Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
PRDM16	63976	broad.mit.edu	37	1	3237952	3237953	+	Intron	INS	-	TA	TA	rs149896666		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3237952_3237953insTA	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397			PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)				T	EVI1	MDS|AML								---	---	---	---
Unknown	0	broad.mit.edu	37	1	3362352	3362353	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3362352_3362353insT								PRDM16 (7169 upstream) : ARHGEF16 (8794 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	4887689	4887690	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4887689_4887690delAC								AJAP1 (43839 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5079534	5079534	+	IGR	DEL	A	-	-	rs35447874		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5079534delA								AJAP1 (235684 upstream) : NPHP4 (843336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5146399	5146400	+	IGR	INS	-	AC	AC	rs144584415	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5146399_5146400insAC								AJAP1 (302549 upstream) : NPHP4 (776470 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5748446	5748447	+	IGR	INS	-	TG	TG	rs150820945	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5748446_5748447insTG								AJAP1 (904596 upstream) : NPHP4 (174423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5806720	5806728	+	IGR	DEL	GGCTTCCCA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5806720_5806728delGGCTTCCCA								AJAP1 (962870 upstream) : NPHP4 (116142 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	5877090	5877090	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5877090delG								None (None upstream) : NPHP4 (45780 downstream)																																			---	---	---	---
ACOT7	11332	broad.mit.edu	37	1	6369521	6369522	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6369521_6369522insT	uc001ams.2	-						ACOT7_uc010nzq.1_Intron|ACOT7_uc001amt.2_Intron|ACOT7_uc001amu.2_Intron|ACOT7_uc001amv.2_Intron|ACOT7_uc001amq.2_Intron|ACOT7_uc001amr.2_Intron	NM_181864	NP_863654			acyl-CoA thioesterase 7 isoform hBACHb							mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity				0	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	6811801	6811802	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6811801_6811802delTG								DNAJC11 (49835 upstream) : CAMTA1 (33582 downstream)																																			---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	6866127	6866127	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6866127delT	uc001aoi.2	+						CAMTA1_uc001aoh.2_Intron	NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7000984	7000984	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7000984delC	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7044690	7044691	+	Intron	INS	-	A	A	rs146603331	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7044690_7044691insA	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
CAMTA1	23261	broad.mit.edu	37	1	7520654	7520654	+	Intron	DEL	C	-	-	rs79831740		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7520654delC	uc001aoi.2	+							NM_015215	NP_056030			calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)														---	---	---	---
RERE	473	broad.mit.edu	37	1	8624890	8624891	+	Intron	DEL	TA	-	-	rs112828643		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8624890_8624891delTA	uc001ape.2	-						RERE_uc001apf.2_Intron|RERE_uc001aph.1_Intron	NM_012102	NP_036234			atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	9466037	9466038	+	IGR	INS	-	A	A	rs112244570		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9466037_9466038insA								SPSB1 (36449 upstream) : SLC25A33 (133490 downstream)																																			---	---	---	---
CASZ1	54897	broad.mit.edu	37	1	10751136	10751139	+	Intron	DEL	CCCT	-	-	rs3835307		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10751136_10751139delCCCT	uc001aro.2	-						CASZ1_uc001arp.1_Intron|CASZ1_uc009vmx.2_Intron	NM_001079843	NP_001073312			castor homolog 1, zinc finger isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	10932458	10932459	+	IGR	INS	-	A	A	rs145684421	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10932458_10932459insA								CASZ1 (75751 upstream) : C1orf127 (74074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	10977787	10977788	+	IGR	INS	-	GAAA	GAAA	rs146436388	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10977787_10977788insGAAA								CASZ1 (121080 upstream) : C1orf127 (28745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	11525560	11525560	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11525560delT								UBIAD1 (177070 upstream) : PTCHD2 (13735 downstream)																																			---	---	---	---
KIAA2013	90231	broad.mit.edu	37	1	11987126	11987127	+	5'Flank	INS	-	A	A	rs76564244		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11987126_11987127insA	uc001atk.2	-						KIAA2013_uc001atl.1_5'Flank	NM_138346	NP_612355			hypothetical protein LOC90231 precursor							integral to membrane				ovary(1)	1	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00149)|all_lung(284;0.00189)|Breast(348;0.00586)|Colorectal(325;0.0062)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0556)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
VPS13D	55187	broad.mit.edu	37	1	12464704	12464705	+	Intron	INS	-	T	T	rs74996715		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12464704_12464705insT	uc001atv.2	+						VPS13D_uc001atw.2_Intron|VPS13D_uc001atx.2_Intron|VPS13D_uc009vnl.2_Intron	NM_015378	NP_056193			vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)														---	---	---	---
C1orf158	93190	broad.mit.edu	37	1	12810792	12810793	+	Intron	INS	-	T	T	rs77782348		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12810792_12810793insT	uc001auh.2	+						C1orf158_uc010obe.1_Intron	NM_152290	NP_689503			hypothetical protein LOC93190											ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00575)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	14220897	14220897	+	IGR	DEL	A	-	-	rs79907219		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14220897delA								PRDM2 (69325 upstream) : KAZ (704316 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	14828635	14828636	+	IGR	INS	-	T	T	rs142479080	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14828635_14828636insT								PRDM2 (677063 upstream) : KAZ (96577 downstream)																																			---	---	---	---
KAZ	23254	broad.mit.edu	37	1	15037837	15037838	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15037837_15037838insA	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron	NM_201628	NP_963922			kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0																		---	---	---	---
DDI2	84301	broad.mit.edu	37	1	15962979	15962979	+	Intron	DEL	A	-	-	rs76447779		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15962979delA	uc001awx.1	+						DDI2_uc009voj.1_Intron	NM_032341	NP_115717			DNA-damage inducible protein 2						proteolysis		aspartic-type endopeptidase activity				0		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00327)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.03e-07)|COAD - Colon adenocarcinoma(227;4.48e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	16840176	16840177	+	IGR	INS	-	AG	AG	rs59871634		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16840176_16840177insAG								CROCCL2 (20980 upstream) : NBPF1 (50235 downstream)																																			---	---	---	---
NBPF1	55672	broad.mit.edu	37	1	16937750	16937750	+	Intron	DEL	G	-	-	rs60194348		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16937750delG	uc009vos.1	-						NBPF1_uc001aza.3_Intron|NBPF1_uc001azb.1_Intron|NBPF1_uc001azc.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)														---	---	---	---
CROCCL1	84809	broad.mit.edu	37	1	16965449	16965449	+	Intron	DEL	A	-	-	rs141730973		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16965449delA	uc001azg.1	-						CROCCL1_uc001azi.1_Intron|uc001azj.1_Intron					Homo sapiens mRNA for FLJ00313 protein.												0																		---	---	---	---
CROCC	9696	broad.mit.edu	37	1	17290814	17290818	+	Intron	DEL	TCTTT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17290814_17290818delTCTTT	uc001azt.2	+						CROCC_uc001azu.2_Intron	NM_014675	NP_055490			ciliary rootlet coiled-coil						cell cycle|cell projection organization|centrosome organization|protein localization	actin cytoskeleton|centriole|ciliary rootlet|plasma membrane	kinesin binding|structural molecule activity			ovary(2)|breast(2)|central_nervous_system(1)	5		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	17520394	17520395	+	IGR	INS	-	AGTTTCTAG	AGTTTCTAG	rs144699959	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17520394_17520395insAGTTTCTAG								PADI2 (74446 upstream) : PADI1 (11226 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	18158595	18158595	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18158595delG								ACTL8 (5039 upstream) : IGSF21 (275645 downstream)																																			---	---	---	---
IGSF21	84966	broad.mit.edu	37	1	18581353	18581356	+	Intron	DEL	CATC	-	-	rs72010934		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18581353_18581356delCATC	uc001bau.1	+							NM_032880	NP_116269			immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	22557631	22557632	+	IGR	INS	-	CATC	CATC	rs145437311	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22557631_22557632insCATC								WNT4 (87246 upstream) : ZBTB40 (220712 downstream)																																			---	---	---	---
EPHA8	2046	broad.mit.edu	37	1	22904736	22904739	+	Intron	DEL	TGTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22904736_22904739delTGTG	uc001bfx.1	+						EPHA8_uc001bfw.2_Intron	NM_020526	NP_065387			ephrin receptor EphA8 isoform 1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)														---	---	---	---
CNR2	1269	broad.mit.edu	37	1	24220613	24220614	+	Intron	INS	-	A	A	rs143682394		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24220613_24220614insA	uc001bif.2	-							NM_001841	NP_001832			cannabinoid receptor 2 (macrophage)						behavior|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	dendrite|integral to plasma membrane|perikaryon	cannabinoid receptor activity			skin(2)|central_nervous_system(1)	3		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.32e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;2.9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.146)	Nabilone(DB00486)													---	---	---	---
RHCE	6006	broad.mit.edu	37	1	25710884	25710884	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25710884delT	uc001bkf.2	-						RHCE_uc001bkg.2_Intron|RHCE_uc001bkh.2_Intron|RHCE_uc001bki.2_Intron|RHCE_uc001bkj.2_Intron	NM_020485	NP_065231			Rhesus blood group, CcEe antigens isoform 1							integral to plasma membrane					0		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
C1orf135	79000	broad.mit.edu	37	1	26168021	26168021	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26168021delT	uc001bkw.1	-							NM_024037	NP_076942			aurora A-binding protein												0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00521)|all_lung(284;0.00764)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.117)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.28e-25)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000787)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	26945287	26945288	+	IGR	INS	-	TGAA	TGAA	rs146613184	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26945287_26945288insTGAA								RPS6KA1 (43767 upstream) : ARID1A (77234 downstream)																																			---	---	---	---
SLC9A1	6548	broad.mit.edu	37	1	27451728	27451729	+	Intron	INS	-	T	T	rs72092080		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27451728_27451729insT	uc001bnm.2	-						SLC9A1_uc010ofk.1_Intron|SLC9A1_uc001bnn.2_Intron	NM_003047	NP_003038			solute carrier family 9, isoform A1						regulation of pH	integral to membrane	sodium:hydrogen antiporter activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)													---	---	---	---
STX12	23673	broad.mit.edu	37	1	28127000	28127003	+	Intron	DEL	GTGT	-	-	rs111335951		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28127000_28127003delGTGT	uc001bou.3	+							NM_177424	NP_803173			syntaxin 12						cholesterol efflux|intracellular protein transport|protein stabilization|vesicle-mediated transport	Golgi apparatus|integral to membrane|membrane raft|phagocytic vesicle	SNAP receptor activity			breast(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|all_lung(284;9.43e-05)|Lung NSC(340;0.000185)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;3.96e-24)|Colorectal(126;3.46e-08)|COAD - Colon adenocarcinoma(152;1.83e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00258)|KIRC - Kidney renal clear cell carcinoma(1967;0.00302)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
PTPRU	10076	broad.mit.edu	37	1	29577768	29577769	+	Intron	INS	-	A	A	rs78311123		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29577768_29577769insA	uc001bru.2	+						PTPRU_uc001brv.2_Intron|PTPRU_uc001brw.2_Intron|PTPRU_uc009vtq.2_Intron|PTPRU_uc009vtr.2_Intron	NM_005704	NP_005695			protein tyrosine phosphatase, receptor type, U						canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	29873754	29873754	+	IGR	DEL	T	-	-	rs66605834		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29873754delT								PTPRU (220439 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	31128790	31128791	+	IGR	INS	-	T	T	rs144223262	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31128790_31128791insT								None (None upstream) : MATN1 (55335 downstream)																																			---	---	---	---
SDC3	9672	broad.mit.edu	37	1	31361420	31361421	+	Intron	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31361420_31361421delCA	uc001bse.2	-							NM_014654	NP_055469			syndecan 3							integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(586;0.0393)|Colorectal(325;0.0466)|all_neural(195;0.0966)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		STAD - Stomach adenocarcinoma(196;0.0197)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
TINAGL1	64129	broad.mit.edu	37	1	32045665	32045666	+	Intron	DEL	TG	-	-	rs67110682		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32045665_32045666delTG	uc001bta.2	+						TINAGL1_uc001bsz.2_Intron|TINAGL1_uc010ogi.1_Intron|TINAGL1_uc010ogj.1_Intron|TINAGL1_uc010ogk.1_Intron	NM_022164	NP_071447			tubulointerstitial nephritis antigen-like 1						endosome transport|immune response|proteolysis	extracellular region	cysteine-type endopeptidase activity|extracellular matrix structural constituent|polysaccharide binding|scavenger receptor activity				0		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		STAD - Stomach adenocarcinoma(196;0.0526)|READ - Rectum adenocarcinoma(331;0.145)														---	---	---	---
TXLNA	200081	broad.mit.edu	37	1	32655143	32655144	+	Intron	DEL	TT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32655143_32655144delTT	uc001bui.2	+						TXLNA_uc001buj.2_Intron	NM_175852	NP_787048			taxilin						cell proliferation|exocytosis	cytoplasm|extracellular region	cytokine activity|high molecular weight B cell growth factor receptor binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)																---	---	---	---
TXLNA	200081	broad.mit.edu	37	1	32663415	32663415	+	3'UTR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32663415delT	uc001bui.2	+	11					TXLNA_uc001buj.2_3'UTR|CCDC28B_uc001buk.2_5'Flank|CCDC28B_uc001bul.1_5'Flank	NM_175852	NP_787048			taxilin						cell proliferation|exocytosis	cytoplasm|extracellular region	cytokine activity|high molecular weight B cell growth factor receptor binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)																---	---	---	---
BSDC1	55108	broad.mit.edu	37	1	32855130	32855130	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32855130delA	uc001bvh.3	-						BSDC1_uc010ohg.1_Intron|BSDC1_uc010ohh.1_Intron|BSDC1_uc010ohi.1_Intron|BSDC1_uc001bvg.3_Intron|BSDC1_uc001bvj.2_Intron|BSDC1_uc001bvi.2_Intron	NM_018045	NP_060515			BSD domain containing 1 isoform b								protein binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)																---	---	---	---
PHC2	1912	broad.mit.edu	37	1	33857768	33857769	+	Intron	INS	-	CA	CA	rs145325204	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33857768_33857769insCA	uc009vuh.1	-						PHC2_uc001bxi.1_Intron	NM_198040	NP_932157			polyhomeotic-like 2 isoform a						multicellular organismal development	PcG protein complex	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)																---	---	---	---
CSMD2	114784	broad.mit.edu	37	1	34029679	34029681	+	Intron	DEL	TCA	-	-	rs71891174		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34029679_34029681delTCA	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128			CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	35038987	35038988	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35038987_35038988insT								C1orf94 (354258 upstream) : MIR552 (96212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	35538852	35538852	+	IGR	DEL	A	-	-	rs112288247		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35538852delA								ZMYM6 (41283 upstream) : ZMYM1 (6120 downstream)																																			---	---	---	---
TRAPPC3	27095	broad.mit.edu	37	1	36606765	36606767	+	Intron	DEL	AAG	-	-	rs66870479		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36606765_36606767delAAG	uc001bzx.2	-						TRAPPC3_uc001bzy.2_Intron	NM_014408	NP_055223			trafficking protein particle complex 3							endoplasmic reticulum	guanylate cyclase activity|heme binding			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0393)																---	---	---	---
MAP7D1	55700	broad.mit.edu	37	1	36644432	36644433	+	Intron	INS	-	GGCG	GGCG	rs142470160	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36644432_36644433insGGCG	uc001bzz.2	+						MAP7D1_uc001caa.2_Intron|MAP7D1_uc001cab.2_Intron|MAP7D1_uc001cac.2_Intron|MAP7D1_uc001cad.2_Intron	NM_018067	NP_060537			MAP7 domain containing 1							cytoplasm|spindle				ovary(3)|breast(2)	5		Myeloproliferative disorder(586;0.0393)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	37012398	37012400	+	IGR	DEL	GAG	-	-	rs71573727		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37012398_37012400delGAG								CSF3R (63889 upstream) : GRIK3 (248728 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	38069548	38069551	+	IGR	DEL	ATTT	-	-	rs149325379		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38069548_38069551delATTT								GNL2 (7962 upstream) : RSPO1 (7400 downstream)																																			---	---	---	---
YRDC	79693	broad.mit.edu	37	1	38270944	38270944	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38270944delA	uc001cca.1	-						C1orf122_uc001ccb.1_5'Flank	NM_024640	NP_078916			ischemia/reperfusion inducible protein						negative regulation of transport	membrane|mitochondrion					0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
INPP5B	3633	broad.mit.edu	37	1	38386347	38386349	+	Intron	DEL	AAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38386347_38386349delAAG	uc001ccg.1	-						INPP5B_uc009vvk.1_Intron|INPP5B_uc001ccf.1_Intron	NM_005540	NP_005531			inositol polyphosphate-5-phosphatase, 75kDa						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
INPP5B	3633	broad.mit.edu	37	1	38395410	38395410	+	Intron	DEL	T	-	-	rs28442147	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38395410delT	uc001ccg.1	-						INPP5B_uc009vvk.1_Intron|INPP5B_uc001cch.2_3'UTR|INPP5B_uc001ccf.1_Intron	NM_005540	NP_005531			inositol polyphosphate-5-phosphatase, 75kDa						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	39116654	39116655	+	IGR	INS	-	TG	TG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39116654_39116655insTG								POU3F1 (604204 upstream) : RRAGC (188360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	40283559	40283559	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40283559delG								BMP8B (29026 upstream) : TRIT1 (23149 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	40400945	40400946	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40400945_40400946insA								MYCL1 (33258 upstream) : MFSD2A (19838 downstream)																																			---	---	---	---
GUCA2A	2980	broad.mit.edu	37	1	42633114	42633115	+	5'Flank	INS	-	TGAGG	TGAGG	rs150434346	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42633114_42633115insTGAGG	uc001chd.1	-							NM_033553	NP_291031			guanylate cyclase activator 2A precursor						signal transduction	extracellular region	guanylate cyclase activator activity|hormone activity			pancreas(1)	1	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
FOXJ3	22887	broad.mit.edu	37	1	42797501	42797501	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42797501delA	uc001che.2	-						FOXJ3_uc001chf.2_Intron|FOXJ3_uc001chg.2_Intron|FOXJ3_uc001chh.1_Intron	NM_014947	NP_055762			forkhead box J3						embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)	2	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---
EIF2B3	8891	broad.mit.edu	37	1	45392810	45392811	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45392810_45392811insA	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron|EIF2B3_uc001cmw.2_Intron	NM_020365	NP_065098			eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
EIF2B3	8891	broad.mit.edu	37	1	45427876	45427877	+	Intron	INS	-	CATCAT	CATCAT	rs138231502	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45427876_45427877insCATCAT	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron|EIF2B3_uc001cmw.2_Intron	NM_020365	NP_065098			eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	46996870	46996870	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46996870delG								DMBX1 (16986 upstream) : KNCN (14446 downstream)																																	OREG0013463	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	1	48170446	48170447	+	IGR	INS	-	TT	TT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48170446_48170447insTT								FOXD2 (264084 upstream) : SKINTL (396940 downstream)																																			---	---	---	---
AGBL4	84871	broad.mit.edu	37	1	49581262	49581263	+	Intron	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49581262_49581263delGA	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron	NM_032785	NP_116174			ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---
FAF1	11124	broad.mit.edu	37	1	51174194	51174194	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51174194delA	uc009vyx.1	-						FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Intron	NM_007051	NP_008982			FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity	p.0?(1)		ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)														---	---	---	---
SLC1A7	6512	broad.mit.edu	37	1	53565450	53565451	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53565450_53565451delAC	uc001cuy.2	-							NM_006671	NP_006662			solute carrier family 1 (glutamate transporter),							integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)													---	---	---	---
GLIS1	148979	broad.mit.edu	37	1	54100896	54100896	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54100896delA	uc001cvr.1	-							NM_147193	NP_671726			GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1																		---	---	---	---
SSBP3	23648	broad.mit.edu	37	1	54867051	54867052	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54867051_54867052delAC	uc001cxe.2	-						SSBP3_uc001cxf.2_Intron|SSBP3_uc001cxg.2_Intron	NM_145716	NP_663768			single stranded DNA binding protein 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	single-stranded DNA binding				0																		---	---	---	---
C1orf177	163747	broad.mit.edu	37	1	55285786	55285793	+	Intron	DEL	TCTTTCTT	-	-	rs56030373		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55285786_55285793delTCTTTCTT	uc001cyb.3	+						C1orf177_uc001cya.3_Intron	NM_001110533	NP_001104003			hypothetical protein LOC163747 isoform 2												0																		---	---	---	---
C1orf177	163747	broad.mit.edu	37	1	55302270	55302272	+	Intron	DEL	AGA	-	-	rs66539918		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55302270_55302272delAGA	uc001cyb.3	+						C1orf177_uc001cya.3_Intron	NM_001110533	NP_001104003			hypothetical protein LOC163747 isoform 2												0																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58511294	58511295	+	Intron	INS	-	T	T	rs139670738	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58511294_58511295insT	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58584898	58584899	+	Intron	DEL	GT	-	-	rs148261288		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58584898_58584899delGT	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
DAB1	1600	broad.mit.edu	37	1	58847622	58847648	+	Intron	DEL	AAAGAAGTGAGACTGAATGACACCATG	-	-	rs72138023	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:58847622_58847648delAAAGAAGTGAGACTGAATGACACCATG	uc001cyt.1	-							NM_021080	NP_066566			disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	59487650	59487650	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59487650delA								JUN (237865 upstream) : LOC729467 (109960 downstream)																																			---	---	---	---
NFIA	4774	broad.mit.edu	37	1	61903522	61903534	+	Intron	DEL	TCTGTTTGGTGTA	-	-	rs66839476		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61903522_61903534delTCTGTTTGGTGTA	uc001czw.2	+						NFIA_uc001czy.2_Intron|NFIA_uc010oos.1_Intron|NFIA_uc001czv.2_Intron|NFIA_uc001czx.2_Intron|NFIA_uc009wae.2_Intron	NM_001134673	NP_001128145			nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2																		---	---	---	---
TM2D1	83941	broad.mit.edu	37	1	62154414	62154415	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62154414_62154415insA	uc001czz.1	-							NM_032027	NP_114416			beta-amyloid binding protein precursor						apoptosis					ovary(1)	1																		---	---	---	---
INADL	10207	broad.mit.edu	37	1	62541589	62541590	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62541589_62541590insA	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron|hsa-mir-3116-1|MI0014128_5'Flank	NM_176877	NP_795352			InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4																		---	---	---	---
INADL	10207	broad.mit.edu	37	1	62555344	62555344	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62555344delT	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352			InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4																		---	---	---	---
KANK4	163782	broad.mit.edu	37	1	62744869	62744872	+	Intron	DEL	CGCA	-	-	rs71783988	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62744869_62744872delCGCA	uc001dah.3	-						KANK4_uc001dai.3_Intron	NM_181712	NP_859063			ankyrin repeat domain 38											ovary(3)|skin(2)|lung(1)	6																		---	---	---	---
WDR78	79819	broad.mit.edu	37	1	67291990	67291990	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67291990delT	uc001dcx.2	-						WDR78_uc009waw.2_Intron|WDR78_uc009wax.2_Intron	NM_024763	NP_079039			WD repeat domain 78 isoform 1											ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	68073049	68073049	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68073049delA								SERBP1 (176926 upstream) : GADD45A (77834 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	69576545	69576545	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69576545delA								DEPDC1 (613746 upstream) : LRRC7 (456323 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	69954440	69954441	+	IGR	DEL	AA	-	-	rs147693671		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:69954440_69954441delAA								DEPDC1 (991641 upstream) : LRRC7 (78427 downstream)																																			---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70354404	70354404	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70354404delA	uc001dep.2	+						LRRC7_uc009wbg.2_Intron	NM_020794	NP_065845			leucine rich repeat containing 7							centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
NEGR1	257194	broad.mit.edu	37	1	71939964	71939965	+	Intron	INS	-	TG	TG	rs143101746	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:71939964_71939965insTG	uc001dfw.2	-						NEGR1_uc001dfv.2_Intron|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169			neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)														---	---	---	---
NEGR1	257194	broad.mit.edu	37	1	72311400	72311403	+	Intron	DEL	ATCT	-	-	rs67647009		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72311400_72311403delATCT	uc001dfw.2	-						NEGR1_uc001dfv.2_Intron|NEGR1_uc010oqs.1_Intron	NM_173808	NP_776169			neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	72859699	72859700	+	IGR	INS	-	CA	CA	rs145726231	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72859699_72859700insCA								NEGR1 (111294 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	73104944	73104944	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73104944delA								NEGR1 (356539 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	73204882	73204883	+	IGR	INS	-	GT	GT	rs146663108	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:73204882_73204883insGT								NEGR1 (456477 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	74185633	74185634	+	IGR	INS	-	A	A	rs138771062		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74185633_74185634insA								None (None upstream) : LRRIQ3 (306070 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	77224975	77224976	+	IGR	INS	-	T	T	rs149606518	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77224975_77224976insT								ST6GALNAC3 (128306 upstream) : ST6GALNAC5 (108210 downstream)																																			---	---	---	---
AK5	26289	broad.mit.edu	37	1	77867213	77867214	+	Intron	INS	-	A	A	rs141488317	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77867213_77867214insA	uc001dhn.2	+						AK5_uc001dho.2_Intron	NM_174858	NP_777283			adenylate kinase 5 isoform 1						ADP biosynthetic process|ATP metabolic process|dADP biosynthetic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine ribonucleotide biosynthetic process|signal transduction	centrosome|cytosol	adenylate kinase activity|ATP binding|cAMP-dependent protein kinase regulator activity|nucleoside kinase activity			skin(1)	1																		---	---	---	---
IFI44L	10964	broad.mit.edu	37	1	79086632	79086632	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79086632delC	uc010oro.1	+						IFI44L_uc010orp.1_Intron|IFI44L_uc010orq.1_Intron	NM_006820	NP_006811			interferon-induced protein 44-like							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	80816464	80816464	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80816464delA								None (None upstream) : LPHN2 (955381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	84707354	84707354	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84707354delT								PRKACB (3175 upstream) : SAMD13 (56695 downstream)																																			---	---	---	---
DDAH1	23576	broad.mit.edu	37	1	85989795	85989796	+	Intron	INS	-	AAAAAC	AAAAAC	rs77446953		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85989795_85989796insAAAAAC	uc001dlc.2	-							NM_001134445	NP_001127917			dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	87135712	87135712	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87135712delA								CLCA3P (14654 upstream) : SH3GLB1 (34545 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	87157952	87157953	+	IGR	INS	-	TCTC	TCTC	rs72722211		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87157952_87157953insTCTC								CLCA3P (36894 upstream) : SH3GLB1 (12304 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	87254226	87254226	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87254226delC								SH3GLB1 (40360 upstream) : SEP15 (73904 downstream)																																			---	---	---	---
LOC339524	339524	broad.mit.edu	37	1	87609806	87609809	+	Intron	DEL	TTAC	-	-	rs10555931		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87609806_87609809delTTAC	uc001dme.1	+						LOC339524_uc001dmf.2_Intron	NM_001134492	NP_001127964			heparan sulfate 2-O-sulfotransferase 1 isoform												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	88243111	88243114	+	IGR	DEL	TCTG	-	-	rs2503265		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88243111_88243114delTCTG								LMO4 (428508 upstream) : PKN2 (906808 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	88391296	88391296	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88391296delT								LMO4 (576693 upstream) : PKN2 (758626 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	94865961	94865961	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94865961delA								ARHGAP29 (125337 upstream) : ABCD3 (17972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	95176637	95176637	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95176637delT	uc001dqu.2	-											Homo sapiens cDNA clone IMAGE:4795773.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	95271944	95271945	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95271944_95271945insT	uc001dqu.2	-											Homo sapiens cDNA clone IMAGE:4795773.																														---	---	---	---
SLC44A3	126969	broad.mit.edu	37	1	95353176	95353176	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95353176delG	uc001dqv.3	+						SLC44A3_uc001dqx.3_Intron|SLC44A3_uc010otq.1_Intron|SLC44A3_uc010otr.1_Intron|SLC44A3_uc001dqw.3_Intron|SLC44A3_uc010ots.1_Intron|SLC44A3_uc009wds.2_Intron|SLC44A3_uc010ott.1_Intron|SLC44A3_uc010otu.1_Intron	NM_001114106	NP_001107578			solute carrier family 44, member 3 isoform 1							integral to membrane|plasma membrane	choline transmembrane transporter activity			kidney(1)	1		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)													---	---	---	---
DPYD	1806	broad.mit.edu	37	1	97769966	97769966	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97769966delT	uc001drv.2	-							NM_000110	NP_000101			dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	99249151	99249151	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99249151delA								SNX7 (23097 upstream) : LPPR5 (106652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	101777759	101777760	+	IGR	INS	-	C	C	rs144762040	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101777759_101777760insC								S1PR1 (70683 upstream) : OLFM3 (490367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	102810377	102810378	+	IGR	INS	-	A	A	rs142255863	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102810377_102810378insA								OLFM3 (347587 upstream) : COL11A1 (531646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	105034864	105034865	+	IGR	INS	-	A	A	rs57301801		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:105034864_105034865insA								AMY1A (827692 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	107592153	107592166	+	IGR	DEL	TTTTTTTTTTTTTT	-	-	rs34300147		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:107592153_107592166delTTTTTTTTTTTTTT								None (None upstream) : PRMT6 (7101 downstream)																																			---	---	---	---
VAV3	10451	broad.mit.edu	37	1	108379725	108379725	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108379725delA	uc001dvk.1	-						VAV3_uc010ouw.1_Intron|VAV3_uc001dvl.1_Intron|VAV3_uc010oux.1_Intron	NM_006113	NP_006104			vav 3 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)														---	---	---	---
C1orf183	55924	broad.mit.edu	37	1	112277019	112277020	+	Intron	INS	-	T	T	rs150589873	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112277019_112277020insT	uc001ebo.1	-						C1orf183_uc001ebp.1_Intron	NM_019099	NP_061972			hypothetical protein LOC55924 isoform 1											ovary(2)	2		all_cancers(81;7.29e-06)|all_epithelial(167;4.98e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.16e-05)		Lung(183;0.0155)|Colorectal(144;0.0289)|all cancers(265;0.0592)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0852)|COAD - Colon adenocarcinoma(174;0.113)														---	---	---	---
ST7L	54879	broad.mit.edu	37	1	113148312	113148312	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113148312delA	uc001ecd.2	-						ST7L_uc009wgh.2_Intron|ST7L_uc001ecc.2_Intron|ST7L_uc010owg.1_Intron|ST7L_uc010owh.1_Intron|ST7L_uc001ece.2_Intron|ST7L_uc001ecf.2_Intron|ST7L_uc001ecg.2_Intron|ST7L_uc010owi.1_Intron|ST7L_uc001ech.2_Intron|ST7L_uc001eci.2_Intron|ST7L_uc009wgi.1_Intron|ST7L_uc010owj.1_Intron	NM_017744	NP_060214			suppression of tumorigenicity 7-like isoform 1						negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
PTPN22	26191	broad.mit.edu	37	1	114390409	114390410	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114390409_114390410insA	uc001eds.2	-						PTPN22_uc009wgq.2_Intron|PTPN22_uc010owo.1_Intron|PTPN22_uc001edt.2_Intron|PTPN22_uc009wgr.2_Intron|PTPN22_uc009wgs.2_Intron|PTPN22_uc001edu.2_Intron	NM_015967	NP_057051			protein tyrosine phosphatase, non-receptor type						negative regulation of T cell activation|negative regulation of T cell receptor signaling pathway|phosphoanandamide dephosphorylation|regulation of B cell receptor signaling pathway|regulation of natural killer cell proliferation|T cell differentiation	internal side of plasma membrane|nucleus|perinuclear region of cytoplasm	kinase binding|protein tyrosine phosphatase activity|SH3 domain binding			kidney(2)|lung(1)|skin(1)	4	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
SYCP1	6847	broad.mit.edu	37	1	115519122	115519122	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115519122delC	uc001efr.2	+						SYCP1_uc010owt.1_Intron|SYCP1_uc001efq.2_Intron|SYCP1_uc009wgw.2_Intron	NM_003176	NP_003167			synaptonemal complex protein 1						cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	116739961	116739961	+	IGR	DEL	A	-	-	rs71582566		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116739961delA								C1orf161 (62100 upstream) : ATP1A1 (175043 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	118078584	118078584	+	IGR	DEL	T	-	-	rs67865395		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118078584delT								MAN1A2 (10264 upstream) : FAM46C (70020 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	118138461	118138462	+	IGR	INS	-	A	A	rs10693460		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118138461_118138462insA								MAN1A2 (70141 upstream) : FAM46C (10142 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	119710076	119710076	+	Intron	DEL	A	-	-	rs34206694		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119710076delA	uc001ehp.1	+						uc009whk.1_Intron					Homo sapiens cDNA FLJ43771 fis, clone TESTI2049553.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	119895546	119895547	+	IGR	DEL	AT	-	-	rs35848055		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119895546_119895547delAT								WARS2 (212251 upstream) : HAO2 (15855 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142544716	142544717	+	IGR	INS	-	TAAG	TAAG	rs9629108	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142544716_142544717insTAAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142545532	142545533	+	IGR	INS	-	A	A	rs141772623	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142545532_142545533insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142547915	142547916	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142547915_142547916delTC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	142622448	142622449	+	Intron	INS	-	A	A	rs145372515	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142622448_142622449insA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142623788	142623788	+	Intron	DEL	T	-	-	rs149122083		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142623788delT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142632962	142632963	+	Intron	INS	-	T	T	rs143018251		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142632962_142632963insT	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142686744	142686744	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142686744delA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	142905285	142905286	+	Intron	INS	-	T	T	rs151023691		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142905285_142905286insT	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	143516178	143516178	+	IGR	DEL	G	-	-	rs61824581		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143516178delG								None (None upstream) : LOC100286793 (131461 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	143532978	143532979	+	IGR	INS	-	G	G	rs138972237		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143532978_143532979insG								None (None upstream) : LOC100286793 (114660 downstream)																																			---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	144529132	144529133	+	Intron	INS	-	G	G	rs75901853		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144529132_144529133insG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764			hypothetical protein LOC400818							cytoplasm					0																		---	---	---	---
NBPF9	400818	broad.mit.edu	37	1	145107317	145107318	+	Intron	DEL	AA	-	-	rs150668102		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145107317_145107318delAA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|SEC22B_uc001eml.1_Intron					RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0																		---	---	---	---
NBPF10	100132406	broad.mit.edu	37	1	145213726	145213727	+	Intron	DEL	GG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145213726_145213727delGG	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)														---	---	---	---
LOC200030	200030	broad.mit.edu	37	1	148019228	148019229	+	Intron	INS	-	T	T	rs111827203		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148019228_148019229insT	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_Intron|NBPF14_uc001eqq.2_Intron|NBPF14_uc001eqs.1_Intron	NM_017940	NP_060410			hypothetical protein LOC55672							cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	148848809	148848809	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148848809delT								NBPF16 (90498 upstream) : LOC645166 (79477 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	148849360	148849361	+	IGR	INS	-	TC	TC			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148849360_148849361insTC								NBPF16 (91049 upstream) : LOC645166 (78925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	148852384	148852384	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148852384delT								NBPF16 (94073 upstream) : LOC645166 (75902 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	148898510	148898510	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148898510delG	uc009wkv.1	+											Homo sapiens cDNA, FLJ17483.																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	149272572	149272576	+	IGR	DEL	CTGTC	-	-	rs148759702		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149272572_149272576delCTGTC								LOC645166 (319518 upstream) : LOC388692 (6900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	149353070	149353070	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149353070delT								LOC388692 (61328 upstream) : FCGR1C (16224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	150178238	150178239	+	IGR	INS	-	A	A	rs76576967		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150178238_150178239insA								PLEKHO1 (46422 upstream) : ANP32E (12479 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	150696793	150696801	+	IGR	DEL	CTTCTGCAG	-	-	rs112158604		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150696793_150696801delCTTCTGCAG								HORMAD1 (3441 upstream) : CTSS (5753 downstream)																																			---	---	---	---
LYSMD1	388695	broad.mit.edu	37	1	151136355	151136356	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151136355_151136356delTG	uc001ewy.2	-						LYSMD1_uc010pcr.1_Intron|SCNM1_uc010pcs.1_5'Flank|SCNM1_uc001ewz.2_5'Flank|SCNM1_uc009wmn.2_5'Flank	NM_212551	NP_997716			LysM, putative peptidoglycan-binding, domain						cell wall macromolecule catabolic process						0	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
HRNR	388697	broad.mit.edu	37	1	152185323	152185323	+	3'UTR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152185323delC	uc001ezt.1	-	3						NM_001009931	NP_001009931			hornerin						keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	152468899	152468899	+	IGR	DEL	A	-	-	rs79192333		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152468899delA								CRNN (82149 upstream) : LCE5A (14421 downstream)																																			---	---	---	---
IL6R	3570	broad.mit.edu	37	1	154427786	154427786	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154427786delG	uc001fez.1	+						IL6R_uc001ffa.1_Intron	NM_000565	NP_000556			interleukin 6 receptor isoform 1 precursor						acute-phase response|ciliary neurotrophic factor-mediated signaling pathway|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|endocrine pancreas development|hepatic immune response|negative regulation of collagen biosynthetic process|negative regulation of interleukin-8 production|positive regulation of activation of Janus kinase activity|positive regulation of anti-apoptosis|positive regulation of chemokine production|positive regulation of chemokine production|positive regulation of interleukin-6 production|positive regulation of leukocyte chemotaxis|positive regulation of MAPKKK cascade|positive regulation of osteoblast differentiation|positive regulation of smooth muscle cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of apoptosis	apical plasma membrane|basolateral plasma membrane|extracellular space|interleukin-6 receptor complex	ciliary neurotrophic factor binding|enzyme binding|protein homodimerization activity			ovary(3)|breast(1)	4	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)															---	---	---	---
PYGO2	90780	broad.mit.edu	37	1	154932096	154932097	+	Frame_Shift_Ins	INS	-	G	G	rs141564510	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154932096_154932097insG	uc001fft.2	-	3	585_586	c.379_380insC	c.(379-381)CAGfs	p.Q127fs		NM_138300	NP_612157	Q9BRQ0	PYGO2_HUMAN	pygopus homolog 2	127	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding|zinc ion binding			skin(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)															---	---	---	---
THBS3	7059	broad.mit.edu	37	1	155173633	155173633	+	Intron	DEL	T	-	-	rs72426166		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155173633delT	uc001fix.2	-						RAG1AP1_uc010pey.1_Intron|THBS3_uc009wqi.2_Intron|THBS3_uc001fiz.2_Intron|THBS3_uc001fiy.2_Intron|THBS3_uc010pfu.1_Intron|THBS3_uc010pfv.1_Intron|THBS3_uc001fja.2_Intron	NM_007112	NP_009043			thrombospondin 3 precursor						cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity			breast(3)|ovary(2)	5	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)															---	---	---	---
DAP3	7818	broad.mit.edu	37	1	155706209	155706210	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155706209_155706210insT	uc001flq.2	+						DAP3_uc001flr.2_Intron|DAP3_uc001fls.2_Intron|DAP3_uc010pgl.1_Intron|DAP3_uc001flt.2_Intron|DAP3_uc001flu.2_Intron|DAP3_uc010pgm.1_Intron	NM_033657	NP_387506			death-associated protein 3						induction of apoptosis by extracellular signals	mitochondrial ribosome|nucleolus|small ribosomal subunit	protein binding			ovary(1)	1	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)																	---	---	---	---
SEMA4A	64218	broad.mit.edu	37	1	156138018	156138018	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156138018delT	uc001fnl.2	+						SEMA4A_uc009wrq.2_Intron|SEMA4A_uc001fnm.2_Intron|SEMA4A_uc001fnn.2_Intron|SEMA4A_uc001fno.2_Intron	NM_022367	NP_071762			semaphorin B precursor						axon guidance	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.158)																	---	---	---	---
SLC25A44	9673	broad.mit.edu	37	1	156176030	156176030	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156176030delT	uc001fnp.2	+						SLC25A44_uc010phc.1_Intron|SLC25A44_uc009wrr.2_Intron|SLC25A44_uc010phd.1_Intron|SLC25A44_uc010phe.1_Intron	NM_014655	NP_055470			solute carrier family 25, member 44						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding			ovary(1)	1	Hepatocellular(266;0.158)																	---	---	---	---
PMF1	11243	broad.mit.edu	37	1	156200354	156200355	+	Intron	INS	-	GA	GA	rs143621173	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156200354_156200355insGA	uc001fnq.2	+						PMF1_uc009wru.1_Intron|PMF1_uc001fnr.2_Intron|BGLAP_uc001fns.1_Intron	NM_007221	NP_009152			polyamine-modulated factor 1						cell division|chromosome segregation|mitotic prometaphase|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytosol|MIS12/MIND type complex|transcription factor complex	leucine zipper domain binding|transcription coactivator activity				0	Hepatocellular(266;0.158)																	---	---	---	---
TMEM79	84283	broad.mit.edu	37	1	156253436	156253438	+	Intron	DEL	TTT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156253436_156253438delTTT	uc010phi.1	+						SMG5_uc001foc.3_5'Flank|TMEM79_uc001fod.2_Intron|TMEM79_uc009wrw.2_5'Flank	NM_032323	NP_115699			transmembrane protein 79							integral to membrane				central_nervous_system(1)	1	Hepatocellular(266;0.158)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	156418967	156418967	+	IGR	DEL	A	-	-	rs71591940		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156418967delA								C1orf61 (18474 upstream) : MEF2D (14553 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	157356628	157356629	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157356628_157356629insT								ETV3 (248245 upstream) : FCRL5 (126539 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	157543241	157543241	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157543241delA								FCRL5 (20931 upstream) : FCRL4 (299 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	157621636	157621636	+	IGR	DEL	T	-	-	rs80299575		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157621636delT								FCRL4 (53766 upstream) : FCRL3 (24642 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	158111041	158111042	+	5'Flank	INS	-	GTTT	GTTT	rs139103433	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158111041_158111042insGTTT	uc001frq.2	-											Homo sapiens cDNA clone IMAGE:5295410.																														---	---	---	---
ATP1A2	477	broad.mit.edu	37	1	160082734	160082735	+	5'Flank	DEL	TC	-	-	rs113822588		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160082734_160082735delTC	uc001fvc.2	+						ATP1A2_uc001fvb.2_5'Flank	NM_000702	NP_000693			Na+/K+ -ATPase alpha 2 subunit proprotein						ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	160741626	160741627	+	IGR	INS	-	AC	AC	rs141520069	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160741626_160741627insAC								SLAMF7 (17026 upstream) : LY9 (24301 downstream)																																			---	---	---	---
PCP4L1	654790	broad.mit.edu	37	1	161252012	161252013	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161252012_161252013insA	uc001gad.2	+							NM_001102566	NP_001096036			Purkinje cell protein 4 like 1												0	all_cancers(52;4.16e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)															---	---	---	---
NOS1AP	9722	broad.mit.edu	37	1	162070799	162070799	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162070799delC	uc001gbv.2	+						NOS1AP_uc010pkr.1_Intron|NOS1AP_uc010pks.1_Intron|NOS1AP_uc001gbw.2_Intron	NM_014697	NP_055512			nitric oxide synthase 1 (neuronal) adaptor						regulation of apoptosis|regulation of nitric oxide biosynthetic process|regulation of nitric-oxide synthase activity		nitric-oxide synthase binding|PDZ domain binding			lung(2)|upper_aerodigestive_tract(1)	3	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)															---	---	---	---
TMCO1	54499	broad.mit.edu	37	1	165727275	165727277	+	Intron	DEL	TCT	-	-	rs71678704		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165727275_165727277delTCT	uc001gdj.3	-						TMCO1_uc001gdl.3_Intron|TMCO1_uc001gdm.3_Intron|TMCO1_uc001gdk.3_Intron|TMCO1_uc001gdn.3_Intron	NM_019026	NP_061899			transmembrane and coiled-coil domains 1							endoplasmic reticulum membrane|Golgi membrane|integral to membrane				central_nervous_system(1)	1	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)																	---	---	---	---
UCK2	7371	broad.mit.edu	37	1	165817898	165817899	+	Intron	DEL	CA	-	-	rs77004702		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165817898_165817899delCA	uc001gdp.2	+						UCK2_uc010plb.1_Intron	NM_012474	NP_036606			uridine-cytidine kinase 2						pyrimidine base metabolic process|pyrimidine nucleoside salvage	cytosol	ATP binding|phosphotransferase activity, alcohol group as acceptor|uridine kinase activity			ovary(1)	1	all_hematologic(923;0.048)|Acute lymphoblastic leukemia(8;0.155)																	---	---	---	---
FAM78B	149297	broad.mit.edu	37	1	166050370	166050370	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166050370delT	uc001gdr.2	-						FAM78B_uc010plc.1_Intron	NM_001017961	NP_001017961			hypothetical protein LOC149297											central_nervous_system(1)|skin(1)	2	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	168183894	168183895	+	IGR	INS	-	G	G	rs144521509	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168183894_168183895insG								TIPRL (12545 upstream) : SFT2D2 (11360 downstream)																																			---	---	---	---
TBX19	9095	broad.mit.edu	37	1	168230332	168230352	+	Intron	DEL	CTGGATAGCTGAACCATCATC	-	-	rs71974117		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168230332_168230352delCTGGATAGCTGAACCATCATC	uc001gfj.3	+							NM_005149	NP_005140			T-box 19						anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	170203596	170203596	+	IGR	DEL	T	-	-	rs148478244		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170203596delT								METTL11B (66673 upstream) : LOC284688 (36951 downstream)																																			---	---	---	---
C1orf129	80133	broad.mit.edu	37	1	170911510	170911515	+	Intron	DEL	ACACAC	-	-	rs147619622		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170911510_170911515delACACAC	uc001ghg.2	+						C1orf129_uc009wvy.2_Intron|C1orf129_uc010plz.1_Intron	NM_025063	NP_079339			hypothetical protein LOC80133 isoform 2								binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	172486437	172486438	+	IGR	DEL	TG	-	-	rs113844905		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172486437_172486438delTG								C1orf105 (48472 upstream) : C1orf9 (15822 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	172700409	172700409	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172700409delG								FASLG (64399 upstream) : TNFSF18 (309951 downstream)																																			---	---	---	---
DARS2	55157	broad.mit.edu	37	1	173802911	173802912	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173802911_173802912insT	uc001gjh.1	+							NM_018122	NP_060592			aspartyl-tRNA synthetase 2, mitochondrial						tRNA aminoacylation for protein translation	mitochondrial matrix|nucleus	aspartate-tRNA ligase activity|ATP binding|nucleic acid binding			central_nervous_system(2)	2					L-Aspartic Acid(DB00128)													---	---	---	---
Unknown	0	broad.mit.edu	37	1	174076734	174076734	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174076734delT								RC3H1 (114524 upstream) : RABGAP1L (51900 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	174999159	174999160	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174999159_174999160delCA								MRPS14 (6598 upstream) : TNN (37834 downstream)																																			---	---	---	---
TNN	63923	broad.mit.edu	37	1	175059584	175059584	+	Intron	DEL	C	-	-	rs35831070		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175059584delC	uc001gkl.1	+						TNN_uc010pmx.1_Intron	NM_022093	NP_071376			tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)														---	---	---	---
TNN	63923	broad.mit.edu	37	1	175112655	175112656	+	Intron	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175112655_175112656delGT	uc001gkl.1	+							NM_022093	NP_071376			tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	175886338	175886339	+	IGR	INS	-	AA	AA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175886338_175886339insAA								TNR (173586 upstream) : RFWD2 (27628 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	177751486	177751486	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177751486delT								FAM5B (499929 upstream) : SEC16B (146003 downstream)																																			---	---	---	---
RASAL2	9462	broad.mit.edu	37	1	178270572	178270573	+	Intron	INS	-	T	T	rs76882557		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178270572_178270573insT	uc001glq.2	+						RASAL2_uc009wxb.2_Intron	NM_170692	NP_733793			RAS protein activator like 2 isoform 2						negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	178963749	178963750	+	IGR	INS	-	T	T	rs142554826	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178963749_178963750insT								RALGPS2 (74514 upstream) : FAM20B (31324 downstream)																																			---	---	---	---
RGSL1	353299	broad.mit.edu	37	1	182467475	182467475	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182467475delC	uc009wxw.2	+						RGSL1_uc010pnu.1_Intron|RGSL1_uc009wxx.1_Intron	NM_001137669	NP_001131141			regulator of G-protein signaling like 1							integral to membrane	signal transducer activity			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	184173488	184173488	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184173488delG								TSEN15 (130147 upstream) : C1orf21 (182662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	186210060	186210061	+	IGR	INS	-	GAG	GAG	rs150054900	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186210060_186210061insGAG								HMCN1 (49975 upstream) : PRG4 (55344 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	187651966	187651969	+	IGR	DEL	GTGT	-	-	rs66937664		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187651966_187651969delGTGT								PLA2G4A (693861 upstream) : None (None downstream)																																			---	---	---	---
FAM5C	339479	broad.mit.edu	37	1	190118756	190118757	+	Intron	DEL	TG	-	-	rs113482140		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190118756_190118757delTG	uc001gse.1	-						FAM5C_uc010pot.1_Intron	NM_199051	NP_950252			family with sequence similarity 5, member C							extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)																	---	---	---	---
FAM5C	339479	broad.mit.edu	37	1	190427049	190427050	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190427049_190427050insA	uc001gse.1	-						FAM5C_uc010pot.1_Intron	NM_199051	NP_950252			family with sequence similarity 5, member C							extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)																	---	---	---	---
Unknown	0	broad.mit.edu	37	1	192652084	192652085	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192652084_192652085insT								RGS13 (22697 upstream) : RGS2 (126084 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	192873765	192873765	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192873765delT								RGS2 (92359 upstream) : UCHL5 (111135 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	193277761	193277762	+	IGR	INS	-	TG	TG	rs71642910	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193277761_193277762insTG								CDC73 (53821 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	194396602	194396603	+	IGR	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:194396602_194396603delAG								None (None upstream) : None (None downstream)																																			---	---	---	---
DENND1B	163486	broad.mit.edu	37	1	197492707	197492707	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197492707delG	uc010ppe.1	-						DENND1B_uc010ppf.1_Intron	NM_001142795	NP_001136267			DENN/MADD domain containing 1B isoform 1							clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0																		---	---	---	---
NEK7	140609	broad.mit.edu	37	1	198264334	198264334	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198264334delT	uc001gun.3	+							NM_133494	NP_598001			NIMA-related kinase 7							cytoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|lung(1)|ovary(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	199986422	199986423	+	IGR	INS	-	T	T	rs34397499		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:199986422_199986423insT								None (None upstream) : NR5A2 (10347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	200333605	200333605	+	Intron	DEL	A	-	-	rs35176014		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200333605delA	uc001gvd.1	-											Homo sapiens chromosome 1 open reading frame 98, mRNA (cDNA clone IMAGE:5197767).																														---	---	---	---
Unknown	0	broad.mit.edu	37	1	200492983	200492983	+	IGR	DEL	T	-	-	rs67020119		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200492983delT								ZNF281 (113817 upstream) : KIF14 (27642 downstream)																																			---	---	---	---
IPO9	55705	broad.mit.edu	37	1	201852617	201852617	+	3'UTR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201852617delC	uc001gwz.2	+	24						NM_018085	NP_060555			importin 9						protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	202083017	202083018	+	IGR	INS	-	TGTGTGTGTG	TGTGTGTGTG	rs145582764	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202083017_202083018insTGTGTGTGTG								ELF3 (96711 upstream) : GPR37L1 (9011 downstream)																																			---	---	---	---
PTPN7	5778	broad.mit.edu	37	1	202121419	202121419	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202121419delC	uc001gxm.1	-						PTPN7_uc001gxl.1_Intron|PTPN7_uc001gxn.1_Intron|PTPN7_uc010ppv.1_Intron|PTPN7_uc010ppw.1_Intron|PTPN7_uc010ppx.1_Intron|PTPN7_uc010ppy.1_Intron|PTPN7_uc001gxo.1_Intron	NM_002832	NP_002823			protein tyrosine phosphatase, non-receptor type							cytosol|internal side of plasma membrane	protein binding|protein tyrosine phosphatase activity			skin(1)	1																		---	---	---	---
KDM5B	10765	broad.mit.edu	37	1	202701171	202701171	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202701171delA	uc001gyf.2	-						KDM5B_uc009xag.2_Intron|KDM5B_uc001gyg.1_Intron	NM_006618	NP_006609			jumonji, AT rich interactive domain 1B						negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5																		---	---	---	---
FMOD	2331	broad.mit.edu	37	1	203319705	203319706	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203319705_203319706delAC	uc001gzr.2	-						FMOD_uc010pqi.1_5'Flank	NM_002023	NP_002014			fibromodulin precursor						transforming growth factor beta receptor complex assembly	extracellular space|proteinaceous extracellular matrix				ovary(2)|breast(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.171)															---	---	---	---
C1orf157	284573	broad.mit.edu	37	1	204003493	204003500	+	Intron	DEL	CTTTCTTT	-	-	rs112904762	by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204003493_204003500delCTTTCTTT	uc001haj.2	-						C1orf157_uc001hak.2_Intron|C1orf157_uc010pqo.1_Intron	NR_027902				Homo sapiens cDNA FLJ40343 fis, clone TESTI2032774.												0	all_cancers(21;0.083)|Breast(84;0.193)|all_epithelial(62;0.21)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0754)|Kidney(21;0.0934)|Epithelial(59;0.233)															---	---	---	---
SOX13	9580	broad.mit.edu	37	1	204050384	204050386	+	Intron	DEL	TTC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204050384_204050386delTTC	uc001ham.2	+						SOX13_uc001hal.2_Intron	NM_005686	NP_005677			SRY-box 13						anatomical structure morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)															---	---	---	---
PLEKHA6	22874	broad.mit.edu	37	1	204250661	204250661	+	Intron	DEL	A	-	-	rs72141326		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204250661delA	uc001hau.2	-							NM_014935	NP_055750			phosphoinositol 3-phosphate-binding protein-3											ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	204384627	204384628	+	IGR	INS	-	T	T	rs80271128	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204384627_204384628insT								PPP1R15B (3683 upstream) : PIK3C2B (7131 downstream)																																			---	---	---	---
PIK3C2B	5287	broad.mit.edu	37	1	204451633	204451633	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204451633delA	uc001haw.2	-						PIK3C2B_uc010pqv.1_Intron|PIK3C2B_uc001hax.1_Intron|PIK3C2B_uc009xbd.1_Intron	NM_002646	NP_002637			phosphoinositide-3-kinase, class 2 beta						cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)															---	---	---	---
PIK3C2B	5287	broad.mit.edu	37	1	204451891	204451892	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204451891_204451892insA	uc001haw.2	-						PIK3C2B_uc010pqv.1_Intron|PIK3C2B_uc001hax.1_Intron|PIK3C2B_uc009xbd.1_Intron	NM_002646	NP_002637			phosphoinositide-3-kinase, class 2 beta						cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)															---	---	---	---
MDM4	4194	broad.mit.edu	37	1	204665386	204665386	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204665386delC	uc001hbd.1	+							NM_002393				mouse double minute 4 homolog						apoptosis|cell proliferation|cellular response to hypoxia|G0 to G1 transition|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of protein catabolic process|negative regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization	nucleus	enzyme binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)					A		GBM|bladder|retinoblastoma								---	---	---	---
MDM4	4194	broad.mit.edu	37	1	204665925	204665926	+	Intron	DEL	CG	-	-	rs76106591	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204665925_204665926delCG	uc001hbd.1	+							NM_002393				mouse double minute 4 homolog						apoptosis|cell proliferation|cellular response to hypoxia|G0 to G1 transition|negative regulation of apoptosis|negative regulation of cell cycle arrest|negative regulation of cell proliferation|negative regulation of protein catabolic process|negative regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization	nucleus	enzyme binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)					A		GBM|bladder|retinoblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	1	204749352	204749355	+	IGR	DEL	GTTT	-	-	rs36166450		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204749352_204749355delGTTT								MDM4 (71691 upstream) : NFASC (48427 downstream)																																			---	---	---	---
NFASC	23114	broad.mit.edu	37	1	204895226	204895226	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204895226delT	uc001hbj.2	+						NFASC_uc001hbh.2_Intron|NFASC_uc010pqz.1_Intron|NFASC_uc010pra.1_Intron|NFASC_uc001hbi.2_Intron|NFASC_uc009xbg.1_Intron	NM_001005388	NP_001005388			neurofascin isoform 1 precursor						axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)															---	---	---	---
CDK18	5129	broad.mit.edu	37	1	205472552	205472552	+	5'Flank	DEL	A	-	-	rs5780286		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205472552delA	uc001hcr.2	+						CDK18_uc009xbk.1_5'Flank|CDK18_uc009xbl.1_5'Flank|CDK18_uc010pri.1_5'Flank|CDK18_uc001hcp.2_5'Flank|CDK18_uc001hcq.2_5'Flank|CDK18_uc010prj.1_5'Flank	NM_212503	NP_997668			PCTAIRE protein kinase 3 isoform a								ATP binding|cyclin-dependent protein kinase activity|protein binding|signal transducer activity			stomach(2)	2																		---	---	---	---
MFSD4	148808	broad.mit.edu	37	1	205544324	205544324	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205544324delG	uc001hcv.3	+						MFSD4_uc010prk.1_Intron|MFSD4_uc010prl.1_Intron	NM_181644	NP_857595			major facilitator superfamily domain containing						transmembrane transport	integral to membrane				skin(2)|central_nervous_system(1)	3	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)															---	---	---	---
RAB7L1	8934	broad.mit.edu	37	1	205738328	205738330	+	3'UTR	DEL	GTT	-	-	rs147452045		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205738328_205738330delGTT	uc001hdf.3	-	6					RAB7L1_uc009xbp.2_3'UTR|RAB7L1_uc001hde.3_3'UTR|RAB7L1_uc010prr.1_3'UTR|RAB7L1_uc009xbq.2_RNA	NM_003929	NP_003920			RAB7, member RAS oncogene family-like 1 isoform						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding			ovary(1)	1	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0194)															---	---	---	---
RASSF5	83593	broad.mit.edu	37	1	206709036	206709037	+	Intron	INS	-	TG	TG	rs142222948	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206709036_206709037insTG	uc001hed.2	+						RASSF5_uc001hec.1_Intron|RASSF5_uc001hee.2_Intron	NM_182663	NP_872604			Ras association (RalGDS/AF-6) domain family 5						apoptosis|intracellular signal transduction	cytoplasm|microtubule	metal ion binding|protein binding			ovary(1)	1	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
FCAMR	83953	broad.mit.edu	37	1	207132820	207132821	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207132820_207132821insA	uc001hfa.3	-						FCAMR_uc001hfb.2_Intron|FCAMR_uc009xca.1_Intron|FCAMR_uc001hfc.2_Intron	NM_001122980	NP_001116452			Fc receptor, IgA, IgM, high affinity isoform 2							integral to membrane|plasma membrane	receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	207457182	207457182	+	IGR	DEL	T	-	-	rs67483935		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207457182delT								C4BPA (138874 upstream) : CD55 (37635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	210438731	210438731	+	IGR	DEL	T	-	-	rs138584592		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210438731delT								SERTAD4 (22293 upstream) : HHAT (62875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	212637979	212637984	+	IGR	DEL	GTGTGT	-	-	rs71646165		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212637979_212637984delGTGTGT								NENF (18260 upstream) : ATF3 (100713 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	212853419	212853420	+	IGR	INS	-	A	A	rs146819706		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212853419_212853420insA								FAM71A (53305 upstream) : BATF3 (6340 downstream)																																			---	---	---	---
VASH2	79805	broad.mit.edu	37	1	213152405	213152407	+	Intron	DEL	AAG	-	-	rs66803896		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213152405_213152407delAAG	uc001hjy.2	+						VASH2_uc001hjx.2_Intron|VASH2_uc010ptn.1_Intron|VASH2_uc001hjw.2_Intron	NM_001136475	NP_001129947			vasohibin 2 isoform 3						positive regulation of angiogenesis|positive regulation of endothelial cell proliferation	cytoplasm					0				OV - Ovarian serous cystadenocarcinoma(81;0.00479)|all cancers(67;0.00844)|GBM - Glioblastoma multiforme(131;0.0496)|Epithelial(68;0.0986)														---	---	---	---
RPS6KC1	26750	broad.mit.edu	37	1	213246637	213246637	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213246637delA	uc010ptr.1	+						RPS6KC1_uc001hkd.2_Intron|RPS6KC1_uc010pts.1_Intron|RPS6KC1_uc010ptt.1_Intron|RPS6KC1_uc010ptu.1_Intron|RPS6KC1_uc010ptv.1_Intron|RPS6KC1_uc001hke.2_Intron	NM_012424	NP_036556			ribosomal protein S6 kinase, 52kDa, polypeptide						cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	213705852	213705852	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213705852delA								RPS6KC1 (259045 upstream) : PROX1 (455434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	213762986	213762986	+	IGR	DEL	A	-	-	rs11341124		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213762986delA								RPS6KC1 (316179 upstream) : PROX1 (398300 downstream)																																			---	---	---	---
PTPN14	5784	broad.mit.edu	37	1	214636775	214636775	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214636775delT	uc001hkk.1	-						PTPN14_uc010pty.1_Intron	NM_005401	NP_005392			protein tyrosine phosphatase, non-receptor type						lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)														---	---	---	---
CENPF	1063	broad.mit.edu	37	1	214810718	214810718	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214810718delT	uc001hkm.2	+							NM_016343	NP_057427			centromere protein F						cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)														---	---	---	---
CENPF	1063	broad.mit.edu	37	1	214836542	214836542	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214836542delG	uc001hkm.2	+							NM_016343	NP_057427			centromere protein F						cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)														---	---	---	---
ESRRG	2104	broad.mit.edu	37	1	217204712	217204712	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217204712delG	uc010puc.1	-						ESRRG_uc001hkz.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318			estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---
EPRS	2058	broad.mit.edu	37	1	220191138	220191138	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220191138delA	uc001hly.1	-						EPRS_uc010puf.1_Intron|EPRS_uc001hlz.1_Intron|EPRS_uc009xdt.1_Intron	NM_004446	NP_004437			glutamyl-prolyl tRNA synthetase						glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)													---	---	---	---
MOSC2	54996	broad.mit.edu	37	1	220947413	220947414	+	Intron	INS	-	T	T	rs34602928		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220947413_220947414insT	uc001hmq.2	+						MOSC2_uc001hmr.2_Intron|MOSC2_uc009xdx.2_Intron	NM_017898	NP_060368			MOCO sulphurase C-terminal domain containing 2							mitochondrial outer membrane|peroxisome	molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.00499)|all cancers(67;0.204)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	221572878	221572878	+	IGR	DEL	A	-	-	rs139534309		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221572878delA								LOC400804 (63240 upstream) : DUSP10 (301888 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	221586640	221586641	+	IGR	INS	-	GT	GT	rs10660423		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221586640_221586641insGT								LOC400804 (77002 upstream) : DUSP10 (288125 downstream)																																			---	---	---	---
CAPN8	388743	broad.mit.edu	37	1	223805109	223805109	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223805109delA	uc009xee.2	-							NM_001143962	NP_001137434			calpain 8						proteolysis	Golgi apparatus	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	1	224200218	224200219	+	IGR	INS	-	C	C	rs148091516		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224200218_224200219insC								TP53BP2 (166544 upstream) : FBXO28 (101572 downstream)																																			---	---	---	---
CNIH4	29097	broad.mit.edu	37	1	224550084	224550085	+	Intron	DEL	TC	-	-	rs141310741		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224550084_224550085delTC	uc001hom.1	+						CNIH4_uc001hon.1_Intron	NM_014184	NP_054903			cornichon homolog 4						intracellular signal transduction	endoplasmic reticulum|integral to membrane	protein binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.00341)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	224726785	224726786	+	IGR	DEL	AC	-	-	rs142640470		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224726785_224726786delAC								WDR26 (105053 upstream) : CNIH3 (77393 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	224773180	224773180	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224773180delT								WDR26 (151448 upstream) : CNIH3 (30999 downstream)																																			---	---	---	---
CDC42BPA	8476	broad.mit.edu	37	1	227440960	227440961	+	Intron	INS	-	GA	GA	rs150466644	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227440960_227440961insGA	uc001hqr.2	-						CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron	NM_003607	NP_003598			CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)																---	---	---	---
Unknown	0	broad.mit.edu	37	1	228097351	228097366	+	IGR	DEL	AGGGAGTAAGGGAGGA	-	-	rs148717265		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228097351_228097366delAGGGAGTAAGGGAGGA								PRSS38 (63182 upstream) : WNT9A (11799 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	229106423	229106424	+	IGR	INS	-	TG	TG	rs150515210	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229106423_229106424insTG								RHOU (224014 upstream) : RAB4A (300455 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	229811338	229811345	+	IGR	DEL	CCATCCAT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229811338_229811345delCCATCCAT								URB2 (15392 upstream) : GALNT2 (382191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	229996213	229996214	+	IGR	DEL	TG	-	-	rs71908660		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229996213_229996214delTG								URB2 (200267 upstream) : GALNT2 (197322 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	230079429	230079429	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230079429delA								URB2 (283483 upstream) : GALNT2 (114107 downstream)																																			---	---	---	---
GALNT2	2590	broad.mit.edu	37	1	230274271	230274272	+	Intron	INS	-	A	A	rs35938447		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230274271_230274272insA	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472			polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)																---	---	---	---
