTTTT								CNTNAP4 (34688 upstream) : MON1B (597010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	77693046	77693049	+	IGR	DEL	CTTT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77693046_77693049delCTTT								ADAMTS18 (224035 upstream) : NUDT7 (63362 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	79893723	79893724	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79893723_79893724delTG								MAF (259101 upstream) : DYNLRB2 (681130 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	79919842	79919843	+	IGR	DEL	TG	-	-	rs71791864		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79919842_79919843delTG								MAF (285220 upstream) : DYNLRB2 (655011 downstream)																																			---	---	---	---
PKD1L2	114780	broad.mit.edu	37	16	81193729	81193729	+	Intron	DEL	T	-	-	rs72123864		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81193729delT	uc002fgh.1	-						PKD1L2_uc002fgg.1_Intron	NM_052892	NP_443124			polycystin 1-like 2 isoform a						neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity|sugar binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83541661	83541664	+	Intron	DEL	GAAG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83541661_83541664delGAAG	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron|hsa-mir-3182|MI0014224_5'Flank	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	83922057	83922060	+	IGR	DEL	ACAT	-	-	rs173525	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83922057_83922060delACAT								HSBP1 (75463 upstream) : MLYCD (10670 downstream)																																			---	---	---	---
OSGIN1	29948	broad.mit.edu	37	16	83984084	83984089	+	Intron	DEL	ACACAC	-	-	rs148860372		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83984084_83984089delACACAC	uc002fha.2	+						OSGIN1_uc002fhb.2_Intron|OSGIN1_uc002fhc.2_5'Flank	NM_013370	NP_037502			oxidative stress induced growth inhibitor 1						cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0																		---	---	---	---
ZDHHC7	55625	broad.mit.edu	37	16	85023668	85023668	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85023668delG	uc002fiq.2	-						ZDHHC7_uc010voi.1_Intron|ZDHHC7_uc002fir.1_Intron	NM_017740	NP_060210			zinc finger, DHHC-type containing 7 isoform 2							integral to membrane	acyltransferase activity|protein binding|zinc ion binding			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	87218600	87218603	+	Intron	DEL	TGTG	-	-	rs146093099		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87218600_87218603delTGTG	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	88278000	88278003	+	IGR	DEL	TGGA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88278000_88278003delTGGA								BANP (167077 upstream) : ZNF469 (215876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	88330349	88330352	+	IGR	DEL	ACAT	-	-	rs111781035		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88330349_88330352delACAT								BANP (219426 upstream) : ZNF469 (163527 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	88460131	88460131	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88460131delC								BANP (349208 upstream) : ZNF469 (33748 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	89670246	89670246	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89670246delG								CPNE7 (6593 upstream) : DPEP1 (9470 downstream)																																			---	---	---	---
TUSC5	286753	broad.mit.edu	37	17	1185279	1185280	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1185279_1185280delTG	uc002fsi.1	+							NM_172367	NP_758955			LOST1						response to biotic stimulus	integral to membrane				skin(2)	2				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)														---	---	---	---
YWHAE	7531	broad.mit.edu	37	17	1252911	1252912	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1252911_1252912insT	uc002fsj.2	-						YWHAE_uc002fsk.2_Intron|YWHAE_uc010vqh.1_Intron|YWHAE_uc010vqi.1_Intron	NM_006761	NP_006752			tyrosine 3/tryptophan 5 -monooxygenase						apoptosis|G2/M transition of mitotic cell cycle|induction of apoptosis by extracellular signals|interspecies interaction between organisms|intracellular signal transduction|nerve growth factor receptor signaling pathway	cytosol|melanosome	histone deacetylase binding|phosphoserine binding			lung(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)														---	---	---	---
SMG6	23293	broad.mit.edu	37	17	1975165	1975166	+	Intron	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1975165_1975166delTG	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045			Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4																		---	---	---	---
ITGAE	3682	broad.mit.edu	37	17	3678242	3678243	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3678242_3678243insT	uc002fwo.3	-							NM_002208	NP_002199			integrin, alpha E precursor						cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	4284528	4284529	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4284528_4284529insA								UBE2G1 (14559 upstream) : SPNS3 (52690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	6097571	6097573	+	IGR	DEL	GGA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6097571_6097573delGGA								WSCD1 (69826 upstream) : AIPL1 (229487 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	7046702	7046703	+	IGR	DEL	AA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7046702_7046703delAA								ASGR2 (28410 upstream) : ASGR1 (30049 downstream)																																			---	---	---	---
ASGR1	432	broad.mit.edu	37	17	7079706	7079707	+	Intron	DEL	CT	-	-	rs61339710		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7079706_7079707delCT	uc002ges.3	-						ASGR1_uc010clx.1_Intron	NM_001671	NP_001662			asialoglycoprotein receptor 1						receptor-mediated endocytosis	integral to plasma membrane	asialoglycoprotein receptor activity|metal ion binding|sugar binding			breast(1)|central_nervous_system(1)	2																		---	---	---	---
STX8	9482	broad.mit.edu	37	17	9434580	9434581	+	Intron	INS	-	T	T	rs149732830	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9434580_9434581insT	uc002glx.2	-							NM_004853	NP_004844			syntaxin 8						transport	endoplasmic reticulum|integral to plasma membrane				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	9714831	9714831	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9714831delA								DHRS7C (20230 upstream) : GLP2R (14550 downstream)																																			---	---	---	---
C17orf48	56985	broad.mit.edu	37	17	10610866	10610866	+	Intron	DEL	G	-	-	rs67369386		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10610866delG	uc002gmt.2	+						C17orf48_uc002gmu.2_Intron|C17orf48_uc002gmv.2_Intron	NM_020233	NP_064618			ADP-ribose/CDP-alcohol pyrophosphatase								ADP-ribose diphosphatase activity|CDP-glycerol diphosphatase activity|metal ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	10752124	10752125	+	IGR	INS	-	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10752124_10752125insG								PIRT (10706 upstream) : SHISA6 (392615 downstream)																																			---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11541239	11541239	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11541239delA	uc002gne.2	+							NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	13122612	13122613	+	IGR	DEL	TG	-	-	rs111526596		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13122612_13122613delTG								ELAC2 (201253 upstream) : HS3ST3A1 (276393 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	14804667	14804668	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14804667_14804668insA								HS3ST3B1 (555175 upstream) : PMP22 (328429 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	15819797	15819798	+	IGR	INS	-	G	G	rs143081587	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15819797_15819798insG								MEIS3P1 (126780 upstream) : ADORA2B (28433 downstream)																																			---	---	---	---
NCOR1	9611	broad.mit.edu	37	17	16072291	16072293	+	Intron	DEL	AAC	-	-	rs72271646		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16072291_16072293delAAC	uc002gpo.2	-						NCOR1_uc002gpn.2_Intron|NCOR1_uc002gpp.1_Intron|NCOR1_uc002gpr.2_Intron|NCOR1_uc002gps.1_Intron|NCOR1_uc010coz.1_Intron|NCOR1_uc010cpb.1_Intron|NCOR1_uc010cpa.1_Intron|NCOR1_uc002gpu.2_Intron	NM_006311	NP_006302			nuclear receptor co-repressor 1						cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)														---	---	---	---
MPRIP	23164	broad.mit.edu	37	17	16963719	16963719	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16963719delG	uc002gqu.1	+						MPRIP_uc002gqv.1_Intron	NM_201274	NP_958431			myosin phosphatase-Rho interacting protein							cytoplasm|cytoskeleton	actin binding				0																		---	---	---	---
PEMT	10400	broad.mit.edu	37	17	17466269	17466269	+	Intron	DEL	A	-	-	rs11356900		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17466269delA	uc002grj.2	-						PEMT_uc002grk.2_Intron|PEMT_uc002grl.2_Intron|PEMT_uc010vwx.1_Intron	NM_148173	NP_680478			phosphatidylethanolamine N-methyltransferase						cell proliferation|phosphatidylcholine biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrial membrane	phosphatidylethanolamine N-methyltransferase activity				0				Colorectal(2;0.0157)|READ - Rectum adenocarcinoma(2;0.0891)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	21242753	21242754	+	IGR	INS	-	T	T	rs146703998		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21242753_21242754insT								MAP2K3 (24204 upstream) : KCNJ12 (36945 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21250516	21250516	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21250516delC								MAP2K3 (31967 upstream) : KCNJ12 (29183 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21251747	21251749	+	IGR	DEL	CGT	-	-	rs58901223		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21251747_21251749delCGT								MAP2K3 (33198 upstream) : KCNJ12 (27950 downstream)																																			---	---	---	---
KCNJ12	3768	broad.mit.edu	37	17	21288492	21288492	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21288492delT	uc002gyv.1	+							NM_021012	NP_066292			potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21333424	21333424	+	IGR	DEL	C	-	-	rs111937714		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21333424delC								KCNJ12 (10245 upstream) : C17orf51 (98148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21561692	21561692	+	IGR	DEL	G	-	-	rs79167069		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21561692delG								C17orf51 (83961 upstream) : FAM27L (263678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	22257941	22257942	+	IGR	INS	-	A	A	rs7216561		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22257941_22257942insA								FLJ36000 (344871 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25279303	25279304	+	IGR	INS	-	GAAG	GAAG	rs138846612	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25279303_25279304insGAAG								None (None upstream) : WSB1 (341802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25294086	25294086	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25294086delA								None (None upstream) : WSB1 (327020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25298581	25298584	+	IGR	DEL	GAGT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25298581_25298584delGAGT								None (None upstream) : WSB1 (322522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	25599596	25599596	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25599596delT								None (None upstream) : WSB1 (21510 downstream)																																			---	---	---	---
CPD	1362	broad.mit.edu	37	17	28712523	28712526	+	Intron	DEL	CACA	-	-	rs140688706		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28712523_28712526delCACA	uc002hfb.1	+						CPD_uc010wbo.1_Intron|CPD_uc010wbp.1_Intron	NM_001304	NP_001295			carboxypeptidase D precursor						proteolysis	integral to membrane	metallocarboxypeptidase activity|serine-type carboxypeptidase activity|zinc ion binding			liver(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	28890718	28890721	+	IGR	DEL	CATT	-	-	rs35235334	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28890718_28890721delCATT								TBC1D29 (211 upstream) : LRRC37B2 (12762 downstream)																																			---	---	---	---
LRRC37B2	147172	broad.mit.edu	37	17	28922579	28922579	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28922579delG	uc010wbq.1	+							NR_015341				Homo sapiens cDNA FLJ90801 fis, clone Y79AA1000207.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	29338460	29338461	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29338460_29338461delAC								RNF135 (11535 upstream) : NF1 (83534 downstream)														p.?(1)																					---	---	---	---
PSMD11	5717	broad.mit.edu	37	17	30803824	30803824	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30803824delC	uc010cta.1	+						PSMD11_uc010wbz.1_Intron|PSMD11_uc002hhm.2_Intron	NM_002815	NP_002806			proteasome 26S non-ATPase subunit 11						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding			ovary(1)	1		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)															---	---	---	---
ACCN1	40	broad.mit.edu	37	17	31920383	31920383	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31920383delA	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	32638566	32638567	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32638566_32638567insT								CCL11 (23367 upstream) : CCL8 (7499 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	34465808	34465809	+	IGR	INS	-	G	G	rs141568211	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34465808_34465809insG								CCL4 (32794 upstream) : TBC1D3B (27252 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	35006675	35006676	+	IGR	INS	-	G	G	rs142548786	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35006675_35006676insG								MRM1 (41269 upstream) : LHX1 (287823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	35117701	35117702	+	IGR	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35117701_35117702delGA								MRM1 (152295 upstream) : LHX1 (176797 downstream)																																			---	---	---	---
LHX1	3975	broad.mit.edu	37	17	35294340	35294341	+	5'Flank	INS	-	A	A	rs113265097		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35294340_35294341insA	uc002hnh.1	+						uc002hng.1_5'Flank|LHX1_uc010cux.1_5'Flank	NM_005568	NP_005559			LIM homeobox protein 1						cerebellar Purkinje cell differentiation|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation|cervix development|comma-shaped body morphogenesis|dorsal/ventral pattern formation|ectoderm formation|embryonic pattern specification|embryonic retina morphogenesis in camera-type eye|embryonic viscerocranium morphogenesis|endoderm formation|forebrain regionalization|head development|motor axon guidance|negative regulation of transcription, DNA-dependent|nephric duct morphogenesis|nephron tubule epithelial cell differentiation|neuron migration|oviduct epithelium development|paramesonephric duct development|positive regulation of anterior head development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of embryonic development|positive regulation of gastrulation|positive regulation of transcription, DNA-dependent|post-embryonic development|primitive streak formation|renal vesicle morphogenesis|retina layer formation|S-shaped body morphogenesis|spinal cord association neuron differentiation|transcription from RNA polymerase II promoter|ureteric bud development|uterine epithelium development|vagina development	nucleus|protein complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(25;0.00607)																---	---	---	---
SYNRG	11276	broad.mit.edu	37	17	35907566	35907566	+	Intron	DEL	T	-	-	rs66504222		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35907566delT	uc002hoa.2	-						SYNRG_uc010wde.1_Intron|SYNRG_uc010wdf.1_Intron|SYNRG_uc002hoc.2_Intron|SYNRG_uc002hoe.2_Intron|SYNRG_uc002hod.2_Intron|SYNRG_uc010wdg.1_Intron|SYNRG_uc002hob.2_Intron|SYNRG_uc002hof.2_Intron	NM_007247	NP_009178			synergin, gamma isoform 1						endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	36821316	36821316	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36821316delA								SRCIN1 (59133 upstream) : C17orf96 (6645 downstream)																																			---	---	---	---
MED24	9862	broad.mit.edu	37	17	38183505	38183506	+	Intron	INS	-	G	G	rs144546030	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38183505_38183506insG	uc002htt.2	-						MED24_uc010wes.1_Intron|MED24_uc010wet.1_Intron|MED24_uc002hts.2_Intron|MED24_uc002htu.2_Intron|MED24_uc010cwn.2_Intron|MED24_uc010weu.1_Intron|MED24_uc010wev.1_Intron|MED24_uc010wew.1_Intron|MED24_uc010wex.1_Intron|SNORD124_uc010wey.1_5'Flank	NM_014815	NP_055630			mediator complex subunit 24 isoform 1						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1	Colorectal(19;0.000442)															OREG0024386	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	17	38214556	38214557	+	IGR	INS	-	GAG	GAG	rs139816794	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38214556_38214557insGAG								MED24 (3667 upstream) : THRA (3606 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	39271621	39271621	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39271621delT								KRTAP4-9 (8883 upstream) : KRTAP4-11 (1815 downstream)																																			---	---	---	---
KRT33B	3884	broad.mit.edu	37	17	39523970	39523970	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39523970delA	uc002hwl.2	-							NM_002279	NP_002270			type I hair keratin 3B							intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	39586518	39586519	+	IGR	INS	-	T	T	rs150714780	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39586518_39586519insT								KRT37 (5696 upstream) : KRT38 (6102 downstream)																																			---	---	---	---
NT5C3L	115024	broad.mit.edu	37	17	39982464	39982471	+	Intron	DEL	TTTCTTTC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39982464_39982471delTTTCTTTC	uc002hyc.3	-						NT5C3L_uc002hxx.3_Intron|NT5C3L_uc010wfu.1_Intron|NT5C3L_uc002hyb.3_Intron|NT5C3L_uc002hyd.3_Intron|NT5C3L_uc002hxy.3_Intron|NT5C3L_uc002hxz.3_Intron|NT5C3L_uc002hya.3_Intron	NM_052935	NP_443167			5'-nucleotidase, cytosolic III-like							cytoplasm	5'-nucleotidase activity|magnesium ion binding				0		Breast(137;0.000162)		BRCA - Breast invasive adenocarcinoma(366;0.15)														---	---	---	---
EZH1	2145	broad.mit.edu	37	17	40894889	40894890	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40894889_40894890insT	uc002iaz.2	-						EZH1_uc002iba.2_Intron|EZH1_uc010wgt.1_Intron|EZH1_uc010wgu.1_Intron|EZH1_uc010wgv.1_Intron|EZH1_uc010wgw.1_Intron|EZH1_uc010cyp.2_Intron|EZH1_uc010cyq.2_Intron|EZH1_uc010cys.2_Intron|uc002ibc.3_RNA	NM_001991	NP_001982			enhancer of zeste homolog 1						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	chromatin binding|DNA binding			ovary(3)	3		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	41437568	41437569	+	IGR	INS	-	AAAG	AAAG	rs143347439	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41437568_41437569insAAAG								TMEM106A (65979 upstream) : LOC100130581 (9644 downstream)																																			---	---	---	---
C17orf104	284071	broad.mit.edu	37	17	42748147	42748151	+	3'UTR	DEL	TCCAC	-	-	rs62065978		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42748147_42748151delTCCAC	uc010czv.2	+	6					C17orf104_uc002igz.3_3'UTR|C17orf104_uc010wja.1_Intron|C17orf104_uc002iha.2_Intron	NM_001145080	NP_001138552			hypothetical protein LOC284071											central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	42782896	42782897	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42782896_42782897insT								CCDC43 (15731 upstream) : DBF4B (3079 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	42861900	42861900	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42861900delT								ADAM11 (2688 upstream) : GJC1 (13917 downstream)																																			---	---	---	---
CRHR1	1394	broad.mit.edu	37	17	43768622	43768622	+	Intron	DEL	G	-	-	rs112251495		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43768622delG	uc002ijp.2	+						CRHR1_uc010wjx.1_Intron					SubName: Full=cDNA FLJ60308, highly similar to Corticotropin-releasing factor receptor 1;						female pregnancy|immune response|parturition	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(3)	3	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)														---	---	---	---
KIAA1267	284058	broad.mit.edu	37	17	44133819	44133819	+	Intron	DEL	A	-	-	rs67822287		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44133819delA	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258			hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)																---	---	---	---
KIAA1267	284058	broad.mit.edu	37	17	44244421	44244422	+	Intron	INS	-	A	A	rs66866969		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44244421_44244422insA	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258			hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)																---	---	---	---
KIAA1267	284058	broad.mit.edu	37	17	44254994	44254994	+	Intron	DEL	T	-	-	rs66963150		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44254994delT	uc002ikc.2	-						KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258			hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	47512341	47512341	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47512341delA								PHB (20099 upstream) : NGFR (60314 downstream)																																	OREG0024539	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	17	48087005	48087006	+	IGR	INS	-	TC	TC	rs79709032		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48087005_48087006insTC								DLX3 (14417 upstream) : ITGA3 (46334 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	51517672	51517673	+	IGR	DEL	AC	-	-	rs10687860		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51517672_51517673delAC								None (None upstream) : KIF2B (382566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	51715816	51715816	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51715816delT								None (None upstream) : KIF2B (184423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	52669224	52669224	+	IGR	DEL	T	-	-	rs112206806		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52669224delT								KIF2B (766651 upstream) : TOM1L1 (308828 downstream)																																			---	---	---	---
STXBP4	252983	broad.mit.edu	37	17	53235245	53235245	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53235245delG	uc002iuf.1	+						STXBP4_uc010dcd.1_Intron	NM_178509	NP_848604			syntaxin binding protein 4							cytoplasm	calcium ion binding			ovary(1)	1																		---	---	---	---
ANKFN1	162282	broad.mit.edu	37	17	54295545	54295546	+	Intron	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54295545_54295546delTC	uc002iun.1	+							NM_153228	NP_694960			ankyrin-repeat and fibronectin type III domain											large_intestine(1)|ovary(1)	2																		---	---	---	---
DGKE	8526	broad.mit.edu	37	17	54928309	54928309	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54928309delA	uc002iur.2	+						DGKE_uc002ius.1_Intron	NM_003647	NP_003638			diacylglycerol kinase epsilon						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding			breast(2)	2	Breast(9;3.59e-07)																	---	---	---	---
AKAP1	8165	broad.mit.edu	37	17	55175842	55175842	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55175842delA	uc002iux.2	+						AKAP1_uc010wnl.1_Intron|AKAP1_uc002iuy.2_Intron|AKAP1_uc010dcm.2_Intron	NM_003488	NP_003479			A-kinase anchor protein 1 precursor						blood coagulation	cytosol|integral to membrane|mitochondrial outer membrane	protein binding|RNA binding			ovary(1)	1	Breast(9;5.46e-08)																	---	---	---	---
TEX14	56155	broad.mit.edu	37	17	56701105	56701107	+	Intron	DEL	AAG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56701105_56701107delAAG	uc010dcz.1	-						TEX14_uc002iwr.1_Intron|TEX14_uc002iws.1_Intron|TEX14_uc010dda.1_Intron	NM_198393	NP_938207			testis expressed sequence 14 isoform a							cytoplasm	ATP binding|protein kinase activity			stomach(4)|lung(3)|breast(3)|ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)|pancreas(1)	17	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	58932628	58932629	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58932628_58932629insT	uc002iyv.3	+						BCAS3_uc010wow.1_Intron|BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	59221741	59221741	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59221741delT	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
BRIP1	83990	broad.mit.edu	37	17	59766115	59766116	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59766115_59766116insA	uc002izk.1	-						BRIP1_uc002izl.1_Intron	NM_032043	NP_114432			BRCA1 interacting protein C-terminal helicase 1						DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1								F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
PRKCA	5578	broad.mit.edu	37	17	64442357	64442358	+	Intron	DEL	AC	-	-	rs34110221		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64442357_64442358delAC	uc002jfp.1	+						PRKCA_uc002jfo.1_Intron	NM_002737	NP_002728			protein kinase C, alpha						activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	65061419	65061419	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65061419delA								CACNG1 (8510 upstream) : HELZ (5136 downstream)																																			---	---	---	---
ARSG	22901	broad.mit.edu	37	17	66297259	66297259	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66297259delA	uc002jhc.2	+						ARSG_uc002jhb.1_Intron	NM_014960	NP_055775			Arylsulfatase G precursor						sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	66627449	66627449	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66627449delT								FAM20A (30354 upstream) : ABCA8 (235984 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	66842145	66842145	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66842145delA								FAM20A (245050 upstream) : ABCA8 (21288 downstream)																																			---	---	---	---
MAP2K6	5608	broad.mit.edu	37	17	67527197	67527198	+	Intron	INS	-	T	T	rs35152020		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67527197_67527198insT	uc002jij.2	+							NM_002758	NP_002749			mitogen-activated protein kinase kinase 6						activation of MAPK activity|cell cycle arrest|DNA damage induced protein phosphorylation|innate immune response|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of muscle cell differentiation|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|pancreas(1)	5	Breast(10;6.05e-10)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	68919953	68919953	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68919953delG								KCNJ2 (743772 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68952728	68952728	+	IGR	DEL	C	-	-	rs68037296		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68952728delC								KCNJ2 (776547 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69912674	69912676	+	IGR	DEL	TTC	-	-	rs35202043		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69912674_69912676delTTC								None (None upstream) : SOX9 (204485 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70471978	70471978	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70471978delG	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																														---	---	---	---
SLC39A11	201266	broad.mit.edu	37	17	71009632	71009632	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71009632delA	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242			solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1																		---	---	---	---
SLC39A11	201266	broad.mit.edu	37	17	71032582	71032583	+	Intron	INS	-	T	T	rs147044974	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71032582_71032583insT	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242			solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	71729219	71729219	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71729219delT								SDK2 (88992 upstream) : C17orf54 (16190 downstream)																																			---	---	---	---
TTYH2	94015	broad.mit.edu	37	17	72247798	72247799	+	Intron	INS	-	C	C	rs72359136		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72247798_72247799insC	uc002jkc.2	+						TTYH2_uc010wqw.1_Intron|TTYH2_uc002jkd.2_Intron	NM_032646	NP_116035			tweety 2 isoform 1							chloride channel complex|plasma membrane	chloride channel activity|protein binding			ovary(3)|large_intestine(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	72483586	72483586	+	IGR	DEL	T	-	-	rs36037181		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72483586delT								CD300A (2655 upstream) : CD300LB (33727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	74361261	74361262	+	IGR	DEL	AA	-	-	rs34272729		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74361261_74361262delAA								PRPSAP1 (10982 upstream) : SPHK1 (11480 downstream)																																			---	---	---	---
SEC14L1	6397	broad.mit.edu	37	17	75140039	75140039	+	Intron	DEL	T	-	-	rs67616908		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75140039delT	uc002jto.2	+						SEC14L1_uc010dhc.2_Intron|SEC14L1_uc010wth.1_Intron|SEC14L1_uc002jtm.2_Intron	NM_003003	NP_002994			SEC14 (S. cerevisiae)-like 1 isoform a						transport	Golgi apparatus|integral to membrane	binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	75241905	75241908	+	IGR	DEL	GTGC	-	-	rs72303930		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75241905_75241908delGTGC								SEC14L1 (28726 upstream) : SEPT9 (35584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	75900660	75900661	+	IGR	INS	-	TTCTC	TTCTC	rs146100132	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75900660_75900661insTTCTC								FLJ45079 (20491 upstream) : TNRC6C (99657 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	77879833	77879833	+	IGR	DEL	T	-	-	rs76096752		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77879833delT								CBX4 (66620 upstream) : TBC1D16 (33988 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	79274703	79274706	+	IGR	DEL	ACAC	-	-	rs139349924		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79274703_79274706delACAC								SLC38A10 (5607 upstream) : C17orf55 (1918 downstream)																																			---	---	---	---