ARV1	64801	broad.mit.edu	37	1	231120113	231120114	+	Intron	INS	-	GC	GC	rs139111816		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231120113_231120114insGC	uc009xfl.1	+						ARV1_uc001huh.2_Intron	NM_022786	NP_073623			ARV1 homolog						sphingolipid metabolic process	integral to membrane				breast(2)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)		COAD - Colon adenocarcinoma(196;0.211)|Colorectal(1306;0.233)														---	---	---	---
Unknown	0	broad.mit.edu	37	1	234470757	234470757	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234470757delT								SLC35F3 (10495 upstream) : C1orf31 (38518 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	234721131	234721132	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234721131_234721132insA								TARBP1 (106282 upstream) : IRF2BP2 (18885 downstream)																																			---	---	---	---
GNG4	2786	broad.mit.edu	37	1	235740979	235740979	+	Intron	DEL	T	-	-	rs11332448		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235740979delT	uc001hxe.3	-						GNG4_uc009xfz.2_Intron|GNG4_uc001hxh.3_Intron	NM_001098722	NP_001092192			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|negative regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00168)|Prostate(94;0.0776)|Acute lymphoblastic leukemia(190;0.23)	OV - Ovarian serous cystadenocarcinoma(106;0.000882)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	236658184	236658184	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236658184delA								EDARADD (10176 upstream) : LGALS8 (23381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	238194186	238194186	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238194186delA								LOC100130331 (102569 upstream) : LOC339535 (449500 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	238737477	238737477	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238737477delT								LOC339535 (88160 upstream) : CHRM3 (812388 downstream)																																			---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240512794	240512795	+	Intron	INS	-	A	A	rs144101965	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240512794_240512795insA	uc010pyd.1	+						FMN2_uc010pye.1_Intron|FMN2_uc010pyf.1_Intron|FMN2_uc010pyg.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
FMN2	56776	broad.mit.edu	37	1	240582716	240582716	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240582716delA	uc010pyd.1	+						FMN2_uc010pye.1_Intron|FMN2_uc010pyg.1_Intron	NM_020066	NP_064450			formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)															---	---	---	---
GREM2	64388	broad.mit.edu	37	1	240696873	240696873	+	Intron	DEL	C	-	-	rs5782152		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240696873delC	uc001hys.2	-							NM_022469	NP_071914			gremlin 2 precursor						BMP signaling pathway	extracellular space	cytokine activity				0		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	240817115	240817116	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240817115_240817116insA								GREM2 (41653 upstream) : RGS7 (114439 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	1	242125285	242125285	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242125285delA								EXO1 (72238 upstream) : MAP1LC3C (33507 downstream)																																			---	---	---	---
MAP1LC3C	440738	broad.mit.edu	37	1	242160304	242160304	+	Intron	DEL	G	-	-	rs3932333	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242160304delG	uc001hzk.2	-							NM_001004343	NP_001004343			microtubule-associated protein 1 light chain 3						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule	protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(106;0.0188)															---	---	---	---
PLD5	200150	broad.mit.edu	37	1	242574842	242574842	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242574842delT	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron					RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---
SDCCAG8	10806	broad.mit.edu	37	1	243650232	243650233	+	Intron	INS	-	CTA	CTA	rs147566046	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243650232_243650233insCTA	uc001hzw.2	+						SDCCAG8_uc010pyk.1_Intron|SDCCAG8_uc010pyl.1_Intron|SDCCAG8_uc001hzx.2_Intron	NM_006642	NP_006633			serologically defined colon cancer antigen 8						establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)														---	---	---	---
AKT3	10000	broad.mit.edu	37	1	243872395	243872395	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243872395delT	uc001iab.1	-						AKT3_uc001hzz.1_Intron	NM_005465	NP_005456			AKT3 kinase isoform 1						signal transduction	Golgi apparatus|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|lung(1)|breast(1)|central_nervous_system(1)	4	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	244907593	244907594	+	IGR	INS	-	T	T	rs111659610		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244907593_244907594insT								PPPDE1 (35261 upstream) : FAM36A (91045 downstream)																																			---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245649698	245649698	+	Intron	DEL	A	-	-	rs5782349		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245649698delA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
KIF26B	55083	broad.mit.edu	37	1	245653981	245653981	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245653981delA	uc001ibf.1	+						KIF26B_uc010pyq.1_Intron	NM_018012	NP_060482			kinesin family member 26B						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)	3	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)															---	---	---	---
Unknown	0	broad.mit.edu	37	1	246860022	246860033	+	IGR	DEL	GTGTGTGTGTGT	-	-	rs34881883		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246860022_246860033delGTGTGTGTGTGT								CNST (28139 upstream) : SCCPDH (27345 downstream)																																			---	---	---	---
OR2L13	284521	broad.mit.edu	37	1	248146417	248146418	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248146417_248146418delTG	uc001ids.2	+							NM_175911	NP_787107			olfactory receptor, family 2, subfamily L,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)															---	---	---	---
SNTG2	54221	broad.mit.edu	37	2	1095260	1095261	+	Intron	INS	-	TCTGAAGGTGGGTGCAGTGAGGGCAGTGATGGTCAGGTCA	TCTGAAGGTGGGTGCAGTGAGGGCAGTGATGGTCAGGTCA	rs144652916		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1095260_1095261insTCTGAAGGTGGGTGCAGTGAGGGCAGTGATGGTCAGGTCA	uc002qwq.2	+						SNTG2_uc002qwp.2_Intron|SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841			syntrophin, gamma 2						central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	1586392	1586393	+	IGR	INS	-	A	A	rs113174308		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1586392_1586393insA								TPO (39894 upstream) : PXDN (49267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	2371475	2371476	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2371475_2371476delCA								MYT1L (36430 upstream) : TSSC1 (821265 downstream)																																			---	---	---	---
ALLC	55821	broad.mit.edu	37	2	3745212	3745215	+	Intron	DEL	TCTA	-	-	rs77220200	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3745212_3745215delTCTA	uc010ewt.2	+						ALLC_uc002qyf.2_Intron	NM_018436	NP_060906			allantoicase isoform a								allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)											HNSCC(21;0.051)			---	---	---	---
Unknown	0	broad.mit.edu	37	2	4134867	4134868	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4134867_4134868delAC								ALLC (384609 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	4457788	4457789	+	IGR	INS	-	TC	TC	rs138869263	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:4457788_4457789insTC								ALLC (707530 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5235670	5235670	+	IGR	DEL	A	-	-	rs6737346	byFrequency;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5235670delA								None (None upstream) : SOX11 (597129 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5438847	5438856	+	IGR	DEL	CGCGCACACA	-	-	rs10595678		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5438847_5438856delCGCGCACACA								None (None upstream) : SOX11 (393943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	5908222	5908222	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5908222delA								SOX11 (66706 upstream) : LOC150622 (164597 downstream)																																			---	---	---	---
LOC150622	150622	broad.mit.edu	37	2	6076823	6076824	+	Intron	INS	-	A	A	rs76903760		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6076823_6076824insA	uc002qyk.2	+							NR_026832				Homo sapiens cDNA FLJ30594 fis, clone BRAWH2008903.												0																		---	---	---	---
CMPK2	129607	broad.mit.edu	37	2	7001234	7001235	+	Intron	DEL	CG	-	-	rs3085147		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001234_7001235delCG	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198			UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
CMPK2	129607	broad.mit.edu	37	2	7001250	7001259	+	Intron	DEL	CACACACACC	-	-	rs57039812		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001250_7001259delCACACACACC	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198			UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	7301030	7301030	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7301030delT								RNF144A (116723 upstream) : LOC339788 (761528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7403641	7403642	+	IGR	INS	-	AC	AC	rs141070782	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7403641_7403642insAC								RNF144A (219334 upstream) : LOC339788 (658916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	7605181	7605181	+	IGR	DEL	A	-	-	rs148947959		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7605181delA								RNF144A (420874 upstream) : LOC339788 (457377 downstream)																																			---	---	---	---
ASAP2	8853	broad.mit.edu	37	2	9399683	9399695	+	Intron	DEL	AGCCCAAAACCTT	-	-	rs35075609		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9399683_9399695delAGCCCAAAACCTT	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878			ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0																		---	---	---	---
CPSF3	51692	broad.mit.edu	37	2	9574498	9574498	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9574498delA	uc002qzo.1	+						CPSF3_uc010ewx.1_Intron|CPSF3_uc002qzp.1_Intron	NM_016207	NP_057291			cleavage and polyadenylation specific factor 3,						histone mRNA 3'-end processing|mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex|ribonucleoprotein complex	5'-3' exonuclease activity|endoribonuclease activity|metal ion binding|protein binding|RNA binding			breast(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)														---	---	---	---
IAH1	285148	broad.mit.edu	37	2	9627918	9627921	+	Intron	DEL	TGTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9627918_9627921delTGTG	uc002qzr.2	+						IAH1_uc002qzs.2_Intron|IAH1_uc002qzt.2_Intron|IAH1_uc010yiz.1_Intron	NM_001039613	NP_001034702			isoamyl acetate-hydrolyzing esterase 1 homolog						lipid catabolic process		hydrolase activity, acting on ester bonds				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	9720113	9720114	+	IGR	INS	-	T	T	rs35653923	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9720113_9720114insT								ADAM17 (24196 upstream) : YWHAQ (3993 downstream)																																			---	---	---	---
CYS1	192668	broad.mit.edu	37	2	10208160	10208161	+	Intron	DEL	TG	-	-	rs59993020		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10208160_10208161delTG	uc002rag.2	-							NM_001037160	NP_001032237			cystin 1							cilium axoneme					0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.166)|OV - Ovarian serous cystadenocarcinoma(76;0.227)														---	---	---	---
C2orf48	348738	broad.mit.edu	37	2	10325405	10325406	+	Intron	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10325405_10325406delGA	uc002rai.1	+							NM_182626	NP_872432			hypothetical protein LOC348738												0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	11538884	11538885	+	IGR	DEL	AC	-	-	rs146658611		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11538884_11538885delAC								ROCK2 (54173 upstream) : E2F6 (45617 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	12179569	12179570	+	Intron	INS	-	TG	TG	rs147123891	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12179569_12179570insTG	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	16179654	16179654	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16179654delT								MYCN (92526 upstream) : FAM49A (554247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	17392929	17392930	+	IGR	DEL	TT	-	-	rs145054334		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17392929_17392930delTT								FAM49A (545833 upstream) : RAD51AP2 (299056 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	18394288	18394289	+	IGR	INS	-	T	T	rs59236152		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18394288_18394289insT								KCNS3 (280064 upstream) : NT5C1B (341702 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	18581278	18581278	+	IGR	DEL	C	-	-	rs66527107		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18581278delC								KCNS3 (467054 upstream) : NT5C1B (154713 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	18671975	18671976	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18671975_18671976delTC								KCNS3 (557751 upstream) : NT5C1B (64015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	19934791	19934794	+	IGR	DEL	GAAA	-	-	rs72315540	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19934791_19934794delGAAA								OSR1 (376419 upstream) : TTC32 (161724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	20620819	20620820	+	IGR	INS	-	TG	TG	rs112291587		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20620819_20620820insTG								PUM2 (70356 upstream) : RHOB (26015 downstream)																																			---	---	---	---
C2orf43	60526	broad.mit.edu	37	2	21000848	21000849	+	Intron	DEL	AC	-	-	rs111544765		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21000848_21000849delAC	uc002rec.2	-						C2orf43_uc002rea.1_Intron|C2orf43_uc002reb.1_Intron|C2orf43_uc010yka.1_Intron|C2orf43_uc010ykb.1_Intron|C2orf43_uc010ykc.1_Intron|C2orf43_uc010ykd.1_Intron|C2orf43_uc010yke.1_Intron|C2orf43_uc010ykf.1_Intron	NM_021925	NP_068744			hypothetical protein LOC60526												0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	22328567	22328567	+	IGR	DEL	A	-	-	rs140809309		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22328567delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	22875539	22875542	+	IGR	DEL	TCAT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:22875539_22875542delTCAT								None (None upstream) : KLHL29 (879913 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	23426387	23426388	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23426387_23426388delAC								None (None upstream) : KLHL29 (329067 downstream)																																			---	---	---	---
ATAD2B	54454	broad.mit.edu	37	2	23993658	23993658	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23993658delT	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc002rei.3_Intron|ATAD2B_uc002rej.3_Intron	NM_017552	NP_060022			ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
LOC375190	375190	broad.mit.edu	37	2	24361205	24361207	+	Intron	DEL	TTA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24361205_24361207delTTA	uc010ykl.1	+						LOC375190_uc002rew.2_Intron|LOC375190_uc002rfb.2_Intron	NM_001145710	NP_001139182			hypothetical protein LOC375190												0																		---	---	---	---
MAPRE3	22924	broad.mit.edu	37	2	27236428	27236429	+	Intron	INS	-	CATT	CATT	rs144870752	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27236428_27236429insCATT	uc002rhw.2	+						MAPRE3_uc002rhx.2_Intron|uc002rhy.1_Intron|MAPRE3_uc010yld.1_5'Flank	NM_012326	NP_036458			microtubule-associated protein, RP/EB family,						cell division|mitosis|positive regulation of transcription, DNA-dependent	cytoplasm|cytoplasmic microtubule|microtubule|midbody|perinuclear region of cytoplasm	microtubule binding|protein binding|small GTPase regulator activity			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
SLC4A1AP	22950	broad.mit.edu	37	2	27914041	27914041	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27914041delT	uc002rlk.3	+							NM_018158	NP_060628			solute carrier family 4 (anion exchanger),							cytoplasm|nucleus	double-stranded RNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
BRE	9577	broad.mit.edu	37	2	28164924	28164924	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28164924delT	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664			brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
BRE	9577	broad.mit.edu	37	2	28443979	28443980	+	Intron	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28443979_28443980delCT	uc002rlr.2	+						BRE_uc002rlp.1_Intron|BRE_uc002rlq.2_Intron|BRE_uc002rls.2_Intron|BRE_uc002rlt.2_Intron|BRE_uc002rlu.2_Intron|BRE_uc002rlv.2_Intron	NM_199194	NP_954664			brain and reproductive organ-expressed (TNFRSF1A						apoptosis|chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of anti-apoptosis|positive regulation of DNA repair|response to ionizing radiation|signal transduction	BRCA1-A complex|BRISC complex|cytoplasm|nuclear ubiquitin ligase complex	peroxisome targeting sequence binding|polyubiquitin binding|tumor necrosis factor receptor binding			lung(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	28688947	28688986	+	IGR	DEL	TCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCC	-	-	rs148403221	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28688947_28688986delTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCC								FOSL2 (51433 upstream) : PLB1 (29996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	29192678	29192679	+	IGR	INS	-	TTT	TTT	rs71403636		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29192678_29192679insTTT								WDR43 (21598 upstream) : FAM179A (11485 downstream)																																			---	---	---	---
GALNT14	79623	broad.mit.edu	37	2	31338139	31338139	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31338139delT	uc002rnr.2	-						GALNT14_uc002rnq.2_Intron|GALNT14_uc002rns.2_Intron|GALNT14_uc010ymr.1_Intron|GALNT14_uc010ezo.1_Intron|GALNT14_uc010ezp.1_Intron	NM_024572	NP_078848			N-acetylgalactosaminyltransferase 14							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			upper_aerodigestive_tract(2)|skin(1)	3	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
CAPN14	440854	broad.mit.edu	37	2	31414296	31414297	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31414296_31414297insA	uc010yms.1	-						CAPN14_uc002rnt.1_Intron	NM_001145122	NP_001138594			calpain 14						proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0																		---	---	---	---
XDH	7498	broad.mit.edu	37	2	31601042	31601053	+	Intron	DEL	AAGCAAGCAAGC	-	-	rs28600110		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31601042_31601053delAAGCAAGCAAGC	uc002rnv.1	-							NM_000379	NP_000370			xanthine dehydrogenase						purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)													---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33317261	33317262	+	Intron	DEL	CG	-	-	rs113961167		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33317261_33317262delCG	uc002ros.2	+							NM_206943	NP_996826			latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
LTBP1	4052	broad.mit.edu	37	2	33405522	33405522	+	Intron	DEL	T	-	-	rs71829396		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33405522delT	uc002ros.2	+						LTBP1_uc002rot.2_Intron|LTBP1_uc002rou.2_Intron|LTBP1_uc002rov.2_Intron|LTBP1_uc010ymz.1_Intron|LTBP1_uc010yna.1_Intron	NM_206943	NP_996826			latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	35673358	35673359	+	IGR	DEL	CA	-	-	rs72055843		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35673358_35673359delCA								None (None upstream) : CRIM1 (910038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	36313404	36313405	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36313404_36313405delCA								None (None upstream) : CRIM1 (269992 downstream)																																			---	---	---	---
SLC8A1	6546	broad.mit.edu	37	2	40663617	40663617	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40663617delG	uc002rsa.2	-						SLC8A1_uc002rsd.3_Intron|SLC8A1_uc010fan.1_Intron|SLC8A1_uc002rsc.1_Intron	NM_001112802	NP_001106273			solute carrier family 8 (sodium/calcium						cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	42339272	42339273	+	IGR	DEL	GC	-	-	rs72340927		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42339272_42339273delGC								PKDCC (53606 upstream) : EML4 (57217 downstream)																																			---	---	---	---
EML4	27436	broad.mit.edu	37	2	42521837	42521837	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42521837delA	uc002rsi.2	+						EML4_uc010fap.2_Intron|EML4_uc002rsj.2_Intron	NM_019063	NP_061936			echinoderm microtubule associated protein like 4						microtubule-based process|mitosis	cytoplasm|microtubule	protein binding		EML4/ALK(246)	lung(246)|ovary(2)|central_nervous_system(1)|skin(1)	250								T	ALK	NSCLC								---	---	---	---
Unknown	0	broad.mit.edu	37	2	43108208	43108209	+	IGR	DEL	GT	-	-	rs72118363		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43108208_43108209delGT								HAAO (88457 upstream) : ZFP36L2 (341333 downstream)																																			---	---	---	---
DYNC2LI1	51626	broad.mit.edu	37	2	43999332	43999333	+	5'Flank	DEL	AT	-	-	rs3834787		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43999332_43999333delAT	uc002rtk.2	+						DYNC2LI1_uc002rth.2_5'Flank|DYNC2LI1_uc002rti.2_5'Flank|DYNC2LI1_uc002rtj.2_5'Flank|DYNC2LI1_uc002rtl.2_5'Flank|DYNC2LI1_uc010ynz.1_5'Flank	NM_016008	NP_057092			dynein 2 light intermediate chain isoform 1							apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	44261864	44261864	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44261864delC								LRPPRC (38720 upstream) : PPM1B (134136 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	44293377	44293377	+	IGR	DEL	G	-	-	rs61062797		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44293377delG								LRPPRC (70233 upstream) : PPM1B (102623 downstream)																																			---	---	---	---
C2orf34	79823	broad.mit.edu	37	2	44918114	44918115	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44918114_44918115insA	uc002rum.2	+							NM_024766	NP_079042			hypothetical protein LOC79823							cytoplasm	calmodulin-lysine N-methyltransferase activity				0		all_hematologic(82;0.0892)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---
Unknown	0	broad.mit.edu	37	2	45178003	45178008	+	IGR	DEL	CACGCA	-	-	rs57374096		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45178003_45178008delCACGCA								SIX3 (5613 upstream) : SIX2 (54317 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	45230247	45230248	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45230247_45230248delTG								SIX3 (57857 upstream) : SIX2 (2077 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	45371536	45371539	+	IGR	DEL	GTGG	-	-	rs112416419	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45371536_45371539delGTGG								SIX2 (134993 upstream) : SRBD1 (244281 downstream)																																			---	---	---	---
TTC7A	57217	broad.mit.edu	37	2	47265398	47265399	+	Intron	DEL	AA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47265398_47265399delAA	uc002rvo.2	+						TTC7A_uc002rvm.2_Intron|TTC7A_uc002rvn.1_Intron|TTC7A_uc010fbb.2_Intron|TTC7A_uc010fbc.2_Intron|TTC7A_uc002rvp.2_Intron|TTC7A_uc002rvq.2_Intron|TTC7A_uc002rvr.2_Intron	NM_020458	NP_065191			tetratricopeptide repeat domain 7A								binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	48199271	48199272	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48199271_48199272insA								FBXO11 (66457 upstream) : FOXN2 (342523 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	48514453	48514453	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48514453delT								FBXO11 (381639 upstream) : FOXN2 (27342 downstream)																																			---	---	---	---
LHCGR	3973	broad.mit.edu	37	2	48916852	48916853	+	Intron	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48916852_48916853delCT	uc002rwu.3	-						GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224			luteinizing hormone/choriogonadotropin receptor						male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)									Familial_Male-Limited_Precocious_Puberty				---	---	---	---
FSHR	2492	broad.mit.edu	37	2	49355632	49355632	+	Intron	DEL	A	-	-	rs34017410		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49355632delA	uc002rww.2	-						FSHR_uc002rwx.2_Intron|FSHR_uc010fbn.2_Intron|FSHR_uc010fbo.1_Intron	NM_000145	NP_000136			follicle stimulating hormone receptor isoform 1						female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)									Gonadal_Dysgenesis_46_XX				---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50504538	50504549	+	Intron	DEL	CCTCCCTCCTTC	-	-	rs145171946	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50504538_50504549delCCTCCCTCCTTC	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_138735	NP_620072			neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50504634	50504652	+	Intron	DEL	CTTTTTCCTTCCTTCCTTC	-	-	rs147518619		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50504634_50504652delCTTTTTCCTTCCTTCCTTC	uc010fbp.2	-						NRXN1_uc002rxb.3_Intron|NRXN1_uc010fbq.2_Intron|NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxc.1_Intron	NM_138735	NP_620072			neurexin 1 isoform beta precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	50935489	50935490	+	Intron	DEL	TT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50935489_50935490delTT	uc010fbq.2	-						NRXN1_uc002rxe.3_Intron	NM_001135659	NP_001129131			neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	51085714	51085714	+	Intron	DEL	A	-	-	rs145159916		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51085714delA	uc010fbq.2	-						NRXN1_uc002rxe.3_Intron	NM_001135659	NP_001129131			neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
NRXN1	9378	broad.mit.edu	37	2	51167612	51167612	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51167612delA	uc010fbq.2	-						NRXN1_uc002rxe.3_Intron|NRXN1_uc002rxd.1_Intron	NM_001135659	NP_001129131			neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	51333933	51333934	+	IGR	DEL	TA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51333933_51333934delTA								NRXN1 (74259 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	51690355	51690355	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51690355delA								NRXN1 (430681 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	51825951	51825951	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51825951delT								NRXN1 (566277 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53484414	53484415	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53484414_53484415insA								None (None upstream) : ASB3 (412703 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	53632061	53632062	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:53632061_53632062insA								None (None upstream) : ASB3 (265056 downstream)																																			---	---	---	---
ACYP2	98	broad.mit.edu	37	2	54479405	54479405	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54479405delT	uc002rxq.3	+							NM_138448	NP_612457			acylphosphatase 2						phosphate metabolic process		acylphosphatase activity				0																		---	---	---	---
ACYP2	98	broad.mit.edu	37	2	54479703	54479704	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54479703_54479704insT	uc002rxq.3	+							NM_138448	NP_612457			acylphosphatase 2						phosphate metabolic process		acylphosphatase activity				0																		---	---	---	---
SPTBN1	6711	broad.mit.edu	37	2	54798710	54798713	+	Intron	DEL	ACAT	-	-	rs146083631	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54798710_54798713delACAT	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron|SPTBN1_uc002rxx.2_Intron	NM_003128	NP_003119			spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)															---	---	---	---
SPTBN1	6711	broad.mit.edu	37	2	54798712	54798713	+	Intron	DEL	AT	-	-	rs72281211		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54798712_54798713delAT	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron|SPTBN1_uc002rxx.2_Intron	NM_003128	NP_003119			spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	55346664	55346665	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55346664_55346665insT								RTN4 (68930 upstream) : C2orf63 (53022 downstream)																																			---	---	---	---
SMEK2	57223	broad.mit.edu	37	2	55836884	55836885	+	Intron	INS	-	A	A	rs112904725		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55836884_55836885insA	uc002rzc.2	-						SMEK2_uc002rzb.2_Intron|SMEK2_uc002rzd.2_Intron	NM_001122964	NP_001116436			SMEK homolog 2, suppressor of mek1 isoform 1							microtubule organizing center|nucleus	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)															---	---	---	---
PNPT1	87178	broad.mit.edu	37	2	55908979	55908980	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55908979_55908980insA	uc002rzf.2	-						PNPT1_uc002rzg.2_Intron	NM_033109	NP_149100			polyribonucleotide nucleotidyltransferase 1						mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	58741846	58741846	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58741846delT								FANCL (273331 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	59231799	59231799	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59231799delT	uc002rzy.2	+						uc002rzz.2_Intron					Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	59811429	59811429	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59811429delT								None (None upstream) : BCL11A (866874 downstream)																																			---	---	---	---
BCL11A	53335	broad.mit.edu	37	2	60694268	60694268	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60694268delT	uc002sae.1	-						BCL11A_uc002sab.2_Intron|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Intron|BCL11A_uc002sad.1_Intron|BCL11A_uc002saf.1_Intron	NM_022893	NP_075044			B-cell CLL/lymphoma 11A isoform 1						negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)					T	IGH@	B-CLL								---	---	---	---
USP34	9736	broad.mit.edu	37	2	61552411	61552412	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61552411_61552412insA	uc002sbe.2	-							NM_014709	NP_055524			ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	61915628	61915628	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61915628delT								XPO1 (150210 upstream) : FAM161A (136357 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	62815655	62815662	+	IGR	DEL	ACACACAC	-	-	rs138821102		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62815655_62815662delACACACAC								TMEM17 (52875 upstream) : EHBP1 (85351 downstream)																																			---	---	---	---
VPS54	51542	broad.mit.edu	37	2	64244471	64244471	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64244471delA	uc002scq.2	-						VPS54_uc002scp.2_Intron	NM_016516	NP_057600			vacuolar protein sorting 54 isoform 1						protein transport|retrograde transport, endosome to Golgi						0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	64696577	64696578	+	IGR	INS	-	C	C	rs147404020	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64696577_64696578insC								HSPC159 (8066 upstream) : AFTPH (54887 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	66355494	66355495	+	IGR	INS	-	TCCC	TCCC	rs150726147	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66355494_66355495insTCCC								SPRED2 (695838 upstream) : MEIS1 (307037 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	66876540	66876541	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66876540_66876541delAC								MEIS1 (76650 upstream) : ETAA1 (747901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	67406227	67406227	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67406227delA	uc002sdx.2	+						uc002sdy.1_Intron					Homo sapiens, clone IMAGE:5541055, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	67754052	67754053	+	IGR	INS	-	A	A	rs138510309	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67754052_67754053insA								ETAA1 (116519 upstream) : C1D (515280 downstream)																																			---	---	---	---
ANTXR1	84168	broad.mit.edu	37	2	69411196	69411197	+	Intron	DEL	CA	-	-	rs66480718		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69411196_69411197delCA	uc002sfg.2	+							NM_032208	NP_115584			anthrax toxin receptor 1 isoform 1 precursor						actin cytoskeleton reorganization|substrate adhesion-dependent cell spreading	filopodium membrane|integral to membrane|lamellipodium membrane	actin filament binding|collagen binding|metal ion binding|protein binding|transmembrane receptor activity			ovary(2)|skin(2)	4														Familial_Infantile_Hemangioma				---	---	---	---
Unknown	0	broad.mit.edu	37	2	70576820	70576823	+	IGR	DEL	CACG	-	-	rs76759253		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70576820_70576823delCACG								FAM136A (47600 upstream) : TGFA (97596 downstream)																																			---	---	---	---
ATP6V1B1	525	broad.mit.edu	37	2	71170317	71170318	+	Intron	INS	-	AC	AC	rs140731815	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71170317_71170318insAC	uc002shj.2	+						ATP6V1B1_uc002shi.1_Intron|ATP6V1B1_uc010fdv.2_Intron|ATP6V1B1_uc010fdw.2_Intron|ATP6V1B1_uc010fdx.2_Intron	NM_001692	NP_001683			ATPase, H+ transporting, lysosomal 56/58kDa, V1						ATP hydrolysis coupled proton transport|calcium ion homeostasis|cellular iron ion homeostasis|excretion|inner ear morphogenesis|insulin receptor signaling pathway|ossification|pH reduction|sensory perception of sound|transferrin transport	apical plasma membrane|basolateral plasma membrane|cytosol|endomembrane system|lateral plasma membrane|microvillus|proton-transporting V-type ATPase, V1 domain|vacuolar proton-transporting V-type ATPase complex	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			skin(1)	1																		---	---	---	---
DYSF	8291	broad.mit.edu	37	2	71684788	71684788	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71684788delG	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron	NM_003494	NP_003485			dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	72329288	72329298	+	IGR	DEL	TAGTGTATTAT	-	-	rs72303136		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72329288_72329298delTAGTGTATTAT								DYSF (415396 upstream) : CYP26B1 (27069 downstream)																																			---	---	---	---
EXOC6B	23233	broad.mit.edu	37	2	72571582	72571582	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72571582delT	uc010fep.2	-							NM_015189	NP_056004			SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	73106677	73106678	+	IGR	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73106677_73106678delAG								EXOC6B (53500 upstream) : SPR (7834 downstream)																																			---	---	---	---
MTHFD2	10797	broad.mit.edu	37	2	74429086	74429086	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74429086delT	uc002skk.2	+						MTHFD2_uc002skj.2_Intron|MTHFD2_uc010yro.1_Intron|MTHFD2_uc010ffb.2_Intron|MTHFD2_uc010yrp.1_Intron	NM_006636	NP_006627			methylenetetrahydrofolate dehydrogenase 2						folic acid-containing compound biosynthetic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	magnesium ion binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|phosphate binding|protein binding				0					NADH(DB00157)|Tetrahydrofolic acid(DB00116)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	75860958	75860961	+	IGR	DEL	TCAT	-	-	rs10609102		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75860958_75860961delTCAT								FAM176A (64110 upstream) : MRPL19 (12948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	78644801	78644802	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78644801_78644802delTG	uc002snv.3	-											Homo sapiens cytochrome c, somatic pseudogene 6, mRNA (cDNA clone IMAGE:4815768).																														---	---	---	---
CTNNA2	1496	broad.mit.edu	37	2	79565704	79565705	+	Intron	INS	-	TCTTTTTCC	TCTTTTTCC	rs6734961	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79565704_79565705insTCTTTTTCC	uc010yse.1	+							NM_004389	NP_004380			catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	82873068	82873068	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:82873068delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	83816962	83816962	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:83816962delC								None (None upstream) : FUNDC2P2 (700844 downstream)																																			---	---	---	---
ELMOD3	84173	broad.mit.edu	37	2	85618139	85618147	+	3'UTR	DEL	CAGTGGAGC	-	-	rs73945729		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85618139_85618147delCAGTGGAGC	uc002spf.3	+	15					ELMOD3_uc002spg.3_3'UTR|ELMOD3_uc002sph.3_3'UTR|ELMOD3_uc010ysn.1_3'UTR|ELMOD3_uc010yso.1_RNA|ELMOD3_uc010ysp.1_RNA	NM_001135021	NP_001128493			ELMO/CED-12 domain containing 3 isoform b						phagocytosis	cytoskeleton				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	85961901	85961902	+	IGR	INS	-	A	A	rs138924827	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85961901_85961902insA								GNLY (36027 upstream) : ATOH8 (19007 downstream)																																			---	---	---	---
RMND5A	64795	broad.mit.edu	37	2	87884409	87884409	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87884409delC	uc002srs.3	+											SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	88536472	88536473	+	IGR	DEL	CA	-	-	rs113223255		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88536472_88536473delCA								THNSL2 (50327 upstream) : FOXI3 (211253 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	90430573	90430574	+	Intron	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90430573_90430574insG	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	91739761	91739765	+	IGR	DEL	ATTTC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91739761_91739765delATTTC								None (None upstream) : LOC654342 (65427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91798818	91798818	+	IGR	DEL	C	-	-	rs71380648		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91798818delC								None (None upstream) : LOC654342 (6374 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	91799030	91799031	+	IGR	INS	-	T	T	rs149067363		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91799030_91799031insT								None (None upstream) : LOC654342 (6161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92044120	92044121	+	IGR	INS	-	AC	AC			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92044120_92044121insAC								GGT8P (73967 upstream) : FKSG73 (85038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92048141	92048142	+	IGR	INS	-	TG	TG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92048141_92048142insTG								GGT8P (77988 upstream) : FKSG73 (81017 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92089509	92089509	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92089509delA								GGT8P (119356 upstream) : FKSG73 (39650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92105903	92105904	+	IGR	INS	-	C	C	rs150556462	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92105903_92105904insC								GGT8P (135750 upstream) : FKSG73 (23255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92265925	92265926	+	IGR	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92265925_92265926delAG								FKSG73 (135431 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	92317890	92317890	+	IGR	DEL	T	-	-	rs7597972		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92317890delT								FKSG73 (187396 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	95372710	95372710	+	IGR	DEL	T	-	-	rs111407030		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95372710delT								None (None upstream) : ANKRD20B (53965 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	95594945	95594945	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95594945delT	uc002stv.1	-											Homo sapiens cDNA FLJ44118 fis, clone TESTI4047069.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	98283731	98283731	+	5'Flank	DEL	A	-	-	rs67377947		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98283731delA	uc002syc.1	+											Homo sapiens cDNA clone IMAGE:5271446.																														---	---	---	---
VWA3B	200403	broad.mit.edu	37	2	98867787	98867787	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98867787delA	uc002syo.2	+						VWA3B_uc002sym.2_Intron|VWA3B_uc002syn.1_Intron|VWA3B_uc010yvi.1_Intron|VWA3B_uc002syp.1_Intron|VWA3B_uc002syq.1_Intron|VWA3B_uc002syr.1_Intron|VWA3B_uc002sys.2_Intron	NM_144992	NP_659429			von Willebrand factor A domain containing 3B											ovary(3)|large_intestine(2)|skin(1)	6																		---	---	---	---
MAP4K4	9448	broad.mit.edu	37	2	102400726	102400727	+	Intron	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102400726_102400727delGT	uc002tbg.2	+						MAP4K4_uc002tbc.2_Intron|MAP4K4_uc002tbd.2_Intron|MAP4K4_uc002tbe.2_Intron|MAP4K4_uc002tbf.2_Intron|MAP4K4_uc010yvy.1_Intron|MAP4K4_uc002tbh.2_Intron|MAP4K4_uc002tbi.2_Intron	NM_145687	NP_663720			mitogen-activated protein kinase kinase kinase						intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
MAP4K4	9448	broad.mit.edu	37	2	102503487	102503488	+	Intron	DEL	AA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102503487_102503488delAA	uc002tbg.2	+						MAP4K4_uc002tbc.2_Intron|MAP4K4_uc002tbd.2_Intron|MAP4K4_uc002tbe.2_Intron|MAP4K4_uc002tbf.2_Intron|MAP4K4_uc010yvy.1_Intron|MAP4K4_uc002tbh.2_Intron|MAP4K4_uc002tbi.2_Intron|MAP4K4_uc010yvz.1_Intron|MAP4K4_uc002tbk.2_Intron|MAP4K4_uc002tbl.2_Intron	NM_145687	NP_663720			mitogen-activated protein kinase kinase kinase						intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
SLC9A4	389015	broad.mit.edu	37	2	103134855	103134855	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103134855delG	uc002tbz.3	+							NM_001011552	NP_001011552			solute carrier family 9 (sodium/hydrogen						regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3																		---	---	---	---
TGFBRAP1	9392	broad.mit.edu	37	2	105894526	105894543	+	Intron	DEL	TGTGTGTGTGTGTGTGTG	-	-	rs10533783		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105894526_105894543delTGTGTGTGTGTGTGTGTG	uc002tcq.2	-						TGFBRAP1_uc010fjc.2_Intron|TGFBRAP1_uc002tcr.3_Intron	NM_004257	NP_004248			transforming growth factor, beta receptor						regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	106064792	106064793	+	IGR	INS	-	T	T	rs112329491		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106064792_106064793insT								FHL2 (9562 upstream) : NCK2 (296561 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	107630146	107630147	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107630146_107630147delGT								ST6GAL2 (126583 upstream) : LOC729121 (809373 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	107932138	107932139	+	IGR	INS	-	GT	GT	rs147987530	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107932138_107932139insGT								ST6GAL2 (428575 upstream) : LOC729121 (507381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	108204958	108204959	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108204958_108204959insT								ST6GAL2 (701395 upstream) : LOC729121 (234561 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	108556339	108556340	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108556339_108556340insA								RGPD4 (47340 upstream) : SLC5A7 (46655 downstream)																																			---	---	---	---
SLC5A7	60482	broad.mit.edu	37	2	108605177	108605178	+	Intron	INS	-	A	A	rs150049631	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108605177_108605178insA	uc002tdv.2	+						SLC5A7_uc010ywm.1_Intron|SLC5A7_uc010fjj.2_Intron|SLC5A7_uc010ywn.1_Intron	NM_021815	NP_068587			solute carrier family 5 (choline transporter),						acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)													---	---	---	---
NPHP1	4867	broad.mit.edu	37	2	110909866	110909866	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110909866delA	uc002tfn.3	-						NPHP1_uc002tfm.3_Intron|NPHP1_uc002tfl.3_Intron|NPHP1_uc002tfo.3_Intron|NPHP1_uc010ywx.1_Intron|NPHP1_uc010fjv.1_Intron	NM_207181	NP_997064			nephrocystin 1 isoform 2						actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity			ovary(2)	2																		---	---	---	---
NPHP1	4867	broad.mit.edu	37	2	110945486	110945487	+	Intron	INS	-	A	A	rs139627954	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110945486_110945487insA	uc002tfn.3	-						NPHP1_uc002tfm.3_Intron|NPHP1_uc002tfl.3_Intron|NPHP1_uc002tfo.3_Intron|NPHP1_uc010ywx.1_Intron|NPHP1_uc010fjv.1_Intron|NPHP1_uc002tfp.2_Intron	NM_207181	NP_997064			nephrocystin 1 isoform 2						actin cytoskeleton organization|cell projection organization|cell-cell adhesion|excretion|retina development in camera-type eye|signal transduction|spermatid differentiation|visual behavior	adherens junction|cell-cell junction|cilium axoneme|cytoplasm|cytoskeleton|motile cilium|photoreceptor connecting cilium	protein binding|structural molecule activity			ovary(2)	2																		---	---	---	---
BCL2L11	10018	broad.mit.edu	37	2	111877346	111877347	+	5'Flank	INS	-	G	G	rs151098219	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111877346_111877347insG	uc002tgv.1	+						BCL2L11_uc002tgt.1_5'Flank|BCL2L11_uc002tgu.1_5'Flank	NM_138621	NP_619527			BCL2-like 11 isoform 1						activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|nerve growth factor receptor signaling pathway|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria	cytosol|endomembrane system|mitochondrial outer membrane|plasma membrane	protein binding|protein binding				0																		---	---	---	---
MERTK	10461	broad.mit.edu	37	2	112663010	112663011	+	Intron	INS	-	T	T	rs68060352		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112663010_112663011insT	uc002thk.1	+						MERTK_uc002thl.1_Intron	NM_006343	NP_006334			MER receptor tyrosine kinase precursor						cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9																		---	---	---	---
MERTK	10461	broad.mit.edu	37	2	112739637	112739637	+	Intron	DEL	T	-	-	rs76598731		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112739637delT	uc002thk.1	+						MERTK_uc002thl.1_Intron	NM_006343	NP_006334			MER receptor tyrosine kinase precursor						cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9																		---	---	---	---
FBLN7	129804	broad.mit.edu	37	2	112916707	112916707	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112916707delA	uc002tho.1	+						FBLN7_uc002thn.2_Intron|FBLN7_uc010fki.1_Intron|FBLN7_uc010fkj.1_Intron	NM_153214	NP_694946			fibulin 7 isoform 1						cell adhesion	proteinaceous extracellular matrix	calcium ion binding|heparin binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	114552156	114552159	+	IGR	DEL	GAAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114552156_114552159delGAAG								SLC35F5 (37756 upstream) : ACTR3 (95378 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	114634730	114634730	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114634730delT								SLC35F5 (120330 upstream) : ACTR3 (12807 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	118492294	118492295	+	IGR	DEL	AG	-	-	rs10546760		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118492294_118492295delAG								None (None upstream) : DDX18 (79960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	119466769	119466769	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119466769delT								INSIG2 (599173 upstream) : EN1 (132979 downstream)																																			---	---	---	---
SCTR	6344	broad.mit.edu	37	2	120269917	120269922	+	Intron	DEL	CCTTCT	-	-	rs60261438	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120269917_120269922delCCTTCT	uc002tma.2	-							NM_002980	NP_002971			secretin receptor precursor						digestion|excretion	integral to plasma membrane	secretin receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3					Secretin(DB00021)													---	---	---	---
TMEM177	80775	broad.mit.edu	37	2	120442116	120442116	+	Intron	DEL	T	-	-	rs5022958		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120442116delT	uc010flh.2	+						TMEM177_uc002tme.2_Intron					SubName: Full=Putative uncharacterized protein MGC10993; SubName: Full=Putative uncharacterized protein TMEM177;							integral to membrane				ovary(1)	1	Colorectal(110;0.196)																	---	---	---	---
TMEM177	80775	broad.mit.edu	37	2	120463195	120463196	+	Intron	INS	-	GTGT	GTGT	rs148953846	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120463195_120463196insGTGT	uc002tme.2	+											Homo sapiens cDNA FLJ32751 fis, clone TESTI2001621.							integral to membrane				ovary(1)	1	Colorectal(110;0.196)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	121343948	121343948	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121343948delT								LOC84931 (120023 upstream) : GLI2 (149251 downstream)																																			---	---	---	---
GLI2	2736	broad.mit.edu	37	2	121527422	121527422	+	Intron	DEL	T	-	-	rs35777290		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121527422delT	uc010yyu.1	+						GLI2_uc002tmp.1_Intron					SubName: Full=cDNA FLJ60878, highly similar to Homo sapiens GLI-Kruppel family member GLI2, mRNA;						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)																---	---	---	---
TFCP2L1	29842	broad.mit.edu	37	2	122032518	122032518	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122032518delA	uc002tmx.2	-						TFCP2L1_uc010flr.2_Intron	NM_014553	NP_055368			LBP-9						female pregnancy|steroid biosynthetic process	mitochondrion|nucleolus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			pancreas(2)|ovary(1)	3	Renal(3;0.01)																	---	---	---	---
CLASP1	23332	broad.mit.edu	37	2	122275922	122275923	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122275922_122275923delAC	uc002tnc.2	-						CLASP1_uc010yyy.1_Intron|CLASP1_uc010yyz.1_Intron|CLASP1_uc010yza.1_Intron|CLASP1_uc010yzb.1_Intron|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tng.1_Intron	NM_015282	NP_056097			CLIP-associating protein 1 isoform 1						axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)																	---	---	---	---
Unknown	0	broad.mit.edu	37	2	123257972	123257975	+	IGR	DEL	CTTT	-	-	rs71983928	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123257972_123257975delCTTT								TSN (732546 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	123652631	123652632	+	IGR	INS	-	T	T	rs56294635	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123652631_123652632insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	123837677	123837678	+	IGR	INS	-	T	T	rs146419129	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:123837677_123837678insT								None (None upstream) : CNTNAP5 (945186 downstream)																																			---	---	---	---
CNTNAP5	129684	broad.mit.edu	37	2	125028278	125028279	+	Intron	INS	-	TG	TG	rs149484374	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125028278_125028279insTG	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129			contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	127147743	127147747	+	IGR	DEL	AGCAG	-	-	rs141995889		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127147743_127147747delAGCAG								None (None upstream) : GYPC (265937 downstream)																																			---	---	---	---
GYPC	2995	broad.mit.edu	37	2	127424285	127424288	+	Intron	DEL	ACAC	-	-	rs56317821		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127424285_127424288delACAC	uc002tnq.2	+						GYPC_uc002tnr.2_Intron|GYPC_uc010flv.2_Intron	NM_002101	NP_002092			glycophorin C isoform 1							cortical cytoskeleton|integral to plasma membrane	protein binding			central_nervous_system(1)	1	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	127556828	127556829	+	IGR	INS	-	TCTC	TCTC	rs139067721	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127556828_127556829insTCTC								GYPC (102583 upstream) : BIN1 (248778 downstream)																																			---	---	---	---
ARHGEF4	50649	broad.mit.edu	37	2	131770339	131770339	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131770339delA	uc002tsa.1	+						ARHGEF4_uc010fmw.1_Intron|ARHGEF4_uc002tsb.1_Intron|ARHGEF4_uc010fmx.1_Intron	NM_015320	NP_056135			Rho guanine nucleotide exchange factor 4 isoform						apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity			breast(3)|ovary(2)|skin(1)	6		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	132125181	132125182	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132125181_132125182delCA								LOC150786 (3450 upstream) : LOC401010 (74552 downstream)																																			---	---	---	---
NCRNA00164	554226	broad.mit.edu	37	2	133011694	133011695	+	Intron	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133011694_133011695insC	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0																		---	---	---	---
MIR663B	100302269	broad.mit.edu	37	2	133015150	133015150	+	5'Flank	DEL	G	-	-	rs583654		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133015150delG	hsa-mir-663b|MI0006336	-						NCRNA00164_uc002ttj.3_RNA																	0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	133023673	133023676	+	IGR	DEL	CCCT	-	-	rs111943961		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133023673_133023676delCCCT								NCRNA00164 (8131 upstream) : GPR39 (150471 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133053343	133053344	+	IGR	INS	-	A	A	rs140692458	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133053343_133053344insA								NCRNA00164 (37801 upstream) : GPR39 (120803 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	133151758	133151758	+	IGR	DEL	C	-	-	rs66702652		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133151758delC								NCRNA00164 (136216 upstream) : GPR39 (22389 downstream)																																			---	---	---	---
NCKAP5	344148	broad.mit.edu	37	2	133577809	133577809	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133577809delT	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246			Nck-associated protein 5 isoform 1								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	134513704	134513704	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134513704delA								NCKAP5 (187673 upstream) : MGAT5 (498126 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	134783746	134783747	+	IGR	DEL	TG	-	-	rs72261470		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134783746_134783747delTG								NCKAP5 (457715 upstream) : MGAT5 (228083 downstream)																																			---	---	---	---
MGAT5	4249	broad.mit.edu	37	2	135017651	135017652	+	Intron	INS	-	AGCATATG	AGCATATG	rs138168662	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135017651_135017652insAGCATATG	uc002ttv.1	+							NM_002410	NP_002401			N-acetylglucosaminyltransferase V						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0964)														---	---	---	---
TMEM163	81615	broad.mit.edu	37	2	135225178	135225178	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135225178delG	uc002ttx.2	-						TMEM163_uc002tty.2_Intron	NM_030923	NP_112185			transmembrane protein 163							integral to membrane					0				BRCA - Breast invasive adenocarcinoma(221;0.154)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	135551439	135551439	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135551439delG								TMEM163 (26105 upstream) : ACMSD (44747 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	135673189	135673189	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135673189delT	uc010zbe.1	-											Homo sapiens cDNA FLJ57500 complete cds.																														---	---	---	---
LCT	3938	broad.mit.edu	37	2	136552603	136552604	+	Intron	INS	-	CG	CG	rs150578954	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136552603_136552604insCG	uc002tuu.1	-							NM_002299	NP_002290			lactase-phlorizin hydrolase preproprotein						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	137259680	137259681	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137259680_137259681delAC								CXCR4 (383955 upstream) : THSD7B (263434 downstream)																																			---	---	---	---
LRP1B	53353	broad.mit.edu	37	2	142527730	142527730	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142527730delT	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027			low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---
ARHGAP15	55843	broad.mit.edu	37	2	143923513	143923520	+	Intron	DEL	AAGAAAGA	-	-	rs2919144		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143923513_143923520delAAGAAAGA	uc002tvm.3	+						ARHGAP15_uc010zbl.1_Intron	NM_018460	NP_060930			ARHGAP15						regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)														---	---	---	---
ARHGAP15	55843	broad.mit.edu	37	2	144337275	144337276	+	Intron	INS	-	T	T	rs138592393	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144337275_144337276insT	uc002tvm.3	+						ARHGAP15_uc002tvn.2_Intron	NM_018460	NP_060930			ARHGAP15						regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)														---	---	---	---
GTDC1	79712	broad.mit.edu	37	2	144893962	144893962	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144893962delA	uc002tvp.2	-						GTDC1_uc002tvo.2_Intron|GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Intron|GTDC1_uc010fnn.2_Intron|GTDC1_uc002tvs.2_Intron|GTDC1_uc010fno.2_Intron|GTDC1_uc002tvt.1_Intron	NM_001006636	NP_001006637			glycosyltransferase-like domain containing 1						biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	146094900	146094900	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:146094900delA								ZEB2 (816969 upstream) : None (None downstream)																																			---	---	---	---
MBD5	55777	broad.mit.edu	37	2	149039477	149039477	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149039477delT	uc002twm.3	+							NM_018328	NP_060798			methyl-CpG binding domain protein 5							chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	149591652	149591653	+	IGR	INS	-	CTTT	CTTT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149591652_149591653insCTTT								EPC2 (46517 upstream) : KIF5C (41166 downstream)																																			---	---	---	---
KIF5C	3800	broad.mit.edu	37	2	149653442	149653445	+	Intron	DEL	CACC	-	-	rs35534052	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149653442_149653445delCACC	uc010zbu.1	+							NM_004522	NP_004513			kinesin family member 5C						microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)														---	---	---	---
LYPD6	130574	broad.mit.edu	37	2	150267818	150267819	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150267818_150267819insT	uc002twy.2	+						LYPD6_uc010fnt.2_Intron|LYPD6_uc002twz.2_Intron|LYPD6_uc002txa.2_Intron	NM_194317	NP_919298			LY6/PLAUR domain containing 6 precursor							extracellular region					0				BRCA - Breast invasive adenocarcinoma(221;0.0667)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	150577487	150577488	+	IGR	DEL	AG	-	-	rs72082917		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:150577487_150577488delAG								MMADHC (133157 upstream) : RND3 (747224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	151820096	151820096	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151820096delC								RND3 (475916 upstream) : RBM43 (284633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	151870275	151870276	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151870275_151870276delCA								RND3 (526095 upstream) : RBM43 (234453 downstream)																																			---	---	---	---
FMNL2	114793	broad.mit.edu	37	2	153394405	153394406	+	Intron	INS	-	AC	AC	rs151210210	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153394405_153394406insAC	uc002tye.2	+							NM_052905	NP_443137			formin-like 2						actin cytoskeleton organization	cytoplasm	actin binding|Rho GTPase binding			central_nervous_system(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	153830084	153830084	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153830084delT								ARL6IP6 (212317 upstream) : RPRM (503768 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	154141955	154141955	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154141955delA								ARL6IP6 (524188 upstream) : RPRM (191897 downstream)																																			---	---	---	---
KCNJ3	3760	broad.mit.edu	37	2	155682858	155682858	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155682858delA	uc002tyv.1	+						KCNJ3_uc010zce.1_Intron	NM_002239	NP_002230			potassium inwardly-rectifying channel J3						synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	157028965	157028965	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157028965delA	uc002tyw.2	-											Homo sapiens cDNA clone IMAGE:5209417.																														---	---	---	---
CYTIP	9595	broad.mit.edu	37	2	158319074	158319074	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158319074delA	uc010zcl.1	-							NM_004288	NP_004279			cytohesin 1 interacting protein						regulation of cell adhesion	cell cortex|early endosome	protein binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	158497275	158497276	+	IGR	DEL	TC	-	-	rs72368708		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158497275_158497276delTC								ACVR1C (11876 upstream) : ACVR1 (95682 downstream)																																			---	---	---	---
CCDC148	130940	broad.mit.edu	37	2	159251126	159251126	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159251126delA	uc002tzq.2	-						CCDC148_uc002tzr.2_Intron|CCDC148_uc010foh.2_Intron|CCDC148_uc010foi.1_Intron|CCDC148_uc010foj.1_Intron|CCDC148_uc010fok.1_Intron|CCDC148_uc002tzs.1_Intron	NM_138803	NP_620158			coiled-coil domain containing 148											ovary(2)	2																		---	---	---	---
TANC1	85461	broad.mit.edu	37	2	160069295	160069295	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160069295delG	uc002uag.2	+						TANC1_uc010zcm.1_Intron|TANC1_uc010fom.1_Intron|TANC1_uc010fon.2_Intron	NM_033394	NP_203752			tetratricopeptide repeat, ankyrin repeat and							cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160254366	160254366	+	Intron	DEL	T	-	-	rs34725967		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160254366delT	uc002uao.2	-						BAZ2B_uc002uap.2_Intron	NM_013450	NP_038478			bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
BAZ2B	29994	broad.mit.edu	37	2	160566501	160566502	+	Intron	INS	-	T	T	rs145626956	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160566501_160566502insT	uc002uau.1	-						uc002uaw.2_Intron|MARCH7_uc002uax.2_5'Flank|MARCH7_uc010foq.2_5'Flank|MARCH7_uc010zcn.1_5'Flank					SubName: Full=Putative uncharacterized protein DKFZp686H10114;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	162135457	162135458	+	IGR	INS	-	TCC	TCC			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162135457_162135458insTCC								TANK (42775 upstream) : PSMD14 (29328 downstream)																																			---	---	---	---
SLC4A10	57282	broad.mit.edu	37	2	162729068	162729068	+	Intron	DEL	A	-	-	rs5835886		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162729068delA	uc002ubx.3	+						SLC4A10_uc010fpa.1_Intron|SLC4A10_uc010zcr.1_Intron|SLC4A10_uc002uby.3_Intron|SLC4A10_uc010zcs.1_Intron	NM_022058	NP_071341			solute carrier family 4, sodium bicarbonate						bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	165705866	165705866	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165705866delA								COBLL1 (7188 upstream) : SLC38A11 (48946 downstream)																																			---	---	---	---
CSRNP3	80034	broad.mit.edu	37	2	166493548	166493548	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166493548delT	uc002udf.2	+						CSRNP3_uc002udg.2_Intron	NM_024969	NP_079245			cysteine-serine-rich nuclear protein 3						apoptosis|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|large_intestine(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	167011570	167011571	+	Intron	DEL	GG	-	-	rs5000306		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167011570_167011571delGG	uc002udp.2	+											Homo sapiens, clone IMAGE:3681561, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	167453670	167453671	+	IGR	INS	-	GG	GG	rs142180832	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167453670_167453671insGG								SCN7A (102953 upstream) : XIRP2 (291326 downstream)																																			---	---	---	---
LRP2	4036	broad.mit.edu	37	2	170074140	170074140	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170074140delG	uc002ues.2	-							NM_004525	NP_004516			low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	171581830	171581831	+	Intron	INS	-	A	A	rs111521986		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171581830_171581831insA	uc002ugf.1	-											Homo sapiens cDNA FLJ13453 fis, clone PLACE1003205.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	171587197	171587197	+	RNA	DEL	A	-	-	rs71399552		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171587197delA	uc002ugf.1	-	4		c.1148delT								Homo sapiens cDNA FLJ13453 fis, clone PLACE1003205.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	172755684	172755689	+	IGR	DEL	CCTCTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172755684_172755689delCCTCTG								SLC25A12 (4871 upstream) : HAT1 (23246 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	173133839	173133840	+	IGR	INS	-	CTTT	CTTT	rs147982277	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173133839_173133840insCTTT								DLX2 (166361 upstream) : ITGA6 (158242 downstream)																																			---	---	---	---
ZAK	51776	broad.mit.edu	37	2	174081238	174081239	+	Intron	INS	-	T	T	rs138775422	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174081238_174081239insT	uc002uhz.2	+						ZAK_uc002uhy.2_Intron|ZAK_uc010zei.1_Intron|ZAK_uc002uia.1_Intron|uc002uib.2_Intron	NM_016653	NP_057737			MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	174387274	174387274	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174387274delT								CDCA7 (153556 upstream) : SP3 (385985 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	174470163	174470163	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174470163delT								CDCA7 (236445 upstream) : SP3 (303096 downstream)																																			---	---	---	---
WIPF1	7456	broad.mit.edu	37	2	175442645	175442646	+	Intron	INS	-	A	A	rs113650894		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175442645_175442646insA	uc002uiy.2	-						uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Intron|WIPF1_uc010fqt.1_Intron|WIPF1_uc002ujc.1_Intron|WIPF1_uc002uiz.2_Intron|WIPF1_uc002ujb.1_Intron|WIPF1_uc010zep.1_Intron	NM_003387	NP_003378			WAS/WASL interacting protein family, member 1						actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	177999680	177999681	+	IGR	INS	-	A	A	rs72470365		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177999680_177999681insA								MIR1246 (533900 upstream) : HNRNPA3 (77741 downstream)																																			---	---	---	---
HNRNPA3	220988	broad.mit.edu	37	2	178087794	178087794	+	3'UTR	DEL	A	-	-	rs1065388		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178087794delA	uc002ulc.1	+	11					HNRNPA3_uc002uld.2_3'UTR|HNRNPA3_uc002ule.2_3'UTR	NM_194247	NP_919223			heterogeneous nuclear ribonucleoprotein A3							catalytic step 2 spliceosome|nucleolus|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(2)	2																		---	---	---	---
PDE11A	50940	broad.mit.edu	37	2	178712718	178712719	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178712718_178712719delTG	uc002ulq.2	-						PDE11A_uc002ulp.2_Intron|PDE11A_uc002ulr.2_Intron|PDE11A_uc002uls.1_Intron|PDE11A_uc002ult.1_Intron|PDE11A_uc002ulu.1_Intron	NM_016953	NP_058649			phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)											Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				---	---	---	---
OSBPL6	114880	broad.mit.edu	37	2	179091165	179091165	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179091165delG	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron	NM_032523	NP_115912			oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)															---	---	---	---
OSBPL6	114880	broad.mit.edu	37	2	179244038	179244039	+	Intron	INS	-	AGGA	AGGA	rs141753997	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179244038_179244039insAGGA	uc002ulx.2	+						OSBPL6_uc002ulw.2_Intron|OSBPL6_uc002uly.2_Intron|OSBPL6_uc010zfe.1_Intron|OSBPL6_uc002ulz.2_Intron|OSBPL6_uc002uma.2_Intron	NM_032523	NP_115912			oxysterol-binding protein-like protein 6 isoform						lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)															---	---	---	---
TTN	7273	broad.mit.edu	37	2	179625576	179625577	+	Intron	DEL	GT	-	-	rs146296588		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179625576_179625577delGT	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc002unb.2_Intron	NM_133378	NP_596869			titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
SESTD1	91404	broad.mit.edu	37	2	180113247	180113248	+	Intron	INS	-	AA	AA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180113247_180113248insAA	uc002uni.3	-							NM_178123	NP_835224			SEC14 and spectrin domains 1						regulation of calcium ion transport via voltage-gated calcium channel activity		phosphatidic acid binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylinositol-4-phosphate binding|phosphatidylinositol-5-phosphate binding|protein binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)															---	---	---	---
ZNF385B	151126	broad.mit.edu	37	2	180313344	180313344	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180313344delA	uc002unn.3	-						ZNF385B_uc002unj.2_Intron|ZNF385B_uc002unk.2_Intron|ZNF385B_uc002unl.2_Intron|ZNF385B_uc002unm.2_Intron	NM_152520	NP_689733			zinc finger protein 385B isoform 1							nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)															---	---	---	---
ZNF385B	151126	broad.mit.edu	37	2	180339548	180339548	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180339548delG	uc002unn.3	-						ZNF385B_uc002unj.2_Intron|ZNF385B_uc002unk.2_Intron|ZNF385B_uc002unl.2_Intron|ZNF385B_uc002unm.2_Intron	NM_152520	NP_689733			zinc finger protein 385B isoform 1							nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	181596176	181596194	+	IGR	DEL	GAAAGCAGAGAGAAAGCGA	-	-	rs2113783		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181596176_181596194delGAAAGCAGAGAGAAAGCGA								CWC22 (724336 upstream) : UBE2E3 (248918 downstream)																																			---	---	---	---
PPP1R1C	151242	broad.mit.edu	37	2	182818991	182818994	+	RNA	DEL	CACA	-	-	rs71842804		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182818991_182818994delCACA	uc002uon.2	+	1		c.24_27delCACA								Homo sapiens protein phosphatase 1 regulatory subunit 1A mRNA, complete cds.						signal transduction	cytoplasm	protein phosphatase inhibitor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0628)													OREG0015111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PDE1A	5136	broad.mit.edu	37	2	183258110	183258110	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183258110delT	uc002uos.2	-						PDE1A_uc010zfp.1_Intron|PDE1A_uc002uoq.1_Intron|PDE1A_uc010zfq.1_Intron|PDE1A_uc002uor.2_Intron|PDE1A_uc002uov.1_Intron	NM_001003683	NP_001003683			phosphodiesterase 1A isoform 2						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)															---	---	---	---
DNAJC10	54431	broad.mit.edu	37	2	183624165	183624165	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183624165delT	uc002uow.1	+						DNAJC10_uc002uox.1_Intron|DNAJC10_uc002uoy.1_Intron|DNAJC10_uc002uoz.1_Intron|DNAJC10_uc010fro.1_Intron	NM_018981	NP_061854			DnaJ (Hsp40) homolog, subfamily C, member 10						apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding			ovary(1)|large_intestine(1)|breast(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	184434498	184434499	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:184434498_184434499insT								NUP35 (408091 upstream) : None (None downstream)																																			---	---	---	---
ZNF804A	91752	broad.mit.edu	37	2	185796250	185796250	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185796250delG	uc002uph.2	+							NM_194250	NP_919226			zinc finger protein 804A							intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	188872284	188872285	+	IGR	INS	-	ACACACAC	ACACACAC	rs143985976	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188872284_188872285insACACACAC								TFPI (453065 upstream) : GULP1 (284319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	189084062	189084062	+	IGR	DEL	T	-	-	rs113819371		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189084062delT								TFPI (664843 upstream) : GULP1 (72542 downstream)																																			---	---	---	---
GULP1	51454	broad.mit.edu	37	2	189409809	189409809	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189409809delT	uc010fru.2	+						GULP1_uc002uqd.2_Intron|GULP1_uc010zfw.1_Intron|GULP1_uc002uqf.2_Intron|GULP1_uc002uqg.2_Intron	NM_016315	NP_057399			GULP, engulfment adaptor PTB domain containing						apoptosis|lipid transport|phagocytosis, engulfment	cytoplasm|intracellular membrane-bounded organelle	signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0423)|Epithelial(96;0.158)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	190127098	190127099	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190127098_190127099delCA								COL5A2 (82493 upstream) : WDR75 (179060 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	190903684	190903685	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190903684_190903685insT								PMS1 (161330 upstream) : MSTN (16742 downstream)																																			---	---	---	---
STAT4	6775	broad.mit.edu	37	2	191926873	191926873	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191926873delT	uc002usm.1	-						STAT4_uc002usn.1_Intron|STAT4_uc010zgk.1_Intron|STAT4_uc002uso.2_Intron	NM_003151	NP_003142			signal transducer and activator of transcription						JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)															---	---	---	---
STAT4	6775	broad.mit.edu	37	2	191941180	191941180	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191941180delC	uc002usm.1	-						STAT4_uc002usn.1_Intron|STAT4_uc002uso.2_Intron|STAT4_uc002usp.3_Intron	NM_003151	NP_003142			signal transducer and activator of transcription						JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	193289570	193289571	+	IGR	INS	-	T	T	rs56825961		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193289570_193289571insT								TMEFF2 (229926 upstream) : PCGEM1 (325000 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	193559379	193559380	+	IGR	INS	-	GG	GG	rs145559595	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193559379_193559380insGG								TMEFF2 (499735 upstream) : PCGEM1 (55191 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	195552936	195552937	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195552936_195552937delAC								None (None upstream) : SLC39A10 (968595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	199202033	199202033	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:199202033delA	uc002uux.1	-											Homo sapiens cDNA FLJ39180 fis, clone OCBBF2004168.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	200457940	200457941	+	IGR	INS	-	A	A	rs35461661		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200457940_200457941insA								FLJ32063 (116282 upstream) : C2orf69 (318038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	200633298	200633298	+	Intron	DEL	T	-	-	rs36028250		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200633298delT	uc002uvg.2	-											Homo sapiens hypothetical protein LOC348751, mRNA (cDNA clone IMAGE:5311172).																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	200730874	200730881	+	IGR	DEL	TTTGTTTG	-	-	rs72344244		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200730874_200730881delTTTGTTTG								FLJ32063 (389216 upstream) : C2orf69 (45098 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	201161638	201161639	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201161638_201161639delCA								C2orf47 (332793 upstream) : SPATS2L (8965 downstream)																																			---	---	---	---
SPATS2L	26010	broad.mit.edu	37	2	201173348	201173349	+	Intron	DEL	AC	-	-	rs72185003		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201173348_201173349delAC	uc002uvn.3	+						SPATS2L_uc010fst.2_Intron|SPATS2L_uc002uvo.3_Intron|SPATS2L_uc002uvp.3_Intron|SPATS2L_uc002uvq.3_Intron|SPATS2L_uc002uvr.3_Intron|SPATS2L_uc010zhc.1_5'Flank	NM_015535	NP_056350			SPATS2-like protein isoform a							cytoplasm|nucleolus				ovary(2)|pancreas(1)	3																		---	---	---	---
AOX1	316	broad.mit.edu	37	2	201493630	201493631	+	Intron	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201493630_201493631insC	uc002uvx.2	+						AOX1_uc010zhf.1_Intron|AOX1_uc010fsu.2_Intron	NM_001159	NP_001150			aldehyde oxidase 1						inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)													---	---	---	---