RAB40B	10966	broad.mit.edu	37	17	80629081	80629082	+	Intron	INS	-	AC	AC			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80629081_80629082insAC	uc002kft.2	-						RAB40B_uc002kfs.2_Intron	NM_006822	NP_006813			RAB40B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			central_nervous_system(1)	1	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	1201637	1201643	+	IGR	DEL	GATCTCT	-	-	rs71676416		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1201637_1201643delGATCTCT								ADCYAP1 (289466 upstream) : C18orf2 (52747 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	1483902	1483903	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1483902_1483903delCA								C18orf2 (76721 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	2120929	2120930	+	IGR	INS	-	A	A	rs145905936	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2120929_2120930insA								C18orf2 (713748 upstream) : METTL4 (416595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	2245059	2245059	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2245059delA								C18orf2 (837878 upstream) : METTL4 (292466 downstream)																																			---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	3759258	3759259	+	Intron	DEL	AA	-	-	rs66542955		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3759258_3759259delAA	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron|DLGAP1_uc002kmk.2_Intron	NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
RAB31	11031	broad.mit.edu	37	18	9711167	9711168	+	Intron	INS	-	TC	TC	rs149501112	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9711167_9711168insTC	uc002kog.2	+							NM_006868	NP_006859			RAB31, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1																		---	---	---	---
FAM38B	63895	broad.mit.edu	37	18	10783094	10783094	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10783094delA	uc002kou.1	-											RecName: Full=Transmembrane protein C18orf30;							integral to membrane	ion channel activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	10932932	10932932	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10932932delA								FAM38B (230953 upstream) : GNAL (756204 downstream)																																			---	---	---	---
GNAL	2774	broad.mit.edu	37	18	11856761	11856762	+	Intron	INS	-	T	T	rs140073330	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11856761_11856762insT	uc010dkz.2	+						GNAL_uc002kqc.2_Intron|GNAL_uc002kqd.2_Intron|GNAL_uc010wzt.1_5'Flank	NM_001142339	NP_001135811			guanine nucleotide binding protein (G protein),						activation of adenylate cyclase activity by dopamine receptor signaling pathway|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception of smell|synaptic transmission	heterotrimeric G-protein complex	adenylate cyclase activity|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	12105714	12105715	+	Intron	DEL	TG	-	-	rs145123406		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12105714_12105715delTG	uc002kqr.2	+						uc002kqs.2_Intron					Homo sapiens mRNA; cDNA DKFZp686E2239 (from clone DKFZp686E2239).																														---	---	---	---
CEP192	55125	broad.mit.edu	37	18	13009014	13009015	+	Intron	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13009014_13009015delTT	uc010xac.1	+						CEP192_uc002krs.1_Intron	NM_032142	NP_115518			centrosomal protein 192kDa											ovary(4)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	14351243	14351244	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14351243_14351244insA								LOC284233 (8721 upstream) : CXADRP3 (126712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15397846	15397846	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15397846delG								LOC644669 (71928 upstream) : None (None downstream)																																			---	---	---	---
GREB1L	80000	broad.mit.edu	37	18	19074058	19074059	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19074058_19074059insA	uc010xam.1	+						GREB1L_uc010dlp.1_Intron|GREB1L_uc010xan.1_Intron|GREB1L_uc010dlr.1_Intron	NM_001142966	NP_001136438			growth regulation by estrogen in breast							integral to membrane					0																		---	---	---	---
GREB1L	80000	broad.mit.edu	37	18	19074156	19074156	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19074156delT	uc010xam.1	+						GREB1L_uc010dlp.1_Intron|GREB1L_uc010xan.1_Intron|GREB1L_uc010dlr.1_Intron	NM_001142966	NP_001136438			growth regulation by estrogen in breast							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	19478109	19478109	+	IGR	DEL	T	-	-	rs112096983		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19478109delT								MIB1 (27199 upstream) : GATA6 (271307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	19537283	19537284	+	IGR	DEL	TT	-	-	rs77682603		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19537283_19537284delTT								MIB1 (86373 upstream) : GATA6 (212132 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	20154541	20154541	+	IGR	DEL	T	-	-	rs67058896		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20154541delT								CTAGE1 (156663 upstream) : RBBP8 (358754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	20203258	20203258	+	IGR	DEL	C	-	-	rs34316398		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20203258delC								CTAGE1 (205380 upstream) : RBBP8 (310037 downstream)																																			---	---	---	---
NPC1	4864	broad.mit.edu	37	18	21134570	21134570	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21134570delA	uc002kum.3	-						NPC1_uc010xaz.1_Intron|NPC1_uc010xba.1_Intron	NM_000271	NP_000262			Niemann-Pick disease, type C1 precursor						autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)																	---	---	---	---
NPC1	4864	broad.mit.edu	37	18	21139923	21139924	+	Intron	INS	-	A	A	rs112490232		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21139923_21139924insA	uc002kum.3	-						NPC1_uc010xaz.1_Intron|NPC1_uc010xba.1_Intron	NM_000271	NP_000262			Niemann-Pick disease, type C1 precursor						autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)																	---	---	---	---
Unknown	0	broad.mit.edu	37	18	23123146	23123147	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23123146_23123147delAC								ZNF521 (190932 upstream) : SS18 (473072 downstream)																																			---	---	---	---
CHST9	83539	broad.mit.edu	37	18	24720909	24720910	+	Intron	INS	-	G	G	rs150496059	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24720909_24720910insG	uc002kwd.2	-						C18orf16_uc010xbm.1_Intron|CHST9_uc002kwe.2_Intron	NM_031422	NP_113610			GalNAc-4-sulfotransferase 2						carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)																	---	---	---	---
Unknown	0	broad.mit.edu	37	18	24929522	24929522	+	Intron	DEL	A	-	-	rs34320033		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24929522delA	uc002kwf.1	-											Homo sapiens cDNA FLJ45994 fis, clone SKMUS2009557.																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	25102511	25102512	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25102511_25102512delAC	uc002kwf.1	-											Homo sapiens cDNA FLJ45994 fis, clone SKMUS2009557.																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	25486298	25486299	+	IGR	INS	-	TGG	TGG	rs142908406	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25486298_25486299insTGG								C18orf16 (715648 upstream) : CDH2 (44631 downstream)																																			---	---	---	---
CDH2	1000	broad.mit.edu	37	18	25711648	25711649	+	Intron	DEL	GT	-	-	rs17446770	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:25711648_25711649delGT	uc002kwg.2	-							NM_001792	NP_001783			cadherin 2, type 1 preproprotein						adherens junction organization|cell junction assembly|positive regulation of muscle cell differentiation	catenin complex|integral to membrane	alpha-catenin binding|beta-catenin binding|calcium ion binding|gamma-catenin binding			ovary(3)|lung(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	26036979	26036979	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:26036979delC								CDH2 (279534 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	27164063	27164064	+	IGR	INS	-	C	C	rs139298394	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27164063_27164064insC								None (None upstream) : MIR302F (714812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	27500717	27500718	+	IGR	DEL	AA	-	-	rs78164621		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27500717_27500718delAA								None (None upstream) : MIR302F (378158 downstream)																																			---	---	---	---
MEP1B	4225	broad.mit.edu	37	18	29781262	29781263	+	Intron	INS	-	AC	AC	rs79583961		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29781262_29781263insAC	uc002kxj.3	+							NM_005925	NP_005916			meprin A beta precursor						digestion|proteolysis	extracellular space|integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
FAM59A	64762	broad.mit.edu	37	18	29984415	29984416	+	Intron	INS	-	A	A	rs11367080		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29984415_29984416insA	uc002kxl.2	-						FAM59A_uc002kxk.1_Intron	NM_022751	NP_073588			family with sequence similarity 59, member A											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	30065479	30065479	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30065479delT								FAM59A (15032 upstream) : WBP11P1 (26147 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	30218117	30218117	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30218117delA								WBP11P1 (123521 upstream) : KLHL14 (34517 downstream)																																			---	---	---	---
MOCOS	55034	broad.mit.edu	37	18	33769418	33769419	+	Intron	INS	-	G	G	rs138019752	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33769418_33769419insG	uc002kzq.3	+						uc002kzp.2_5'Flank	NM_017947	NP_060417			molybdenum cofactor sulfurase						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	18	35367529	35367529	+	IGR	DEL	T	-	-	rs34466123		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35367529delT								CELF4 (221529 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	35374737	35374738	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35374737_35374738insA								CELF4 (228737 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	35574136	35574137	+	IGR	INS	-	TATT	TATT	rs139565953	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35574136_35574137insTATT								CELF4 (428136 upstream) : None (None downstream)																																			---	---	---	---
LOC647946	647946	broad.mit.edu	37	18	37043504	37043504	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37043504delA	uc010xcj.1	-						LOC647946_uc002lal.1_Intron	NR_024391				Homo sapiens cDNA FLJ33284 fis, clone ASTRO2009458.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	37438605	37438608	+	Intron	DEL	GTGT	-	-	rs66468256		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37438605_37438608delGTGT	uc010xck.1	-											Homo sapiens cDNA, FLJ99758.																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	38365580	38365581	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:38365580_38365581insA								LOC647946 (985298 upstream) : KC6 (694657 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	39435386	39435387	+	IGR	INS	-	TT	TT			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39435386_39435387insTT								KC6 (334825 upstream) : PIK3C3 (99812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	39721571	39721572	+	IGR	INS	-	A	A	rs140493229	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39721571_39721572insA								PIK3C3 (60127 upstream) : RIT2 (601621 downstream)																																			---	---	---	---
SLC14A2	8170	broad.mit.edu	37	18	43035396	43035396	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43035396delG	uc010dnj.2	+						SLC14A2_uc002lbb.2_Intron|uc002lbc.1_Intron	NM_007163	NP_009094			solute carrier family 14 (urea transporter),							apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
SLC14A2	8170	broad.mit.edu	37	18	43161849	43161850	+	Intron	INS	-	C	C	rs138955130	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43161849_43161850insC	uc010dnj.2	+						SLC14A2_uc002lbb.2_Intron	NM_007163	NP_009094			solute carrier family 14 (urea transporter),							apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
MYO5B	4645	broad.mit.edu	37	18	47372560	47372560	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47372560delG	uc002leb.2	-						MYO5B_uc002ldz.2_Intron|MYO5B_uc002lea.2_Intron	NM_001080467	NP_001073936			myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	49327323	49327323	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49327323delT								MEX3C (603633 upstream) : DCC (539248 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	52804011	52804012	+	IGR	INS	-	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:52804011_52804012insC								CCDC68 (177272 upstream) : TCF4 (85550 downstream)																																			---	---	---	---
TCF4	6925	broad.mit.edu	37	18	53181637	53181638	+	Intron	DEL	CA	-	-	rs35363143		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53181637_53181638delCA	uc002lfz.2	-						TCF4_uc010xdx.1_Intron|TCF4_uc010dph.1_Intron|TCF4_uc010xdy.1_Intron|TCF4_uc002lga.2_Intron|TCF4_uc010dpi.2_Intron	NM_003199	NP_003190			transcription factor 4 isoform b						positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	56664232	56664233	+	IGR	DEL	CC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56664232_56664233delCC								ZNF532 (10529 upstream) : LOC390858 (38738 downstream)																																			---	---	---	---
CCBE1	147372	broad.mit.edu	37	18	57175130	57175130	+	Intron	DEL	T	-	-	rs34926170		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57175130delT	uc002lib.2	-							NM_133459	NP_597716			collagen and calcium binding EGF domains 1						lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	57452790	57452790	+	IGR	DEL	A	-	-	rs34715616		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57452790delA								CCBE1 (88146 upstream) : PMAIP1 (114402 downstream)																																			---	---	---	---
CDH20	28316	broad.mit.edu	37	18	59025350	59025350	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59025350delT	uc002lif.2	+							NM_031891	NP_114097			cadherin 20, type 2 preproprotein						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)																---	---	---	---
PIGN	23556	broad.mit.edu	37	18	59798686	59798688	+	Intron	DEL	CTT	-	-	rs5825478		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59798686_59798688delCTT	uc002lii.3	-						PIGN_uc002lij.3_Intron	NM_176787	NP_789744			phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5		Colorectal(73;0.187)																---	---	---	---
KIAA1468	57614	broad.mit.edu	37	18	59912271	59912271	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59912271delG	uc002lil.2	+						KIAA1468_uc002lik.1_Intron|KIAA1468_uc010xel.1_Intron|KIAA1468_uc002lim.2_Intron	NM_020854	NP_065905			hypothetical protein LOC57614								binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	63907497	63907498	+	IGR	DEL	AG	-	-	rs34767187		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63907497_63907498delAG								CDH7 (359323 upstream) : CDH19 (263823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	64297182	64297182	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64297182delG								CDH19 (25966 upstream) : DSEL (876637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	64917958	64917959	+	IGR	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64917958_64917959delGA								CDH19 (646742 upstream) : DSEL (255860 downstream)																																			---	---	---	---
DOK6	220164	broad.mit.edu	37	18	67240643	67240643	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67240643delA	uc002lkl.2	+							NM_152721	NP_689934			docking protein 6								insulin receptor binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Colorectal(73;0.083)|Esophageal squamous(42;0.131)																---	---	---	---
RTTN	25914	broad.mit.edu	37	18	67840728	67840728	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67840728delA	uc002lkp.2	-						RTTN_uc002lko.2_Intron|RTTN_uc010xfb.1_Intron|RTTN_uc002lkq.1_Intron	NM_173630	NP_775901			rotatin								binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	69771105	69771105	+	IGR	DEL	C	-	-	rs35157889		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69771105delC								None (None upstream) : CBLN2 (432810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	70376752	70376752	+	IGR	DEL	A	-	-	rs11348812		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:70376752delA								CBLN2 (165029 upstream) : NETO1 (32799 downstream)																																			---	---	---	---
CNDP2	55748	broad.mit.edu	37	18	72176867	72176868	+	Intron	INS	-	A	A	rs11419365		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72176867_72176868insA	uc002llm.1	+						CNDP2_uc002lln.1_Intron|CNDP2_uc002llp.1_3'UTR|CNDP2_uc010dqs.2_5'Flank	NM_018235	NP_060705			CNDP dipeptidase 2							cytoplasm	carboxypeptidase activity|metal ion binding|metallopeptidase activity|protein binding|tripeptidase activity			ovary(2)|skin(1)	3		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	73330106	73330106	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73330106delA								C18orf62 (190517 upstream) : ZNF516 (741513 downstream)																																			---	---	---	---
ZNF236	7776	broad.mit.edu	37	18	74546331	74546332	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74546331_74546332insT	uc002lmi.2	+						ZNF236_uc002lmj.2_Intron	NM_007345	NP_031371			zinc finger protein 236						cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	74911412	74911413	+	IGR	INS	-	C	C	rs139345073	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74911412_74911413insC								MBP (66638 upstream) : GALR1 (50595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	75173695	75173696	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75173695_75173696delTG								GALR1 (191601 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	76823730	76823731	+	IGR	INS	-	T	T	rs34156581		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76823730_76823731insT								SALL3 (65539 upstream) : ATP9B (5666 downstream)																																			---	---	---	---
NFATC1	4772	broad.mit.edu	37	18	77184490	77184491	+	Intron	DEL	TC	-	-	rs35847918		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77184490_77184491delTC	uc010xfg.1	+						NFATC1_uc002lnc.1_Intron|NFATC1_uc010xff.1_Intron|NFATC1_uc002lnd.2_Intron|NFATC1_uc002lne.2_Intron|NFATC1_uc010xfh.1_Intron|NFATC1_uc010xfi.1_Intron|NFATC1_uc010xfj.1_Intron|NFATC1_uc002lnf.2_Intron|NFATC1_uc002lng.2_Intron|NFATC1_uc010xfk.1_Intron	NM_006162	NP_006153			nuclear factor of activated T-cells, cytosolic						intracellular signal transduction|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	FK506 binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	260238	260239	+	IGR	INS	-	A	A	rs140609467		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:260238_260239insA								FLJ45445 (58029 upstream) : PPAP2C (20807 downstream)																																			---	---	---	---
SBNO2	22904	broad.mit.edu	37	19	1164603	1164605	+	Intron	DEL	AGG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1164603_1164605delAGG	uc002lrk.3	-						SBNO2_uc010dse.2_Intron	NM_014963	NP_055778			strawberry notch homolog 2 isoform 1						macrophage activation involved in immune response|negative regulation of transcription, DNA-dependent|regulation of inflammatory response|transcription, DNA-dependent						0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	1539381	1539381	+	IGR	DEL	T	-	-	rs71335372		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1539381delT								PLK5P (3926 upstream) : MEX3D (15288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	1552728	1552728	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1552728delA								PLK5P (17273 upstream) : MEX3D (1941 downstream)																																			---	---	---	---
SPPL2B	56928	broad.mit.edu	37	19	2349081	2349082	+	Intron	INS	-	A	A	rs142396912	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2349081_2349082insA	uc002lvs.2	+						SPPL2B_uc002lvr.2_Intron	NM_152988	NP_694533			signal peptide peptidase-like 2B isoform 2							Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
GNG7	2788	broad.mit.edu	37	19	2600261	2600261	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2600261delA	uc002lwd.2	-							NM_052847	NP_443079			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ZNF77	58492	broad.mit.edu	37	19	2947172	2947175	+	5'Flank	DEL	TAAA	-	-	rs72299015		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2947172_2947175delTAAA	uc002lws.3	-							NM_021217	NP_067040			zinc finger protein 77						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
NCLN	56926	broad.mit.edu	37	19	3192359	3192364	+	Intron	DEL	GGGCTG	-	-	rs11278022		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3192359_3192364delGGGCTG	uc002lxi.2	+						NCLN_uc002lxh.1_Intron	NM_020170	NP_064555			nicalin precursor						proteolysis|regulation of signal transduction	endoplasmic reticulum membrane|integral to membrane|nucleus	peptidase activity|protein binding				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.83e-113)|Epithelial(107;1.65e-111)|all cancers(105;1.53e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00139)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
TNFAIP8L1	126282	broad.mit.edu	37	19	4648149	4648149	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4648149delC	uc002max.2	+							NM_152362	NP_689575			tumor necrosis factor, alpha-induced protein												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
PTPRS	5802	broad.mit.edu	37	19	5218214	5218215	+	Intron	DEL	AA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5218214_5218215delAA	uc002mbv.2	-						PTPRS_uc002mbu.1_Intron|PTPRS_uc010xin.1_Intron|PTPRS_uc002mbw.2_Intron|PTPRS_uc002mbx.2_Intron|PTPRS_uc002mby.2_Intron	NM_002850	NP_002841			protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)														---	---	---	---
MLLT1	4298	broad.mit.edu	37	19	6234915	6234915	+	Intron	DEL	A	-	-	rs3036307		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6234915delA	uc002mek.2	-							NM_005934	NP_005925			myeloid/lymphoid or mixed-lineage leukemia						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|protein binding			skin(1)	1								T	MLL	AL								---	---	---	---
EMR1	2015	broad.mit.edu	37	19	6933933	6933934	+	Intron	INS	-	ATA	ATA	rs138851464	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6933933_6933934insATA	uc002mfw.2	+						EMR1_uc010dvc.2_Intron|EMR1_uc010dvb.2_Intron|EMR1_uc010xji.1_Intron|EMR1_uc010xjj.1_Intron	NM_001974	NP_001965			egf-like module containing, mucin-like, hormone						cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)																	---	---	---	---
INSR	3643	broad.mit.edu	37	19	7225710	7225711	+	Intron	INS	-	C	C	rs112529897		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7225710_7225711insC	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
INSR	3643	broad.mit.edu	37	19	7291081	7291081	+	Intron	DEL	A	-	-	rs79281052		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7291081delA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
XAB2	56949	broad.mit.edu	37	19	7694311	7694311	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7694311delC	uc002mgx.2	-						uc010dvi.1_5'Flank	NM_020196	NP_064581			XPA binding protein 2						transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	catalytic step 2 spliceosome|nucleoplasm	protein binding			central_nervous_system(2)|breast(1)|skin(1)	4													Direct_reversal_of_damage|NER					---	---	---	---
Unknown	0	broad.mit.edu	37	19	7781677	7781678	+	IGR	INS	-	TCTGGGGGC	TCTGGGGGC	rs145827860	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7781677_7781678insTCTGGGGGC								FCER2 (14645 upstream) : CLEC4G (12166 downstream)																																			---	---	---	---
LASS4	79603	broad.mit.edu	37	19	8307866	8307869	+	Intron	DEL	GTCT	-	-	rs148380054		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8307866_8307869delGTCT	uc002mjg.2	+						LASS4_uc002mjh.2_Intron|LASS4_uc002mji.2_Intron|LASS4_uc010dvz.2_Intron	NM_024552	NP_078828			LAG1 homolog, ceramide synthase 4							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	8865564	8865565	+	IGR	INS	-	A	A	rs148286254		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8865564_8865565insA								OR2Z1 (23230 upstream) : ZNF558 (54817 downstream)																																			---	---	---	---
MUC16	94025	broad.mit.edu	37	19	8989306	8989315	+	Intron	DEL	AAAACAAAAC	-	-	rs112562675		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8989306_8989315delAAAACAAAAC	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966			mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
FDX1L	112812	broad.mit.edu	37	19	10425993	10425994	+	Intron	DEL	GG	-	-	rs62130693		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10425993_10425994delGG	uc002mny.1	-						FDX1L_uc002mnx.1_Intron	NM_001031734	NP_001026904			ferredoxin 1-like precursor						electron transport chain|transport	mitochondrial matrix	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)															---	---	---	---
ZNF439	90594	broad.mit.edu	37	19	11973967	11973968	+	5'Flank	INS	-	T	T	rs35595001		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11973967_11973968insT	uc002mss.2	+						ZNF439_uc002msr.2_Intron	NM_152262	NP_689475			zinc finger protein 439						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
RTBDN	83546	broad.mit.edu	37	19	12940008	12940009	+	Intron	INS	-	T	T	rs142640807		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12940008_12940009insT	uc002mvi.2	-						RTBDN_uc002mvh.1_Intron|RTBDN_uc002mvj.2_Intron	NM_001080997	NP_001074466			retbindin isoform 1							extracellular region					0																		---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13366586	13366597	+	Intron	DEL	CCTCCTTTCCTT	-	-	rs118071564	by1000genomes;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13366586_13366597delCCTCCTTTCCTT	uc010dze.2	-						CACNA1A_uc010xnd.1_Intron|CACNA1A_uc002mwx.3_Intron|CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc010xne.1_Intron|CACNA1A_uc002mwv.3_Intron	NM_001127221	NP_001120693			calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	13634307	13634307	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13634307delC								CACNA1A (17033 upstream) : CCDC130 (208267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	13979875	13979875	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13979875delC								MIR23A (32402 upstream) : MIR181C (5638 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	14476273	14476274	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14476273_14476274insA								LPHN1 (159276 upstream) : CD97 (15939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	14936618	14936618	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14936618delC								OR7C1 (25670 upstream) : OR7A5 (522 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	15176030	15176030	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15176030delT								CASP14 (9130 upstream) : OR1I1 (21847 downstream)																																			---	---	---	---
NWD1	284434	broad.mit.edu	37	19	16893853	16893853	+	Intron	DEL	T	-	-	rs111618636		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16893853delT	uc002neu.3	+						NWD1_uc002net.3_Intron|NWD1_uc002nev.3_Intron					RecName: Full=NACHT and WD repeat domain-containing protein 1;								ATP binding			skin(3)|ovary(2)|pancreas(2)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	17710287	17710288	+	IGR	INS	-	AAGATCA	AAGATCA	rs144470217	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17710287_17710288insAAGATCA								GLT25D1 (16322 upstream) : UNC13A (1850 downstream)																																			---	---	---	---
TMEM59L	25789	broad.mit.edu	37	19	18720844	18720844	+	5'Flank	DEL	G	-	-	rs34456257		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18720844delG	uc002njy.3	+						TMEM59L_uc010ebu.1_5'Flank	NM_012109	NP_036241			brain-specific membrane-anchored protein							Golgi membrane|integral to membrane|membrane fraction				ovary(2)|skin(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	20758004	20758005	+	IGR	INS	-	T	T	rs67489330		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20758004_20758005insT								ZNF737 (9378 upstream) : ZNF626 (44740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	20897985	20897985	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20897985delA								ZNF626 (53583 upstream) : ZNF85 (208095 downstream)																																			---	---	---	---
ZNF429	353088	broad.mit.edu	37	19	21728866	21728866	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21728866delT	uc010ecu.1	+											Homo sapiens KRAB zinc finger protein HZF26 (HZF26) mRNA, partial cds.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2																		---	---	---	---
ZNF254	9534	broad.mit.edu	37	19	24307575	24307576	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24307575_24307576insT	uc002nru.2	+						ZNF254_uc010xrk.1_Intron	NM_203282	NP_975011			zinc finger protein 254						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	27836843	27836844	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27836843_27836844delTG								None (None upstream) : LOC148189 (444558 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	27858357	27858357	+	IGR	DEL	C	-	-	rs143331608		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27858357delC								None (None upstream) : LOC148189 (423045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	28231372	28231372	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28231372delG	uc002nrw.1	-											Homo sapiens cDNA FLJ36869 fis, clone ASTRO2016819.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	28559355	28559356	+	IGR	INS	-	A	A	rs79973765		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28559355_28559356insA								LOC148189 (274507 upstream) : LOC148145 (896684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29315980	29315980	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29315980delA								None (None upstream) : LOC148145 (140060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29568010	29568011	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29568010_29568011delCA								LOC148145 (107955 upstream) : UQCRFS1 (130156 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29913584	29913585	+	Intron	INS	-	AC	AC	rs138747356	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29913584_29913585insAC	uc002nse.1	-											Homo sapiens cDNA FLJ37474 fis, clone BRAWH2012619.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	29981621	29981622	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29981621_29981622insA	uc002nse.1	-											Homo sapiens cDNA FLJ37474 fis, clone BRAWH2012619.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	30362203	30362203	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30362203delA								CCNE1 (46985 upstream) : C19orf2 (52348 downstream)																																			---	---	---	---