FAM126B	285172	broad.mit.edu	37	2	201845746	201845746	+	3'UTR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201845746delA	uc002uws.3	-	12					FAM126B_uc002uwu.2_3'UTR|FAM126B_uc002uwv.2_3'UTR	NM_173822	NP_776183			hypothetical protein LOC285172							intracellular				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	201969410	201969411	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201969410_201969411insT								NDUFB3 (18939 upstream) : CFLAR (11405 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	201973423	201973424	+	IGR	DEL	TT	-	-	rs72931008	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201973423_201973424delTT								NDUFB3 (22952 upstream) : CFLAR (7392 downstream)																																			---	---	---	---
CASP8	841	broad.mit.edu	37	2	202110587	202110588	+	Intron	INS	-	TTT	TTT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202110587_202110588insTTT	uc002uxr.1	+						CASP8_uc010ftc.1_Intron|CASP8_uc002uxo.1_Intron|CASP8_uc002uxp.1_Intron|CASP8_uc002uxq.1_Intron	NM_033355	NP_203519			caspase 8 isoform B precursor						activation of caspase activity|activation of pro-apoptotic gene products|cellular component disassembly involved in apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|induction of apoptosis by intracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis involved in cellular protein catabolic process|response to tumor necrosis factor	centrosome|cytosol|mitochondrial outer membrane	cysteine-type endopeptidase activity|protein binding|protein binding			upper_aerodigestive_tract(2)|ovary(1)|breast(1)|skin(1)	5															HNSCC(4;0.00038)			---	---	---	---
Unknown	0	broad.mit.edu	37	2	203047165	203047166	+	Intron	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203047165_203047166delTC	uc002uyy.1	+											RecName: Full=Uncharacterized protein KIAA2012;																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	203122317	203122318	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203122317_203122318insT								SUMO1 (18995 upstream) : NOP58 (8197 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	203439063	203439063	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203439063delT								BMPR2 (6590 upstream) : FAM117B (60838 downstream)																																			---	---	---	---
NBEAL1	65065	broad.mit.edu	37	2	204017075	204017076	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204017075_204017076insA	uc002uzt.3	+						NBEAL1_uc002uzs.3_Intron	NM_001114132	NP_001107604			neurobeachin-like 1 isoform 3								binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	204518488	204518488	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204518488delA								RAPH1 (118430 upstream) : CD28 (52710 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	204644150	204644150	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204644150delT								CD28 (41594 upstream) : CTLA4 (88359 downstream)																																			---	---	---	---
DYTN	391475	broad.mit.edu	37	2	207533390	207533390	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207533390delC	uc002vbr.1	-							NM_001093730	NP_001087199			dystrotelin							plasma membrane	zinc ion binding			ovary(1)|central_nervous_system(1)	2				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)														---	---	---	---
KLF7	8609	broad.mit.edu	37	2	207966850	207966851	+	Intron	DEL	TC	-	-	rs56843018		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207966850_207966851delTC	uc002vbz.1	-						KLF7_uc002vca.1_Intron|KLF7_uc010zix.1_Intron	NM_003709	NP_003700			Kruppel-like factor 7 (ubiquitous)						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			central_nervous_system(1)|skin(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	208288281	208288290	+	IGR	DEL	GTGTGTGTGA	-	-	rs59733742	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208288281_208288290delGTGTGTGTGA								MIR1302-4 (154133 upstream) : CREB1 (106326 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	208375704	208375705	+	IGR	DEL	TC	-	-	rs71963336		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208375704_208375705delTC								MIR1302-4 (241556 upstream) : CREB1 (18911 downstream)																																			---	---	---	---
PIKFYVE	200576	broad.mit.edu	37	2	209187178	209187179	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209187178_209187179insT	uc002vcz.2	+						PIKFYVE_uc010fun.1_Intron|PIKFYVE_uc002vcy.1_Intron	NM_015040	NP_055855			phosphatidylinositol-3-phosphate 5-kinase type						cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10																		---	---	---	---
PTH2R	5746	broad.mit.edu	37	2	209492362	209492362	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209492362delT	uc010fuo.1	+											Homo sapiens cDNA FLJ60238 complete cds, highly similar to Parathyroid hormone receptor precursor.							integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	209992185	209992186	+	IGR	INS	-	AT	AT	rs139926400	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209992185_209992186insAT								PTH2R (287367 upstream) : MAP2 (296585 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	210214480	210214481	+	IGR	INS	-	TAT	TAT	rs144378295	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210214480_210214481insTAT								PTH2R (509662 upstream) : MAP2 (74290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	211292582	211292582	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211292582delG								MYL1 (112687 upstream) : LANCL1 (3392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	212192857	212192857	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212192857delT								CPS1 (649028 upstream) : ERBB4 (47585 downstream)																																			---	---	---	---
ERBB4	2066	broad.mit.edu	37	2	212278033	212278034	+	Intron	INS	-	AA	AA	rs36108369		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212278033_212278034insAA	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron	NM_005235	NP_005226			v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)											TSP Lung(8;0.080)			---	---	---	---
ERBB4	2066	broad.mit.edu	37	2	212705624	212705624	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212705624delG	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Intron	NM_005235	NP_005226			v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)											TSP Lung(8;0.080)			---	---	---	---
ERBB4	2066	broad.mit.edu	37	2	213004014	213004015	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213004014_213004015delAC	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Intron	NM_005235	NP_005226			v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)											TSP Lung(8;0.080)			---	---	---	---
ERBB4	2066	broad.mit.edu	37	2	213304223	213304224	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213304223_213304224insA	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Intron	NM_005235	NP_005226			v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)											TSP Lung(8;0.080)			---	---	---	---
SPAG16	79582	broad.mit.edu	37	2	214778201	214778202	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214778201_214778202delTG	uc002veq.2	+						SPAG16_uc010fuz.1_Intron|SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808			sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)														---	---	---	---
VWC2L	402117	broad.mit.edu	37	2	215434047	215434048	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215434047_215434048delAC	uc002vet.2	+						VWC2L_uc010zjl.1_Intron	NM_001080500	NP_001073969			von Willebrand factor C domain-containing							extracellular region					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	216144639	216144654	+	IGR	DEL	GGAGGGAAGGAAGGAG	-	-	rs139605262	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216144639_216144654delGGAGGGAAGGAAGGAG								ABCA12 (141488 upstream) : ATIC (32038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	216542563	216542564	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216542563_216542564delTG	uc002vfm.1	-						uc002vfn.1_Intron					Homo sapiens cDNA FLJ34546 fis, clone HLUNG2008959.																														---	---	---	---
Unknown	0	broad.mit.edu	37	2	216691411	216691411	+	Intron	DEL	A	-	-	rs34239786		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216691411delA	uc002vfm.1	-						uc002vfn.1_Intron					Homo sapiens cDNA FLJ34546 fis, clone HLUNG2008959.																														---	---	---	---
XRCC5	7520	broad.mit.edu	37	2	216984251	216984251	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216984251delT	uc002vfy.2	+						XRCC5_uc002vfz.2_Intron	NM_021141	NP_066964			ATP-dependent DNA helicase II						double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|provirus integration|telomere maintenance|transcription, DNA-dependent	Ku70:Ku80 complex|nonhomologous end joining complex|nuclear telomere cap complex|nucleoplasm	ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|telomeric DNA binding|transcription regulatory region DNA binding			lung(1)|kidney(1)	2		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)									Direct_reversal_of_damage|NHEJ					---	---	---	---
MARCH4	57574	broad.mit.edu	37	2	217208967	217208968	+	Intron	INS	-	AAAC	AAAC	rs141748360	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217208967_217208968insAAAC	uc002vgb.2	-							NM_020814	NP_065865			membrane-associated ring finger (C3HC4) 4							Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)														---	---	---	---
NHEJ1	79840	broad.mit.edu	37	2	220022695	220022696	+	Intron	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220022695_220022696delTC	uc002vjp.3	-						NHEJ1_uc002vjq.3_Intron	NM_024782	NP_079058			nonhomologous end-joining factor 1						B cell differentiation|central nervous system development|DNA recombination|double-strand break repair via nonhomologous end joining|positive regulation of ligase activity|response to ionizing radiation|T cell differentiation	nonhomologous end joining complex|nucleus	DNA binding|identical protein binding			lung(1)	1		Renal(207;0.0915)		Epithelial(149;2.15e-06)|all cancers(144;0.000339)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0112)									Direct_reversal_of_damage|NHEJ					---	---	---	---
PTPRN	5798	broad.mit.edu	37	2	220160698	220160699	+	Intron	DEL	AC	-	-	rs112910848		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220160698_220160699delAC	uc002vkz.2	-						PTPRN_uc010zlc.1_Intron|PTPRN_uc002vla.2_Intron|uc010zld.1_5'Flank|MIR153-1_hsa-mir-153-1|MI0000463_5'Flank	NM_002846	NP_002837			protein tyrosine phosphatase, receptor type, N						response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	222605210	222605211	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222605210_222605211insA								EPHA4 (166288 upstream) : PAX3 (459396 downstream)																																			---	---	---	---
PAX3	5077	broad.mit.edu	37	2	223094894	223094895	+	Intron	INS	-	AA	AA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223094894_223094895insAA	uc010fwo.2	-						PAX3_uc002vmt.1_Intron|PAX3_uc002vmy.1_Intron|PAX3_uc002vmv.1_Intron|PAX3_uc002vmw.1_Intron|PAX3_uc002vmx.1_Intron	NM_181457	NP_852122			paired box 3 isoform PAX3						apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)				T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						---	---	---	---
AP1S3	130340	broad.mit.edu	37	2	224697956	224697957	+	Intron	INS	-	AAAT	AAAT	rs144135099	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224697956_224697957insAAAT	uc010fwx.1	-						AP1S3_uc002vnn.2_Intron|AP1S3_uc010fww.2_Intron|AP1S3_uc002vno.2_Intron	NM_001039569	NP_001034658			adaptor-related protein complex 1, sigma 3						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane coat	protein transporter activity				0		Renal(207;0.0112)|Lung NSC(271;0.0186)|all_lung(227;0.0272)		Epithelial(121;7.6e-10)|all cancers(144;3.62e-07)|Lung(261;0.0086)|LUSC - Lung squamous cell carcinoma(224;0.00902)														---	---	---	---
SERPINE2	5270	broad.mit.edu	37	2	224874411	224874412	+	Intron	INS	-	A	A	rs141729141	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224874411_224874412insA	uc002vnu.2	-						SERPINE2_uc002vnt.2_Intron|SERPINE2_uc010zlr.1_Intron|SERPINE2_uc002vnv.2_Intron	NM_006216	NP_006207			plasminogen activator inhibitor type 1, member 2						negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	225299931	225299935	+	IGR	DEL	TGTTT	-	-	rs72268158		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225299931_225299935delTGTTT								FAM124B (33220 upstream) : CUL3 (34934 downstream)																																			---	---	---	---
DOCK10	55619	broad.mit.edu	37	2	225647990	225647991	+	Intron	INS	-	T	T	rs113069373		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225647990_225647991insT	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron	NM_014689	NP_055504			dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	226647262	226647289	+	IGR	DEL	CCTCCCTCCCTTCCTCCCTCCCTCCCTT	-	-	rs72963840		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226647262_226647289delCCTCCCTCCCTTCCTCCCTCCCTCCCTT								KIAA1486 (51791 upstream) : IRS1 (948745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	227082622	227082623	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227082622_227082623insT								KIAA1486 (487151 upstream) : IRS1 (513411 downstream)																																			---	---	---	---
RHBDD1	84236	broad.mit.edu	37	2	227799296	227799296	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227799296delC	uc002voi.2	+						RHBDD1_uc010fxc.2_Intron|RHBDD1_uc002voj.2_Intron	NM_032276	NP_115652			rhomboid domain containing 1							integral to membrane	serine-type endopeptidase activity			ovary(1)	1		Renal(207;0.023)|all_lung(227;0.13)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;1.47e-11)|all cancers(144;1.52e-08)|Lung(261;0.0128)|LUSC - Lung squamous cell carcinoma(224;0.0175)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	228297163	228297163	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228297163delT								TM4SF20 (53141 upstream) : AGFG1 (39725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	228540327	228540328	+	IGR	INS	-	CAAACAAA	CAAACAAA	rs142886674	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228540327_228540328insCAAACAAA								C2orf83 (42291 upstream) : SLC19A3 (9599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	229329139	229329140	+	IGR	DEL	GT	-	-	rs34721776		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229329139_229329140delGT								SPHKAP (282778 upstream) : PID1 (559550 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	229633921	229633923	+	IGR	DEL	CTT	-	-	rs146404554		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229633921_229633923delCTT								SPHKAP (587560 upstream) : PID1 (254767 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	229785128	229785128	+	IGR	DEL	A	-	-	rs111521664		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229785128delA								SPHKAP (738767 upstream) : PID1 (103562 downstream)																																			---	---	---	---
PID1	55022	broad.mit.edu	37	2	229963586	229963586	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229963586delT	uc002vpr.3	-						PID1_uc002vps.3_Intron|PID1_uc002vpt.3_Intron|PID1_uc002vpu.3_Intron	NM_001100818	NP_001094288			phosphotyrosine interaction domain containing 1							cytoplasm				breast(3)|skin(1)	4		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	232445309	232445311	+	IGR	DEL	GGA	-	-	rs111897916		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232445309_232445311delGGA								NMUR1 (50127 upstream) : C2orf57 (12301 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	232513152	232513153	+	IGR	INS	-	A	A	rs139210814		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232513152_232513153insA								C2orf57 (54160 upstream) : PTMA (60082 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	232779512	232779515	+	IGR	DEL	CACC	-	-	rs72149301		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232779512_232779515delCACC								MIR1471 (22504 upstream) : NPPC (10620 downstream)																																			---	---	---	---
EFHD1	80303	broad.mit.edu	37	2	233502053	233502054	+	Intron	INS	-	T	T	rs5839444		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233502053_233502054insT	uc002vtc.2	+						EFHD1_uc010fyf.2_Intron	NM_025202	NP_079478			EF-hand domain family, member D1								calcium ion binding|protein binding				0		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Breast(86;0.0199)|Renal(207;0.025)		Epithelial(121;2.08e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00825)|Lung(119;0.0101)														---	---	---	---
GIGYF2	26058	broad.mit.edu	37	2	233652137	233652138	+	Intron	INS	-	G	G	rs137940131	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233652137_233652138insG	uc002vti.3	+						GIGYF2_uc010zmj.1_Intron|GIGYF2_uc002vtg.2_Intron|GIGYF2_uc002vtj.3_Intron|GIGYF2_uc002vtk.3_Intron|GIGYF2_uc002vth.3_Intron|GIGYF2_uc010zmk.1_Intron|GIGYF2_uc010zml.1_Intron	NM_015575	NP_056390			GRB10 interacting GYF protein 2 isoform b						cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)														---	---	---	---
TRPM8	79054	broad.mit.edu	37	2	234884525	234884526	+	Intron	INS	-	AAACA	AAACA	rs149554135	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234884525_234884526insAAACA	uc002vvh.2	+						TRPM8_uc010fyj.2_Intron	NM_024080	NP_076985			transient receptor potential cation channel,							integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)													---	---	---	---
TRPM8	79054	broad.mit.edu	37	2	234886842	234886843	+	Intron	INS	-	GT	GT	rs138727890	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234886842_234886843insGT	uc002vvh.2	+						TRPM8_uc010fyj.2_Intron	NM_024080	NP_076985			transient receptor potential cation channel,							integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	235154817	235154817	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235154817delA								SPP2 (169041 upstream) : ARL4C (246871 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	235162901	235162902	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235162901_235162902delCA								SPP2 (177125 upstream) : ARL4C (238786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	235330389	235330389	+	IGR	DEL	T	-	-	rs34004623		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235330389delT								SPP2 (344613 upstream) : ARL4C (71299 downstream)																																			---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236422807	236422808	+	Intron	DEL	CA	-	-	rs112677932		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236422807_236422808delCA	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
AGAP1	116987	broad.mit.edu	37	2	236907950	236907952	+	Intron	DEL	TGA	-	-	rs75277673		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236907950_236907952delTGA	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208			centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
ASB18	401036	broad.mit.edu	37	2	237130316	237130316	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237130316delA	uc010znh.1	-							NM_212556	NP_997721			ankyrin repeat and SOCS box-containing 18						intracellular signal transduction					ovary(1)	1		all_hematologic(139;0.00615)|Renal(207;0.00963)|Breast(86;0.0126)|Acute lymphoblastic leukemia(138;0.0815)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)|GBM - Glioblastoma multiforme(43;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	238039711	238039712	+	IGR	DEL	TG	-	-	rs144613674		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238039711_238039712delTG								COPS8 (32224 upstream) : COL6A3 (192943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	238040582	238040582	+	IGR	DEL	T	-	-	rs11340333		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238040582delT								COPS8 (33095 upstream) : COL6A3 (192073 downstream)																																			---	---	---	---
ESPNL	339768	broad.mit.edu	37	2	239034408	239034409	+	Intron	INS	-	TGGAG	TGGAG	rs72394021		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239034408_239034409insTGGAG	uc002vxq.3	+						ESPNL_uc010fyw.2_Intron	NM_194312	NP_919288			espin-like											pancreas(1)	1		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)														---	---	---	---
ASB1	51665	broad.mit.edu	37	2	239339485	239339485	+	Intron	DEL	T	-	-	rs36119506		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239339485delT	uc002vyg.2	+							NM_001040445	NP_001035535			ankyrin repeat and SOCS box-containing protein						intracellular signal transduction|negative regulation of cytokine biosynthetic process						0		all_epithelial(40;2.65e-14)|Breast(86;7.61e-05)|Renal(207;0.00183)|all_lung(227;0.0283)|Ovarian(221;0.0365)|Lung NSC(271;0.0941)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	239675873	239675873	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239675873delG								ASB1 (314983 upstream) : TWIST2 (80800 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	239687579	239687580	+	IGR	INS	-	A	A	rs140255769	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239687579_239687580insA								ASB1 (326689 upstream) : TWIST2 (69093 downstream)																																			---	---	---	---
HDAC4	9759	broad.mit.edu	37	2	240006162	240006163	+	Intron	DEL	CA	-	-	rs112444527		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240006162_240006163delCA	uc002vyk.3	-						HDAC4_uc010fyy.2_Intron	NM_006037	NP_006028			histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)														---	---	---	---
Unknown	0	broad.mit.edu	37	2	241138159	241138168	+	IGR	DEL	CACTGTCCAT	-	-	rs72133392		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241138159_241138168delCACTGTCCAT								OTOS (58086 upstream) : GPC1 (236947 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	241244842	241244842	+	IGR	DEL	A	-	-	rs79726289		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241244842delA								OTOS (164769 upstream) : GPC1 (130273 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	241606446	241606447	+	IGR	INS	-	T	T	rs149585654	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241606446_241606447insT								GPR35 (35771 upstream) : AQP12B (9389 downstream)																																			---	---	---	---
AGXT	189	broad.mit.edu	37	2	241813191	241813191	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241813191delA	uc002waa.3	+							NM_000030	NP_000021			alanine-glyoxylate aminotransferase						glyoxylate metabolic process|protein targeting to peroxisome	mitochondrial matrix|peroxisomal matrix	alanine-glyoxylate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|serine-pyruvate transaminase activity				0		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)													---	---	---	---
Unknown	0	broad.mit.edu	37	2	242807876	242807876	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242807876delG								PDCD1 (6818 upstream) : C2orf85 (4010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	242830998	242830999	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242830998_242830999insA								C2orf85 (15516 upstream) : LOC728323 (199845 downstream)																																			---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2149867	2149868	+	Intron	INS	-	C	C	rs55760208		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2149867_2149868insC	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2474498	2474499	+	Intron	INS	-	T	T	rs5846183		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2474498_2474499insT	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
CNTN4	152330	broad.mit.edu	37	3	2978612	2978613	+	Intron	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2978612_2978613insG	uc003bpc.2	+						CNTN4_uc003bpb.1_Intron|CNTN4_uc003bpd.1_Intron|CNTN4_uc003bpe.2_Intron|CNTN4_uc003bpf.2_Intron	NM_175607	NP_783200			contactin 4 isoform a precursor						axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	3400813	3400814	+	IGR	INS	-	T	T	rs145624685	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3400813_3400814insT								CRBN (179423 upstream) : SUMF1 (422222 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	6283152	6283152	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:6283152delA								None (None upstream) : GRM7 (619650 downstream)																																			---	---	---	---
SRGAP3	9901	broad.mit.edu	37	3	9164393	9164393	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9164393delA	uc003brf.1	-						SRGAP3_uc003brg.1_Intron|SRGAP3_uc003bri.1_Intron|SRGAP3_uc003brk.2_Intron	NM_014850	NP_055665			SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---
Unknown	0	broad.mit.edu	37	3	10782827	10782832	+	IGR	DEL	ATCATA	-	-	rs149879419	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10782827_10782832delATCATA								ATP2B2 (33111 upstream) : LOC285370 (18337 downstream)																																			---	---	---	---
HACL1	26061	broad.mit.edu	37	3	15613336	15613336	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15613336delC	uc003caf.2	-						HACL1_uc011avr.1_Intron|HACL1_uc011avs.1_Intron|HACL1_uc011avt.1_Intron|HACL1_uc003cag.2_Intron|HACL1_uc011avu.1_Intron|HACL1_uc010hep.2_Intron	NM_012260	NP_036392			2-hydroxyphytanoyl-CoA lyase						fatty acid alpha-oxidation	peroxisomal matrix	carbon-carbon lyase activity|identical protein binding|magnesium ion binding|thiamine pyrophosphate binding				0																		---	---	---	---
PLCL2	23228	broad.mit.edu	37	3	17100871	17100871	+	Intron	DEL	A	-	-	rs72066505		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17100871delA	uc011awc.1	+						PLCL2_uc011awd.1_Intron	NM_001144382	NP_001137854			phospholipase C-like 2 isoform 1						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4																		---	---	---	---
TBC1D5	9779	broad.mit.edu	37	3	17216080	17216081	+	Intron	INS	-	TTG	TTG	rs147351562	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17216080_17216081insTTG	uc003cbf.2	-						TBC1D5_uc010heu.2_Intron|TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron	NM_014744	NP_055559			TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	22929957	22929958	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:22929957_22929958insA								ZNF385D (515834 upstream) : UBE2E2 (314695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	23767914	23767915	+	IGR	INS	-	AAGAGAGA	AAGAGAGA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:23767914_23767915insAAGAGAGA								UBE2E2 (135618 upstream) : UBE2E1 (79524 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	24564308	24564308	+	IGR	DEL	G	-	-	rs76783435		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24564308delG								THRB (27855 upstream) : RARB (651515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	24941415	24941416	+	IGR	INS	-	T	T	rs141171634	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24941415_24941416insT								THRB (404962 upstream) : RARB (274407 downstream)																																			---	---	---	---
RARB	5915	broad.mit.edu	37	3	25269716	25269717	+	Intron	INS	-	G	G	rs55988825		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25269716_25269717insG	uc011awl.1	+							NM_016152	NP_057236			retinoic acid receptor, beta isoform 2						embryonic digestive tract development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	protein binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|large_intestine(1)|pancreas(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tamibarotene(DB04942)|Tazarotene(DB00799)													---	---	---	---
ZCWPW2	152098	broad.mit.edu	37	3	28458549	28458549	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28458549delT	uc003ceh.2	+						ZCWPW2_uc003cei.2_Intron	NM_001040432	NP_001035522			zinc finger, CW type with PWWP domain 2								zinc ion binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	28750233	28750234	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28750233_28750234insT								ZCWPW2 (183603 upstream) : RBMS3 (572709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	34175213	34175213	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:34175213delA								PDCD6IP (264019 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	35595699	35595699	+	IGR	DEL	G	-	-	rs35321007		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35595699delG								None (None upstream) : ARPP21 (85382 downstream)																																			---	---	---	---
LRRFIP2	9209	broad.mit.edu	37	3	37127047	37127047	+	Intron	DEL	A	-	-	rs79397684		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37127047delA	uc003cgp.2	-						LRRFIP2_uc011ayf.1_Intron|LRRFIP2_uc003cgr.2_Intron|LRRFIP2_uc003cgs.3_Intron|LRRFIP2_uc003cgt.3_Intron	NM_006309	NP_006300			leucine rich repeat (in FLII) interacting						Wnt receptor signaling pathway		LRR domain binding			ovary(1)	1																		---	---	---	---
ITGA9	3680	broad.mit.edu	37	3	37670986	37670990	+	Intron	DEL	ATAAA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37670986_37670990delATAAA	uc003chd.2	+						ITGA9_uc003chc.2_3'UTR	NM_002207	NP_002198			integrin, alpha 9 precursor						axon guidance|cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			breast(3)|pancreas(1)|lung(1)|skin(1)	6				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	38587309	38587309	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38587309delG								EXOG (19513 upstream) : SCN5A (2245 downstream)																																			---	---	---	---
SCN5A	6331	broad.mit.edu	37	3	38603496	38603508	+	Intron	DEL	GGGCACACAGAGT	-	-	rs111313242		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38603496_38603508delGGGCACACAGAGT	uc003cio.2	-						SCN5A_uc003cin.2_Intron|SCN5A_uc003cil.3_Intron|SCN5A_uc010hhi.2_Intron|SCN5A_uc010hhk.2_Intron|SCN5A_uc011ayr.1_Intron|SCN5A_uc010hhj.1_Intron	NM_198056	NP_932173			voltage-gated sodium channel type V alpha						blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)													---	---	---	---
SCN5A	6331	broad.mit.edu	37	3	38687720	38687720	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38687720delT	uc003cio.2	-						SCN5A_uc003cin.2_Intron|SCN5A_uc003cil.3_Intron|SCN5A_uc010hhi.2_Intron|SCN5A_uc010hhk.2_Intron|SCN5A_uc011ayr.1_Intron	NM_198056	NP_932173			voltage-gated sodium channel type V alpha						blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)													---	---	---	---
SCN10A	6336	broad.mit.edu	37	3	38797793	38797793	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38797793delA	uc003ciq.2	-							NM_006514	NP_006505			sodium channel, voltage-gated, type X, alpha						sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	38859365	38859365	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38859365delT								SCN10A (23864 upstream) : SCN11A (27895 downstream)																																			---	---	---	---
MYRIP	25924	broad.mit.edu	37	3	40140412	40140413	+	Intron	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40140412_40140413delGT	uc003cka.2	+						MYRIP_uc010hhu.2_Intron|MYRIP_uc010hhv.2_Intron|MYRIP_uc010hhw.2_Intron|MYRIP_uc010hhx.1_Intron|MYRIP_uc011ayz.1_5'Flank	NM_015460	NP_056275			myosin VIIA and Rab interacting protein						intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)														---	---	---	---
MYRIP	25924	broad.mit.edu	37	3	40255106	40255107	+	Intron	INS	-	ACACAG	ACACAG	rs143014416	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40255106_40255107insACACAG	uc003cka.2	+						MYRIP_uc010hhu.2_Intron|MYRIP_uc010hhv.2_Intron|MYRIP_uc010hhw.2_Intron|MYRIP_uc011ayz.1_Intron|uc003ckb.2_Intron	NM_015460	NP_056275			myosin VIIA and Rab interacting protein						intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	40508568	40508568	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40508568delA								RPL14 (4710 upstream) : ZNF619 (10065 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	41177912	41177912	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41177912delG								ZNF621 (596869 upstream) : CTNNB1 (58489 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	41227267	41227267	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41227267delT								ZNF621 (646224 upstream) : CTNNB1 (9134 downstream)																																			---	---	---	---
ULK4	54986	broad.mit.edu	37	3	41401778	41401779	+	Intron	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41401778_41401779insG	uc003ckv.3	-							NM_017886	NP_060356			unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	42041513	42041513	+	IGR	DEL	C	-	-	rs1357014	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42041513delC								ULK4 (37853 upstream) : TRAK1 (91233 downstream)																																			---	---	---	---
FAM198A	729085	broad.mit.edu	37	3	43079104	43079105	+	Intron	INS	-	A	A	rs149962411	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43079104_43079105insA	uc003cmp.3	+						FAM198A_uc010hii.2_Intron|FAM198A_uc003cmo.3_Intron|FAM198A_uc010hih.2_Intron	NM_001129908	NP_001123380			hypothetical protein LOC729085							extracellular region					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	43803816	43803818	+	IGR	DEL	AAA	-	-	rs34005124		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43803816_43803818delAAA								ABHD5 (39600 upstream) : MIR138-1 (351886 downstream)																																			---	---	---	---
KIF15	56992	broad.mit.edu	37	3	44820493	44820495	+	Intron	DEL	ACC	-	-	rs60293095		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44820493_44820495delACC	uc003cnx.3	+						KIF15_uc010hiq.2_Intron	NM_020242	NP_064627			kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)														---	---	---	---
CDCP1	64866	broad.mit.edu	37	3	45167743	45167744	+	Intron	INS	-	TC	TC	rs140448669	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45167743_45167744insTC	uc003com.2	-						CDCP1_uc003con.2_Intron	NM_022842	NP_073753			CUB domain-containing protein 1 isoform 1							extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	46079522	46079523	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46079522_46079523insT								XCR1 (10543 upstream) : CCR3 (125573 downstream)																																			---	---	---	---
FBXW12	285231	broad.mit.edu	37	3	48432831	48432832	+	Intron	DEL	AT	-	-	rs58522667		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48432831_48432832delAT	uc003csr.2	+						FBXW12_uc010hjv.2_Intron|FBXW12_uc003css.2_Intron|FBXW12_uc010hjw.2_Intron	NM_207102	NP_996985			F-box and WD repeat domain containing 12 isoform												0				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---
SLC25A20	788	broad.mit.edu	37	3	48921791	48921792	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48921791_48921792insT	uc003cva.3	-						SLC25A20_uc011bbw.1_Intron|SLC25A20_uc010hkj.2_Intron	NM_000387	NP_000378			carnitine/acylcarnitine translocase						carnitine shuttle|cellular lipid metabolic process|regulation of fatty acid oxidation	integral to membrane|mitochondrial inner membrane	acyl carnitine transporter activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000168)|Kidney(197;0.00231)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	L-Carnitine(DB00583)													---	---	---	---
ITIH3	3699	broad.mit.edu	37	3	52836109	52836110	+	Intron	INS	-	T	T	rs34338052		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52836109_52836110insT	uc003dfv.2	+						ITIH3_uc011bek.1_Intron	NM_002217	NP_002208			inter-alpha (globulin) inhibitor H3						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)														---	---	---	---
MUSTN1	389125	broad.mit.edu	37	3	52866685	52866685	+	Intron	DEL	T	-	-	rs11313924		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52866685delT	uc010hmq.1	-						ITIH4_uc011bem.1_5'Flank|ITIH4_uc011ben.1_5'Flank|ITIH4_uc003dfz.2_5'Flank|ITIH4_uc010hmp.1_5'Flank					Homo sapiens mRNA for hypothetical protein (ORF1), clone 03708.												0				BRCA - Breast invasive adenocarcinoma(193;6.56e-05)|Kidney(197;0.000586)|KIRC - Kidney renal clear cell carcinoma(197;0.000755)|OV - Ovarian serous cystadenocarcinoma(275;0.0471)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	53524884	53524884	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53524884delT								DCP1A (143247 upstream) : CACNA1D (4147 downstream)																																			---	---	---	---
CACNA1D	776	broad.mit.edu	37	3	53530745	53530746	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53530745_53530746insT	uc003dgv.3	+						CACNA1D_uc003dgu.3_Intron|CACNA1D_uc003dgy.3_Intron	NM_001128840	NP_001122312			calcium channel, voltage-dependent, L type,						axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)													---	---	---	---
CACNA2D3	55799	broad.mit.edu	37	3	54889656	54889656	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54889656delA	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868			calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)														---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56139123	56139124	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56139123_56139124insA	uc003dhr.1	-							NM_015576	NP_056391			cytomatrix protein p110							cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
DNAH12	201625	broad.mit.edu	37	3	57484741	57484742	+	Intron	INS	-	ACAAAC	ACAAAC	rs140130720	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57484741_57484742insACAAAC	uc003dit.2	-						DNAH12_uc003diu.2_Intron	NM_178504	NP_848599			dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	59309594	59309595	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59309594_59309595delGT								C3orf67 (273836 upstream) : FHIT (425443 downstream)																																			---	---	---	---
FHIT	2272	broad.mit.edu	37	3	59946305	59946305	+	Intron	DEL	T	-	-	rs34390680		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:59946305delT	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
FHIT	2272	broad.mit.edu	37	3	61205002	61205003	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61205002_61205003delTG	uc003dkx.3	-						FHIT_uc003dky.2_Intron|FHIT_uc010hnn.1_Intron	NM_002012	NP_002003			fragile histidine triad gene						nucleotide metabolic process		bis(5'-adenosyl)-triphosphatase activity|protein binding				0		all_cancers(2;2.37e-314)|all_epithelial(2;5.17e-286)|Colorectal(2;1.24e-68)|all_lung(2;1.31e-45)|Lung NSC(2;1.79e-44)|all_hematologic(2;1.59e-23)|Renal(2;1.03e-13)|Breast(2;1.06e-10)|Esophageal squamous(2;6.31e-09)|Melanoma(2;1.83e-07)|Acute lymphoblastic leukemia(2;5.46e-05)|all_neural(2;0.00118)|Medulloblastoma(2;0.00263)|Hepatocellular(2;0.0245)|Ovarian(2;0.0408)		UCEC - Uterine corpus endometrioid carcinoma (45;0.0887)|Epithelial(1;9.28e-70)|all cancers(1;3.07e-60)|Colorectal(1;2.33e-53)|STAD - Stomach adenocarcinoma(1;7.22e-48)|COAD - Colon adenocarcinoma(3;1.05e-44)|READ - Rectum adenocarcinoma(3;2.41e-08)|KIRC - Kidney renal clear cell carcinoma(10;0.000109)|Kidney(10;0.000125)|Lung(1;0.000161)|LUSC - Lung squamous cell carcinoma(1;0.000742)|OV - Ovarian serous cystadenocarcinoma(275;0.00372)|BRCA - Breast invasive adenocarcinoma(55;0.00448)				T	HMGA2	pleomorphic salivary gland adenoma				Renal_Cell_Cancer_associated_with_constitutional_translocation_of_chromosome_3				---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	61811489	61811490	+	Intron	INS	-	TTG	TTG	rs139646098	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61811489_61811490insTTG	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron	NM_002841	NP_002832			protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
PTPRG	5793	broad.mit.edu	37	3	61988752	61988752	+	Intron	DEL	T	-	-	rs76089158		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61988752delT	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron	NM_002841	NP_002832			protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)														---	---	---	---
CADPS	8618	broad.mit.edu	37	3	62545174	62545174	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62545174delT	uc003dll.2	-						CADPS_uc003dlk.1_Intron|CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707			Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)														---	---	---	---
CADPS	8618	broad.mit.edu	37	3	62693926	62693927	+	Intron	INS	-	AA	AA	rs148595631	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62693926_62693927insAA	uc003dll.2	-						CADPS_uc003dlm.2_Intron|CADPS_uc003dln.2_Intron	NM_003716	NP_003707			Ca2+-dependent secretion activator isoform 1						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)														---	---	---	---
PRICKLE2	166336	broad.mit.edu	37	3	64160117	64160117	+	Intron	DEL	A	-	-	rs55838516		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64160117delA	uc003dmf.2	-							NM_198859	NP_942559			prickle-like 2							cytoplasm|nuclear membrane	zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	64342460	64342461	+	IGR	INS	-	CCA	CCA	rs143617197	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64342460_64342461insCCA								PRICKLE2 (131329 upstream) : ADAMTS9 (158872 downstream)																																			---	---	---	---
ADAMTS9	56999	broad.mit.edu	37	3	64594416	64594417	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64594416_64594417insA	uc003dmg.2	-						ADAMTS9_uc011bfo.1_Intron|ADAMTS9_uc003dmh.1_Intron|ADAMTS9_uc011bfp.1_Intron	NM_182920	NP_891550			ADAM metallopeptidase with thrombospondin type 1						glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	64775230	64775231	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64775230_64775231insA	uc003dml.2	+											Homo sapiens cDNA FLJ25194 fis, clone REC04095.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	66790862	66790862	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66790862delT								LRIG1 (240017 upstream) : KBTBD8 (257865 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	66885911	66885912	+	IGR	INS	-	T	T	rs141430581	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66885911_66885912insT								LRIG1 (335066 upstream) : KBTBD8 (162815 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	66964579	66964579	+	IGR	DEL	A	-	-	rs71616246		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66964579delA								LRIG1 (413734 upstream) : KBTBD8 (84148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	67085366	67085367	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67085366_67085367delCA								KBTBD8 (23736 upstream) : SUCLG2 (339778 downstream)																																			---	---	---	---
FAM19A1	407738	broad.mit.edu	37	3	68163047	68163047	+	Intron	DEL	G	-	-	rs57805065		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68163047delG	uc003dnd.2	+						FAM19A1_uc003dne.2_Intron|FAM19A1_uc003dng.2_Intron	NM_213609	NP_998774			family with sequence similarity 19 (chemokine							endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	70299560	70299561	+	IGR	DEL	TC	-	-	rs71674617		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70299560_70299561delTC								MITF (282074 upstream) : FOXP1 (705176 downstream)																																			---	---	---	---
EIF4E3	317649	broad.mit.edu	37	3	71735695	71735696	+	Intron	DEL	GT	-	-	rs113620245		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71735695_71735696delGT	uc003dov.3	-						EIF4E3_uc011bgc.1_Intron|EIF4E3_uc003dox.2_Intron|EIF4E3_uc011bgd.1_Intron|EIF4E3_uc010hoc.2_Intron	NM_001134651	NP_001128123			eukaryotic translation initiation factor 4E						regulation of translation	cytoplasm|mRNA cap binding complex	translation initiation factor activity				0		Prostate(10;0.0166)		BRCA - Breast invasive adenocarcinoma(55;2.56e-05)|Epithelial(33;2.9e-05)|Lung(16;9.28e-05)|LUSC - Lung squamous cell carcinoma(21;0.00227)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	72161641	72161641	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72161641delG								PROK2 (327284 upstream) : RYBP (262110 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	72342459	72342460	+	IGR	DEL	AA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72342459_72342460delAA								PROK2 (508102 upstream) : RYBP (81291 downstream)																																			---	---	---	---
PDZRN3	23024	broad.mit.edu	37	3	73501001	73501002	+	Intron	DEL	CA	-	-	rs67864278		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73501001_73501002delCA	uc003dpl.1	-						PDZRN3_uc011bgh.1_Intron|PDZRN3_uc010hoe.1_Intron|PDZRN3_uc011bgg.1_Intron	NM_015009	NP_055824			PDZ domain containing ring finger 3								ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	75874251	75874252	+	IGR	INS	-	A	A	rs143217163	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75874251_75874252insA								ZNF717 (39581 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	75989690	75989693	+	IGR	DEL	TCTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75989690_75989693delTCTG								ZNF717 (155020 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	76829027	76829027	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76829027delT								ZNF717 (994357 upstream) : ROBO2 (260267 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	78218632	78218632	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78218632delC								ROBO2 (521971 upstream) : ROBO1 (427756 downstream)																																			---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78931962	78931963	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78931962_78931963insT	uc003dqe.2	-						ROBO1_uc003dqb.2_Intron|ROBO1_uc003dqc.2_Intron|ROBO1_uc003dqd.2_Intron	NM_002941	NP_002932			roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	79673856	79673856	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:79673856delT	uc003dqe.2	-							NM_002941	NP_002932			roundabout 1 isoform a						activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	80791914	80791915	+	IGR	INS	-	TG	TG	rs113216518		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:80791914_80791915insTG								ROBO1 (974855 upstream) : GBE1 (746935 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	81439712	81439713	+	IGR	INS	-	AGAC	AGAC	rs144290942	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81439712_81439713insAGAC								None (None upstream) : GBE1 (99137 downstream)																																			---	---	---	---
GBE1	2632	broad.mit.edu	37	3	81541828	81541829	+	Intron	INS	-	TTCTCCCT	TTCTCCCT	rs149554537	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81541828_81541829insTTCTCCCT	uc003dqg.2	-							NM_000158	NP_000149			glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)										Glycogen_Storage_Disease_type_IV				---	---	---	---
GBE1	2632	broad.mit.edu	37	3	81775389	81775389	+	Intron	DEL	G	-	-	rs3836324		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81775389delG	uc003dqg.2	-						GBE1_uc011bgm.1_Intron	NM_000158	NP_000149			glucan (1,4-alpha-), branching enzyme 1						glucose metabolic process|glycogen biosynthetic process	cytosol	1,4-alpha-glucan branching enzyme activity|cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(3)	3		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)										Glycogen_Storage_Disease_type_IV				---	---	---	---
Unknown	0	broad.mit.edu	37	3	81818401	81818402	+	IGR	INS	-	TC	TC	rs143191265	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81818401_81818402insTC								GBE1 (7451 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	82544623	82544624	+	IGR	INS	-	GT	GT	rs140413671	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:82544623_82544624insGT								GBE1 (733673 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	83556459	83556460	+	IGR	INS	-	A	A	rs148434537		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83556459_83556460insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	84418102	84418103	+	IGR	INS	-	AC	AC	rs142659573	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84418102_84418103insAC								None (None upstream) : CADM2 (590030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	87210562	87210563	+	IGR	INS	-	AC	AC	rs11127972	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87210562_87210563insAC								VGLL3 (170305 upstream) : CHMP2B (65850 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	88239603	88239604	+	IGR	INS	-	A	A	rs151018779	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88239603_88239604insA								C3orf38 (32490 upstream) : EPHA3 (917070 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	88521271	88521271	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88521271delT								C3orf38 (314158 upstream) : EPHA3 (635403 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	88665182	88665183	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88665182_88665183delTG								C3orf38 (458069 upstream) : EPHA3 (491491 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	95955224	95955225	+	IGR	DEL	AC	-	-	rs72292539		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:95955224_95955225delAC								None (None upstream) : EPHA6 (578200 downstream)																																			---	---	---	---
EPHA6	285220	broad.mit.edu	37	3	97126192	97126193	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97126192_97126193delAC	uc010how.1	+							NM_001080448	NP_001073917			EPH receptor A6 isoform a							integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	98841260	98841260	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98841260delT								DCBLD2 (220727 upstream) : COL8A1 (516194 downstream)																																			---	---	---	---
GPR128	84873	broad.mit.edu	37	3	100330087	100330088	+	Intron	INS	-	TTTCCTTC	TTTCCTTC	rs71981038		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100330087_100330088insTTTCCTTC	uc003duc.2	+							NM_032787	NP_116176			G protein-coupled receptor 128 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4																		---	---	---	---
CEP97	79598	broad.mit.edu	37	3	101459437	101459438	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101459437_101459438insT	uc003dvk.1	+						CEP97_uc010hpm.1_Intron|CEP97_uc011bhf.1_Intron|CEP97_uc003dvl.1_Intron|CEP97_uc003dvm.1_Intron	NM_024548	NP_078824			centrosomal protein 97kDa							centrosome|nucleus	protein binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	102630583	102630584	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102630583_102630584delTG								ZPLD1 (431898 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	105592224	105592225	+	IGR	INS	-	CA	CA	rs147618026	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105592224_105592225insCA								CBLB (3958 upstream) : LOC100302640 (963435 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	105631931	105631932	+	IGR	DEL	TG	-	-	rs148950914		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105631931_105631932delTG								CBLB (43665 upstream) : LOC100302640 (923728 downstream)																																			---	---	---	---
LOC285205	285205	broad.mit.edu	37	3	107628760	107628761	+	Intron	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107628760_107628761insC	uc003dws.3	+							NR_015394				Homo sapiens cDNA clone IMAGE:5721886.												0																		---	---	---	---
MORC1	27136	broad.mit.edu	37	3	108740576	108740577	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108740576_108740577insA	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244			MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8																		---	---	---	---
MORC1	27136	broad.mit.edu	37	3	108745749	108745749	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108745749delC	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244			MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	109103350	109103351	+	IGR	INS	-	TT	TT	rs10632888		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109103350_109103351insTT								DPPA4 (46931 upstream) : FLJ25363 (25486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	110203181	110203184	+	IGR	DEL	AAAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110203181_110203184delAAAG								FLJ25363 (989167 upstream) : PVRL3 (587681 downstream)																																			---	---	---	---
PHLDB2	90102	broad.mit.edu	37	3	111685348	111685349	+	Intron	DEL	AT	-	-	rs67645066		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111685348_111685349delAT	uc010hqa.2	+						PHLDB2_uc003dyc.2_Intron|PHLDB2_uc003dyd.2_Intron|PHLDB2_uc003dyg.2_Intron|PHLDB2_uc003dyh.2_Intron|PHLDB2_uc003dyi.2_Intron|PHLDB2_uc003dyj.2_Intron	NM_001134438	NP_001127910			pleckstrin homology-like domain, family B,							cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6																		---	---	---	---
TMPRSS7	344805	broad.mit.edu	37	3	111774313	111774314	+	Intron	INS	-	AC	AC	rs774772	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111774313_111774314insAC	uc010hqb.2	+						TMPRSS7_uc011bhr.1_Intron	NM_001042575	NP_001036040			transmembrane protease, serine 7						proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity			ovary(1)|kidney(1)	2																		---	---	---	---
KIAA2018	205717	broad.mit.edu	37	3	113406113	113406114	+	Intron	DEL	CC	-	-	rs67480409		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113406113_113406114delCC	uc003eam.2	-							NM_001009899	NP_001009899			hypothetical protein LOC205717						regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3																		---	---	---	---
ATP6V1A	523	broad.mit.edu	37	3	113502622	113502622	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113502622delT	uc003eao.2	+						ATP6V1A_uc011bik.1_Intron	NM_001690	NP_001681			ATPase, H+ transporting, lysosomal V1 subunit A						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|integral to plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism			ovary(2)|skin(1)	3																		---	---	---	---
KIAA1407	57577	broad.mit.edu	37	3	113749031	113749031	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113749031delA	uc003eax.2	-						KIAA1407_uc011bin.1_Intron|KIAA1407_uc011bio.1_Intron|KIAA1407_uc011bip.1_Intron	NM_020817	NP_065868			hypothetical protein LOC57577											ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	117086985	117086986	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:117086985_117086986delCA								LOC285194 (651100 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	118140570	118140571	+	IGR	INS	-	TACT	TACT	rs143216568	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118140570_118140571insTACT								None (None upstream) : IGSF11 (478910 downstream)																																			---	---	---	---
C3orf15	89876	broad.mit.edu	37	3	119461528	119461529	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119461528_119461529insT	uc003ede.3	+						C3orf15_uc010hqz.2_Intron|C3orf15_uc011bjd.1_Intron|C3orf15_uc011bje.1_Intron	NM_033364	NP_203528			AAT1-alpha							mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)														---	---	---	---
RABL3	285282	broad.mit.edu	37	3	120428430	120428431	+	Intron	INS	-	AGACAAAGCAC	AGACAAAGCAC	rs141684205	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120428430_120428431insAGACAAAGCAC	uc003edx.2	-							NM_173825	NP_776186			RAB, member of RAS oncogene family-like 3						small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)														---	---	---	---
POLQ	10721	broad.mit.edu	37	3	121245917	121245917	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121245917delT	uc003eee.3	-							NM_199420	NP_955452			DNA polymerase theta						DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)									DNA_polymerases_(catalytic_subunits)					---	---	---	---
ADCY5	111	broad.mit.edu	37	3	123064574	123064575	+	Intron	INS	-	AGACAGAGAGACAGAGAGACAGAC	AGACAGAGAGACAGAGAGACAGAC	rs72215295		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123064574_123064575insAGACAGAGAGACAGAGAGACAGAC	uc003egh.1	-						ADCY5_uc003egg.1_Intron|ADCY5_uc003egi.1_Intron	NM_183357	NP_899200			adenylate cyclase 5						activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)														---	---	---	---
ADCY5	111	broad.mit.edu	37	3	123107426	123107427	+	Intron	INS	-	A	A	rs145121108	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123107426_123107427insA	uc003egh.1	-						ADCY5_uc003egg.1_Intron|ADCY5_uc003egi.1_Intron	NM_183357	NP_899200			adenylate cyclase 5						activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)														---	---	---	---
MYLK	4638	broad.mit.edu	37	3	123404479	123404479	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123404479delG	uc003ego.2	-						MYLK_uc011bjv.1_Intron|MYLK_uc011bjw.1_Intron|MYLK_uc003egp.2_Intron|MYLK_uc003egq.2_Intron|MYLK_uc003egr.2_Intron|MYLK_uc003egs.2_Intron|MYLK_uc003egt.2_Intron	NM_053025	NP_444253			myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)														---	---	---	---
ITGB5	3693	broad.mit.edu	37	3	124484907	124484907	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124484907delA	uc003eho.2	-						ITGB5_uc010hrx.2_Intron	NM_002213	NP_002204			integrin, beta 5 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|muscle contraction	integrin complex	receptor activity			skin(2)	2				GBM - Glioblastoma multiforme(114;0.163)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	126821008	126821009	+	IGR	INS	-	AC	AC	rs150234852	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126821008_126821009insAC								PLXNA1 (64780 upstream) : TPRA1 (470899 downstream)																																			---	---	---	---
PODXL2	50512	broad.mit.edu	37	3	127373801	127373802	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127373801_127373802delTG	uc003ejq.2	+							NM_015720	NP_056535			podocalyxin-like 2 precursor						leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	128272424	128272425	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128272424_128272425insA								LOC90246 (42997 upstream) : C3orf27 (18419 downstream)																																			---	---	---	---
PLXND1	23129	broad.mit.edu	37	3	129279856	129279856	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129279856delC	uc003emx.2	-						PLXND1_uc003emw.2_5'Flank|PLXND1_uc011blb.1_Intron	NM_015103	NP_055918			plexin D1 precursor						axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	130213865	130213865	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130213865delT								COL29A1 (10177 upstream) : COL6A6 (65313 downstream)																																			---	---	---	---
ATP2C1	27032	broad.mit.edu	37	3	130614348	130614349	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130614348_130614349insT	uc003enl.2	+						ATP2C1_uc011blg.1_Intron|ATP2C1_uc011blh.1_Intron|ATP2C1_uc011bli.1_Intron|ATP2C1_uc003enk.2_Intron|ATP2C1_uc003enm.2_Intron|ATP2C1_uc003enn.2_Intron|ATP2C1_uc003eno.2_Intron|ATP2C1_uc003enp.2_Intron|ATP2C1_uc003enq.2_Intron|ATP2C1_uc003enr.2_Intron|ATP2C1_uc003ens.2_Intron|ATP2C1_uc003ent.2_Intron	NM_014382	NP_055197			calcium-transporting ATPase 2C1 isoform 1a						actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)									Hailey-Hailey_disease				---	---	---	---
DNAJC13	23317	broad.mit.edu	37	3	132153998	132153999	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132153998_132153999delTG	uc003eor.2	+						DNAJC13_uc010htq.1_Intron	NM_015268	NP_056083			DnaJ (Hsp40) homolog, subfamily C, member 13								heat shock protein binding			ovary(1)|breast(1)	2																		---	---	---	---
BFSP2	8419	broad.mit.edu	37	3	133136368	133136369	+	Intron	INS	-	CCA	CCA	rs142660264	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133136368_133136369insCCA	uc003epn.1	+							NM_003571	NP_003562			phakinin						response to stimulus|visual perception	cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens				0																		---	---	---	---
SLCO2A1	6578	broad.mit.edu	37	3	133742739	133742741	+	Intron	DEL	TAA	-	-	rs148939728		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133742739_133742741delTAA	uc003eqa.3	-						SLCO2A1_uc003eqb.3_Intron|SLCO2A1_uc011blv.1_Intron|SLCO2A1_uc010htw.1_Intron	NM_005630	NP_005621			solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to plasma membrane|membrane fraction	prostaglandin transmembrane transporter activity|protein binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	134508744	134508744	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134508744delA								KY (138266 upstream) : EPHB1 (5516 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	137127194	137127195	+	IGR	INS	-	T	T	rs148955313	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137127194_137127195insT								IL20RB (397274 upstream) : SOX14 (356384 downstream)																																			---	---	---	---
CLSTN2	64084	broad.mit.edu	37	3	140168102	140168102	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140168102delT	uc003etn.2	+						CLSTN2_uc003etm.2_Intron	NM_022131	NP_071414			calsyntenin 2 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7															HNSCC(16;0.037)			---	---	---	---
GK5	256356	broad.mit.edu	37	3	141944762	141944763	+	5'Flank	INS	-	C	C	rs149752928	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141944762_141944763insC	uc003euq.1	-						GK5_uc010hus.1_5'Flank|GK5_uc010hut.1_5'Flank	NM_001039547	NP_001034636			glycerol kinase 5 (putative)						glycerol metabolic process		ATP binding|glycerol kinase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	144018356	144018356	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144018356delT								C3orf58 (307147 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	144087638	144087639	+	IGR	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144087638_144087639insC								C3orf58 (376429 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	144213418	144213419	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144213418_144213419insT								C3orf58 (502209 upstream) : None (None downstream)																																			---	---	---	---
PLOD2	5352	broad.mit.edu	37	3	145880936	145880936	+	5'Flank	DEL	T	-	-	rs140434655		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:145880936delT	uc003evs.1	-						PLOD2_uc011bnm.1_5'Flank|PLOD2_uc003evr.1_5'Flank	NM_000935	NP_000926			procollagen-lysine, 2-oxoglutarate 5-dioxygenase						protein modification process|response to hypoxia	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2					Vitamin C(DB00126)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	146715290	146715291	+	IGR	INS	-	TG	TG	rs145769955	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146715290_146715291insTG								PLSCR5 (391287 upstream) : ZIC4 (388546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	148078586	148078587	+	IGR	DEL	AT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148078586_148078587delAT								ZIC1 (944082 upstream) : AGTR1 (337071 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	148337873	148337877	+	IGR	DEL	AGGGA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148337873_148337877delAGGGA								None (None upstream) : AGTR1 (77781 downstream)																																			---	---	---	---
RNF13	11342	broad.mit.edu	37	3	149577284	149577285	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149577284_149577285delAC	uc003exn.3	+						RNF13_uc003exp.3_Intron	NM_007282	NP_009213			ring finger protein 13						protein autoubiquitination	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane|nuclear inner membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	150201920	150201920	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150201920delA								TSC22D2 (24307 upstream) : SERP1 (57861 downstream)																																			---	---	---	---
MED12L	116931	broad.mit.edu	37	3	150911752	150911753	+	Intron	INS	-	T	T	rs62878862		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150911752_150911753insT	uc003eyp.2	+						MED12L_uc011bnz.1_Intron	NM_053002	NP_443728			mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
IGSF10	285313	broad.mit.edu	37	3	151174023	151174023	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151174023delT	uc011bod.1	-							NM_178822	NP_849144			immunoglobulin superfamily, member 10 precursor						cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	151297663	151297664	+	IGR	INS	-	AAGGAAGAAAGG	AAGGAAGAAAGG	rs145031240	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151297663_151297664insAAGGAAGAAAGG								IGSF10 (121166 upstream) : AADACL2 (154040 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	151613219	151613220	+	IGR	INS	-	ACG	ACG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151613219_151613220insACG								SUCNR1 (13569 upstream) : LOC401093 (367193 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	151903540	151903540	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151903540delA								SUCNR1 (303890 upstream) : LOC401093 (76873 downstream)																																			---	---	---	---
MBNL1	4154	broad.mit.edu	37	3	151987507	151987509	+	Intron	DEL	TTC	-	-	rs35226257		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151987507_151987509delTTC	uc003ezh.2	+						MBNL1_uc003ezi.2_Intron|MBNL1_uc003ezj.2_Intron|LOC401093_uc011boe.1_5'Flank|LOC401093_uc011bof.1_5'Flank|MBNL1_uc003ezg.1_Intron	NM_021038	NP_066368			muscleblind-like 1 isoform a						embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	152456147	152456148	+	IGR	INS	-	T	T	rs142808625	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152456147_152456148insT								MBNL1 (272579 upstream) : P2RY1 (96588 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	154963457	154963458	+	IGR	INS	-	TG	TG	rs145341990	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154963457_154963458insTG								MME (61939 upstream) : PLCH1 (234213 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	155167362	155167362	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155167362delC								MME (265844 upstream) : PLCH1 (30309 downstream)																																			---	---	---	---
PLCH1	23007	broad.mit.edu	37	3	155284438	155284439	+	Intron	INS	-	A	A	rs138163918	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155284438_155284439insA	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432			phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	155788630	155788630	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155788630delA								GMPS (133112 upstream) : KCNAB1 (49707 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	157240780	157240783	+	IGR	DEL	TTAT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157240780_157240783delTTAT								VEPH1 (19365 upstream) : C3orf55 (20376 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	158641566	158641567	+	IGR	INS	-	GT	GT	rs150895435	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158641566_158641567insGT								MFSD1 (94062 upstream) : SCHIP1 (145550 downstream)																																			---	---	---	---
SCHIP1	29970	broad.mit.edu	37	3	159150129	159150136	+	Intron	DEL	GAGAGAGA	-	-	rs72044332		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159150129_159150136delGAGAGAGA	uc003fcs.1	+						SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|SCHIP1_uc003fct.1_Intron	NM_014575	NP_055390			schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	159702917	159702917	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159702917delA	uc003fcw.1	-											Homo sapiens cDNA FLJ39842 fis, clone SPLEN2014293.																														---	---	---	---
PPM1L	151742	broad.mit.edu	37	3	160675365	160675366	+	Intron	INS	-	TT	TT	rs71878436		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160675365_160675366insTT	uc003fdr.2	+						PPM1L_uc003fds.2_Intron|PPM1L_uc003fdt.2_Intron|PPM1L_uc010hwf.2_Intron	NM_139245	NP_640338			protein phosphatase 1 (formerly 2C)-like						protein dephosphorylation|sphingolipid metabolic process	endoplasmic reticulum membrane|integral to membrane|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(1)	1			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	162197199	162197199	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162197199delT								OTOL1 (975471 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	162500642	162500645	+	Intron	DEL	GGGT	-	-	rs56824069		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162500642_162500645delGGGT	uc003feg.2	+											Homo sapiens, clone IMAGE:2905387, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	3	164430496	164430497	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164430496_164430497insA								MIR720 (371258 upstream) : SI (266190 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	165957240	165957240	+	IGR	DEL	A	-	-	rs63268060		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165957240delA								BCHE (401987 upstream) : None (None downstream)																																			---	---	---	---
MECOM	2122	broad.mit.edu	37	3	169150071	169150071	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169150071delT	uc011bpj.1	-						MECOM_uc011bpk.1_Intron|MECOM_uc010hwn.2_Intron|MECOM_uc011bpl.1_Intron	NM_004991	NP_004982			MDS1 and EVI1 complex locus isoform c						apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14																		---	---	---	---
SLC7A14	57709	broad.mit.edu	37	3	170204413	170204423	+	Intron	DEL	AGCACTTTGAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170204413_170204423delAGCACTTTGAG	uc003fgz.2	-						CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000			solute carrier family 7 (cationic amino acid							integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)															---	---	---	---
NLGN1	22871	broad.mit.edu	37	3	173557661	173557666	+	Intron	DEL	TATAGA	-	-	rs3033760		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173557661_173557666delTATAGA	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747			neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	174737368	174737368	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174737368delA	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	174941130	174941131	+	Intron	INS	-	T	T	rs71626204		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174941130_174941131insT	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
NAALADL2	254827	broad.mit.edu	37	3	175010382	175010383	+	Intron	INS	-	AC	AC	rs150395131	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175010382_175010383insAC	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898			N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	177962217	177962217	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177962217delT								None (None upstream) : KCNMB2 (292007 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	180040643	180040644	+	IGR	INS	-	A	A	rs77020269		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180040643_180040644insA								PEX5L (286126 upstream) : TTC14 (279274 downstream)																																			---	---	---	---
MCCC1	56922	broad.mit.edu	37	3	182747479	182747479	+	Intron	DEL	T	-	-	rs10709578		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182747479delT	uc003fle.2	-						MCCC1_uc010hxi.2_Intron|MCCC1_uc011bqo.1_Intron|MCCC1_uc003flf.2_Intron|MCCC1_uc003flg.2_Intron|MCCC1_uc011bqp.1_Intron	NM_020166	NP_064551			methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)						biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)													---	---	---	---
Unknown	0	broad.mit.edu	37	3	184466351	184466351	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184466351delT								MAGEF1 (36515 upstream) : VPS8 (63580 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	184470805	184470820	+	IGR	DEL	TGGGAGAAGAAGGTGA	-	-	rs71162261	by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184470805_184470820delTGGGAGAAGAAGGTGA								MAGEF1 (40969 upstream) : VPS8 (59111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	184484878	184484879	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184484878_184484879delGT								MAGEF1 (55042 upstream) : VPS8 (45052 downstream)																																			---	---	---	---
LIPH	200879	broad.mit.edu	37	3	185240421	185240424	+	Intron	DEL	AAAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185240421_185240424delAAAG	uc003fpm.2	-						LIPH_uc010hyh.2_Intron	NM_139248	NP_640341			lipase, member H precursor						lipid catabolic process	extracellular space|plasma membrane	heparin binding|phospholipase activity			ovary(1)|pancreas(1)	2	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)															---	---	---	---
Unknown	0	broad.mit.edu	37	3	185614979	185614980	+	IGR	INS	-	GTTT	GTTT	rs144375871	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185614979_185614980insGTTT								IGF2BP2 (72152 upstream) : TRA2B (17380 downstream)																																			---	---	---	---
DGKG	1608	broad.mit.edu	37	3	186081934	186081934	+	5'Flank	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186081934delT	uc003fqa.2	-						DGKG_uc003fqb.2_5'Flank|DGKG_uc003fqc.2_5'Flank|DGKG_uc011brx.1_5'Flank	NM_001346	NP_001337			diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)													---	---	---	---
LPP	4026	broad.mit.edu	37	3	188295546	188295549	+	Intron	DEL	TTCG	-	-	rs72048204		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188295546_188295549delTTCG	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569			LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)				T	HMGA2|MLL|C12orf9	lipoma|leukemia								---	---	---	---
Unknown	0	broad.mit.edu	37	3	189295726	189295729	+	IGR	DEL	TTCC	-	-	rs148151112		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189295726_189295729delTTCC								TPRG1 (254456 upstream) : TP63 (53487 downstream)																																			---	---	---	---
TP63	8626	broad.mit.edu	37	3	189497956	189497959	+	Intron	DEL	AAAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189497956_189497959delAAAG	uc003fry.2	+						TP63_uc003frx.2_Intron|TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron	NM_003722	NP_003713			tumor protein p63 isoform 1						anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)										Hay-Wells_syndrome	HNSCC(45;0.13)			---	---	---	---
TP63	8626	broad.mit.edu	37	3	189504236	189504239	+	Intron	DEL	ACAC	-	-	rs142033420		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189504236_189504239delACAC	uc003fry.2	+						TP63_uc003frx.2_Intron|TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron	NM_003722	NP_003713			tumor protein p63 isoform 1						anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)										Hay-Wells_syndrome	HNSCC(45;0.13)			---	---	---	---
FGF12	2257	broad.mit.edu	37	3	192103443	192103449	+	Intron	DEL	ATAGTTT	-	-	rs149960789		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192103443_192103449delATAGTTT	uc003fsx.2	-						FGF12_uc003fsy.2_Intron	NM_021032	NP_066360			fibroblast growth factor 12 isoform 1						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	193455645	193455646	+	IGR	INS	-	C	C	rs149216358	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193455645_193455646insC								OPA1 (40046 upstream) : LOC100128023 (255238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	3	194110986	194110989	+	IGR	DEL	AAAC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194110986_194110989delAAAC								LRRC15 (20514 upstream) : GP5 (4561 downstream)																																			---	---	---	---
C3orf21	152002	broad.mit.edu	37	3	194871528	194871535	+	Intron	DEL	CTCACACA	-	-	rs113560509		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194871528_194871535delCTCACACA	uc003fum.3	-						C3orf21_uc003ful.2_Intron	NM_152531	NP_689744			hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	195376801	195376802	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195376801_195376802insA	uc011bta.1	-											Homo sapiens, clone IMAGE:5171739, mRNA.																														---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195494401	195494402	+	Intron	INS	-	CCA	CCA	rs148745721	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195494401_195494402insCCA	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876			mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
MUC4	4585	broad.mit.edu	37	3	195522717	195522717	+	Intron	DEL	A	-	-	rs11289627		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195522717delA	uc011bto.1	-						MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron	NM_018406	NP_060876			mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	3	195553121	195553122	+	IGR	INS	-	C	C	rs138895558	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195553121_195553122insC								MUC4 (13973 upstream) : TNK2 (37114 downstream)																																			---	---	---	---
SENP5	205564	broad.mit.edu	37	3	196656858	196656859	+	Intron	INS	-	AA	AA	rs71305258		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196656858_196656859insAA	uc003fwz.3	+						SENP5_uc011bty.1_Intron	NM_152699	NP_689912			SUMO1/sentrin specific peptidase 5						cell cycle|cell division|proteolysis	nucleolus	cysteine-type peptidase activity			breast(2)|lung(1)	3	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)														---	---	---	---
PIGZ	80235	broad.mit.edu	37	3	196681802	196681802	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196681802delT	uc003fxh.2	-							NM_025163	NP_079439			phosphatidylinositol glycan anchor biosynthesis,						GPI anchor biosynthetic process	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			ovary(3)	3	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)														---	---	---	---
BDH1	622	broad.mit.edu	37	3	197242784	197242787	+	Intron	DEL	CACG	-	-	rs112513920		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197242784_197242787delCACG	uc003fxr.2	-						BDH1_uc003fxs.2_Intron|BDH1_uc003fxt.2_Intron|BDH1_uc003fxu.2_Intron	NM_203314	NP_976059			3-hydroxybutyrate dehydrogenase, type 1						cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)													---	---	---	---