C19orf2	8725	broad.mit.edu	37	19	30446889	30446889	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30446889delT	uc002nsr.2	+						C19orf2_uc002nsq.2_Intron|C19orf2_uc002nss.2_Intron	NM_003796	NP_003787			RPB5-mediating protein isoform a						protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	34594751	34594751	+	IGR	DEL	A	-	-	rs72444725		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34594751delA								KCTD15 (288086 upstream) : LSM14A (68601 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	34620164	34620165	+	IGR	INS	-	T	T	rs74177112		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34620164_34620165insT								KCTD15 (313499 upstream) : LSM14A (43187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	35105021	35105021	+	Intron	DEL	T	-	-	rs145725264		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35105021delT	uc002nvo.1	-											Homo sapiens cDNA FLJ36176 fis, clone TESTI2026491.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	36665129	36665132	+	IGR	DEL	TCTC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36665129_36665132delTCTC								COX7A1 (21358 upstream) : ZNF565 (8056 downstream)																																			---	---	---	---
ZNF829	374899	broad.mit.edu	37	19	37398706	37398706	+	Intron	DEL	A	-	-	rs113535347		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37398706delA	uc002ofa.1	-						ZNF345_uc002oez.2_Intron|ZNF829_uc002ofb.2_3'UTR	NM_001037232	NP_001032309			zinc finger protein 829						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---
DPF1	8193	broad.mit.edu	37	19	38714688	38714689	+	Intron	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38714688_38714689delCA	uc002ohl.2	-						DPF1_uc002ohm.2_Intron|DPF1_uc002ohn.2_Intron|DPF1_uc010xtu.1_Intron|DPF1_uc010xtv.1_Intron|DPF1_uc010xtw.1_Intron	NM_004647	NP_004638			D4, zinc and double PHD fingers family 1 isoform						induction of apoptosis|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nBAF complex	zinc ion binding				0	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
KCNK6	9424	broad.mit.edu	37	19	38816199	38816199	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38816199delG	uc002oic.2	+						KCNK6_uc002oid.2_5'UTR	NM_004823	NP_004814			potassium channel, subfamily K, member 6							voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(1)	1	all_cancers(60;5.83e-07)		Lung(45;0.00047)|LUSC - Lung squamous cell carcinoma(53;0.000613)		Ibutilide(DB00308)|Quinidine(DB00908)													---	---	---	---
RYR1	6261	broad.mit.edu	37	19	38997795	38997796	+	Intron	INS	-	AAG	AAG	rs149208626	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38997795_38997796insAAG	uc002oit.2	+						RYR1_uc002oiu.2_Intron|RYR1_uc002oiv.1_Intron	NM_000540	NP_000531			skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	40568357	40568357	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40568357delT								ZNF780B (6242 upstream) : ZNF780A (6703 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	42249228	42249228	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42249228delA								CEACAM5 (14792 upstream) : CEACAM6 (10170 downstream)																																			---	---	---	---
CEACAM3	1084	broad.mit.edu	37	19	42315522	42315522	+	3'UTR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42315522delA	uc002orn.1	+	7					CEACAM3_uc010eia.1_3'UTR|CEACAM3_uc002oro.1_RNA	NM_001815	NP_001806			carcinoembryonic antigen-related cell adhesion							integral to membrane				skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	45240140	45240141	+	IGR	INS	-	G	G	rs144457657	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45240140_45240141insG								CEACAM16 (26156 upstream) : BCL3 (11837 downstream)																																			---	---	---	---
EXOC3L2	90332	broad.mit.edu	37	19	45725889	45725890	+	Intron	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45725889_45725890delTC	uc002pay.1	-							NM_138568	NP_612635			exocyst complex component 3-like 2											ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)														---	---	---	---
EXOC3L2	90332	broad.mit.edu	37	19	45733495	45733495	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45733495delG	uc002pay.1	-							NM_138568	NP_612635			exocyst complex component 3-like 2											ovary(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)														---	---	---	---
EML2	24139	broad.mit.edu	37	19	46125009	46125009	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46125009delT	uc002pcn.2	-						EML2_uc002pco.2_Intron|EML2_uc002pcp.2_Intron|EML2_uc010xxl.1_Intron|EML2_uc010xxm.1_Intron|EML2_uc010xxn.1_Intron|EML2_uc010xxo.1_Intron|EML2_uc010ekj.2_Intron	NM_012155	NP_036287			echinoderm microtubule associated protein like						sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)														---	---	---	---
NUCB1	4924	broad.mit.edu	37	19	49409198	49409202	+	Intron	DEL	CACTC	-	-	rs71903082		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49409198_49409202delCACTC	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175			nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	49524829	49524830	+	IGR	INS	-	GT	GT	rs145027786	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49524829_49524830insGT								LHB (4482 upstream) : CGB (1297 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	52098972	52098975	+	5'Flank	DEL	CCCC	-	-	rs5828485		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52098972_52098975delCCCC	uc002pxd.1	-											SubName: Full=cDNA FLJ30403 fis, clone BRACE2008480; SubName: Full=HCG2008157;																														---	---	---	---
ZNF836	162962	broad.mit.edu	37	19	52667703	52667706	+	Intron	DEL	AAGG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52667703_52667706delAAGG	uc010ydi.1	-						ZNF836_uc010ydj.1_Intron	NM_001102657	NP_001096127			zinc finger protein 836						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ZNF701	55762	broad.mit.edu	37	19	53074487	53074488	+	Intron	DEL	GA	-	-	rs72423162		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53074487_53074488delGA	uc002pzs.1	+						ZNF701_uc010ydn.1_Intron	NM_018260	NP_060730			zinc finger protein 701						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)														---	---	---	---
ZNF83	55769	broad.mit.edu	37	19	53192513	53192513	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53192513delA	uc010epz.2	-						ZNF83_uc010eqb.1_Intron	NM_001105554	NP_001099024			zinc finger protein 83 isoform b							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)														---	---	---	---
ZNF765	91661	broad.mit.edu	37	19	53907252	53907253	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53907252_53907253insA	uc010ydx.1	+						ZNF765_uc002qbm.2_Intron|ZNF765_uc002qbn.2_Intron	NM_001040185	NP_001035275			zinc finger protein 765						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00379)														---	---	---	---
NLRP7	199713	broad.mit.edu	37	19	55473636	55473637	+	Intron	INS	-	T	T	rs34974314		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55473636_55473637insT	uc010esl.2	-							NM_001127255	NP_001120727			NACHT, leucine rich repeat and PYD containing 7								ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)														---	---	---	---
ZNF547	284306	broad.mit.edu	37	19	58069719	58069719	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58069719delC	uc002qpm.3	+						ZNF550_uc002qpc.2_Intron|ZNF550_uc010eue.1_Intron|ZNF550_uc002qpd.2_Intron|ZNF550_uc002qpe.1_5'Flank					RecName: Full=Zinc finger protein 547;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)														---	---	---	---
ZNF329	79673	broad.mit.edu	37	19	58656218	58656218	+	Intron	DEL	T	-	-	rs139667809		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58656218delT	uc002qrn.2	-						ZNF329_uc010euk.1_Intron|ZNF329_uc002qro.1_Intron|ZNF329_uc002qrp.1_Intron	NM_024620	NP_078896			zinc finger protein 329						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)														---	---	---	---
ZNF544	27300	broad.mit.edu	37	19	58754840	58754840	+	Intron	DEL	G	-	-	rs35652921		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58754840delG	uc010euo.2	+						ZNF544_uc010eun.1_Intron|ZNF544_uc010yhw.1_Intron|ZNF544_uc010yhx.1_Intron|ZNF544_uc010yhy.1_Intron|ZNF544_uc002qrt.3_Intron|ZNF544_uc002qru.3_Intron|ZNF544_uc002qrv.2_Intron	NM_014480	NP_055295			zinc finger protein 544						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	356675	356676	+	IGR	INS	-	AAAC	AAAC	rs141017984	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:356675_356676insAAAC								NRSN2 (16331 upstream) : TRIB3 (4632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	1799062	1799063	+	IGR	DEL	CT	-	-	rs11468516		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1799062_1799063delCT								SIRPG (160637 upstream) : SIRPA (75750 downstream)																																			---	---	---	---
PDYN	5173	broad.mit.edu	37	20	1967895	1967898	+	Intron	DEL	ATGA	-	-	rs149917936		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1967895_1967898delATGA	uc010gaj.2	-						uc002wfu.1_Intron|PDYN_uc002wfv.2_Intron|PDYN_uc010zpt.1_Intron	NM_024411	NP_077722			beta-neoendorphin-dynorphin preproprotein						cell death|neuropeptide signaling pathway|synaptic transmission	extracellular region|plasma membrane	opioid peptide activity			upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
PTPRA	5786	broad.mit.edu	37	20	2880095	2880095	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2880095delT	uc010zqb.1	+						VPS16_uc002whh.2_Intron|PTPRA_uc002whj.2_Intron|PTPRA_uc010zqc.1_Intron|PTPRA_uc002whk.2_Intron|PTPRA_uc010zqd.1_Intron|PTPRA_uc002whl.2_Intron|PTPRA_uc002whm.2_Intron					SubName: Full=cDNA FLJ60525, highly similar to Receptor-type tyrosine-protein phosphatase alpha (EC 3.1.3.48);						axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1																		---	---	---	---
C20orf27	54976	broad.mit.edu	37	20	3744222	3744222	+	Intron	DEL	G	-	-	rs33973237		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3744222delG	uc002wji.1	-						C20orf27_uc002wjf.1_Intron|C20orf27_uc002wjh.1_Intron	NM_001039140	NP_001034229			hypothetical protein LOC54976												0																		---	---	---	---
SLC23A2	9962	broad.mit.edu	37	20	4863104	4863105	+	Intron	INS	-	A	A	rs75643994		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4863104_4863105insA	uc002wlg.1	-						SLC23A2_uc010zqr.1_Intron|SLC23A2_uc002wlh.1_Intron|SLC23A2_uc002wli.2_Intron	NM_005116	NP_005107			solute carrier family 23 (nucleobase						L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	5439065	5439065	+	IGR	DEL	A	-	-	rs35693720		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5439065delA								PROKR2 (141687 upstream) : LOC149837 (40153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	7378831	7378831	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7378831delA								BMP2 (617921 upstream) : HAO1 (484800 downstream)																																			---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8381810	8381810	+	Intron	DEL	T	-	-	rs11295611		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8381810delT	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_Intron|PLCB1_uc002wmz.1_Intron|PLCB1_uc002wna.2_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8707206	8707206	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8707206delA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8748897	8748898	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8748897_8748898insT	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	9037434	9037434	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9037434delG								PLCB1 (171889 upstream) : PLCB4 (12267 downstream)																																			---	---	---	---
SNAP25	6616	broad.mit.edu	37	20	10226340	10226341	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10226340_10226341delAC	uc002wnq.1	+						SNAP25_uc002wnr.1_Intron|SNAP25_uc002wns.1_Intron|SNAP25_uc010gca.1_Intron|SNAP25_uc010gcb.1_Intron|SNAP25_uc010gcc.1_Intron	NM_130811	NP_570824			synaptosomal-associated protein 25 isoform						energy reserve metabolic process|glutamate secretion|neurotransmitter uptake|synaptic vesicle docking involved in exocytosis	cell junction|growth cone|perinuclear region of cytoplasm|synapse|synaptosome				skin(2)	2					Botulinum Toxin Type A(DB00083)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	11480601	11480602	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11480601_11480602insA								JAG1 (825907 upstream) : BTBD3 (390875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12089840	12089840	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12089840delA								BTBD3 (182598 upstream) : SPTLC3 (899787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12202023	12202023	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12202023delT								BTBD3 (294781 upstream) : SPTLC3 (787604 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12626960	12626960	+	IGR	DEL	T	-	-	rs73615544		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12626960delT								BTBD3 (719718 upstream) : SPTLC3 (362667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	12849177	12849177	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12849177delA								BTBD3 (941935 upstream) : SPTLC3 (140450 downstream)																																			---	---	---	---
SPTLC3	55304	broad.mit.edu	37	20	13059319	13059320	+	Intron	INS	-	TA	TA			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13059319_13059320insTA	uc002wod.1	+							NM_018327	NP_060797			serine palmitoyltransferase, long chain base						sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)													---	---	---	---
TASP1	55617	broad.mit.edu	37	20	13542525	13542526	+	Intron	INS	-	A	A	rs139759513	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13542525_13542526insA	uc002woi.2	-						TASP1_uc010zri.1_Intron|TASP1_uc002woh.2_Intron|TASP1_uc010zrj.1_Intron	NM_017714	NP_060184			taspase 1 precursor						asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0																		---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	14435076	14435076	+	Intron	DEL	G	-	-	rs68081540		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14435076delG	uc002wou.2	+						MACROD2_uc002wot.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	14562706	14562711	+	Intron	DEL	TTTACA	-	-	rs66872351		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14562706_14562711delTTTACA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002wox.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	16998398	16998398	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16998398delT								OTOR (265590 upstream) : PCSK2 (208354 downstream)																																			---	---	---	---
BFSP1	631	broad.mit.edu	37	20	17492384	17492385	+	Intron	INS	-	A	A	rs150536596	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17492384_17492385insA	uc002wpo.2	-						BFSP1_uc002wpp.2_Intron|BFSP1_uc010zrn.1_Intron|BFSP1_uc010zro.1_Intron	NM_001195	NP_001186			filensin isoform 1							cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens			central_nervous_system(1)	1																		---	---	---	---
RRBP1	6238	broad.mit.edu	37	20	17664439	17664440	+	5'Flank	INS	-	TTCG	TTCG	rs150523235	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17664439_17664440insTTCG	uc010zrq.1	-						RRBP1_uc002wpv.1_5'Flank|RRBP1_uc002wpw.1_5'Flank|RRBP1_uc010gcl.1_5'Flank|RRBP1_uc010zrr.1_5'Flank					SubName: Full=RRBP1 protein; Flags: Fragment;						protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1																		---	---	---	---
C20orf26	26074	broad.mit.edu	37	20	20268766	20268766	+	Intron	DEL	G	-	-	rs11361343		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20268766delG	uc002wru.2	+						C20orf26_uc002wrw.2_Intron	NM_015585	NP_056400			hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	20352370	20352370	+	IGR	DEL	T	-	-	rs138299075		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20352370delT								INSM1 (780 upstream) : RALGAPA2 (21042 downstream)																																			---	---	---	---
XRN2	22803	broad.mit.edu	37	20	21363731	21363732	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21363731_21363732insA	uc002wsf.1	+						XRN2_uc002wsg.1_Intron|XRN2_uc010zsk.1_Intron|XRN2_uc002wsh.1_Intron	NM_012255	NP_036387			5'-3' exoribonuclease 2						cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	23555029	23555029	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23555029delT								CST9L (5643 upstream) : CST9 (28020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	23595206	23595206	+	IGR	DEL	G	-	-	rs71332610		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23595206delG								CST9 (8596 upstream) : CST3 (13330 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	23604767	23604769	+	IGR	DEL	CAA	-	-	rs148436271		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23604767_23604769delCAA								CST9 (18157 upstream) : CST3 (3767 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24113300	24113300	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24113300delC								GGTLC1 (143884 upstream) : TMEM90B (336535 downstream)																																			---	---	---	---
GINS1	9837	broad.mit.edu	37	20	25387525	25387526	+	5'Flank	INS	-	A	A	rs77183061		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25387525_25387526insA	uc002wuv.1	+						GINS1_uc010zte.1_5'Flank	NM_021067	NP_066545			GINS complex subunit 1						DNA strand elongation involved in DNA replication|S phase of mitotic cell cycle	cytoplasm|nucleoplasm				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25862448	25862449	+	IGR	DEL	GA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25862448_25862449delGA								FAM182B (13662 upstream) : LOC100134868 (127986 downstream)																																			---	---	---	---
FAM182A	284800	broad.mit.edu	37	20	26062850	26062851	+	Intron	INS	-	TT	TT	rs149634594	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26062850_26062851insTT	uc010gdq.2	+							NR_026713				Homo sapiens cDNA FLJ38374 fis, clone FEBRA2002552.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	26137886	26137887	+	IGR	INS	-	G	G	rs138944727	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26137886_26137887insG								C20orf191 (43209 upstream) : MIR663 (50935 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29478267	29478268	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29478267_29478268insT								None (None upstream) : FRG1B (133611 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29624864	29624865	+	Intron	INS	-	G	G	rs77578462		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29624864_29624865insG	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010gdr.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29638718	29638719	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29638718_29638719insA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29646613	29646614	+	Intron	DEL	AT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29646613_29646614delAT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	29825100	29825109	+	IGR	DEL	AATGGAATGG	-	-	rs145194358	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29825100_29825109delAATGGAATGG								FRG1B (171192 upstream) : DEFB115 (20358 downstream)																																			---	---	---	---
HM13	81502	broad.mit.edu	37	20	30155311	30155312	+	Intron	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30155311_30155312delTC	uc002wwe.2	+						HM13_uc002wwc.2_Intron|HM13_uc002wwd.2_Intron|HM13_uc002wwf.2_Intron|HM13_uc010gdu.2_Intron	NM_030789	NP_110416			minor histocompatibility antigen 13 isoform 1						membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding			breast(1)	1	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)															---	---	---	---
TPX2	22974	broad.mit.edu	37	20	30366259	30366259	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30366259delT	uc002wwp.1	+						TPX2_uc010gdv.1_Intron	NM_012112	NP_036244			TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)															---	---	---	---
TPX2	22974	broad.mit.edu	37	20	30368698	30368701	+	Intron	DEL	TTAT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30368698_30368701delTTAT	uc002wwp.1	+						TPX2_uc010gdv.1_Intron	NM_012112	NP_036244			TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)															---	---	---	---
COMMD7	149951	broad.mit.edu	37	20	31303288	31303289	+	Intron	INS	-	AAAC	AAAC	rs150588388	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31303288_31303289insAAAC	uc002wya.3	-						COMMD7_uc010ged.2_Intron|COMMD7_uc002wyb.2_Intron	NM_053041	NP_444269			COMM domain containing 7 isoform 1						negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|tumor necrosis factor-mediated signaling pathway		NF-kappaB binding			breast(1)	1																		---	---	---	---
PLUNC	51297	broad.mit.edu	37	20	31827120	31827120	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31827120delA	uc002wyv.2	+						PLUNC_uc002wyt.3_Intron|PLUNC_uc002wyu.3_Intron	NM_130852	NP_570913			palate, lung and nasal epithelium associated						innate immune response	extracellular region	lipid binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	32050968	32050969	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32050968_32050969delAC								SNTA1 (19270 upstream) : CBFA2T2 (26959 downstream)																																			---	---	---	---
RALY	22913	broad.mit.edu	37	20	32660736	32660737	+	Intron	DEL	GT	-	-	rs3835232		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32660736_32660737delGT	uc002xab.2	+						RALY_uc010zui.1_Intron|RALY_uc002xac.2_Intron|RALY_uc002xad.2_Intron|RALY_uc002xae.1_Intron	NM_016732	NP_057951			RNA binding protein (autoantigenic,							catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
EDEM2	55741	broad.mit.edu	37	20	33813761	33813761	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33813761delT	uc010zuv.1	-						MMP24_uc002xbu.2_5'Flank	NM_018217	NP_060687			ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00936)															---	---	---	---
PHF20	51230	broad.mit.edu	37	20	34452330	34452343	+	Intron	DEL	ACACACACACACAC	-	-	rs10561011		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34452330_34452343delACACACACACACAC	uc002xek.1	+						PHF20_uc002xei.1_Intron|PHF20_uc010gfo.1_Intron|PHF20_uc002xej.1_Intron|PHF20_uc002xel.1_Intron	NM_016436	NP_057520			PHD finger protein 20						regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)																	---	---	---	---
DLGAP4	22839	broad.mit.edu	37	20	35054926	35054926	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35054926delA	uc002xff.2	+						DLGAP4_uc010zvp.1_Intron	NM_014902	NP_055717			disks large-associated protein 4 isoform a						cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)																---	---	---	---
C20orf132	140699	broad.mit.edu	37	20	35801933	35801934	+	Intron	INS	-	CTGT	CTGT	rs143367151	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35801933_35801934insCTGT	uc010zvu.1	-						C20orf132_uc002xgm.2_Intron|C20orf132_uc002xgn.2_Intron	NM_152503	NP_689716			hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)																---	---	---	---
RALGAPB	57148	broad.mit.edu	37	20	37118655	37118655	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37118655delT	uc002xiw.2	+						RALGAPB_uc010zvz.1_Intron|RALGAPB_uc002xix.2_Intron|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_5'Flank	NM_020336	NP_065069			Ral GTPase activating protein, beta subunit						activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	39627107	39627109	+	Intron	DEL	TAA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39627107_39627109delTAA	uc002xjj.2	+						uc002xjk.2_Intron					Homo sapiens cDNA FLJ10978 fis, clone PLACE1001484.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	42375448	42375448	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42375448delA								GTSF1L (19806 upstream) : TOX2 (168044 downstream)																																			---	---	---	---
ZNF335	63925	broad.mit.edu	37	20	44586694	44586695	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44586694_44586695insT	uc002xqw.2	-						ZNF335_uc010zxk.1_Intron	NM_022095	NP_071378			zinc finger protein 335						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|ovary(1)	4		Myeloproliferative disorder(115;0.0122)																---	---	---	---
SNAI1	6615	broad.mit.edu	37	20	48602569	48602569	+	Intron	DEL	G	-	-	rs67500998		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48602569delG	uc002xuz.2	+							NM_005985	NP_005976			snail 1 homolog						epithelial to mesenchymal transition|mesoderm formation|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|zinc ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	48644815	48644826	+	IGR	DEL	ACACACACACAC	-	-	rs36232176	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48644815_48644826delACACACACACAC								SNAI1 (39397 upstream) : TMEM189-UBE2V1 (52837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	48823859	48823861	+	IGR	DEL	AAG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48823859_48823861delAAG								CEBPB (14647 upstream) : PTPN1 (303030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49853841	49853842	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49853841_49853842insA								KCNG1 (214166 upstream) : NFATC2 (153924 downstream)																																			---	---	---	---
ATP9A	10079	broad.mit.edu	37	20	50278341	50278342	+	Intron	INS	-	AC	AC	rs150689439	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50278341_50278342insAC	uc002xwg.1	-						ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036			ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	50563356	50563357	+	IGR	DEL	GT	-	-	rs111578894		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50563356_50563357delGT								SALL4 (144308 upstream) : ZFP64 (137194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	51043544	51043544	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51043544delA								ZFP64 (235020 upstream) : TSHZ2 (545333 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	51058845	51058848	+	IGR	DEL	AGAA	-	-	rs144149431		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51058845_51058848delAGAA								ZFP64 (250321 upstream) : TSHZ2 (530029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52524257	52524257	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52524257delA								SUMO1P1 (32009 upstream) : BCAS1 (35822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52999960	52999960	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52999960delT								PFDN4 (163469 upstream) : DOK5 (92297 downstream)																																			---	---	---	---
DOK5	55816	broad.mit.edu	37	20	53103110	53103111	+	Intron	INS	-	CA	CA	rs144765725	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53103110_53103111insCA	uc002xwy.2	+						DOK5_uc010gin.2_Intron|DOK5_uc002xwz.2_Intron	NM_018431	NP_060901			docking protein 5								insulin receptor binding			ovary(1)	1			Colorectal(105;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	53318316	53318317	+	IGR	DEL	AG	-	-	rs144037618	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53318316_53318317delAG								DOK5 (50607 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	53374279	53374279	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53374279delT								DOK5 (106570 upstream) : None (None downstream)																																			---	---	---	---
AURKA	6790	broad.mit.edu	37	20	54949073	54949074	+	Intron	DEL	AC	-	-	rs144437309		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54949073_54949074delAC	uc002xxd.1	-						AURKA_uc002xxe.1_Intron|AURKA_uc002xxf.1_Intron|AURKA_uc002xxg.1_Intron|AURKA_uc002xxh.1_Intron|AURKA_uc002xxi.1_Intron|AURKA_uc002xxj.1_Intron|AURKA_uc002xxk.1_Intron|AURKA_uc010zzd.1_Intron	NM_198433	NP_940835			serine/threonine protein kinase 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|phosphatidylinositol-mediated signaling|regulation of protein stability|spindle organization	cytosol|nucleus|perinuclear region of cytoplasm|spindle microtubule|spindle pole centrosome	ATP binding|protein kinase binding|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(1)|large_intestine(1)|skin(1)	8			Colorectal(105;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	55183444	55183446	+	IGR	DEL	AAG	-	-	rs74181063		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55183444_55183446delAAG								C20orf107 (71870 upstream) : TFAP2C (20912 downstream)																																			---	---	---	---
PMEPA1	56937	broad.mit.edu	37	20	56234228	56234229	+	Intron	INS	-	CTC	CTC	rs143496846	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56234228_56234229insCTC	uc002xyq.2	-						PMEPA1_uc002xyr.2_Intron|PMEPA1_uc002xys.2_Intron|PMEPA1_uc002xyt.2_Intron	NM_020182	NP_064567			transmembrane prostate androgen-induced protein						androgen receptor signaling pathway	integral to membrane|plasma membrane	WW domain binding			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	59172873	59172873	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59172873delG	uc010gjw.1	+											Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																														---	---	---	---
CDH4	1002	broad.mit.edu	37	20	59866747	59866748	+	Intron	INS	-	TGCTGTG	TGCTGTG	rs150846216	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59866747_59866748insTGCTGTG	uc002ybn.1	+							NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60253209	60253215	+	Intron	DEL	GATGGAT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60253209_60253215delGATGGAT	uc002ybn.1	+						CDH4_uc002ybo.1_Intron|CDH4_uc002ybp.1_Intron	NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
TAF4	6874	broad.mit.edu	37	20	60610635	60610640	+	Intron	DEL	AAAAGC	-	-	rs73628182	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60610635_60610640delAAAAGC	uc002ybs.2	-							NM_003185	NP_003176			TBP-associated factor 4						interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	60663550	60663551	+	IGR	INS	-	CACACA	CACACA	rs139706353	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60663550_60663551insCACACA								TAF4 (22684 upstream) : LSM14B (33966 downstream)																																			---	---	---	---
LAMA5	3911	broad.mit.edu	37	20	60917359	60917359	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60917359delA	uc002ycq.2	-							NM_005560	NP_005551			laminin alpha 5 precursor						angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	61899184	61899185	+	IGR	DEL	TG	-	-	rs147621065		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61899184_61899185delTG								FLJ16779 (6221 upstream) : ARFGAP1 (4980 downstream)																																			---	---	---	---
ZBTB46	140685	broad.mit.edu	37	20	62452248	62452249	+	Intron	INS	-	T	T	rs112667175		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62452248_62452249insT	uc002ygu.2	-						uc002ygw.2_Intron	NM_025224				zinc finger and BTB domain containing 46						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)|ovary(1)	2	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)																	---	---	---	---
ZNF512B	57473	broad.mit.edu	37	20	62602273	62602274	+	5'Flank	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62602273_62602274delTT	uc002yhl.1	-							NM_020713	NP_065764			zinc finger protein 512B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)																	---	---	---	---
Unknown	0	broad.mit.edu	37	21	9834535	9834535	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9834535delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10401098	10401099	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10401098_10401099delAC								None (None upstream) : TPTE (505644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10824463	10824467	+	IGR	DEL	GAATG	-	-	rs138742671		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10824463_10824467delGAATG								None (None upstream) : TPTE (82276 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10840555	10840555	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10840555delG								None (None upstream) : TPTE (66188 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10855527	10855528	+	IGR	INS	-	GAATG	GAATG	rs150774792		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10855527_10855528insGAATG								None (None upstream) : TPTE (51215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10894925	10894926	+	IGR	INS	-	CCTT	CCTT	rs142337572	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10894925_10894926insCCTT								None (None upstream) : TPTE (11817 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11129890	11129891	+	IGR	INS	-	T	T	rs138525903		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11129890_11129891insT								BAGE (30953 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	11163941	11163941	+	IGR	DEL	T	-	-	rs148282638		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11163941delT								BAGE (65004 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14396225	14396226	+	IGR	DEL	AC	-	-	rs148035813		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14396225_14396226delAC								None (None upstream) : C21orf99 (14261 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14874100	14874100	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14874100delA								C21orf99 (383531 upstream) : POTED (108398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	15275937	15275938	+	5'Flank	INS	-	A	A	rs147035684	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15275937_15275938insA	uc002yjg.2	+											DQ579288																														---	---	---	---
C21orf34	388815	broad.mit.edu	37	21	17955966	17955966	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17955966delG	uc002ykb.2	+						C21orf34_uc010glc.2_Intron|C21orf34_uc002ykc.2_Intron	NR_027790				Homo sapiens C21ORF34 (C21orf34) mRNA, partial cds, alternatively spliced.												0		Breast(209;0.152)		Epithelial(23;8.3e-05)|all cancers(11;0.000383)|Colorectal(24;0.00387)|COAD - Colon adenocarcinoma(22;0.0113)|OV - Ovarian serous cystadenocarcinoma(11;0.0127)|LUSC - Lung squamous cell carcinoma(23;0.153)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	18445851	18445851	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18445851delA								C21orf34 (463757 upstream) : CXADR (439479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	18697495	18697496	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18697495_18697496insA								C21orf34 (715401 upstream) : CXADR (187834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	20916314	20916317	+	IGR	DEL	TTTG	-	-	rs34397513		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20916314_20916317delTTTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	21482792	21482793	+	IGR	DEL	AA	-	-	rs113394610		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21482792_21482793delAA								None (None upstream) : C21orf131 (632121 downstream)																																			---	---	---	---
NCAM2	4685	broad.mit.edu	37	21	22386740	22386741	+	Intron	INS	-	A	A	rs71322017		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22386740_22386741insA	uc002yld.1	+						NCAM2_uc011acb.1_Intron	NM_004540	NP_004531			neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	23085494	23085494	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23085494delA								NCAM2 (174280 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	24469618	24469618	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24469618delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	25675001	25675002	+	IGR	DEL	TG	-	-	rs140994127		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:25675001_25675002delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	26020893	26020896	+	IGR	DEL	TTCC	-	-	rs67729072		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26020893_26020896delTTCC								None (None upstream) : NCRNA00158 (737238 downstream)																																			---	---	---	---
CYYR1	116159	broad.mit.edu	37	21	27867872	27867872	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27867872delA	uc002ymd.2	-						CYYR1_uc011ack.1_Intron|CYYR1_uc002yme.2_Intron	NM_052954	NP_443186			cysteine and tyrosine-rich 1 protein precursor							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	29085026	29085027	+	IGR	INS	-	T	T	rs111275699		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29085026_29085027insT								ADAMTS5 (745587 upstream) : NCRNA00113 (9671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29548905	29548906	+	Intron	DEL	AG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29548905_29548906delAG	uc002yml.2	-											Homo sapiens cDNA clone IMAGE:5541115, partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	30757645	30757653	+	IGR	DEL	CCCTGTCTC	-	-	rs112563832		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30757645_30757653delCCCTGTCTC								BACH1 (23428 upstream) : GRIK1 (151603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	31726892	31726892	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31726892delT								KRTAP23-1 (5968 upstream) : KRTAP13-2 (16818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	33110490	33110491	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33110490_33110491insT								SFRS15 (6059 upstream) : HUNK (135137 downstream)																																			---	---	---	---
GCFC1	94104	broad.mit.edu	37	21	34143306	34143306	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34143306delG	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron|C21orf49_uc002yqs.2_5'Flank|C21orf49_uc002yqu.3_5'Flank|C21orf49_uc002yqt.2_5'Flank	NM_016631	NP_057715			GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	35529472	35529473	+	IGR	INS	-	TG	TG	rs147597208	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35529472_35529473insTG								MRPS6 (14138 upstream) : C21orf82 (23505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	36159413	36159413	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36159413delA								NCRNA00160 (49934 upstream) : RUNX1 (686 downstream)																																			---	---	---	---
RUNX1	861	broad.mit.edu	37	21	36786007	36786007	+	Intron	DEL	A	-	-	rs113236714		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36786007delA	uc002yut.1	-											Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387								T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				---	---	---	---
MORC3	23515	broad.mit.edu	37	21	37696178	37696178	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37696178delT	uc002yvi.2	+							NM_015358	NP_056173			MORC family CW-type zinc finger 3						cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	38016355	38016355	+	IGR	DEL	C	-	-	rs150851221		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38016355delC								CLDN14 (67488 upstream) : SIM2 (55636 downstream)																																			---	---	---	---
KCNJ6	3763	broad.mit.edu	37	21	39026716	39026717	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39026716_39026717insA	uc011aej.1	-						KCNJ6_uc002ywo.2_Intron	NM_002240	NP_002231			potassium inwardly-rectifying channel J6						synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)													---	---	---	---
Unknown	0	broad.mit.edu	37	21	43151932	43151932	+	IGR	DEL	A	-	-	rs75126539		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43151932delA								NCRNA00112 (14191 upstream) : RIPK4 (7597 downstream)																																			---	---	---	---
UMODL1	89766	broad.mit.edu	37	21	43482512	43482512	+	5'Flank	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43482512delC	uc002zae.1	+						UMODL1_uc002zad.1_5'Flank	NM_173568	NP_775839			uromodulin-like 1 isoform 2 precursor							cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3																		---	---	---	---
WDR4	10785	broad.mit.edu	37	21	44271722	44271722	+	Intron	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44271722delG	uc002zci.2	-						WDR4_uc002zck.1_Intron|WDR4_uc002zcl.1_Intron|WDR4_uc010gpg.1_Intron|WDR4_uc011aew.1_Intron|WDR4_uc010gph.1_Intron	NM_033661	NP_387510			WD repeat domain 4 protein						tRNA modification	cytoplasm|nucleoplasm	protein binding			ovary(1)	1				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	44580490	44580498	+	IGR	DEL	CACACACAC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44580490_44580498delCACACACAC								U2AF1 (52802 upstream) : CRYAA (8643 downstream)																																			---	---	---	---
HSF2BP	11077	broad.mit.edu	37	21	45021192	45021192	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45021192delT	uc002zdi.2	-						HSF2BP_uc011aey.1_Intron	NM_007031	NP_008962			heat shock transcription factor 2 binding						spermatogenesis|transcription from RNA polymerase II promoter	cytosol	binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	16902631	16902634	+	IGR	DEL	ACAA	-	-	rs113850822		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16902631_16902634delACAA								OR11H1 (452827 upstream) : CCT8L2 (169014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17388694	17388696	+	IGR	DEL	TTA	-	-	rs140889738		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17388694_17388696delTTA								HSFYL1 (78469 upstream) : GAB4 (54133 downstream)																																			---	---	---	---
CECR7	100130418	broad.mit.edu	37	22	17524154	17524154	+	Intron	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17524154delA	uc002zlx.1	+							NR_015352				Homo sapiens cDNA FLJ40726 fis, clone TKIDN1000164.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	18886526	18886526	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18886526delT								GGT3P (93534 upstream) : DGCR6 (7015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	19560227	19560227	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19560227delT								LOC150185 (5865 upstream) : SEPT5 (141760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	20188920	20188931	+	Intron	DEL	CCTTCCTTCCTT	-	-	rs71987686		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20188920_20188931delCCTTCCTTCCTT	uc002zrs.1	-											Homo sapiens cDNA FLJ35233 fis, clone PROST2001540.																														---	---	---	---
Unknown	0	broad.mit.edu	37	22	20212756	20212757	+	IGR	DEL	CA	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20212756_20212757delCA								LOC150197 (16696 upstream) : RTN4R (16183 downstream)																																			---	---	---	---
ZNF74	7625	broad.mit.edu	37	22	20753861	20753862	+	Intron	INS	-	T	T	rs141114891		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20753861_20753862insT	uc010gsm.2	+						ZNF74_uc002zsg.2_Intron|ZNF74_uc002zsh.2_Intron|ZNF74_uc002zsi.2_Intron|ZNF74_uc010gsn.2_Intron	NM_003426	NP_003417			zinc finger protein 74						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	actin cytoskeleton|nucleus	DNA binding|RNA binding|zinc ion binding			ovary(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)															---	---	---	---
KLHL22	84861	broad.mit.edu	37	22	20840971	20840971	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20840971delT	uc002zsl.1	-						KLHL22_uc011ahr.1_Intron|KLHL22_uc002zsm.1_Intron	NM_032775	NP_116164			kelch-like						cell division	Cul3-RING ubiquitin ligase complex				lung(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)															---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22644316	22644317	+	Intron	DEL	GG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22644316_22644317delGG	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22942420	22942421	+	Intron	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22942420_22942421insA	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	23945410	23945411	+	IGR	INS	-	T	T	rs139933610	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23945410_23945411insT								IGLL1 (22915 upstream) : C22orf43 (5229 downstream)																																			---	---	---	---
CYTSA	23384	broad.mit.edu	37	22	24678629	24678630	+	Intron	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24678629_24678630insT	uc002zzw.2	+						CYTSA_uc002zzv.3_Intron|CYTSA_uc011ajq.1_Intron	NM_015330	NP_056145			cytospin A						cell cycle|cell division						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	25347467	25347468	+	IGR	INS	-	T	T	rs9624677	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25347467_25347468insT								TMEM211 (12153 upstream) : KIAA1671 (76473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	25656029	25656031	+	IGR	DEL	CTC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25656029_25656031delCTC								CRYBB2 (28193 upstream) : IGLL3 (57857 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27137885	27137886	+	IGR	INS	-	TCT	TCT	rs149086090	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27137885_27137886insTCT								MIAT (22936 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27993529	27993529	+	IGR	DEL	A	-	-	rs35301367		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27993529delA								MIAT (878580 upstream) : MN1 (150737 downstream)																																			---	---	---	---
TTC28	23331	broad.mit.edu	37	22	28560380	28560380	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28560380delT	uc003adp.3	-							NM_001145418	NP_001138890			tetratricopeptide repeat domain 28								binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	29899736	29899736	+	IGR	DEL	A	-	-	rs144045243		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29899736delA								NEFH (12461 upstream) : THOC5 (4421 downstream)																																			---	---	---	---
NF2	4771	broad.mit.edu	37	22	30075976	30075977	+	Intron	INS	-	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30075976_30075977insC	uc003age.3	+						NF2_uc003afy.3_Intron|NF2_uc003afz.3_Intron|NF2_uc003agf.3_Intron|NF2_uc003agb.3_Intron|NF2_uc003agc.3_Intron|NF2_uc003agd.3_Intron|NF2_uc003agg.3_Intron|NF2_uc003aga.3_Intron|NF2_uc003agh.3_Intron|NF2_uc003agi.3_Intron|NF2_uc003agj.3_Intron|NF2_uc003agk.3_Intron|NF2_uc010gvp.2_Intron|NF2_uc011akq.1_Intron	NM_000268	NP_000259			neurofibromin 2 isoform 1						actin cytoskeleton organization|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of cell-matrix adhesion|negative regulation of DNA replication|negative regulation of tyrosine phosphorylation of Stat3 protein|negative regulation of tyrosine phosphorylation of Stat5 protein|positive regulation of stress fiber assembly|regulation of hippo signaling cascade|Schwann cell proliferation	cytoskeleton|early endosome|extrinsic to membrane|filopodium membrane|nucleolus|perinuclear region of cytoplasm|ruffle membrane	cytoskeletal protein binding|protein binding	p.?(1)		meninges(372)|soft_tissue(284)|central_nervous_system(20)|kidney(10)|pleura(9)|skin(7)|large_intestine(5)|breast(5)|urinary_tract(3)|thyroid(2)|endometrium(2)|ovary(2)|lung(2)|stomach(2)|bone(2)|pituitary(1)	728								D|Mis|N|F|S|O		meningioma|acoustic neuroma|renal 	meningioma|acoustic neuroma			Neurofibromatosis_type_2				---	---	---	---
Unknown	0	broad.mit.edu	37	22	30918921	30918921	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30918921delT								SEC14L4 (17223 upstream) : GAL3ST1 (31703 downstream)																																			---	---	---	---
LIMK2	3985	broad.mit.edu	37	22	31649333	31649333	+	Intron	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31649333delC	uc003akh.2	+						LIMK2_uc003akg.2_Intron|LIMK2_uc003aki.2_Intron|LIMK2_uc003akj.2_Intron|LIMK2_uc003akk.2_Intron|LIMK2_uc011aln.1_Intron	NM_005569	NP_005560			LIM domain kinase 2 isoform 2a							mitochondrion|nucleus	ATP binding|protein serine/threonine kinase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	35638524	35638525	+	IGR	DEL	CT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35638524_35638525delCT								ISX (155146 upstream) : HMGXB4 (14920 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	35980877	35980878	+	IGR	DEL	GT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35980877_35980878delGT								RASD2 (30834 upstream) : MB (21934 downstream)																																			---	---	---	---
NCF4	4689	broad.mit.edu	37	22	37259296	37259296	+	Intron	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37259296delT	uc003apy.3	+						NCF4_uc003apz.3_Intron	NM_000631	NP_000622			neutrophil cytosolic factor 4 isoform 1						cell communication|immune response|oxidation-reduction process	cytosol|NADPH oxidase complex	phosphatidylinositol binding|protein dimerization activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	37518741	37518742	+	IGR	INS	-	CTC	CTC	rs34028040		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37518741_37518742insCTC								TMPRSS6 (13138 upstream) : IL2RB (3138 downstream)																																			---	---	---	---
CYTH4	27128	broad.mit.edu	37	22	37704913	37704914	+	Intron	DEL	GC	-	-	rs35720920		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37704913_37704914delGC	uc003arf.2	+						CYTH4_uc003are.2_Intron|CYTH4_uc011amw.1_Intron|CYTH4_uc010gxe.2_Intron	NM_013385	NP_037517			cytohesin 4						regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
PICK1	9463	broad.mit.edu	37	22	38453648	38453649	+	Intron	INS	-	G	G	rs146374889	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38453648_38453649insG	uc003auq.2	+						PICK1_uc003aur.2_Intron|PICK1_uc003aus.2_Intron|PICK1_uc003aut.2_5'Flank	NM_012407	NP_036539			protein interacting with C kinase 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|DNA methylation involved in embryo development|DNA methylation involved in gamete generation|monoamine transport|neuronal ion channel clustering|protein phosphorylation|receptor clustering|retrograde vesicle-mediated transport, Golgi to ER|synaptic transmission	cell junction|endocytic vesicle membrane|Golgi apparatus|perinuclear region of cytoplasm|presynaptic membrane	ATPase activity|metal ion binding|protein C-terminus binding|protein kinase C binding|receptor binding				0	Melanoma(58;0.045)																	---	---	---	---
SLC16A8	23539	broad.mit.edu	37	22	38480371	38480371	+	5'Flank	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38480371delA	uc003auu.2	-							NM_013356	NP_037488			solute carrier family 16, member 8						blood coagulation|leukocyte migration|pyruvate metabolic process	integral to plasma membrane|membrane fraction	lactate transmembrane transporter activity|secondary active monocarboxylate transmembrane transporter activity|symporter activity				0	Melanoma(58;0.045)				Pyruvic acid(DB00119)													---	---	---	---
TEF	7008	broad.mit.edu	37	22	41761384	41761389	+	5'Flank	DEL	TGTGTG	-	-	rs67617287		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41761384_41761389delTGTGTG	uc003azx.2	+							NM_001145398	NP_001138870			thyrotrophic embryonic factor isoform 2						rhythmic process	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
NFAM1	150372	broad.mit.edu	37	22	42776800	42776801	+	3'UTR	INS	-	A	A	rs75167297		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42776800_42776801insA	uc003bcn.3	-	6						NM_145912	NP_666017			NFAT activation molecule 1 precursor						B cell differentiation|inflammatory response|intracellular signal transduction|positive regulation of B cell receptor signaling pathway|positive regulation of cytokine production|positive regulation of sequence-specific DNA binding transcription factor activity	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity				0																		---	---	---	---
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45134614	45134615	+	Intron	DEL	CT	-	-	rs73889726		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45134614_45134615delCT	uc003bfd.2	+						PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|PRR5-ARHGAP8_uc003bfg.1_Intron	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	46242475	46242475	+	IGR	DEL	T	-	-	rs66525868		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46242475delT								ATXN10 (1646 upstream) : WNT7B (73773 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	46259459	46259460	+	IGR	INS	-	A	A	rs145137275	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46259459_46259460insA								ATXN10 (18630 upstream) : WNT7B (56788 downstream)																																			---	---	---	---
PPARA	5465	broad.mit.edu	37	22	46602168	46602169	+	Intron	DEL	TG	-	-	rs35700219		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46602168_46602169delTG	uc003bgw.1	+						PPARA_uc003bgx.1_Intron|PPARA_uc010hab.1_Intron|PPARA_uc003bha.2_Intron|PPARA_uc003bhb.1_Intron|PPARA_uc010hac.1_Intron	NM_005036	NP_005027			peroxisome proliferative activated receptor,						fatty acid metabolic process|fatty acid transport|negative regulation of appetite|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fatty acid beta-oxidation|regulation of cellular ketone metabolic process by positive regulation of transcription from an RNA polymerase II promoter|regulation of glycolysis by positive regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|ligand-regulated transcription factor activity|lipid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|ubiquitin conjugating enzyme binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Simvastatin(DB00641)													---	---	---	---
Unknown	0	broad.mit.edu	37	22	47777633	47777633	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47777633delA								TBC1D22A (207911 upstream) : None (None downstream)																																			---	---	---	---
FAM19A5	25817	broad.mit.edu	37	22	49131686	49131686	+	Intron	DEL	G	-	-	rs10716843		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49131686delG	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436			family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	50151651	50151651	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50151651delT								C22orf34 (100461 upstream) : BRD1 (15287 downstream)																																			---	---	---	---
PIM3	415116	broad.mit.edu	37	22	50355032	50355034	+	Intron	DEL	GGC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50355032_50355034delGGC	uc003bjb.2	+						PIM3_uc011arj.1_5'Flank	NM_001001852	NP_001001852			serine/threonine protein kinase pim-3						cell cycle|negative regulation of apoptosis|regulation of mitotic cell cycle		ATP binding|protein binding|protein serine/threonine kinase activity				0		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.196)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
TTLL8	164714	broad.mit.edu	37	22	50467360	50467360	+	Intron	DEL	C	-	-	rs74203202		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50467360delC	uc011ark.1	-							NM_001080447	NP_001073916			tubulin tyrosine ligase-like family, member 8											ovary(2)	2		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)														---	---	---	---
SAPS2	9701	broad.mit.edu	37	22	50795362	50795363	+	Intron	INS	-	A	A	rs148255072	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50795362_50795363insA	uc003blc.2	+						SAPS2_uc003bky.1_Intron|SAPS2_uc003bkz.1_Intron|SAPS2_uc003bla.1_Intron	NM_014678	NP_055493			SAPS domain family, member 2							cytoplasm|intracellular membrane-bounded organelle	protein binding				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.222)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	423089	423089	+	IGR	DEL	G	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:423089delG								PPP2R3B (75462 upstream) : SHOX (161990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	635746	635747	+	IGR	DEL	AG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:635746_635747delAG								SHOX (15601 upstream) : CRLF2 (679140 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	722086	722100	+	IGR	DEL	CTCCTTCTCCTCCTC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:722086_722100delCTCCTTCTCCTCCTC								SHOX (101941 upstream) : CRLF2 (592787 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	952162	952163	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:952162_952163delTG								SHOX (332017 upstream) : CRLF2 (362724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1679610	1679611	+	IGR	DEL	TC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1679610_1679611delTC								P2RY8 (23573 upstream) : SFRS17A (30875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1702553	1702554	+	IGR	INS	-	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1702553_1702554insT								P2RY8 (46516 upstream) : SFRS17A (7932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	2023474	2023475	+	IGR	INS	-	TGG	TGG			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2023474_2023475insTGG								ASMT (261501 upstream) : DHRSX (114082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	21015958	21015959	+	IGR	DEL	TG	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21015958_21015959delTG								RPS6KA3 (730435 upstream) : CNKSR2 (377021 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	39474377	39474377	+	IGR	DEL	C	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39474377delC								MID1IP1 (808596 upstream) : BCOR (436124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	49630132	49630132	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49630132delT								PAGE4 (31562 upstream) : LOC158572 (11196 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	61734096	61734097	+	IGR	INS	-	AA	AA	rs112959578		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61734096_61734097insAA								None (None upstream) : SPIN4 (833011 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	61847720	61847720	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61847720delT								None (None upstream) : SPIN4 (719388 downstream)																																			---	---	---	---
FAM46D	169966	broad.mit.edu	37	X	79634987	79634988	+	Intron	DEL	TT	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79634987_79634988delTT	uc004edl.1	+							NM_152630	NP_689843			hypothetical protein LOC169966											lung(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	82130968	82130969	+	IGR	INS	-	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82130968_82130969insA								None (None upstream) : POU3F4 (632300 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	88396028	88396029	+	IGR	INS	-	ACACACAC	ACACACAC			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:88396028_88396029insACACACAC								CPXCR1 (386245 upstream) : TGIF2LX (780911 downstream)																																			---	---	---	---
PRPS1	5631	broad.mit.edu	37	X	106877687	106877688	+	Intron	INS	-	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106877687_106877688insC	uc004ene.3	+						PRPS1_uc010npg.2_Intron|PRPS1_uc011msj.1_Intron	NM_002764	NP_002755			phosphoribosyl pyrophosphate synthetase 1						5-phosphoribose 1-diphosphate biosynthetic process|hypoxanthine biosynthetic process|nervous system development|nucleoside metabolic process|purine nucleotide biosynthetic process|pyrimidine nucleotide biosynthetic process|ribonucleoside monophosphate biosynthetic process|urate biosynthetic process	cytosol	ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			breast(3)|large_intestine(1)	4																		---	---	---	---
ZCCHC16	340595	broad.mit.edu	37	X	111448835	111448836	+	Intron	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111448835_111448836delAC	uc004epo.1	+							NM_001004308	NP_001004308			zinc finger, CCHC domain containing 16								nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	133415630	133415630	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133415630delA								CCDC160 (35824 upstream) : PHF6 (91712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	136489989	136489989	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136489989delT								GPR101 (376156 upstream) : ZIC3 (158357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	141582169	141582169	+	IGR	DEL	A	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:141582169delA								MAGEC2 (289093 upstream) : SPANXN4 (531535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	145039336	145039337	+	IGR	DEL	AC	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145039336_145039337delAC								CXorf1 (127968 upstream) : MIR890 (36456 downstream)																																			---	---	---	---