BDH1	622	broad.mit.edu	37	3	197275754	197275757	+	Intron	DEL	ACAC	-	-	rs112014696		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197275754_197275757delACAC	uc003fxr.2	-						BDH1_uc003fxs.2_Intron|BDH1_uc003fxt.2_Intron|BDH1_uc003fxu.2_Intron	NM_203314	NP_976059			3-hydroxybutyrate dehydrogenase, type 1						cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)													---	---	---	---
LRCH3	84859	broad.mit.edu	37	3	197536467	197536467	+	Intron	DEL	C	-	-	rs113865664		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197536467delC	uc011bul.1	+						LRCH3_uc003fyj.1_Intron|LRCH3_uc011bum.1_Intron|LRCH3_uc011bun.1_Intron	NM_032773	NP_116162			leucine-rich repeats and calponin homology (CH)							extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)														---	---	---	---
LRCH3	84859	broad.mit.edu	37	3	197597953	197597953	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197597953delT	uc011bul.1	+						LRCH3_uc003fyj.1_Intron|LRCH3_uc011bum.1_Intron|LRCH3_uc011bun.1_Intron|LRCH3_uc003fyk.2_Intron	NM_032773	NP_116162			leucine-rich repeats and calponin homology (CH)							extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)														---	---	---	---
ZNF718	255403	broad.mit.edu	37	4	115934	115939	+	Intron	DEL	TGTGTG	-	-	rs59002663		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115934_115939delTGTGTG	uc003fzt.3	+						ZNF595_uc003fzu.1_Intron	NM_001039127	NP_001034216			zinc finger protein 718						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)														---	---	---	---
ZNF732	654254	broad.mit.edu	37	4	292206	292207	+	5'Flank	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:292206_292207insA	uc011buu.1	-						ZNF732_uc010ibb.1_Intron	NM_001137608	NP_001131080			zinc finger protein 732						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
CPLX1	10815	broad.mit.edu	37	4	780647	780648	+	Intron	INS	-	G	G	rs145744400	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:780647_780648insG	uc003gbi.2	-						CPLX1_uc003gbj.2_Intron	NM_006651	NP_006642			complexin 1						glutamate secretion	cytosol					0				Colorectal(103;0.187)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	1149474	1149475	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1149474_1149475delAC								RNF212 (41892 upstream) : SPON2 (11247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	1175037	1175038	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1175037_1175038insA								SPON2 (8057 upstream) : LOC100130872 (14534 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	1177028	1177029	+	IGR	INS	-	A	A	rs112375905		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1177028_1177029insA								SPON2 (10048 upstream) : LOC100130872 (12543 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	1187539	1187539	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1187539delT								SPON2 (20559 upstream) : LOC100130872 (2033 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3582091	3582094	+	Intron	DEL	TCCG	-	-	rs9286702		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3582091_3582094delTCCG	uc003ghj.1	+						uc003ghk.1_Intron					Homo sapiens cDNA FLJ35424 fis, clone SMINT2001461.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	3599475	3599476	+	IGR	INS	-	G	G	rs139662766	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3599475_3599476insG								LRPAP1 (65251 upstream) : ADRA2C (168599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3601666	3601667	+	IGR	INS	-	G	G	rs74519684		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3601666_3601667insG								LRPAP1 (67442 upstream) : ADRA2C (166408 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	3607288	3607289	+	IGR	INS	-	C	C	rs141113002	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3607288_3607289insC								LRPAP1 (73064 upstream) : ADRA2C (160786 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	4345959	4345960	+	IGR	INS	-	T	T	rs144157612	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4345959_4345960insT								ZBTB49 (22447 upstream) : D4S234E (3909 downstream)																																			---	---	---	---
D4S234E	27065	broad.mit.edu	37	4	4420291	4420292	+	3'UTR	INS	-	AA	AA	rs148158327	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4420291_4420292insAA	uc011bvz.1	+	8					D4S234E_uc003ghz.2_3'UTR|D4S234E_uc003gia.2_3'UTR|D4S234E_uc003gib.2_3'UTR	NM_014392	NP_055207			brain neuron cytoplasmic protein 1						dopamine receptor signaling pathway	Golgi membrane|integral to membrane|nucleus	dopamine receptor binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.166)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	5940313	5940313	+	IGR	DEL	T	-	-	rs11326788		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5940313delT								CRMP1 (45528 upstream) : C4orf50 (18532 downstream)																																			---	---	---	---
C4orf50	389197	broad.mit.edu	37	4	5983556	5983557	+	Intron	INS	-	C	C	rs149190272	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5983556_5983557insC	uc003git.1	-							NM_207405	NP_997288			hypothetical protein LOC389197											pancreas(2)|breast(1)	3																		---	---	---	---
PPP2R2C	5522	broad.mit.edu	37	4	6378178	6378179	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6378178_6378179insT	uc003gjc.2	-						PPP2R2C_uc003gjb.2_Intron|PPP2R2C_uc011bwd.1_Intron|PPP2R2C_uc011bwe.1_Intron|PPP2R2C_uc003gja.2_Intron|PPP2R2C_uc003gjd.1_Intron	NM_020416	NP_065149			gamma isoform of regulatory subunit B55, protein						signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
SORCS2	57537	broad.mit.edu	37	4	7524607	7524627	+	Intron	DEL	TCCCTCCTCCCTCTTCTCTCC	-	-	rs36231941		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7524607_7524627delTCCCTCCTCCCTCTTCTCTCC	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828			VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
AFAP1	60312	broad.mit.edu	37	4	7785806	7785807	+	Intron	INS	-	TT	TT	rs146270291	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7785806_7785807insTT	uc003gkg.1	-						AFAP1_uc011bwk.1_Intron	NM_198595	NP_940997			actin filament associated protein 1							actin cytoskeleton|cytoplasm|focal adhesion	actin binding				0																		---	---	---	---
SH3TC1	54436	broad.mit.edu	37	4	8215616	8215616	+	Intron	DEL	A	-	-	rs111933899		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8215616delA	uc003gkv.3	+						SH3TC1_uc003gkw.3_Intron|SH3TC1_uc003gkx.3_Intron	NM_018986	NP_061859			SH3 domain and tetratricopeptide repeats 1								binding			large_intestine(2)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	8252311	8252311	+	IGR	DEL	T	-	-	rs71649516		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8252311delT								SH3TC1 (9483 upstream) : HTRA3 (19181 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	8355595	8355595	+	IGR	DEL	G	-	-	rs11310423		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8355595delG								HTRA3 (46765 upstream) : ACOX3 (12415 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	8547177	8547177	+	IGR	DEL	G	-	-	rs76657760		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8547177delG								C4orf23 (51919 upstream) : GPR78 (35114 downstream)																																			---	---	---	---
SLC2A9	56606	broad.mit.edu	37	4	9960614	9960618	+	Intron	DEL	AAAGT	-	-	rs113208805		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9960614_9960618delAAAGT	uc003gmc.2	-						SLC2A9_uc003gmd.2_Intron	NM_020041	NP_064425			solute carrier family 2, member 9 protein						glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	11091419	11091419	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11091419delA								CLNK (405033 upstream) : MIR572 (279032 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	11826926	11826927	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11826926_11826927delTG								HS3ST1 (396389 upstream) : None (None downstream)																																			---	---	---	---
RAB28	9364	broad.mit.edu	37	4	13467379	13467380	+	Intron	DEL	AC	-	-	rs33979911		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13467379_13467380delAC	uc003gmu.2	-						RAB28_uc003gmt.2_Intron|RAB28_uc011bwz.1_Intron|RAB28_uc003gmv.2_Intron	NM_001017979	NP_001017979			RAB28, member RAS oncogene family isoform 1						small GTPase mediated signal transduction	plasma membrane	GDP binding|GTP binding|GTPase activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	15745389	15745389	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15745389delC								BST1 (5456 upstream) : CD38 (34542 downstream)																																			---	---	---	---
LDB2	9079	broad.mit.edu	37	4	16583518	16583519	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16583518_16583519insA	uc003goz.2	-						LDB2_uc003gpa.2_Intron|LDB2_uc003gpb.2_Intron|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Intron|LDB2_uc003goy.2_Intron|LDB2_uc011bxi.1_Intron	NM_001290	NP_001281			LIM domain binding 2 isoform a								LIM domain binding|transcription cofactor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	16993351	16993351	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16993351delT								LDB2 (92927 upstream) : QDPR (494669 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	17119397	17119400	+	IGR	DEL	AAAG	-	-	rs113051690		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17119397_17119400delAAAG								LDB2 (218973 upstream) : QDPR (368620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	17220696	17220696	+	IGR	DEL	T	-	-	rs34509594		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17220696delT								LDB2 (320272 upstream) : QDPR (267324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	17536715	17536715	+	IGR	DEL	T	-	-	rs112929485		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17536715delT								CLRN2 (7988 upstream) : LAP3 (42212 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	18524382	18524382	+	IGR	DEL	C	-	-	rs76594635		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18524382delC								LCORL (500997 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	19688805	19688806	+	IGR	INS	-	T	T	rs146705507	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19688805_19688806insT								None (None upstream) : SLIT2 (566429 downstream)																																			---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	21332767	21332767	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21332767delT	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175			Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	21518030	21518030	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21518030delT	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175			Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
KCNIP4	80333	broad.mit.edu	37	4	21721690	21721690	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21721690delA	uc003gqi.1	-							NM_147182	NP_671711			Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	22295095	22295096	+	IGR	INS	-	CA	CA	rs150927679	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22295095_22295096insCA								KCNIP4 (344721 upstream) : GPR125 (93903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	23557346	23557347	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23557346_23557347insT								GBA3 (736155 upstream) : PPARGC1A (236298 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	24494761	24494762	+	IGR	INS	-	TATCCA	TATCCA	rs139645008	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:24494761_24494762insTATCCA								PPARGC1A (603061 upstream) : MIR573 (27053 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	25453114	25453117	+	IGR	DEL	AGGG	-	-	rs35347658		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25453114_25453117delAGGG								ANAPC4 (32995 upstream) : SLC34A2 (204318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	26204593	26204600	+	IGR	DEL	AAGGAAGG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26204593_26204600delAAGGAAGG								C4orf52 (273093 upstream) : RBPJ (116732 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	28541788	28541789	+	IGR	INS	-	TTCC	TTCC	rs111687646	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28541788_28541789insTTCC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	28900171	28900172	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28900171_28900172insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31410947	31410948	+	IGR	DEL	AC	-	-	rs113552810		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31410947_31410948delAC								PCDH7 (262526 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	31779749	31779752	+	IGR	DEL	GTGC	-	-	rs72337835	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31779749_31779752delGTGC								PCDH7 (631328 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	33888111	33888112	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33888111_33888112insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	34100936	34100936	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34100936delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	34968524	34968525	+	IGR	INS	-	T	T	rs150880533	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:34968524_34968525insT								None (None upstream) : ARAP2 (981319 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	40330938	40330940	+	IGR	DEL	AGG	-	-	rs72145179		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40330938_40330940delAGG								RHOH (84657 upstream) : CHRNA9 (6529 downstream)																																			---	---	---	---
APBB2	323	broad.mit.edu	37	4	41011929	41011929	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41011929delT	uc003gvl.2	-						APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc011byt.1_Intron	NM_173075	NP_775098			amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
APBB2	323	broad.mit.edu	37	4	41206068	41206069	+	Intron	INS	-	AAT	AAT	rs147299078	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41206068_41206069insAAT	uc003gvl.2	-						APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron	NM_173075	NP_775098			amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3																		---	---	---	---
GRXCR1	389207	broad.mit.edu	37	4	43003119	43003119	+	Intron	DEL	T	-	-	rs112275383		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:43003119delT	uc003gwt.2	+							NM_001080476	NP_001073945			glutaredoxin, cysteine rich 1						cell redox homeostasis|inner ear receptor stereocilium organization|sensory perception of sound|vestibular receptor cell development	kinocilium|stereocilium	electron carrier activity|protein disulfide oxidoreductase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	45927169	45927169	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:45927169delT								None (None upstream) : GABRG1 (110620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	46399418	46399419	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46399418_46399419insT								GABRA2 (6997 upstream) : COX7B2 (337430 downstream)																																			---	---	---	---
GABRB1	2560	broad.mit.edu	37	4	47422995	47422996	+	Intron	DEL	AG	-	-	rs10604334		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47422995_47422996delAG	uc003gxh.2	+						GABRB1_uc011bze.1_Intron	NM_000812	NP_000803			gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)													---	---	---	---
FRYL	285527	broad.mit.edu	37	4	48763023	48763024	+	Intron	DEL	TC	-	-	rs71600795		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48763023_48763024delTC	uc003gyh.1	-						FRYL_uc003gyk.2_Intron|FRYL_uc003gym.1_Intron|FRYL_uc003gyn.3_Intron	NM_015030	NP_055845			furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1																		---	---	---	---
CWH43	80157	broad.mit.edu	37	4	49012805	49012805	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49012805delG	uc003gyv.2	+						CWH43_uc011bzl.1_Intron	NM_025087	NP_079363			cell wall biogenesis 43 C-terminal homolog						GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	49099749	49099753	+	IGR	DEL	TCCGG	-	-	rs60947727		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099749_49099753delTCCGG								CWH43 (35656 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49218022	49218022	+	IGR	DEL	A	-	-	rs78904448		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49218022delA								CWH43 (153929 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49242853	49242853	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49242853delT								CWH43 (178760 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49553179	49553182	+	IGR	DEL	GAAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49553179_49553182delGAAG								CWH43 (489086 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	49634016	49634020	+	IGR	DEL	GGAAG	-	-	rs57378837		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49634016_49634020delGGAAG								CWH43 (569923 upstream) : None (None downstream)																																			---	---	---	---
DCUN1D4	23142	broad.mit.edu	37	4	52732574	52732577	+	Intron	DEL	ATGT	-	-	rs149394404		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52732574_52732577delATGT	uc003gze.2	+						DCUN1D4_uc003gzf.2_Intron|DCUN1D4_uc011bzn.1_Intron|DCUN1D4_uc003gzg.2_Intron|DCUN1D4_uc003gzh.2_Intron|DCUN1D4_uc011bzo.1_Intron	NM_001040402	NP_001035492			DCN1, defective in cullin neddylation 1, domain											ovary(2)	2			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	53427030	53427031	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53427030_53427031delAC								SPATA18 (463573 upstream) : USP46 (30098 downstream)																																			---	---	---	---
PDGFRA	5156	broad.mit.edu	37	4	55160973	55160973	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55160973delT	uc003han.3	+						PDGFRA_uc003haa.2_Intron	NM_006206	NP_006197			platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			---	---	---	---
Unknown	0	broad.mit.edu	37	4	55265501	55265502	+	IGR	DEL	GT	-	-	rs34237138		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55265501_55265502delGT								PDGFRA (101090 upstream) : KIT (258593 downstream)																																			---	---	---	---
CLOCK	9575	broad.mit.edu	37	4	56329018	56329019	+	Intron	INS	-	GTGTGT	GTGTGT	rs62303714	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56329018_56329019insGTGTGT	uc003haz.1	-						CLOCK_uc003hba.1_Intron	NM_004898	NP_004889			clock						circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)															---	---	---	---
PDCL2	132954	broad.mit.edu	37	4	56446020	56446020	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56446020delT	uc003hbb.2	-							NM_152401	NP_689614			phosducin-like 2												0	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	57626656	57626657	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57626656_57626657insT								HOPX (78784 upstream) : SPINK2 (49377 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	58351064	58351065	+	IGR	INS	-	AGC	AGC	rs143409503	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58351064_58351065insAGC								IGFBP7 (374525 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59094950	59094950	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59094950delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59455878	59455878	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59455878delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	59474993	59474993	+	IGR	DEL	A	-	-	rs11302573		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59474993delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	61007950	61007950	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61007950delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	61386332	61386333	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61386332_61386333insA								None (None upstream) : LPHN3 (680641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	61672938	61672939	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:61672938_61672939delTG								None (None upstream) : LPHN3 (394035 downstream)																																			---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62322591	62322591	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62322591delG	uc003hcq.3	+						LPHN3_uc010ihg.1_Intron					RecName: Full=Latrophilin-3; AltName: Full=Calcium-independent alpha-latrotoxin receptor 3; AltName: Full=Lectomedin-3; Flags: Precursor;						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18																		---	---	---	---
LPHN3	23284	broad.mit.edu	37	4	62654996	62654997	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62654996_62654997delTG	uc010ihh.2	+						LPHN3_uc003hcq.3_Intron|LPHN3_uc003hcs.1_Intron	NM_015236	NP_056051			latrophilin 3 precursor						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	63753672	63753676	+	IGR	DEL	AAAAA	-	-	rs147455415		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63753672_63753676delAAAAA								LPHN3 (815505 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	63880851	63880851	+	IGR	DEL	T	-	-	rs35900338		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63880851delT								LPHN3 (942684 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65057592	65057592	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65057592delT								None (None upstream) : TECRL (86593 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	65096251	65096251	+	IGR	DEL	A	-	-	rs78862761		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65096251delA								None (None upstream) : TECRL (47934 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	67731344	67731345	+	IGR	INS	-	TC	TC			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67731344_67731345insTC								MIR1269 (588698 upstream) : CENPC1 (606644 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	70439844	70439844	+	IGR	DEL	C	-	-	rs35225483		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70439844delC								UGT2B4 (48112 upstream) : UGT2A1 (14292 downstream)																																			---	---	---	---
CSN1S1	1446	broad.mit.edu	37	4	70809724	70809725	+	Intron	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70809724_70809725delTC	uc003hep.1	+						CSN1S1_uc003heq.1_Intron|CSN1S1_uc003her.1_Intron	NM_001890	NP_001881			casein alpha s1 isoform 1							extracellular region	protein binding|transporter activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	70842511	70842514	+	IGR	DEL	TGTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70842511_70842514delTGTG								CSN2 (15785 upstream) : STATH (19134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	76205839	76205839	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76205839delG								PARM1 (230516 upstream) : RCHY1 (198516 downstream)																																			---	---	---	---
G3BP2	9908	broad.mit.edu	37	4	76586663	76586663	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76586663delT	uc003hir.2	-						G3BP2_uc003his.2_Intron|G3BP2_uc003hit.2_Intron	NM_012297	NP_036429			Ras-GTPase activating protein SH3 domain-binding						cytoplasmic sequestering of NF-kappaB|mRNA transport|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	GTPase activator activity|nucleotide binding|receptor signaling complex scaffold activity|RNA binding			breast(2)|central_nervous_system(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)															---	---	---	---
SHROOM3	57619	broad.mit.edu	37	4	77439725	77439728	+	Intron	DEL	TGCT	-	-	rs71659329		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77439725_77439728delTGCT	uc011cbx.1	+							NM_020859	NP_065910			shroom family member 3 protein						apical protein localization|cell morphogenesis|cellular pigment accumulation|pattern specification process|regulation of cell shape	adherens junction|apical junction complex|apical plasma membrane|cytoplasm|microtubule	actin binding			skin(2)|ovary(1)	3			Lung(101;0.0903)															---	---	---	---
Unknown	0	broad.mit.edu	37	4	78051138	78051138	+	IGR	DEL	T	-	-	rs150447942		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78051138delT								CCNI (54013 upstream) : CCNG2 (27219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	78326068	78326069	+	IGR	INS	-	GGG	GGG	rs142290910	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:78326068_78326069insGGG								CCNG2 (234858 upstream) : CXCL13 (106838 downstream)																																			---	---	---	---
FRAS1	80144	broad.mit.edu	37	4	79386852	79386866	+	Intron	DEL	GCTGGCCCTGGTTAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79386852_79386866delGCTGGCCCTGGTTAG	uc003hlb.2	+							NM_025074	NP_079350			Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	79939935	79939944	+	Intron	DEL	AGTCCCACAT	-	-	rs34070123		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79939935_79939944delAGTCCCACAT	uc003hlr.1	+											Homo sapiens full length insert cDNA clone YY75G10.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	81087205	81087208	+	IGR	DEL	CCTC	-	-	rs76920241		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81087205_81087208delCCTC								ANTXR2 (92728 upstream) : PRDM8 (18231 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	82178320	82178321	+	IGR	DEL	AA	-	-	rs142985389		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82178320_82178321delAA								PRKG2 (42102 upstream) : RASGEF1B (169898 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	84410552	84410552	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84410552delA								FAM175A (4262 upstream) : AGPAT9 (46709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	84888401	84888402	+	Intron	INS	-	TTAAAAGTTTG	TTAAAAGTTTG	rs149754615	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84888401_84888402insTTAAAAGTTTG	uc010ikd.1	-											Homo sapiens cDNA FLJ37966 fis, clone CTONG2009871.																														---	---	---	---
WDFY3	23001	broad.mit.edu	37	4	85792039	85792040	+	Intron	INS	-	A	A	rs34424987		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85792039_85792040insA	uc003hpd.2	-						WDFY3_uc003hpf.2_Intron	NM_014991	NP_055806			WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)														---	---	---	---
MAPK10	5602	broad.mit.edu	37	4	87222567	87222567	+	Intron	DEL	A	-	-	rs111965801		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87222567delA	uc003hpq.2	-						MAPK10_uc010ikg.2_Intron|MAPK10_uc003hpr.2_Intron|MAPK10_uc003hps.2_Intron|MAPK10_uc003hpt.2_Intron|MAPK10_uc003hpu.2_Intron|MAPK10_uc003hpv.2_Intron|MAPK10_uc010ikh.1_Intron	NM_138982	NP_620448			mitogen-activated protein kinase 10 isoform 2						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|MAP kinase kinase activity|protein binding			stomach(1)|breast(1)|central_nervous_system(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)														---	---	---	---
SLC10A6	345274	broad.mit.edu	37	4	87760427	87760427	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87760427delA	uc003hqd.2	-							NM_197965	NP_932069			sodium-dependent organic anion transporter							integral to membrane|plasma membrane	bile acid:sodium symporter activity				0		Acute lymphoblastic leukemia(40;0.244)|all_hematologic(202;0.248)		OV - Ovarian serous cystadenocarcinoma(123;0.00099)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	88824399	88824399	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88824399delT								MEPE (56457 upstream) : SPP1 (72403 downstream)																																			---	---	---	---
ABCG2	9429	broad.mit.edu	37	4	89091262	89091263	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89091262_89091263insA	uc003hrh.2	-											RecName: Full=ATP-binding cassette sub-family G member 2; AltName: Full=Placenta-specific ATP-binding cassette transporter; AltName: Full=Breast cancer resistance protein; AltName: Full=Mitoxantrone resistance-associated protein; AltName: Full=CDw338; AltName: CD_antigen=CD338;						cellular iron ion homeostasis|urate metabolic process	integral to membrane|plasma membrane	ATP binding|heme transporter activity|protein homodimerization activity|xenobiotic-transporting ATPase activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Imatinib(DB00619)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nitrendipine(DB01054)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Topotecan(DB01030)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	89250514	89250521	+	Intron	DEL	TATATGTG	-	-	rs72176681	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89250514_89250521delTATATGTG	uc003hro.2	+											Homo sapiens, clone IMAGE:5199401, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	4	89278507	89278507	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89278507delA								PPM1K (72619 upstream) : HERC6 (21384 downstream)																																			---	---	---	---
HERC5	51191	broad.mit.edu	37	4	89409386	89409386	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89409386delT	uc003hrt.2	+						HERC5_uc011cdm.1_Intron	NM_016323	NP_057407			hect domain and RLD 5						innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)														---	---	---	---
HERC3	8916	broad.mit.edu	37	4	89528324	89528325	+	Intron	DEL	GT	-	-	rs34945630		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89528324_89528325delGT	uc003hrw.1	+						HERC3_uc003hrv.2_Intron|HERC3_uc011cdn.1_Intron	NM_014606	NP_055421			hect domain and RLD 3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)														---	---	---	---
FAM13A	10144	broad.mit.edu	37	4	90013495	90013495	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90013495delA	uc003hsh.1	-											Homo sapiens mRNA for KIAA0914 protein, partial cds.						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2																		---	---	---	---
GRID2	2895	broad.mit.edu	37	4	93952896	93952896	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93952896delT	uc011cdt.1	+						GRID2_uc010ikx.2_Intron|GRID2_uc011cdu.1_Intron|GRID2_uc011cdv.1_Intron	NM_001510	NP_001501			glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
GRID2	2895	broad.mit.edu	37	4	94581942	94581943	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94581942_94581943insT	uc011cdt.1	+						GRID2_uc011cdu.1_Intron	NM_001510	NP_001501			glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	97123655	97123656	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:97123655_97123656delGT								PDHA2 (361031 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	100278008	100278009	+	IGR	INS	-	AGA	AGA	rs140726322	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100278008_100278009insAGA								ADH1C (4091 upstream) : ADH7 (55409 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	100363879	100363879	+	IGR	DEL	A	-	-	rs34954347		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100363879delA								ADH7 (7354 upstream) : C4orf17 (68321 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	101715441	101715441	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101715441delA								EMCN (276191 upstream) : PPP3CA (229146 downstream)																																			---	---	---	---
BANK1	55024	broad.mit.edu	37	4	102880785	102880785	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102880785delT	uc003hvy.3	+						BANK1_uc003hvx.3_Intron|BANK1_uc010ill.2_Intron|BANK1_uc003hvz.3_Intron	NM_017935	NP_060405			B-cell scaffold protein with ankyrin repeats 1						B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	103059102	103059103	+	IGR	INS	-	A	A	rs5860716		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103059102_103059103insA								BANK1 (63135 upstream) : SLC39A8 (113095 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	103138206	103138207	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103138206_103138207insT								BANK1 (142239 upstream) : SLC39A8 (33991 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	106958245	106958246	+	IGR	INS	-	A	A	rs149595444	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106958245_106958246insA								NPNT (65418 upstream) : TBCK (8987 downstream)																																			---	---	---	---
TBCK	93627	broad.mit.edu	37	4	107092559	107092560	+	Intron	INS	-	A	A	rs142249370	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107092559_107092560insA	uc010ilv.2	-						TBCK_uc003hyb.2_Intron|TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907			TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5																		---	---	---	---
TBCK	93627	broad.mit.edu	37	4	107121765	107121765	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107121765delT	uc010ilv.2	-						TBCK_uc003hyb.2_Intron|TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907			TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5																		---	---	---	---
TBCK	93627	broad.mit.edu	37	4	107216073	107216074	+	Intron	DEL	TA	-	-	rs72174253		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107216073_107216074delTA	uc010ilv.2	-						TBCK_uc003hye.2_Intron|TBCK_uc003hyc.2_Intron|TBCK_uc003hyd.2_Intron|TBCK_uc003hyf.2_Intron	NM_001163435	NP_001156907			TBC domain-containing protein kinase-like							intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5																		---	---	---	---
DKK2	27123	broad.mit.edu	37	4	108045698	108045698	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108045698delC	uc010ilw.1	-											Homo sapiens dickkopf-2 mRNA, complete cds.						multicellular organismal development|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular space				ovary(3)|lung(1)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)														---	---	---	---
SGMS2	166929	broad.mit.edu	37	4	108781681	108781682	+	Intron	INS	-	T	T	rs111760095		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108781681_108781682insT	uc003hyl.3	+							NM_001136258	NP_001129730			sphingomyelin synthase 2						sphingomyelin biosynthetic process	integral to Golgi membrane|integral to plasma membrane	ceramide cholinephosphotransferase activity|kinase activity|sphingomyelin synthase activity			lung(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.95e-05)	Choline(DB00122)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	109277568	109277568	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109277568delC								LEF1 (187990 upstream) : LOC285456 (181778 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	109554935	109554936	+	IGR	DEL	TC	-	-	rs58393165		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109554935_109554936delTC								RPL34 (3298 upstream) : OSTC (16805 downstream)																																			---	---	---	---
CCDC109B	55013	broad.mit.edu	37	4	110553771	110553772	+	Intron	INS	-	TT	TT	rs149626795		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110553771_110553772insTT	uc011cfs.1	+						CCDC109B_uc010imf.2_Intron	NM_017918	NP_060388			coiled-coil domain containing 109B							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;6.65e-06)														---	---	---	---
EGF	1950	broad.mit.edu	37	4	110925370	110925371	+	Intron	DEL	AT	-	-	rs35428416		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110925370_110925371delAT	uc003hzy.3	+						EGF_uc011cfu.1_Intron|EGF_uc011cfv.1_Intron|EGF_uc010imk.2_Intron	NM_001963	NP_001954			epidermal growth factor precursor						angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)													---	---	---	---
ELOVL6	79071	broad.mit.edu	37	4	111046982	111046983	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111046982_111046983insA	uc003hzz.2	-						ELOVL6_uc003iaa.2_Intron	NM_001130721	NP_001124193			elongation of very long chain fatty acids-like						fatty acid elongation, saturated fatty acid|long-chain fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process		fatty acid elongase activity|protein binding			haematopoietic_and_lymphoid_tissue(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.00462)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	111577895	111577895	+	IGR	DEL	T	-	-	rs34073981		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111577895delT								PITX2 (14778 upstream) : MIR297 (203843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	111905519	111905519	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111905519delT								MIR297 (123716 upstream) : None (None downstream)																																			---	---	---	---
TIFA	92610	broad.mit.edu	37	4	113200833	113200833	+	Intron	DEL	T	-	-	rs66958877		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113200833delT	uc003ial.2	-							NM_052864	NP_443096			TRAF-interacting protein with a								protein binding			breast(1)	1		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00172)														---	---	---	---
CAMK2D	817	broad.mit.edu	37	4	114447569	114447570	+	Intron	INS	-	AT	AT	rs148980963	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114447569_114447570insAT	uc003ibi.2	-						CAMK2D_uc003ibj.2_Intron|CAMK2D_uc003ibk.2_Intron|CAMK2D_uc003ibo.3_Intron|CAMK2D_uc003ibm.2_Intron|CAMK2D_uc003ibn.2_Intron|CAMK2D_uc003ibl.2_Intron	NM_001221	NP_001212			calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|regulation of cell growth|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)	1		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	115401448	115401450	+	IGR	DEL	CTC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115401448_115401450delCTC								ARSJ (500570 upstream) : UGT8 (118161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	118478963	118478964	+	IGR	INS	-	A	A	rs141463641		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118478963_118478964insA								TRAM1L1 (472227 upstream) : NDST3 (475809 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	118596478	118596480	+	IGR	DEL	CAA	-	-	rs33990035		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118596478_118596480delCAA								TRAM1L1 (589742 upstream) : NDST3 (358293 downstream)																																			---	---	---	---
PDE5A	8654	broad.mit.edu	37	4	120524531	120524534	+	Intron	DEL	ATAC	-	-	rs145920744		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120524531_120524534delATAC	uc003idh.2	-						PDE5A_uc003idf.2_Intron|PDE5A_uc003idg.2_Intron	NM_001083	NP_001074			phosphodiesterase 5A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|zinc ion binding				0					Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Vardenafil(DB00862)													---	---	---	---
Unknown	0	broad.mit.edu	37	4	121560972	121560973	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121560972_121560973insA								MAD2L1 (572959 upstream) : PRDM5 (54957 downstream)																																			---	---	---	---
PRDM5	11107	broad.mit.edu	37	4	121738679	121738680	+	Intron	INS	-	AGAAAGAC	AGAAAGAC	rs146470386	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121738679_121738680insAGAAAGAC	uc003idn.2	-						PRDM5_uc003ido.2_Intron|PRDM5_uc010ine.2_Intron|PRDM5_uc010inf.2_Intron	NM_018699	NP_061169			PR domain containing 5						histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	122025542	122025543	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122025542_122025543insT								C4orf31 (31869 upstream) : TNIP3 (27023 downstream)																																			---	---	---	---
EXOSC9	5393	broad.mit.edu	37	4	122721708	122721709	+	5'Flank	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122721708_122721709insT	uc003iea.2	+						EXOSC9_uc003idz.2_5'Flank|EXOSC9_uc003ieb.2_5'Flank	NM_005033	NP_005024			exosome component 9 isoform 2						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|immune response|nuclear mRNA surveillance|nuclear polyadenylation-dependent rRNA catabolic process|positive regulation of cell growth|rRNA processing	cytosol|nuclear exosome (RNase complex)|nucleolus|nucleolus|nucleus	3'-5'-exoribonuclease activity|AU-rich element binding|protein binding				0																		---	---	---	---
BBS12	166379	broad.mit.edu	37	4	123665366	123665367	+	3'UTR	INS	-	A	A	rs147626341	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123665366_123665367insA	uc003ieu.2	+	2						NM_152618	NP_689831			Bardet-Biedl syndrome 12						cellular protein metabolic process	cilium	ATP binding			ovary(2)	2														Bardet-Biedl_syndrome				---	---	---	---
SPATA5	166378	broad.mit.edu	37	4	124119424	124119424	+	Intron	DEL	A	-	-	rs138641806		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:124119424delA	uc003iez.3	+							NM_145207	NP_660208			spermatogenesis associated 5						cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	126820006	126820013	+	IGR	DEL	CTTTCCTT	-	-	rs72085376		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126820006_126820013delCTTTCCTT								MIR2054 (391544 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	127477287	127477288	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:127477287_127477288delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	127992569	127992569	+	IGR	DEL	C	-	-	rs66906471		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:127992569delC								None (None upstream) : INTU (561551 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	128209325	128209326	+	IGR	INS	-	ACACACAC	ACACACAC	rs139484371	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128209325_128209326insACACACAC								None (None upstream) : INTU (344794 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	128242462	128242463	+	IGR	DEL	AC	-	-	rs144086450		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128242462_128242463delAC								None (None upstream) : INTU (311657 downstream)																																			---	---	---	---
MFSD8	256471	broad.mit.edu	37	4	128869054	128869055	+	Intron	DEL	CT	-	-	rs11942770	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128869054_128869055delCT	uc003ifp.2	-						MFSD8_uc011cgu.1_Intron|MFSD8_uc011cgv.1_Intron|MFSD8_uc011cgw.1_Intron|MFSD8_uc011cgx.1_Intron	NM_152778	NP_689991			major facilitator superfamily domain containing						cell death|transmembrane transport	integral to membrane|lysosomal membrane				ovary(1)|liver(1)	2																		---	---	---	---
MFSD8	256471	broad.mit.edu	37	4	128883873	128883873	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128883873delA	uc003ifp.2	-						MFSD8_uc011cgu.1_Intron|MFSD8_uc011cgv.1_Intron|MFSD8_uc011cgw.1_Intron|MFSD8_uc011cgx.1_Intron|C4orf29_uc003ifq.1_5'Flank|C4orf29_uc003ifr.2_5'Flank|C4orf29_uc003ifs.2_5'Flank	NM_152778	NP_689991			major facilitator superfamily domain containing						cell death|transmembrane transport	integral to membrane|lysosomal membrane				ovary(1)|liver(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	131077387	131077388	+	IGR	INS	-	A	A	rs148391076	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131077387_131077388insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	131470687	131470688	+	IGR	INS	-	A	A	rs142270289	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:131470687_131470688insA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	132456108	132456108	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:132456108delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	135195859	135195859	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:135195859delT								PABPC4L (72956 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137441346	137441346	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137441346delT								None (None upstream) : PCDH18 (998730 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	137445717	137445717	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:137445717delC								None (None upstream) : PCDH18 (994359 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	138021761	138021762	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138021761_138021762insT								None (None upstream) : PCDH18 (418314 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	139673354	139673354	+	IGR	DEL	G	-	-	rs140270926	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139673354delG								SLC7A11 (509851 upstream) : CCRN4L (263589 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	139742634	139742634	+	IGR	DEL	A	-	-	rs11361187		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139742634delA								SLC7A11 (579131 upstream) : CCRN4L (194309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	142106021	142106022	+	IGR	INS	-	TGTGTG	TGTGTG	rs150571670	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:142106021_142106022insTGTGTG								RNF150 (51405 upstream) : ZNF330 (36027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	143886242	143886243	+	IGR	INS	-	AA	AA	rs150939072	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143886242_143886243insAA								INPP4B (118638 upstream) : USP38 (219827 downstream)																																			---	---	---	---
SMAD1	4086	broad.mit.edu	37	4	146479231	146479232	+	3'UTR	INS	-	A	A	rs34142651		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146479231_146479232insA	uc003ikc.2	+	7					SMAD1_uc003ikd.2_3'UTR|SMAD1_uc010iov.2_3'UTR|SMAD1_uc011cic.1_3'UTR	NM_005900	NP_005891			Sma- and Mad-related protein 1						BMP signaling pathway|embryonic pattern specification|primary miRNA processing|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|nuclear inner membrane	co-SMAD binding|I-SMAD binding|identical protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity			ovary(1)	1	all_hematologic(180;0.151)															OREG0016348	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	4	148353634	148353635	+	IGR	DEL	TT	-	-	rs77660218		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148353634_148353635delTT								MIR548G (87765 upstream) : EDNRA (48272 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	150268261	150268276	+	IGR	DEL	AGGGAGGGAGGAAGGA	-	-	rs35688715		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150268261_150268276delAGGGAGGGAGGAAGGA								NR3C2 (904618 upstream) : DCLK2 (731804 downstream)																																			---	---	---	---
DCLK2	166614	broad.mit.edu	37	4	151019811	151019811	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151019811delT	uc003ilm.3	+						DCLK2_uc003iln.3_Intron|DCLK2_uc003ilo.3_Intron|DCLK2_uc003ilp.3_Intron	NM_001040260	NP_001035350			doublecortin-like kinase 2 isoform a						intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)																	---	---	---	---
SH3D19	152503	broad.mit.edu	37	4	152043663	152043664	+	Intron	INS	-	CACACA	CACACA	rs140816878	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152043663_152043664insCACACA	uc010ipl.1	-						SH3D19_uc003imb.2_Intron|SH3D19_uc003imc.2_Intron|SH3D19_uc003ime.2_Intron|SH3D19_uc010ipm.2_Intron	NM_001009555	NP_001009555			SH3 domain containing 19 isoform a						cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding			ovary(1)|skin(1)	2	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)																---	---	---	---
SH3D19	152503	broad.mit.edu	37	4	152127160	152127161	+	Intron	DEL	AC	-	-	rs34898017		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152127160_152127161delAC	uc010ipl.1	-						SH3D19_uc003ime.2_Intron|SH3D19_uc010ipm.2_Intron	NM_001009555	NP_001009555			SH3 domain containing 19 isoform a						cellular membrane organization|positive regulation of membrane protein ectodomain proteolysis|post-Golgi vesicle-mediated transport	cytosol|Golgi apparatus|nucleus|plasma membrane	proline-rich region binding			ovary(1)|skin(1)	2	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	152295197	152295198	+	IGR	DEL	TA	-	-	rs138673435		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152295197_152295198delTA								PRSS48 (82594 upstream) : FAM160A1 (35200 downstream)																																			---	---	---	---
TRIM2	23321	broad.mit.edu	37	4	154124547	154124548	+	Intron	DEL	AC	-	-	rs113323369		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154124547_154124548delAC	uc003ing.2	+						TRIM2_uc003inh.2_5'Flank	NM_001130067	NP_001123539			tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)														---	---	---	---
TRIM2	23321	broad.mit.edu	37	4	154142960	154142961	+	Intron	INS	-	AGGG	AGGG	rs147852477	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154142960_154142961insAGGG	uc003ing.2	+						TRIM2_uc003inh.2_Intron	NM_001130067	NP_001123539			tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	156746450	156746457	+	IGR	DEL	ACACACAC	-	-	rs3078481		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156746450_156746457delACACACAC								GUCY1B3 (17668 upstream) : ACCN5 (4424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	157512226	157512227	+	IGR	INS	-	AGAG	AGAG	rs140723927	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157512226_157512227insAGAG								CTSO (637178 upstream) : PDGFC (170537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	157947496	157947497	+	IGR	INS	-	T	T	rs111660420		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:157947496_157947497insT								PDGFC (54950 upstream) : GLRB (49780 downstream)																																			---	---	---	---
GLRB	2743	broad.mit.edu	37	4	158001945	158001946	+	Intron	DEL	TT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158001945_158001946delTT	uc003ipj.2	+							NM_000824	NP_000815			glycine receptor, beta isoform A precursor						nervous system development|neuropeptide signaling pathway|startle response	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|protein binding|receptor activity			skin(2)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Glycine(DB00145)													---	---	---	---
FNIP2	57600	broad.mit.edu	37	4	159725565	159725566	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159725565_159725566insT	uc003iqe.3	+						FNIP2_uc003iqd.2_Intron	NM_020840	NP_065891			folliculin interacting protein 2						DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)														---	---	---	---
FNIP2	57600	broad.mit.edu	37	4	159727192	159727193	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159727192_159727193insT	uc003iqe.3	+						FNIP2_uc003iqd.2_Intron	NM_020840	NP_065891			folliculin interacting protein 2						DNA damage response, signal transduction resulting in induction of apoptosis|protein phosphorylation|regulation of protein phosphorylation	cytoplasm	protein binding				0	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	161599443	161599444	+	IGR	INS	-	TG	TG	rs139991726	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161599443_161599444insTG								None (None upstream) : FSTL5 (705607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	161740266	161740267	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:161740266_161740267insT								None (None upstream) : FSTL5 (564784 downstream)																																			---	---	---	---
MARCH1	55016	broad.mit.edu	37	4	164663546	164663549	+	Intron	DEL	CCTC	-	-	rs72017607		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164663546_164663549delCCTC	uc003iqs.1	-							NM_017923	NP_060393			membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
MARCH1	55016	broad.mit.edu	37	4	164971841	164971841	+	Intron	DEL	T	-	-	rs149656090		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164971841delT	uc003iqs.1	-							NM_017923	NP_060393			membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---
Unknown	0	broad.mit.edu	37	4	165628858	165628859	+	IGR	INS	-	A	A	rs138546703	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165628858_165628859insA								MARCH1 (323656 upstream) : TRIM61 (246741 downstream)																																			---	---	---	---
TRIM61	391712	broad.mit.edu	37	4	165891648	165891649	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165891648_165891649insA	uc003iqw.2	-							NM_001012414	NP_001012414			tripartite motif-containing 61							intracellular	zinc ion binding			skin(1)	1	all_hematologic(180;0.221)	Prostate(90;0.109)		GBM - Glioblastoma multiforme(119;0.155)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	166580566	166580567	+	IGR	INS	-	A	A	rs35425758		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166580566_166580567insA								CPE (161085 upstream) : TLL1 (213843 downstream)																																			---	---	---	---
TLL1	7092	broad.mit.edu	37	4	167017363	167017366	+	Intron	DEL	GTGT	-	-	rs112241888		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167017363_167017366delGTGT	uc003irh.1	+						TLL1_uc011cjn.1_Intron|TLL1_uc011cjo.1_Intron	NM_012464	NP_036596			tolloid-like 1 precursor						cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)														---	---	---	---
SPOCK3	50859	broad.mit.edu	37	4	167740980	167740980	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167740980delC	uc003iri.1	-						SPOCK3_uc011cjp.1_Intron|SPOCK3_uc011cjq.1_Intron|SPOCK3_uc011cjr.1_Intron|SPOCK3_uc003irj.1_Intron|SPOCK3_uc011cjs.1_Intron|SPOCK3_uc011cjt.1_Intron|SPOCK3_uc011cju.1_Intron|SPOCK3_uc011cjv.1_Intron|SPOCK3_uc003irk.3_Intron	NM_016950	NP_058646			testican 3 isoform 2						signal transduction	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase inhibitor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_hematologic(180;0.221)	Prostate(90;0.0181)|Renal(120;0.0184)|Melanoma(52;0.0198)		GBM - Glioblastoma multiforme(119;0.02)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	168838765	168838767	+	IGR	DEL	AAT	-	-	rs36023935		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168838765_168838767delAAT								SPOCK3 (683024 upstream) : ANXA10 (174940 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	168880105	168880105	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:168880105delA								SPOCK3 (724364 upstream) : ANXA10 (133602 downstream)																																			---	---	---	---
PALLD	23022	broad.mit.edu	37	4	169600256	169600257	+	Intron	INS	-	GG	GG	rs148509302	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169600256_169600257insGG	uc011cjx.1	+						PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron	NM_016081	NP_057165			palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)										Pancreatic_Cancer_Familial_Clustering_of				---	---	---	---
NEK1	4750	broad.mit.edu	37	4	170522990	170522990	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170522990delA	uc003isb.1	-						NEK1_uc003isc.1_Intron|NEK1_uc003isd.1_Intron|NEK1_uc003ise.1_Intron|NEK1_uc003isf.1_Intron|NEK1_uc003isg.1_5'Flank	NM_012224	NP_036356			NIMA-related kinase 1						cell division|cilium assembly|mitosis	nucleus|pericentriolar material	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(3)|ovary(2)|large_intestine(1)	6		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)														---	---	---	---
GALNTL6	442117	broad.mit.edu	37	4	173063063	173063064	+	Intron	DEL	CC	-	-	rs33969520		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173063063_173063064delCC	uc003isv.2	+							NM_001034845	NP_001030017			N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
GALNTL6	442117	broad.mit.edu	37	4	173723266	173723266	+	Intron	DEL	C	-	-	rs79695507		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173723266delC	uc003isv.2	+							NM_001034845	NP_001030017			N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	4	175381450	175381450	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175381450delT								KIAA1712 (126919 upstream) : HPGD (29878 downstream)																																			---	---	---	---
ASB5	140458	broad.mit.edu	37	4	177152994	177152995	+	Intron	INS	-	CAAAACAAAA	CAAAACAAAA	rs148949995	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177152994_177152995insCAAAACAAAA	uc003iuq.1	-						ASB5_uc003iup.1_Intron	NM_080874	NP_543150			ankyrin repeat and SOCS box-containing protein						intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)														---	---	---	---
VEGFC	7424	broad.mit.edu	37	4	177622890	177622891	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177622890_177622891insA	uc003ius.1	-							NM_005429	NP_005420			vascular endothelial growth factor C						angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(5)	5		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	178206711	178206711	+	IGR	DEL	G	-	-	rs13144731	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178206711delG								VEGFC (492816 upstream) : NEIL3 (24280 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	180406803	180406803	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180406803delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	180486310	180486311	+	IGR	INS	-	C	C	rs140940052	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180486310_180486311insC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	180599687	180599688	+	IGR	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:180599687_180599688delAG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	181326857	181326858	+	IGR	INS	-	T	T	rs146429839	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181326857_181326858insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	182439191	182439192	+	IGR	INS	-	A	A	rs148140028	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:182439191_182439192insA								None (None upstream) : MGC45800 (620967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	183022406	183022417	+	IGR	DEL	AGGAAGGAAAGA	-	-	rs112237248		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183022406_183022417delAGGAAGGAAAGA								None (None upstream) : MGC45800 (37742 downstream)																																			---	---	---	---
ODZ3	55714	broad.mit.edu	37	4	183540582	183540583	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183540582_183540583insA	uc003ivd.1	+							NM_001080477	NP_001073946			odz, odd Oz/ten-m homolog 3						signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	183768091	183768092	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183768091_183768092delGT								ODZ3 (43914 upstream) : DCTD (43153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	183862870	183862871	+	IGR	DEL	CA	-	-	rs67086610		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183862870_183862871delCA								DCTD (24240 upstream) : FAM92A3 (95947 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	184272647	184272648	+	IGR	DEL	TT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184272647_184272648delTT								WWC2 (30720 upstream) : CDKN2AIP (93141 downstream)																																			---	---	---	---
UFSP2	55325	broad.mit.edu	37	4	186328912	186328912	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186328912delA	uc003ixo.2	-						UFSP2_uc003ixn.2_Intron|UFSP2_uc003ixq.2_Intron|UFSP2_uc003ixp.2_Intron	NM_018359	NP_060829			UFM1-specific peptidase 2							endoplasmic reticulum|nucleus	small conjugating protein-specific protease activity				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	186490079	186490080	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186490079_186490080insT								PDLIM3 (33367 upstream) : SORBS2 (16519 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	187497583	187497583	+	IGR	DEL	G	-	-	rs77063015		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187497583delG								MTNR1A (21046 upstream) : FAT1 (11355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	189009256	189009256	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189009256delA								ZFP42 (83057 upstream) : TRIML2 (3171 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	189104768	189104769	+	IGR	DEL	TG	-	-	rs67795032		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189104768_189104769delTG								TRIML1 (36119 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190544300	190544301	+	IGR	INS	-	CCCT	CCCT	rs33912339		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190544300_190544301insCCCT								None (None upstream) : FRG1 (317673 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190588707	190588716	+	IGR	DEL	GTGTGTGTAG	-	-	rs67626614		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190588707_190588716delGTGTGTGTAG								None (None upstream) : FRG1 (273258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190596438	190596439	+	IGR	INS	-	TCCTTGG	TCCTTGG	rs140220951		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190596438_190596439insTCCTTGG								None (None upstream) : FRG1 (265535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190651353	190651354	+	IGR	INS	-	TT	TT	rs72718675	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190651353_190651354insTT								None (None upstream) : FRG1 (210620 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190661500	190661501	+	IGR	INS	-	T	T	rs140481215		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190661500_190661501insT								None (None upstream) : FRG1 (200473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190672200	190672202	+	IGR	DEL	CTC	-	-	rs3064882		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190672200_190672202delCTC								None (None upstream) : FRG1 (189772 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190677797	190677801	+	IGR	DEL	ATATT	-	-	rs66718667		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190677797_190677801delATATT								None (None upstream) : FRG1 (184173 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	4	190758367	190758368	+	IGR	INS	-	CAC	CAC			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190758367_190758368insCAC								None (None upstream) : FRG1 (103606 downstream)																																			---	---	---	---
ZDHHC11	79844	broad.mit.edu	37	5	816304	816304	+	Intron	DEL	C	-	-	rs57168940		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:816304delC	uc011cma.1	-						ZDHHC11_uc010itc.2_Intron|ZDHHC11_uc003jbj.2_Intron	NM_024786	NP_079062			zinc finger, DHHC-type containing 11							integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)															---	---	---	---
TERT	7015	broad.mit.edu	37	5	1276304	1276305	+	Intron	DEL	CC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1276304_1276305delCC	uc003jcb.1	-						TERT_uc003jbz.1_Intron|TERT_uc003jca.1_Intron|TERT_uc003jcc.1_Intron|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983			telomerase reverse transcriptase isoform 1						anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)											TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				---	---	---	---
Unknown	0	broad.mit.edu	37	5	1648913	1648914	+	IGR	INS	-	A	A	rs139517504	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1648913_1648914insA								LOC728613 (14793 upstream) : MRPL36 (149586 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	2118608	2118613	+	IGR	DEL	GCACGC	-	-	rs143218989	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2118608_2118613delGCACGC								IRX4 (235728 upstream) : IRX2 (627668 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3358309	3358309	+	IGR	DEL	C	-	-	rs77579287		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3358309delC								C5orf38 (602797 upstream) : IRX1 (237859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	3428543	3428543	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3428543delG	uc003jdd.2	-											Homo sapiens cDNA clone IMAGE:4823480.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	3476743	3476743	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3476743delG	uc003jdd.2	-											Homo sapiens cDNA clone IMAGE:4823480.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	3504966	3504967	+	Intron	DEL	TG	-	-	rs111344873		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3504966_3504967delTG	uc003jdd.2	-											Homo sapiens cDNA clone IMAGE:4823480.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	3701165	3701166	+	IGR	INS	-	TTT	TTT	rs140577401	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3701165_3701166insTTT								IRX1 (99649 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	4487077	4487078	+	IGR	INS	-	T	T	rs141385620	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4487077_4487078insT								IRX1 (885561 upstream) : LOC340094 (547394 downstream)																																			---	---	---	---
LOC340094	340094	broad.mit.edu	37	5	5043429	5043432	+	Intron	DEL	AAAG	-	-	rs66711034		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5043429_5043432delAAAG	uc003jdg.2	+						LOC340094_uc003jdh.2_Intron	NR_026994				Homo sapiens hypothetical protein LOC340094, mRNA (cDNA clone IMAGE:5295461).												0																		---	---	---	---
ADAMTS16	170690	broad.mit.edu	37	5	5250821	5250824	+	Intron	DEL	TCTG	-	-	rs2964416		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5250821_5250824delTCTG	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron	NM_139056	NP_620687			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	5714683	5714684	+	IGR	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5714683_5714684delCT								KIAA0947 (224346 upstream) : FLJ33360 (595870 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	5740117	5740117	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5740117delG								KIAA0947 (249780 upstream) : FLJ33360 (570437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	6297241	6297241	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6297241delT								KIAA0947 (806904 upstream) : FLJ33360 (13313 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	6422674	6422674	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6422674delG								MED10 (44035 upstream) : UBE2QL1 (26062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	6544111	6544112	+	IGR	DEL	CA	-	-	rs66808203		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6544111_6544112delCA								UBE2QL1 (51406 upstream) : LOC255167 (38175 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	7965650	7965650	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7965650delA								MTRR (64417 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	8287043	8287046	+	IGR	DEL	CTCC	-	-	rs139964067		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8287043_8287046delCTCC								MTRR (385810 upstream) : SEMA5A (748092 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	9622286	9622287	+	IGR	INS	-	TTTG	TTTG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9622286_9622287insTTTG								SNORD123 (73260 upstream) : TAS2R1 (6822 downstream)																																			---	---	---	---
LOC285692	285692	broad.mit.edu	37	5	9717800	9717801	+	Intron	INS	-	A	A	rs148965965	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9717800_9717801insA	uc003jen.2	-							NR_027112				Homo sapiens clone TEE10 Cri-du-chat region mRNA.												0																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11163030	11163031	+	Intron	INS	-	AC	AC	rs142257103	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11163030_11163031insAC	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11501749	11501749	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11501749delG	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
CTNND2	1501	broad.mit.edu	37	5	11509469	11509470	+	Intron	INS	-	A	A	rs141854249	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11509469_11509470insA	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323			catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---
TRIO	7204	broad.mit.edu	37	5	14335131	14335132	+	Intron	INS	-	GT	GT	rs144645388	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14335131_14335132insGT	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc011cna.1_Intron|TRIO_uc003jfh.1_Intron	NM_007118	NP_009049			triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)																	---	---	---	---
LOC285696	285696	broad.mit.edu	37	5	17151066	17151077	+	Intron	DEL	TTTTCTTTTCTT	-	-	rs72327936		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17151066_17151077delTTTTCTTTTCTT	uc003jfw.2	-							NR_027253				Homo sapiens cDNA FLJ34047 fis, clone FCBBF3000001.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	18181588	18181589	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18181588_18181589insA								BASP1 (904653 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	18200104	18200105	+	IGR	DEL	CA	-	-	rs34928024		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:18200104_18200105delCA								BASP1 (923169 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	23370332	23370333	+	IGR	DEL	TG	-	-	rs72015611		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23370332_23370333delTG								CDH12 (516601 upstream) : PRDM9 (137391 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	23760213	23760213	+	IGR	DEL	T	-	-	rs33926714		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23760213delT								PRDM9 (231509 upstream) : CDH10 (726997 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	23995258	23995259	+	Intron	DEL	TG	-	-	rs70963569		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23995258_23995259delTG	uc003jgq.1	+											Homo sapiens cDNA FLJ34836 fis, clone NT2NE2010400.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	25124763	25124763	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:25124763delC								CDH10 (479852 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	26553534	26553535	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26553534_26553535delAC								None (None upstream) : CDH9 (327174 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	27450728	27450735	+	IGR	DEL	CACACACA	-	-	rs111363634		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27450728_27450735delCACACACA								CDH9 (412039 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	27804724	27804727	+	IGR	DEL	CACA	-	-	rs71605171		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27804724_27804727delCACA								CDH9 (766035 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	28516996	28516996	+	IGR	DEL	A	-	-	rs33993510		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28516996delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	31355958	31355959	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31355958_31355959insT								CDH6 (30721 upstream) : RNASEN (44643 downstream)																																			---	---	---	---
RNASEN	29102	broad.mit.edu	37	5	31498964	31498964	+	Intron	DEL	A	-	-	rs111545757		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31498964delA	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron|RNASEN_uc003jhi.2_Intron|RNASEN_uc010iui.1_Intron	NM_013235	NP_037367			ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0																		---	---	---	---
PDZD2	23037	broad.mit.edu	37	5	31759648	31759648	+	Intron	DEL	T	-	-	rs72391201		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31759648delT	uc003jhl.2	+							NM_178140	NP_835260			PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	32120839	32120839	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32120839delA								PDZD2 (9802 upstream) : GOLPH3 (3985 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	33510993	33510994	+	IGR	DEL	GT	-	-	rs113454511		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33510993_33510994delGT								TARS (42799 upstream) : ADAMTS12 (16293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	34619770	34619771	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34619770_34619771insA								C1QTNF3 (576453 upstream) : RAI14 (36662 downstream)																																			---	---	---	---
UGT3A1	133688	broad.mit.edu	37	5	35972597	35972598	+	Intron	DEL	GT	-	-	rs71699579		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35972597_35972598delGT	uc003jjv.1	-						UGT3A1_uc003jjw.1_Intron|UGT3A1_uc011coq.1_Intron|UGT3A1_uc011cor.1_Intron|UGT3A1_uc003jjy.1_Intron	NM_152404	NP_689617			UDP glycosyltransferase 3 family, polypeptide A1							integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
UGT3A1	133688	broad.mit.edu	37	5	35990207	35990208	+	Intron	INS	-	G	G	rs7712116		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35990207_35990208insG	uc003jjv.1	-						UGT3A1_uc003jjw.1_Intron|UGT3A1_uc011coq.1_Intron|UGT3A1_uc011cor.1_Intron|UGT3A1_uc003jjy.1_Intron	NM_152404	NP_689617			UDP glycosyltransferase 3 family, polypeptide A1							integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	38184174	38184177	+	IGR	DEL	TGTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38184174_38184177delTGTG								GDNF (344392 upstream) : EGFLAM (74356 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	38655341	38655341	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38655341delT	uc003jlj.2	+											Homo sapiens cDNA clone IMAGE:4829282.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	39552200	39552201	+	IGR	INS	-	TG	TG	rs139240644	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39552200_39552201insTG								DAB2 (126865 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	39607599	39607599	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39607599delC								DAB2 (182264 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	41098236	41098236	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41098236delT								HEATR7B2 (26792 upstream) : C6 (44100 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	42331039	42331040	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42331039_42331040delTG								FBXO4 (389376 upstream) : GHR (92986 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	42356389	42356389	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42356389delA								FBXO4 (414726 upstream) : GHR (67637 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	44074314	44074314	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44074314delT								NNT (368647 upstream) : FGF10 (230783 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	44843617	44843618	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44843617_44843618delTC								MRPS30 (28003 upstream) : HCN1 (415735 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	46277728	46277729	+	IGR	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46277728_46277729insG								HCN1 (581508 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	46278787	46278789	+	IGR	DEL	CTT	-	-	rs74468978		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:46278787_46278789delCTT								HCN1 (582567 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	50521471	50521472	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50521471_50521472insT								PARP8 (383302 upstream) : ISL1 (157486 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	54524912	54524912	+	5'Flank	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54524912delA	uc003jpu.1	-											full-length cDNA clone CS0DK002YL21 of HeLa cells Cot 25-normalized of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	58234502	58234502	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58234502delT								RAB3C (87097 upstream) : PDE4D (30364 downstream)																																			---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58390828	58390828	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58390828delA	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc010iwi.1_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
PDE4D	5144	broad.mit.edu	37	5	58847298	58847301	+	Intron	DEL	CACA	-	-	rs66713822		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58847298_58847301delCACA	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron	NM_001104631	NP_001098101			phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)													---	---	---	---
ERCC8	1161	broad.mit.edu	37	5	60201113	60201117	+	Intron	DEL	TTCAG	-	-	rs4647096		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60201113_60201117delTTCAG	uc003jsm.3	-						ERCC8_uc003jsk.2_Intron|ERCC8_uc003jsl.3_Intron|ERCC8_uc011cqp.1_Intron|ERCC8_uc003jsn.3_Intron	NM_000082	NP_000073			excision repair cross-complementing rodent						positive regulation of DNA repair|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein polyubiquitination|response to oxidative stress|response to UV|response to UV|transcription-coupled nucleotide-excision repair	Cul4A-RING ubiquitin ligase complex|nuclear matrix|nucleoplasm|nucleotide-excision repair complex|soluble fraction	protein binding|protein complex binding				0		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)											Direct_reversal_of_damage|NER					---	---	---	---
Unknown	0	broad.mit.edu	37	5	61058149	61058149	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61058149delT								FLJ37543 (55787 upstream) : KIF2A (543840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	61309562	61309563	+	IGR	INS	-	A	A	rs151202419	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61309562_61309563insA								FLJ37543 (307200 upstream) : KIF2A (292426 downstream)																																			---	---	---	---
IPO11	51194	broad.mit.edu	37	5	61902804	61902804	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61902804delT	uc003jtc.2	+						IPO11_uc011cqr.1_Intron|IPO11_uc010iwr.2_Intron|IPO11_uc003jte.2_Intron	NM_016338	NP_057422			Ran binding protein 11 isoform 2							cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)														---	---	---	---
MAST4	375449	broad.mit.edu	37	5	66251041	66251042	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66251041_66251042insA	uc003jut.1	+						MAST4_uc003jur.3_Intron|MAST4_uc010iwz.2_Intron|MAST4_uc003jus.2_Intron	NM_015183	NP_055998			microtubule associated serine/threonine kinase							cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	67279027	67279027	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67279027delG								CD180 (786410 upstream) : PIK3R1 (232577 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	67462298	67462299	+	IGR	DEL	TT	-	-	rs62357297		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67462298_67462299delTT								CD180 (969681 upstream) : PIK3R1 (49305 downstream)																																			---	---	---	---