VAMP7	6845	broad.mit.edu	37	X	155138279	155138280	+	Intron	INS	-	TTTG	TTTG			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155138279_155138280insTTTG	uc004fnr.2	+						VAMP7_uc004fnt.2_Intron|VAMP7_uc011naa.1_Intron|VAMP7_uc011nab.1_Intron|VAMP7_uc004fns.2_Intron|VAMP7_uc011nac.1_Intron	NM_005638	NP_005629			vesicle-associated membrane protein 7 isoform 1						calcium ion-dependent exocytosis|endosome to lysosome transport|eosinophil degranulation|ER to Golgi vesicle-mediated transport|neutrophil degranulation|phagocytosis, engulfment|post-Golgi vesicle-mediated transport|protein transport|vesicle fusion	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|phagocytic vesicle membrane|plasma membrane|SNARE complex|transport vesicle membrane	protein binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)																	---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9931909	9931909	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9931909delT								TTTY22 (281055 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9933276	9933276	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9933276delT								TTTY22 (282422 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	9951063	9951064	+	IGR	DEL	AA	-	-	rs144784124		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9951063_9951064delAA								TTTY22 (300209 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13399277	13399277	+	IGR	DEL	T	-	-			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13399277delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	59032513	59032515	+	IGR	DEL	TCC	-	-	rs4047360		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59032513_59032515delTCC								None (None upstream) : None (None downstream)																																			---	---	---	---
KLHL17	339451	broad.mit.edu	37	1	898763	898763	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:898763G>A	uc001aca.1	+	8	1341	c.1234G>A	c.(1234-1236)GTG>ATG	p.V412M	KLHL17_uc001acc.1_RNA|KLHL17_uc010nyb.1_3'UTR	NM_198317	NP_938073	Q6TDP4	KLH17_HUMAN	kelch-like 17	412	Interaction with F-actin (By similarity).|Kelch 2.				actin cytoskeleton organization	actin cytoskeleton|cell junction|postsynaptic density|postsynaptic membrane	protein complex scaffold				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)														---	---	---	---
EXTL1	2134	broad.mit.edu	37	1	26349582	26349582	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26349582A>G	uc001blf.2	+	1	1312	c.445A>G	c.(445-447)ATG>GTG	p.M149V		NM_004455	NP_004446	Q92935	EXTL1_HUMAN	exostoses-like 1	149	Lumenal (Potential).				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
TRIM62	55223	broad.mit.edu	37	1	33613159	33613159	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33613159G>A	uc001bxb.2	-	5	1685	c.1047C>T	c.(1045-1047)GGC>GGT	p.G349G		NM_018207	NP_060677	Q9BVG3	TRI62_HUMAN	tripartite motif-containing 62	349	B30.2/SPRY.					intracellular	zinc ion binding				0		Myeloproliferative disorder(586;0.0393)																---	---	---	---
NCDN	23154	broad.mit.edu	37	1	36026775	36026775	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36026775G>T	uc001bza.2	+	4	1150	c.1023G>T	c.(1021-1023)ATG>ATT	p.M341I	NCDN_uc001bzb.2_Missense_Mutation_p.M341I|NCDN_uc001bzc.2_Missense_Mutation_p.M324I	NM_001014839	NP_001014839	Q9UBB6	NCDN_HUMAN	neurochondrin isoform 1	341					neuron projection development	cytosol|dendrite|neuronal cell body				large_intestine(2)|pancreas(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---
MACF1	23499	broad.mit.edu	37	1	39827053	39827053	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39827053C>T	uc010oiu.1	+	13	7926	c.7795C>T	c.(7795-7797)CGG>TGG	p.R2599W	MACF1_uc010ois.1_Missense_Mutation_p.R2097W|MACF1_uc001cda.1_Missense_Mutation_p.R2005W|MACF1_uc001cdc.1_Missense_Mutation_p.R1184W|MACF1_uc001cdb.1_Missense_Mutation_p.R1184W	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	4164					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---
MFSD2A	84879	broad.mit.edu	37	1	40434278	40434278	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40434278G>A	uc001cev.2	+	13	1610	c.1429G>A	c.(1429-1431)GAA>AAA	p.E477K	MFSD2A_uc010ojb.1_Missense_Mutation_p.E425K|MFSD2A_uc001ceu.2_Missense_Mutation_p.E464K|MFSD2A_uc010ojc.1_Missense_Mutation_p.E308K|MFSD2A_uc009vvy.2_RNA|MFSD2A_uc001cex.2_Missense_Mutation_p.E128K	NM_001136493	NP_001129965	Q8NA29	MFS2A_HUMAN	major facilitator superfamily domain containing	477					transmembrane transport	endoplasmic reticulum membrane|integral to membrane				ovary(1)|pancreas(1)	2																		---	---	---	---
RIMKLA	284716	broad.mit.edu	37	1	42865118	42865118	+	Silent	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42865118G>T	uc001chi.2	+	2	345	c.207G>T	c.(205-207)GTG>GTT	p.V69V		NM_173642	NP_775913	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family	69					protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0																		---	---	---	---
PTCH2	8643	broad.mit.edu	37	1	45292608	45292608	+	Silent	SNP	G	A	A	rs149815763	byFrequency	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45292608G>A	uc010olf.1	-	17	2673	c.2661C>T	c.(2659-2661)CAC>CAT	p.H887H	PTCH2_uc010olg.1_Silent_p.H585H	NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	887	Extracellular (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(6)|breast(6)|central_nervous_system(3)|skin(2)|ovary(1)	18	Acute lymphoblastic leukemia(166;0.155)													Basal_Cell_Nevus_syndrome				---	---	---	---
TNNI3K	51086	broad.mit.edu	37	1	74905163	74905163	+	Intron	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74905163T>G	uc001dgf.1	+						TNNI3K_uc001dgd.2_Intron|TNNI3K_uc001dge.1_Intron	NM_015978	NP_057062			TNNI3 interacting kinase isoform b							cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10																		---	---	---	---
LPHN2	23266	broad.mit.edu	37	1	82456289	82456289	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82456289C>A	uc001dit.3	+	21	3853	c.3672C>A	c.(3670-3672)AAC>AAA	p.N1224K	LPHN2_uc001dis.2_Missense_Mutation_p.N204K|LPHN2_uc001diu.2_Missense_Mutation_p.N1224K|LPHN2_uc001div.2_3'UTR|LPHN2_uc009wcd.2_3'UTR|LPHN2_uc001diw.2_Missense_Mutation_p.N851K	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	1280	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)														---	---	---	---
CLCA1	1179	broad.mit.edu	37	1	86960033	86960033	+	Missense_Mutation	SNP	G	A	A	rs146316532		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86960033G>A	uc001dlt.2	+	11	1973	c.1844G>A	c.(1843-1845)CGC>CAC	p.R615H	CLCA1_uc001dls.1_Missense_Mutation_p.R554H	NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	615					calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)														---	---	---	---
ARHGAP29	9411	broad.mit.edu	37	1	94643408	94643408	+	Silent	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94643408T>C	uc001dqj.3	-	21	3165	c.2796A>G	c.(2794-2796)GAA>GAG	p.E932E	ARHGAP29_uc009wdq.1_RNA|ARHGAP29_uc001dqk.2_Silent_p.E498E	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1	932					Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)														---	---	---	---
VAV3	10451	broad.mit.edu	37	1	108145749	108145749	+	Silent	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108145749G>T	uc001dvk.1	-	23	2106	c.2052C>A	c.(2050-2052)ACC>ACA	p.T684T	VAV3_uc010ouu.1_Silent_p.T88T|VAV3_uc001dvj.1_Silent_p.T124T|VAV3_uc010ouv.1_Silent_p.T88T|VAV3_uc010ouw.1_Silent_p.T684T	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform	684	SH2.				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)														---	---	---	---
SLC6A17	388662	broad.mit.edu	37	1	110734722	110734722	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110734722C>T	uc009wfq.2	+	7	1454	c.993C>T	c.(991-993)TTC>TTT	p.F331F	SLC6A17_uc001dze.1_5'Flank	NM_001010898	NP_001010898	Q9H1V8	S6A17_HUMAN	solute carrier family 6, member 17	331	Cytoplasmic (Potential).				alanine transport|glycine transport|leucine transport|proline transport	cell junction|integral to plasma membrane|synaptic vesicle membrane	neurotransmitter:sodium symporter activity			ovary(1)|pancreas(1)	2		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)														---	---	---	---
VTCN1	79679	broad.mit.edu	37	1	117695783	117695783	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117695783C>T	uc001ehb.2	-	4	726	c.654G>A	c.(652-654)ACG>ACA	p.T218T	VTCN1_uc001ehc.2_Silent_p.T123T|VTCN1_uc009whf.1_Silent_p.T102T	NM_024626	NP_078902	Q7Z7D3	VTCN1_HUMAN	V-set domain containing T cell activation	218	Extracellular (Potential).|Ig-like V-type 2.					integral to membrane|plasma membrane					0	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)														---	---	---	---
CHD1L	9557	broad.mit.edu	37	1	146756070	146756070	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146756070C>T	uc001epm.3	+	16	1815	c.1752C>T	c.(1750-1752)CCC>CCT	p.P584P	uc001epp.2_Intron|CHD1L_uc001epn.3_Silent_p.P471P|CHD1L_uc010ozo.1_RNA|CHD1L_uc009wjg.2_RNA|CHD1L_uc009wjh.2_Silent_p.P490P|CHD1L_uc010ozp.1_Silent_p.P303P|CHD1L_uc001epo.3_Silent_p.P380P|CHD1L_uc010ozq.1_Silent_p.P157P|CHD1L_uc009wji.2_Silent_p.P303P	NM_004284	NP_004275	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein	584					chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.0487)																	---	---	---	---
VPS72	6944	broad.mit.edu	37	1	151149392	151149392	+	Missense_Mutation	SNP	C	T	T	rs147304252		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151149392C>T	uc001exe.1	-	6	866	c.823G>A	c.(823-825)GAG>AAG	p.E275K	TMOD4_uc001exd.2_5'Flank|TMOD4_uc001exc.3_5'Flank|TMOD4_uc010pct.1_5'Flank	NM_005997	NP_005988	Q15906	VPS72_HUMAN	transcription factor-like 1	275					chromatin modification|negative regulation of transcription from RNA polymerase II promoter	nucleus|protein complex	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|pancreas(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
FLG	2312	broad.mit.edu	37	1	152276150	152276150	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152276150G>A	uc001ezu.1	-	3	11248	c.11212C>T	c.(11212-11214)CGC>TGC	p.R3738C		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3738	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											Ichthyosis				---	---	---	---
SPTA1	6708	broad.mit.edu	37	1	158606549	158606549	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158606549T>A	uc001fst.1	-	37	5391	c.5192A>T	c.(5191-5193)GAG>GTG	p.E1731V		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1731	Spectrin 17.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)																	---	---	---	---
PVRL4	81607	broad.mit.edu	37	1	161049492	161049492	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161049492G>A	uc001fxo.2	-	2	626	c.327C>T	c.(325-327)GAC>GAT	p.D109D		NM_030916	NP_112178	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4 precursor	109	Ig-like V-type 1.|Extracellular (Potential).				adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane				ovary(2)	2	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)															---	---	---	---
PIK3C2B	5287	broad.mit.edu	37	1	204401452	204401452	+	Missense_Mutation	SNP	G	A	A	rs139230011		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204401452G>A	uc001haw.2	-	28	4510	c.4031C>T	c.(4030-4032)ACG>ATG	p.T1344M	PIK3C2B_uc010pqv.1_Missense_Mutation_p.T1316M	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	1344					cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)															---	---	---	---
LBR	3930	broad.mit.edu	37	1	225591011	225591011	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225591011G>C	uc001hoy.2	-	14	1985	c.1842C>G	c.(1840-1842)ATC>ATG	p.I614M	LBR_uc001hoz.2_Missense_Mutation_p.I614M	NM_002296	NP_002287	Q14739	LBR_HUMAN	lamin B receptor	614					cholesterol biosynthetic process	integral to nuclear inner membrane	chromo shadow domain binding|delta14-sterol reductase activity|DNA binding|lamin binding|receptor activity			ovary(1)|skin(1)	2	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)														---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228492035	228492035	+	Intron	SNP	A	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228492035A>C	uc009xez.1	+						OBSCN_uc001hsn.2_Intron|OBSCN_uc001hsq.1_Silent_p.T1505T	NM_001098623	NP_001092093			obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
NID1	4811	broad.mit.edu	37	1	236205525	236205525	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236205525C>T	uc001hxo.2	-	4	922	c.820G>A	c.(820-822)GTG>ATG	p.V274M	NID1_uc009xgd.2_Missense_Mutation_p.V274M	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor	274					cell-matrix adhesion	basement membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Becaplermin(DB00102)|Urokinase(DB00013)													---	---	---	---
ACTN2	88	broad.mit.edu	37	1	236914817	236914817	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236914817G>A	uc001hyf.2	+	15	1908	c.1704G>A	c.(1702-1704)GCG>GCA	p.A568A	ACTN2_uc001hyg.2_Silent_p.A360A|ACTN2_uc009xgi.1_Silent_p.A568A|ACTN2_uc010pxu.1_Silent_p.A257A|ACTN2_uc001hyh.2_Silent_p.A256A	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	568	Spectrin 3.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)															---	---	---	---
RYR2	6262	broad.mit.edu	37	1	237774169	237774169	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237774169C>A	uc001hyl.1	+	36	4911	c.4791C>A	c.(4789-4791)AGC>AGA	p.S1597R		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1597	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---
VN1R5	317705	broad.mit.edu	37	1	247419493	247419493	+	Silent	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247419493T>C	uc010pyu.1	+	1	120	c.120T>C	c.(118-120)CCT>CCC	p.P40P		NM_173858	NP_776257	Q7Z5H4	VN1R5_HUMAN	vomeronasal 1 receptor 5	40	Cytoplasmic (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity				0	all_cancers(71;5.7e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)	all_cancers(173;0.0314)	OV - Ovarian serous cystadenocarcinoma(106;0.00854)															---	---	---	---
OR6F1	343169	broad.mit.edu	37	1	247875222	247875222	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247875222G>A	uc001idj.1	-	1	836	c.836C>T	c.(835-837)ACT>ATT	p.T279I		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	279	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)															---	---	---	---
OR2T4	127074	broad.mit.edu	37	1	248525700	248525700	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525700G>T	uc001ieh.1	+	1	818	c.818G>T	c.(817-819)TGC>TTC	p.C273F		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	273	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---
DDX1	1653	broad.mit.edu	37	2	15760410	15760410	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15760410G>A	uc002rce.2	+	17	1573	c.1285G>A	c.(1285-1287)GTT>ATT	p.V429I	DDX1_uc010yjq.1_Missense_Mutation_p.V337I	NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1	429	Necessary for interaction with RELA.				DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity	p.V429I(1)		central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)														---	---	---	---
SMC6	79677	broad.mit.edu	37	2	17896196	17896196	+	Silent	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17896196T>C	uc002rco.2	-	16	1958	c.1662A>G	c.(1660-1662)TTA>TTG	p.L554L	SMC6_uc010exo.2_Silent_p.L554L|SMC6_uc002rcn.2_Silent_p.L554L|SMC6_uc002rcp.1_Silent_p.L580L|SMC6_uc002rcq.2_Silent_p.L580L	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein	554	Flexible hinge.				DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)																	---	---	---	---
CAD	790	broad.mit.edu	37	2	27464253	27464253	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27464253G>A	uc002rji.2	+	38	6034	c.5872G>A	c.(5872-5874)GAC>AAC	p.D1958N	CAD_uc010eyw.2_Missense_Mutation_p.D1895N	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	1958	ATCase (Aspartate transcarbamylase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)													---	---	---	---
DNAJC5G	285126	broad.mit.edu	37	2	27501049	27501049	+	Intron	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27501049C>T	uc002rjl.1	+						SLC30A3_uc010ylh.1_5'Flank|DNAJC5G_uc010yli.1_Intron|DNAJC5G_uc002rjm.1_Intron	NM_173650	NP_775921			DnaJ (Hsp40) homolog, subfamily C, member 5						protein folding	membrane	heat shock protein binding|unfolded protein binding			skin(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
TEX261	113419	broad.mit.edu	37	2	71216923	71216923	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71216923G>A	uc002shn.2	-	4	442	c.328C>T	c.(328-330)CTA>TTA	p.L110L	TEX261_uc010fdy.2_Silent_p.L63L	NM_144582	NP_653183	Q6UWH6	TX261_HUMAN	testis expressed sequence 261	110	Helical; (Potential).					integral to membrane					0																		---	---	---	---
NAT8B	51471	broad.mit.edu	37	2	73928162	73928162	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73928162G>C	uc002sjk.1	-	2	306	c.271C>G	c.(271-273)CGC>GGC	p.R91G		NM_016347	NP_057431	Q9UHF3	NAT8B_HUMAN	N-acetyltransferase 8B	91	N-acetyltransferase.				gastrulation with mouth forming second	integral to membrane	N-acetyltransferase activity				0																		---	---	---	---
REG1A	5967	broad.mit.edu	37	2	79348742	79348742	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79348742C>G	uc002snz.2	+	3	222	c.119C>G	c.(118-120)ACC>AGC	p.T40S	REG1A_uc010ffx.1_Missense_Mutation_p.T40S|REG1A_uc010ysd.1_Missense_Mutation_p.T40S	NM_002909	NP_002900	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha precursor	40	C-type lectin.				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	89986376	89986376	+	Intron	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89986376G>A	uc010fhm.2	+						uc002stn.1_5'Flank					Parts of antibodies, mostly variable regions.																														---	---	---	---
LONRF2	164832	broad.mit.edu	37	2	100919517	100919517	+	Intron	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100919517G>A	uc002tal.3	-						LONRF2_uc010yvs.1_Intron	NM_198461	NP_940863			LON peptidase N-terminal domain and ring finger						proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2																		---	---	---	---
DPP10	57628	broad.mit.edu	37	2	116598409	116598409	+	Intron	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116598409T>G	uc002tla.1	+						DPP10_uc002tlb.1_Intron|DPP10_uc002tlc.1_Intron|DPP10_uc002tle.2_Intron|DPP10_uc002tlf.1_Intron	NM_020868	NP_065919			dipeptidyl peptidase 10 isoform long						proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	133540650	133540650	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133540650C>A	uc002ttp.2	-	14	4108	c.3734G>T	c.(3733-3735)GGG>GTG	p.G1245V	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	1245							protein binding				0																		---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	141625403	141625403	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141625403C>T	uc002tvj.1	-	27	5307	c.4335G>A	c.(4333-4335)AGG>AGA	p.R1445R	LRP1B_uc010fnl.1_Silent_p.R627R	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1445	Extracellular (Potential).|LDL-receptor class B 12.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
XIRP2	129446	broad.mit.edu	37	2	168107513	168107513	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168107513C>T	uc002udx.2	+	8	9629	c.9611C>T	c.(9610-9612)CCG>CTG	p.P3204L	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.P3029L|XIRP2_uc010fpq.2_Missense_Mutation_p.P2982L|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	3029					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179396928	179396928	+	Missense_Mutation	SNP	C	T	T	rs115150240	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179396928C>T	uc010zfg.1	-	307	96934	c.96710G>A	c.(96709-96711)CGA>CAA	p.R32237Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R25932Q|TTN_uc010zfi.1_Missense_Mutation_p.R25865Q|TTN_uc010zfj.1_Missense_Mutation_p.R25740Q|TTN_uc002umq.2_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33164							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
CD28	940	broad.mit.edu	37	2	204591670	204591670	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204591670C>T	uc002vah.3	+	2	589	c.367C>T	c.(367-369)CTA>TTA	p.L123L	CD28_uc002vag.1_Intron|CD28_uc010zio.1_Intron|CD28_uc010ftx.2_Intron|CD28_uc002vaj.3_Intron	NM_006139	NP_006130	P10747	CD28_HUMAN	CD28 antigen precursor	123	Extracellular (Potential).|Ig-like V-type.				cell surface receptor linked signaling pathway|cytokine biosynthetic process|humoral immune response|positive regulation of anti-apoptosis|positive regulation of interleukin-2 biosynthetic process|positive regulation of mitosis|positive regulation of translation|positive regulation of viral genome replication|regulation of defense response to virus by virus|regulatory T cell differentiation|T cell costimulation|viral reproduction	cytosol|external side of plasma membrane|integral to plasma membrane	coreceptor activity|protease binding|SH3/SH2 adaptor activity				0																		---	---	---	---
ABCA12	26154	broad.mit.edu	37	2	215865683	215865683	+	Silent	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215865683G>T	uc002vew.2	-	22	3145	c.2925C>A	c.(2923-2925)GTC>GTA	p.V975V	ABCA12_uc002vev.2_Silent_p.V657V|ABCA12_uc010zjn.1_5'UTR	NM_173076	NP_775099	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A, member 12	975					cellular homeostasis|lipid transport	integral to membrane	ATP binding|ATPase activity			ovary(6)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	11		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)														---	---	---	---
SCG2	7857	broad.mit.edu	37	2	224462739	224462739	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224462739C>T	uc002vnm.2	-	2	1395	c.1262G>A	c.(1261-1263)CGT>CAT	p.R421H		NM_003469	NP_003460	P13521	SCG2_HUMAN	secretogranin II precursor	421					angiogenesis|endothelial cell migration|eosinophil chemotaxis|induction of positive chemotaxis|inflammatory response|MAPKKK cascade|negative regulation of apoptosis|negative regulation of endothelial cell proliferation|positive regulation of endothelial cell proliferation|protein secretion	extracellular space|stored secretory granule	chemoattractant activity|cytokine activity			ovary(1)	1		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)														---	---	---	---
GIGYF2	26058	broad.mit.edu	37	2	233656089	233656089	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233656089G>A	uc002vti.3	+	14	1552	c.1215G>A	c.(1213-1215)ACG>ACA	p.T405T	GIGYF2_uc010zmj.1_Silent_p.T405T|GIGYF2_uc002vtg.2_Silent_p.T399T|GIGYF2_uc002vtj.3_Silent_p.T426T|GIGYF2_uc002vtk.3_Silent_p.T405T|GIGYF2_uc002vth.3_Silent_p.T399T|GIGYF2_uc010zmk.1_RNA|GIGYF2_uc010zml.1_Silent_p.T236T	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b	405					cell death		protein binding	p.T405M(1)		ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)														---	---	---	---
ANKMY1	51281	broad.mit.edu	37	2	241468581	241468581	+	Missense_Mutation	SNP	G	A	A	rs150953451	byFrequency	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241468581G>A	uc002vyz.1	-	4	788	c.559C>T	c.(559-561)CGC>TGC	p.R187C	ANKMY1_uc002vza.1_Intron|ANKMY1_uc010fzd.1_Missense_Mutation_p.R276C|ANKMY1_uc002vzb.1_Intron|ANKMY1_uc002vzc.1_Intron|ANKMY1_uc002vzd.1_Intron|ANKMY1_uc010fze.1_Intron|ANKMY1_uc002vze.2_Intron	NM_016552	NP_057636	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	187							zinc ion binding			central_nervous_system(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)														---	---	---	---
GRM7	2917	broad.mit.edu	37	3	7188234	7188234	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7188234A>T	uc003bqm.2	+	2	889	c.615A>T	c.(613-615)CAA>CAT	p.Q205H	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.Q205H|GRM7_uc003bql.2_Missense_Mutation_p.Q205H	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	205	Extracellular (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)													---	---	---	---
KCNH8	131096	broad.mit.edu	37	3	19492858	19492858	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19492858T>G	uc003cbk.1	+	10	1982	c.1787T>G	c.(1786-1788)ATG>AGG	p.M596R	KCNH8_uc011awe.1_3'UTR|KCNH8_uc010hex.1_Missense_Mutation_p.M57R|KCNH8_uc011awf.1_3'UTR	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	596	cNMP.|Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5																		---	---	---	---
EPM2AIP1	9852	broad.mit.edu	37	3	37033016	37033016	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37033016T>C	uc003cgk.2	-	1	1780	c.1553A>G	c.(1552-1554)AAT>AGT	p.N518S	MLH1_uc011aye.1_5'Flank|MLH1_uc003cgl.2_5'Flank|MLH1_uc011ayb.1_5'Flank|MLH1_uc010hge.2_5'Flank|MLH1_uc003cgn.3_5'Flank|MLH1_uc011ayc.1_5'Flank|MLH1_uc011ayd.1_5'Flank|MLH1_uc003cgo.2_5'Flank	NM_014805	NP_055620	Q7L775	EPMIP_HUMAN	EPM2A interacting protein 1	518						endoplasmic reticulum					0																		---	---	---	---
ZNF620	253639	broad.mit.edu	37	3	40558220	40558220	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40558220C>G	uc003ckk.2	+	5	1284	c.1135C>G	c.(1135-1137)CTG>GTG	p.L379V	ZNF620_uc003ckl.2_Missense_Mutation_p.L265V	NM_175888	NP_787084	Q6ZNG0	ZN620_HUMAN	zinc finger protein 620	379	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)														---	---	---	---
CCR1	1230	broad.mit.edu	37	3	46245328	46245328	+	Silent	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46245328G>T	uc003cph.1	-	2	548	c.477C>A	c.(475-477)GCC>GCA	p.A159A	CCR3_uc003cpg.1_Intron	NM_001295	NP_001286	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	159	Helical; Name=4; (Potential).				cell adhesion|cell-cell signaling|cytokine-mediated signaling pathway|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	integral to plasma membrane	C-C chemokine receptor activity			skin(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)														---	---	---	---
NBEAL2	23218	broad.mit.edu	37	3	47046044	47046044	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47046044G>A	uc003cqp.2	+	38	6437	c.6258G>A	c.(6256-6258)GCG>GCA	p.A2086A	NBEAL2_uc010hjm.1_Silent_p.A1463A|NBEAL2_uc010hjn.1_Silent_p.A482A|NBEAL2_uc010hjo.1_5'Flank	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2086	BEACH.						binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)														---	---	---	---
BSN	8927	broad.mit.edu	37	3	49689053	49689053	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49689053C>T	uc003cxe.3	+	5	2178	c.2064C>T	c.(2062-2064)GAC>GAT	p.D688D		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	688					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)														---	---	---	---
PBRM1	55193	broad.mit.edu	37	3	52676057	52676057	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52676057T>A	uc003des.2	-	10	1012	c.1000A>T	c.(1000-1002)AAA>TAA	p.K334*	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Nonsense_Mutation_p.K334*|PBRM1_uc003der.2_Nonsense_Mutation_p.K302*|PBRM1_uc003det.2_Nonsense_Mutation_p.K334*|PBRM1_uc003deu.2_Nonsense_Mutation_p.K334*|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Nonsense_Mutation_p.K334*|PBRM1_uc010hmk.1_Nonsense_Mutation_p.K334*|PBRM1_uc003dey.2_Nonsense_Mutation_p.K334*|PBRM1_uc003dez.1_Nonsense_Mutation_p.K334*|PBRM1_uc003dfb.1_Nonsense_Mutation_p.K232*	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	334					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)				Mis|N|F|S|D|O		clear cell renal carcinoma|breast								---	---	---	---
ITIH4	3700	broad.mit.edu	37	3	52858975	52858975	+	Splice_Site	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52858975C>A	uc003dfz.2	-	7	796	c.760_splice	c.e7-1	p.I254_splice	ITIH4_uc011bel.1_Splice_Site|ITIH4_uc003dfy.2_Splice_Site_p.I118_splice|ITIH4_uc011bem.1_Splice_Site_p.I254_splice|ITIH4_uc011ben.1_Splice_Site_p.I254_splice	NM_002218	NP_002209			inter-alpha (globulin) inhibitor H4						acute-phase response|hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)														---	---	---	---
DZIP3	9666	broad.mit.edu	37	3	108363573	108363573	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108363573C>T	uc003dxd.2	+	14	2126	c.1704C>T	c.(1702-1704)TAC>TAT	p.Y568Y	DZIP3_uc003dxf.1_Silent_p.Y568Y|DZIP3_uc011bhm.1_Silent_p.Y19Y|DZIP3_uc003dxe.1_Silent_p.Y568Y|DZIP3_uc003dxg.1_Silent_p.Y291Y	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	568					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
DGKG	1608	broad.mit.edu	37	3	185993429	185993429	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185993429C>T	uc003fqa.2	-	10	1354	c.817G>A	c.(817-819)GCC>ACC	p.A273T	DGKG_uc003fqb.2_Missense_Mutation_p.A273T|DGKG_uc003fqc.2_Missense_Mutation_p.A273T|DGKG_uc011brx.1_Missense_Mutation_p.A273T	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1	273	Phorbol-ester/DAG-type 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)													---	---	---	---
HRG	3273	broad.mit.edu	37	3	186395655	186395655	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186395655C>G	uc003fqq.2	+	7	1584	c.1561C>G	c.(1561-1563)CAT>GAT	p.H521D		NM_000412	NP_000403	P04196	HRG_HUMAN	histidine-rich glycoprotein precursor	521					fibrinolysis|platelet activation|platelet degranulation	extracellular region|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding			ovary(1)|central_nervous_system(1)	2	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)														---	---	---	---
MASP1	5648	broad.mit.edu	37	3	186959292	186959292	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186959292C>T	uc003frh.1	-	10	1612	c.1280G>A	c.(1279-1281)AGA>AAA	p.R427K	MASP1_uc003fri.2_Missense_Mutation_p.R427K|MASP1_uc003frj.2_Missense_Mutation_p.R396K	NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	427	Sushi 2.				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)														---	---	---	---
GPR78	27201	broad.mit.edu	37	4	8588796	8588796	+	Silent	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8588796G>T	uc003glk.2	+	3	1217	c.798G>T	c.(796-798)GTG>GTT	p.V266V	CPZ_uc003gll.2_Intron	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	266	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6																		---	---	---	---
ANTXR2	118429	broad.mit.edu	37	4	80954723	80954723	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80954723C>T	uc003hlz.3	-	9	1462	c.699G>A	c.(697-699)GAG>GAA	p.E233E	ANTXR2_uc003hly.3_Silent_p.E233E|ANTXR2_uc003hlx.1_RNA|ANTXR2_uc010ijn.2_Intron	NM_001145794	NP_001139266	P58335	ANTR2_HUMAN	anthrax toxin receptor 2 isoform 2	233	Extracellular (Potential).					endoplasmic reticulum membrane|extracellular region|integral to membrane|plasma membrane	metal ion binding|protein binding|receptor activity			ovary(1)	1														Juvenile_Hyaline_Fibromatosis				---	---	---	---
HSD17B13	345275	broad.mit.edu	37	4	88243955	88243955	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88243955G>A	uc003hqo.2	-	1	102	c.39C>T	c.(37-39)ACC>ACT	p.T13T	HSD17B13_uc010ikk.2_Silent_p.T13T	NM_178135	NP_835236	Q7Z5P4	DHB13_HUMAN	hydroxysteroid (17-beta) dehydrogenase 13	13						extracellular region	binding|oxidoreductase activity				0		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.000308)														---	---	---	---
SPP1	6696	broad.mit.edu	37	4	88901281	88901281	+	Intron	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88901281A>G	uc003hra.2	+						SPP1_uc003hrb.2_Intron|SPP1_uc003hrc.2_Intron|SPP1_uc011cde.1_Intron|SPP1_uc003hrd.2_Intron	NM_001040058	NP_001035147			secreted phosphoprotein 1 isoform a						biomineral tissue development|cell adhesion|decidualization|embryo implantation|ossification|response to vitamin D	extracellular space	cytokine activity			ovary(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-05)														---	---	---	---
C4orf37	285555	broad.mit.edu	37	4	98762070	98762070	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98762070G>A	uc003htt.1	-	9	1148	c.1058C>T	c.(1057-1059)CCA>CTA	p.P353L		NM_174952	NP_777612	Q8N412	CD037_HUMAN	hypothetical protein LOC285555	353											0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)														---	---	---	---
USP53	54532	broad.mit.edu	37	4	120192884	120192884	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120192884G>A	uc003ics.3	+	15	2935	c.1869G>A	c.(1867-1869)CCG>CCA	p.P623P	USP53_uc003icr.3_Silent_p.P623P|USP53_uc003icu.3_Silent_p.P246P|USP53_uc003ict.2_Silent_p.P246P	NM_019050	NP_061923	Q70EK8	UBP53_HUMAN	ubiquitin specific protease 53	623					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			ovary(1)|breast(1)|kidney(1)|skin(1)	4																		---	---	---	---
PDE5A	8654	broad.mit.edu	37	4	120527881	120527881	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120527881T>C	uc003idh.2	-	2	879	c.724A>G	c.(724-726)ATC>GTC	p.I242V	PDE5A_uc003idf.2_Missense_Mutation_p.I200V|PDE5A_uc003idg.2_Missense_Mutation_p.I190V	NM_001083	NP_001074	O76074	PDE5A_HUMAN	phosphodiesterase 5A isoform 1	242	GAF 1.				platelet activation|signal transduction	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|zinc ion binding				0					Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Vardenafil(DB00862)													---	---	---	---
PRMT10	90826	broad.mit.edu	37	4	148575466	148575466	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148575466G>A	uc003ilc.2	-	9	1724	c.1582C>T	c.(1582-1584)CTT>TTT	p.L528F	PRMT10_uc003ilb.2_Missense_Mutation_p.L172F|PRMT10_uc003ild.2_Missense_Mutation_p.L415F	NM_138364	NP_612373	Q6P2P2	ANM10_HUMAN	protein arginine methyltransferase 10	528						cytoplasm	binding|protein methyltransferase activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
FGG	2266	broad.mit.edu	37	4	155531317	155531317	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155531317T>G	uc003ioj.2	-	5	575	c.434A>C	c.(433-435)CAA>CCA	p.Q145P	FGG_uc003iog.2_Missense_Mutation_p.Q145P|FGG_uc003ioh.2_Missense_Mutation_p.Q145P|FGG_uc010ipx.2_Intron|FGG_uc010ipy.2_Intron|FGG_uc003ioi.2_5'UTR|FGG_uc003iok.2_Missense_Mutation_p.Q145P	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B	145					platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)													---	---	---	---
GUCY1A3	2982	broad.mit.edu	37	4	156632330	156632330	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156632330T>A	uc003iov.2	+	7	1549	c.1013T>A	c.(1012-1014)ATC>AAC	p.I338N	GUCY1A3_uc003iou.2_Missense_Mutation_p.I338N|GUCY1A3_uc010iqc.2_Missense_Mutation_p.I338N|GUCY1A3_uc003iow.2_Missense_Mutation_p.I338N|GUCY1A3_uc010iqd.2_Missense_Mutation_p.I337N|GUCY1A3_uc003iox.2_Missense_Mutation_p.I338N|GUCY1A3_uc003ioz.2_Missense_Mutation_p.I103N|GUCY1A3_uc003ioy.2_Missense_Mutation_p.I338N|GUCY1A3_uc010iqe.2_Missense_Mutation_p.I103N|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Missense_Mutation_p.I338N	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	338					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)														---	---	---	---
ODZ3	55714	broad.mit.edu	37	4	183268028	183268028	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183268028T>G	uc003ivd.1	+	2	494	c.457T>G	c.(457-459)TCA>GCA	p.S153A	ODZ3_uc010irv.1_Missense_Mutation_p.S153A	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	153	Cytoplasmic (Potential).|Teneurin N-terminal.				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)														---	---	---	---
SEMA5A	9037	broad.mit.edu	37	5	9197334	9197334	+	Missense_Mutation	SNP	T	A	A	rs150193258	byFrequency;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9197334T>A	uc003jek.2	-	10	1726	c.1014A>T	c.(1012-1014)CAA>CAT	p.Q338H		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	338	Sema.|Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13793780	13793780	+	Nonsense_Mutation	SNP	T	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13793780T>A	uc003jfd.2	-	49	8110	c.8068A>T	c.(8068-8070)AAG>TAG	p.K2690*		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2690	AAA 3 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---
DNAH5	1767	broad.mit.edu	37	5	13814814	13814814	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13814814A>C	uc003jfd.2	-	43	7172	c.7130T>G	c.(7129-7131)TTC>TGC	p.F2377C		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2377	AAA 2 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---
TARS	6897	broad.mit.edu	37	5	33456315	33456315	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33456315G>A	uc003jhy.2	+	8	1115	c.820G>A	c.(820-822)GCT>ACT	p.A274T	TARS_uc011cob.1_Missense_Mutation_p.A262T|TARS_uc010iup.1_Missense_Mutation_p.A215T|TARS_uc011coc.1_Missense_Mutation_p.A295T|TARS_uc003jhz.2_Missense_Mutation_p.A170T|TARS_uc011cod.1_Missense_Mutation_p.A153T	NM_152295	NP_689508	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	274					threonyl-tRNA aminoacylation	cytosol	ATP binding|protein homodimerization activity|threonine-tRNA ligase activity			ovary(2)	2					L-Threonine(DB00156)													---	---	---	---
UGT3A1	133688	broad.mit.edu	37	5	35955844	35955844	+	Nonsense_Mutation	SNP	G	A	A	rs61734803	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35955844G>A	uc003jjv.1	-	6	1355	c.1198C>T	c.(1198-1200)CGA>TGA	p.R400*	UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Nonsense_Mutation_p.R400*|UGT3A1_uc011cor.1_Nonsense_Mutation_p.R366*	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	400	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
GABRA1	2554	broad.mit.edu	37	5	161292806	161292806	+	Intron	SNP	C	G	G	rs144727170	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161292806C>G	uc010jiw.2	+						GABRA1_uc010jix.2_Intron|GABRA1_uc010jiy.2_Intron|GABRA1_uc003lyx.3_Intron|GABRA1_uc010jiz.2_Intron|GABRA1_uc010jja.2_Intron|GABRA1_uc010jjb.2_Intron	NM_000806	NP_000797			gamma-aminobutyric acid (GABA) A receptor, alpha						gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)													---	---	---	---
ODZ2	57451	broad.mit.edu	37	5	167674828	167674828	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167674828G>A	uc010jjd.2	+	27	6857	c.6857G>A	c.(6856-6858)GGG>GAG	p.G2286E	ODZ2_uc003lzr.3_Missense_Mutation_p.G2056E|ODZ2_uc003lzt.3_Missense_Mutation_p.G1659E|ODZ2_uc010jje.2_Missense_Mutation_p.G1550E	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)														---	---	---	---
ELOVL2	54898	broad.mit.edu	37	6	10990020	10990020	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10990020C>T	uc003mzp.3	-	7	842	c.681G>A	c.(679-681)CCG>CCA	p.P227P		NM_017770	NP_060240	Q9NXB9	ELOV2_HUMAN	elongation of very long chain fatty acids-like	227					fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)															---	---	---	---
TULP1	7287	broad.mit.edu	37	6	35467912	35467912	+	Silent	SNP	C	T	T	rs61734562	byFrequency;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35467912C>T	uc003okv.3	-	14	1353	c.1341G>A	c.(1339-1341)CTG>CTA	p.L447L	TULP1_uc003okw.3_Silent_p.L394L	NM_003322	NP_003313	O00294	TULP1_HUMAN	tubby like protein 1	447					dendrite development|eye photoreceptor cell development|phagocytosis|photoreceptor cell maintenance|positive regulation of phagocytosis	cell junction|cytoplasm|extracellular region|photoreceptor inner segment|photoreceptor outer segment|synapse	actin filament binding|phosphatidylinositol-4,5-bisphosphate binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75843127	75843127	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75843127G>A	uc003phs.2	-	34	5842	c.5676C>T	c.(5674-5676)CCC>CCT	p.P1892P	COL12A1_uc003pht.2_Silent_p.P728P	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	1892	Fibronectin type-III 14.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
PHIP	55023	broad.mit.edu	37	6	79695110	79695110	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79695110G>A	uc003pir.2	-	22	2722	c.2496C>T	c.(2494-2496)TCC>TCT	p.S832S	PHIP_uc003piq.2_5'Flank|PHIP_uc011dyp.1_Silent_p.S831S	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	832					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)														---	---	---	---
L3MBTL3	84456	broad.mit.edu	37	6	130442081	130442081	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130442081G>T	uc003qbt.2	+	20	2114	c.1944G>T	c.(1942-1944)ATG>ATT	p.M648I	L3MBTL3_uc003qbu.2_Missense_Mutation_p.M623I	NM_032438	NP_115814	Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 isoform a	648					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)														---	---	---	---
ECT2L	345930	broad.mit.edu	37	6	139134440	139134440	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139134440C>T	uc003qif.1	+	1	132	c.29C>T	c.(28-30)GCC>GTC	p.A10V	ECT2L_uc011edq.1_5'Flank	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2	10					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0																		---	---	---	---
TIAM2	26230	broad.mit.edu	37	6	155532370	155532370	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155532370C>T	uc003qqb.2	+	17	4370	c.3097C>T	c.(3097-3099)CTG>TTG	p.L1033L	TIAM2_uc003qqe.2_Silent_p.L1033L|TIAM2_uc010kjj.2_Silent_p.L566L|TIAM2_uc003qqf.2_Silent_p.L409L|TIAM2_uc011efl.1_Silent_p.L369L|TIAM2_uc003qqg.2_Silent_p.L345L	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1033					apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)														---	---	---	---
STK31	56164	broad.mit.edu	37	7	23802528	23802528	+	Silent	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23802528T>C	uc003sws.3	+	11	1469	c.1402T>C	c.(1402-1404)TTA>CTA	p.L468L	STK31_uc003swt.3_Silent_p.L445L|STK31_uc011jze.1_Silent_p.L468L|STK31_uc010kuq.2_Silent_p.L445L	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	468							ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9																		---	---	---	---
BBS9	27241	broad.mit.edu	37	7	33644593	33644593	+	Intron	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33644593A>G	uc003tdn.1	+						BBS9_uc003tdo.1_Intron|BBS9_uc003tdp.1_Intron|BBS9_uc003tdq.1_Intron|BBS9_uc010kwn.1_Intron|BBS9_uc003tdr.1_Missense_Mutation_p.R404G|BBS9_uc003tds.1_Intron|BBS9_uc003tdt.2_Intron	NM_198428	NP_940820			parathyroid hormone-responsive B1 isoform 2						fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)											Bardet-Biedl_syndrome				---	---	---	---
GPR141	353345	broad.mit.edu	37	7	37780800	37780800	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37780800T>G	uc003tfm.1	+	1	805	c.805T>G	c.(805-807)TTC>GTC	p.F269V	uc003tfl.2_Intron	NM_181791	NP_861456	Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	269	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3																		---	---	---	---
CAMK2B	816	broad.mit.edu	37	7	44282927	44282927	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44282927C>T	uc003tkq.2	-	8	733	c.523G>A	c.(523-525)GCT>ACT	p.A175T	CAMK2B_uc003tkp.2_Missense_Mutation_p.A175T|CAMK2B_uc003tkx.2_Missense_Mutation_p.A175T|CAMK2B_uc010kyd.2_RNA|CAMK2B_uc003tkr.2_Missense_Mutation_p.A175T|CAMK2B_uc003tks.2_Missense_Mutation_p.A175T|CAMK2B_uc003tku.2_Missense_Mutation_p.A175T|CAMK2B_uc003tkv.2_Missense_Mutation_p.A175T|CAMK2B_uc003tkt.2_Missense_Mutation_p.A175T|CAMK2B_uc003tkw.2_Missense_Mutation_p.A175T|CAMK2B_uc010kyc.2_Missense_Mutation_p.A175T	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II	175	Protein kinase.				interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2																		---	---	---	---
EGFR	1956	broad.mit.edu	37	7	55240694	55240694	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55240694C>T	uc003tqk.2	+	17	2184	c.1938C>T	c.(1936-1938)ATC>ATT	p.I646I	EGFR_uc010kzg.1_Silent_p.I601I|EGFR_uc011kco.1_Silent_p.I593I	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	646	Helical; (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			---	---	---	---
EGFR	1956	broad.mit.edu	37	7	55269427	55269427	+	Splice_Site	SNP	G	T	T	rs142231053		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55269427G>T	uc003tqk.2	+	26	3361	c.3115_splice	c.e26-1	p.S1039_splice	EGFR_uc010kzg.1_Splice_Site_p.S994_splice|EGFR_uc011kco.1_Splice_Site_p.S986_splice	NM_005228	NP_005219			epidermal growth factor receptor isoform a						activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			---	---	---	---
MLXIPL	51085	broad.mit.edu	37	7	73021968	73021968	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73021968G>A	uc003tyn.1	-	3	483	c.435C>T	c.(433-435)TTC>TTT	p.F145F	MLXIPL_uc003tyk.1_Silent_p.F145F|MLXIPL_uc003tyl.1_Silent_p.F145F|MLXIPL_uc003tym.1_Silent_p.F145F|MLXIPL_uc003tyo.1_RNA|MLXIPL_uc003typ.1_Silent_p.F145F|MLXIPL_uc003tyq.1_5'Flank	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14	145					anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)														OREG0018107	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PCLO	27445	broad.mit.edu	37	7	82583852	82583852	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82583852T>G	uc003uhx.2	-	5	6706	c.6417A>C	c.(6415-6417)GAA>GAC	p.E2139D	PCLO_uc003uhv.2_Missense_Mutation_p.E2139D	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2070					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---
SRI	6717	broad.mit.edu	37	7	87837812	87837812	+	Intron	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87837812T>G	uc003ujq.1	-						SRI_uc011khg.1_Intron|SRI_uc003ujr.1_Intron|SRI_uc011khh.1_Silent_p.R179R	NM_003130	NP_003121			sorcin isoform a						heart development|intracellular sequestering of iron ion|muscle organ development|regulation of action potential|regulation of heart contraction|regulation of striated muscle contraction|signal transduction	sarcoplasmic reticulum membrane	calcium channel regulator activity|calcium ion binding|receptor binding			upper_aerodigestive_tract(1)	1	Esophageal squamous(14;0.00202)																	---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88962667	88962667	+	Intron	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88962667G>A	uc011khi.1	+							NM_181646	NP_857597			zinc finger protein 804B							intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
ZNF804B	219578	broad.mit.edu	37	7	88966071	88966071	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88966071C>A	uc011khi.1	+	4	4313	c.3775C>A	c.(3775-3777)CAC>AAC	p.H1259N		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1259						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)												HNSCC(36;0.09)			---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90546981	90546981	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90546981C>A	uc003uky.2	+	8	990	c.768C>A	c.(766-768)GAC>GAA	p.D256E	CDK14_uc003ukz.1_Missense_Mutation_p.D238E|CDK14_uc010les.1_Missense_Mutation_p.D210E|CDK14_uc011khl.1_Missense_Mutation_p.D127E	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1	256	Protein kinase.	Proton acceptor (By similarity).			cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
SAMD9	54809	broad.mit.edu	37	7	92733264	92733264	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92733264G>T	uc003umf.2	-	3	2403	c.2147C>A	c.(2146-2148)GCA>GAA	p.A716E	SAMD9_uc003umg.2_Missense_Mutation_p.A716E	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	716						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)															---	---	---	---
ARPC1A	10552	broad.mit.edu	37	7	98946472	98946472	+	Intron	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98946472T>C	uc003upx.1	+						ARPC1A_uc010lfu.1_Intron|ARPC1A_uc003upy.1_Intron|ARPC1A_uc011kit.1_Intron	NM_006409	NP_006400			actin related protein 2/3 complex subunit 1A						actin cytoskeleton organization|regulation of actin filament polymerization	actin cytoskeleton|cytoplasm	actin binding			ovary(1)	1	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---
STAG3	10734	broad.mit.edu	37	7	99787136	99787136	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99787136C>T	uc003utx.1	+	8	939	c.784C>T	c.(784-786)CGT>TGT	p.R262C	STAG3_uc010lgs.1_Missense_Mutation_p.R50C|STAG3_uc011kjk.1_Missense_Mutation_p.R204C	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3	262					chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)																	---	---	---	---
CALD1	800	broad.mit.edu	37	7	134645370	134645370	+	Silent	SNP	C	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134645370C>G	uc003vrz.2	+	13	2745	c.2286C>G	c.(2284-2286)CCC>CCG	p.P762P	CALD1_uc003vry.2_3'UTR|CALD1_uc003vsa.2_Silent_p.P533P|CALD1_uc003vsb.2_Silent_p.P507P|CALD1_uc010lmm.2_Silent_p.P532P|CALD1_uc011kpt.1_Silent_p.P281P|CALD1_uc003vsc.2_Silent_p.P527P|CALD1_uc003vsd.2_Silent_p.P501P|CALD1_uc011kpu.1_Silent_p.P512P|CALD1_uc011kpv.1_Silent_p.P371P|CALD1_uc003vse.2_Silent_p.P625P|CALD1_uc010lmn.2_RNA	NM_033138	NP_149129	Q05682	CALD1_HUMAN	caldesmon 1 isoform 1	762					cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0																		---	---	---	---
SLC37A3	84255	broad.mit.edu	37	7	140051160	140051160	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140051160C>T	uc003vvo.2	-	9	961	c.795G>A	c.(793-795)CCG>CCA	p.P265P	SLC37A3_uc003vvp.2_Silent_p.P265P|SLC37A3_uc010lnh.2_Silent_p.P265P|SLC37A3_uc011kqz.1_RNA|SLC37A3_uc011kra.1_3'UTR|SLC37A3_uc011krb.1_3'UTR	NM_207113	NP_996996	Q8NCC5	SPX3_HUMAN	solute carrier family 37 (glycerol-3-phosphate	265					carbohydrate transport|transmembrane transport	integral to membrane				ovary(3)	3	Melanoma(164;0.0142)																	---	---	---	---
EPHA1	2041	broad.mit.edu	37	7	143098701	143098701	+	Intron	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143098701G>T	uc003wcz.2	-							NM_005232	NP_005223			ephrin receptor EphA1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)																---	---	---	---
ARHGEF5	7984	broad.mit.edu	37	7	144077108	144077108	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144077108G>A	uc003wel.2	+	15	4871	c.4753G>A	c.(4753-4755)GTC>ATC	p.V1585I	ARHGEF5_uc003wem.2_Missense_Mutation_p.V386I	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	1585					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)																	---	---	---	---
TEX15	56154	broad.mit.edu	37	8	30703059	30703059	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30703059T>G	uc003xil.2	-	1	3475	c.3475A>C	c.(3475-3477)AGT>CGT	p.S1159R		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1159	Ser-rich.									ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)														---	---	---	---
IDO2	169355	broad.mit.edu	37	8	39872812	39872812	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39872812G>T	uc010lwy.1	+	11	1196	c.954G>T	c.(952-954)AAG>AAT	p.K318N	IDO2_uc003xno.1_RNA|IDO2_uc010lwz.1_Missense_Mutation_p.K59N|IDO2_uc003xnp.1_Missense_Mutation_p.K59N	NM_194294	NP_919270	Q6ZQW0	I23O2_HUMAN	indoleamine-pyrrole 2,3 dioxygenase-like 1	305					tryptophan catabolic process to kynurenine	cytosol	heme binding|indoleamine 2,3-dioxygenase activity|tryptophan 2,3-dioxygenase activity			ovary(2)	2																		---	---	---	---
DKK4	27121	broad.mit.edu	37	8	42233288	42233288	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42233288C>T	uc003xpb.2	-	2	283	c.172G>A	c.(172-174)GAT>AAT	p.D58N		NM_014420	NP_055235	Q9UBT3	DKK4_HUMAN	dickkopf homolog 4 precursor	58	DKK-type Cys-1.				multicellular organismal development|negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular region				ovary(1)	1	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|Lung(22;0.00597)|LUSC - Lung squamous cell carcinoma(45;0.024)															---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52384793	52384793	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52384793G>A	uc003xqu.3	-	8	867	c.766C>T	c.(766-768)CGG>TGG	p.R256W		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	256	Ig-like C2-type 1.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
SOX17	64321	broad.mit.edu	37	8	55370898	55370898	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55370898G>A	uc003xsb.3	+	1	404	c.200G>A	c.(199-201)CGT>CAT	p.R67H		NM_022454	NP_071899	Q9H6I2	SOX17_HUMAN	SRY-box 17	67					angiogenesis|cardiac cell fate determination|endocardial cell differentiation|endocardium formation|endoderm formation|heart formation|heart looping|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell growth|outflow tract morphogenesis|positive regulation of transcription, DNA-dependent|protein destabilization|protein stabilization|regulation of embryonic development|renal system development|vasculogenesis|Wnt receptor signaling pathway	transcription factor complex	beta-catenin binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			lung(1)	1		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)															---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77764205	77764205	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77764205C>A	uc003yav.2	+	10	5300	c.4913C>A	c.(4912-4914)CCT>CAT	p.P1638H	ZFHX4_uc003yau.1_Missense_Mutation_p.P1683H|ZFHX4_uc003yaw.1_Missense_Mutation_p.P1638H	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1638						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
CNGB3	54714	broad.mit.edu	37	8	87738843	87738843	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87738843T>C	uc003ydx.2	-	3	300	c.254A>G	c.(253-255)AAC>AGC	p.N85S		NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	85	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3																		---	---	---	---
FZD6	8323	broad.mit.edu	37	8	104342101	104342101	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104342101C>A	uc003ylh.2	+	6	2044	c.1760C>A	c.(1759-1761)ACA>AAA	p.T587K	FZD6_uc003ylj.2_Missense_Mutation_p.T587K|FZD6_uc011lhn.1_Missense_Mutation_p.T553K|FZD6_uc011lho.1_Missense_Mutation_p.T282K|FZD6_uc011lhp.1_Missense_Mutation_p.T532K	NM_003506	NP_003497	O60353	FZD6_HUMAN	frizzled 6 isoform a precursor	587	Cytoplasmic (Potential).				angiogenesis|axonogenesis|cell proliferation in midbrain|establishment of planar polarity|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|inner ear morphogenesis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|neural tube closure|non-canonical Wnt receptor signaling pathway	apical part of cell|apicolateral plasma membrane|cytoplasm|integral to plasma membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)															---	---	---	---
TRHR	7201	broad.mit.edu	37	8	110100462	110100462	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110100462C>G	uc003ymz.3	+	1	737	c.721C>G	c.(721-723)CAG>GAG	p.Q241E		NM_003301	NP_003292	P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	241	Cytoplasmic (Potential).					integral to plasma membrane	thyrotropin-releasing hormone receptor activity			skin(2)|lung(1)	3			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)															---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113933965	113933965	+	Silent	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113933965C>A	uc003ynu.2	-	10	1683	c.1524G>T	c.(1522-1524)GTG>GTT	p.V508V	CSMD3_uc003ynt.2_Silent_p.V468V|CSMD3_uc011lhx.1_Silent_p.V404V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	508	Extracellular (Potential).|Sushi 2.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
KCNQ3	3786	broad.mit.edu	37	8	133141788	133141788	+	Silent	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133141788A>G	uc003ytj.2	-	15	2565	c.2340T>C	c.(2338-2340)CGT>CGC	p.R780R	KCNQ3_uc010mdt.2_Silent_p.R768R|uc003yti.2_5'Flank	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein	780					axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)															---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8518172	8518172	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8518172G>C	uc003zkk.2	-	20	1930	c.1219C>G	c.(1219-1221)CCT>GCT	p.P407A	PTPRD_uc003zkp.2_Missense_Mutation_p.P407A|PTPRD_uc003zkq.2_Missense_Mutation_p.P407A|PTPRD_uc003zkr.2_Missense_Mutation_p.P401A|PTPRD_uc003zks.2_Missense_Mutation_p.P397A|PTPRD_uc003zkl.2_Missense_Mutation_p.P407A|PTPRD_uc003zkm.2_Missense_Mutation_p.P394A|PTPRD_uc003zkn.2_Missense_Mutation_p.P407A|PTPRD_uc003zko.2_Missense_Mutation_p.P404A	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	407	Fibronectin type-III 1.|Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
RORB	6096	broad.mit.edu	37	9	77282770	77282770	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77282770C>G	uc004aji.2	+	8	1146	c.1097C>G	c.(1096-1098)ACC>AGC	p.T366S	RORB_uc004ajh.2_Missense_Mutation_p.T355S	NM_006914	NP_008845	Q92753	RORB_HUMAN	RAR-related orphan receptor B	366	Ligand-binding (Potential).				eye photoreceptor cell development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|visual perception	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
C9orf79	286234	broad.mit.edu	37	9	90499895	90499895	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90499895G>A	uc004app.3	+	4	528	c.493G>A	c.(493-495)GTG>ATG	p.V165M	C9orf79_uc004apo.1_Intron	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	165						integral to membrane				ovary(3)	3																		---	---	---	---
OR13F1	138805	broad.mit.edu	37	9	107266586	107266586	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107266586C>G	uc011lvm.1	+	1	43	c.43C>G	c.(43-45)CTG>GTG	p.L15V		NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F,	15	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
TLR4	7099	broad.mit.edu	37	9	120475865	120475865	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475865T>C	uc004bjz.2	+	3	1750	c.1459T>C	c.(1459-1461)TTC>CTC	p.F487L	TLR4_uc004bka.2_Missense_Mutation_p.F447L|TLR4_uc004bkb.2_Missense_Mutation_p.F287L	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	487	LRR 15.|Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16																		---	---	---	---
POMT1	10585	broad.mit.edu	37	9	134385416	134385416	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134385416G>A	uc004cav.2	+	8	934	c.732G>A	c.(730-732)CCG>CCA	p.P244P	POMT1_uc011mci.1_3'UTR|POMT1_uc004cax.2_Intron|POMT1_uc011mcj.1_Intron|POMT1_uc004cau.2_Intron|POMT1_uc004caw.2_Intron|POMT1_uc011mck.1_Intron|POMT1_uc011mcl.1_Intron|POMT1_uc011mcm.1_Intron|POMT1_uc011mcn.1_5'UTR	NM_007171	NP_009102	Q9Y6A1	POMT1_HUMAN	protein-O-mannosyltransferase 1 isoform a	244					multicellular organismal development|protein O-linked glycosylation	endoplasmic reticulum membrane|integral to membrane	dolichyl-phosphate-mannose-protein mannosyltransferase activity|metal ion binding			upper_aerodigestive_tract(1)	1		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.65e-05)|Epithelial(140;0.000259)														---	---	---	---
FAM107B	83641	broad.mit.edu	37	10	14816509	14816509	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14816509C>A	uc001ina.1	-	1	388	c.154G>T	c.(154-156)GTC>TTC	p.V52F	FAM107B_uc010qbu.1_RNA	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641	Error:Variant_position_missing_in_Q9H098_after_alignment										breast(4)	4																		---	---	---	---
CUBN	8029	broad.mit.edu	37	10	16982027	16982027	+	Intron	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16982027T>G	uc001ioo.2	-							NM_001081	NP_001072			cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
GPR158	57512	broad.mit.edu	37	10	25886937	25886937	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25886937G>T	uc001isj.2	+	11	2442	c.2382G>T	c.(2380-2382)GAG>GAT	p.E794D	GPR158_uc001isk.2_Missense_Mutation_p.E169D	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	794	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8																		---	---	---	---
CUL2	8453	broad.mit.edu	37	10	35300855	35300855	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35300855C>T	uc001ixv.2	-	20	2237	c.2027G>A	c.(2026-2028)CGG>CAG	p.R676Q	CUL2_uc009xma.2_Missense_Mutation_p.R545Q|CUL2_uc010qer.1_Missense_Mutation_p.R695Q|CUL2_uc001ixw.2_Missense_Mutation_p.R676Q	NM_003591	NP_003582	Q13617	CUL2_HUMAN	cullin 2	676					cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding			ovary(3)	3																		---	---	---	---
CHST3	9469	broad.mit.edu	37	10	73765685	73765685	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73765685G>T	uc001jsn.2	+	2	525	c.85G>T	c.(85-87)GTT>TTT	p.V29F		NM_004273	NP_004264	Q7LGC8	CHST3_HUMAN	chondroitin 6-sulfotransferase 3	29	Helical; Signal-anchor for type II membrane protein; (Potential).				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity				0																		---	---	---	---
MYST4	23522	broad.mit.edu	37	10	76788849	76788849	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76788849G>C	uc001jwn.1	+	18	4760	c.4267G>C	c.(4267-4269)GAC>CAC	p.D1423H	MYST4_uc001jwo.1_Missense_Mutation_p.D1131H|MYST4_uc001jwp.1_Missense_Mutation_p.D1240H	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic	1423					histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)							T	CREBBP	AML								---	---	---	---
SUFU	51684	broad.mit.edu	37	10	104359222	104359222	+	Nonsense_Mutation	SNP	G	T	T	rs141737156	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104359222G>T	uc001kvy.1	+	8	1089	c.943G>T	c.(943-945)GGA>TGA	p.G315*	SUFU_uc001kvw.1_Nonsense_Mutation_p.G315*|SUFU_uc001kvx.2_Nonsense_Mutation_p.G315*|SUFU_uc009xxe.1_RNA|SUFU_uc009xxf.1_RNA	NM_016169	NP_057253	Q9UMX1	SUFU_HUMAN	suppressor of fused	315					negative regulation of transcription from RNA polymerase II promoter|proteolysis|skeletal system development	cytoplasm|nucleus	identical protein binding|protein binding|signal transducer activity|transcription corepressor activity|transcription factor binding			central_nervous_system(4)|skin(2)|breast(1)	7		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)				D|F|S		medulloblastoma	medulloblastoma			Medulloblastoma_associated_with_Germline_SUFU_Mutation				---	---	---	---