CDK7	1022	broad.mit.edu	37	5	68529506	68529509	+	5'Flank	DEL	AAAC	-	-	rs72115334		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68529506_68529509delAAAC	uc003jvs.3	+						CDK7_uc010ixd.1_5'Flank|CDK7_uc003jvt.3_5'Flank|CDK7_uc003jvu.3_5'Flank	NM_001799	NP_001790			cyclin-dependent kinase 7						androgen receptor signaling pathway|cell division|cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex|mitochondrion	androgen receptor binding|ATP binding|cyclin-dependent protein kinase activity|DNA-dependent ATPase activity|protein C-terminus binding|RNA polymerase II carboxy-terminal domain kinase activity|transcription coactivator activity			lung(1)	1		Lung NSC(167;7.26e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.98e-56)|Epithelial(20;3.54e-52)|all cancers(19;9.11e-48)|Lung(70;0.0185)									NER					---	---	---	---
Unknown	0	broad.mit.edu	37	5	70527356	70527356	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70527356delG	uc010iyn.2	-						uc011crx.1_Intron					Homo sapiens cDNA FLJ78390 complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	70713338	70713339	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70713338_70713339insT	uc010iyu.1	-						uc003kbl.1_Intron					Homo sapiens cDNA FLJ41874 fis, clone OCBBF2019327.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	71029836	71029838	+	IGR	DEL	CTC	-	-	rs34704845		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71029836_71029838delCTC								CARTPT (12964 upstream) : MAP1B (373280 downstream)																																			---	---	---	---
RGNEF	64283	broad.mit.edu	37	5	73114200	73114203	+	Intron	DEL	TTAT	-	-	rs5868698		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73114200_73114203delTTAT	uc011csq.1	+						RGNEF_uc003kcx.2_Intron|RGNEF_uc003kcy.1_Intron|RGNEF_uc010izf.2_Intron|RGNEF_uc011csr.1_Intron	NM_001080479	NP_001073948			Rho-guanine nucleotide exchange factor						cell differentiation|intracellular signal transduction|regulation of Rho protein signal transduction	cytoplasm|plasma membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|RNA binding				0		Lung NSC(167;0.0378)|all_lung(232;0.04)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.25e-51)														---	---	---	---
FAM169A	26049	broad.mit.edu	37	5	74184199	74184200	+	Intron	INS	-	A	A	rs34804379		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74184199_74184200insA	uc010izm.2	-							NM_015566	NP_056381			hypothetical protein LOC26049												0																		---	---	---	---
IQGAP2	10788	broad.mit.edu	37	5	75931613	75931614	+	Intron	INS	-	A	A	rs138224065	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75931613_75931614insA	uc003kek.2	+						IQGAP2_uc010izv.2_Intron|IQGAP2_uc011csv.1_Intron|IQGAP2_uc003kel.2_Intron	NM_006633	NP_006624			IQ motif containing GTPase activating protein 2						small GTPase mediated signal transduction	actin cytoskeleton	actin binding|calmodulin binding|GTPase inhibitor activity|Ras GTPase activator activity			ovary(6)|central_nervous_system(1)	7		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	76244958	76244958	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76244958delA								S100Z (27903 upstream) : CRHBP (3722 downstream)																																			---	---	---	---
LHFPL2	10184	broad.mit.edu	37	5	77874409	77874412	+	Intron	DEL	CACA	-	-	rs113306386		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77874409_77874412delCACA	uc003kfo.2	-							NM_005779	NP_005770			lipoma HMGIC fusion partner-like 2							integral to membrane					0		all_lung(232;0.000409)|Lung NSC(167;0.00108)|Ovarian(174;0.0107)|Prostate(461;0.218)		OV - Ovarian serous cystadenocarcinoma(54;6.48e-46)|Epithelial(54;8.43e-42)|all cancers(79;1.42e-36)														---	---	---	---
HOMER1	9456	broad.mit.edu	37	5	78671727	78671728	+	3'UTR	INS	-	T	T	rs71763510		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78671727_78671728insT	uc003kfy.2	-	9					HOMER1_uc010jab.2_3'UTR|HOMER1_uc010jac.2_3'UTR|HOMER1_uc010jad.2_3'UTR	NM_004272	NP_004263			homer 1						activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane					0		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	79131001	79131001	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79131001delC								CMYA5 (34953 upstream) : MTX3 (141540 downstream)																																			---	---	---	---
SERINC5	256987	broad.mit.edu	37	5	79486931	79486932	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79486931_79486932insA	uc003kgj.2	-						SERINC5_uc003kgk.2_Intron|SERINC5_uc003kgl.2_Intron|SERINC5_uc003kgm.2_Intron|SERINC5_uc011ctj.1_Intron	NM_178276	NP_840060			developmentally regulated protein TPO1						phosphatidylserine metabolic process|phospholipid biosynthetic process|positive regulation of transferase activity	endoplasmic reticulum membrane|integral to membrane				ovary(1)	1		Lung NSC(167;0.00328)|all_lung(232;0.00356)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;2.93e-46)|Epithelial(54;5.59e-40)|all cancers(79;1.89e-34)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	80198086	80198086	+	IGR	DEL	T	-	-	rs11333499		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80198086delT								MSH3 (25453 upstream) : RASGRF2 (58472 downstream)																																			---	---	---	---
RASGRF2	5924	broad.mit.edu	37	5	80324679	80324679	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80324679delC	uc003kha.1	+						RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840			Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)														---	---	---	---
RASGRF2	5924	broad.mit.edu	37	5	80404651	80404652	+	Intron	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:80404651_80404652delCT	uc003kha.1	+						RASGRF2_uc011ctn.1_Intron	NM_006909	NP_008840			Ras protein-specific guanine						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|endoplasmic reticulum membrane|plasma membrane	protein binding|Rho guanyl-nucleotide exchange factor activity			breast(5)|ovary(3)|large_intestine(2)|central_nervous_system(1)|skin(1)	12		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)														---	---	---	---
SSBP2	23635	broad.mit.edu	37	5	81032093	81032093	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81032093delA	uc003kho.2	-						SSBP2_uc003khn.2_Intron|SSBP2_uc003khp.2_Intron|SSBP2_uc011ctp.1_Intron|SSBP2_uc011ctq.1_Intron|SSBP2_uc011ctr.1_Intron	NM_012446	NP_036578			single-stranded DNA binding protein 2						regulation of transcription, DNA-dependent	cytoplasm|nucleus	single-stranded DNA binding		SSBP2/JAK2(4)	haematopoietic_and_lymphoid_tissue(4)|skin(1)	5		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	81568501	81568502	+	IGR	INS	-	CA	CA	rs151135948	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81568501_81568502insCA								ATG10 (17290 upstream) : RPS23 (639 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	81966170	81966171	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81966170_81966171insT								ATP6AP1L (352024 upstream) : TMEM167A (382496 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	82020862	82020863	+	IGR	INS	-	TGT	TGT	rs148969170	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82020862_82020863insTGT								ATP6AP1L (406716 upstream) : TMEM167A (327804 downstream)																																			---	---	---	---
HAPLN1	1404	broad.mit.edu	37	5	82971995	82972014	+	5'Flank	DEL	ACAGAGATACGCACACATAT	-	-	rs71594677		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82971995_82972014delACAGAGATACGCACACATAT	uc003kim.2	-						HAPLN1_uc003kin.2_Intron	NM_001884	NP_001875			hyaluronan and proteoglycan link protein 1						cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			large_intestine(3)|ovary(1)|skin(1)	5		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	86546158	86546159	+	IGR	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86546158_86546159insC								COX7C (629577 upstream) : RASA1 (17992 downstream)																																			---	---	---	---
MEF2C	4208	broad.mit.edu	37	5	88177543	88177544	+	Intron	INS	-	T	T	rs5869446		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88177543_88177544insT	uc003kjj.2	-						MEF2C_uc003kjk.2_Intron|MEF2C_uc003kjm.2_Intron|MEF2C_uc003kjl.2_Intron	NM_002397	NP_002388			myocyte enhancer factor 2C isoform 1						apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			lung(3)|breast(2)|ovary(1)|large_intestine(1)	7		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)											HNSCC(66;0.2)			---	---	---	---
Unknown	0	broad.mit.edu	37	5	88269416	88269417	+	IGR	INS	-	AA	AA	rs11422905		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88269416_88269417insAA								MEF2C (69547 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	91632686	91632687	+	Intron	DEL	GC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:91632686_91632687delGC	uc003kkb.1	+											Homo sapiens cDNA FLJ31923 fis, clone NT2RP7005323.																														---	---	---	---
MCTP1	79772	broad.mit.edu	37	5	94405404	94405405	+	Intron	INS	-	T	T	rs141736018		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94405404_94405405insT	uc003kkx.2	-						MCTP1_uc003kkv.2_Intron|MCTP1_uc003kkw.2_Intron|MCTP1_uc003kkz.2_Intron	NM_024717	NP_078993			multiple C2 domains, transmembrane 1 isoform L						calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)														---	---	---	---
RHOBTB3	22836	broad.mit.edu	37	5	95072935	95072935	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95072935delA	uc003klm.2	+						RHOBTB3_uc003klk.1_Intron	NM_014899	NP_055714			rho-related BTB domain containing 3						retrograde transport, endosome to Golgi	Golgi apparatus	ATP binding|ATPase activity|Rab GTPase binding			lung(1)|skin(1)	2		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	95495672	95495672	+	IGR	DEL	A	-	-	rs10541724		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95495672delA								MIR583 (80756 upstream) : PCSK1 (230447 downstream)																																			---	---	---	---
LNPEP	4012	broad.mit.edu	37	5	96307049	96307050	+	Intron	INS	-	TG	TG	rs3076561		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96307049_96307050insTG	uc003kmv.1	+						LNPEP_uc003kmw.1_Intron|uc003kmx.1_5'Flank	NM_005575	NP_005566			leucyl/cystinyl aminopeptidase isoform 1						cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)														---	---	---	---
LIX1	167410	broad.mit.edu	37	5	96475933	96475934	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96475933_96475934delTG	uc003kmy.3	-							NM_153234	NP_694966			limb expression 1											ovary(1)	1		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	97491793	97491796	+	IGR	DEL	TGTT	-	-	rs10567161	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97491793_97491796delTGTT								RIOK2 (972788 upstream) : RGMB (613203 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	98694782	98694783	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98694782_98694783insA								CHD1 (432544 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	99292304	99292305	+	IGR	INS	-	T	T	rs149426997	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99292304_99292305insT								None (None upstream) : LOC100133050 (422904 downstream)																																			---	---	---	---
FAM174A	345757	broad.mit.edu	37	5	99873954	99873955	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:99873954_99873955delTG	uc003knj.1	+							NM_198507	NP_940909			family with sequence similarity 174, member A							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	103602290	103602290	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:103602290delT								NUDT12 (703800 upstream) : RAB9BP1 (832885 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	104663997	104663998	+	IGR	DEL	TG	-	-	rs72169845		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104663997_104663998delTG								RAB9BP1 (228199 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	106317425	106317426	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:106317425_106317426insT								None (None upstream) : EFNA5 (395165 downstream)																																			---	---	---	---
PJA2	9867	broad.mit.edu	37	5	108681058	108681058	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108681058delA	uc003kos.3	-							NM_014819	NP_055634			praja 2, RING-H2 motif containing						long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)														---	---	---	---
TMEM232	642987	broad.mit.edu	37	5	109673193	109673194	+	Intron	INS	-	TC	TC	rs138446353	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109673193_109673194insTC	uc003kow.1	-						TMEM232_uc003kov.1_Intron	NM_001039763	NP_001034852			transmembrane protein 232							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	5	110482197	110482198	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110482197_110482198delTC								WDR36 (15996 upstream) : CAMK4 (77450 downstream)																																			---	---	---	---
C5orf13	9315	broad.mit.edu	37	5	111145565	111145566	+	Intron	INS	-	GC	GC	rs139310678	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111145565_111145566insGC	uc011cvr.1	-						C5orf13_uc011cvs.1_Intron	NM_001142475	NP_001135947			neuronal protein 3.1 isoform c							cytoplasm				skin(1)	1		all_cancers(142;0.00597)|all_epithelial(76;0.000144)|Prostate(80;0.0115)|Colorectal(10;0.0446)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;5.45e-09)|Epithelial(69;2e-08)|all cancers(49;1.9e-06)|COAD - Colon adenocarcinoma(37;0.0514)|Colorectal(14;0.0629)														---	---	---	---
C5orf13	9315	broad.mit.edu	37	5	111145567	111145568	+	Intron	INS	-	GT	GT	rs34883733		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111145567_111145568insGT	uc011cvr.1	-						C5orf13_uc011cvs.1_Intron	NM_001142475	NP_001135947			neuronal protein 3.1 isoform c							cytoplasm				skin(1)	1		all_cancers(142;0.00597)|all_epithelial(76;0.000144)|Prostate(80;0.0115)|Colorectal(10;0.0446)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;5.45e-09)|Epithelial(69;2e-08)|all cancers(49;1.9e-06)|COAD - Colon adenocarcinoma(37;0.0514)|Colorectal(14;0.0629)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	111989395	111989395	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111989395delT								FLJ11235 (232722 upstream) : APC (53823 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	112028432	112028433	+	IGR	DEL	AA	-	-	rs11241180		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112028432_112028433delAA								FLJ11235 (271759 upstream) : APC (14785 downstream)																																			---	---	---	---
APC	324	broad.mit.edu	37	5	112047954	112047955	+	Intron	INS	-	T	T	rs148752571	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112047954_112047955insT	uc010jby.2	+						APC_uc011cvt.1_Intron	NM_001127511	NP_001120983			adenomatous polyposis coli						canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity			large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)			12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			---	---	---	---
MCC	4163	broad.mit.edu	37	5	112474534	112474534	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112474534delA	uc003kqj.3	-						MCC_uc003kqk.3_Intron|MCC_uc003kql.3_Intron|MCC_uc011cwb.1_Intron|MCC_uc010jcd.1_Intron	NM_002387	NP_002378			mutated in colorectal cancers isoform 2						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane	protein binding|receptor activity			ovary(1)	1		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	113439440	113439440	+	IGR	DEL	G	-	-	rs138083333		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113439440delG								YTHDC2 (508461 upstream) : KCNN2 (258576 downstream)																																			---	---	---	---
FEM1C	56929	broad.mit.edu	37	5	114872268	114872269	+	Intron	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114872268_114872269insG	uc003krb.1	-							NM_020177	NP_064562			feminization 1 homolog a							cytoplasm				breast(2)|ovary(1)	3		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	116462766	116462766	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116462766delT								SEMA6A (552215 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	116823636	116823637	+	Intron	INS	-	A	A	rs150634689	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116823636_116823637insA	uc003kry.2	+											Homo sapiens cDNA clone IMAGE:5297581.																														---	---	---	---
Unknown	0	broad.mit.edu	37	5	117082736	117082747	+	IGR	DEL	TGTGTGTGTGTG	-	-	rs72296308		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117082736_117082747delTGTGTGTGTGTG								None (None upstream) : None (None downstream)																																			---	---	---	---
PRR16	51334	broad.mit.edu	37	5	119945772	119945772	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:119945772delA	uc003ksq.2	+						PRR16_uc003ksp.2_Intron	NM_016644	NP_057728			proline rich 16											pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	120279640	120279640	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120279640delT								PRR16 (256678 upstream) : FTMT (908010 downstream)																																			---	---	---	---
SRFBP1	153443	broad.mit.edu	37	5	121306783	121306784	+	Intron	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121306783_121306784delAG	uc003kst.1	+							NM_152546	NP_689759			serum response factor binding protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	perinuclear region of cytoplasm					0		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	121459239	121459240	+	IGR	INS	-	TG	TG	rs141056674	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121459239_121459240insTG								LOX (45184 upstream) : ZNF474 (5975 downstream)																																			---	---	---	---
SNX24	28966	broad.mit.edu	37	5	122230669	122230669	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122230669delT	uc011cwo.1	+						SNX24_uc003ktf.2_Intron|SNX24_uc010jcy.2_Intron	NM_014035	NP_054754			SBBI31 protein						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0		Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)														---	---	---	---
SNX24	28966	broad.mit.edu	37	5	122288752	122288753	+	Intron	INS	-	CTTTCTTTCTTC	CTTTCTTTCTTC	rs138020508	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122288752_122288753insCTTTCTTTCTTC	uc011cwo.1	+						SNX24_uc003ktf.2_Intron|SNX24_uc010jcy.2_Intron	NM_014035	NP_054754			SBBI31 protein						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding				0		Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000654)|Epithelial(69;0.0016)|all cancers(49;0.0139)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	122379422	122379422	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:122379422delC								PPIC (6997 upstream) : PRDM6 (45419 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	123767326	123767326	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123767326delA								CSNK1G3 (814864 upstream) : ZNF608 (205284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	125162739	125162740	+	IGR	INS	-	G	G	rs143145994	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125162739_125162740insG								None (None upstream) : GRAMD3 (533048 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	125451024	125451025	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:125451024_125451025delAC								None (None upstream) : GRAMD3 (244763 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	127079803	127079804	+	IGR	INS	-	A	A	rs77914650		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127079803_127079804insA								CTXN3 (85482 upstream) : FLJ33630 (196331 downstream)																																			---	---	---	---
FBN2	2201	broad.mit.edu	37	5	127611135	127611135	+	Intron	DEL	T	-	-	rs72152773		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127611135delT	uc003kuu.2	-							NM_001999	NP_001990			fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	129152340	129152341	+	IGR	INS	-	CG	CG	rs140537753	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129152340_129152341insCG								ADAMTS19 (77964 upstream) : CHSY3 (88182 downstream)																																			---	---	---	---
IL4	3565	broad.mit.edu	37	5	132011754	132011754	+	Intron	DEL	T	-	-	rs2243256		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132011754delT	uc003kxk.1	+						IL4_uc003kxl.1_Intron	NM_000589	NP_000580			interleukin 4 isoform 1 precursor						B cell differentiation|cellular defense response|chemotaxis|cholesterol metabolic process|connective tissue growth factor biosynthetic process|negative regulation of apoptosis|negative regulation of osteoclast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of interleukin-13 production|positive regulation of isotype switching to IgE isotypes|positive regulation of isotype switching to IgG isotypes|positive regulation of MHC class II biosynthetic process|positive regulation of T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|T-helper 2 cell cytokine production	extracellular space	cytokine activity|growth factor activity|interleukin-4 receptor binding				0		all_cancers(142;2.81e-05)|all_lung(232;1.47e-05)|Lung NSC(810;2.31e-05)|all_neural(839;0.0459)|Ovarian(839;0.0481)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.00245)														---	---	---	---
FSTL4	23105	broad.mit.edu	37	5	132566872	132566873	+	Intron	INS	-	A	A	rs112922906		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132566872_132566873insA	uc003kyn.1	-							NM_015082	NP_055897			follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	134531305	134531305	+	Intron	DEL	T	-	-	rs5871553		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134531305delT	uc003laj.1	+											Homo sapiens cDNA: FLJ23312 fis, clone HEP11874.																														---	---	---	---
FBXL21	26223	broad.mit.edu	37	5	135274588	135274589	+	Intron	INS	-	TAGA	TAGA	rs148437701	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135274588_135274589insTAGA	uc010jec.1	+						FBXL21_uc003lbc.2_Intron	NM_012159	NP_036291			F-box and leucine-rich repeat protein 21						rhythmic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			lung(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
SPOCK1	6695	broad.mit.edu	37	5	136738507	136738507	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136738507delC	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589			sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---
KLHL3	26249	broad.mit.edu	37	5	136974410	136974410	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136974410delA	uc010jek.2	-						KLHL3_uc011cyc.1_Intron|KLHL3_uc003lbr.3_Intron|KLHL3_uc011cyd.1_Intron|KLHL3_uc010jel.1_Intron|KLHL3_uc010jem.1_Intron	NM_017415	NP_059111			kelch-like 3							cytoplasm|cytoskeleton	actin binding|structural molecule activity				0		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)														---	---	---	---
MYOT	9499	broad.mit.edu	37	5	137113440	137113441	+	Intron	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137113440_137113441delTC	uc011cye.1	+							NM_001135940	NP_001129412			myotilin isoform b						muscle contraction	actin cytoskeleton|sarcolemma|sarcomere	actin binding|structural constituent of muscle			large_intestine(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
WNT8A	7478	broad.mit.edu	37	5	137423338	137423339	+	Intron	INS	-	AA	AA	rs66902804		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137423338_137423339insAA	uc003lcd.1	+						BRD8_uc003lcc.1_Intron|WNT8A_uc011cyj.1_Intron|WNT8A_uc011cyk.1_Intron	NM_058244	NP_490645			wingless-type MMTV integration site family,						brain segmentation|canonical Wnt receptor signaling pathway involved in neural crest cell differentiation|cell migration involved in gastrulation|dorsal/ventral pattern formation|ectoderm development|endoderm development|eye development|hindbrain development|mesodermal cell fate commitment|negative regulation of Wnt receptor signaling pathway|neural crest cell fate commitment|neural plate pattern specification|notochord development|palate development|polarity specification of anterior/posterior axis|polarity specification of proximal/distal axis|positive regulation of fibroblast growth factor receptor signaling pathway|regulation of transcription involved in anterior/posterior axis specification|response to retinoic acid|somitogenesis|spinal cord anterior/posterior patterning|tail morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled binding|signal transducer activity			ovary(1)|lung(1)|breast(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
MATR3	9782	broad.mit.edu	37	5	138662111	138662112	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138662111_138662112insT	uc003ldu.2	+						MATR3_uc003ldt.2_Intron|MATR3_uc003ldw.2_Intron|MATR3_uc003ldx.2_Intron|MATR3_uc010jfc.2_Intron|MATR3_uc011czb.1_Intron|MATR3_uc003ldz.2_Intron|MATR3_uc003lea.2_Intron|MATR3_uc003leb.2_Intron|MATR3_uc003lec.2_Intron	NM_199189	NP_954659			matrin 3							nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
MATR3	9782	broad.mit.edu	37	5	138664839	138664840	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138664839_138664840insT	uc003ldu.2	+						MATR3_uc003ldt.2_Intron|MATR3_uc003ldw.2_Intron|MATR3_uc003ldx.2_Intron|MATR3_uc010jfc.2_Intron|MATR3_uc011czb.1_Intron|MATR3_uc003ldz.2_Intron|MATR3_uc003lea.2_Intron|MATR3_uc003leb.2_Intron|MATR3_uc003lec.2_Intron	NM_199189	NP_954659			matrin 3							nuclear inner membrane|nuclear matrix	nucleotide binding|protein binding|RNA binding|structural molecule activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
NRG2	9542	broad.mit.edu	37	5	139346296	139346297	+	Intron	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139346296_139346297delGA	uc003lex.1	-						NRG2_uc003lev.1_Intron|NRG2_uc003lew.1_Intron|NRG2_uc003ley.1_Intron	NM_004883	NP_004874			neuregulin 2 isoform 1						embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHA1	56147	broad.mit.edu	37	5	140305550	140305550	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140305550delA	uc003lhb.2	+						PCDHA1_uc003lha.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.2_Intron|PCDHAC1_uc003lih.2_5'Flank|PCDHAC1_uc003lig.1_5'Flank	NM_018900	NP_061723			protocadherin alpha 1 isoform 1 precursor						homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
DIAPH1	1729	broad.mit.edu	37	5	140898948	140898949	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140898948_140898949delTG	uc003llb.3	-						DIAPH1_uc011dbd.1_Intron|DIAPH1_uc003llc.3_Intron	NM_005219	NP_005210			diaphanous 1 isoform 1						regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	141569946	141569947	+	IGR	INS	-	CACA	CACA	rs139840987	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141569946_141569947insCACA								NDFIP1 (35940 upstream) : SPRY4 (120045 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	141637082	141637083	+	IGR	DEL	TG	-	-	rs10606076		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141637082_141637083delTG								NDFIP1 (103076 upstream) : SPRY4 (52909 downstream)																																			---	---	---	---
ARHGAP26	23092	broad.mit.edu	37	5	142272931	142272931	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142272931delT	uc011dbj.1	+						ARHGAP26_uc003lmt.2_Intron|ARHGAP26_uc003lmw.2_Intron	NM_015071	NP_055886			GTPase regulator associated with the focal						actin cytoskeleton organization|filopodium assembly|nervous system development|small GTPase mediated signal transduction	cytoskeleton|cytosol|focal adhesion	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(1)	1		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	146925061	146925062	+	IGR	INS	-	GT	GT	rs139315989	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:146925061_146925062insGT								DPYSL3 (35637 upstream) : JAKMIP2 (45644 downstream)																																			---	---	---	---
JAKMIP2	9832	broad.mit.edu	37	5	147130124	147130125	+	Intron	INS	-	AC	AC	rs151015424	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147130124_147130125insAC	uc003loq.1	-						JAKMIP2_uc011dbx.1_Intron|JAKMIP2_uc003lor.1_Intron	NM_014790	NP_055605			janus kinase and microtubule interacting protein							Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
SPINK6	404203	broad.mit.edu	37	5	147589710	147589745	+	Intron	DEL	TATGTATTTCTGCATGCATATGTATTTCTGCATGCA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147589710_147589745delTATGTATTTCTGCATGCATATGTATTTCTGCATGCA	uc003lpa.2	+							NM_205841	NP_995313			serine protease inhibitor, Kazal type 6							extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
AFAP1L1	134265	broad.mit.edu	37	5	148661922	148661923	+	Intron	INS	-	C	C	rs148544249	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148661922_148661923insC	uc003lqh.2	+						AFAP1L1_uc003lqg.3_Intron|AFAP1L1_uc010jgy.2_Intron	NM_152406	NP_689619			actin filament associated protein 1-like 1								protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
NMUR2	56923	broad.mit.edu	37	5	151779882	151779882	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151779882delA	uc003luv.2	-							NM_020167	NP_064552			neuromedin U receptor 2						activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|arachidonic acid secretion|calcium ion transport|central nervous system development|elevation of cytosolic calcium ion concentration|regulation of smooth muscle contraction	integral to membrane|plasma membrane	GTP binding|intracellular calcium activated chloride channel activity|neuromedin U receptor activity			ovary(3)|skin(2)|lung(1)|breast(1)|pancreas(1)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.103)	Kidney(363;0.000106)|KIRC - Kidney renal clear cell carcinoma(527;0.000672)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	152530206	152530206	+	IGR	DEL	A	-	-	rs79804835		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152530206delA								NMUR2 (745366 upstream) : GRIA1 (338969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	153262845	153262846	+	IGR	INS	-	CCA	CCA	rs141158626	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153262845_153262846insCCA								GRIA1 (69417 upstream) : FAM114A2 (108425 downstream)																																			---	---	---	---
GALNT10	55568	broad.mit.edu	37	5	153794905	153794905	+	Intron	DEL	T	-	-	rs78241319		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153794905delT	uc003lvh.2	+						GALNT10_uc010jic.2_Intron|GALNT10_uc010jid.2_Intron|uc003lvi.2_Intron|GALNT10_uc003lvj.2_Intron	NM_198321	NP_938080			GalNAc transferase 10 isoform a							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	157805883	157805884	+	IGR	INS	-	GT	GT	rs138917912	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157805883_157805884insGT								CLINT1 (519715 upstream) : EBF1 (317040 downstream)																																			---	---	---	---
EBF1	1879	broad.mit.edu	37	5	158383762	158383763	+	Intron	INS	-	T	T	rs5872580		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158383762_158383763insT	uc010jip.2	-						EBF1_uc011ddw.1_Intron|EBF1_uc011ddx.1_Intron|EBF1_uc003lxl.3_Intron	NM_024007	NP_076870			early B-cell factor						multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)					T	HMGA2	lipoma								---	---	---	---
Unknown	0	broad.mit.edu	37	5	158839989	158839989	+	IGR	DEL	T	-	-	rs34853926		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158839989delT								IL12B (82508 upstream) : LOC285627 (35575 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	158859552	158859553	+	IGR	INS	-	T	T	rs143946102	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158859552_158859553insT								IL12B (102071 upstream) : LOC285627 (16011 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	159264387	159264387	+	IGR	DEL	T	-	-	rs147390022		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159264387delT								LOC285627 (371103 upstream) : ADRA1B (79353 downstream)																																			---	---	---	---
FABP6	2172	broad.mit.edu	37	5	159648715	159648716	+	Intron	INS	-	T	T	rs137985031	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159648715_159648716insT	uc003lxx.1	+						FABP6_uc003lxz.1_Intron	NM_001130958	NP_001124430			gastrotropin isoform 1						bile acid and bile salt transport|bile acid metabolic process|negative regulation of cell proliferation	cytosol	transporter activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
CCNJL	79616	broad.mit.edu	37	5	159702091	159702092	+	Intron	INS	-	G	G	rs141832431	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159702091_159702092insG	uc003lyb.1	-						CCNJL_uc011dee.1_Intron|CCNJL_uc003lyc.1_Intron|CCNJL_uc011def.1_Intron	NM_024565	NP_078841			cyclin J-like							nucleus					0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	161248718	161248719	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161248718_161248719delCA								GABRA6 (119120 upstream) : GABRA1 (25478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	164173310	164173310	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164173310delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	164771844	164771845	+	IGR	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:164771844_164771845delGA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	166608443	166608443	+	IGR	DEL	T	-	-	rs79528854		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166608443delT								None (None upstream) : ODZ2 (103400 downstream)																																			---	---	---	---
WWC1	23286	broad.mit.edu	37	5	167857657	167857658	+	Intron	INS	-	CT	CT	rs138718876	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167857657_167857658insCT	uc003lzu.2	+						WWC1_uc003lzv.2_Intron|WWC1_uc011den.1_Intron|WWC1_uc003lzw.2_Intron|WWC1_uc010jjf.1_5'Flank	NM_015238	NP_056053			WW and C2 domain containing 1 isoform 3						cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)														---	---	---	---
SLIT3	6586	broad.mit.edu	37	5	168389317	168389318	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:168389317_168389318delAC	uc003mab.2	-						SLIT3_uc010jjg.2_Intron|SLIT3_uc010jji.2_Intron	NM_003062	NP_003053			slit homolog 3 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|cellular response to hormone stimulus|negative chemotaxis|negative regulation of cell growth|negative regulation of chemokine-mediated signaling pathway|response to cortisol stimulus|Roundabout signaling pathway	extracellular space|mitochondrion	calcium ion binding|Roundabout binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
KCNIP1	30820	broad.mit.edu	37	5	169936381	169936382	+	Intron	INS	-	A	A	rs59034172	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169936381_169936382insA	uc003mas.2	+						KCNIP1_uc003map.2_Intron|KCNIP1_uc003mat.2_Intron|KCNIP1_uc010jjp.2_Intron|KCNIP1_uc010jjq.2_Intron	NM_001034837	NP_001030009			Kv channel interacting protein 1 isoform 1						detection of calcium ion|signal transduction|synaptic transmission	plasma membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2	Renal(175;0.000159)|Lung NSC(126;0.0191)|all_lung(126;0.0297)	Medulloblastoma(196;0.0109)|all_neural(177;0.0177)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---
RANBP17	64901	broad.mit.edu	37	5	170717372	170717372	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170717372delA	uc003mba.2	+						RANBP17_uc003mbb.2_Intron|RANBP17_uc010jjs.2_Intron	NM_022897	NP_075048			RAN binding protein 17						mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)					T	TRD@	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	5	171090435	171090435	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171090435delA								FGF18 (206273 upstream) : FBXW11 (198121 downstream)																																			---	---	---	---
STK10	6793	broad.mit.edu	37	5	171576500	171576503	+	Intron	DEL	GTGT	-	-	rs145254227		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171576500_171576503delGTGT	uc003mbo.1	-							NM_005990	NP_005981			serine/threonine kinase 10								ATP binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|testis(1)|breast(1)|pancreas(1)	8	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	172024034	172024035	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172024034_172024035delCA								SH3PXD2B (142507 upstream) : NEURL1B (44241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	173549300	173549301	+	IGR	DEL	GG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173549300_173549301delGG								HMP19 (13119 upstream) : MSX2 (602274 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	174812028	174812047	+	IGR	DEL	AAGGAAAGAAGGAAGGAAGA	-	-	rs111559272		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174812028_174812047delAAGGAAAGAAGGAAGGAAGA								MSX2 (654127 upstream) : DRD1 (55629 downstream)																																			---	---	---	---
ARL10	285598	broad.mit.edu	37	5	175794319	175794319	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175794319delT	uc003mec.1	+						ARL10_uc003meb.2_Intron|MIR1271_hsa-mir-1271|MI0003814_5'Flank	NM_173664	NP_775935			ADP-ribosylation factor-like 10								GTP binding			ovary(1)	1	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)														---	---	---	---
CDHR2	54825	broad.mit.edu	37	5	176015539	176015540	+	Intron	INS	-	GA	GA	rs142821033	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176015539_176015540insGA	uc003mem.1	+						CDHR2_uc003men.1_Intron	NM_017675	NP_060145			protocadherin LKC precursor						homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2																		---	---	---	---
SNCB	6620	broad.mit.edu	37	5	176055457	176055457	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176055457delA	uc003mep.2	-						SNCB_uc003meq.2_Intron|SNCB_uc010jke.1_Intron|EIF4E1B_uc010jkf.1_5'Flank	NM_001001502	NP_001001502			beta-synuclein								calcium ion binding|phospholipase inhibitor activity			ovary(1)	1	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---
Unknown	0	broad.mit.edu	37	5	176086912	176086913	+	IGR	INS	-	TCCA	TCCA	rs141471391	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176086912_176086913insTCCA								TSPAN17 (854 upstream) : UNC5A (150647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	178433528	178433531	+	IGR	DEL	ACAC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178433528_178433531delACAC								GRM6 (11404 upstream) : ZNF879 (17245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	179057898	179057899	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179057898_179057899insA								HNRNPH1 (6228 upstream) : C5orf60 (10661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	179340358	179340358	+	IGR	DEL	T	-	-	rs77877049		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179340358delT								TBC1D9B (5502 upstream) : RNF130 (42116 downstream)																																			---	---	---	---
EXOC2	55770	broad.mit.edu	37	6	524891	524892	+	Intron	INS	-	GTGA	GTGA	rs150779633	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:524891_524892insGTGA	uc003mtd.2	-						EXOC2_uc003mte.2_Intron|EXOC2_uc011dho.1_Intron	NM_018303	NP_060773			Sec5 protein						exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	708184	708184	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:708184delT								EXOC2 (15075 upstream) : LOC285768 (253058 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	834408	834411	+	IGR	DEL	CCTA	-	-	rs72349013		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:834408_834411delCCTA								EXOC2 (141299 upstream) : LOC285768 (126831 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	1346634	1346635	+	IGR	INS	-	GATAGATC	GATAGATC	rs140941511	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1346634_1346635insGATAGATC								FOXQ1 (31642 upstream) : FOXF2 (43434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	1552292	1552292	+	IGR	DEL	A	-	-	rs35385602		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1552292delA								FOXF2 (156461 upstream) : FOXC1 (58389 downstream)																																			---	---	---	---
GMDS	2762	broad.mit.edu	37	6	1668959	1668959	+	Intron	DEL	C	-	-	rs67378132		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1668959delC	uc003mtq.2	-							NM_001500	NP_001491			GDP-mannose 4,6-dehydratase						'de novo' GDP-L-fucose biosynthetic process|GDP-mannose metabolic process|leukocyte cell-cell adhesion		coenzyme binding|GDP-mannose 4,6-dehydratase activity			central_nervous_system(1)	1	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	2473593	2473594	+	Intron	INS	-	CG	CG	rs4959675	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2473593_2473594insCG	uc003mtu.1	+						uc003mtv.2_Intron					Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 1572223.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	2884118	2884118	+	5'Flank	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2884118delT	uc003mue.2	+											Homo sapiens mRNA sequence.																														---	---	---	---
FARS2	10667	broad.mit.edu	37	6	5714441	5714441	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5714441delG	uc010jnv.1	+						FARS2_uc003mwr.2_Intron	NM_006567	NP_006558			phenylalanyl-tRNA synthetase 2 precursor						phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	6839609	6839622	+	IGR	DEL	GTGGGCTGAACACT	-	-	rs143282499		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6839609_6839622delGTGGGCTGAACACT								LY86 (184393 upstream) : RREB1 (268566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	6932305	6932305	+	IGR	DEL	A	-	-	rs113333668		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6932305delA								LY86 (277089 upstream) : RREB1 (175883 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	8265538	8265539	+	IGR	DEL	TT	-	-	rs35736346		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8265538_8265539delTT								EEF1E1 (162710 upstream) : SLC35B3 (146194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	8353491	8353492	+	IGR	INS	-	T	T	rs144599320	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8353491_8353492insT								EEF1E1 (250663 upstream) : SLC35B3 (58241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	8936996	8936997	+	IGR	DEL	AG	-	-	rs34279004		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8936996_8936997delAG								HULC (282919 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	8939730	8939730	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8939730delT								HULC (285653 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	10088438	10088438	+	Intron	DEL	A	-	-	rs111785999		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10088438delA	uc010joj.1	-						uc003myp.1_Intron					Homo sapiens clone 958LR MRDS1 protein (MRDS1) mRNA, complete cds.																														---	---	---	---
ELOVL2	54898	broad.mit.edu	37	6	11037298	11037301	+	Intron	DEL	AGAG	-	-	rs112221288		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11037298_11037301delAGAG	uc003mzp.3	-							NM_017770	NP_060240			elongation of very long chain fatty acids-like						fatty acid elongation, polyunsaturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding				0	Breast(50;0.0418)|Ovarian(93;0.0919)	all_hematologic(90;0.117)	Epithelial(50;0.176)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	11431673	11431673	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11431673delA	uc003mzy.2	+											Homo sapiens cDNA clone IMAGE:4812340.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	11491999	11492000	+	Intron	INS	-	TGA	TGA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11491999_11492000insTGA	uc003mzz.1	+											Homo sapiens cDNA clone IMAGE:5269873.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	12340558	12340559	+	IGR	INS	-	GC	GC	rs143644983	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12340558_12340559insGC								EDN1 (43132 upstream) : PHACTR1 (376329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	12628850	12628865	+	IGR	DEL	CCTCCCTCCCTCCCTT	-	-	rs146594740		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12628850_12628865delCCTCCCTCCCTCCCTT								EDN1 (331424 upstream) : PHACTR1 (88023 downstream)																																			---	---	---	---
PHACTR1	221692	broad.mit.edu	37	6	13076259	13076260	+	Intron	INS	-	T	T	rs55987619		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13076259_13076260insT	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210			phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)															---	---	---	---
GFOD1	54438	broad.mit.edu	37	6	13382146	13382147	+	Intron	INS	-	GT	GT	rs147279188	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13382146_13382147insGT	uc003nat.1	-						GFOD1_uc003nas.1_Intron	NM_018988	NP_061861			glucose-fructose oxidoreductase domain							extracellular region	binding|oxidoreductase activity			ovary(2)	2	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	13908110	13908129	+	IGR	DEL	CCTTCCTTCCTTCCTTCCTT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13908110_13908129delCCTTCCTTCCTTCCTTCCTT								CCDC90A (93321 upstream) : RNF182 (17074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	14875322	14875322	+	IGR	DEL	T	-	-	rs74782467		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14875322delT								CD83 (738176 upstream) : JARID2 (370412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	16991831	16991832	+	IGR	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16991831_16991832delCT								ATXN1 (230110 upstream) : RBM24 (289977 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	17303738	17303738	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17303738delG								RBM24 (9641 upstream) : CAP2 (89998 downstream)																																			---	---	---	---
CAP2	10486	broad.mit.edu	37	6	17436298	17436299	+	Intron	INS	-	TCTT	TCTT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17436298_17436299insTCTT	uc003ncb.2	+						CAP2_uc010jpk.1_Intron|CAP2_uc011dja.1_Intron|CAP2_uc011djb.1_Intron|CAP2_uc011djc.1_Intron|CAP2_uc011djd.1_Intron	NM_006366	NP_006357			adenylyl cyclase-associated protein 2						activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)															---	---	---	---
NUP153	9972	broad.mit.edu	37	6	17646972	17646973	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17646972_17646973insT	uc003ncd.1	-						NUP153_uc011dje.1_Intron|NUP153_uc010jpl.1_Intron	NM_005124	NP_005115			nucleoporin 153kDa						carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)															---	---	---	---
KIF13A	63971	broad.mit.edu	37	6	17858254	17858255	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17858254_17858255insA	uc003ncg.3	-						KIF13A_uc003ncf.2_Intron|KIF13A_uc003nch.3_Intron|KIF13A_uc003nci.3_Intron	NM_022113	NP_071396			kinesin family member 13A isoform a						cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	18562586	18562587	+	Intron	INS	-	TT	TT	rs111447458		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18562586_18562587insTT	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	18565911	18565912	+	Intron	INS	-	CCTT	CCTT	rs143399073	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18565911_18565912insCCTT	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																														---	---	---	---
MBOAT1	154141	broad.mit.edu	37	6	20120237	20120238	+	Intron	INS	-	GT	GT	rs138673714	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20120237_20120238insGT	uc003ncx.1	-						MBOAT1_uc011dji.1_Intron	NM_001080480	NP_001073949			membrane bound O-acyltransferase domain						phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(95;0.244)|Breast(50;0.0379)|Ovarian(93;0.0473)|all_epithelial(95;0.109)		OV - Ovarian serous cystadenocarcinoma(7;0.00392)|all cancers(50;0.0117)|Epithelial(50;0.0454)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	20367172	20367173	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20367172_20367173insA								MBOAT1 (154502 upstream) : E2F3 (34964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	21288513	21288513	+	IGR	DEL	T	-	-	rs143787989		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21288513delT								CDKAL1 (55881 upstream) : SOX4 (305459 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	21329877	21329885	+	IGR	DEL	GTTGTTGTA	-	-	rs142965140		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21329877_21329885delGTTGTTGTA								CDKAL1 (97245 upstream) : SOX4 (264087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	21522419	21522420	+	RNA	DEL	AC	-	-	rs33980574		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21522419_21522420delAC	uc003ndh.2	-	1		c.1595_1596delGT								full-length cDNA clone CS0DF017YB01 of Fetal brain of Homo sapiens (human).																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	21622957	21622957	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:21622957delT								SOX4 (24110 upstream) : FLJ22536 (42046 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	22643142	22643142	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22643142delT								HDGFL1 (72393 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	23198053	23198053	+	IGR	DEL	G	-	-	rs112005891		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23198053delG								HDGFL1 (627304 upstream) : NRSN1 (928361 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	24051146	24051146	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24051146delA								None (None upstream) : NRSN1 (75268 downstream)																																			---	---	---	---
TDP2	51567	broad.mit.edu	37	6	24662057	24662058	+	Intron	INS	-	AA	AA	rs10644291		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24662057_24662058insAA	uc003nej.2	-						TDP2_uc003nei.2_Intron|TDP2_uc010jpu.1_Intron	NM_016614	NP_057698			TRAF and TNF receptor-associated protein						cell surface receptor linked signaling pathway|double-strand break repair	PML body	5'-tyrosyl-DNA phosphodiesterase activity|magnesium ion binding|nuclease activity|protein binding|transcription corepressor activity			ovary(1)|lung(1)	2													Direct_reversal_of_damage|Editing_and_processing_nucleases					---	---	---	---
Unknown	0	broad.mit.edu	37	6	25259698	25259699	+	Intron	INS	-	TTG	TTG	rs142687438	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25259698_25259699insTTG	uc003nex.3	-											Homo sapiens cDNA clone IMAGE:5297808.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	26040832	26040832	+	IGR	DEL	A	-	-	rs34176425		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26040832delA								HIST1H2AB (7036 upstream) : HIST1H2BB (2624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	26212177	26212178	+	IGR	INS	-	T	T	rs142563471	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26212177_26212178insT								HIST1H4E (6929 upstream) : HIST1H2BG (4250 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	26705269	26705270	+	IGR	INS	-	AA	AA	rs28689790	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26705269_26705270insAA								ZNF322A (45306 upstream) : GUSBL1 (133996 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	28462434	28462434	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28462434delT								ZSCAN23 (51155 upstream) : GPX6 (8639 downstream)																																			---	---	---	---
TRIM27	5987	broad.mit.edu	37	6	28894685	28894686	+	5'Flank	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28894685_28894686insG	uc003nlr.2	-						TRIM27_uc003nls.2_5'Flank|TRIM27_uc003nlt.1_5'Flank	NM_006510	NP_006501			ret finger protein						cell proliferation|negative regulation of gene expression, epigenetic|negative regulation of transcription from RNA polymerase II promoter|protein trimerization|spermatogenesis|transcription, DNA-dependent	cytoplasm|integral to plasma membrane|membrane fraction|nuclear membrane|PML body	DNA binding|protein binding|transmembrane receptor protein tyrosine kinase activity|zinc ion binding			ovary(1)	1								T	RET	papillary thyroid								---	---	---	---
HLA-G	3135	broad.mit.edu	37	6	29942706	29942707	+	Intron	INS	-	CTGCGGTGGT	CTGCGGTGGT	rs147265809	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29942706_29942707insCTGCGGTGGT	uc011dmb.1	+						HCG9_uc003rth.2_5'Flank	NM_002127	NP_002118			major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4																		---	---	---	---
TRIM26	7726	broad.mit.edu	37	6	30176682	30176683	+	Intron	DEL	TG	-	-	rs142813564	byFrequency;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30176682_30176683delTG	uc003nps.2	-						TRIM26_uc010jry.2_Intron|TRIM26_uc003npt.2_Intron	NM_003449	NP_003440			tripartite motif-containing 26								DNA binding|zinc ion binding			ovary(2)|lung(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	30798144	30798145	+	Intron	DEL	TG	-	-	rs145488205		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30798144_30798145delTG	uc003nrp.1	-											RecName: Full=Putative uncharacterized protein C6orf214;																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	30821985	30821985	+	IGR	DEL	T	-	-	rs142839923		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30821985delT								IER3 (109658 upstream) : DDR1 (28709 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	31353651	31353652	+	IGR	INS	-	C	C	rs11383867	byFrequency;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31353651_31353652insC								HLA-B (28662 upstream) : MICA (13909 downstream)																																			---	---	---	---
VARS	7407	broad.mit.edu	37	6	31752690	31752690	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31752690delA	uc003nxe.2	-						VARS_uc011doi.1_Intron	NM_006295	NP_006286			valyl-tRNA synthetase						translational elongation|valyl-tRNA aminoacylation	cytosol	ATP binding|protein binding|valine-tRNA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3					L-Valine(DB00161)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	32380399	32380400	+	IGR	DEL	AT	-	-	rs147273400		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32380399_32380400delAT								BTNL2 (5499 upstream) : HLA-DRA (27247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	32452029	32452052	+	IGR	DEL	CCCGGCCAGCGGCAAGGCCGCTCT	-	-	rs67747745		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32452029_32452052delCCCGGCCAGCGGCAAGGCCGCTCT								HLA-DRA (39208 upstream) : HLA-DRB1 (33111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	32627027	32627028	+	IGR	INS	-	AC	AC	rs149660979	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32627027_32627028insAC								HLA-DQA1 (12188 upstream) : HLA-DQB1 (629 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	33918368	33918371	+	IGR	DEL	GTGT	-	-	rs147700351		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33918368_33918371delGTGT								MLN (146575 upstream) : MIR1275 (49378 downstream)																																			---	---	---	---
NUDT3	11165	broad.mit.edu	37	6	34363017	34363018	+	5'Flank	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34363017_34363018insA	uc003ojl.2	-							NM_006703	NP_006694			nudix-type motif 3						cell-cell signaling|diadenosine polyphosphate catabolic process|diphosphoinositol polyphosphate catabolic process	cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|magnesium ion binding				0																		---	---	---	---
LHFPL5	222662	broad.mit.edu	37	6	35791408	35791409	+	3'UTR	INS	-	G	G	rs147136847	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35791408_35791409insG	uc003olg.1	+	4						NM_182548	NP_872354			lipoma HMGIC fusion partner-like 5							integral to membrane				skin(1)	1																		---	---	---	---
SRPK1	6732	broad.mit.edu	37	6	35853076	35853081	+	Intron	DEL	AGAGAG	-	-	rs57749561		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35853076_35853081delAGAGAG	uc003olj.2	-						SRPK1_uc011dtg.1_Intron|SRPK1_uc003olh.2_Intron|SRPK1_uc003oli.2_Intron	NM_003137	NP_003128			SFRS protein kinase 1						cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1																		---	---	---	---
PNPLA1	285848	broad.mit.edu	37	6	36249989	36249990	+	Intron	INS	-	GGAAGGAA	GGAAGGAA	rs147876798	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36249989_36249990insGGAAGGAA	uc010jwf.2	+						PNPLA1_uc003olw.1_Intron|PNPLA1_uc010jwe.1_Intron	NM_001145717	NP_001139189			patatin-like phospholipase domain containing 1						lipid catabolic process		hydrolase activity			large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4																		---	---	---	---
CDKN1A	1026	broad.mit.edu	37	6	36646768	36646769	+	Intron	INS	-	TA	TA	rs146170154	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36646768_36646769insTA	uc003omm.3	+						CDKN1A_uc011dtq.1_Intron|CDKN1A_uc003oml.2_Intron|CDKN1A_uc003omn.2_Intron	NM_000389	NP_000380			cyclin-dependent kinase inhibitor 1A						cell cycle arrest|cellular response to extracellular stimulus|cellular response to ionizing radiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|induction of apoptosis by intracellular signals|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of fibroblast proliferation|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|S phase of mitotic cell cycle|stress-induced premature senescence	cyclin-dependent protein kinase holoenzyme complex|cytosol|nucleoplasm|PCNA-p21 complex	cyclin-dependent protein kinase activating kinase activity|cyclin-dependent protein kinase inhibitor activity|metal ion binding			ovary(1)|breast(1)	2														Multiple_Endocrine_Neoplasia_type_1				---	---	---	---
Unknown	0	broad.mit.edu	37	6	37559221	37559221	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37559221delG								C6orf129 (91521 upstream) : MDGA1 (41063 downstream)																																			---	---	---	---
KCNK17	89822	broad.mit.edu	37	6	39270669	39270670	+	Intron	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39270669_39270670delAG	uc003ooo.2	-						KCNK17_uc003oop.2_Intron	NM_031460	NP_113648			potassium channel, subfamily K, member 17							integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2																		---	---	---	---
KIF6	221458	broad.mit.edu	37	6	39497563	39497563	+	Intron	DEL	A	-	-	rs79280641		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39497563delA	uc003oot.2	-						KIF6_uc010jwz.1_Intron|KIF6_uc010jxa.1_Intron|KIF6_uc011dua.1_Intron|KIF6_uc010jxb.1_Intron	NM_145027	NP_659464			kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3																		---	---	---	---
LRFN2	57497	broad.mit.edu	37	6	40508616	40508616	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40508616delC	uc003oph.1	-							NM_020737	NP_065788			leucine rich repeat and fibronectin type III							cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)																	---	---	---	---
LRFN2	57497	broad.mit.edu	37	6	40530573	40530574	+	Intron	DEL	CT	-	-	rs59544562		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40530573_40530574delCT	uc003oph.1	-							NM_020737	NP_065788			leucine rich repeat and fibronectin type III							cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)																	---	---	---	---
PGC	5225	broad.mit.edu	37	6	41712716	41712719	+	Intron	DEL	TCTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41712716_41712719delTCTG	uc003ora.1	-							NM_002630	NP_002621			progastricsin (pepsinogen C) precursor						digestion|proteolysis	extracellular space	aspartic-type endopeptidase activity				0	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)															---	---	---	---
TRERF1	55809	broad.mit.edu	37	6	42288244	42288245	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42288244_42288245insT	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037			transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	43688328	43688328	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43688328delA								MRPS18A (32800 upstream) : VEGFA (49625 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	43804103	43804104	+	IGR	INS	-	GTCGGT	GTCGGT	rs140626545	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43804103_43804104insGTCGGT								VEGFA (49882 upstream) : LOC100132354 (54661 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	43809464	43809465	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43809464_43809465insA								VEGFA (55243 upstream) : LOC100132354 (49300 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	43926383	43926383	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43926383delA								LOC100132354 (20440 upstream) : C6orf223 (41956 downstream)																																			---	---	---	---
CAPN11	11131	broad.mit.edu	37	6	44145212	44145213	+	Intron	INS	-	CTTT	CTTT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44145212_44145213insCTTT	uc003owt.1	+						CAPN11_uc011dvn.1_Intron	NM_007058	NP_008989			calpain 11						proteolysis	acrosomal vesicle	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			ovary(1)|breast(1)	2	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	45521586	45521587	+	IGR	INS	-	TG	TG	rs138833684	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45521586_45521587insTG								RUNX2 (2768 upstream) : CLIC5 (344603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	45547390	45547391	+	IGR	INS	-	T	T	rs146302535	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45547390_45547391insT								RUNX2 (28572 upstream) : CLIC5 (318799 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	45697979	45697979	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45697979delG								RUNX2 (179161 upstream) : CLIC5 (168211 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	46160334	46160335	+	IGR	DEL	AT	-	-	rs62400865	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46160334_46160335delAT								ENPP5 (21617 upstream) : RCAN2 (28134 downstream)																																			---	---	---	---
PLA2G7	7941	broad.mit.edu	37	6	46672179	46672188	+	3'UTR	DEL	TCTCTCTCTC	-	-	rs10548951		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46672179_46672188delTCTCTCTCTC	uc010jzf.2	-	12						NM_005084	NP_005075			phospholipase A2, group VII						inflammatory response|lipid catabolic process	extracellular space	1-alkyl-2-acetylglycerophosphocholine esterase activity|phospholipid binding				0			Lung(136;0.192)															---	---	---	---
LOC100287718	100287718	broad.mit.edu	37	6	46712010	46712012	+	5'Flank	DEL	CTC	-	-	rs66784615		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46712010_46712012delCTC	uc011dwf.1	+							NM_001162435	NP_001155907			hypothetical protein LOC100287718												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	47077393	47077393	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47077393delC								GPR110 (67311 upstream) : TNFRSF21 (121876 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	47111240	47111241	+	IGR	DEL	TT	-	-	rs113442962		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47111240_47111241delTT								GPR110 (101158 upstream) : TNFRSF21 (88028 downstream)																																			---	---	---	---
CD2AP	23607	broad.mit.edu	37	6	47553485	47553485	+	Intron	DEL	G	-	-	rs66889891		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47553485delG	uc003oyw.2	+							NM_012120	NP_036252			CD2-associated protein						cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)															---	---	---	---
Unknown	0	broad.mit.edu	37	6	48528657	48528658	+	IGR	INS	-	A	A	rs141627437	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48528657_48528658insA								C6orf138 (449714 upstream) : MUT (870336 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	48669927	48669927	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:48669927delC								C6orf138 (590984 upstream) : MUT (729067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	51978999	51978999	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51978999delG								PKHD1 (26576 upstream) : MIR206 (30148 downstream)																																			---	---	---	---
GSTA2	2939	broad.mit.edu	37	6	52627907	52627907	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52627907delT	uc003pay.2	-							NM_000846	NP_000837			glutathione S-transferase alpha 2						glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.118)				Aminophenazone(DB01424)|Amsacrine(DB00276)|Busulfan(DB01008)|Chlorambucil(DB00291)|Chloroquine(DB00608)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Ethacrynic acid(DB00903)|Glutathione(DB00143)|Mechlorethamine(DB00888)|Praziquantel(DB01058)|Vitamin E(DB00163)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	53281992	53281992	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53281992delT								ELOVL5 (68050 upstream) : GCLC (80148 downstream)																																			---	---	---	---
TINAG	27283	broad.mit.edu	37	6	54231402	54231403	+	Intron	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54231402_54231403delGA	uc003pcj.2	+						TINAG_uc010jzt.2_Intron	NM_014464	NP_055279			tubulointerstitial nephritis antigen						cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)															---	---	---	---
COL21A1	81578	broad.mit.edu	37	6	56012164	56012164	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56012164delT	uc003pcs.2	-						COL21A1_uc003pct.1_Intron|COL21A1_uc011dxi.1_Intron|COL21A1_uc003pcu.1_Intron	NM_030820	NP_110447			collagen, type XXI, alpha 1 precursor						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)															---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57258309	57258309	+	Intron	DEL	G	-	-	rs148296987		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57258309delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57353887	57353888	+	Intron	INS	-	TT	TT	rs147035179	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57353887_57353888insTT	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57358888	57358889	+	Intron	INS	-	C	C	rs141390216		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57358888_57358889insC	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57359740	57359741	+	Intron	INS	-	A	A	rs142808209	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57359740_57359741insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57402588	57402589	+	Intron	INS	-	GG	GG	rs78846932		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57402588_57402589insGG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57434426	57434427	+	Intron	INS	-	AA	AA	rs145044694		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57434426_57434427insAA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57469420	57469420	+	Intron	DEL	G	-	-	rs111512806		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57469420delG	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
PRIM2	5558	broad.mit.edu	37	6	57476812	57476813	+	Intron	INS	-	A	A	rs149122632		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57476812_57476813insA	uc003pdx.2	+							NM_000947	NP_000938			DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	57537951	57537953	+	IGR	DEL	TGT	-	-	rs67143578		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57537951_57537953delTGT								PRIM2 (24576 upstream) : GUSBL2 (708206 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	61961609	61961610	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:61961609_61961610insA								None (None upstream) : KHDRBS2 (428255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	63234428	63234429	+	IGR	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63234428_63234429insG								KHDRBS2 (238328 upstream) : LGSN (751428 downstream)																																			---	---	---	---
EYS	346007	broad.mit.edu	37	6	64748702	64748703	+	Intron	DEL	TT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64748702_64748703delTT	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
EYS	346007	broad.mit.edu	37	6	65575420	65575420	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65575420delG	uc011dxu.1	-							NM_001142800	NP_001136272			eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	69090004	69090004	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69090004delC								None (None upstream) : BAI3 (255628 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	70147192	70147192	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70147192delA								BAI3 (47790 upstream) : LMBRD1 (238559 downstream)																																			---	---	---	---
COL19A1	1310	broad.mit.edu	37	6	70712381	70712382	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70712381_70712382insT	uc003pfc.1	+						COL19A1_uc010kam.1_Intron	NM_001858	NP_001849			alpha 1 type XIX collagen precursor						cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	71023425	71023426	+	IGR	INS	-	G	G	rs144409722	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71023425_71023426insG								COL9A1 (10639 upstream) : FAM135A (99681 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	71868280	71868281	+	IGR	INS	-	CTTT	CTTT	rs143813098	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71868280_71868281insCTTT								B3GAT2 (201492 upstream) : OGFRL1 (130196 downstream)																																			---	---	---	---
MTO1	25821	broad.mit.edu	37	6	74170932	74170932	+	5'Flank	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74170932delC	uc003pgy.3	+						MTO1_uc010kav.2_5'Flank|MTO1_uc003pgz.3_5'Flank|MTO1_uc003pha.3_5'Flank|MTO1_uc003phb.3_5'Flank|MTO1_uc003phc.1_5'Flank	NM_133645	NP_598400			mitochondrial translation optimization 1 homolog						tRNA processing	mitochondrion	flavin adenine dinucleotide binding			ovary(3)|skin(2)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	6	75704422	75704422	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75704422delA								None (None upstream) : COL12A1 (89621 downstream)																																			---	---	---	---
COL12A1	1303	broad.mit.edu	37	6	75808040	75808040	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75808040delC	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361			collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9																		---	---	---	---
FILIP1	27145	broad.mit.edu	37	6	76195713	76195714	+	Intron	DEL	AT	-	-	rs150985944	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76195713_76195714delAT	uc003pia.2	-						FILIP1_uc003phy.1_Intron|FILIP1_uc010kbe.2_Intron	NM_015687	NP_056502			filamin A interacting protein 1											skin(3)|ovary(1)	4																		---	---	---	---
MYO6	4646	broad.mit.edu	37	6	76569022	76569023	+	Intron	INS	-	T	T	rs71954909		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76569022_76569023insT	uc003pih.1	+						MYO6_uc003pig.1_Intron|MYO6_uc003pii.1_Intron	NM_004999	NP_004990			myosin VI						actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	78267908	78267910	+	IGR	DEL	TTA	-	-	rs72402186		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:78267908_78267910delTTA								HTR1B (94788 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	80527240	80527241	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80527240_80527241insA								RNY4 (75571 upstream) : ELOVL4 (97295 downstream)																																			---	---	---	---
BCKDHB	594	broad.mit.edu	37	6	80967054	80967055	+	Intron	INS	-	TA	TA	rs141640476	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80967054_80967055insTA	uc003pjd.2	+						BCKDHB_uc003pje.2_Intron	NM_000056	NP_000047			branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	81708591	81708591	+	IGR	DEL	T	-	-	rs2028719	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81708591delT								BCKDHB (652604 upstream) : FAM46A (746857 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	81803635	81803636	+	IGR	INS	-	TT	TT	rs149448557	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:81803635_81803636insTT								BCKDHB (747648 upstream) : FAM46A (651812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	85477299	85477299	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85477299delT								TBX18 (3400 upstream) : NT5E (682003 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	85635378	85635379	+	IGR	INS	-	GT	GT	rs143552477	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85635378_85635379insGT								TBX18 (161479 upstream) : NT5E (523923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	85724410	85724410	+	IGR	DEL	A	-	-	rs11297904		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85724410delA								TBX18 (250511 upstream) : NT5E (434892 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	85993729	85993730	+	IGR	DEL	GT	-	-	rs34458439		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85993729_85993730delGT								TBX18 (519830 upstream) : NT5E (165572 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	86113689	86113689	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86113689delT								TBX18 (639790 upstream) : NT5E (45613 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	87404678	87404678	+	IGR	DEL	C	-	-	rs112712834		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87404678delC								None (None upstream) : HTR1E (242346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	92651938	92651939	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:92651938_92651939insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	95934729	95934729	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95934729delT								None (None upstream) : MANEA (90684 downstream)																																			---	---	---	---
MANEA	79694	broad.mit.edu	37	6	96051937	96051938	+	Intron	INS	-	GT	GT	rs62417817		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96051937_96051938insGT	uc003poo.1	+							NM_024641	NP_078917			mannosidase, endo-alpha						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	glycoprotein endo-alpha-1,2-mannosidase activity			ovary(2)|breast(1)	3		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	96761708	96761709	+	IGR	INS	-	T	T	rs2387155		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96761708_96761709insT								FUT9 (98221 upstream) : KIAA0776 (207993 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	98558981	98558982	+	IGR	INS	-	GT	GT	rs143058118	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98558981_98558982insGT								MIR2113 (86484 upstream) : POU3F2 (723598 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	98943940	98943940	+	IGR	DEL	C	-	-	rs36076727		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:98943940delC								MIR2113 (471443 upstream) : POU3F2 (338640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	100517931	100517932	+	IGR	INS	-	ACG	ACG	rs72550548		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100517931_100517932insACG								MCHR2 (75817 upstream) : SIM1 (318819 downstream)																																			---	---	---	---
ASCC3	10973	broad.mit.edu	37	6	100959589	100959589	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100959589delA	uc003pqk.2	-							NM_006828	NP_006819			activating signal cointegrator 1 complex subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)														---	---	---	---
GRIK2	2898	broad.mit.edu	37	6	102210044	102210045	+	Intron	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102210044_102210045delTC	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775			glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	102718880	102718882	+	IGR	DEL	TTA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102718880_102718882delTTA								GRIK2 (200923 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	104836556	104836557	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104836556_104836557insT								None (None upstream) : HACE1 (339411 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	104986238	104986243	+	IGR	DEL	TCTCTC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104986238_104986243delTCTCTC								None (None upstream) : HACE1 (189725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	106435540	106435540	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106435540delT								PREP (584571 upstream) : PRDM1 (98655 downstream)																																			---	---	---	---
RTN4IP1	84816	broad.mit.edu	37	6	107073724	107073724	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107073724delT	uc003prj.2	-						RTN4IP1_uc010kdd.2_Intron|RTN4IP1_uc003prk.2_Intron	NM_032730	NP_116119			reticulon 4 interacting protein 1 precursor							mitochondrion	oxidoreductase activity|zinc ion binding				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;9.45e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0144)	Epithelial(6;0.000873)|all cancers(7;0.00363)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0394)	all cancers(137;0.113)|BRCA - Breast invasive adenocarcinoma(108;0.127)|Epithelial(106;0.144)														---	---	---	---
PDSS2	57107	broad.mit.edu	37	6	107712694	107712695	+	Intron	INS	-	G	G	rs142884928	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107712694_107712695insG	uc003prt.2	-						PDSS2_uc011eak.1_Intron|PDSS2_uc011eal.1_Intron|PDSS2_uc003pru.2_Intron|PDSS2_uc003prv.2_Intron	NM_020381	NP_065114			prenyl diphosphate synthase, subunit 2						isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	protein heterodimerization activity			ovary(2)	2	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)														---	---	---	---
SESN1	27244	broad.mit.edu	37	6	109410946	109410946	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109410946delA	uc003psu.2	-							NM_014454	NP_055269			sestrin 1						cell cycle arrest|negative regulation of cell proliferation|response to DNA damage stimulus	nucleus				ovary(1)	1		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	109651023	109651023	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109651023delA								C6orf182 (165910 upstream) : CD164 (36695 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	109809108	109809109	+	IGR	INS	-	T	T	rs150028479		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109809108_109809109insT								ZBTB24 (4668 upstream) : AKD1 (4950 downstream)																																			---	---	---	---