NRAP	4892	broad.mit.edu	37	10	115364568	115364568	+	Missense_Mutation	SNP	C	T	T	rs141793697		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115364568C>T	uc001laj.2	-	35	4191	c.4027G>A	c.(4027-4029)GAG>AAG	p.E1343K	NRAP_uc009xyb.2_Missense_Mutation_p.E132K|NRAP_uc001lak.2_Missense_Mutation_p.E1308K|NRAP_uc001lal.3_Missense_Mutation_p.E1343K	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	1343	Nebulin 35.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)														---	---	---	---
NRAP	4892	broad.mit.edu	37	10	115391614	115391614	+	Splice_Site	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115391614A>G	uc001laj.2	-	17	1904	c.1740_splice	c.e17+1	p.N580_splice	NRAP_uc009xyb.2_5'Flank|NRAP_uc001lak.2_Splice_Site_p.N545_splice|NRAP_uc001lal.3_Splice_Site_p.N580_splice	NM_198060	NP_932326			nebulin-related anchoring protein isoform S							fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)														---	---	---	---
ATRNL1	26033	broad.mit.edu	37	10	117059579	117059579	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117059579T>A	uc001lcg.2	+	16	2837	c.2451T>A	c.(2449-2451)AAT>AAA	p.N817K	ATRNL1_uc010qsm.1_5'UTR|ATRNL1_uc010qsn.1_5'Flank	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	817	C-type lectin.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)														---	---	---	---
MUC2	4583	broad.mit.edu	37	11	1093418	1093418	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1093418C>A	uc001lsx.1	+	31	12350	c.12323C>A	c.(12322-12324)CCC>CAC	p.P4108H		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	4108						inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)													---	---	---	---
OR52M1	119772	broad.mit.edu	37	11	4567259	4567259	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4567259C>A	uc010qyf.1	+	1	839	c.839C>A	c.(838-840)GCC>GAC	p.A280D		NM_001004137	NP_001004137	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M,	280	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---
OR52D1	390066	broad.mit.edu	37	11	5510653	5510653	+	Silent	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5510653A>G	uc010qzg.1	+	1	717	c.717A>G	c.(715-717)AAA>AAG	p.K239K	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005163	NP_001005163	Q9H346	O52D1_HUMAN	olfactory receptor, family 52, subfamily D,	239	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.46e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
OR52N2	390077	broad.mit.edu	37	11	5841667	5841667	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5841667C>A	uc010qzp.1	+	1	102	c.102C>A	c.(100-102)TGC>TGA	p.C34*	TRIM5_uc001mbq.1_Intron	NM_001005174	NP_001005174	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N,	34	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---
SYT9	143425	broad.mit.edu	37	11	7335109	7335109	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7335109C>A	uc001mfe.2	+	3	1218	c.981C>A	c.(979-981)TTC>TTA	p.F327L	SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_Intron	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX	327	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)														---	---	---	---
LMO1	4004	broad.mit.edu	37	11	8251922	8251922	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8251922G>C	uc001mgg.1	-	2	652	c.155C>G	c.(154-156)GCG>GGG	p.A52G	LMO1_uc009yfo.1_RNA|LMO1_uc001mgh.1_Missense_Mutation_p.A51G	NM_002315	NP_002306	P25800	RBTN1_HUMAN	LIM domain only 1	52	LIM zinc-binding 1.				cell proliferation|multicellular organismal development|positive regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0				Epithelial(150;1.59e-07)|BRCA - Breast invasive adenocarcinoma(625;0.203)				T|A	TRD@	T-ALL|neuroblastoma	neuroblastoma							---	---	---	---
SCUBE2	57758	broad.mit.edu	37	11	9088341	9088341	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9088341G>A	uc001mhh.1	-	6	743	c.663C>T	c.(661-663)AAC>AAT	p.N221N	SCUBE2_uc001mhi.1_Silent_p.N221N|SCUBE2_uc001mhj.1_Silent_p.N221N	NM_020974	NP_066025	Q9NQ36	SCUB2_HUMAN	CEGP1 protein precursor	221	EGF-like 5 (Potential).					extracellular region	calcium ion binding			ovary(1)|skin(1)	2				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)														---	---	---	---
DBX1	120237	broad.mit.edu	37	11	20178743	20178743	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20178743G>A	uc001mpw.1	-	3	512	c.512C>T	c.(511-513)CCG>CTG	p.P171L		NM_001029865	NP_001025036	A6NMT0	DBX1_HUMAN	developing brain homeobox 1	171					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40137319	40137319	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40137319C>T	uc001mxa.1	-	2	2488	c.524G>A	c.(523-525)CGC>CAC	p.R175H	LRRC4C_uc001mxc.1_Missense_Mutation_p.R171H|LRRC4C_uc001mxd.1_Missense_Mutation_p.R171H|LRRC4C_uc001mxb.1_Missense_Mutation_p.R171H	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	175	LRR 5.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
OR5J2	282775	broad.mit.edu	37	11	55944680	55944680	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55944680A>T	uc010rjb.1	+	1	587	c.587A>T	c.(586-588)GAG>GTG	p.E196V		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)																	---	---	---	---
OR8K1	390157	broad.mit.edu	37	11	56113842	56113842	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56113842T>C	uc010rjg.1	+	1	328	c.328T>C	c.(328-330)TTT>CTT	p.F110L		NM_001002907	NP_001002907	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K,	110	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)														HNSCC(65;0.19)			---	---	---	---
PLCB3	5331	broad.mit.edu	37	11	64026037	64026037	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64026037C>T	uc001nzb.2	+	11	1105	c.1105C>T	c.(1105-1107)CGG>TGG	p.R369W	PLCB3_uc009ypg.1_Missense_Mutation_p.R369W|PLCB3_uc009yph.1_Missense_Mutation_p.R302W|PLCB3_uc009ypi.2_Missense_Mutation_p.R369W	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3	369	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2																		---	---	---	---
OVOL1	5017	broad.mit.edu	37	11	65562618	65562618	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65562618G>A	uc001ofp.2	+	4	926	c.610G>A	c.(610-612)GCG>ACG	p.A204T	OVOL1_uc001ofq.2_Missense_Mutation_p.A142T	NM_004561	NP_004552	O14753	OVOL1_HUMAN	OVO-like 1 binding protein	204					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.17)														---	---	---	---
RPS6KB2	6199	broad.mit.edu	37	11	67201692	67201692	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67201692G>T	uc001old.2	+	12	1075	c.993G>T	c.(991-993)ATG>ATT	p.M331I	RPS6KB2_uc001olf.2_Missense_Mutation_p.M131I|RPS6KB2_uc001olg.2_Missense_Mutation_p.M331I|RPS6KB2_uc009yrq.2_Missense_Mutation_p.M131I|RPS6KB2_uc001ole.2_RNA|RPS6KB2_uc001olh.2_RNA|RPS6KB2_uc009yrr.2_Missense_Mutation_p.M162I	NM_003952	NP_003943	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide	331	AGC-kinase C-terminal.				nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of translational initiation|translation	nucleoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|stomach(1)|lung(1)|salivary_gland(1)	7			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)															---	---	---	---
OMP	4975	broad.mit.edu	37	11	76814137	76814137	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76814137G>A	uc010rsk.1	+	1	252	c.252G>A	c.(250-252)TCG>TCA	p.S84S	CAPN5_uc001oxx.2_Intron|CAPN5_uc009yup.2_Intron|CAPN5_uc009yuq.2_Intron|CAPN5_uc001oxy.2_Intron	NM_006189	NP_006180	P47874	OMP_HUMAN	olfactory marker protein	84					sensory perception of smell|synaptic transmission						0																		---	---	---	---
INTS4	92105	broad.mit.edu	37	11	77602515	77602515	+	Intron	SNP	G	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77602515G>C	uc001oys.2	-						C11orf67_uc001oyp.2_Intron|C11orf67_uc001oyr.1_Intron|INTS4_uc001oyt.2_Intron	NM_033547	NP_291025			integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)															---	---	---	---
TYR	7299	broad.mit.edu	37	11	88911598	88911598	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88911598G>A	uc001pcs.2	+	1	559	c.477G>A	c.(475-477)ATG>ATA	p.M159I		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	159	Lumenal, melanosome (Potential).				eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)									Oculocutaneous_Albinism				---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92565068	92565068	+	Silent	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92565068A>G	uc001pdj.3	+	13	9779	c.9762A>G	c.(9760-9762)CAA>CAG	p.Q3254Q		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3254	Cadherin 30.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
ELMOD1	55531	broad.mit.edu	37	11	107524925	107524925	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107524925G>A	uc010rvs.1	+	10	1079	c.675G>A	c.(673-675)AAG>AAA	p.K225K	ELMOD1_uc001pjm.2_Silent_p.K217K|ELMOD1_uc010rvt.1_Silent_p.K219K	NM_018712	NP_061182	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1 isoform 1	225	ELMO.				phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)														---	---	---	---
CADM1	23705	broad.mit.edu	37	11	115088649	115088649	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115088649C>T	uc001ppi.3	-	6	913	c.784G>A	c.(784-786)GCG>ACG	p.A262T	CADM1_uc001ppf.3_Missense_Mutation_p.A262T|CADM1_uc001ppk.3_Missense_Mutation_p.A262T|CADM1_uc001ppj.3_Missense_Mutation_p.A262T|CADM1_uc001ppl.2_Missense_Mutation_p.A262T|CADM1_uc001pph.3_Missense_Mutation_p.A14T	NM_014333	NP_055148	Q9BY67	CADM1_HUMAN	immunoglobulin superfamily, member 4D isoform 1	262	Ig-like C2-type 2.|Extracellular (Potential).				adherens junction organization|apoptosis|cell differentiation|cell junction assembly|cell recognition|detection of stimulus|heterophilic cell-cell adhesion|homophilic cell adhesion|multicellular organismal development|positive regulation of cytokine secretion|spermatogenesis|susceptibility to natural killer cell mediated cytotoxicity	basolateral plasma membrane|cell-cell junction|integral to membrane	PDZ domain binding|protein C-terminus binding|protein homodimerization activity|receptor binding			ovary(2)	2	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)														---	---	---	---
KCNA5	3741	broad.mit.edu	37	12	5154147	5154147	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5154147A>C	uc001qni.2	+	1	1063	c.834A>C	c.(832-834)GAA>GAC	p.E278D		NM_002234	NP_002225	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related	278						Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity			ovary(2)|breast(2)	4																		---	---	---	---
IFFO1	25900	broad.mit.edu	37	12	6664448	6664448	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6664448G>A	uc001qpd.1	-	1	782	c.748C>T	c.(748-750)CGG>TGG	p.R250W	IFFO1_uc001qpe.1_RNA|IFFO1_uc010sfe.1_Missense_Mutation_p.R250W|IFFO1_uc001qpf.1_Missense_Mutation_p.R250W|IFFO1_uc001qpc.1_Missense_Mutation_p.R250W	NM_080730	NP_542768	Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan isoform 2	250	Potential.					intermediate filament					0																		---	---	---	---
SLC2A14	144195	broad.mit.edu	37	12	7966992	7966992	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7966992C>T	uc001qtk.2	-	16	2276	c.1483G>A	c.(1483-1485)GGT>AGT	p.G495S	SLC2A14_uc001qtl.2_Missense_Mutation_p.G472S|SLC2A14_uc001qtm.2_Missense_Mutation_p.G472S|SLC2A14_uc010sgg.1_Missense_Mutation_p.G386S|SLC2A14_uc001qtn.2_Missense_Mutation_p.G495S|SLC2A14_uc001qto.2_Missense_Mutation_p.G130S|SLC2A14_uc010sgh.1_Missense_Mutation_p.G510S	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14	495	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)														---	---	---	---
PZP	5858	broad.mit.edu	37	12	9355219	9355219	+	Missense_Mutation	SNP	G	A	A	rs142943281		TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9355219G>A	uc001qvl.2	-	3	358	c.329C>T	c.(328-330)ACG>ATG	p.T110M	PZP_uc009zgl.2_Translation_Start_Site	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5																		---	---	---	---
PDE3A	5139	broad.mit.edu	37	12	20792810	20792810	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20792810C>G	uc001reh.1	+	10	2192	c.2170C>G	c.(2170-2172)CTC>GTC	p.L724V		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	724					lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)													---	---	---	---
SOX5	6660	broad.mit.edu	37	12	23893966	23893966	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23893966G>A	uc001rfw.2	-	5	678	c.576C>T	c.(574-576)CCC>CCT	p.P192P	SOX5_uc001rfx.2_Silent_p.P179P|SOX5_uc001rfy.2_Silent_p.P179P|SOX5_uc010siv.1_Silent_p.P179P|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Silent_p.P144P	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	192					transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26784816	26784816	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26784816T>C	uc001rhg.2	-	22	3334	c.2917A>G	c.(2917-2919)ATC>GTC	p.I973V		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	973	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
ARID2	196528	broad.mit.edu	37	12	46243831	46243831	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46243831G>A	uc001ros.1	+	15	1925	c.1925G>A	c.(1924-1926)GGA>GAA	p.G642E	ARID2_uc001ror.2_Missense_Mutation_p.G642E|ARID2_uc009zkg.1_Missense_Mutation_p.G98E|ARID2_uc009zkh.1_Missense_Mutation_p.G269E|ARID2_uc001rou.1_5'UTR	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	642					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)														---	---	---	---
CCDC65	85478	broad.mit.edu	37	12	49314874	49314874	+	Intron	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49314874C>T	uc001rso.2	+							NM_033124	NP_149115			coiled-coil domain containing 65											ovary(1)|skin(1)	2																		---	---	---	---
FAIM2	23017	broad.mit.edu	37	12	50295022	50295022	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50295022G>A	uc001rvj.1	-	2	247	c.102C>T	c.(100-102)GCC>GCT	p.A34A	FAIM2_uc001rvi.1_5'UTR|FAIM2_uc001rvk.1_RNA	NM_012306	NP_036438	Q9BWQ8	FAIM2_HUMAN	Fas apoptotic inhibitory molecule 2	34					anti-apoptosis|apoptosis	cell junction|integral to membrane|postsynaptic membrane				large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---
KRT3	3850	broad.mit.edu	37	12	53189281	53189281	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53189281G>A	uc001say.2	-	1	612	c.546C>T	c.(544-546)CCC>CCT	p.P182P		NM_057088	NP_476429	P12035	K2C3_HUMAN	keratin 3	182	Head.				epithelial cell differentiation|intermediate filament cytoskeleton organization	keratin filament	structural molecule activity				0																		---	---	---	---
OR6C6	283365	broad.mit.edu	37	12	55688987	55688987	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55688987G>T	uc010sph.1	-	1	30	c.30C>A	c.(28-30)TTC>TTA	p.F10L		NM_001005493	NP_001005493	A6NF89	OR6C6_HUMAN	olfactory receptor, family 6, subfamily C,	10	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|skin(1)	2																		---	---	---	---
DNAJC14	85406	broad.mit.edu	37	12	56221860	56221860	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56221860G>A	uc001shx.1	-	2	787	c.583C>T	c.(583-585)CGG>TGG	p.R195W	DNAJC14_uc001shu.1_Missense_Mutation_p.R195W|DNAJC14_uc009zob.1_Missense_Mutation_p.R195W|DNAJC14_uc001shy.1_Missense_Mutation_p.R195W	NM_032364	NP_115740	Q6Y2X3	DJC14_HUMAN	dopamine receptor interacting protein	195					protein folding|protein transport	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|unfolded protein binding			ovary(3)|large_intestine(1)	4																		---	---	---	---
ERBB3	2065	broad.mit.edu	37	12	56482339	56482339	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56482339T>A	uc001sjh.2	+	8	1080	c.887T>A	c.(886-888)GTG>GAG	p.V296E	ERBB3_uc009zoj.2_RNA|ERBB3_uc010sqb.1_Intron|ERBB3_uc010sqc.1_Missense_Mutation_p.V237E|ERBB3_uc001sji.2_5'UTR	NM_001982	NP_001973	P21860	ERBB3_HUMAN	erbB-3 isoform 1 precursor	296	Extracellular (Potential).				cranial nerve development|heart development|negative regulation of cell adhesion|negative regulation of neuron apoptosis|negative regulation of secretion|negative regulation of signal transduction|neuron apoptosis|phosphatidylinositol 3-kinase cascade|positive regulation of phosphatidylinositol 3-kinase cascade|regulation of cell proliferation|Schwann cell differentiation|transmembrane receptor protein tyrosine kinase signaling pathway|wound healing	basolateral plasma membrane|extracellular space|integral to plasma membrane|receptor complex	ATP binding|growth factor binding|protein heterodimerization activity|protein homodimerization activity|protein tyrosine kinase activator activity|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(3)|central_nervous_system(2)|stomach(1)|ovary(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)															---	---	---	---
CAND1	55832	broad.mit.edu	37	12	67704010	67704010	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67704010C>G	uc001stn.2	+	13	3711	c.3274C>G	c.(3274-3276)CTT>GTT	p.L1092V	CAND1_uc001sto.2_Missense_Mutation_p.L602V	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	1092	HEAT 25.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)														---	---	---	---
E2F7	144455	broad.mit.edu	37	12	77427650	77427650	+	Silent	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77427650G>A	uc001sym.3	-	8	1532	c.1296C>T	c.(1294-1296)TAC>TAT	p.Y432Y		NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	432					cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3																		---	---	---	---
MRPL42	28977	broad.mit.edu	37	12	93873160	93873160	+	Intron	SNP	T	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93873160T>A	uc001tcr.2	+						MRPL42_uc001tcq.2_Intron|MRPL42_uc001tcs.2_Intron|MRPL42_uc001tct.2_Intron	NM_172177	NP_751917			mitochondrial ribosomal protein L42 isoform a						translation	mitochondrial small ribosomal subunit	structural constituent of ribosome			ovary(2)	2																		---	---	---	---
TRPC4	7223	broad.mit.edu	37	13	38357422	38357422	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38357422G>A	uc001uws.2	-	2	284	c.49C>T	c.(49-51)CGC>TGC	p.R17C	TRPC4_uc010abv.2_5'UTR|TRPC4_uc001uwt.2_Missense_Mutation_p.R17C|TRPC4_uc010tey.1_Missense_Mutation_p.R17C|TRPC4_uc010abw.2_Missense_Mutation_p.R17C|TRPC4_uc010abx.2_Missense_Mutation_p.R17C|TRPC4_uc010aby.2_Missense_Mutation_p.R17C	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	17	Cytoplasmic (Potential).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)														---	---	---	---
MLNR	2862	broad.mit.edu	37	13	49796441	49796441	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49796441A>T	uc010tgj.1	+	2	1167	c.1167A>T	c.(1165-1167)GAA>GAT	p.E389D		NM_001507	NP_001498	O43193	MTLR_HUMAN	motilin receptor	389	Cytoplasmic (Potential).				digestion	integral to plasma membrane	growth hormone-releasing hormone receptor activity				0		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)														---	---	---	---
ATP7B	540	broad.mit.edu	37	13	52511478	52511478	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52511478G>A	uc001vfw.2	-	19	4112	c.3955C>T	c.(3955-3957)CGA>TGA	p.R1319*	ATP7B_uc010adv.2_Nonsense_Mutation_p.R889*|ATP7B_uc001vfx.2_Nonsense_Mutation_p.R1112*|ATP7B_uc001vfy.2_Nonsense_Mutation_p.R1208*|ATP7B_uc010tgt.1_Nonsense_Mutation_p.R1254*|ATP7B_uc010tgu.1_Nonsense_Mutation_p.R1271*|ATP7B_uc010tgv.1_Nonsense_Mutation_p.R1241*|ATP7B_uc001vfv.2_Nonsense_Mutation_p.R591*|ATP7B_uc010tgs.1_Nonsense_Mutation_p.R530*	NM_000053	NP_000044	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	1319	Cytoplasmic (Potential).				ATP biosynthetic process|cellular copper ion homeostasis|copper ion import|response to copper ion|sequestering of calcium ion	Golgi membrane|integral to plasma membrane|late endosome|mitochondrion	ATP binding|copper ion binding|copper-exporting ATPase activity|protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)										Wilson_disease				---	---	---	---
UTP14C	9724	broad.mit.edu	37	13	52604940	52604940	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52604940T>C	uc001vgb.2	+	2	2535	c.2000T>C	c.(1999-2001)ATT>ACT	p.I667T	UTP14C_uc001vgc.2_RNA	NM_021645	NP_067677	Q5TAP6	UT14C_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	667					cell differentiation|meiosis|multicellular organismal development|rRNA processing|spermatogenesis	nucleolus|small-subunit processome				ovary(3)|large_intestine(1)|breast(1)	5		Breast(56;0.00173)|Lung NSC(96;0.0108)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.3e-08)														---	---	---	---
EDNRB	1910	broad.mit.edu	37	13	78492643	78492643	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78492643C>T	uc001vko.2	-	1	324	c.66G>A	c.(64-66)TCG>TCA	p.S22S	uc001vks.2_5'Flank|EDNRB_uc001vkq.1_Silent_p.S22S|EDNRB_uc010aez.1_Silent_p.S22S|EDNRB_uc001vkp.1_Silent_p.S105S|EDNRB_uc010afa.1_Silent_p.S22S	NM_001122659	NP_001116131	P24530	EDNRB_HUMAN	endothelin receptor type B isoform 1 precursor	22				SRI -> LGV (in Ref. 8).	activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|enteric smooth muscle cell differentiation|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of neuron maturation|negative regulation of transcription from RNA polymerase II promoter|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding				0		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)											OREG0022452	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
EFNB2	1948	broad.mit.edu	37	13	107145743	107145743	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107145743G>A	uc001vqi.2	-	5	672	c.647C>T	c.(646-648)TCG>TTG	p.S216L		NM_004093	NP_004084	P52799	EFNB2_HUMAN	ephrin B2 precursor	216	Extracellular (Potential).				cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)																	---	---	---	---
SYNE2	23224	broad.mit.edu	37	14	64608756	64608756	+	Missense_Mutation	SNP	C	A	A	rs2039475	byFrequency;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64608756C>A	uc001xgm.2	+	82	15486	c.15256C>A	c.(15256-15258)CAT>AAT	p.H5086N	SYNE2_uc001xgl.2_Missense_Mutation_p.H5086N|SYNE2_uc010apy.2_Missense_Mutation_p.H1471N|SYNE2_uc001xgn.2_Missense_Mutation_p.H48N|SYNE2_uc001xgo.2_RNA	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5086	Spectrin 2.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---
SPTB	6710	broad.mit.edu	37	14	65230507	65230507	+	Intron	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65230507G>A	uc001xhr.2	-						SPTB_uc001xhs.2_Intron|SPTB_uc010aqi.2_Intron	NM_001024858	NP_001020029			spectrin beta isoform a						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)														---	---	---	---
C14orf159	80017	broad.mit.edu	37	14	91671132	91671132	+	Silent	SNP	C	T	T	rs147127627	byFrequency	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91671132C>T	uc001xzb.2	+	14	2280	c.1512C>T	c.(1510-1512)ATC>ATT	p.I504I	C14orf159_uc001xyx.2_Intron|C14orf159_uc001xyw.2_Silent_p.I509I|C14orf159_uc001xzc.2_Silent_p.I504I|C14orf159_uc001xza.2_Silent_p.I509I|C14orf159_uc001xyv.2_Intron|C14orf159_uc001xyz.2_Silent_p.I380I|C14orf159_uc001xze.2_Silent_p.I504I	NM_001102366	NP_001095836	Q7Z3D6	CN159_HUMAN	hypothetical protein LOC80017 isoform a	504						mitochondrion				central_nervous_system(2)|ovary(1)	3		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)														---	---	---	---
GOLGA8E	390535	broad.mit.edu	37	15	23444051	23444051	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23444051C>T	uc001yvu.2	+	14	1695	c.706C>T	c.(706-708)CGG>TGG	p.R236W		NM_001012423	NP_001012423			golgi autoantigen, golgin subfamily a, 8E											skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;5.21e-07)|Epithelial(43;5.65e-06)|BRCA - Breast invasive adenocarcinoma(123;0.000614)														---	---	---	---
GABRB3	2562	broad.mit.edu	37	15	27184463	27184463	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27184463A>G	uc001zbb.2	-	1	224	c.121T>C	c.(121-123)TGG>CGG	p.W41R	GABRA5_uc001zbd.1_Intron	NM_021912	NP_068712	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	Error:Variant_position_missing_in_P28472_after_alignment					synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
FBN1	2200	broad.mit.edu	37	15	48714263	48714263	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48714263G>A	uc001zwx.1	-	61	7784	c.7456C>T	c.(7456-7458)CTT>TTT	p.L2486F	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	2486	EGF-like 43; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)														---	---	---	---
FBN1	2200	broad.mit.edu	37	15	48717686	48717686	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48717686G>C	uc001zwx.1	-	60	7661	c.7333C>G	c.(7333-7335)CTG>GTG	p.L2445V	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	2445	EGF-like 42; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)														---	---	---	---
FBN1	2200	broad.mit.edu	37	15	48779357	48779357	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48779357A>C	uc001zwx.1	-	29	3832	c.3504T>G	c.(3502-3504)AAT>AAG	p.N1168K		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	1168	EGF-like 18; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)														---	---	---	---
MYO5C	55930	broad.mit.edu	37	15	52564890	52564890	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52564890C>G	uc010bff.2	-	6	774	c.637G>C	c.(637-639)GAC>CAC	p.D213H	MYO5C_uc010uga.1_RNA|MYO5C_uc010ugb.1_RNA|MYO5C_uc010ugc.1_Missense_Mutation_p.D176H	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	213	Myosin head-like.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)														---	---	---	---
STRA6	64220	broad.mit.edu	37	15	74490113	74490113	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74490113C>T	uc002axk.2	-	3	342	c.160G>A	c.(160-162)GCC>ACC	p.A54T	STRA6_uc002axi.2_5'Flank|STRA6_uc010ulh.1_Missense_Mutation_p.A92T|STRA6_uc002axj.2_Missense_Mutation_p.A93T|STRA6_uc010bji.2_Missense_Mutation_p.A54T|STRA6_uc002axl.2_5'UTR|STRA6_uc002axm.2_Missense_Mutation_p.A54T|STRA6_uc002axn.2_Missense_Mutation_p.A54T|STRA6_uc010uli.1_Missense_Mutation_p.A91T|STRA6_uc010bjj.1_RNA|STRA6_uc010bjk.2_Missense_Mutation_p.A54T	NM_022369	NP_071764	Q9BX79	STRA6_HUMAN	stimulated by retinoic acid gene 6 homolog	54	Helical; (Potential).				adrenal gland development|alveolar primary septum development|developmental growth|diaphragm development|digestive tract morphogenesis|ear development|embryonic camera-type eye formation|embryonic digestive tract development|eyelid development in camera-type eye|face morphogenesis|feeding behavior|female genitalia development|kidney development|lung vasculature development|neuromuscular process|nose morphogenesis|paramesonephric duct development|positive regulation of behavior|pulmonary artery morphogenesis|pulmonary valve morphogenesis|smooth muscle tissue development|transport|uterus morphogenesis|ventricular septum development|vocal learning	integral to membrane|plasma membrane|protein complex	receptor activity			central_nervous_system(1)	1																		---	---	---	---
ULK3	25989	broad.mit.edu	37	15	75133745	75133745	+	Splice_Site	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75133745C>T	uc010bkf.1	-	4	575	c.469_splice	c.e4+1	p.D157_splice	ULK3_uc010ulp.1_Splice_Site_p.D67_splice|ULK3_uc010ulq.1_Splice_Site_p.D168_splice|ULK3_uc010ulr.1_Splice_Site_p.D40_splice|ULK3_uc002ayv.2_Splice_Site_p.D157_splice|ULK3_uc010uls.1_Splice_Site_p.D40_splice|ULK3_uc010ult.1_Splice_Site_p.D67_splice|ULK3_uc010ulu.1_Splice_Site_p.D67_splice	NM_001099436	NP_001092906			unc-51-like kinase 3							cytoplasm	ATP binding|protein serine/threonine kinase activity			breast(2)	2																		---	---	---	---
SGK269	79834	broad.mit.edu	37	15	77473569	77473569	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77473569C>T	uc002bcm.2	-	3	1008	c.700G>A	c.(700-702)GAG>AAG	p.E234K	SGK269_uc002bcn.2_Missense_Mutation_p.E234K	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	234					cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)														---	---	---	---
AP3S2	10239	broad.mit.edu	37	15	90451524	90451524	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90451524T>G	uc002bos.3	-	3	444	c.289A>C	c.(289-291)ATG>CTG	p.M97L	C15orf38_uc002bot.1_RNA|C15orf38_uc002bou.2_Missense_Mutation_p.M97L	NM_182616	NP_872422	P59780	AP3S2_HUMAN	hypothetical protein LOC348110	Error:Variant_position_missing_in_P59780_after_alignment					intracellular protein transport|vesicle-mediated transport	cytoplasmic vesicle membrane|Golgi apparatus|membrane coat	protein transporter activity				0	Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)															---	---	---	---
FURIN	5045	broad.mit.edu	37	15	91424761	91424761	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91424761C>T	uc002bpu.1	+	16	2254	c.2038C>T	c.(2038-2040)CAG>TAG	p.Q680*	FES_uc010uqj.1_5'Flank|FES_uc010uqk.1_5'Flank|FES_uc002bpw.2_5'Flank|FES_uc002bpv.2_5'Flank	NM_002569	NP_002560	P09958	FURIN_HUMAN	furin preproprotein	680	Cys-rich.				cell proliferation|negative regulation of low-density lipoprotein particle receptor catabolic process|negative regulation of transforming growth factor-beta1 production|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|Notch signaling pathway|peptide biosynthetic process|peptidyl-glutamic acid carboxylation|post-translational protein modification|secretion by cell|signal peptide processing|transforming growth factor beta receptor signaling pathway|viral assembly, maturation, egress, and release	cell surface|Golgi lumen|Golgi membrane|integral to membrane|membrane raft|plasma membrane|trans-Golgi network|trans-Golgi network transport vesicle	metal ion binding|nerve growth factor binding|peptide binding|protease binding|serine-type endopeptidase activity|serine-type endopeptidase inhibitor activity			central_nervous_system(4)|lung(2)|breast(1)	7	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)															---	---	---	---
ARHGAP17	55114	broad.mit.edu	37	16	24980088	24980088	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24980088A>G	uc002dnb.2	-	5	371	c.278T>C	c.(277-279)ATG>ACG	p.M93T	ARHGAP17_uc002dnc.2_Missense_Mutation_p.M93T|ARHGAP17_uc010vcf.1_Intron|ARHGAP17_uc002dnf.2_Missense_Mutation_p.M1T|ARHGAP17_uc002dng.1_Missense_Mutation_p.M93T	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1	93	BAR.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)														---	---	---	---