CDC40	51362	broad.mit.edu	37	6	110544676	110544677	+	Intron	INS	-	A	A	rs150005983	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110544676_110544677insA	uc003pua.2	+							NM_015891	NP_056975			cell division cycle 40 homolog						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	111246991	111246992	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111246991_111246992delGT								AMD1 (30078 upstream) : GTF3C6 (32771 downstream)																																			---	---	---	---
FYN	2534	broad.mit.edu	37	6	111989706	111989707	+	Intron	DEL	AA	-	-	rs140235658		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111989706_111989707delAA	uc003pvj.2	-						FYN_uc003pvi.2_Intron|FYN_uc003pvk.2_Intron|FYN_uc003pvh.2_Intron	NM_002037	NP_002028			protein-tyrosine kinase fyn isoform a						axon guidance|calcium ion transport|feeding behavior|interspecies interaction between organisms|intracellular protein kinase cascade|learning|leukocyte migration|platelet activation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|endosome|plasma membrane	ATP binding|glycoprotein binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|central_nervous_system(1)|skin(1)	7		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)											OREG0017620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
FYN	2534	broad.mit.edu	37	6	111999353	111999353	+	Intron	DEL	G	-	-	rs12196216		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111999353delG	uc003pvj.2	-						FYN_uc003pvi.2_Intron|FYN_uc003pvk.2_Intron|FYN_uc003pvh.2_Intron	NM_002037	NP_002028			protein-tyrosine kinase fyn isoform a						axon guidance|calcium ion transport|feeding behavior|interspecies interaction between organisms|intracellular protein kinase cascade|learning|leukocyte migration|platelet activation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|endosome|plasma membrane	ATP binding|glycoprotein binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|central_nervous_system(1)|skin(1)	7		all_cancers(87;1.37e-05)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00125)|Colorectal(196;0.0211)		all cancers(137;0.0451)|OV - Ovarian serous cystadenocarcinoma(136;0.0476)|Epithelial(106;0.102)	Dasatinib(DB01254)													---	---	---	---
Unknown	0	broad.mit.edu	37	6	112279780	112279780	+	IGR	DEL	A	-	-	rs75721609		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112279780delA								FYN (85153 upstream) : WISP3 (95498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	112295645	112295650	+	IGR	DEL	GTGTGT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112295645_112295650delGTGTGT								FYN (101018 upstream) : WISP3 (79628 downstream)																																			---	---	---	---
LAMA4	3910	broad.mit.edu	37	6	112471405	112471410	+	Intron	DEL	ACACAC	-	-	rs72438786		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112471405_112471410delACACAC	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676			laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	113067368	113067368	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:113067368delT								RFPL4B (394870 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	114216262	114216262	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114216262delA								MARCKS (31612 upstream) : FLJ34503 (9289 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	115399043	115399043	+	IGR	DEL	A	-	-	rs71727074		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115399043delA								HS3ST5 (735503 upstream) : FRK (863650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	115921999	115921999	+	IGR	DEL	A	-	-	rs5879335		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115921999delA								None (None upstream) : FRK (340694 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	116146587	116146588	+	IGR	DEL	GG	-	-	rs2582040	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116146587_116146588delGG								None (None upstream) : FRK (116105 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	116241203	116241214	+	IGR	DEL	TGGCGGTGGTAA	-	-	rs72216489	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116241203_116241214delTGGCGGTGGTAA								None (None upstream) : FRK (21479 downstream)																																			---	---	---	---
DSE	29940	broad.mit.edu	37	6	116653608	116653608	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116653608delA	uc003pws.2	+						DSE_uc011ebf.1_Intron|DSE_uc003pwq.1_Intron|DSE_uc003pwr.2_Intron	NM_001080976	NP_001074445			dermatan sulfate epimerase precursor						dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	116815532	116815533	+	IGR	INS	-	AG	AG	rs143341308	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116815532_116815533insAG								FAM26F (30599 upstream) : BET3L (2120 downstream)																																			---	---	---	---
ROS1	6098	broad.mit.edu	37	6	117671851	117671851	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117671851delT	uc003pxp.1	-						ROS1_uc011ebi.1_Intron|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935			proto-oncogene c-ros-1 protein precursor						transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)				T	GOPC|ROS1	glioblastoma|NSCLC								---	---	---	---
C6orf204	387119	broad.mit.edu	37	6	118898050	118898052	+	Intron	DEL	CAT	-	-	rs57886944		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118898050_118898052delCAT	uc003pxz.1	-						C6orf204_uc003pya.1_Intron|C6orf204_uc003pyb.2_Intron|C6orf204_uc011ebj.1_Intron|C6orf204_uc003pyc.2_Intron|C6orf204_uc011ebl.1_Intron	NM_001042475	NP_001035940			chromosome 6 open reading frame 204 isoform a							centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	121837773	121837780	+	IGR	DEL	GGAGACTT	-	-	rs57564096		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121837773_121837780delGGAGACTT								GJA1 (66901 upstream) : HSF2 (882916 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	122411736	122411736	+	IGR	DEL	C	-	-	rs80013268		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122411736delC								GJA1 (640864 upstream) : HSF2 (308960 downstream)																																			---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	125015354	125015354	+	Intron	DEL	T	-	-	rs35835895		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125015354delT	uc003pzo.2	+						NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
NKAIN2	154215	broad.mit.edu	37	6	125022017	125022018	+	Intron	INS	-	ACAC	ACAC	rs143125409	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125022017_125022018insACAC	uc003pzo.2	+						NKAIN2_uc003pzp.2_Intron|NKAIN2_uc010keq.2_Intron|NKAIN2_uc010ker.2_Intron	NM_001040214	NP_001035304			T-cell lymphoma breakpoint-associated target 1							integral to membrane|plasma membrane					0				GBM - Glioblastoma multiforme(226;0.104)														---	---	---	---
NCOA7	135112	broad.mit.edu	37	6	126178712	126178712	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126178712delT	uc010kes.2	+						NCOA7_uc003qae.3_Intron|NCOA7_uc003qah.2_Intron|NCOA7_uc003qai.2_Intron|NCOA7_uc010ket.2_Intron|NCOA7_uc003qaf.2_Intron|NCOA7_uc003qag.2_Intron	NM_181782	NP_861447			nuclear receptor coactivator 7 isoform 1						cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	126866912	126866913	+	Intron	DEL	AA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126866912_126866913delAA	uc003qaq.1	-											Homo sapiens cDNA FLJ45564 fis, clone BRTHA3007469.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	128894058	128894058	+	IGR	DEL	T	-	-	rs113066313		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128894058delT								PTPRK (52188 upstream) : LAMA2 (310228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	128954546	128954547	+	IGR	DEL	GT	-	-	rs4053230		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128954546_128954547delGT								PTPRK (112676 upstream) : LAMA2 (249739 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	128998397	128998400	+	IGR	DEL	TGTG	-	-	rs72258689		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128998397_128998400delTGTG								PTPRK (156527 upstream) : LAMA2 (205886 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	129087182	129087183	+	IGR	DEL	AA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129087182_129087183delAA								PTPRK (245312 upstream) : LAMA2 (117103 downstream)																																			---	---	---	---
SAMD3	154075	broad.mit.edu	37	6	130647513	130647513	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130647513delT	uc003qbx.2	-							NM_001017373	NP_001017373			sterile alpha motif domain containing 3 isoform											ovary(1)	1				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	130921713	130921714	+	IGR	INS	-	A	A	rs56043952		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130921713_130921714insA								TMEM200A (157505 upstream) : LOC285733 (226610 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	131032214	131032215	+	IGR	DEL	GT	-	-	rs72579787		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131032214_131032215delGT								TMEM200A (268006 upstream) : LOC285733 (116109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	133040355	133040355	+	IGR	DEL	T	-	-	rs11291673		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133040355delT								VNN1 (5161 upstream) : VNN3 (3574 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	133252246	133252263	+	IGR	DEL	CATACACACACACACACA	-	-	rs142949183		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133252246_133252263delCATACACACACACACACA								RPS12 (113544 upstream) : LOC285735 (156956 downstream)																																			---	---	---	---
AHI1	54806	broad.mit.edu	37	6	135798799	135798800	+	Intron	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135798799_135798800delCT	uc003qgi.2	-						AHI1_uc003qgh.2_Intron|AHI1_uc003qgj.2_Intron|AHI1_uc003qgk.3_Intron|AHI1_uc003qgl.3_Intron	NM_001134831	NP_001128303			Abelson helper integration site 1 isoform a							adherens junction|cilium|microtubule basal body				ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)														---	---	---	---
PDE7B	27115	broad.mit.edu	37	6	136247627	136247627	+	Intron	DEL	G	-	-	rs113291131		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136247627delG	uc003qgp.2	+						uc003qgq.1_Intron	NM_018945	NP_061818			phosphodiesterase 7B						signal transduction|synaptic transmission	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(1)	1	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Dyphylline(DB00651)|Ketotifen(DB00920)													---	---	---	---
MAP7	9053	broad.mit.edu	37	6	136841338	136841338	+	Intron	DEL	A	-	-	rs141763804		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136841338delA	uc003qgz.2	-						MAP7_uc011edg.1_Intron|MAP7_uc010kgu.2_Intron|MAP7_uc011edh.1_Intron|MAP7_uc010kgv.2_Intron|MAP7_uc010kgs.2_Intron|MAP7_uc011edi.1_Intron|MAP7_uc010kgq.1_Intron|MAP7_uc003qha.1_Intron|MAP7_uc010kgr.2_Intron|MAP7_uc010kgt.2_Intron	NM_003980	NP_003971			microtubule-associated protein 7						establishment or maintenance of cell polarity|microtubule cytoskeleton organization|protein localization in plasma membrane|response to osmotic stress	basolateral plasma membrane|microtubule|microtubule associated complex|nucleus|perinuclear region of cytoplasm	receptor binding|structural molecule activity				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	138182064	138182064	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138182064delT	uc003qhq.1	-											Homo sapiens cDNA FLJ42179 fis, clone THYMU2030796.																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	140717792	140717792	+	IGR	DEL	A	-	-	rs71720119		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140717792delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	141900405	141900405	+	IGR	DEL	A	-	-	rs67463671		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:141900405delA								None (None upstream) : NMBR (496341 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	142013412	142013412	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142013412delA	uc003qit.1	-											SubName: Full=ORF2-like protein; Flags: Fragment;																														---	---	---	---
Unknown	0	broad.mit.edu	37	6	143668500	143668500	+	IGR	DEL	A	-	-	rs67970653		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143668500delA								AIG1 (7061 upstream) : ADAT2 (75470 downstream)																																			---	---	---	---
STX11	8676	broad.mit.edu	37	6	144482009	144482011	+	Intron	DEL	GAC	-	-	rs66502439		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144482009_144482011delGAC	uc003qks.3	+							NM_003764	NP_003755			syntaxin 11						cellular membrane fusion|intracellular protein transport|vesicle-mediated transport	Golgi apparatus|membrane	SNAP receptor activity			ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)										Familial_Hemophagocytic_Lymphohistiocytosis				---	---	---	---
UTRN	7402	broad.mit.edu	37	6	144891402	144891402	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:144891402delA	uc003qkt.2	+							NM_007124	NP_009055			utrophin						muscle contraction|muscle organ development|positive regulation of cell-matrix adhesion	cell junction|cytoplasm|cytoskeleton|membrane fraction|nucleus|postsynaptic membrane	actin binding|calcium ion binding|zinc ion binding			ovary(4)|pancreas(1)	5		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	145596104	145596104	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145596104delT								UTRN (421936 upstream) : EPM2A (350342 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	145679412	145679412	+	IGR	DEL	A	-	-	rs74689901		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145679412delA								UTRN (505244 upstream) : EPM2A (267034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	145719522	145719522	+	IGR	DEL	T	-	-	rs77081200		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:145719522delT								UTRN (545354 upstream) : EPM2A (226924 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	146795766	146795767	+	IGR	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146795766_146795767delAG								GRM1 (37035 upstream) : RAB32 (69061 downstream)																																			---	---	---	---
C6orf103	79747	broad.mit.edu	37	6	147040822	147040822	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147040822delC	uc010khx.2	+						C6orf103_uc003qlp.2_Intron|C6orf103_uc003qlq.2_Intron	NM_024694	NP_078970			hypothetical protein LOC79747						oxygen transport|proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|heme binding|oxygen binding			central_nervous_system(2)|lung(1)	3		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.04e-08)|GBM - Glioblastoma multiforme(68;0.0113)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	150456556	150456556	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150456556delT								ULBP3 (66273 upstream) : PPP1R14C (7632 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	150581101	150581101	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150581101delA								PPP1R14C (9575 upstream) : IYD (108927 downstream)																																			---	---	---	---
MTHFD1L	25902	broad.mit.edu	37	6	151361081	151361084	+	Intron	DEL	CATG	-	-	rs12215772		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151361081_151361084delCATG	uc003qob.2	+						MTHFD1L_uc011een.1_Intron|MTHFD1L_uc011eeo.1_Intron|MTHFD1L_uc003qoc.2_Intron	NM_015440	NP_056255			methylenetetrahydrofolate dehydrogenase (NADP+						folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	151518963	151518965	+	Intron	DEL	AAG	-	-	rs71875198		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151518963_151518965delAAG	uc003qod.2	-											Homo sapiens cDNA clone IMAGE:4838370.																														---	---	---	---
AKAP12	9590	broad.mit.edu	37	6	151565662	151565663	+	Intron	INS	-	AAAC	AAAC	rs148607353	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151565662_151565663insAAAC	uc011eep.1	+						AKAP12_uc003qoe.2_Intron	NM_005100	NP_005091			A kinase (PRKA) anchor protein 12 isoform 1						G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)														---	---	---	---
AKAP12	9590	broad.mit.edu	37	6	151667031	151667034	+	Intron	DEL	TGTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151667031_151667034delTGTG	uc011eep.1	+						AKAP12_uc003qoe.2_Intron|AKAP12_uc003qof.2_Intron|AKAP12_uc010kim.2_Intron|AKAP12_uc003qog.2_Intron	NM_005100	NP_005091			A kinase (PRKA) anchor protein 12 isoform 1						G-protein coupled receptor protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting	cell cortex|cytoskeleton|plasma membrane	adenylate cyclase binding|protein kinase A binding			large_intestine(2)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	8		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)														---	---	---	---
ESR1	2099	broad.mit.edu	37	6	152269753	152269753	+	Intron	DEL	C	-	-	rs117233406	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152269753delC	uc003qom.3	+						ESR1_uc010kin.2_Intron|ESR1_uc010kio.2_Intron|ESR1_uc010kip.2_Intron|ESR1_uc003qon.3_Intron|ESR1_uc003qoo.3_Intron|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Intron|ESR1_uc011eex.1_Intron|ESR1_uc010kit.1_Intron|ESR1_uc011eey.1_Intron	NM_001122742	NP_001116214			estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)													---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152758141	152758141	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152758141delA	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qow.2_Intron|SYNE1_uc003qox.1_Intron	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152809209	152809210	+	Intron	INS	-	AA	AA	rs35496801		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152809209_152809210insAA	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qpa.1_Intron	NM_182961	NP_892006			spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
Unknown	0	broad.mit.edu	37	6	152986216	152986216	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152986216delT								SYNE1 (27682 upstream) : MYCT1 (32814 downstream)																																			---	---	---	---
IPCEF1	26034	broad.mit.edu	37	6	154504525	154504525	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154504525delG	uc003qpx.2	-						OPRM1_uc003qpt.1_Intron|IPCEF1_uc003qpv.2_Intron|IPCEF1_uc003qpw.2_Intron|IPCEF1_uc010kjh.2_Intron	NM_015553	NP_056368			phosphoinositide-binding protein PIP3-E isoform						response to oxidative stress	cytoplasm|plasma membrane	oxygen transporter activity|peroxidase activity				0																		---	---	---	---
TIAM2	26230	broad.mit.edu	37	6	155380429	155380430	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155380429_155380430delTG	uc003qqb.2	+							NM_012454	NP_036586			T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)														---	---	---	---
TIAM2	26230	broad.mit.edu	37	6	155553403	155553403	+	Intron	DEL	T	-	-	rs149649654		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155553403delT	uc003qqb.2	+						TIAM2_uc003qqe.2_Intron|TIAM2_uc010kjj.2_Intron|TIAM2_uc003qqf.2_Intron|TIAM2_uc011efl.1_Intron|TIAM2_uc003qqg.2_Intron|TIAM2_uc003qqh.2_Intron	NM_012454	NP_036586			T-cell lymphoma invasion and metastasis 2						apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	156333931	156333932	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156333931_156333932insA								MIR1202 (65918 upstream) : ARID1B (765154 downstream)																																			---	---	---	---
TMEM181	57583	broad.mit.edu	37	6	158965214	158965215	+	Intron	INS	-	GT	GT	rs149735409	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158965214_158965215insGT	uc003qrm.3	+						TMEM181_uc010kjr.1_Intron	NM_020823	NP_065874			G protein-coupled receptor 178						pathogenesis	integral to membrane	toxin binding			ovary(2)|central_nervous_system(1)	3		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	159860145	159860145	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159860145delA								FNDC1 (167006 upstream) : SOD2 (240006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	160319646	160319648	+	IGR	DEL	CTT	-	-	rs403644	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160319646_160319648delCTT								PNLDC1 (77911 upstream) : MAS1 (8326 downstream)																																			---	---	---	---
SLC22A2	6582	broad.mit.edu	37	6	160651855	160651856	+	Intron	INS	-	A	A	rs144272643	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160651855_160651856insA	uc003qtf.2	-						SLC22A2_uc003qte.1_Intron	NM_003058	NP_003049			solute carrier family 22 member 2						body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)														---	---	---	---
SLC22A2	6582	broad.mit.edu	37	6	160675779	160675779	+	Intron	DEL	G	-	-	rs3839343		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160675779delG	uc003qtf.2	-						SLC22A2_uc003qte.1_Intron|SLC22A2_uc003qth.1_Intron	NM_003058	NP_003049			solute carrier family 22 member 2						body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	161217216	161217216	+	IGR	DEL	C	-	-	rs5881372		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161217216delC								PLG (42871 upstream) : MAP3K4 (195606 downstream)																																			---	---	---	---
AGPAT4	56895	broad.mit.edu	37	6	161611336	161611337	+	Intron	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161611336_161611337delGA	uc003qtr.1	-						AGPAT4_uc003qts.1_Intron|AGPAT4_uc011egb.1_Intron|AGPAT4_uc003qtt.1_Intron|AGPAT4_uc011egc.1_Intron|AGPAT4_uc011egd.1_Intron|AGPAT4_uc011ege.1_Intron	NM_020133	NP_064518			1-acylglycerol-3-phosphate O-acyltransferase 4						phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity|protein binding				0		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)														---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162018642	162018643	+	Intron	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162018642_162018643delCT	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron|PARK2_uc011egf.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
PARK2	5071	broad.mit.edu	37	6	162378442	162378442	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162378442delT	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553			parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)														---	---	---	---
PACRG	135138	broad.mit.edu	37	6	163524551	163524551	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163524551delT	uc003qua.2	+						PACRG_uc003qub.2_Intron|PACRG_uc003quc.2_Intron	NM_152410	NP_689623			parkin co-regulated gene protein isoform 1												0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)														---	---	---	---
PACRG	135138	broad.mit.edu	37	6	163576003	163576004	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163576003_163576004insA	uc003qua.2	+						PACRG_uc003qub.2_Intron|PACRG_uc003quc.2_Intron	NM_152410	NP_689623			parkin co-regulated gene protein isoform 1												0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	165253039	165253039	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165253039delA								None (None upstream) : C6orf118 (440116 downstream)																																			---	---	---	---
PDE10A	10846	broad.mit.edu	37	6	165798119	165798120	+	Intron	DEL	GA	-	-	rs57175607		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165798119_165798120delGA	uc003qun.2	-						PDE10A_uc011egj.1_Intron|PDE10A_uc011egk.1_Intron|PDE10A_uc003quo.2_Intron	NM_006661	NP_006652			phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)													---	---	---	---
PDE10A	10846	broad.mit.edu	37	6	166061019	166061019	+	Intron	DEL	T	-	-	rs10455958		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166061019delT	uc003qun.2	-						PDE10A_uc003quo.2_Intron	NM_006661	NP_006652			phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)													---	---	---	---
PDE10A	10846	broad.mit.edu	37	6	166069725	166069726	+	Intron	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166069725_166069726delCT	uc003qun.2	-						PDE10A_uc003quo.2_Intron	NM_006661	NP_006652			phosphodiesterase 10A isoform 2						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)													---	---	---	---
SFT2D1	113402	broad.mit.edu	37	6	166747387	166747394	+	Intron	DEL	CCACCAAA	-	-	rs71696185		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166747387_166747394delCCACCAAA	uc003qux.2	-							NM_145169	NP_660152			SFT2 domain containing 1						protein transport|vesicle-mediated transport	integral to membrane				central_nervous_system(1)	1		Breast(66;0.000148)|Prostate(117;0.109)|Ovarian(120;0.199)		OV - Ovarian serous cystadenocarcinoma(33;2.63e-19)|BRCA - Breast invasive adenocarcinoma(81;4.92e-06)|GBM - Glioblastoma multiforme(31;4.58e-05)														---	---	---	---
KIF25	3834	broad.mit.edu	37	6	168414423	168414424	+	Intron	INS	-	CA	CA	rs56049828		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168414423_168414424insCA	uc010kkt.1	+											Homo sapiens cDNA FLJ76991 complete cds, highly similar to Homo sapiens kinesin family member 25 (KIF25), transcript variant 1, mRNA.						microtubule-based movement|mitotic sister chromatid segregation	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(1)|pancreas(1)	2		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	168626898	168626899	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168626898_168626899delAC								FRMD1 (147059 upstream) : DACT2 (80687 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	168792521	168792522	+	IGR	INS	-	C	C	rs150750229	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168792521_168792522insC								DACT2 (72119 upstream) : SMOC2 (49509 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	6	168793009	168793009	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168793009delC								DACT2 (72607 upstream) : SMOC2 (49022 downstream)																																			---	---	---	---
PHF10	55274	broad.mit.edu	37	6	170112032	170112033	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170112032_170112033insA	uc011egy.1	-						PHF10_uc011egz.1_Intron|PHF10_uc011eha.1_Intron	NM_018288	NP_060758			PHD finger protein 10 isoform a						nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	npBAF complex	zinc ion binding			urinary_tract(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)														---	---	---	---
Unknown	0	broad.mit.edu	37	6	170421464	170421465	+	IGR	DEL	TG	-	-	rs5881851		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170421464_170421465delTG								C6orf208 (218495 upstream) : LOC154449 (141957 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	448177	448180	+	IGR	DEL	ATCT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:448177_448180delATCT								FAM20C (147466 upstream) : PDGFA (88719 downstream)																																			---	---	---	---
SUN1	23353	broad.mit.edu	37	7	895269	895269	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:895269delC	uc011jvp.1	+						GET4_uc003sjj.1_Intron|SUN1_uc003sjf.2_Intron|SUN1_uc011jvq.1_Intron|SUN1_uc003sjg.2_Intron|SUN1_uc011jvr.1_Intron|SUN1_uc003sji.2_Intron|SUN1_uc003sjk.2_Intron	NM_001130965	NP_001124437			unc-84 homolog A isoform a						cytoskeletal anchoring at nuclear membrane|nuclear matrix anchoring at nuclear membrane	integral to membrane|nuclear inner membrane|SUN-KASH complex	protein binding				0																		---	---	---	---
ADAP1	11033	broad.mit.edu	37	7	945837	945837	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:945837delA	uc003sjo.3	-						ADAP1_uc003sjm.3_5'Flank|ADAP1_uc011jvs.1_Intron|ADAP1_uc003sjn.3_Intron|ADAP1_uc010ksc.2_Intron	NM_006869	NP_006860			centaurin, alpha 1						cell surface receptor linked signaling pathway|regulation of ARF GTPase activity	cytoplasm|nucleus|plasma membrane	ARF GTPase activator activity|inositol 1,3,4,5 tetrakisphosphate binding|protein binding|zinc ion binding			upper_aerodigestive_tract(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	1301314	1301314	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1301314delG								UNCX (24702 upstream) : MICALL2 (172682 downstream)																																			---	---	---	---
MAD1L1	8379	broad.mit.edu	37	7	1870712	1870713	+	Intron	DEL	CT	-	-	rs76390129		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1870712_1870713delCT	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc003sld.1_Intron	NM_001013836	NP_001013858			MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	2665214	2665215	+	IGR	INS	-	TT	TT	rs141539332		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2665214_2665215insTT								IQCE (10847 upstream) : TTYH3 (6388 downstream)																																			---	---	---	---
CARD11	84433	broad.mit.edu	37	7	2957113	2957114	+	Intron	INS	-	C	C	rs146997118	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2957113_2957114insC	uc003smv.2	-							NM_032415	NP_115791			caspase recruitment domain family, member 11						positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)				Mis		DLBCL								---	---	---	---
Unknown	0	broad.mit.edu	37	7	3103304	3103305	+	IGR	INS	-	CTTCTC	CTTCTC	rs143775465	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3103304_3103305insCTTCTC								CARD11 (19725 upstream) : SDK1 (237775 downstream)																																			---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3359900	3359901	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3359900_3359901insT	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3554134	3554135	+	Intron	INS	-	C	C	rs147195008	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3554134_3554135insC	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
SDK1	221935	broad.mit.edu	37	7	3680315	3680316	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:3680315_3680316insT	uc003smx.2	+							NM_152744	NP_689957			sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	4524428	4524430	+	IGR	DEL	AGG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4524428_4524430delAGG								SDK1 (215799 upstream) : FOXK1 (158958 downstream)																																			---	---	---	---
FOXK1	221937	broad.mit.edu	37	7	4757115	4757115	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4757115delT	uc003snc.1	+						FOXK1_uc003sna.1_Intron|FOXK1_uc003snb.1_Intron	NM_001037165	NP_001032242			forkhead box K1						cell differentiation|embryo development|muscle organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			upper_aerodigestive_tract(1)|skin(1)	2		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)														---	---	---	---
RADIL	55698	broad.mit.edu	37	7	4895738	4895739	+	Intron	INS	-	T	T	rs112928865		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4895738_4895739insT	uc003snj.1	-						RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron	NM_018059	NP_060529			Rap GTPase interactor						cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	5903162	5903163	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5903162_5903163insT								ZNF815 (9096 upstream) : OCM (17266 downstream)																																			---	---	---	---
C7orf28A	51622	broad.mit.edu	37	7	5950972	5950972	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5950972delT	uc003spf.2	+							NM_015622	NP_056437			hypothetical protein LOC51622							lysosomal membrane					0		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0974)|OV - Ovarian serous cystadenocarcinoma(56;7.91e-15)														---	---	---	---
USP42	84132	broad.mit.edu	37	7	6191663	6191664	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6191663_6191664insA	uc011jwo.1	+						USP42_uc011jwp.1_Intron|USP42_uc011jwq.1_Intron|USP42_uc011jwr.1_Intron	NM_032172	NP_115548			ubiquitin specific peptidase 42						cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)														---	---	---	---
DAGLB	221955	broad.mit.edu	37	7	6507390	6507390	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6507390delA	uc003sqd.3	-						KDELR2_uc003sqe.3_Intron|KDELR2_uc003sqf.3_Intron	NM_139179	NP_631918			diacylglycerol lipase, beta isoform 1						lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	6612884	6612885	+	IGR	INS	-	C	C	rs141700882	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6612884_6612885insC								GRID2IP (21817 upstream) : ZDHHC4 (4180 downstream)																																			---	---	---	---
ZNF12	7559	broad.mit.edu	37	7	6742671	6742672	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6742671_6742672delAC	uc003sqt.1	-						ZNF12_uc011jxa.1_Intron|ZNF12_uc003sqs.1_Intron	NM_016265	NP_057349			zinc finger protein 12 isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)														---	---	---	---
PMS2CL	441194	broad.mit.edu	37	7	6775144	6775145	+	Intron	INS	-	T	T	rs66809022		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6775144_6775145insT	uc011jxb.1	+						PMS2CL_uc003squ.2_Intron|PMS2CL_uc003sqv.1_Intron					SubName: Full=cDNA FLJ60281, highly similar to PMS1 protein homolog 2;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	7868376	7868378	+	Intron	DEL	CTC	-	-	rs147841701		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7868376_7868378delCTC	uc011jxf.1	+											SubName: Full=cDNA FLJ54628; SubName: Full=HCG19535; SubName: Full=Hypothetical gene supported by AK027125;																														---	---	---	---
NXPH1	30010	broad.mit.edu	37	7	8686992	8686992	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8686992delA	uc003srv.2	+						NXPH1_uc011jxh.1_Intron	NM_152745	NP_689958			neurexophilin 1 precursor							extracellular region				ovary(1)|central_nervous_system(1)	2		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	9136082	9136083	+	IGR	DEL	TA	-	-	rs148059633		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9136082_9136083delTA								NXPH1 (343490 upstream) : PER4 (537817 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	9408817	9408818	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9408817_9408818insA								NXPH1 (616225 upstream) : PER4 (265082 downstream)																																			---	---	---	---
THSD7A	221981	broad.mit.edu	37	7	11776080	11776081	+	Intron	INS	-	TG	TG	rs112377285		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11776080_11776081insTG	uc003ssf.3	-							NM_015204	NP_056019			thrombospondin, type I, domain containing 7A							integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)											HNSCC(18;0.044)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	12277435	12277440	+	IGR	DEL	ATATAC	-	-	rs71968396		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12277435_12277440delATATAC								TMEM106B (546 upstream) : VWDE (93069 downstream)																																			---	---	---	---
DGKB	1607	broad.mit.edu	37	7	14374019	14374024	+	Intron	DEL	GTGCGC	-	-	rs141167627	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14374019_14374024delGTGCGC	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071			diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)													---	---	---	---
MEOX2	4223	broad.mit.edu	37	7	15679880	15679881	+	Intron	DEL	TG	-	-	rs34600761		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15679880_15679881delTG	uc003stc.2	-						MEOX2_uc011jxw.1_Intron	NM_005924	NP_005915			mesenchyme homeobox 2						blood circulation|multicellular organismal development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)														---	---	---	---
BZW2	28969	broad.mit.edu	37	7	16712207	16712208	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:16712207_16712208insT	uc003stl.2	+						BZW2_uc011jxx.1_Intron|BZW2_uc003stm.2_Intron|BZW2_uc003stj.2_Intron|BZW2_uc003stk.2_Intron|BZW2_uc003stn.1_Intron|BZW2_uc003sto.1_Intron|BZW2_uc003stp.2_Intron|BZW2_uc010kua.2_Intron	NM_001159767	NP_001153239			basic leucine zipper and W2 domains 2						cell differentiation|nervous system development|RNA metabolic process		protein binding			ovary(2)	2	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	18019231	18019231	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18019231delA								SNX13 (39100 upstream) : PRPS1L1 (47171 downstream)																																			---	---	---	---
HDAC9	9734	broad.mit.edu	37	7	18406520	18406520	+	Intron	DEL	A	-	-	rs71824856		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18406520delA	uc003sua.1	+						HDAC9_uc011jya.1_Intron	NM_014707	NP_055522			histone deacetylase 9 isoform 3						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)													---	---	---	---
Unknown	0	broad.mit.edu	37	7	19447162	19447163	+	IGR	INS	-	T	T	rs139713383	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19447162_19447163insT								FERD3L (262118 upstream) : TWISTNB (287922 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	21002577	21002577	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21002577delC								RPL23P8 (135138 upstream) : SP4 (465112 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	22882990	22882992	+	IGR	DEL	GTG	-	-	rs113612214		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22882990_22882992delGTG								TOMM7 (20569 upstream) : SNORD93 (13240 downstream)																																			---	---	---	---
STK31	56164	broad.mit.edu	37	7	23919174	23919175	+	Intron	INS	-	CA	CA	rs141933210	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23919174_23919175insCA	uc003swv.1	+											SubName: Full=Putative uncharacterized protein STK31;								ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9																		---	---	---	---
MPP6	51678	broad.mit.edu	37	7	24625775	24625775	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24625775delT	uc003swx.2	+						MPP6_uc003swy.2_Intron	NM_016447	NP_057531			membrane protein, palmitoylated 6						protein complex assembly		protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	25521810	25521810	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25521810delG								NPVF (253705 upstream) : MIR148A (467729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	25844504	25844505	+	IGR	INS	-	AC	AC	rs139766106	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:25844504_25844505insAC								NPVF (576399 upstream) : MIR148A (145034 downstream)																																			---	---	---	---
SKAP2	8935	broad.mit.edu	37	7	26759671	26759672	+	Intron	DEL	AC	-	-	rs35097662		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26759671_26759672delAC	uc003syc.2	-						SKAP2_uc011jzi.1_Intron|SKAP2_uc011jzj.1_Intron	NM_003930	NP_003921			src kinase associated phosphoprotein 2						B cell activation|cell junction assembly|protein complex assembly|signal transduction	cytosol|plasma membrane	SH3/SH2 adaptor activity			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	27715204	27715205	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27715204_27715205insA								HIBADH (12602 upstream) : TAX1BP1 (63787 downstream)																																			---	---	---	---
CPVL	54504	broad.mit.edu	37	7	29176772	29176772	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29176772delC	uc003szv.2	-						CPVL_uc003szw.2_Intron|CPVL_uc003szx.2_Intron	NM_031311	NP_112601			serine carboxypeptidase vitellogenic-like						proteolysis		protein binding|serine-type carboxypeptidase activity			ovary(2)	2																		---	---	---	---
SCRN1	9805	broad.mit.edu	37	7	30030006	30030007	+	5'Flank	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30030006_30030007delTG	uc011kaa.1	-						SCRN1_uc011jzy.1_5'Flank|SCRN1_uc003tak.2_5'Flank|SCRN1_uc011jzz.1_5'Flank	NM_001145514	NP_001138986			secernin 1 isoform b						exocytosis|proteolysis	cytoplasm|nuclear membrane	dipeptidase activity			ovary(2)	2																		---	---	---	---
C7orf16	10842	broad.mit.edu	37	7	31735444	31735444	+	Intron	DEL	T	-	-	rs68028809		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31735444delT	uc003tcl.2	+						C7orf16_uc011kaf.1_Intron	NM_006658	NP_006649			G-substrate isoform 1						behavior|central nervous system development|intracellular protein kinase cascade|protein phosphorylation	soluble fraction				ovary(2)|central_nervous_system(1)	3			GBM - Glioblastoma multiforme(11;0.216)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	33863159	33863164	+	IGR	DEL	ACACAC	-	-	rs72342743		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33863159_33863164delACACAC								BBS9 (217479 upstream) : BMPER (81948 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	35750103	35750106	+	IGR	DEL	CAAC	-	-	rs80343129		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35750103_35750106delCAAC								HERPUD2 (15331 upstream) : SEPT7 (90521 downstream)																																			---	---	---	---
EEPD1	80820	broad.mit.edu	37	7	36298504	36298505	+	Intron	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36298504_36298505insC	uc003tfa.2	+							NM_030636	NP_085139			endonuclease/exonuclease/phosphatase family						DNA repair		DNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	36813705	36813706	+	IGR	INS	-	A	A	rs59375923		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36813705_36813706insA								AOAH (49552 upstream) : ELMO1 (80255 downstream)																																			---	---	---	---
ELMO1	9844	broad.mit.edu	37	7	36940620	36940621	+	Intron	INS	-	T	T	rs145263596	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36940620_36940621insT	uc003tfk.1	-						ELMO1_uc003tfi.1_Intron|ELMO1_uc003tfj.1_Intron|ELMO1_uc011kbb.1_Intron|ELMO1_uc011kbc.1_Intron|ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615			engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6																		---	---	---	---
AMPH	273	broad.mit.edu	37	7	38498965	38498966	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38498965_38498966insA	uc003tgu.2	-						AMPH_uc003tgv.2_Intron|AMPH_uc003tgt.2_Intron	NM_001635	NP_001626			amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5																		---	---	---	---
CDK13	8621	broad.mit.edu	37	7	40031760	40031761	+	Intron	INS	-	GG	GG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40031760_40031761insGG	uc003thh.3	+						CDK13_uc003thi.3_Intron|CDK13_uc011kbf.1_Intron	NM_003718	NP_003709			cell division cycle 2-like 5 isoform 1						alternative nuclear mRNA splicing, via spliceosome|hemopoiesis|interspecies interaction between organisms|phosphorylation of RNA polymerase II C-terminal domain|positive regulation of cell proliferation|regulation of mitosis	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|skin(2)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	41112465	41112465	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41112465delA								C7orf10 (212108 upstream) : INHBA (616138 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	42831526	42831527	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42831526_42831527insA								GLI3 (554908 upstream) : C7orf25 (117347 downstream)																																			---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43289748	43289751	+	Intron	DEL	ACAC	-	-	rs76926365		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43289748_43289751delACAC	uc003tid.1	+						HECW1_uc011kbi.1_Intron|HECW1_uc003tie.1_Intron	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43558852	43558852	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43558852delT	uc003tid.1	+						HECW1_uc011kbi.1_Intron|uc003tig.1_Intron	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
HECW1	23072	broad.mit.edu	37	7	43573219	43573220	+	Intron	INS	-	TGGT	TGGT	rs145535536	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43573219_43573220insTGGT	uc003tid.1	+						HECW1_uc011kbi.1_Intron	NM_015052	NP_055867			NEDD4-like ubiquitin-protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23																		---	---	---	---
RASA4P	401331	broad.mit.edu	37	7	44073273	44073274	+	Intron	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44073273_44073274insC	uc011kbk.1	-						RASA4P_uc003tji.2_RNA|RASA4P_uc010kxx.2_Intron	NM_006989	NP_008920			RAS p21 protein activator 4 isoform 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	44176199	44176200	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44176199_44176200delTC								POLD2 (13052 upstream) : MYL7 (2265 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	47264969	47264970	+	IGR	DEL	TG	-	-	rs138376184		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47264969_47264970delTG								None (None upstream) : TNS3 (49783 downstream)																																			---	---	---	---
TNS3	64759	broad.mit.edu	37	7	47420368	47420369	+	Intron	DEL	CA	-	-	rs143205554	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47420368_47420369delCA	uc003tnv.2	-						TNS3_uc003tnw.2_Intron	NM_022748	NP_073585			tensin 3							focal adhesion	protein binding			ovary(4)	4																		---	---	---	---
ABCA13	154664	broad.mit.edu	37	7	48632839	48632840	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48632839_48632840delTG	uc003toq.2	+						ABCA13_uc010kys.1_Intron|ABCA13_uc010kyt.1_Intron|ABCA13_uc010kyu.1_Intron	NM_152701	NP_689914			ATP binding cassette, sub-family A (ABC1),						transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	49064163	49064163	+	IGR	DEL	T	-	-	rs11332214		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49064163delT								CDC14C (97114 upstream) : VWC2 (749094 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	50884958	50884958	+	IGR	DEL	T	-	-	rs146505350		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50884958delT								GRB10 (23799 upstream) : COBL (198952 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	51795578	51795579	+	IGR	INS	-	C	C	rs148450432	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51795578_51795579insC								COBL (411063 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52176642	52176643	+	IGR	INS	-	TCTCTC	TCTCTC	rs140320709	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52176642_52176643insTCTCTC								COBL (792127 upstream) : POM121L12 (926706 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52462496	52462496	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52462496delT								None (None upstream) : POM121L12 (640853 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	52473435	52473435	+	IGR	DEL	C	-	-	rs74540055		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:52473435delC								None (None upstream) : POM121L12 (629914 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	53555521	53555522	+	IGR	INS	-	T	T	rs12113922		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53555521_53555522insT								POM121L12 (450904 upstream) : HPVC1 (713395 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	54154002	54154002	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54154002delC								None (None upstream) : HPVC1 (114915 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55697321	55697321	+	IGR	DEL	A	-	-	rs151140141		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55697321delA								VOPP1 (57121 upstream) : LOC442308 (15991 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55708783	55708783	+	IGR	DEL	A	-	-	rs75503881		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55708783delA								VOPP1 (68583 upstream) : LOC442308 (4529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	55728691	55728691	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55728691delT								LOC442308 (14049 upstream) : FKBP9L (20077 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57608535	57608536	+	IGR	INS	-	T	T	rs147153132	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57608535_57608536insT								ZNF716 (75270 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57774292	57774292	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57774292delA								ZNF716 (241027 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	57882177	57882178	+	IGR	DEL	TG	-	-	rs111839213		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57882177_57882178delTG								ZNF716 (348912 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	58016641	58016642	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:58016641_58016642delTG								ZNF716 (483376 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61082160	61082161	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61082160_61082161insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61749684	61749684	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61749684delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61818105	61818106	+	IGR	INS	-	AT	AT	rs4088462		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61818105_61818106insAT								None (None upstream) : LOC643955 (933566 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	61877662	61877662	+	IGR	DEL	A	-	-	rs111443864		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61877662delA								None (None upstream) : LOC643955 (874010 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	62581058	62581058	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62581058delT								None (None upstream) : LOC643955 (170614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	63729206	63729207	+	IGR	DEL	TT	-	-	rs35290301		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63729206_63729207delTT								ZNF679 (1906 upstream) : ZNF680 (251048 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	64816026	64816027	+	IGR	INS	-	AA	AA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64816026_64816027insAA								INTS4L1 (121427 upstream) : ZNF92 (22741 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	66086956	66086956	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66086956delA								LOC493754 (29593 upstream) : RABGEF1 (6934 downstream)																																			---	---	---	---
TYW1	55253	broad.mit.edu	37	7	66699768	66699770	+	Intron	DEL	AGA	-	-	rs3070653		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66699768_66699770delAGA	uc003tvn.2	+						TYW1_uc010lai.2_Intron|TYW1_uc011kef.1_Intron|PMS2L4_uc003tvo.2_Intron	NM_018264	NP_060734			radical S-adenosyl methionine and flavodoxin						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	67027186	67027187	+	IGR	INS	-	TT	TT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67027186_67027187insTT								STAG3L4 (240674 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67082174	67082175	+	IGR	INS	-	TT	TT	rs34882472		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67082174_67082175insTT								STAG3L4 (295662 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67159101	67159102	+	IGR	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67159101_67159102delCT								STAG3L4 (372589 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67191347	67191347	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67191347delT								STAG3L4 (404835 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	67744836	67744836	+	IGR	DEL	A	-	-	rs140871151	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67744836delA								STAG3L4 (958324 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68223774	68223775	+	IGR	INS	-	GGGA	GGGA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68223774_68223775insGGGA								None (None upstream) : AUTS2 (840130 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	68983796	68983796	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:68983796delG								None (None upstream) : AUTS2 (80109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	71197681	71197682	+	IGR	INS	-	GT	GT	rs144627783	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71197681_71197682insGT								WBSCR17 (19098 upstream) : CALN1 (46795 downstream)																																			---	---	---	---
RFC2	5982	broad.mit.edu	37	7	73158227	73158228	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73158227_73158228insT	uc011kfa.1	-							NM_181471				replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	73680378	73680378	+	IGR	DEL	T	-	-	rs112071100		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73680378delT								RFC2 (11640 upstream) : CLIP2 (23427 downstream)																																			---	---	---	---
CLIP2	7461	broad.mit.edu	37	7	73705126	73705127	+	Intron	INS	-	TTCA	TTCA	rs145143364	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73705126_73705127insTTCA	uc003uam.2	+						CLIP2_uc003uan.2_Intron	NM_003388	NP_003379			CAP-GLY domain containing linker protein 2							microtubule associated complex				skin(3)	3																		---	---	---	---
GTF2IRD1	9569	broad.mit.edu	37	7	73956242	73956245	+	Intron	DEL	ATAG	-	-	rs112368910		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73956242_73956245delATAG	uc003uaq.2	+						GTF2IRD1_uc010lbq.2_Intron|GTF2IRD1_uc003uap.2_Intron|GTF2IRD1_uc003uar.1_Intron	NM_016328	NP_057412			GTF2I repeat domain containing 1 isoform 1							nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4																		---	---	---	---
HIP1	3092	broad.mit.edu	37	7	75235893	75235894	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75235893_75235894insA	uc003uds.1	-							NM_005338	NP_005329			huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8								T	PDGFRB	CMML								---	---	---	---
CCL26	10344	broad.mit.edu	37	7	75419475	75419476	+	5'Flank	INS	-	CCTT	CCTT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75419475_75419476insCCTT	uc003udt.1	-							NM_006072	NP_006063			chemokine (C-C motif) ligand 26 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	75800154	75800155	+	IGR	INS	-	TT	TT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75800154_75800155insTT								MDH2 (104226 upstream) : SRRM3 (31061 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	75813383	75813384	+	IGR	INS	-	AGAGAGAG	AGAGAGAG	rs146630203	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75813383_75813384insAGAGAGAG								MDH2 (117455 upstream) : SRRM3 (17832 downstream)																																			---	---	---	---
DTX2	113878	broad.mit.edu	37	7	76110507	76110507	+	Intron	DEL	T	-	-	rs11320055		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76110507delT	uc003uff.3	+						DTX2_uc011kgk.1_Intron|DTX2_uc003ufg.3_Intron|DTX2_uc003ufh.3_Intron|DTX2_uc003ufj.3_Intron	NM_020892	NP_065943			deltex 2 isoform a						Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	77755511	77755512	+	Intron	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77755511_77755512delGT	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc010ldx.1_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78031511	78031512	+	Intron	DEL	GG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78031511_78031512delGG	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron|MAGI2_uc010ldx.1_Intron|MAGI2_uc010ldy.1_Intron|MAGI2_uc011kgr.1_Intron|MAGI2_uc011kgs.1_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
MAGI2	9863	broad.mit.edu	37	7	78510105	78510105	+	Intron	DEL	A	-	-	rs148050745		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78510105delA	uc003ugx.2	-						MAGI2_uc003ugy.2_Intron	NM_012301	NP_036433			membrane associated guanylate kinase, WW and PDZ							cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	82158670	82158670	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82158670delA								CACNA2D1 (85639 upstream) : PCLO (224651 downstream)																																			---	---	---	---
SEMA3E	9723	broad.mit.edu	37	7	83246044	83246044	+	Intron	DEL	T	-	-	rs67160899		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83246044delT	uc003uhy.1	-							NM_012431	NP_036563			semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)																---	---	---	---
Unknown	0	broad.mit.edu	37	7	85542953	85542954	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85542953_85542954delAC								SEMA3D (726782 upstream) : GRM3 (730276 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85801580	85801581	+	IGR	INS	-	GTGT	GTGT	rs144018212	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85801580_85801581insGTGT								SEMA3D (985409 upstream) : GRM3 (471649 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	85866703	85866704	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85866703_85866704delAC								None (None upstream) : GRM3 (406526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	86188982	86188983	+	IGR	DEL	CG	-	-	rs149361613		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86188982_86188983delCG								None (None upstream) : GRM3 (84247 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	86866908	86866909	+	IGR	INS	-	TA	TA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86866908_86866909insTA								C7orf23 (17877 upstream) : TP53TG1 (87757 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	89213475	89213475	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89213475delA								ZNF804B (247131 upstream) : DPY19L2P4 (535239 downstream)																																			---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90492320	90492320	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90492320delC	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90600467	90600467	+	Intron	DEL	G	-	-	rs67275640		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90600467delG	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
CDK14	5218	broad.mit.edu	37	7	90771114	90771115	+	Intron	INS	-	TTG	TTG	rs143426665	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90771114_90771115insTTG	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527			PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4																		---	---	---	---
PEX1	5189	broad.mit.edu	37	7	92140456	92140456	+	Intron	DEL	T	-	-	rs34961886		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92140456delT	uc003uly.2	-						PEX1_uc011khr.1_Intron|PEX1_uc010ley.2_Intron|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_Intron	NM_000466	NP_000457			peroxin1						microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)															---	---	---	---
PEX1	5189	broad.mit.edu	37	7	92145744	92145745	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92145744_92145745insA	uc003uly.2	-						PEX1_uc011khr.1_Intron|PEX1_uc010ley.2_Intron|PEX1_uc011khs.1_Intron|PEX1_uc011kht.1_Intron	NM_000466	NP_000457			peroxin1						microtubule-based peroxisome localization|protein import into peroxisome matrix	cytosol|nucleus|peroxisomal membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding|protein complex binding			ovary(1)|central_nervous_system(1)	2	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)															---	---	---	---
HEPACAM2	253012	broad.mit.edu	37	7	92829035	92829036	+	Intron	DEL	AT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92829035_92829036delAT	uc003umm.2	-						HEPACAM2_uc003uml.2_Intron|HEPACAM2_uc010lff.2_Intron|HEPACAM2_uc011khy.1_Intron	NM_001039372	NP_001034461			HEPACAM family member 2 isoform 1							integral to membrane				ovary(3)|breast(1)|kidney(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	95339965	95339966	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95339965_95339966insT								PDK4 (114040 upstream) : DYNC1I1 (61852 downstream)																																			---	---	---	---
DYNC1I1	1780	broad.mit.edu	37	7	95526758	95526758	+	Intron	DEL	A	-	-	rs76495303		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95526758delA	uc003uoc.3	+						DYNC1I1_uc003uod.3_Intron|DYNC1I1_uc003uob.2_Intron|DYNC1I1_uc003uoe.3_Intron|DYNC1I1_uc010lfl.2_Intron	NM_004411	NP_004402			dynein, cytoplasmic 1, intermediate chain 1						vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)															---	---	---	---
DYNC1I1	1780	broad.mit.edu	37	7	95685472	95685473	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95685472_95685473insT	uc003uoc.3	+						DYNC1I1_uc003uod.3_Intron|DYNC1I1_uc003uob.2_Intron|DYNC1I1_uc003uoe.3_Intron|DYNC1I1_uc010lfl.2_Intron	NM_004411	NP_004402			dynein, cytoplasmic 1, intermediate chain 1						vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)															---	---	---	---
Unknown	0	broad.mit.edu	37	7	96377127	96377130	+	IGR	DEL	CTTT	-	-	rs113243068		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96377127_96377130delCTTT								SHFM1 (37924 upstream) : DLX6AS (220698 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	96394644	96394644	+	IGR	DEL	T	-	-	rs2922933	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96394644delT								SHFM1 (55441 upstream) : DLX6AS (203184 downstream)																																			---	---	---	---
MGC72080	389538	broad.mit.edu	37	7	97505173	97505174	+	Intron	INS	-	T	T	rs34906277		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97505173_97505174insT	uc010lfp.1	-											Homo sapiens cDNA, FLJ99734.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	98108146	98108152	+	IGR	DEL	CTGTCAC	-	-	rs112906827		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98108146_98108152delCTGTCAC								BAIAP2L1 (77719 upstream) : NPTX2 (138445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	98204497	98204498	+	IGR	INS	-	C	C	rs150754922	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98204497_98204498insC								BAIAP2L1 (174070 upstream) : NPTX2 (42099 downstream)																																			---	---	---	---
AZGP1	563	broad.mit.edu	37	7	99567204	99567204	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99567204delA	uc003ush.2	-							NM_001185	NP_001176			alpha-2-glycoprotein 1, zinc						antigen processing and presentation|cell adhesion|immune response|lipid catabolic process|negative regulation of cell proliferation	extracellular region|MHC class I protein complex	fatty acid binding|protein transmembrane transporter activity|ribonuclease activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	100553792	100553793	+	Intron	INS	-	ATAAACACAAAA	ATAAACACAAAA	rs148961911	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100553792_100553793insATAAACACAAAA	uc003uxk.1	+						uc003uxl.1_Intron					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																														---	---	---	---
EMID2	136227	broad.mit.edu	37	7	101014246	101014247	+	Intron	INS	-	G	G	rs138174865	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101014246_101014247insG	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714			EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)																	---	---	---	---
EMID2	136227	broad.mit.edu	37	7	101134363	101134363	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101134363delA	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714			EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)																	---	---	---	---
CUX1	1523	broad.mit.edu	37	7	101495109	101495110	+	Intron	INS	-	T	T	rs150270525		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101495109_101495110insT	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530			cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
CUX1	1523	broad.mit.edu	37	7	101740990	101740990	+	Intron	DEL	C	-	-	rs11314718		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101740990delC	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530			cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
CUX1	1523	broad.mit.edu	37	7	101828873	101828873	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101828873delG	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530			cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---
RELN	5649	broad.mit.edu	37	7	103303480	103303481	+	Intron	INS	-	TC	TC	rs148508133	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103303480_103303481insTC	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036			reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	103951822	103951822	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103951822delA								ORC5L (103359 upstream) : LHFPL3 (17282 downstream)																																			---	---	---	---
LHFPL3	375612	broad.mit.edu	37	7	104438198	104438199	+	Intron	INS	-	A	A	rs35550547		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104438198_104438199insA	uc003vce.2	+						LHFPL3_uc003vcf.2_Intron|uc003vcg.2_Intron	NM_199000	NP_945351			lipoma HMGIC fusion partner-like 3							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	104618238	104618238	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104618238delG								LOC723809 (51146 upstream) : LOC100216545 (32751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	105084989	105084990	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105084989_105084990insA								SRPK2 (45191 upstream) : PUS7 (11972 downstream)																																			---	---	---	---
ATXN7L1	222255	broad.mit.edu	37	7	105302458	105302461	+	Intron	DEL	TTTC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105302458_105302461delTTTC	uc003vde.2	-						ATXN7L1_uc003vdf.2_Intron|ATXN7L1_uc003vdh.3_Intron|ATXN7L1_uc011klr.1_Intron	NM_020725	NP_065776			ataxin 7-like 1 isoform 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	106644896	106644897	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106644896_106644897delAC								PIK3CG (97311 upstream) : PRKAR2B (40281 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	107489629	107489630	+	IGR	INS	-	T	T	rs144945409	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107489629_107489630insT								SLC26A3 (45951 upstream) : DLD (41956 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	108928021	108928021	+	IGR	DEL	T	-	-	rs35001349		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108928021delT								C7orf66 (403384 upstream) : EIF3IP1 (671263 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109425617	109425617	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109425617delG								C7orf66 (900980 upstream) : EIF3IP1 (173667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109536734	109536735	+	IGR	INS	-	TGTG	TGTG	rs144252696	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109536734_109536735insTGTG								None (None upstream) : EIF3IP1 (62549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109579609	109579609	+	IGR	DEL	A	-	-	rs78907843	byFrequency;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109579609delA								None (None upstream) : EIF3IP1 (19675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109962068	109962068	+	IGR	DEL	G	-	-	rs35728261		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109962068delG								EIF3IP1 (361798 upstream) : IMMP2L (341042 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	109983326	109983327	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:109983326_109983327insT								EIF3IP1 (383056 upstream) : IMMP2L (319783 downstream)																																			---	---	---	---
FOXP2	93986	broad.mit.edu	37	7	114101530	114101530	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114101530delT	uc003vhb.2	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgz.2_Intron|FOXP2_uc003vha.2_Intron|FOXP2_uc011kmu.1_Intron|FOXP2_uc011kmv.1_Intron|FOXP2_uc003vgt.1_Intron|FOXP2_uc003vgv.1_Intron|FOXP2_uc003vgw.2_Intron|FOXP2_uc003vgx.2_Intron|FOXP2_uc003vhd.2_Intron|FOXP2_uc003vhc.2_Intron	NM_014491	NP_055306			forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	114368923	114368923	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114368923delT								FOXP2 (37831 upstream) : MDFIC (193286 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	115012129	115012129	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115012129delA								MDFIC (352866 upstream) : TFEC (563073 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	116569910	116569910	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116569910delA								CAPZA2 (10598 upstream) : ST7OT1 (22593 downstream)																																			---	---	---	---
WNT2	7472	broad.mit.edu	37	7	116935204	116935208	+	Intron	DEL	AAGAT	-	-	rs72044454		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116935204_116935208delAAGAT	uc003viz.2	-						WNT2_uc003vja.2_Intron	NM_003391	NP_003382			wingless-type MMTV integration site family						atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	117337970	117337970	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117337970delT								CFTR (29254 upstream) : CTTNBP2 (12738 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	117693948	117693948	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117693948delA								CTTNBP2 (180387 upstream) : NAA38 (130138 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118288078	118288079	+	IGR	INS	-	CT	CT	rs141084561	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118288078_118288079insCT								ANKRD7 (405296 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118539840	118539841	+	IGR	INS	-	TA	TA	rs146119152	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118539840_118539841insTA								ANKRD7 (657058 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	118802557	118802557	+	IGR	DEL	T	-	-	rs112130566		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:118802557delT								ANKRD7 (919775 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	119300639	119300639	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119300639delT								None (None upstream) : KCND2 (613083 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	119480438	119480438	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119480438delA								None (None upstream) : KCND2 (433284 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	119719330	119719331	+	IGR	DEL	TC	-	-	rs112026743		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119719330_119719331delTC								None (None upstream) : KCND2 (194391 downstream)																																			---	---	---	---
KCND2	3751	broad.mit.edu	37	7	120380962	120380965	+	Intron	DEL	TTTG	-	-	rs3834346		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120380962_120380965delTTTG	uc003vjj.1	+							NM_012281	NP_036413			potassium voltage-gated channel, Shal-related						regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	121161348	121161349	+	IGR	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121161348_121161349delGA								FAM3C (124926 upstream) : PTPRZ1 (351810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	121234008	121234008	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121234008delT								FAM3C (197586 upstream) : PTPRZ1 (279151 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	121507262	121507263	+	IGR	INS	-	AAAT	AAAT	rs138842591	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121507262_121507263insAAAT								FAM3C (470840 upstream) : PTPRZ1 (5896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	121835691	121835698	+	IGR	DEL	AAAGGAAC	-	-	rs11279754	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121835691_121835698delAAAGGAAC								AASS (51347 upstream) : FEZF1 (105751 downstream)																																			---	---	---	---
CADPS2	93664	broad.mit.edu	37	7	122271748	122271749	+	Intron	INS	-	T	T	rs151177509	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122271748_122271749insT	uc010lkp.2	-						CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424			Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	125046003	125046004	+	IGR	INS	-	T	T	rs149830854	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125046003_125046004insT								POT1 (475966 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	125588300	125588301	+	IGR	INS	-	GAAG	GAAG	rs10215505	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125588300_125588301insGAAG								None (None upstream) : GRM8 (490351 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	127218862	127218863	+	IGR	INS	-	AA	AA	rs146546211	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127218862_127218863insAA								ZNF800 (186095 upstream) : GCC1 (1820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	127248053	127248054	+	IGR	DEL	AG	-	-	rs144565736		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127248053_127248054delAG								FSCN3 (6210 upstream) : PAX4 (2292 downstream)																																			---	---	---	---
SND1	27044	broad.mit.edu	37	7	127318610	127318611	+	Intron	INS	-	A	A	rs143570006	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127318610_127318611insA	uc003vmi.2	+							NM_014390	NP_055205			staphylococcal nuclease domain containing 1						gene silencing by RNA|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	melanosome|nucleus|RNA-induced silencing complex	nuclease activity|nucleic acid binding|protein binding|transcription cofactor activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	127841893	127841894	+	IGR	DEL	TT	-	-	rs151257847		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127841893_127841894delTT								SND1 (109235 upstream) : MIR129-1 (6031 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	127901414	127901414	+	IGR	DEL	T	-	-	rs34741817		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127901414delT								LEP (3732 upstream) : RBM28 (49022 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	128150056	128150056	+	IGR	DEL	A	-	-	rs34342774		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128150056delA								METTL2B (7079 upstream) : FLJ45340 (131239 downstream)																																			---	---	---	---
FAM71F2	346653	broad.mit.edu	37	7	128317558	128317559	+	Intron	INS	-	AAAAA	AAAAA	rs10659136		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128317558_128317559insAAAAA	uc003vnk.3	+						FAM71F2_uc010llm.1_Intron|FAM71F2_uc003vnl.2_Intron|FAM71F2_uc010lln.1_Intron	NM_001012454	NP_001012457			hypothetical protein LOC346653 isoform a												0																		---	---	---	---
TNPO3	23534	broad.mit.edu	37	7	128607793	128607794	+	Intron	INS	-	ACAC	ACAC	rs141723955	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128607793_128607794insACAC	uc003vol.1	-						TNPO3_uc010llx.1_Intron|TNPO3_uc003vom.1_Intron|TNPO3_uc010lly.1_Intron|TNPO3_uc010llz.1_Intron	NM_012470	NP_036602			transportin 3						splicing factor protein import into nucleus	cytoplasm|nucleus	protein binding|receptor activity			ovary(2)|skin(2)|lung(1)	5																		---	---	---	---
AHCYL2	23382	broad.mit.edu	37	7	129055475	129055476	+	Intron	DEL	AA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129055475_129055476delAA	uc011kov.1	+						AHCYL2_uc003vot.2_Intron|AHCYL2_uc003vov.2_Intron|AHCYL2_uc011kow.1_Intron|AHCYL2_uc011kox.1_Intron	NM_015328	NP_056143			S-adenosylhomocysteine hydrolase-like 2 isoform						one-carbon metabolic process		adenosylhomocysteinase activity			ovary(2)	2																		---	---	---	---
FAM40B	57464	broad.mit.edu	37	7	129077368	129077369	+	Intron	DEL	TG	-	-	rs586978	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129077368_129077369delTG	uc011koy.1	+						FAM40B_uc003vow.2_Intron	NM_020704	NP_065755			hypothetical protein LOC57464 isoform a												0																		---	---	---	---
NRF1	4899	broad.mit.edu	37	7	129323128	129323129	+	Intron	INS	-	GTGT	GTGT	rs35691853		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129323128_129323129insGTGT	uc003voz.2	+						NRF1_uc003vpa.2_Intron|NRF1_uc011kpa.1_Intron|NRF1_uc003vpb.2_Intron	NM_005011	NP_005002			nuclear respiratory factor 1						generation of precursor metabolites and energy|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	129650931	129650932	+	IGR	INS	-	T	T	rs56729091		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129650931_129650932insT								UBE2H (58142 upstream) : ZC3HC1 (7195 downstream)																																			---	---	---	---
ZC3HC1	51530	broad.mit.edu	37	7	129672597	129672598	+	Intron	INS	-	GGGAAGGGAAGGA	GGGAAGGGAAGGA	rs142780013	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129672597_129672598insGGGAAGGGAAGGA	uc003vpi.2	-						ZC3HC1_uc003vph.2_Intron|ZC3HC1_uc010lma.2_Intron	NM_016478	NP_057562			zinc finger, C3HC type 1						cell division|mitosis	nucleus	protein kinase binding|zinc ion binding				0	Melanoma(18;0.0435)																	---	---	---	---
TSGA14	95681	broad.mit.edu	37	7	130064241	130064241	+	Intron	DEL	A	-	-	rs35053180		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130064241delA	uc003vpz.2	-						TSGA14_uc010lmf.2_Intron|TSGA14_uc003vqa.2_Intron|TSGA14_uc011kpg.1_Intron|TSGA14_uc003vqb.1_Intron	NM_018718	NP_061188			testis specific, 14						G2/M transition of mitotic cell cycle	centrosome|cytosol					0	Melanoma(18;0.0435)																	---	---	---	---
MKLN1	4289	broad.mit.edu	37	7	130841206	130841207	+	Intron	INS	-	AA	AA	rs58839589		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130841206_130841207insAA	uc011kpl.1	+							NM_001145354	NP_001138826			muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	131309255	131309255	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131309255delG								PODXL (67879 upstream) : PLXNA4 (498837 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	131727160	131727161	+	IGR	DEL	CA	-	-	rs58720975		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131727160_131727161delCA								PODXL (485784 upstream) : PLXNA4 (80931 downstream)																																			---	---	---	---
PLXNA4	91584	broad.mit.edu	37	7	132319222	132319223	+	Intron	DEL	CA	-	-	rs71744552		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132319222_132319223delCA	uc003vrb.2	-							NM_181775	NP_861440			plexin A4 isoform 2							integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133248807	133248807	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133248807delT	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
EXOC4	60412	broad.mit.edu	37	7	133349341	133349342	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133349341_133349342insA	uc003vrk.2	+						EXOC4_uc011kpo.1_Intron|EXOC4_uc003vrl.2_Intron|EXOC4_uc011kpp.1_Intron	NM_021807	NP_068579			SEC8 protein isoform a						vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)																---	---	---	---
LRGUK	136332	broad.mit.edu	37	7	133916168	133916191	+	Intron	DEL	TTTCCTTCCTCCCTTCCTTTCTTC	-	-	rs4283987	byFrequency;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133916168_133916191delTTTCCTTCCTCCCTTCCTTTCTTC	uc003vrm.1	+							NM_144648	NP_653249			leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5																		---	---	---	---
CALD1	800	broad.mit.edu	37	7	134464682	134464682	+	Intron	DEL	A	-	-	rs148112123	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134464682delA	uc003vrz.2	+						CALD1_uc003vry.2_Intron|CALD1_uc003vsa.2_Intron|CALD1_uc003vsb.2_Intron|CALD1_uc010lmm.2_Intron|CALD1_uc011kpt.1_Intron	NM_033138	NP_149129			caldesmon 1 isoform 1						cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0																		---	---	---	---
CALD1	800	broad.mit.edu	37	7	134577801	134577801	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134577801delC	uc003vrz.2	+						CALD1_uc003vry.2_Intron|CALD1_uc003vsa.2_Intron|CALD1_uc003vsb.2_Intron|CALD1_uc010lmm.2_Intron|CALD1_uc011kpt.1_Intron|CALD1_uc003vsc.2_Intron|CALD1_uc003vsd.2_Intron	NM_033138	NP_149129			caldesmon 1 isoform 1						cellular component movement|muscle contraction	cytosol|focal adhesion|myofibril	actin binding|calmodulin binding|myosin binding|tropomyosin binding				0																		---	---	---	---
FAM180A	389558	broad.mit.edu	37	7	135430252	135430253	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135430252_135430253delTG	uc003vtd.2	-						FAM180A_uc010lmt.2_Intron|FAM180A_uc010lmu.2_Intron	NM_205855	NP_995327			hypothetical protein LOC389558 precursor							extracellular region				ovary(2)	2																		---	---	---	---
CHRM2	1129	broad.mit.edu	37	7	136657456	136657456	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136657456delT	uc003vtf.1	+						CHRM2_uc003vtg.1_Intron|CHRM2_uc003vtj.1_Intron|CHRM2_uc003vtk.1_Intron|CHRM2_uc003vtl.1_Intron|CHRM2_uc003vtm.1_Intron|CHRM2_uc003vti.1_Intron|CHRM2_uc003vto.1_Intron|CHRM2_uc003vtn.1_Intron|uc003vtp.1_Intron	NM_001006630	NP_001006631			cholinergic receptor, muscarinic 2						activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)													---	---	---	---
DGKI	9162	broad.mit.edu	37	7	137226634	137226634	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137226634delA	uc003vtt.2	-						DGKI_uc003vtu.2_Intron	NM_004717	NP_004708			diacylglycerol kinase, iota						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	138505211	138505212	+	IGR	INS	-	T	T	rs66501442		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138505211_138505212insT								TMEM213 (14444 upstream) : KIAA1549 (10917 downstream)																																			---	---	---	---
LUC7L2	51631	broad.mit.edu	37	7	139087268	139087268	+	Intron	DEL	T	-	-	rs111406651		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139087268delT	uc003vux.2	+						LUC7L2_uc011kqs.1_Intron|LUC7L2_uc011kqt.1_Intron|LUC7L2_uc003vuy.2_Intron|LUC7L2_uc003vuz.1_Intron|LUC7L2_uc003vva.2_Intron	NM_016019	NP_057103			LUC7-like 2								enzyme binding|metal ion binding				0	Melanoma(164;0.242)																	---	---	---	---
HIPK2	28996	broad.mit.edu	37	7	139372841	139372842	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139372841_139372842delAC	uc003vvf.3	-						HIPK2_uc003vvd.3_Intron	NM_022740	NP_073577			homeodomain interacting protein kinase 2 isoform						apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)																	---	---	---	---
JHDM1D	80853	broad.mit.edu	37	7	139862138	139862140	+	Intron	DEL	AAA	-	-	rs138723426		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139862138_139862140delAAA	uc003vvm.2	-							NM_030647	NP_085150			jumonji C domain containing histone demethylase						midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)																	---	---	---	---
SLC37A3	84255	broad.mit.edu	37	7	140040093	140040094	+	Intron	INS	-	T	T	rs35512830		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140040093_140040094insT	uc003vvo.2	-						SLC37A3_uc003vvn.2_Intron|SLC37A3_uc003vvp.2_Intron|SLC37A3_uc010lnh.2_Intron	NM_207113	NP_996996			solute carrier family 37 (glycerol-3-phosphate						carbohydrate transport|transmembrane transport	integral to membrane				ovary(3)	3	Melanoma(164;0.0142)																	---	---	---	---
Unknown	0	broad.mit.edu	37	7	140193799	140193799	+	IGR	DEL	A	-	-	rs35901185		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140193799delA								MKRN1 (14430 upstream) : DENND2A (24428 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	142887888	142887889	+	IGR	DEL	TG	-	-	rs113395031		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142887888_142887889delTG								TAS2R39 (6361 upstream) : TAS2R40 (31283 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	143644098	143644099	+	IGR	INS	-	TG	TG	rs150839296	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143644098_143644099insTG								OR2F2 (10820 upstream) : OR2F1 (12058 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	144664433	144664442	+	IGR	DEL	ACACACACAT	-	-	rs71718095	by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144664433_144664442delACACACACAT								TPK1 (131287 upstream) : None (None downstream)																																			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	146282843	146282844	+	Intron	INS	-	GAAA	GAAA	rs28702020	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146282843_146282844insGAAA	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	147809949	147809950	+	Intron	INS	-	TT	TT	rs5888306		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147809949_147809950insTT	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
CNTNAP2	26047	broad.mit.edu	37	7	148027993	148027995	+	Intron	DEL	GGA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148027993_148027995delGGA	uc003weu.1	+							NM_014141	NP_054860			cell recognition molecule Caspr2 precursor						behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)												HNSCC(39;0.1)			---	---	---	---
Unknown	0	broad.mit.edu	37	7	148958403	148958404	+	5'Flank	DEL	AG	-	-	rs111893961		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148958403_148958404delAG	uc003wfr.3	+											Homo sapiens cDNA FLJ36716 fis, clone UTERU2010651.																														---	---	---	---
Unknown	0	broad.mit.edu	37	7	149639226	149639229	+	IGR	DEL	TGTG	-	-	rs67472837		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149639226_149639229delTGTG								ATP6V0E2 (61440 upstream) : ACTR3C (305073 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	150125155	150125155	+	IGR	DEL	A	-	-	rs67225623		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150125155delA								LOC728743 (15598 upstream) : GIMAP8 (22807 downstream)																																			---	---	---	---
ABCB8	11194	broad.mit.edu	37	7	150736377	150736377	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150736377delC	uc003wil.3	+						ABCB8_uc010lpw.1_Intron|ABCB8_uc010lpx.2_Intron|ABCB8_uc011kvd.1_Intron|ABCB8_uc003wim.3_Intron|ABCB8_uc003wik.3_Intron	NM_007188	NP_009119			ATP-binding cassette, sub-family B, member 8							ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152085821	152085821	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152085821delG	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
Unknown	0	broad.mit.edu	37	7	152693597	152693597	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152693597delT								ACTR3B (141134 upstream) : DPP6 (890822 downstream)																																			---	---	---	---
DPP6	1804	broad.mit.edu	37	7	153905038	153905038	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153905038delA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154669116	154669123	+	Intron	DEL	CACACACA	-	-	rs138035540		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154669116_154669123delCACACACA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154674760	154674771	+	Intron	DEL	TGCTCACACATT	-	-	rs61723982		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154674760_154674771delTGCTCACACATT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629			dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
CNPY1	285888	broad.mit.edu	37	7	155308704	155308705	+	Intron	DEL	GT	-	-	rs67625567		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155308704_155308705delGT	uc003wmc.1	-							NM_001103176	NP_001096646			canopy 1 homolog												0	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)														---	---	---	---
RBM33	155435	broad.mit.edu	37	7	155522437	155522437	+	Intron	DEL	A	-	-	rs72032756		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155522437delA	uc010lqk.1	+						RBM33_uc011kvv.1_Intron	NM_053043	NP_444271			RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)														---	---	---	---
Unknown	0	broad.mit.edu	37	7	155721614	155721627	+	IGR	DEL	GTCTTAGCTCAGGT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155721614_155721627delGTCTTAGCTCAGGT								SHH (116647 upstream) : C7orf4 (611558 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	157065058	157065058	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157065058delT								UBE3C (2993 upstream) : DNAJB6 (64652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	158962985	158962985	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158962985delT								VIPR2 (25336 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	158999583	158999584	+	IGR	DEL	GG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158999583_158999584delGG								VIPR2 (61934 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	844447	844447	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:844447delA	uc003wpj.1	+						uc003wpk.2_Intron					Homo sapiens cDNA clone IMAGE:4824304.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	967526	967527	+	Intron	INS	-	TG	TG	rs138535174		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:967526_967527insTG	uc003wpj.1	+						uc003wpk.2_Intron					Homo sapiens cDNA clone IMAGE:4824304.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	1204875	1204876	+	IGR	INS	-	CTCTCCTGCCCGTGTGCTGTGTCTGTGCT	CTCTCCTGCCCGTGTGCTGTGTCTGTGCT	rs72370581		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1204875_1204876insCTCTCCTGCCCGTGTGCTGTGTCTGTGCT								ERICH1 (523649 upstream) : DLGAP2 (244693 downstream)																																			---	---	---	---
ARHGEF10	9639	broad.mit.edu	37	8	1805888	1805889	+	Intron	INS	-	T	T	rs142054514	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1805888_1805889insT	uc003wpr.2	+						ARHGEF10_uc003wpq.1_Intron|ARHGEF10_uc003wps.2_Intron|ARHGEF10_uc003wpt.2_5'Flank|ARHGEF10_uc010lrd.1_5'Flank|ARHGEF10_uc003wpu.2_5'Flank	NM_014629	NP_055444			Rho guanine nucleotide exchange factor 10						centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3033029	3033030	+	Intron	INS	-	CCTT	CCTT	rs149583717	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3033029_3033030insCCTT	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	3975473	3975474	+	Intron	INS	-	A	A	rs71502972		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3975473_3975474insA	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
CSMD1	64478	broad.mit.edu	37	8	4165944	4165944	+	Intron	DEL	A	-	-	rs35876460		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4165944delA	uc011kwk.1	-							NM_033225	NP_150094			CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	5194317	5194318	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:5194317_5194318delTG								CSMD1 (341989 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	6989721	6989722	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6989721_6989722insT								DEFA5 (75462 upstream) : LOC349196 (128420 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	7347247	7347247	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7347247delT								DEFB105A (175 upstream) : DEFB107A (6121 downstream)																																			---	---	---	---
MFHAS1	9258	broad.mit.edu	37	8	8652211	8652212	+	Intron	INS	-	T	T	rs140768700	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8652211_8652212insT	uc003wsj.1	-							NM_004225	NP_004216			malignant fibrous histiocytoma amplified												0		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	8794612	8794613	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8794612_8794613insT								MFHAS1 (43481 upstream) : ERI1 (65701 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9042184	9042187	+	IGR	DEL	AAAC	-	-	rs34513922		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9042184_9042187delAAAC								PPP1R3B (33100 upstream) : TNKS (371258 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	9183102	9183103	+	Intron	INS	-	AGAAGAAAGGG	AGAAGAAAGGG	rs138995948	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9183102_9183103insAGAAGAAAGGG	uc003wsq.1	+											Homo sapiens cDNA FLJ31301 fis, clone LIVER1000073.																														---	---	---	---
MSRA	4482	broad.mit.edu	37	8	10002251	10002251	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10002251delT	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc011kwy.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463			methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	10290870	10290871	+	IGR	DEL	TG	-	-	rs66969119		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10290870_10290871delTG								MSRA (4471 upstream) : PRSS55 (92210 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	11190116	11190117	+	IGR	INS	-	T	T	rs147871955	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11190116_11190117insT								AMAC1L2 (421 upstream) : TDH (7029 downstream)																																			---	---	---	---
BLK	640	broad.mit.edu	37	8	11354726	11354726	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11354726delA	uc003wty.2	+						BLK_uc003wtz.2_Intron|BLK_uc003wtx.2_Intron	NM_001715	NP_001706			B lymphoid tyrosine kinase						intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	11494920	11494935	+	IGR	DEL	GTGTGTGTATGTGAGG	-	-	rs55998074		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11494920_11494935delGTGTGTGTATGTGAGG								BLK (72813 upstream) : GATA4 (39533 downstream)																																			---	---	---	---
FAM66D	100132923	broad.mit.edu	37	8	12372125	12372126	+	Intron	INS	-	T	T	rs138225685		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12372125_12372126insT	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	12448061	12448061	+	Intron	DEL	T	-	-	rs147215813		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12448061delT	uc003wvy.3	-											Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	12755536	12755537	+	IGR	INS	-	AA	AA	rs140070138	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12755536_12755537insAA								LOC340357 (86626 upstream) : C8orf79 (47614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	12779030	12779031	+	IGR	DEL	TT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12779030_12779031delTT								LOC340357 (110120 upstream) : C8orf79 (24120 downstream)																																			---	---	---	---
C8orf79	57604	broad.mit.edu	37	8	12823528	12823528	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12823528delA	uc010lsq.2	+						C8orf79_uc011kxw.1_Intron	NM_020844	NP_065895			hypothetical protein LOC57604 isoform 1								methyltransferase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	13509632	13509633	+	IGR	DEL	AA	-	-	rs137880520		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13509632_13509633delAA								C8orf48 (83836 upstream) : SGCZ (437741 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	13525728	13525729	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13525728_13525729insA								C8orf48 (99932 upstream) : SGCZ (421645 downstream)																																			---	---	---	---
SGCZ	137868	broad.mit.edu	37	8	14088669	14088670	+	Intron	INS	-	GT	GT	rs141922150	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:14088669_14088670insGT	uc003wwq.2	-						SGCZ_uc010lss.2_Intron	NM_139167	NP_631906			sarcoglycan zeta						cytoskeleton organization	cytoplasm|cytoskeleton|integral to membrane|sarcolemma				ovary(2)|central_nervous_system(1)	3				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)														---	---	---	---
SLC7A2	6542	broad.mit.edu	37	8	17380245	17380245	+	Intron	DEL	T	-	-	rs113074099		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17380245delT	uc011kyc.1	+							NM_001008539	NP_001008539			solute carrier family 7, member 2 isoform 2						cellular amino acid metabolic process|ion transport	cytoplasm|integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity			ovary(2)|skin(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	17911718	17911718	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17911718delC								PCM1 (24263 upstream) : ASAH1 (2207 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	20504466	20504467	+	IGR	INS	-	CC	CC	rs143928145	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20504466_20504467insCC								LZTS1 (391663 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	20515578	20515579	+	IGR	INS	-	TTTG	TTTG	rs150963903	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20515578_20515579insTTTG								LZTS1 (402775 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	20527650	20527651	+	IGR	INS	-	G	G	rs149726441	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20527650_20527651insG								LZTS1 (414847 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	21258435	21258435	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21258435delG								None (None upstream) : GFRA2 (291095 downstream)																																			---	---	---	---
DOK2	9046	broad.mit.edu	37	8	21739545	21739546	+	Intron	INS	-	T	T	rs111351555		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21739545_21739546insT	uc003wzx.1	-							NM_003974	NP_003965			docking protein 2						blood coagulation|leukocyte migration	cytosol	identical protein binding|insulin receptor binding				0				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	22562173	22562173	+	IGR	DEL	A	-	-	rs112421503		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22562173delA								EGR3 (11358 upstream) : PEBP4 (8592 downstream)																																	OREG0018619	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PEBP4	157310	broad.mit.edu	37	8	22765879	22765882	+	Intron	DEL	AAAC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22765879_22765882delAAAC	uc003xcn.1	-							NM_144962	NP_659399			phosphatidylethanolamine-binding protein 4							lysosome				ovary(1)|large_intestine(1)|breast(1)|skin(1)	4		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	22991656	22991656	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22991656delT								TNFRSF10C (16708 upstream) : TNFRSF10D (1448 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	23120424	23120424	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23120424delT								CHMP7 (912 upstream) : R3HCC1 (25188 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	23610107	23610108	+	IGR	INS	-	ACAC	ACAC	rs143350160	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23610107_23610108insACAC								NKX2-6 (46185 upstream) : STC1 (89326 downstream)																																			---	---	---	---
PPP2R2A	5520	broad.mit.edu	37	8	25518125	25518126	+	Intron	INS	-	G	G	rs138480502	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25518125_25518126insG	uc003xek.2	+							NM_002717	NP_002708			alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)														---	---	---	---
PPP2R2A	5520	broad.mit.edu	37	8	26019753	26019754	+	Intron	INS	-	TTG	TTG	rs12114517	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26019753_26019754insTTG	uc003xek.2	+							NM_002717	NP_002708			alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	27071237	27071240	+	IGR	DEL	AGGC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27071237_27071240delAGGC								MIR548H-4 (164757 upstream) : STMN4 (22576 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	28468004	28468005	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28468004_28468005insA								FZD3 (46045 upstream) : EXTL3 (91148 downstream)																																			---	---	---	---
KIF13B	23303	broad.mit.edu	37	8	29065208	29065208	+	Intron	DEL	A	-	-	rs77917192		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29065208delA	uc003xhh.3	-						KIF13B_uc003xhj.2_Intron|KIF13B_uc010lvf.1_Intron|KIF13B_uc003xhk.2_Intron	NM_015254	NP_056069			kinesin family member 13B						microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	29446404	29446404	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29446404delT								DUSP4 (238219 upstream) : C8orf75 (132374 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	29708502	29708503	+	IGR	DEL	TG	-	-	rs142618587	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29708502_29708503delTG								C8orf75 (102877 upstream) : LOC286135 (70526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	29758867	29758868	+	IGR	INS	-	A	A	rs11385922		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29758867_29758868insA								C8orf75 (153242 upstream) : LOC286135 (20161 downstream)																																			---	---	---	---
NRG1	3084	broad.mit.edu	37	8	31728522	31728523	+	Intron	INS	-	T	T	rs113769852		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31728522_31728523insT	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	31964576	31964577	+	Intron	INS	-	ACA	ACA	rs147059450	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:31964576_31964577insACA	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32193504	32193505	+	Intron	INS	-	CA	CA	rs145896353	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32193504_32193505insCA	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
NRG1	3084	broad.mit.edu	37	8	32251644	32251644	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32251644delA	uc003xip.2	+							NM_013962	NP_039256			neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	33016644	33016644	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33016644delC								NRG1 (394086 upstream) : FUT10 (211702 downstream)																																			---	---	---	---
MAK16	84549	broad.mit.edu	37	8	33354873	33354873	+	Intron	DEL	C	-	-	rs68152666		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33354873delC	uc003xjj.2	+						C8orf41_uc010lvu.1_Intron	NM_032509	NP_115898			MAK16 homolog							nucleolus				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	34107920	34107926	+	IGR	DEL	AGACTGT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34107920_34107926delAGACTGT								DUSP26 (650481 upstream) : UNC5D (985049 downstream)																																			---	---	---	---
UNC5D	137970	broad.mit.edu	37	8	35153942	35153943	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35153942_35153943insT	uc003xjr.1	+							NM_080872	NP_543148			unc-5 homolog D precursor						apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)														---	---	---	---
Unknown	0	broad.mit.edu	37	8	36497509	36497509	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36497509delA								UNC5D (845329 upstream) : KCNU1 (144333 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	37561619	37561619	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37561619delA								ZNF703 (5223 upstream) : ERLIN2 (32478 downstream)																																			---	---	---	---
BRF2	55290	broad.mit.edu	37	8	37710305	37710305	+	5'Flank	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37710305delA	uc003xkk.2	-							NM_018310	NP_060780			RNA polymerase III transcription initiation						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter|transcription initiation, DNA-dependent	nucleoplasm	protein binding|zinc ion binding				0		Lung NSC(58;0.118)|all_lung(54;0.195)	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;1.81e-10)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	40370214	40370215	+	IGR	INS	-	GG	GG	rs142365166	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40370214_40370215insGG								C8orf4 (357393 upstream) : ZMAT4 (17901 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	41081912	41081913	+	IGR	INS	-	AC	AC	rs147266469	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41081912_41081913insAC								ZMAT4 (326569 upstream) : SFRP1 (37566 downstream)																																			---	---	---	---
GOLGA7	51125	broad.mit.edu	37	8	41363690	41363691	+	Intron	INS	-	T	T	rs149330272	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41363690_41363691insT	uc003xnu.2	+						GOLGA7_uc003xnv.2_Intron|GOLGA7_uc003xnw.2_Intron	NM_016099	NP_057183			golgi autoantigen, golgin subfamily a, 7							Golgi membrane				breast(1)	1	Ovarian(28;0.014)|Colorectal(14;0.0234)|Lung SC(25;0.211)	all_lung(54;0.000771)|Lung NSC(58;0.0031)|Hepatocellular(245;0.014)|Esophageal squamous(32;0.0559)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00596)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	43500015	43500015	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43500015delT								POTEA (281687 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	47721831	47721831	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:47721831delA								None (None upstream) : BEYLA (30677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	48985679	48985679	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48985679delA								UBE2V2 (11227 upstream) : EFCAB1 (637672 downstream)																																			---	---	---	---
SNTG1	54212	broad.mit.edu	37	8	51507581	51507584	+	Intron	DEL	TGTG	-	-	rs138443139		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51507581_51507584delTGTG	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840			syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)																---	---	---	---
PXDNL	137902	broad.mit.edu	37	8	52564939	52564940	+	Intron	DEL	TC	-	-	rs140082315		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52564939_52564940delTC	uc003xqu.3	-							NM_144651	NP_653252			peroxidasin homolog-like precursor						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---
PCMTD1	115294	broad.mit.edu	37	8	52778631	52778631	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52778631delA	uc003xqx.3	-						PCMTD1_uc003xqw.3_Intron|PCMTD1_uc011ldn.1_Intron|PCMTD1_uc010lya.2_Intron	NM_052937	NP_443169			protein-L-isoaspartate (D-aspartate)							cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)																---	---	---	---
Unknown	0	broad.mit.edu	37	8	54028628	54028629	+	IGR	DEL	GT	-	-	rs111630883		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54028628_54028629delGT								NPBWR1 (175175 upstream) : OPRK1 (109647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	54204040	54204041	+	IGR	INS	-	ACAC	ACAC	rs145236546	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54204040_54204041insACAC								OPRK1 (39846 upstream) : ATP6V1H (424075 downstream)																																			---	---	---	---
RGS20	8601	broad.mit.edu	37	8	54788011	54788012	+	Intron	DEL	CC	-	-	rs72289085		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54788011_54788012delCC	uc003xrp.2	+						RGS20_uc003xrq.2_Intron|RGS20_uc010lye.2_Intron|RGS20_uc010lyf.2_Intron	NM_170587	NP_733466			regulator of G-protein signaling 20 isoform a						negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|nucleus|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	55273994	55274005	+	IGR	DEL	CCTTCCTTCTTT	-	-	rs66756943	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55273994_55274005delCCTTCCTTCTTT								MRPL15 (212920 upstream) : SOX17 (96490 downstream)																																			---	---	---	---
RP1	6101	broad.mit.edu	37	8	55544405	55544406	+	Intron	INS	-	T	T	rs36032942		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55544405_55544406insT	uc011ldy.1	+											SubName: Full=cDNA, FLJ79410, moderately similar to Oxygen-regulated protein 1;						axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)															---	---	---	---
RP1	6101	broad.mit.edu	37	8	55677507	55677507	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55677507delT	uc011ldy.1	+											SubName: Full=cDNA, FLJ79410, moderately similar to Oxygen-regulated protein 1;						axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	55768528	55768533	+	IGR	DEL	CACACC	-	-	rs145846116	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55768528_55768533delCACACC								RP1 (85997 upstream) : XKR4 (246484 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	57361199	57361200	+	Intron	INS	-	TG	TG	rs144941482	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57361199_57361200insTG	uc003xtb.1	+						PENK_uc003xsz.2_5'Flank|PENK_uc003xta.3_5'Flank|PENK_uc010lym.2_5'Flank					Homo sapiens cDNA FLJ34244 fis, clone FCBBF3028794.																												OREG0018778	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	8	57756565	57756566	+	IGR	INS	-	CCTT	CCTT	rs149413224	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57756565_57756566insCCTT								PENK (397283 upstream) : IMPAD1 (113925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	59154083	59154083	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59154083delT								FAM110B (91806 upstream) : UBXN2B (169740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	60196756	60196756	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60196756delT								TOX (164989 upstream) : CA8 (904667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	60502786	60502787	+	IGR	INS	-	AC	AC	rs138957330	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60502786_60502787insAC								TOX (471019 upstream) : CA8 (598636 downstream)																																			---	---	---	---
CHD7	55636	broad.mit.edu	37	8	61630302	61630302	+	Intron	DEL	A	-	-	rs11302708		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61630302delA	uc003xue.2	+							NM_017780	NP_060250			chromodomain helicase DNA binding protein 7						central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	61962725	61962726	+	IGR	INS	-	T	T	rs146509637	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61962725_61962726insT								CHD7 (183262 upstream) : CLVS1 (237799 downstream)																																			---	---	---	---
ASPH	444	broad.mit.edu	37	8	62421564	62421566	+	Intron	DEL	CTT	-	-	rs149272892		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62421564_62421566delCTT	uc003xuj.2	-						ASPH_uc011leg.1_Intron	NM_004318	NP_004309			aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)													---	---	---	---
Unknown	0	broad.mit.edu	37	8	62960468	62960468	+	IGR	DEL	T	-	-	rs34422566		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62960468delT								ASPH (333269 upstream) : NKAIN3 (201033 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	64445826	64445845	+	IGR	DEL	CTTCCTTCCTTCCTTCCTTT	-	-	rs147214559	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64445826_64445845delCTTCCTTCCTTCCTTCCTTT								YTHDF3 (320481 upstream) : MIR124-2 (845861 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	64508328	64508329	+	IGR	INS	-	C	C	rs147231272	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64508328_64508329insC								YTHDF3 (382983 upstream) : MIR124-2 (783377 downstream)																																			---	---	---	---
CYP7B1	9420	broad.mit.edu	37	8	65528077	65528077	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:65528077delA	uc003xvj.2	-							NM_004820	NP_004811			cytochrome P450, family 7, subfamily B,						bile acid biosynthetic process|cell death|cholesterol metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)																---	---	---	---
LRRC67	286187	broad.mit.edu	37	8	67908753	67908753	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67908753delT	uc003xxc.2	-							NM_001013626	NP_001013648			leucine rich repeat containing 67												0																		---	---	---	---
COPS5	10987	broad.mit.edu	37	8	67968871	67968871	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67968871delG	uc003xxe.2	-						COPS5_uc003xxd.2_Intron|COPS5_uc003xxf.2_Intron|COPS5_uc010lyu.1_Intron|COPS5_uc010lyv.1_Intron	NM_006837	NP_006828			COP9 signalosome subunit 5						cullin deneddylation|transcription from RNA polymerase II promoter	eukaryotic translation initiation factor 3 complex|signalosome	metal ion binding|metallopeptidase activity|protein binding|transcription coactivator activity|translation initiation factor activity			ovary(1)|skin(1)	2	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)															---	---	---	---
CPA6	57094	broad.mit.edu	37	8	68617286	68617287	+	Intron	INS	-	G	G	rs151148856	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68617286_68617287insG	uc003xxq.3	-						CPA6_uc003xxr.3_Intron|CPA6_uc003xxs.2_Intron	NM_020361	NP_065094			carboxypeptidase A6 isoform 1 precursor						proteolysis	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)															---	---	---	---
SLCO5A1	81796	broad.mit.edu	37	8	70629018	70629018	+	Intron	DEL	T	-	-	rs111366566		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70629018delT	uc003xyl.2	-						SLCO5A1_uc010lzb.2_Intron|SLCO5A1_uc011lfa.1_Intron|SLCO5A1_uc003xyk.2_Intron|SLCO5A1_uc010lzc.2_Intron	NM_030958	NP_112220			solute carrier organic anion transporter family,							integral to membrane|plasma membrane	transporter activity			ovary(3)|upper_aerodigestive_tract(1)	4	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	70869953	70869953	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70869953delA								SLCO5A1 (122654 upstream) : PRDM14 (94072 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	71656546	71656546	+	IGR	DEL	A	-	-	rs5892236		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71656546delA								XKR9 (8370 upstream) : EYA1 (453124 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	72317488	72317490	+	Intron	DEL	AAC	-	-	rs72385866		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72317488_72317490delAAC	uc003xyw.2	-											Homo sapiens cDNA clone IMAGE:5264099.																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	72621526	72621526	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72621526delT								EYA1 (347059 upstream) : MSC (132251 downstream)																																			---	---	---	---
KCNB2	9312	broad.mit.edu	37	8	73613779	73613779	+	Intron	DEL	T	-	-	rs5892361		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73613779delT	uc003xzb.2	+							NM_004770	NP_004761			potassium voltage-gated channel, Shab-related						regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	74139473	74139475	+	IGR	DEL	TCT	-	-	rs147397010		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74139473_74139475delTCT								C8orf84 (133966 upstream) : RPL7 (63400 downstream)																																			---	---	---	---
STAU2	27067	broad.mit.edu	37	8	74376836	74376837	+	Intron	INS	-	ACAT	ACAT	rs67799072		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74376836_74376837insACAT	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron	NM_014393	NP_055208			staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)															---	---	---	---
GDAP1	54332	broad.mit.edu	37	8	75273640	75273641	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75273640_75273641insT	uc003yah.2	+						GDAP1_uc011lfj.1_Intron|GDAP1_uc003yai.2_Intron	NM_018972	NP_061845			ganglioside-induced differentiation-associated							cytoplasm					0	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	75810831	75810831	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75810831delC								PI15 (43569 upstream) : CRISPLD1 (86012 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	76569290	76569290	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76569290delT								HNF4G (90231 upstream) : LOC100192378 (953825 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	78238260	78238260	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78238260delC								PEX2 (325736 upstream) : None (None downstream)																																			---	---	---	---
STMN2	11075	broad.mit.edu	37	8	80548631	80548631	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80548631delC	uc003ybj.2	+						STMN2_uc010lzp.2_Intron|STMN2_uc011lfn.1_Intron	NM_007029	NP_008960			superiorcervical ganglia, neural specific 10						intracellular signal transduction|negative regulation of microtubule depolymerization|negative regulation of microtubule polymerization|negative regulation of neuron projection development|neuron differentiation|positive regulation of microtubule depolymerization|positive regulation of neuron projection development	axon|growth cone|membrane|membrane fraction|perinuclear region of cytoplasm|soluble fraction	protein binding			ovary(1)|central_nervous_system(1)	2	all_lung(9;8.34e-05)		Epithelial(68;0.0229)|all cancers(69;0.0874)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	80664572	80664572	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80664572delA								STMN2 (86178 upstream) : HEY1 (11674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	83670925	83670926	+	IGR	INS	-	A	A	rs149186136	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83670925_83670926insA								SNX16 (916404 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	83815837	83815838	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83815837_83815838delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84371982	84371985	+	IGR	DEL	ACAT	-	-	rs57753791		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84371982_84371985delACAT								None (None upstream) : RALYL (723468 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	84372019	84372020	+	IGR	DEL	CC	-	-	rs60051271		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:84372019_84372020delCC								None (None upstream) : RALYL (723433 downstream)																																			---	---	---	---
CA13	377677	broad.mit.edu	37	8	86167493	86167493	+	Intron	DEL	T	-	-	rs111718621		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86167493delT	uc003ydg.2	+						CA13_uc003ydf.1_Intron	NM_198584	NP_940986			carbonic anhydrase XIII						one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0																		---	---	---	---
FAM82B	51115	broad.mit.edu	37	8	87486036	87486039	+	3'UTR	DEL	CTTA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87486036_87486039delCTTA	uc003ydu.2	-	10					FAM82B_uc011lfz.1_3'UTR|FAM82B_uc011lga.1_3'UTR	NM_016033	NP_057117			regulator of microtubule dynamics 1							microtubule|spindle pole	binding			ovary(1)	1																		---	---	---	---
CPNE3	8895	broad.mit.edu	37	8	87573352	87573352	+	3'UTR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87573352delC	uc003ydv.2	+	17					CPNE3_uc003ydw.1_3'UTR	NM_003909	NP_003900			copine III						lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	87869963	87869963	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87869963delT								CNGB3 (114062 upstream) : CNBD1 (8713 downstream)																																			---	---	---	---
MMP16	4325	broad.mit.edu	37	8	89268892	89268893	+	Intron	INS	-	TC	TC	rs149979317	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89268892_89268893insTC	uc003yeb.3	-						MMP16_uc003yec.2_Intron	NM_005941	NP_005932			matrix metalloproteinase 16 isoform 1						collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	89440932	89440935	+	IGR	DEL	CTAT	-	-	rs71556461		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89440932_89440935delCTAT								MMP16 (101215 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	89928900	89928900	+	IGR	DEL	A	-	-	rs71558402		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89928900delA								MMP16 (589183 upstream) : RIPK2 (841075 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	90230368	90230368	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:90230368delG								MMP16 (890651 upstream) : RIPK2 (539607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	91186464	91186476	+	IGR	DEL	GGAAAGAAAGAAG	-	-	rs139709899	by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91186464_91186476delGGAAAGAAAGAAG								CALB1 (78777 upstream) : TMEM64 (447747 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	91420549	91420549	+	IGR	DEL	T	-	-	rs35531892		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91420549delT								CALB1 (312862 upstream) : TMEM64 (213674 downstream)																																			---	---	---	---
NECAB1	64168	broad.mit.edu	37	8	91857016	91857018	+	Intron	DEL	TTC	-	-	rs35328083		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91857016_91857018delTTC	uc011lgg.1	+							NM_022351	NP_071746			N-terminal EF-hand calcium binding protein 1						antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity			central_nervous_system(1)	1			BRCA - Breast invasive adenocarcinoma(11;0.0499)															---	---	---	---
NECAB1	64168	broad.mit.edu	37	8	91866164	91866165	+	Intron	INS	-	G	G	rs148765774	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91866164_91866165insG	uc011lgg.1	+							NM_022351	NP_071746			N-terminal EF-hand calcium binding protein 1						antibiotic biosynthetic process	cytoplasm	calcium ion binding|oxidoreductase activity			central_nervous_system(1)	1			BRCA - Breast invasive adenocarcinoma(11;0.0499)															---	---	---	---
LRRC69	100130742	broad.mit.edu	37	8	92146727	92146728	+	Intron	INS	-	C	C	rs148249074	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92146727_92146728insC	uc010mal.1	+						LRRC69_uc003yev.1_Intron|LRRC69_uc003yew.1_Intron	NM_001129890	NP_001123362			leucine rich repeat containing 69												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	8	92521570	92521571	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92521570_92521571insT								SLC26A7 (111190 upstream) : RUNX1T1 (449581 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	92683515	92683516	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92683515_92683516delCA								SLC26A7 (273135 upstream) : RUNX1T1 (287636 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	94201477	94201480	+	IGR	DEL	GGAG	-	-	rs2449608		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94201477_94201480delGGAG								C8orf83 (171576 upstream) : FAM92A1 (511293 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	95639568	95639568	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95639568delT								KIAA1429 (73880 upstream) : ESRP1 (13796 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	96127747	96127748	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96127747_96127748insT								C8orf38 (39351 upstream) : PLEKHF2 (18290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	96487695	96487695	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96487695delT								C8orf37 (206258 upstream) : GDF6 (666865 downstream)																																			---	---	---	---
PTDSS1	9791	broad.mit.edu	37	8	97314804	97314805	+	Intron	INS	-	TTG	TTG	rs142080567	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97314804_97314805insTTG	uc003yht.1	+						PTDSS1_uc003yhu.1_Intron	NM_014754	NP_055569			phosphatidylserine synthase 1						phosphatidylserine biosynthetic process	integral to membrane	transferase activity			ovary(1)	1	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)													---	---	---	---
PGCP	10404	broad.mit.edu	37	8	97976054	97976054	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97976054delT	uc003yhw.2	+						PGCP_uc010mbe.2_Intron	NM_016134	NP_057218			plasma glutamate carboxypeptidase precursor						peptide metabolic process|proteolysis	cytoplasm|extracellular space	metal ion binding|metallocarboxypeptidase activity			upper_aerodigestive_tract(1)	1	Breast(36;1.86e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	8	98621888	98621888	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98621888delT								TSPYL5 (331712 upstream) : MTDH (34519 downstream)																																			---	---	---	---
RGS22	26166	broad.mit.edu	37	8	101115868	101115869	+	Intron	INS	-	A	A	rs138837508	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101115868_101115869insA	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron|RGS22_uc010mbo.1_Intron	NM_015668	NP_056483			regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)															---	---	---	---
SPAG1	6674	broad.mit.edu	37	8	101206174	101206175	+	Intron	DEL	TT	-	-	rs2453664	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101206174_101206175delTT	uc003yjh.1	+						SPAG1_uc003yjg.1_Intron|SPAG1_uc003yji.1_Intron	NM_172218	NP_757367			sperm associated antigen 1						single fertilization	cytoplasm	GTP binding|hydrolase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)														---	---	---	---
ODF1	4956	broad.mit.edu	37	8	103572984	103572992	+	In_Frame_Del	DEL	TGCAGCCCC	-	-	rs72175040	byFrequency;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103572984_103572992delTGCAGCCCC	uc003ykt.2	+	2	733_741	c.625_633delTGCAGCCCC	c.(625-633)TGCAGCCCCdel	p.CSP215del		NM_024410	NP_077721	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	215_217	C-X-P repeat region.				cell differentiation|multicellular organismal development|spermatogenesis	outer dense fiber	structural molecule activity			ovary(2)	2	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	103888499	103888499	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103888499delA								AZIN1 (12102 upstream) : ATP6V1C1 (144749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	105634638	105634639	+	IGR	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105634638_105634639insC								LRP12 (33418 upstream) : ZFPM2 (696508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	109140114	109140133	+	IGR	DEL	AAGGAAGGAAGGAAGGAAGG	-	-	rs71947791	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109140114_109140133delAAGGAAGGAAGGAAGGAAGG								RSPO2 (44201 upstream) : EIF3E (73840 downstream)																																			---	---	---	---
EIF3E	3646	broad.mit.edu	37	8	109218822	109218823	+	Intron	DEL	CA	-	-	rs72312119		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109218822_109218823delCA	uc003ymu.2	-						EIF3E_uc003ymt.2_Intron|EIF3E_uc003ymv.2_Intron|EIF3E_uc010mci.1_Intron	NM_001568	NP_001559			eukaryotic translation initiation factor 3,						negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)															---	---	---	---
TMEM74	157753	broad.mit.edu	37	8	109768879	109768880	+	Intron	INS	-	AGAAAGAAAGAA	AGAAAGAAAGAA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109768879_109768880insAGAAAGAAAGAA	uc003ymx.2	-											Homo sapiens cDNA FLJ30668 fis, clone FCBBF1000675.						autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	110159250	110159250	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110159250delT								TRHR (27440 upstream) : NUDCD1 (93899 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	110948437	110948440	+	IGR	DEL	AGGA	-	-	rs147604132	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110948437_110948440delAGGA								SYBU (244417 upstream) : KCNV1 (30795 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	111675504	111675506	+	IGR	DEL	TGT	-	-	rs71827989		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111675504_111675506delTGT								KCNV1 (687428 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	111755563	111755563	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111755563delG								KCNV1 (767487 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	112002555	112002556	+	IGR	DEL	TC	-	-	rs77578990		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112002555_112002556delTC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	112042483	112042484	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:112042483_112042484insT								None (None upstream) : None (None downstream)																																			---	---	---	---
CSMD3	114788	broad.mit.edu	37	8	113406116	113406117	+	Intron	INS	-	T	T	rs141353238		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113406116_113406117insT	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756			CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63															HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	115548928	115548928	+	IGR	DEL	T	-	-	rs77649559		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115548928delT								None (None upstream) : TRPS1 (871797 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117134529	117134530	+	IGR	INS	-	GT	GT	rs143231706	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117134529_117134530insGT								TRPS1 (453301 upstream) : EIF3H (522526 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117150428	117150429	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117150428_117150429insT								TRPS1 (469200 upstream) : EIF3H (506627 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	117280636	117280636	+	IGR	DEL	T	-	-	rs111943342		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117280636delT								TRPS1 (599408 upstream) : EIF3H (376420 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	118527672	118527672	+	IGR	DEL	A	-	-	rs35939862		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118527672delA								SLC30A8 (338720 upstream) : MED30 (5293 downstream)																																			---	---	---	---
SAMD12	401474	broad.mit.edu	37	8	119550400	119550415	+	Intron	DEL	TCTGTCTGTCTGTCTG	-	-	rs112923761		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119550400_119550415delTCTGTCTGTCTGTCTG	uc003yom.2	-						SAMD12_uc010mda.1_Intron|SAMD12_uc010mdb.1_Intron	NM_207506	NP_997389			sterile alpha motif domain containing 12 isoform											ovary(1)	1	all_cancers(13;3.91e-25)|Lung NSC(37;1.13e-07)|Ovarian(258;0.0249)		STAD - Stomach adenocarcinoma(47;0.00391)															---	---	---	---
MTBP	27085	broad.mit.edu	37	8	121530792	121530792	+	Intron	DEL	T	-	-	rs34427476		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121530792delT	uc003ypc.1	+							NM_022045	NP_071328			Mdm2, transformed 3T3 cell double minute 2, p53						cell cycle arrest					skin(2)|ovary(1)	3	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	122470043	122470044	+	IGR	INS	-	TATT	TATT	rs147377027	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122470043_122470044insTATT								SNTB1 (645734 upstream) : HAS2 (155227 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122703879	122703879	+	IGR	DEL	A	-	-	rs76874270		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122703879delA								HAS2AS (46946 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	122760263	122760263	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122760263delA								HAS2AS (103330 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123344717	123344718	+	IGR	INS	-	T	T	rs150072465	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123344717_123344718insT								HAS2AS (687784 upstream) : ZHX2 (449183 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	123570204	123570204	+	IGR	DEL	T	-	-	rs35015507		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123570204delT								HAS2AS (913271 upstream) : ZHX2 (223697 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	124063387	124063388	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124063387_124063388insT								DERL1 (8739 upstream) : WDR67 (21532 downstream)																																			---	---	---	---
SQLE	6713	broad.mit.edu	37	8	126013918	126013918	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126013918delA	uc011liq.1	+							NM_003129	NP_003120			squalene epoxidase						cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome	flavin adenine dinucleotide binding|squalene monooxygenase activity			ovary(1)|breast(1)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		Butenafine(DB01091)|Naftifine(DB00735)|Terbinafine(DB00857)													---	---	---	---
NSMCE2	286053	broad.mit.edu	37	8	126242946	126242946	+	Intron	DEL	T	-	-	rs35658963		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126242946delT	uc003yrw.2	+							NM_173685	NP_775956			non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	126957754	126957755	+	RNA	INS	-	A	A	rs139606427	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126957754_126957755insA	uc003yry.2	-	2		c.948_949insT								Homo sapiens mRNA; cDNA DKFZp686L20185 (from clone DKFZp686L20185).																														---	---	---	---
Unknown	0	broad.mit.edu	37	8	127124253	127124253	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127124253delG								TRIB1 (673611 upstream) : FAM84B (440434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129297791	129297793	+	IGR	DEL	AGG	-	-	rs74872571	byFrequency;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129297791_129297793delAGG								MIR1208 (135357 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129415737	129415737	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129415737delC								MIR1208 (253303 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	129773472	129773472	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129773472delA								MIR1208 (611038 upstream) : GSDMC (986971 downstream)																																			---	---	---	---
FAM49B	51571	broad.mit.edu	37	8	131025015	131025015	+	Intron	DEL	A	-	-	rs80049825		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131025015delA	uc003ysw.2	-						FAM49B_uc003ysx.2_Intron|FAM49B_uc003ysy.1_Intron	NM_016623	NP_057707			hypothetical protein LOC51571												0	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)															---	---	---	---
ADCY8	114	broad.mit.edu	37	8	131821143	131821145	+	Intron	DEL	CTC	-	-	rs140891148		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131821143_131821145delCTC	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106			adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
ADCY8	114	broad.mit.edu	37	8	131882167	131882168	+	Intron	INS	-	TCC	TCC	rs142256411	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131882167_131882168insTCC	uc003ytd.3	-						ADCY8_uc010mds.2_Intron	NM_001115	NP_001106			adenylate cyclase 8						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)												HNSCC(32;0.087)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	132213735	132213735	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132213735delA								ADCY8 (160900 upstream) : EFR3A (702624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134727695	134727695	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134727695delT								ST3GAL1 (143512 upstream) : ZFAT (762338 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	134772833	134772834	+	IGR	DEL	GT	-	-	rs35062284		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134772833_134772834delGT								ST3GAL1 (188650 upstream) : ZFAT (717199 downstream)																																			---	---	---	---
LOC286094	286094	broad.mit.edu	37	8	136286763	136286763	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136286763delG	uc011ljm.1	+							NR_026706				Homo sapiens cDNA clone IMAGE:4837396.												0																		---	---	---	---
KHDRBS3	10656	broad.mit.edu	37	8	136508443	136508444	+	Intron	INS	-	C	C	rs74306397		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136508443_136508444insC	uc003yuv.2	+						KHDRBS3_uc003yuw.2_Intron	NM_006558	NP_006549			KH domain containing, RNA binding, signal						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)															---	---	---	---
KHDRBS3	10656	broad.mit.edu	37	8	136528813	136528814	+	Intron	INS	-	TGTGTGTG	TGTGTGTG	rs150491872	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136528813_136528814insTGTGTGTG	uc003yuv.2	+						KHDRBS3_uc003yuw.2_Intron	NM_006558	NP_006549			KH domain containing, RNA binding, signal						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	SH3 domain binding			ovary(2)	2	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	138274179	138274180	+	IGR	INS	-	A	A	rs138618569	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138274179_138274180insA								None (None upstream) : FAM135B (868088 downstream)																																			---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139238394	139238395	+	Intron	DEL	GT	-	-	rs72185111		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139238394_139238395delGT	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996			hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
FAM135B	51059	broad.mit.edu	37	8	139414446	139414447	+	Intron	INS	-	TTTT	TTTT	rs140543243	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139414446_139414447insTTTT	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996			hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---
Unknown	0	broad.mit.edu	37	8	141539699	141539699	+	IGR	DEL	C	-	-	rs2944757	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141539699delC								CHRAC1 (12447 upstream) : EIF2C2 (1566 downstream)																																			---	---	---	---
PTK2	5747	broad.mit.edu	37	8	141999108	141999109	+	Intron	INS	-	A	A	rs139670957	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141999108_141999109insA	uc003yvu.2	-						PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560			PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	142359627	142359628	+	IGR	INS	-	AC	AC	rs148211915	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142359627_142359628insAC								LOC731779 (4908 upstream) : GPR20 (6961 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	142953158	142953158	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142953158delG								MIR1302-7 (85484 upstream) : NCRNA00051 (326559 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	143094097	143094099	+	IGR	DEL	CCT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143094097_143094099delCCT								MIR1302-7 (226423 upstream) : NCRNA00051 (185618 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144031701	144031702	+	IGR	INS	-	TGG	TGG	rs139557961	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144031701_144031702insTGG								CYP11B2 (32442 upstream) : LOC100133669 (31746 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144250915	144250915	+	IGR	DEL	A	-	-	rs111901776		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144250915delA								LY6H (8862 upstream) : GPIHBP1 (44153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	8	144263869	144263870	+	IGR	INS	-	TG	TG	rs150238148	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144263869_144263870insTG								LY6H (21816 upstream) : GPIHBP1 (31198 downstream)																																			---	---	---	---
RHPN1	114822	broad.mit.edu	37	8	144459233	144459234	+	Intron	INS	-	GT	GT	rs142163832	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144459233_144459234insGT	uc003yyb.2	+							NM_052924	NP_443156			rhophilin 1						signal transduction	intracellular				large_intestine(1)	1	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)															---	---	---	---
Unknown	0	broad.mit.edu	37	8	144483736	144483762	+	IGR	DEL	GGGAGGGCAGAGGGGAGGGGAGGGGAG	-	-	rs144982318	by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144483736_144483762delGGGAGGGCAGAGGGGAGGGGAGGGGAG								RHPN1 (17347 upstream) : MAFA (27753 downstream)																																	OREG0019046	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	8	144857505	144857506	+	IGR	INS	-	AC	AC			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144857505_144857506insAC								FAM83H (41591 upstream) : SCRIB (15584 downstream)																																			---	---	---	---
DOCK8	81704	broad.mit.edu	37	9	400095	400097	+	Intron	DEL	CAC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:400095_400097delCAC	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc010mgw.1_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272			dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)														---	---	---	---
KANK1	23189	broad.mit.edu	37	9	497859	497860	+	Intron	INS	-	A	A	rs58009416		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:497859_497860insA	uc003zgl.1	+							NM_015158	NP_055973			KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)														---	---	---	---
KANK1	23189	broad.mit.edu	37	9	666014	666015	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:666014_666015insA	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron	NM_015158	NP_055973			KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)														---	---	---	---
KANK1	23189	broad.mit.edu	37	9	702232	702233	+	Intron	DEL	AG	-	-	rs148073567		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:702232_702233delAG	uc003zgl.1	+						KANK1_uc003zgm.2_Intron|KANK1_uc003zgn.1_Intron|KANK1_uc003zgo.1_Intron|KANK1_uc003zgp.1_Intron|KANK1_uc003zgq.2_Intron|KANK1_uc003zgr.1_Intron	NM_015158	NP_055973			KN motif and ankyrin repeat domains 1 isoform a						negative regulation of actin filament polymerization	cytoplasm				ovary(2)|central_nervous_system(1)|pancreas(1)	4		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	1490803	1490804	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:1490803_1490804delTC								DMRT2 (433250 upstream) : SMARCA2 (524538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	2232827	2232827	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2232827delA								SMARCA2 (39206 upstream) : FLJ35024 (189875 downstream)																																			---	---	---	---
SLC1A1	6505	broad.mit.edu	37	9	4540364	4540364	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4540364delG	uc003zij.1	+							NM_004170	NP_004161			solute carrier family 1, member 1						D-aspartate import|L-glutamate import|synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)													---	---	---	---
C9orf46	55848	broad.mit.edu	37	9	5408309	5408309	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5408309delG	uc003zjc.2	-						C9orf46_uc003zjd.2_Intron	NM_018465	NP_060935			hypothetical protein LOC55848							integral to membrane				ovary(1)	1	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.00106)|Lung(218;0.125)														---	---	---	---
C9orf46	55848	broad.mit.edu	37	9	5420668	5420668	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5420668delC	uc003zjc.2	-						C9orf46_uc003zjd.2_Intron	NM_018465	NP_060935			hypothetical protein LOC55848							integral to membrane				ovary(1)	1	all_hematologic(13;0.158)	Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.00106)|Lung(218;0.125)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	5880482	5880482	+	IGR	DEL	C	-	-	rs75589722		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5880482delC								ERMP1 (47401 upstream) : MLANA (10427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	7748972	7748973	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7748972_7748973insA								KDM4C (573325 upstream) : C9orf123 (47520 downstream)																																			---	---	---	---
C9orf123	90871	broad.mit.edu	37	9	7798766	7798766	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7798766delA	uc003zki.2	-						C9orf123_uc003zkj.2_Intron					Homo sapiens cDNA FLJ46908 fis, clone FEBRA2004867.							integral to membrane					0		all_cancers(3;0.0539)|Lung NSC(3;3.36e-05)|all_lung(3;0.000156)|all_epithelial(3;0.0356)		GBM - Glioblastoma multiforme(50;0.0561)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	7803716	7803719	+	IGR	DEL	GTGT	-	-	rs149425353		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7803716_7803719delGTGT								C9orf123 (3917 upstream) : PTPRD (510528 downstream)																																			---	---	---	---
PTPRD	5789	broad.mit.edu	37	9	8632122	8632123	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8632122_8632123delTG	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron|PTPRD_uc003zkt.1_Intron	NM_002839	NP_002830			protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)											TSP Lung(15;0.13)			---	---	---	---
Unknown	0	broad.mit.edu	37	9	11294066	11294067	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11294066_11294067delTG								PTPRD (681343 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	11591736	11591737	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11591736_11591737delAC								PTPRD (979013 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	11787993	11787994	+	IGR	INS	-	TG	TG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11787993_11787994insTG								None (None upstream) : TYRP1 (905392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13445721	13445721	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13445721delT								MPDZ (166158 upstream) : NFIB (636127 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13868300	13868301	+	IGR	INS	-	ATGT	ATGT	rs4008021	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13868300_13868301insATGT								MPDZ (588737 upstream) : NFIB (213547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	13964508	13964508	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13964508delT								MPDZ (684945 upstream) : NFIB (117340 downstream)																																			---	---	---	---
NFIB	4781	broad.mit.edu	37	9	14308325	14308326	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14308325_14308326delAC	uc003zle.2	-						NFIB_uc003zlf.2_Intron|NFIB_uc011lmo.1_Intron	NM_005596	NP_005587			nuclear factor I/B						anterior commissure morphogenesis|chondrocyte differentiation|Clara cell differentiation|commissural neuron axon guidance|DNA replication|glial cell differentiation|lung ciliated cell differentiation|negative regulation of DNA binding|negative regulation of epithelial cell proliferation involved in lung morphogenesis|negative regulation of mesenchymal cell proliferation involved in lung development|positive regulation of transcription from RNA polymerase II promoter|principal sensory nucleus of trigeminal nerve development|Type I pneumocyte differentiation|Type II pneumocyte differentiation	cerebellar mossy fiber|nucleolus|nucleus	RNA polymerase II transcription corepressor activity|sequence-specific DNA binding RNA polymerase II transcription factor activity				0				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)				T	MYB|HGMA2	adenoid cystic carcinoma|lipoma								---	---	---	---
TTC39B	158219	broad.mit.edu	37	9	15186697	15186697	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15186697delT	uc003zlr.1	-						TTC39B_uc003zlq.1_Intron|TTC39B_uc011lmp.1_Intron|TTC39B_uc010mie.1_Intron|TTC39B_uc011lmq.1_Intron|TTC39B_uc011lmr.1_Intron|TTC39B_uc010mif.1_3'UTR|TTC39B_uc003zlp.1_Intron	NM_152574	NP_689787			tetratricopeptide repeat domain 39B								binding			ovary(1)	1																		---	---	---	---
C9orf93	203238	broad.mit.edu	37	9	15614269	15614270	+	Intron	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15614269_15614270insG	uc003zmd.2	+						C9orf93_uc010mih.1_Intron|C9orf93_uc003zme.2_Intron|C9orf93_uc011lmu.1_Intron|C9orf93_uc003zmc.2_Intron	NM_173550	NP_775821			hypothetical protein LOC203238												0				GBM - Glioblastoma multiforme(50;4.84e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	18295343	18295344	+	IGR	DEL	TT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18295343_18295344delTT								SH3GL2 (498223 upstream) : ADAMTSL1 (178760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	20041200	20041201	+	IGR	INS	-	AG	AG	rs150268464	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20041200_20041201insAG								SLC24A2 (252392 upstream) : MLLT3 (303767 downstream)																																			---	---	---	---
KIAA1797	54914	broad.mit.edu	37	9	20679121	20679126	+	Intron	DEL	TGTGTG	-	-	rs35199205		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20679121_20679126delTGTGTG	uc003zog.1	+							NM_017794	NP_060264			hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)														---	---	---	---
KIAA1797	54914	broad.mit.edu	37	9	20887240	20887241	+	Intron	INS	-	T	T	rs71504752	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20887240_20887241insT	uc003zog.1	+						KIAA1797_uc003zoh.1_Intron	NM_017794	NP_060264			hypothetical protein LOC54914							integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)														---	---	---	---
CDKN2BAS	100048912	broad.mit.edu	37	9	22044104	22044104	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22044104delG	uc010miw.1	+						CDKN2BAS_uc010mix.1_Intron|CDKN2BAS_uc003zpm.2_Intron					Homo sapiens hypothetical methylthioadenosine phosphorylase fusion protein mRNA, complete cds.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	24827688	24827688	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:24827688delA								None (None upstream) : TUSC1 (848706 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	24831448	24831448	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:24831448delA								None (None upstream) : TUSC1 (844946 downstream)																																			---	---	---	---
MOBKL2B	79817	broad.mit.edu	37	9	27513916	27513926	+	Intron	DEL	TGGATGGATGG	-	-	rs11279544	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27513916_27513926delTGGATGGATGG	uc003zqn.2	-							NM_024761	NP_079037			MOB1, Mps One Binder kinase activator-like 2B								metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	27826093	27826094	+	IGR	DEL	TT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27826093_27826094delTT								C9orf72 (252251 upstream) : LINGO2 (122434 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	28806090	28806090	+	IGR	DEL	T	-	-	rs77332421		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28806090delT								LINGO2 (86787 upstream) : MIR876 (57534 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	29853932	29853932	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:29853932delA								MIR873 (964979 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	30395355	30395356	+	IGR	DEL	TT	-	-	rs71504218		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30395355_30395356delTT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	30692487	30692488	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:30692487_30692488delAC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	31203194	31203195	+	IGR	INS	-	TTCT	TTCT	rs145068613	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:31203194_31203195insTTCT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	32112294	32112294	+	IGR	DEL	A	-	-	rs35618631		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32112294delA								None (None upstream) : ACO1 (272307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	33743986	33743987	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33743986_33743987delGT								PTENP1 (66568 upstream) : PRSS3 (6528 downstream)																																			---	---	---	---
DCAF12	25853	broad.mit.edu	37	9	34129376	34129377	+	5'Flank	INS	-	TT	TT	rs145342084	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34129376_34129377insTT	uc003ztt.2	-							NM_015397	NP_056212			DDB1 and CUL4 associated factor 12							centrosome|CUL4 RING ubiquitin ligase complex					0																		---	---	---	---
DNAI1	27019	broad.mit.edu	37	9	34468185	34468186	+	Intron	INS	-	T	T	rs140009835		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34468185_34468186insT	uc003zum.2	+						DNAI1_uc011lom.1_Intron	NM_012144	NP_036276			dynein, axonemal, intermediate chain 1						cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)										Kartagener_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	9	34634431	34634432	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34634431_34634432insA								ARID3C (6420 upstream) : SIGMAR1 (288 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	35758806	35758806	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35758806delT								MSMP (4534 upstream) : NPR2 (33600 downstream)																																			---	---	---	---
TMEM8B	51754	broad.mit.edu	37	9	35854650	35854651	+	3'UTR	INS	-	GT	GT	rs144763477	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35854650_35854651insGT	uc003zym.2	+	14					TMEM8B_uc003zyo.2_3'UTR	NM_001042589	NP_001036054			transmembrane protein 8B isoform a						cell-matrix adhesion|regulation of growth|regulation of mitotic cell cycle	cell surface|endoplasmic reticulum|integral to membrane|mitochondrion|nucleus|plasma membrane	protein binding			ovary(1)	1																		---	---	---	---
HRCT1	646962	broad.mit.edu	37	9	35903624	35903625	+	5'Flank	INS	-	T	T	rs3071824		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35903624_35903625insT	uc003zyr.1	+							NM_001039792	NP_001034881			histidine rich carboxyl terminus 1							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	36314313	36314314	+	IGR	INS	-	AA	AA	rs146502092	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36314313_36314314insAA								CLTA (9535 upstream) : RNF38 (22087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	36819023	36819024	+	IGR	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36819023_36819024delCT								MELK (141345 upstream) : PAX5 (19507 downstream)																																			---	---	---	---
SHB	6461	broad.mit.edu	37	9	37989086	37989087	+	Intron	INS	-	CT	CT	rs140994932	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37989086_37989087insCT	uc004aax.2	-							NM_003028	NP_003019			Src homology 2 domain containing adaptor protein						angiogenesis|apoptosis|cell differentiation|signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity			central_nervous_system(2)|skin(1)	3		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	38927162	38927163	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38927162_38927163insT								C9orf122 (303887 upstream) : CNTNAP3 (145603 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66774039	66774039	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66774039delG								LOC442421 (271012 upstream) : AQP7P1 (480228 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	66823200	66823200	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66823200delT								LOC442421 (320173 upstream) : AQP7P1 (431067 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68330988	68330988	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68330988delT								FAM27B (536799 upstream) : MIR1299 (671251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68359003	68359004	+	IGR	INS	-	AC	AC	rs140853720	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68359003_68359004insAC								FAM27B (564814 upstream) : MIR1299 (643235 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68393794	68393794	+	IGR	DEL	T	-	-	rs113985464		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68393794delT								FAM27B (599605 upstream) : MIR1299 (608445 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	68436364	68436364	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68436364delT								FAM27B (642175 upstream) : MIR1299 (565875 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69833589	69833590	+	IGR	DEL	AT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69833589_69833590delAT								LOC100133920 (168640 upstream) : FOXD4L5 (342119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	69953018	69953018	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69953018delT								LOC100133920 (288069 upstream) : FOXD4L5 (222691 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	71166376	71166376	+	IGR	DEL	G	-	-	rs57024694		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71166376delG								C9orf71 (10593 upstream) : PIP5K1B (154240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	71883518	71883519	+	IGR	INS	-	ATA	ATA	rs145089768	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71883518_71883519insATA								TJP2 (13400 upstream) : FAM189A2 (55969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	72591095	72591095	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72591095delG								C9orf135 (69948 upstream) : MAMDC2 (67402 downstream)																																			---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73366966	73366967	+	Intron	DEL	GC	-	-	rs71507124	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73366966_73366967delGC	uc004aid.2	-						TRPM3_uc004ahu.2_Intron|TRPM3_uc004ahv.2_Intron|TRPM3_uc004ahw.2_Intron|TRPM3_uc004ahx.2_Intron|TRPM3_uc004ahy.2_Intron|TRPM3_uc004ahz.2_Intron|TRPM3_uc004aia.2_Intron|TRPM3_uc004aib.2_Intron|TRPM3_uc004aic.2_Intron|TRPM3_uc010mor.2_Intron	NM_001007471	NP_001007472			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
TRPM3	80036	broad.mit.edu	37	9	73887792	73887792	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73887792delT	uc004aii.2	-							NM_206948	NP_996831			transient receptor potential cation channel,							integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---
TMEM2	23670	broad.mit.edu	37	9	74330153	74330155	+	Intron	DEL	CTT	-	-	rs35031807		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74330153_74330155delCTT	uc011lsa.1	-						TMEM2_uc010mos.2_Intron|TMEM2_uc011lsb.1_Intron	NM_013390	NP_037522			transmembrane protein 2 isoform a							integral to membrane				ovary(2)	2		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	75129093	75129093	+	IGR	DEL	A	-	-	rs34686101		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75129093delA								ZFAND5 (148930 upstream) : TMC1 (7624 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	77825400	77825401	+	IGR	INS	-	TC	TC	rs146576432	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77825400_77825401insTC								OSTF1 (63287 upstream) : PCSK5 (680159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	78035661	78035662	+	IGR	DEL	AC	-	-	rs113066452		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78035661_78035662delAC								OSTF1 (273548 upstream) : PCSK5 (469898 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	78332467	78332474	+	IGR	DEL	ACACACAT	-	-	rs79400967		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78332467_78332474delACACACAT								OSTF1 (570354 upstream) : PCSK5 (173086 downstream)																																			---	---	---	---