ZNF668	79759	broad.mit.edu	37	16	31075222	31075222	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31075222G>A	uc010caf.2	-	2	916	c.559C>T	c.(559-561)CGG>TGG	p.R187W	ZNF668_uc002eao.2_Missense_Mutation_p.R187W|ZNF668_uc010cag.1_Missense_Mutation_p.R187W	NM_024706	NP_078982	Q96K58	ZN668_HUMAN	zinc finger protein 668	187	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(4)	4																		---	---	---	---
HEATR3	55027	broad.mit.edu	37	16	50136169	50136169	+	Splice_Site	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50136169G>A	uc002efw.2	+	14	1906	c.1744_splice	c.e14-1	p.N582_splice	HEATR3_uc002efx.2_Splice_Site_p.N496_splice	NM_182922	NP_891552			HEAT repeat containing 3								binding			ovary(1)|skin(1)	2																		---	---	---	---
CES1	1066	broad.mit.edu	37	16	55866963	55866963	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55866963C>A	uc002eim.2	-	1	113	c.5G>T	c.(4-6)TGG>TTG	p.W2L	CES1_uc002eil.2_Missense_Mutation_p.W2L|CES1_uc002ein.2_Missense_Mutation_p.W2L	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor	2				W -> L (in Ref. 5; AAD53175).	response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)													---	---	---	---
PDP2	57546	broad.mit.edu	37	16	66919494	66919494	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66919494G>T	uc002eqk.1	+	2	1469	c.1307G>T	c.(1306-1308)TGG>TTG	p.W436L		NM_020786	NP_065837	Q9P2J9	PDP2_HUMAN	pyruvate dehydrogenase phosphatase isoenzyme 2	436					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity|metal ion binding			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)														---	---	---	---
CNTNAP4	85445	broad.mit.edu	37	16	76486451	76486451	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76486451C>A	uc002feu.1	+	10	1503	c.1118C>A	c.(1117-1119)ACT>AAT	p.T373N	CNTNAP4_uc002fev.1_Missense_Mutation_p.T237N|CNTNAP4_uc010chb.1_Missense_Mutation_p.T300N|CNTNAP4_uc002fex.1_Missense_Mutation_p.T376N|CNTNAP4_uc002few.2_Missense_Mutation_p.T348N	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	373	Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
ADAD2	161931	broad.mit.edu	37	16	84227796	84227796	+	Intron	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84227796G>T	uc002fhr.2	+						ADAD2_uc002fhq.2_Missense_Mutation_p.M201I|uc002fhs.1_Missense_Mutation_p.P162Q	NM_001145400	NP_001138872			adenosine deaminase domain containing 2 isoform						RNA processing	intracellular	adenosine deaminase activity|double-stranded RNA binding				0																		---	---	---	---
RPH3AL	9501	broad.mit.edu	37	17	177339	177339	+	5'UTR	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:177339C>T	uc002frd.1	-	1					RPH3AL_uc010vpy.1_5'UTR|RPH3AL_uc002fre.1_5'UTR|RPH3AL_uc002frf.1_5'UTR|RPH3AL_uc010cjl.1_5'UTR	NM_006987	NP_008918			rabphilin 3A-like (without C2 domains)						exocytosis|intracellular protein transport	transport vesicle membrane	cytoskeletal protein binding|Rab GTPase binding|zinc ion binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.023)|all cancers(1;4.96e-06)|Epithelial(1;2.86e-05)|BRCA - Breast invasive adenocarcinoma(1;0.00453)|OV - Ovarian serous cystadenocarcinoma(1;0.0716)|LUAD - Lung adenocarcinoma(1115;0.102)|COAD - Colon adenocarcinoma(4;0.107)														---	---	---	---
TP53	7157	broad.mit.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578212G>A	uc002gim.2	-	6	831	c.637C>T	c.(637-639)CGA>TGA	p.R213*	TP53_uc002gig.1_Nonsense_Mutation_p.R213*|TP53_uc002gih.2_Nonsense_Mutation_p.R213*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R81*|TP53_uc010cng.1_Nonsense_Mutation_p.R81*|TP53_uc002gii.1_Nonsense_Mutation_p.R81*|TP53_uc010cnh.1_Nonsense_Mutation_p.R213*|TP53_uc010cni.1_Nonsense_Mutation_p.R213*|TP53_uc002gij.2_Nonsense_Mutation_p.R213*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.R120*|TP53_uc002gio.2_Nonsense_Mutation_p.R81*|TP53_uc010vug.1_Nonsense_Mutation_p.R174*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	213	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R213*(186)|p.R213L(25)|p.R213Q(22)|p.R213fs*34(10)|p.0?(7)|p.R213P(5)|p.R81*(2)|p.R120*(2)|p.R213G(2)|p.K164_P219del(1)|p.D208_V216delDRNTFRHSV(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R213*33(1)|p.D208fs*1(1)|p.R213>L(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11543688	11543688	+	Missense_Mutation	SNP	C	T	T	rs114346791	byFrequency;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11543688C>T	uc002gne.2	+	10	1956	c.1888C>T	c.(1888-1890)CGC>TGC	p.R630C		NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	630	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
KRT28	162605	broad.mit.edu	37	17	38953511	38953511	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38953511G>A	uc002hvh.1	-	4	779	c.713C>T	c.(712-714)GCG>GTG	p.A238V		NM_181535	NP_853513	Q7Z3Y7	K1C28_HUMAN	keratin 25D	238	Rod.|Linker 12.					cytoplasm|intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)																---	---	---	---
AOC3	8639	broad.mit.edu	37	17	41004209	41004209	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41004209C>T	uc002ibv.2	+	1	1009	c.849C>T	c.(847-849)GCC>GCT	p.A283A		NM_003734	NP_003725	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3 precursor	283	Extracellular (Potential).				amine metabolic process|cell adhesion|inflammatory response	cell surface|integral to membrane|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|protein homodimerization activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)													---	---	---	---
BRCA1	672	broad.mit.edu	37	17	41244276	41244276	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41244276G>T	uc002icq.2	-	10	3504	c.3272C>A	c.(3271-3273)CCT>CAT	p.P1091H	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.P1020H|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.P1044H|BRCA1_uc002ict.2_Missense_Mutation_p.P1091H|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.P1091H|BRCA1_uc002ide.1_Missense_Mutation_p.P922H|BRCA1_uc010cyy.1_Missense_Mutation_p.P1091H|BRCA1_uc010whs.1_Missense_Mutation_p.P1091H|BRCA1_uc010cyz.2_Missense_Mutation_p.P1044H|BRCA1_uc010cza.2_Missense_Mutation_p.P1065H|BRCA1_uc010wht.1_Missense_Mutation_p.P795H	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	1091					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)				D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			---	---	---	---
BRCA1	672	broad.mit.edu	37	17	41245727	41245727	+	Silent	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41245727T>C	uc002icq.2	-	10	2053	c.1821A>G	c.(1819-1821)AAA>AAG	p.K607K	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Silent_p.K536K|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Silent_p.K560K|BRCA1_uc002ict.2_Silent_p.K607K|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Silent_p.K607K|BRCA1_uc002ide.1_Silent_p.K438K|BRCA1_uc010cyy.1_Silent_p.K607K|BRCA1_uc010whs.1_Silent_p.K607K|BRCA1_uc010cyz.2_Silent_p.K560K|BRCA1_uc010cza.2_Silent_p.K581K|BRCA1_uc010wht.1_Silent_p.K311K	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	607					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)				D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			---	---	---	---
CARD14	79092	broad.mit.edu	37	17	78169018	78169018	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78169018C>T	uc002jxw.1	+	10	1580	c.1385C>T	c.(1384-1386)ACG>ATG	p.T462M	CARD14_uc002jxt.1_RNA|CARD14_uc002jxv.2_Missense_Mutation_p.T462M|CARD14_uc010wud.1_RNA|CARD14_uc002jxx.2_Missense_Mutation_p.T225M|CARD14_uc010dhu.1_Missense_Mutation_p.T260M	NM_024110	NP_077015	Q9BXL6	CAR14_HUMAN	caspase recruitment domain protein 14 isoform 1	462					activation of NF-kappaB-inducing kinase activity|positive regulation of protein phosphorylation|regulation of apoptosis	aggresome|cytoplasm|plasma membrane	CARD domain binding			ovary(4)|skin(1)	5	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)															---	---	---	---
RNF213	57674	broad.mit.edu	37	17	78319116	78319116	+	Silent	SNP	C	T	T	rs145456322	byFrequency	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78319116C>T	uc002jyh.1	+	4	1423	c.1200C>T	c.(1198-1200)AAC>AAT	p.N400N		NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)															---	---	---	---
RNF213	57674	broad.mit.edu	37	17	78367140	78367140	+	Intron	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78367140T>C	uc002jyh.1	+						uc002jyi.1_Intron|RNF213_uc010dhx.1_Intron	NM_020914	NP_065965			ring finger protein 213											ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)															---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78866538	78866538	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78866538G>A	uc002jyt.1	+	19	2916	c.2111G>A	c.(2110-2112)AGT>AAT	p.S704N	RPTOR_uc010wug.1_Missense_Mutation_p.S546N	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1	704					cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
ARHGAP28	79822	broad.mit.edu	37	18	6896535	6896535	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6896535C>T	uc010wzi.1	+	15	1647	c.1409C>T	c.(1408-1410)GCT>GTT	p.A470V	ARHGAP28_uc002knc.2_Missense_Mutation_p.A595V|ARHGAP28_uc002knd.2_Missense_Mutation_p.A488V|ARHGAP28_uc002kne.2_Missense_Mutation_p.A488V|ARHGAP28_uc002knf.2_Missense_Mutation_p.A479V			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;	470					signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)																---	---	---	---
ARHGAP28	79822	broad.mit.edu	37	18	6898567	6898567	+	Intron	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6898567C>T	uc010wzi.1	+						ARHGAP28_uc002knc.2_Silent_p.S669S|ARHGAP28_uc002knd.2_Silent_p.S562S|ARHGAP28_uc002kne.2_Intron|ARHGAP28_uc002knf.2_Silent_p.S553S					SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)																---	---	---	---
RBBP8	5932	broad.mit.edu	37	18	20562243	20562243	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20562243C>T	uc002ktw.2	+	7	822	c.491C>T	c.(490-492)CCG>CTG	p.P164L	RBBP8_uc002kty.2_Missense_Mutation_p.P164L|RBBP8_uc002ktz.2_Missense_Mutation_p.P164L|RBBP8_uc002kua.2_Missense_Mutation_p.P164L|RBBP8_uc002ktx.1_Missense_Mutation_p.P164L	NM_002894	NP_002885	Q99708	COM1_HUMAN	retinoblastoma binding protein 8 isoform a	164					cell cycle checkpoint|DNA double-strand break processing involved in repair via single-strand annealing|meiosis|regulation of transcription from RNA polymerase II promoter	nucleus	damaged DNA binding|protein binding|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)|lung(1)|skin(1)	3	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)										Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
LAMA3	3909	broad.mit.edu	37	18	21478983	21478983	+	Silent	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21478983A>G	uc002kuq.2	+	46	5876	c.5790A>G	c.(5788-5790)GCA>GCG	p.A1930A	LAMA3_uc002kur.2_Silent_p.A1930A|LAMA3_uc002kus.3_Silent_p.A321A|LAMA3_uc002kut.3_Silent_p.A321A	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	1930	Domain II and I.|Potential.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
DSEL	92126	broad.mit.edu	37	18	65180215	65180215	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65180215G>T	uc002lke.1	-	2	2885	c.1661C>A	c.(1660-1662)TCT>TAT	p.S554Y		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	544						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)																---	---	---	---
CNDP1	84735	broad.mit.edu	37	18	72245447	72245447	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72245447G>A	uc002llq.2	+	9	1263	c.1052G>A	c.(1051-1053)GGG>GAG	p.G351E	CNDP1_uc002lls.2_Missense_Mutation_p.G154E	NM_032649	NP_116038	Q96KN2	CNDP1_HUMAN	carnosinase 1 precursor	351					proteolysis	extracellular region	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity|tripeptidase activity				0		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)														---	---	---	---
ZNF236	7776	broad.mit.edu	37	18	74620320	74620320	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74620320C>T	uc002lmi.2	+	14	2534	c.2336C>T	c.(2335-2337)TCG>TTG	p.S779L	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	779					cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)														---	---	---	---
ADNP2	22850	broad.mit.edu	37	18	77894540	77894540	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77894540G>A	uc002lnw.2	+	4	1699	c.1244G>A	c.(1243-1245)GGG>GAG	p.G415E		NM_014913	NP_055728	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	415	Pro-rich.				cellular response to oxidative stress|cellular response to retinoic acid|negative regulation of cell death|neuron differentiation|positive regulation of cell growth	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|breast(3)|central_nervous_system(1)	8		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)														---	---	---	---
FEM1A	55527	broad.mit.edu	37	19	4793214	4793214	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4793214G>A	uc002mbf.2	+	1	1487	c.1348G>A	c.(1348-1350)GCC>ACC	p.A450T	uc002mbg.1_RNA	NM_018708	NP_061178	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a	450					regulation of ubiquitin-protein ligase activity	cytoplasm	binding|ubiquitin-protein ligase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)														---	---	---	---
KDM4B	23030	broad.mit.edu	37	19	5144859	5144859	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5144859C>T	uc002mbq.3	+	21	3193	c.2967C>T	c.(2965-2967)GAC>GAT	p.D989D	KDM4B_uc010xim.1_Silent_p.D1023D|KDM4B_uc002mbr.3_Silent_p.D747D	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B	989	Tudor 2.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1																		---	---	---	---
TYK2	7297	broad.mit.edu	37	19	10475399	10475399	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10475399C>A	uc002moc.3	-	9	1636	c.1258G>T	c.(1258-1260)GTG>TTG	p.V420L	TYK2_uc010dxe.2_Missense_Mutation_p.V235L|TYK2_uc002mod.2_Missense_Mutation_p.V420L	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	420	FERM.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)															---	---	---	---
ZNF433	163059	broad.mit.edu	37	19	12127452	12127452	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12127452T>G	uc002msy.1	-	4	401	c.230A>C	c.(229-231)AAA>ACA	p.K77T	uc002msx.1_Intron|ZNF433_uc002msz.1_Missense_Mutation_p.K42T	NM_001080411	NP_001073880	Q8N7K0	ZN433_HUMAN	zinc finger protein 433	77	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
CYP2A7	1549	broad.mit.edu	37	19	41383141	41383141	+	Missense_Mutation	SNP	C	T	T	rs73553091	byFrequency;by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41383141C>T	uc002opm.2	-	7	1657	c.1115G>A	c.(1114-1116)CGC>CAC	p.R372H	CYP2A7_uc002opo.2_Missense_Mutation_p.R372H|CYP2A7_uc002opn.2_Missense_Mutation_p.R321H	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,	372						endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)															---	---	---	---
PSG3	5671	broad.mit.edu	37	19	43242973	43242973	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43242973A>T	uc002oue.2	-	2	465	c.333T>A	c.(331-333)AAT>AAA	p.N111K	PSG3_uc002ouf.2_RNA|PSG1_uc002oug.1_Intron|PSG3_uc010eil.2_Missense_Mutation_p.N133K	NM_021016	NP_066296	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	111	Ig-like V-type.				defense response|female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)																---	---	---	---
SHANK1	50944	broad.mit.edu	37	19	51207401	51207401	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51207401G>A	uc002psx.1	-	9	1217	c.1198C>T	c.(1198-1200)CGA>TGA	p.R400*		NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	400					cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)														---	---	---	---
KLK5	25818	broad.mit.edu	37	19	51452106	51452106	+	Intron	SNP	G	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51452106G>C	uc002pue.2	-						KLK5_uc002puf.2_Intron|KLK5_uc002pug.2_Intron	NM_001077491	NP_001070959			kallikrein-related peptidase 5 preproprotein						epidermis development|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)														---	---	---	---
USP29	57663	broad.mit.edu	37	19	57640677	57640677	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57640677A>G	uc002qny.2	+	4	990	c.634A>G	c.(634-636)AGT>GGT	p.S212G		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	212					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)														---	---	---	---
ZNF304	57343	broad.mit.edu	37	19	57867740	57867740	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57867740C>T	uc010ygw.1	+	3	891	c.503C>T	c.(502-504)ACG>ATG	p.T168M	ZNF304_uc010etw.2_Missense_Mutation_p.T215M|ZNF304_uc010etx.2_Missense_Mutation_p.T126M	NM_020657	NP_065708	Q9HCX3	ZN304_HUMAN	zinc finger protein 304	168					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)														---	---	---	---
SIRPA	140885	broad.mit.edu	37	20	1896039	1896039	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1896039G>A	uc002wfq.2	+	3	734	c.374G>A	c.(373-375)CGG>CAG	p.R125Q	SIRPA_uc010zps.1_Missense_Mutation_p.R105Q|SIRPA_uc002wfr.2_Missense_Mutation_p.R125Q|SIRPA_uc002wfs.2_Missense_Mutation_p.R125Q|SIRPA_uc002wft.2_Missense_Mutation_p.R125Q	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	125	Ig-like V-type.|Extracellular (Potential).		R -> Q.		blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)														---	---	---	---
SMOX	54498	broad.mit.edu	37	20	4163049	4163049	+	Missense_Mutation	SNP	A	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4163049A>T	uc002wkm.1	+	5	1124	c.923A>T	c.(922-924)GAT>GTT	p.D308V	SMOX_uc002wkk.1_Intron|SMOX_uc002wkl.1_Intron|SMOX_uc002wkn.1_Intron|SMOX_uc002wkp.2_Missense_Mutation_p.D308V|SMOX_uc010zqo.1_Intron|SMOX_uc002wko.1_Missense_Mutation_p.D308V	NM_175839	NP_787033	Q9NWM0	SMOX_HUMAN	spermine oxidase isoform 1	308					polyamine biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	polyamine oxidase activity			breast(1)	1					Spermine(DB00127)													---	---	---	---
OTOR	56914	broad.mit.edu	37	20	16729120	16729120	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16729120G>A	uc002wpj.2	+	1	118	c.74G>A	c.(73-75)CGT>CAT	p.R25H	OTOR_uc002wpk.2_5'Flank	NM_020157	NP_064542	Q9NRC9	OTOR_HUMAN	otoraplin precursor	25					sensory perception of sound	extracellular region				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
CD93	22918	broad.mit.edu	37	20	23064930	23064930	+	Silent	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23064930G>T	uc002wsv.2	-	1	2048	c.1900C>A	c.(1900-1902)CGA>AGA	p.R634R		NM_012072	NP_036204	Q9NPY3	C1QR1_HUMAN	CD93 antigen precursor	634	Cytoplasmic (Potential).				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding			large_intestine(2)	2	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)																	---	---	---	---
RALGAPB	57148	broad.mit.edu	37	20	37150312	37150312	+	Silent	SNP	A	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37150312A>G	uc002xiw.2	+	10	1847	c.1590A>G	c.(1588-1590)GGA>GGG	p.G530G	RALGAPB_uc010zvz.1_Intron|RALGAPB_uc002xix.2_Silent_p.G530G|RALGAPB_uc002xiy.1_Silent_p.G530G|RALGAPB_uc002xiz.2_Silent_p.G308G|RALGAPB_uc002xja.1_Silent_p.G257G	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	530					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2																		---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41385239	41385239	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41385239C>T	uc002xkg.2	-	6	906	c.722G>A	c.(721-723)CGT>CAT	p.R241H	PTPRT_uc010ggj.2_Missense_Mutation_p.R241H	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	241	Extracellular (Potential).|Ig-like C2-type.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
JPH2	57158	broad.mit.edu	37	20	42788551	42788551	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42788551C>A	uc002xli.1	-	2	1749	c.876G>T	c.(874-876)ATG>ATT	p.M292I		NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1	292	MORN 7.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
ARFGEF2	10564	broad.mit.edu	37	20	47589713	47589713	+	Silent	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47589713C>T	uc002xtx.3	+	12	1709	c.1557C>T	c.(1555-1557)AAC>AAT	p.N519N		NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	519					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)															---	---	---	---
ARFGEF2	10564	broad.mit.edu	37	20	47589714	47589714	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47589714T>A	uc002xtx.3	+	12	1710	c.1558T>A	c.(1558-1560)TAC>AAC	p.Y520N		NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	520					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)															---	---	---	---
RAE1	8480	broad.mit.edu	37	20	55949651	55949651	+	Intron	SNP	C	T	T	rs6070087	by1000genomes	TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55949651C>T	uc002xyg.2	+						RAE1_uc010gis.1_Intron|RAE1_uc010git.1_Intron|RAE1_uc002xyh.2_Intron|RAE1_uc002xyi.2_Intron	NM_003610	NP_003601			RAE1 (RNA export 1, S.pombe) homolog						carbohydrate metabolic process|glucose transport|mRNA export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|cytoskeleton|nuclear outer membrane|nuclear pore	microtubule binding|RNA binding				0	Lung NSC(12;0.00263)|all_lung(29;0.00828)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;3.7e-14)|Epithelial(14;1.07e-09)|all cancers(14;1.11e-08)															---	---	---	---
VAPB	9217	broad.mit.edu	37	20	57015989	57015989	+	Silent	SNP	A	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57015989A>T	uc002xza.2	+	5	694	c.423A>T	c.(421-423)ATA>ATT	p.I141I	VAPB_uc002xzb.2_RNA|VAPB_uc010zzo.1_Silent_p.I18I|VAPB_uc002xzc.2_Intron	NM_004738	NP_004729	O95292	VAPB_HUMAN	VAMP-associated protein B/C	141	Cytoplasmic (Potential).				cell death|endoplasmic reticulum unfolded protein response|positive regulation of viral genome replication|sphingolipid metabolic process|virus-host interaction	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane	beta-tubulin binding|enzyme binding|protein heterodimerization activity|protein homodimerization activity|structural molecule activity			kidney(1)	1	Lung NSC(12;0.000615)|all_lung(29;0.00186)		BRCA - Breast invasive adenocarcinoma(13;6.2e-12)|Epithelial(14;3.7e-08)|all cancers(14;3.88e-07)															---	---	---	---
SYCP2	10388	broad.mit.edu	37	20	58450394	58450394	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58450394C>T	uc002yaz.2	-	33	3420	c.3281G>A	c.(3280-3282)CGA>CAA	p.R1094Q		NM_014258	NP_055073	Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1094					cell division|meiotic prophase I|synaptonemal complex assembly		DNA binding			ovary(3)|lung(2)	5	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)															---	---	---	---
DIDO1	11083	broad.mit.edu	37	20	61538606	61538606	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61538606C>T	uc002ydr.1	-	5	1531	c.1267G>A	c.(1267-1269)GCA>ACA	p.A423T	DIDO1_uc002yds.1_Missense_Mutation_p.A423T|DIDO1_uc002ydt.1_Missense_Mutation_p.A423T|DIDO1_uc002ydu.1_Missense_Mutation_p.A423T|DIDO1_uc002ydv.1_Missense_Mutation_p.A423T|DIDO1_uc002ydw.1_Missense_Mutation_p.A423T|DIDO1_uc002ydx.1_Missense_Mutation_p.A423T|DIDO1_uc011aao.1_Missense_Mutation_p.A423T	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	423					apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)																	---	---	---	---
PCMTD2	55251	broad.mit.edu	37	20	62904820	62904820	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62904820G>T	uc002yil.3	+	6	1153	c.953G>T	c.(952-954)CGG>CTG	p.R318L	PCMTD2_uc002yim.3_Missense_Mutation_p.R291L	NM_018257	NP_060727	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate)	318						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)																	---	---	---	---
NCAM2	4685	broad.mit.edu	37	21	22790834	22790834	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22790834C>G	uc002yld.1	+	11	1674	c.1425C>G	c.(1423-1425)TGC>TGG	p.C475W	NCAM2_uc011acb.1_Missense_Mutation_p.C333W	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	475	Ig-like C2-type 5.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)														---	---	---	---
RRP1B	23076	broad.mit.edu	37	21	45096775	45096775	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45096775C>T	uc002zdk.2	+	8	890	c.776C>T	c.(775-777)GCT>GTT	p.A259V		NM_015056	NP_055871	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1 homolog B	259					rRNA processing	cytosol|nucleolus|preribosome, small subunit precursor	protein binding			skin(1)	1				STAD - Stomach adenocarcinoma(101;0.178)														---	---	---	---
DGCR2	9993	broad.mit.edu	37	22	19055718	19055718	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19055718G>A	uc002zoq.1	-	3	471	c.223C>T	c.(223-225)CCT>TCT	p.P75S	DGCR2_uc002zor.1_5'UTR|DGCR2_uc011agr.1_Missense_Mutation_p.P34S	NM_005137	NP_005128	P98153	IDD_HUMAN	integral membrane protein DGCR2 precursor	75	Extracellular (Potential).				cell adhesion|organ morphogenesis	integral to membrane	receptor activity|sugar binding			large_intestine(1)	1	Colorectal(54;0.0993)																	---	---	---	---
CLTCL1	8218	broad.mit.edu	37	22	19197987	19197987	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19197987A>C	uc002zpb.2	-	20	3173	c.3098T>G	c.(3097-3099)ATC>AGC	p.I1033S	CLTCL1_uc011agv.1_Missense_Mutation_p.I1033S|CLTCL1_uc011agw.1_Missense_Mutation_p.I1033S|CLTCL1_uc011agt.1_5'Flank|CLTCL1_uc011agu.1_5'Flank|CLTCL1_uc010grm.1_5'Flank|CLTCL1_uc002zpe.2_5'UTR|CLTCL1_uc002zpd.1_5'UTR	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1	1033	Proximal segment.|Heavy chain arm.				anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)							T	?	ALCL								---	---	---	---
MTMR3	8897	broad.mit.edu	37	22	30415828	30415828	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30415828G>C	uc003agv.3	+	17	2508	c.2180G>C	c.(2179-2181)AGC>ACC	p.S727T	MTMR3_uc003agu.3_Missense_Mutation_p.S727T|MTMR3_uc003agw.3_Missense_Mutation_p.S727T	NM_021090	NP_066576	Q13615	MTMR3_HUMAN	myotubularin-related protein 3 isoform c	727					phosphatidylinositol dephosphorylation	cytoplasm|membrane|membrane fraction|nucleus	metal ion binding|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity			breast(3)|ovary(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)															---	---	---	---
NHS	4810	broad.mit.edu	37	X	17742545	17742545	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17742545A>C	uc004cxx.2	+	5	1510	c.1172A>C	c.(1171-1173)GAA>GCA	p.E391A	NHS_uc011mix.1_Missense_Mutation_p.E412A|NHS_uc004cxy.2_Missense_Mutation_p.E235A|NHS_uc004cxz.2_Missense_Mutation_p.E214A|NHS_uc004cya.2_Missense_Mutation_p.E114A	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	391						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)																	---	---	---	---
MAGEE1	57692	broad.mit.edu	37	X	75650737	75650737	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75650737T>C	uc004ecm.1	+	1	2621	c.2414T>C	c.(2413-2415)CTT>CCT	p.L805P		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	805	Interaction with DTNA (By similarity).|MAGE 2.					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6																		---	---	---	---
PABPC5	140886	broad.mit.edu	37	X	90690686	90690686	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90690686A>C	uc004efg.2	+	2	550	c.110A>C	c.(109-111)AAG>ACG	p.K37T	PABPC5_uc004eff.1_Intron	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	37	RRM 1.					cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3																		---	---	---	---
PCDH19	57526	broad.mit.edu	37	X	99662857	99662857	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99662857C>T	uc010nmz.2	-	1	2415	c.739G>A	c.(739-741)GTG>ATG	p.V247M	PCDH19_uc004efw.3_Missense_Mutation_p.V247M|PCDH19_uc004efx.3_Missense_Mutation_p.V247M	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	247	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7																		---	---	---	---
TCEAL6	158931	broad.mit.edu	37	X	101395898	101395898	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101395898T>A	uc004eiq.2	-	3	567	c.406A>T	c.(406-408)AGT>TGT	p.S136C		NM_001006938	NP_001006939	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	136					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1																		---	---	---	---
NRK	203447	broad.mit.edu	37	X	105137923	105137923	+	Silent	SNP	A	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105137923A>C	uc004emd.2	+	6	780	c.477A>C	c.(475-477)CGA>CGC	p.R159R	NRK_uc010npc.1_5'UTR	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	159	Protein kinase.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14															HNSCC(51;0.14)			---	---	---	---
CXorf57	55086	broad.mit.edu	37	X	105879863	105879863	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105879863G>C	uc004emi.3	+	7	1545	c.1394G>C	c.(1393-1395)GGA>GCA	p.G465A	CXorf57_uc004emj.3_Missense_Mutation_p.G465A|CXorf57_uc004emh.2_Missense_Mutation_p.G465A	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN	hypothetical protein LOC55086	465										ovary(1)|lung(1)|breast(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	106803596	106803596	+	IGR	SNP	G	A	A			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106803596G>A								CXorf41 (316124 upstream) : PRPS1 (68058 downstream)																																			---	---	---	---
MAGEC1	9947	broad.mit.edu	37	X	140994991	140994991	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140994991C>T	uc004fbt.2	+	4	2087	c.1801C>T	c.(1801-1803)CAG>TAG	p.Q601*	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	601							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)														HNSCC(15;0.026)			---	---	---	---
MAGEC2	51438	broad.mit.edu	37	X	141291612	141291612	+	Silent	SNP	A	C	C			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:141291612A>C	uc004fbu.1	-	3	510	c.162T>G	c.(160-162)TCT>TCG	p.S54S		NM_016249	NP_057333	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	54	Ser-rich.					cytoplasm|nucleus				breast(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)														HNSCC(46;0.14)			---	---	---	---
CD99L2	83692	broad.mit.edu	37	X	149944667	149944667	+	Missense_Mutation	SNP	T	G	G			TCGA-BR-4281-01A-02D-1126-08	TCGA-BR-4281-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149944667T>G	uc004fel.2	-	9	753	c.635A>C	c.(634-636)AAG>ACG	p.K212T	CD99L2_uc004fek.2_RNA|CD99L2_uc004fem.2_Missense_Mutation_p.K163T|CD99L2_uc004fen.2_Missense_Mutation_p.K140T|CD99L2_uc004feo.2_RNA|CD99L2_uc011myb.1_Missense_Mutation_p.K139T	NM_031462	NP_113650	Q8TCZ2	C99L2_HUMAN	CD99 antigen-like 2 isoform E3'-E4'-E3-E4	212	Cytoplasmic (Potential).				cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