PCSK5	5125	broad.mit.edu	37	9	78506448	78506453	+	Intron	DEL	CACACA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78506448_78506453delCACACA	uc004ajz.2	+						PCSK5_uc004ajy.2_Intron|PCSK5_uc004aka.2_Intron	NM_006200	NP_006191			proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern formation|cell-cell signaling|cytokine biosynthetic process|embryo implantation|embryonic digestive tract development|embryonic skeletal system development|heart development|kidney development|limb morphogenesis|nerve growth factor processing|nerve growth factor receptor signaling pathway|peptide biosynthetic process|renin secretion into blood stream|respiratory tube development|signal peptide processing|viral assembly, maturation, egress, and release	extracellular space|Golgi lumen|stored secretory granule	peptide binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3																		---	---	---	---
GCNT1	2650	broad.mit.edu	37	9	79082320	79082320	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79082320delT	uc010mpf.2	+						GCNT1_uc010mpg.2_Intron|GCNT1_uc010mph.2_Intron|GCNT1_uc004akf.3_Intron	NM_001490	NP_001481			beta-1,3-galactosyl-O-glycosyl-glycoprotein						protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity				0																		---	---	---	---
PRUNE2	158471	broad.mit.edu	37	9	79256918	79256918	+	Intron	DEL	A	-	-	rs72075308		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79256918delA	uc010mpk.2	-						PRUNE2_uc011lsk.1_Intron|PRUNE2_uc011lsl.1_Intron|PRUNE2_uc011lsm.1_Intron|PRUNE2_uc004akj.3_Intron	NM_015225	NP_056040			prune homolog 2						apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	80786105	80786106	+	IGR	INS	-	C	C	rs147453065	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:80786105_80786106insC								GNAQ (139913 upstream) : CEP78 (64885 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	81101192	81101193	+	IGR	INS	-	GAT	GAT	rs142614571	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81101192_81101193insGAT								PSAT1 (156185 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	85573133	85573134	+	IGR	DEL	CA	-	-	rs28433598		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85573133_85573134delCA								FLJ46321 (962963 upstream) : RASEF (24183 downstream)																																			---	---	---	---
RASEF	158158	broad.mit.edu	37	9	85614523	85614524	+	Intron	INS	-	T	T	rs76028673		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85614523_85614524insT	uc004amo.1	-							NM_152573	NP_689786			RAS and EF-hand domain containing						protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3																		---	---	---	---
FRMD3	257019	broad.mit.edu	37	9	86094701	86094704	+	Intron	DEL	GGAA	-	-	rs11140111	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86094701_86094704delGGAA	uc004ams.1	-						FRMD3_uc004amr.1_Intron	NM_174938	NP_777598			FERM domain containing 3							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
C9orf64	84267	broad.mit.edu	37	9	86574197	86574197	+	5'Flank	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86574197delA	uc004anb.2	-						C9orf64_uc004anc.2_5'Flank	NM_032307	NP_115683			hypothetical protein LOC84267												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	89192167	89192168	+	IGR	INS	-	CT	CT	rs57390805	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89192167_89192168insCT								ZCCHC6 (222789 upstream) : GAS1 (367111 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	89849916	89849917	+	Intron	INS	-	TG	TG	rs10633716		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89849916_89849917insTG	uc004apb.1	-											Homo sapiens cDNA clone IMAGE:30346008.																														---	---	---	---
Unknown	0	broad.mit.edu	37	9	90097522	90097523	+	IGR	INS	-	A	A	rs142888868	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90097522_90097523insA								C9orf170 (322881 upstream) : DAPK1 (15135 downstream)																																			---	---	---	---
DAPK1	1612	broad.mit.edu	37	9	90241357	90241359	+	Intron	DEL	AAC	-	-	rs66597242		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90241357_90241359delAAC	uc004apc.2	+						DAPK1_uc004ape.2_Intron|DAPK1_uc004apd.2_Intron|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Intron	NM_004938	NP_004929			death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2														Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				---	---	---	---
SEMA4D	10507	broad.mit.edu	37	9	91984782	91984783	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91984782_91984783delTG	uc011ltm.1	-						SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqm.2_5'Flank	NM_001142287	NP_001135759			semaphorin 4D isoform 2						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
SEMA4D	10507	broad.mit.edu	37	9	91986642	91986643	+	Intron	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91986642_91986643delTC	uc011ltm.1	-						SEMA4D_uc011ltn.1_Intron|SEMA4D_uc011lto.1_Intron|SEMA4D_uc004aqm.2_5'Flank	NM_001142287	NP_001135759			semaphorin 4D isoform 2						anti-apoptosis|axon guidance|cell adhesion|immune response	integral to membrane|plasma membrane	receptor activity|receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
LOC100129066	100129066	broad.mit.edu	37	9	92273736	92273736	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92273736delA	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	92974818	92974819	+	IGR	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92974818_92974819delGA								LOC100129066 (640144 upstream) : DIRAS2 (397295 downstream)																																			---	---	---	---
CENPP	401541	broad.mit.edu	37	9	95346632	95346635	+	Intron	DEL	TGTT	-	-	rs35631188		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95346632_95346635delTGTT	uc004arz.2	+						CENPP_uc010mqx.2_Intron	NM_001012267	NP_001012267			centromere protein P						CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm				ovary(2)	2																		---	---	---	---
PHF2	5253	broad.mit.edu	37	9	96385011	96385012	+	Intron	INS	-	T	T	rs146176457	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96385011_96385012insT	uc004aub.2	+						PHF2_uc011lug.1_Intron	NM_005392	NP_005383			PHD finger protein 2						liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)														---	---	---	---
PHF2	5253	broad.mit.edu	37	9	96385127	96385130	+	Intron	DEL	GTCT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96385127_96385130delGTCT	uc004aub.2	+						PHF2_uc011lug.1_Intron	NM_005392	NP_005383			PHD finger protein 2						liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	96472792	96472793	+	IGR	DEL	TG	-	-	rs5899189		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96472792_96472793delTG								PHF2 (30925 upstream) : BARX1 (241118 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	96998927	96998928	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96998927_96998928insT								MIRLET7D (57725 upstream) : ZNF169 (22650 downstream)																																			---	---	---	---
C9orf3	84909	broad.mit.edu	37	9	97505475	97505476	+	Intron	INS	-	GAG	GAG	rs59665022		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97505475_97505476insGAG	uc004auy.2	+						C9orf3_uc011lui.1_Intron|C9orf3_uc004aux.1_Intron	NM_032823	NP_116212			aminopeptidase O						leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	98486654	98486655	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98486654_98486655delCA								PTCH1 (207407 upstream) : C9orf130 (81717 downstream)																																			---	---	---	---
ZNF510	22869	broad.mit.edu	37	9	99537348	99537348	+	Intron	DEL	T	-	-	rs113196824		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99537348delT	uc004awn.1	-						ZNF510_uc004awo.1_Intron	NM_014930	NP_055745			zinc finger protein 510						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Acute lymphoblastic leukemia(62;0.0527)																---	---	---	---
TMOD1	7111	broad.mit.edu	37	9	100354712	100354712	+	Intron	DEL	A	-	-	rs10710591		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100354712delA	uc004axk.1	+						TMOD1_uc004axl.1_Intron	NM_003275	NP_003266			tropomodulin 1						muscle filament sliding	cytosol	actin binding				0		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	101670858	101670859	+	IGR	INS	-	A	A	rs149178813	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101670858_101670859insA								GALNT12 (58500 upstream) : COL15A1 (35279 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	104211297	104211301	+	IGR	DEL	AAAGA	-	-	rs150108645	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104211297_104211301delAAAGA								ALDOB (13235 upstream) : C9orf125 (26308 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	104258531	104258532	+	IGR	INS	-	GA	GA	rs141052923	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104258531_104258532insGA								C9orf125 (9056 upstream) : RNF20 (37601 downstream)																																			---	---	---	---
ABCA1	19	broad.mit.edu	37	9	107615496	107615497	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107615496_107615497insT	uc004bcl.2	-							NM_005502	NP_005493			ATP-binding cassette, sub-family A member 1						Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
ABCA1	19	broad.mit.edu	37	9	107650339	107650340	+	Intron	INS	-	GTGT	GTGT	rs147762490	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107650339_107650340insGTGT	uc004bcl.2	-						ABCA1_uc004bcm.2_Intron	NM_005502	NP_005493			ATP-binding cassette, sub-family A member 1						Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	107875166	107875166	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107875166delA								ABCA1 (184730 upstream) : SLC44A1 (131763 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	110518989	110518989	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110518989delT								KLF4 (266942 upstream) : None (None downstream)																																			---	---	---	---
C9orf5	23731	broad.mit.edu	37	9	111836136	111836136	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111836136delG	uc004bdt.3	-						C9orf5_uc004bds.3_Intron|C9orf5_uc004bdr.3_Intron	NM_032012	NP_114401			hypothetical protein LOC23731							integral to membrane				central_nervous_system(1)	1		Myeloproliferative disorder(63;0.204)		OV - Ovarian serous cystadenocarcinoma(323;3.08e-05)|STAD - Stomach adenocarcinoma(157;0.0823)														---	---	---	---
SVEP1	79987	broad.mit.edu	37	9	113248936	113248937	+	Intron	INS	-	C	C	rs143245953		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113248936_113248937insC	uc010mtz.2	-						SVEP1_uc010mua.1_Intron|SVEP1_uc004beu.2_Intron	NM_153366	NP_699197			polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7																		---	---	---	---
C9orf84	158401	broad.mit.edu	37	9	114543909	114543911	+	Intron	DEL	AGG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114543909_114543911delAGG	uc004bfr.2	-						C9orf84_uc011lwt.1_Intron|C9orf84_uc004bfs.1_Intron	NM_173521	NP_775792			hypothetical protein LOC158401 isoform 1											ovary(2)	2																		---	---	---	---
UGCG	7357	broad.mit.edu	37	9	114656799	114656799	+	5'Flank	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114656799delG	uc004bft.2	+							NM_003358	NP_003349			ceramide glucosyltransferase						epidermis development|glucosylceramide biosynthetic process	Golgi membrane|integral to membrane|membrane fraction	ceramide glucosyltransferase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.0433)	Miglustat(DB00419)													---	---	---	---
UGCG	7357	broad.mit.edu	37	9	114665063	114665063	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114665063delT	uc004bft.2	+							NM_003358	NP_003349			ceramide glucosyltransferase						epidermis development|glucosylceramide biosynthetic process	Golgi membrane|integral to membrane|membrane fraction	ceramide glucosyltransferase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.0433)	Miglustat(DB00419)													---	---	---	---
Unknown	0	broad.mit.edu	37	9	114733388	114733389	+	IGR	INS	-	TT	TT	rs140302323	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114733388_114733389insTT								UGCG (37957 upstream) : SUSD1 (69673 downstream)																																			---	---	---	---
SUSD1	64420	broad.mit.edu	37	9	114928166	114928169	+	Intron	DEL	AAAG	-	-	rs10622700		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114928166_114928169delAAAG	uc004bfu.2	-						SUSD1_uc010mui.2_Intron|SUSD1_uc010muj.2_Intron	NM_022486	NP_071931			sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0																		---	---	---	---
SUSD1	64420	broad.mit.edu	37	9	114936326	114936335	+	Intron	DEL	GGCTTCCAGT	-	-	rs72157169		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114936326_114936335delGGCTTCCAGT	uc004bfu.2	-						SUSD1_uc010mui.2_Intron|SUSD1_uc010muj.2_Intron	NM_022486	NP_071931			sushi domain containing 1 precursor							integral to membrane	calcium ion binding				0																		---	---	---	---
ROD1	9991	broad.mit.edu	37	9	114983547	114983548	+	3'UTR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114983547_114983548delAC	uc004bfw.2	-	15					ROD1_uc004bfv.2_3'UTR|ROD1_uc004bfx.2_3'UTR|ROD1_uc011lwu.1_3'UTR|ROD1_uc004bfy.2_3'UTR|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147			ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1																		---	---	---	---
C9orf80	58493	broad.mit.edu	37	9	115455169	115455170	+	Intron	INS	-	C	C	rs147964591	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115455169_115455170insC	uc004bgg.2	-						C9orf80_uc010muk.2_Intron	NM_021218	NP_067041			SOSSC protein						DNA repair|response to ionizing radiation	SOSS complex	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	116403056	116403056	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116403056delT								RGS3 (43039 upstream) : ZNF618 (235506 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	116599839	116599839	+	IGR	DEL	G	-	-	rs35225039		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116599839delG								RGS3 (239822 upstream) : ZNF618 (38723 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	117528940	117528941	+	IGR	INS	-	CCTT	CCTT	rs113822880	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117528940_117528941insCCTT								C9orf91 (120244 upstream) : TNFSF15 (22672 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	118206179	118206179	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118206179delA								DEC1 (41256 upstream) : C9orf27 (444367 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	118751600	118751601	+	IGR	INS	-	TT	TT	rs72491617		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118751600_118751601insTT								C9orf27 (64223 upstream) : PAPPA (164470 downstream)																																			---	---	---	---
PAPPA	5069	broad.mit.edu	37	9	119131427	119131428	+	Intron	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119131427_119131428delTC	uc004bjn.2	+						PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572			pregnancy-associated plasma protein A						cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9																		---	---	---	---
ASTN2	23245	broad.mit.edu	37	9	119625117	119625122	+	Intron	DEL	ACACAT	-	-	rs3984947		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119625117_119625122delACACAT	uc004bjs.1	-						ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830			astrotactin 2 isoform c							integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	121484845	121484846	+	IGR	INS	-	TG	TG	rs138744453	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121484845_121484846insTG								None (None upstream) : DBC1 (444062 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	121543604	121543605	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121543604_121543605insT								None (None upstream) : DBC1 (385303 downstream)																																			---	---	---	---
DAB2IP	153090	broad.mit.edu	37	9	124335062	124335062	+	Intron	DEL	A	-	-	rs520529	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124335062delA	uc004bln.2	+							NM_032552	NP_115941			disabled homolog 2 interacting protein isoform						activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
DAB2IP	153090	broad.mit.edu	37	9	124523354	124523354	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124523354delC	uc004bln.2	+						DAB2IP_uc004blo.2_Intron	NM_032552	NP_115941			disabled homolog 2 interacting protein isoform						activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	125284862	125284863	+	IGR	INS	-	TG	TG	rs141974996	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125284862_125284863insTG								OR1J4 (2502 upstream) : OR1N1 (3774 downstream)																																			---	---	---	---
RABGAP1	23637	broad.mit.edu	37	9	125724516	125724516	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125724516delA	uc011lzh.1	+						RABGAP1_uc004bnl.3_Intron|RABGAP1_uc004bnm.1_Intron	NM_012197	NP_036329			RAB GTPase activating protein 1						cell cycle	centrosome|cytosol|microtubule associated complex	Rab GTPase activator activity|tubulin binding			ovary(3)|kidney(2)	5																		---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126263991	126263991	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126263991delG	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
DENND1A	57706	broad.mit.edu	37	9	126369768	126369769	+	Intron	DEL	AC	-	-	rs10557656		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126369768_126369769delAC	uc004bnz.1	-						DENND1A_uc011lzl.1_Intron|DENND1A_uc004bny.1_Intron|DENND1A_uc011lzm.1_Intron|DENND1A_uc004boa.1_Intron|DENND1A_uc004bob.1_Intron|DENND1A_uc004boc.2_Intron	NM_020946	NP_065997			DENN/MADD domain containing 1A isoform 1							cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---
SCAI	286205	broad.mit.edu	37	9	127834021	127834021	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127834021delA	uc004bpe.2	-						SCAI_uc004bpd.2_Intron|SCAI_uc010mwu.2_Intron	NM_001144877	NP_001138349			suppressor of cancer cell invasion isoform 2						negative regulation of cell migration|negative regulation of Rho protein signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|integral to membrane|nucleus	protein binding|transcription corepressor activity			ovary(2)|breast(2)|central_nervous_system(1)	5																		---	---	---	---
GAPVD1	26130	broad.mit.edu	37	9	128115389	128115390	+	Intron	INS	-	A	A	rs78020439		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128115389_128115390insA	uc010mwx.2	+						GAPVD1_uc004bpp.2_Intron|GAPVD1_uc004bpq.2_Intron|GAPVD1_uc004bpr.2_Intron|GAPVD1_uc004bps.2_Intron|GAPVD1_uc004bpt.2_Intron	NM_015635	NP_056450			GTPase activating protein and VPS9 domains 1						endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	128182978	128182979	+	IGR	INS	-	AGTT	AGTT	rs140192612	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128182978_128182979insAGTT								GAPVD1 (55689 upstream) : MAPKAP1 (16695 downstream)																																			---	---	---	---
FAM125B	89853	broad.mit.edu	37	9	129176128	129176129	+	Intron	INS	-	GTGC	GTGC	rs148914544	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129176128_129176129insGTGC	uc004bqh.1	+						FAM125B_uc011lzy.1_Intron|FAM125B_uc010mxd.2_Intron	NM_033446	NP_258257			hypothetical protein LOC89853 isoform 1						protein transport	late endosome membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	129346736	129346737	+	IGR	INS	-	T	T	rs11371753		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129346736_129346737insT								FAM125B (73037 upstream) : LMX1B (30011 downstream)																																			---	---	---	---
LMX1B	4010	broad.mit.edu	37	9	129408597	129408616	+	Intron	DEL	ATCCATCCATCTACCTACCC	-	-	rs112445569		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129408597_129408616delATCCATCCATCTACCTACCC	uc004bqj.2	+						LMX1B_uc004bqi.2_Intron|LMX1B_uc011maa.1_Intron	NM_002316	NP_002307			LIM homeobox transcription factor 1, beta						dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0														Nail-Patella_Syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	9	129505098	129505098	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129505098delA								LMX1B (41787 upstream) : ZBTB43 (62187 downstream)																																			---	---	---	---
PTRH1	138428	broad.mit.edu	37	9	130467194	130467195	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130467194_130467195insT	uc004brm.2	-						C9orf117_uc004brn.1_5'Flank|C9orf117_uc010mxl.1_5'Flank					Homo sapiens cDNA clone IMAGE:4908933, partial cds.						translation		aminoacyl-tRNA hydrolase activity|protein binding				0																		---	---	---	---
PPP2R4	5524	broad.mit.edu	37	9	131892689	131892690	+	Intron	INS	-	T	T	rs76380491		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131892689_131892690insT	uc004bxm.1	+						PPP2R4_uc004bxl.1_Intron|PPP2R4_uc011mbo.1_Intron|PPP2R4_uc010myr.1_Intron|PPP2R4_uc004bxn.1_Intron|PPP2R4_uc004bxo.1_Intron|PPP2R4_uc011mbp.1_Intron|PPP2R4_uc011mbq.1_Intron|PPP2R4_uc010mys.1_Intron	NM_178001	NP_821068			protein phosphatase 2A, regulatory subunit B'						ATP catabolic process|negative regulation of phosphoprotein phosphatase activity|negative regulation of protein dephosphorylation|positive regulation of apoptosis|positive regulation of phosphoprotein phosphatase activity|positive regulation of protein dephosphorylation	calcium channel complex|cytoplasm|nucleus|protein phosphatase type 2A complex|soluble fraction	ATP binding|peptidyl-prolyl cis-trans isomerase activity|protein heterodimerization activity|protein homodimerization activity|protein phosphatase 2A binding|protein phosphatase type 2A regulator activity|protein tyrosine phosphatase activator activity|receptor binding			ovary(1)|lung(1)|pancreas(1)	3		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)														---	---	---	---
ASB6	140459	broad.mit.edu	37	9	132402444	132402444	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132402444delG	uc004byf.1	-						ASB6_uc004bye.1_Intron|ASB6_uc004byg.1_Intron|ASB6_uc011mbt.1_Intron|ASB6_uc010myx.1_Intron	NM_017873	NP_060343			ankyrin repeat and SOCS box-containing 6 isoform						intracellular signal transduction	cytoplasm					0		Ovarian(14;0.00556)																---	---	---	---
ABL1	25	broad.mit.edu	37	9	133632923	133632924	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133632923_133632924insT	uc004bzv.2	+							NM_007313	NP_009297			c-abl oncogene 1, receptor tyrosine kinase						actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	9	133772892	133772893	+	IGR	DEL	TG	-	-	rs10533037		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133772892_133772893delTG								QRFP (3667 upstream) : FIBCD1 (4933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	134212474	134212475	+	IGR	DEL	AG	-	-	rs34963376		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134212474_134212475delAG								PPAPDC3 (27825 upstream) : BAT2L1 (57125 downstream)																																	OREG0019559	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
BAT2L1	84726	broad.mit.edu	37	9	134270347	134270348	+	Intron	DEL	GT	-	-	rs55909039		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134270347_134270348delGT	uc004cam.1	+											SubName: Full=BAT2L protein;								protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	9	136618801	136618804	+	IGR	DEL	AAGG	-	-	rs78001076		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136618801_136618804delAAGG								SARDH (13724 upstream) : VAV2 (8213 downstream)																																			---	---	---	---
BRD3	8019	broad.mit.edu	37	9	136924652	136924652	+	Intron	DEL	C	-	-	rs67264020		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136924652delC	uc004cew.2	-						BRD3_uc004cex.2_Intron	NM_007371	NP_031397			bromodomain containing protein 3							nucleus	protein binding		BRD3/C15orf55(3)	stomach(4)|midline_organs(3)|kidney(1)	8				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)				T	NUT|C15orf55	lethal midline carcinoma of young people								---	---	---	---
Unknown	0	broad.mit.edu	37	9	137336644	137336645	+	IGR	INS	-	CTCG	CTCG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137336644_137336645insCTCG								RXRA (4213 upstream) : COL5A1 (197007 downstream)																																			---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137652068	137652069	+	Intron	INS	-	CA	CA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137652068_137652069insCA	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
COL5A1	1289	broad.mit.edu	37	9	137654668	137654669	+	Intron	INS	-	GA	GA	rs147145971	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137654668_137654669insGA	uc004cfe.2	+							NM_000093	NP_000084			alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	139450253	139450254	+	IGR	INS	-	C	C	rs146483984		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139450253_139450254insC								NOTCH1 (10015 upstream) : EGFL7 (103054 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	9	139489509	139489510	+	IGR	INS	-	AGGAGGAGGAGGAGAA	AGGAGGAGGAGGAGAA	rs149520278	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139489509_139489510insAGGAGGAGGAGGAGAA								NOTCH1 (49271 upstream) : EGFL7 (63798 downstream)																																			---	---	---	---
EHMT1	79813	broad.mit.edu	37	9	140616764	140616765	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140616764_140616765insT	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033			euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)														---	---	---	---
Unknown	0	broad.mit.edu	37	9	141094190	141094191	+	IGR	INS	-	AGG	AGG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141094190_141094191insAGG								TUBBP5 (22306 upstream) : FAM157B (12446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	110225	110230	+	IGR	DEL	CCCTAA	-	-	rs144631212	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110225_110230delCCCTAA								TUBB8 (14721 upstream) : ZMYND11 (70194 downstream)																																			---	---	---	---
GTPBP4	23560	broad.mit.edu	37	10	1061538	1061570	+	Intron	DEL	CTGGGGTCCTGAGCGCTGAGCCTGGGAGTGGAC	-	-	rs71731536	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1061538_1061570delCTGGGGTCCTGAGCGCTGAGCCTGGGAGTGGAC	uc001ift.2	+						GTPBP4_uc001ifu.2_Intron|GTPBP4_uc010qad.1_Intron|GTPBP4_uc010qae.1_Intron	NM_012341	NP_036473			G protein-binding protein CRFG						negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)														---	---	---	---
ADARB2	105	broad.mit.edu	37	10	1682065	1682068	+	Intron	DEL	AAAC	-	-	rs139187681	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1682065_1682068delAAAC	uc009xhq.2	-							NM_018702	NP_061172			adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	2347736	2347737	+	IGR	INS	-	TGTGTG	TGTGTG	rs147125550	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:2347736_2347737insTGTGTG								ADARB2 (568018 upstream) : PFKP (762015 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	3535989	3535990	+	Intron	INS	-	TC	TC	rs151309591	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3535989_3535990insTC	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	3614633	3614633	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3614633delT	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	4213545	4213545	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4213545delG								KLF6 (386072 upstream) : LOC100216001 (407899 downstream)																																			---	---	---	---
AKR1C1	1645	broad.mit.edu	37	10	4965920	4965920	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:4965920delA	uc001iho.2	+						AKR1E2_uc001ihl.1_Intron|AKR1C2_uc010qan.1_Intron	NM_001353	NP_001344			aldo-keto reductase family 1, member C1						bile acid and bile salt transport|bile acid metabolic process|cholesterol homeostasis|intestinal cholesterol absorption|protein homooligomerization|response to organophosphorus|xenobiotic metabolic process	cytosol	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity|aldo-keto reductase (NADP) activity|androsterone dehydrogenase (B-specific) activity|bile acid binding|indanol dehydrogenase activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			ovary(2)	2					NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	5423644	5423647	+	IGR	DEL	ACAG	-	-	rs72779808		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5423644_5423647delACAG								UCN3 (7475 upstream) : TUBAL3 (11415 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6321510	6321510	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6321510delT								PFKFB3 (44005 upstream) : PRKCQ (147595 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	6417741	6417741	+	IGR	DEL	A	-	-	rs74623620		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6417741delA								PFKFB3 (140236 upstream) : PRKCQ (51364 downstream)																																			---	---	---	---
ITIH2	3698	broad.mit.edu	37	10	7764280	7764281	+	Intron	DEL	CA	-	-	rs5782996		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7764280_7764281delCA	uc001ijs.2	+							NM_002216	NP_002207			inter-alpha globulin inhibitor H2 polypeptide						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	8089885	8089885	+	IGR	DEL	C	-	-	rs403350	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8089885delC								TAF3 (33172 upstream) : FLJ45983 (2528 downstream)																																			---	---	---	---
CELF2	10659	broad.mit.edu	37	10	11167854	11167855	+	Intron	INS	-	A	A	rs143947114	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11167854_11167855insA	uc001iki.3	+						CELF2_uc010qbi.1_Intron|CELF2_uc010qbj.1_Intron|CELF2_uc001ikk.2_Intron|CELF2_uc001ikl.3_Intron	NM_001025077	NP_001020248			CUG triplet repeat, RNA binding protein 2						mRNA processing|regulation of heart contraction	cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding				0																		---	---	---	---
UPF2	26019	broad.mit.edu	37	10	12063829	12063829	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12063829delA	uc001ila.2	-						UPF2_uc001ilb.2_Intron|UPF2_uc001ilc.2_Intron|UPF2_uc009xiz.1_Intron	NM_080599	NP_542166			UPF2 regulator of nonsense transcripts homolog						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	exon-exon junction complex|perinuclear region of cytoplasm	identical protein binding|RNA binding			central_nervous_system(2)|ovary(1)	3		Renal(717;0.228)																---	---	---	---
NUDT5	11164	broad.mit.edu	37	10	12234944	12234944	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12234944delT	uc001ilj.2	-						NUDT5_uc001ilk.2_Intron	NM_014142	NP_054861			nudix-type motif 5						D-ribose catabolic process|ribonucleoside diphosphate catabolic process	intracellular	ADP-ribose diphosphatase activity|magnesium ion binding			ovary(1)|pancreas(1)	2		Renal(717;0.228)																---	---	---	---
CAMK1D	57118	broad.mit.edu	37	10	12546107	12546108	+	Intron	INS	-	GGGT	GGGT	rs149803598	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12546107_12546108insGGGT	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718			calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	12936567	12936567	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12936567delT								LOC283070 (59023 upstream) : CCDC3 (2058 downstream)																																			---	---	---	---
FRMD4A	55691	broad.mit.edu	37	10	14280073	14280073	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14280073delG	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imv.2_Intron	NM_018027	NP_060497			FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	16466126	16466127	+	IGR	INS	-	A	A	rs112961366		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16466126_16466127insA								FAM188A (563607 upstream) : PTER (12840 downstream)																																			---	---	---	---
ST8SIA6	338596	broad.mit.edu	37	10	17492883	17492884	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17492883_17492884delAC	uc001ipd.2	-						ST8SIA6_uc010qce.1_Intron	NM_001004470	NP_001004470			ST8 alpha-N-acetyl-neuraminide						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1																		---	---	---	---
CACNB2	783	broad.mit.edu	37	10	18445991	18445992	+	Intron	INS	-	AA	AA	rs67576689		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18445991_18445992insAA	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron	NM_201596	NP_963890			calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
CACNB2	783	broad.mit.edu	37	10	18505526	18505526	+	Intron	DEL	T	-	-	rs144299997		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18505526delT	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron	NM_201596	NP_963890			calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
CACNB2	783	broad.mit.edu	37	10	18712069	18712070	+	Intron	INS	-	TTACCTGTT	TTACCTGTT	rs145815723	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18712069_18712070insTTACCTGTT	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron|CACNB2_uc009xkb.1_Intron|CACNB2_uc010qcm.1_Intron|CACNB2_uc001ipz.2_Intron|CACNB2_uc001ipy.2_Intron|CACNB2_uc010qcn.1_Intron|CACNB2_uc010qco.1_Intron|CACNB2_uc001iqa.2_Intron	NM_201596	NP_963890			calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)													---	---	---	---
NSUN6	221078	broad.mit.edu	37	10	18909345	18909346	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18909345_18909346insA	uc010qcp.1	-							NM_182543	NP_872349			NOL1/NOP2/Sun domain family, member 6								methyltransferase activity|RNA binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	19217964	19217965	+	IGR	DEL	TC	-	-	rs141499386		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19217964_19217965delTC								ARL5B (251024 upstream) : PLXDC2 (887407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	19414308	19414311	+	IGR	DEL	TTCC	-	-	rs10450313	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:19414308_19414311delTTCC								ARL5B (447368 upstream) : PLXDC2 (691061 downstream)																																			---	---	---	---
NEBL	10529	broad.mit.edu	37	10	21438256	21438256	+	Intron	DEL	G	-	-	rs60755026		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21438256delG	uc001iqk.2	-						C10orf113_uc001iqm.2_5'Flank	NM_213569	NP_998734			nebulette non-muscle isoform						regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	23191360	23191360	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23191360delA								PIP4K2A (187857 upstream) : ARMC3 (25594 downstream)																																			---	---	---	---
MSRB2	22921	broad.mit.edu	37	10	23394142	23394145	+	Intron	DEL	TGTG	-	-	rs72006003		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23394142_23394145delTGTG	uc001iro.2	+							NM_012228	NP_036360			methionine sulfoxide reductase B2 precursor						protein repair	mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0					L-Methionine(DB00134)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	23460301	23460301	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:23460301delG								MSRB2 (49360 upstream) : PTF1A (21159 downstream)																																			---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24698842	24698843	+	Intron	INS	-	T	T	rs147278908	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24698842_24698843insT	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron	NM_019590	NP_062536			sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
KIAA1217	56243	broad.mit.edu	37	10	24746255	24746256	+	Intron	INS	-	TTTG	TTTG	rs150884436	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24746255_24746256insTTTG	uc001iru.3	+						KIAA1217_uc001irs.2_Intron|KIAA1217_uc001irt.3_Intron|KIAA1217_uc010qcy.1_Intron|KIAA1217_uc010qcz.1_Intron|KIAA1217_uc001irv.1_Intron|KIAA1217_uc010qda.1_Intron|KIAA1217_uc001irw.2_Intron	NM_019590	NP_062536			sickle tail isoform 1						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7																		---	---	---	---
GPR158	57512	broad.mit.edu	37	10	25572899	25572899	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25572899delA	uc001isj.2	+							NM_020752	NP_065803			G protein-coupled receptor 158 precursor							integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8																		---	---	---	---
MYO3A	53904	broad.mit.edu	37	10	26269166	26269166	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26269166delA	uc001isn.2	+						MYO3A_uc009xko.1_Intron|MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron|MYO3A_uc001ism.2_Intron	NM_017433	NP_059129			myosin IIIA						protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	26946229	26946230	+	IGR	INS	-	AC	AC	rs147492162	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26946229_26946230insAC								LOC731789 (3847 upstream) : PDSS1 (40365 downstream)																																			---	---	---	---
YME1L1	10730	broad.mit.edu	37	10	27434219	27434219	+	Intron	DEL	A	-	-	rs72362930		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27434219delA	uc001iti.2	-						YME1L1_uc001itj.2_Intron|YME1L1_uc010qdl.1_Intron|YME1L1_uc009xkv.2_Intron	NM_139312	NP_647473			YME1-like 1 isoform 1						protein catabolic process|proteolysis	membrane|mitochondrion	ATP binding|metal ion binding|metalloendopeptidase activity|nucleoside-triphosphatase activity			ovary(1)	1																		---	---	---	---
ACBD5	91452	broad.mit.edu	37	10	27525043	27525046	+	Intron	DEL	AAAA	-	-	rs71901777		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27525043_27525046delAAAA	uc010qdp.1	-						ACBD5_uc010qdm.1_Intron|ACBD5_uc010qdn.1_Intron|ACBD5_uc010qdo.1_Intron|ACBD5_uc001ito.2_Intron|ACBD5_uc001itp.2_Intron|ACBD5_uc001itq.2_Intron|ACBD5_uc001itr.1_Intron	NM_145698	NP_663736			acyl-Coenzyme A binding domain containing 5						transport	integral to membrane|peroxisomal membrane	fatty-acyl-CoA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	29153898	29153898	+	IGR	DEL	T	-	-	rs66817729		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29153898delT								BAMBI (182030 upstream) : LYZL1 (424092 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	29645131	29645131	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29645131delC								LYZL1 (44974 upstream) : LOC387647 (53352 downstream)																																			---	---	---	---
SVIL	6840	broad.mit.edu	37	10	29825840	29825841	+	Intron	INS	-	AA	AA	rs66655814		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29825840_29825841insAA	uc001iut.1	-						SVIL_uc001iuu.1_Intron|SVIL_uc009xld.1_Intron	NM_021738	NP_068506			supervillin isoform 2						cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)																---	---	---	---
KIAA1462	57608	broad.mit.edu	37	10	30302248	30302248	+	RNA	DEL	A	-	-	rs79803186		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30302248delA	uc001iuw.1	-	1		c.1955delT								Homo sapiens cDNA FLJ31040 fis, clone HSYRA2000224.											ovary(4)	4																		---	---	---	---
KIAA1462	57608	broad.mit.edu	37	10	30331326	30331326	+	Intron	DEL	T	-	-	rs11337887		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30331326delT	uc001iux.2	-						KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Intron|KIAA1462_uc009xle.1_Intron	NM_020848	NP_065899			hypothetical protein LOC57608											ovary(4)	4																		---	---	---	---
KIAA1462	57608	broad.mit.edu	37	10	30362576	30362577	+	Intron	INS	-	TCCT	TCCT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30362576_30362577insTCCT	uc001iuz.2	-											RecName: Full=Uncharacterized protein KIAA1462;											ovary(4)	4																		---	---	---	---
MTPAP	55149	broad.mit.edu	37	10	30648303	30648314	+	Intron	DEL	CACACACACACC	-	-	rs144311753	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30648303_30648314delCACACACACACC	uc001ivb.3	-							NM_018109	NP_060579			PAP associated domain containing 1 precursor						cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	32050699	32050702	+	IGR	DEL	AGGA	-	-	rs112430684		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32050699_32050702delAGGA								ZEB1 (232572 upstream) : ARHGAP12 (44523 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	33377420	33377422	+	IGR	DEL	TCA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33377420_33377422delTCA								ITGB1 (130127 upstream) : NRP1 (88998 downstream)																																			---	---	---	---
NRP1	8829	broad.mit.edu	37	10	33525908	33525908	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33525908delT	uc001iwx.3	-						NRP1_uc001iwv.3_Intron|NRP1_uc009xlz.2_Intron|NRP1_uc001iww.3_Intron|NRP1_uc001iwy.3_Intron|NRP1_uc001iwz.2_Intron|NRP1_uc001ixa.2_Intron|NRP1_uc001ixb.1_Intron|NRP1_uc001ixc.1_Intron	NM_003873	NP_003864			neuropilin 1 isoform a						axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)													---	---	---	---
Unknown	0	broad.mit.edu	37	10	35258254	35258259	+	IGR	DEL	AGCTCG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35258254_35258259delAGCTCG								PARD3 (154331 upstream) : CUL2 (40549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38535120	38535121	+	IGR	DEL	TG	-	-	rs113618221		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38535120_38535121delTG								LOC100129055 (31848 upstream) : HSD17B7P2 (110187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38948903	38948904	+	IGR	DEL	AT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38948903_38948904delAT								LOC399744 (207823 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	38958317	38958318	+	IGR	INS	-	GA	GA	rs112098561		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38958317_38958318insGA								LOC399744 (217237 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	39089329	39089330	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:39089329_39089330insT								LOC399744 (348249 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42634977	42634978	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42634977_42634978insT								None (None upstream) : LOC441666 (192337 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	42796640	42796641	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42796640_42796641insA								None (None upstream) : LOC441666 (30674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	43193448	43193462	+	IGR	DEL	CTTCTTCTTCTCCCC	-	-	rs148292883	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43193448_43193462delCTTCTTCTTCTCCCC								ZNF33B (59456 upstream) : BMS1 (84492 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	43401143	43401145	+	IGR	DEL	AAC	-	-	rs141611485		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43401143_43401145delAAC								BMS1 (70760 upstream) : RET (171372 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	43802753	43802753	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43802753delG								RASGEF1A (40386 upstream) : FXYD4 (64339 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	43981974	43981975	+	IGR	INS	-	A	A	rs74822420		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43981974_43981975insA								ZNF487 (3967 upstream) : ZNF239 (69820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	44477099	44477099	+	IGR	DEL	C	-	-	rs11321295		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:44477099delC								HNRNPA3P1 (191234 upstream) : CXCL12 (388508 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	45335556	45335557	+	Intron	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45335556_45335557insC	uc001jbk.1	-						uc001jbl.2_Intron					Homo sapiens cDNA FLJ31956 fis, clone NT2RP7007359.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	46977797	46977797	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46977797delG								SYT15 (7196 upstream) : GPRIN2 (15749 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	46984928	46984929	+	IGR	INS	-	A	A	rs147764650		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46984928_46984929insA								SYT15 (14327 upstream) : GPRIN2 (8617 downstream)																																			---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47019290	47019291	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47019290_47019291insA	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47058740	47058741	+	Intron	INS	-	AT	AT	rs138826253		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47058740_47058741insAT	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47064173	47064174	+	Intron	INS	-	T	T	rs141388931	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47064173_47064174insT	uc001jed.3	-											Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
ANXA8	653145	broad.mit.edu	37	10	47083148	47083161	+	Intron	DEL	GAGAGAGAGAGAGA	-	-	rs10594749		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47083148_47083161delGAGAGAGAGAGAGA	uc001jed.3	-						PPYR1_uc001jee.2_5'Flank|PPYR1_uc009xna.2_5'Flank					Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	50401984	50401985	+	IGR	INS	-	AG	AG	rs151337817	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50401984_50401985insAG								C10orf128 (5577 upstream) : C10orf71 (105202 downstream)																																			---	---	---	---
PARG	8505	broad.mit.edu	37	10	51565359	51565368	+	Intron	DEL	CCGCCCCTTC	-	-	rs67900423		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51565359_51565368delCCGCCCCTTC	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|NCOA4_uc009xon.2_Intron|NCOA4_uc010qhd.1_Intron|NCOA4_uc001jis.3_Intron|NCOA4_uc010qhe.1_Intron|NCOA4_uc010qhf.1_Intron	NM_003631	NP_003622			poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)														---	---	---	---
PRKG1	5592	broad.mit.edu	37	10	53679293	53679294	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53679293_53679294insT	uc001jjm.2	+						PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_001098512	NP_001091982			protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	54301204	54301205	+	IGR	INS	-	T	T	rs143248943	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54301204_54301205insT								DKK1 (223788 upstream) : MBL2 (223936 downstream)																																			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55949684	55949685	+	Intron	DEL	TA	-	-	rs57328325		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55949684_55949685delTA	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045			protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	55954370	55954371	+	Intron	INS	-	TG	TG	rs139203231	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55954370_55954371insTG	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045			protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
PCDH15	65217	broad.mit.edu	37	10	56556039	56556042	+	Intron	DEL	TATG	-	-	rs59394821		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:56556039_56556042delTATG	uc001jju.1	-						PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Intron|PCDH15_uc010qhw.1_Intron|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Intron|PCDH15_uc010qhz.1_Intron|PCDH15_uc010qia.1_Intron|PCDH15_uc010qib.1_Intron|PCDH15_uc001jjw.2_Intron	NM_033056	NP_149045			protocadherin 15 isoform CD1-4 precursor						equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---
Unknown	0	broad.mit.edu	37	10	58864141	58864141	+	IGR	DEL	A	-	-	rs71299275		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:58864141delA								ZWINT (743107 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	59538568	59538569	+	IGR	INS	-	A	A	rs151199222	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59538568_59538569insA								None (None upstream) : IPMK (417049 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	59816005	59816005	+	IGR	DEL	T	-	-	rs35758684		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59816005delT								None (None upstream) : IPMK (139613 downstream)																																			---	---	---	---
BICC1	80114	broad.mit.edu	37	10	60359689	60359690	+	Intron	INS	-	GTGT	GTGT	rs144406545	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60359689_60359690insGTGT	uc001jki.1	+							NM_001080512	NP_001073981			bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---
PHYHIPL	84457	broad.mit.edu	37	10	61001654	61001656	+	Intron	DEL	AAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61001654_61001656delAAG	uc001jkk.3	+						PHYHIPL_uc001jkl.3_Intron|PHYHIPL_uc001jkm.3_Intron	NM_032439	NP_115815			phytanoyl-CoA 2-hydroxylase interacting												0																		---	---	---	---
ANK3	288	broad.mit.edu	37	10	62213504	62213505	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62213504_62213505delAC	uc010qih.1	-						ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron	NM_001149	NP_001140			ankyrin 3 isoform 2						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---
ANK3	288	broad.mit.edu	37	10	62245076	62245077	+	Intron	INS	-	G	G	rs142545993	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62245076_62245077insG	uc010qih.1	-						ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron	NM_001149	NP_001140			ankyrin 3 isoform 2						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	62500488	62500488	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62500488delA								ANK3 (7333 upstream) : CDK1 (37635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	62827927	62827927	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62827927delA								RHOBTB1 (66729 upstream) : TMEM26 (338474 downstream)																																			---	---	---	---
REEP3	221035	broad.mit.edu	37	10	65287054	65287054	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65287054delA	uc001jmt.2	+						REEP3_uc009xpl.1_Intron	NM_001001330	NP_001001330			receptor accessory protein 3							integral to membrane					0	Prostate(12;0.0119)|all_hematologic(501;0.191)																	---	---	---	---
Unknown	0	broad.mit.edu	37	10	65412734	65412735	+	IGR	INS	-	CACACACACACACT	CACACACACACACT	rs140977104	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65412734_65412735insCACACACACACACT								REEP3 (30763 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	65557798	65557798	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65557798delT								REEP3 (175827 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	65994901	65994904	+	IGR	DEL	GTGT	-	-	rs145437779		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65994901_65994904delGTGT								REEP3 (612930 upstream) : ANXA2P3 (590381 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	66165893	66165894	+	IGR	DEL	TG	-	-	rs34579338		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:66165893_66165894delTG								REEP3 (783922 upstream) : ANXA2P3 (419391 downstream)																																			---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	67979380	67979380	+	Intron	DEL	T	-	-	rs139117603		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67979380delT	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	68251726	68251728	+	Intron	DEL	TAA	-	-	rs76570618		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68251726_68251728delTAA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
CTNNA3	29119	broad.mit.edu	37	10	69380331	69380331	+	Intron	DEL	A	-	-	rs75963753		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69380331delA	uc009xpn.1	-						CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|CTNNA3_uc001jna.2_Intron	NM_001127384	NP_001120856			catenin, alpha 3						cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8																		---	---	---	---
DNA2	1763	broad.mit.edu	37	10	70208690	70208691	+	Intron	DEL	GT	-	-	rs10544469		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70208690_70208691delGT	uc001jof.2	-						DNA2_uc001jog.1_Intron|DNA2_uc001joh.1_Intron	NM_001080449	NP_001073918			DNA replication helicase 2 homolog						base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base				0																		---	---	---	---
SLC25A16	8034	broad.mit.edu	37	10	70250983	70250983	+	Intron	DEL	T	-	-	rs71470521		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70250983delT	uc001joi.2	-						SLC25A16_uc010qix.1_Intron|SLC25A16_uc010qiy.1_Intron|SLC25A16_uc001joj.2_Intron	NM_152707	NP_689920			solute carrier family 25, member 16						coenzyme biosynthetic process|pantothenate metabolic process	integral to membrane|mitochondrial inner membrane	binding|solute:solute antiporter activity				0																		---	---	---	---
TET1	80312	broad.mit.edu	37	10	70343196	70343197	+	Intron	INS	-	A	A	rs147349382	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70343196_70343197insA	uc001jok.3	+							NM_030625	NP_085128			CXXC finger 6						DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9																		---	---	---	---
SUPV3L1	6832	broad.mit.edu	37	10	70938985	70938985	+	5'Flank	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70938985delT	uc001jpe.1	+						SUPV3L1_uc010qjd.1_5'Flank	NM_003171	NP_003162			suppressor of var1, 3-like 1 precursor						DNA duplex unwinding	mitochondrial nucleoid|nucleus	ATP binding|DNA binding|DNA helicase activity|RNA binding			urinary_tract(1)|ovary(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	71339042	71339043	+	IGR	INS	-	ACAC	ACAC	rs145278104	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71339042_71339043insACAC								NEUROG3 (5920 upstream) : C10orf35 (50960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	72889058	72889059	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72889058_72889059delAC								PCBD1 (240517 upstream) : UNC5B (83239 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	72901492	72901492	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72901492delC								PCBD1 (252951 upstream) : UNC5B (70806 downstream)																																			---	---	---	---
UNC5B	219699	broad.mit.edu	37	10	72974098	72974099	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72974098_72974099insT	uc001jro.2	+						UNC5B_uc001jrp.2_Intron	NM_170744	NP_734465			unc-5 homolog B precursor						apoptosis|axon guidance|regulation of apoptosis	integral to membrane				ovary(2)|lung(1)	3																		---	---	---	---
CDH23	64072	broad.mit.edu	37	10	73231303	73231304	+	Intron	INS	-	CAGATTG	CAGATTG	rs143123050	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73231303_73231304insCAGATTG	uc001jrx.3	+						CDH23_uc001jrw.3_Intron|CDH23_uc001jrv.2_Intron|CDH23_uc009xql.2_Intron	NM_022124	NP_071407			cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11																		---	---	---	---
PSAP	5660	broad.mit.edu	37	10	73580467	73580468	+	Intron	INS	-	A	A	rs140197333	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73580467_73580468insA	uc001jsm.2	-						PSAP_uc001jsl.2_Intron	NM_002778	NP_002769			prosaposin isoform a preproprotein						glycosphingolipid metabolic process|lipid transport|platelet activation|platelet degranulation	extracellular space|Golgi apparatus|integral to membrane|lysosomal lumen	enzyme activator activity|lipid binding			ovary(1)	1																		---	---	---	---
CHST3	9469	broad.mit.edu	37	10	73723910	73723911	+	5'Flank	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73723910_73723911insC	uc001jsn.2	+							NM_004273	NP_004264			chondroitin 6-sulfotransferase 3						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 6-sulfotransferase activity				0																		---	---	---	---
ASCC1	51008	broad.mit.edu	37	10	73902123	73902124	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73902123_73902124insT	uc001jst.1	-						ASCC1_uc001jsr.1_Intron|ASCC1_uc001jss.1_Intron|ASCC1_uc001jsu.1_Intron|ASCC1_uc010qju.1_Intron					RecName: Full=Activating signal cointegrator 1 complex subunit 1; AltName: Full=ASC-1 complex subunit p50; AltName: Full=Trip4 complex subunit p50;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|transcription factor complex	RNA binding				0																		---	---	---	---
CBARA1	10367	broad.mit.edu	37	10	74235192	74235193	+	Intron	INS	-	T	T	rs5786077		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74235192_74235193insT	uc001jtb.1	-						CBARA1_uc010qjw.1_Intron|CBARA1_uc010qjx.1_Intron|CBARA1_uc009xqo.1_Intron	NM_006077	NP_006068			calcium binding atopy-related autoantigen 1						calcium ion import|defense response|elevation of mitochondrial calcium ion concentration	integral to membrane|mitochondrial inner membrane	calcium ion binding|protein binding			ovary(1)	1																		---	---	---	---
CCDC109A	90550	broad.mit.edu	37	10	74516774	74516774	+	Intron	DEL	A	-	-	rs79732334		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74516774delA	uc001jtc.2	+						CCDC109A_uc009xqp.1_Intron|CCDC109A_uc009xqq.1_Intron|CCDC109A_uc010qjy.1_Intron|CCDC109A_uc009xqr.2_Intron|CCDC109A_uc001jtd.2_Intron	NM_138357	NP_612366			coiled-coil domain containing 109A						elevation of mitochondrial calcium ion concentration|mitochondrial calcium ion transport|protein complex oligomerization	integral to membrane|mitochondrial inner membrane	protein binding				0	Prostate(51;0.0198)																	---	---	---	---
MRPS16	51021	broad.mit.edu	37	10	75012037	75012037	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75012037delT	uc001jts.1	-						MRPS16_uc010qkh.1_Intron|MRPS16_uc001jtt.1_Intron|uc001jtu.1_5'Flank	NM_016065	NP_057149			mitochondrial ribosomal protein S16 precursor						translation	mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome				0	Prostate(51;0.0119)																	---	---	---	---
CAMK2G	818	broad.mit.edu	37	10	75593358	75593359	+	Intron	INS	-	T	T	rs67630529		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75593358_75593359insT	uc001jvv.1	-						CAMK2G_uc001jvm.1_Intron|CAMK2G_uc001jvo.1_Intron|CAMK2G_uc001jvq.1_Intron|CAMK2G_uc001jvr.1_Intron|CAMK2G_uc001jvp.1_Intron|CAMK2G_uc001jvs.1_Intron|CAMK2G_uc001jvt.1_Intron|CAMK2G_uc001jvu.1_Intron|CAMK2G_uc010qkv.1_Intron|CAMK2G_uc009xrp.1_Intron|CAMK2G_uc001jvw.1_Intron|CAMK2G_uc001jvx.1_Intron	NM_172171	NP_751911			calcium/calmodulin-dependent protein kinase II						insulin secretion|interferon-gamma-mediated signaling pathway|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)|stomach(1)	2	Prostate(51;0.0112)																	---	---	---	---
ADK	132	broad.mit.edu	37	10	75954848	75954849	+	Intron	INS	-	A	A	rs150095098	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75954848_75954849insA	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Intron|ADK_uc010qlc.1_Intron	NM_006721	NP_006712			adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)													---	---	---	---
ADK	132	broad.mit.edu	37	10	76132882	76132882	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76132882delA	uc001jwi.2	+						ADK_uc010qlb.1_Intron|ADK_uc001jwj.2_Intron|ADK_uc010qlc.1_Intron	NM_006721	NP_006712			adenosine kinase isoform b						purine base metabolic process|purine ribonucleoside salvage	cytosol	adenosine kinase activity|ATP binding|metal ion binding|phosphotransferase activity, alcohol group as acceptor			ovary(1)|skin(1)	2	Prostate(51;0.0112)|Ovarian(15;0.148)				Adenosine(DB00640)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Pegademase bovine(DB00061)|Ribavirin(DB00811)													---	---	---	---
MYST4	23522	broad.mit.edu	37	10	76630340	76630340	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76630340delT	uc001jwn.1	+						MYST4_uc001jwm.1_Intron|MYST4_uc001jwo.1_Intron|MYST4_uc001jwp.1_Intron	NM_012330	NP_036462			MYST histone acetyltransferase (monocytic						histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription factor binding|zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|breast(2)|skin(1)|prostate(1)	16	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)							T	CREBBP	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	10	77015550	77015551	+	IGR	INS	-	CAAAA	CAAAA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77015550_77015551insCAAAA								COMTD1 (19780 upstream) : ZNF503 (142054 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	77056256	77056257	+	RNA	INS	-	C	C	rs142114878	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77056256_77056257insC	uc001jxd.1	+	1		c.109_110insC								Homo sapiens cDNA FLJ13383 fis, clone PLACE1001024.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	78502448	78502449	+	IGR	INS	-	A	A	rs151068739	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78502448_78502449insA								C10orf11 (185324 upstream) : KCNMA1 (126910 downstream)																																			---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	79205123	79205124	+	Intron	INS	-	AGAC	AGAC	rs3997974		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79205123_79205124insAGAC	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
KCNMA1	3778	broad.mit.edu	37	10	79235338	79235338	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79235338delG	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824			large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)													---	---	---	---
DLG5	9231	broad.mit.edu	37	10	79636507	79636507	+	Intron	DEL	A	-	-	rs112056607		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79636507delA	uc001jzk.2	-						DLG5_uc009xru.1_Intron	NM_004747	NP_004738			discs large homolog 5						cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	80047772	80047773	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:80047772_80047773insT	uc010qlp.1	+						uc001jzw.1_Intron					SubName: Full=cDNA FLJ57363;																														---	---	---	---
ZMIZ1	57178	broad.mit.edu	37	10	81043352	81043352	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81043352delA	uc001kaf.2	+						ZMIZ1_uc001kag.2_Intron|ZMIZ1_uc001kah.1_Intron	NM_020338	NP_065071			retinoic acid induced 17						transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)															---	---	---	---
ZCCHC24	219654	broad.mit.edu	37	10	81183792	81183792	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81183792delG	uc001kak.2	-						ZCCHC24_uc010qlr.1_Intron|ZCCHC24_uc009xrw.2_Intron	NM_153367	NP_699198			zinc finger, CCHC domain containing 24								nucleic acid binding|zinc ion binding			breast(1)	1																		---	---	---	---
LOC219347	219347	broad.mit.edu	37	10	81822514	81822514	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81822514delA	uc001kbk.2	-						LOC219347_uc001kbi.3_Intron|LOC219347_uc009xsk.2_Intron|LOC219347_uc009xsl.2_Intron|LOC219347_uc009xsm.2_Intron|LOC219347_uc001kbj.3_Intron					Homo sapiens cDNA FLJ11611 fis, clone HEMBA1003987.												0																		---	---	---	---
DYDC1	143241	broad.mit.edu	37	10	82106844	82106844	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82106844delA	uc001kbx.2	-						DYDC1_uc001kby.1_Intron|DYDC1_uc009xsr.1_Intron|DYDC2_uc001kbz.1_Intron|DYDC2_uc001kca.1_Intron	NM_138812	NP_620167			DPY30 domain containing 1												0			Colorectal(32;0.229)															---	---	---	---
DYDC1	143241	broad.mit.edu	37	10	82112908	82112908	+	Intron	DEL	A	-	-	rs112021487		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82112908delA	uc001kbx.2	-						DYDC1_uc001kby.1_Intron|DYDC1_uc009xsr.1_Intron|DYDC2_uc001kbz.1_Intron|DYDC2_uc001kca.1_Intron	NM_138812	NP_620167			DPY30 domain containing 1												0			Colorectal(32;0.229)															---	---	---	---
SH2D4B	387694	broad.mit.edu	37	10	82305976	82305976	+	Intron	DEL	T	-	-	rs67166247		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82305976delT	uc001kck.1	+						SH2D4B_uc001kcl.1_Intron	NM_207372	NP_997255			SH2 domain containing 4B isoform 1												0			Colorectal(32;0.229)															---	---	---	---
Unknown	0	broad.mit.edu	37	10	82663430	82663430	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82663430delT								SH2D4B (257114 upstream) : NRG3 (971640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	82763748	82763749	+	IGR	INS	-	GT	GT	rs143104794	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82763748_82763749insGT								SH2D4B (357432 upstream) : NRG3 (871321 downstream)																																			---	---	---	---
NRG3	10718	broad.mit.edu	37	10	83798517	83798517	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83798517delG	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848			neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)														---	---	---	---
NRG3	10718	broad.mit.edu	37	10	83991066	83991066	+	Intron	DEL	T	-	-	rs112620116		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83991066delT	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848			neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)														---	---	---	---
NRG3	10718	broad.mit.edu	37	10	84459614	84459615	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84459614_84459615delTG	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848			neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	85219612	85219612	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85219612delT								NRG3 (472677 upstream) : GHITM (679573 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	86931760	86931761	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86931760_86931761insA								FAM190B (653484 upstream) : GRID1 (427551 downstream)																																			---	---	---	---
PTEN	5728	broad.mit.edu	37	10	89699051	89699051	+	Intron	DEL	G	-	-	rs140691140		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89699051delG	uc001kfb.2	+							NM_000314	NP_000305			phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.Y27fs*1(2)|p.?(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)			31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			---	---	---	---
RNLS	55328	broad.mit.edu	37	10	90264599	90264600	+	Intron	DEL	AG	-	-	rs72278132		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90264599_90264600delAG	uc001kfe.2	-						RNLS_uc010qms.1_Intron|RNLS_uc001kfd.2_Intron|RNLS_uc009xtj.2_Intron	NM_001031709	NP_001026879			renalase isoform 1							extracellular region	oxidoreductase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	91685221	91685222	+	Intron	INS	-	AG	AG	rs144626896	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91685221_91685222insAG	uc001kgx.1	-											Homo sapiens cDNA FLJ35900 fis, clone TESTI2009545.																														---	---	---	---
LOC100188947	100188947	broad.mit.edu	37	10	93350269	93350269	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93350269delA	uc010qnl.1	-							NR_024467				Homo sapiens, clone IMAGE:6063621, mRNA.												0																		---	---	---	---
CPEB3	22849	broad.mit.edu	37	10	93854566	93854567	+	Intron	DEL	AC	-	-	rs35569779		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93854566_93854567delAC	uc001khw.1	-						CPEB3_uc001khu.1_Intron|CPEB3_uc001khv.1_Intron|CPEB3_uc010qnn.1_Intron	NM_014912	NP_055727			cytoplasmic polyadenylation element binding								nucleotide binding|RNA binding				0		Colorectal(252;0.0869)																---	---	---	---
EXOC6	54536	broad.mit.edu	37	10	94737450	94737451	+	Intron	DEL	AT	-	-	rs4917670	byFrequency;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94737450_94737451delAT	uc001kig.2	+						EXOC6_uc010qnr.1_Intron|EXOC6_uc001kie.2_Intron|EXOC6_uc009xub.2_Intron|EXOC6_uc009xuc.2_Intron|EXOC6_uc001kih.2_Intron|EXOC6_uc001kii.2_Intron	NM_019053	NP_061926			SEC15-like 1 isoform a						protein transport|vesicle docking involved in exocytosis	exocyst				skin(1)	1		Colorectal(252;0.123)																---	---	---	---
CYP26C1	340665	broad.mit.edu	37	10	94819820	94819833	+	5'Flank	DEL	CAAGAGTCGTCGGG	-	-	rs3831311		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94819820_94819833delCAAGAGTCGTCGGG	uc010qns.1	+						CYP26C1_uc009xud.2_5'Flank	NM_183374	NP_899230			cytochrome P450, family 26, subfamily C,						anterior/posterior pattern formation|central nervous system development|negative regulation of retinoic acid receptor signaling pathway|neural crest cell development|organelle fusion|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			central_nervous_system(1)	1		Colorectal(252;0.122)																---	---	---	---
MYOF	26509	broad.mit.edu	37	10	95229162	95229163	+	Intron	INS	-	A	A	rs140628708		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95229162_95229163insA	uc001kin.2	-						MYOF_uc001kio.2_Intron|MYOF_uc001kip.3_Intron|MYOF_uc009xuf.2_Intron	NM_013451	NP_038479			myoferlin isoform a						blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4																		---	---	---	---
ENTPD1	953	broad.mit.edu	37	10	97512929	97512930	+	5'Flank	INS	-	A	A	rs144326453	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97512929_97512930insA	uc001klh.3	+						ENTPD1_uc001kle.1_Intron|ENTPD1_uc001kli.3_Intron|ENTPD1_uc010qoj.1_5'Flank|ENTPD1_uc010qok.1_5'Flank|ENTPD1_uc010qol.1_5'Flank|ENTPD1_uc010qom.1_5'Flank|ENTPD1_uc010qon.1_5'Flank|ENTPD1_uc009xva.2_5'Flank|ENTPD1_uc009xuz.2_5'Flank	NM_001776	NP_001767			ectonucleoside triphosphate diphosphohydrolase 1						cell adhesion	integral to plasma membrane	ATP binding			ovary(3)	3		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)														---	---	---	---
ARHGAP19	84986	broad.mit.edu	37	10	98949029	98949029	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98949029delG	uc001kmy.2	-							NM_032900				Rho GTPase activating protein 19						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|nucleus	GTPase activator activity				0		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)														---	---	---	---
LOC100270710	100270710	broad.mit.edu	37	10	99478597	99478598	+	5'Flank	INS	-	A	A	rs143088462	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99478597_99478598insA	uc010qoz.1	-							NR_026754				Homo sapiens hypothetical LOC100270710 (LOC100270710), non-coding RNA.												0																		---	---	---	---
CRTAC1	55118	broad.mit.edu	37	10	99708276	99708276	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99708276delT	uc001kou.1	-						CRTAC1_uc001kov.2_Intron	NM_018058	NP_060528			cartilage acidic protein 1 precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)														---	---	---	---
HPSE2	60495	broad.mit.edu	37	10	100374053	100374054	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100374053_100374054insT	uc001kpn.1	-						HPSE2_uc009xwc.1_Intron|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600			heparanase 2						carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)														---	---	---	---
ENTPD7	57089	broad.mit.edu	37	10	101427380	101427380	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101427380delA	uc001kqa.3	+						ENTPD7_uc009xwl.2_Intron	NM_020354	NP_065087			ectonucleoside triphosphate diphosphohydrolase							cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)														---	---	---	---
TLX1NB	100038246	broad.mit.edu	37	10	102857410	102857411	+	Intron	DEL	TT	-	-	rs111702827		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102857410_102857411delTT	uc001ksv.2	-							NM_001085398	NP_001078867			TLX1 divergent												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	102966700	102966701	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102966700_102966701insA								TLX1 (69155 upstream) : LBX1 (20033 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	102982053	102982053	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102982053delC								TLX1 (84508 upstream) : LBX1 (4681 downstream)																																			---	---	---	---
BTRC	8945	broad.mit.edu	37	10	103287519	103287524	+	Intron	DEL	TCTCTC	-	-	rs138197737		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103287519_103287524delTCTCTC	uc001kta.2	+						BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Intron	NM_033637	NP_378663			beta-transducin repeat containing protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)														---	---	---	---
BTRC	8945	broad.mit.edu	37	10	103292507	103292508	+	Intron	INS	-	TGTGTG	TGTGTG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103292507_103292508insTGTGTG	uc001kta.2	+						BTRC_uc001ktb.2_Intron|BTRC_uc001ktc.2_Intron	NM_033637	NP_378663			beta-transducin repeat containing protein						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|positive regulation of proteolysis|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein destabilization|viral reproduction|Wnt receptor signaling pathway	cytosol|nucleus|SCF ubiquitin ligase complex				ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)														---	---	---	---
NEURL	9148	broad.mit.edu	37	10	105265483	105265483	+	Intron	DEL	G	-	-	rs79375715		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105265483delG	uc001kxh.2	+							NM_004210	NP_004201			neuralized-like						nervous system development	perinuclear region of cytoplasm	zinc ion binding				0				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	107647917	107647918	+	IGR	INS	-	A	A	rs147587614	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107647917_107647918insA								SORCS3 (622924 upstream) : SORCS1 (685504 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	108125735	108125735	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108125735delA								None (None upstream) : SORCS1 (207687 downstream)																																			---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108749066	108749067	+	Intron	INS	-	G	G	rs149130575	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108749066_108749067insG	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	108969759	108969762	+	IGR	DEL	GAGA	-	-	rs113760145		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108969759_108969762delGAGA								SORCS1 (45467 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	110503332	110503333	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110503332_110503333insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	111375568	111375569	+	IGR	INS	-	T	T	rs60713536		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111375568_111375569insT								None (None upstream) : XPNPEP1 (248955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	113128075	113128076	+	IGR	INS	-	TG	TG	rs61871947		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113128075_113128076insTG								ADRA2A (287415 upstream) : GPAM (781546 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	113726125	113726126	+	IGR	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113726125_113726126delAG								ADRA2A (885465 upstream) : GPAM (183496 downstream)																																			---	---	---	---
VTI1A	143187	broad.mit.edu	37	10	114556162	114556163	+	Intron	INS	-	AA	AA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114556162_114556163insAA	uc001kzz.2	+							NM_145206	NP_660207			SNARE Vti1a-beta protein						intracellular protein transport|retrograde transport, endosome to Golgi	SNARE complex	protein transporter activity|SNAP receptor activity			ovary(1)	1		Colorectal(252;0.0314)|Breast(234;0.183)		Epithelial(162;0.0126)|all cancers(201;0.0487)														---	---	---	---
TCF7L2	6934	broad.mit.edu	37	10	114879430	114879430	+	Intron	DEL	T	-	-	rs72417319		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114879430delT	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron	NM_001146274	NP_001139746			transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)														---	---	---	---
TCF7L2	6934	broad.mit.edu	37	10	114881535	114881536	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114881535_114881536delAC	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron	NM_001146274	NP_001139746			transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)														---	---	---	---
TCF7L2	6934	broad.mit.edu	37	10	114915875	114915875	+	Intron	DEL	T	-	-	rs67257685		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114915875delT	uc001lae.3	+						TCF7L2_uc001lac.3_Intron|TCF7L2_uc010qrk.1_Intron|TCF7L2_uc010qrl.1_Intron|TCF7L2_uc010qrm.1_Intron|TCF7L2_uc010qrn.1_Intron|TCF7L2_uc001lad.3_Intron|TCF7L2_uc001lag.3_Intron|TCF7L2_uc001laf.3_Intron|TCF7L2_uc010qro.1_Intron|TCF7L2_uc001lah.2_Intron|TCF7L2_uc010qrp.1_Intron|TCF7L2_uc010qrq.1_Intron|TCF7L2_uc010qrr.1_Intron|TCF7L2_uc010qrs.1_Intron|TCF7L2_uc010qrt.1_Intron|TCF7L2_uc010qru.1_Intron|TCF7L2_uc010qrv.1_Intron|TCF7L2_uc010qrw.1_Intron|TCF7L2_uc010qrx.1_Intron	NM_001146274	NP_001139746			transcription factor 7-like 2 isoform 1						anti-apoptosis|blood vessel development|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell cycle arrest|cell proliferation|fat cell differentiation|glucose homeostasis|maintenance of DNA repeat elements|myoblast cell fate commitment|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|pancreas development|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of insulin secretion|positive regulation of protein binding|positive regulation of protein export from nucleus|positive regulation of protein kinase B signaling cascade|positive regulation of transcription from RNA polymerase II promoter|regulation of hormone metabolic process|regulation of smooth muscle cell proliferation|response to glucose stimulus	beta-catenin-TCF7L2 complex|PML body|protein-DNA complex	armadillo repeat domain binding|beta-catenin binding|gamma-catenin binding|nuclear hormone receptor binding|protein kinase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			large_intestine(3)|ovary(1)	4		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	115694592	115694593	+	IGR	INS	-	A	A	rs114942651		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115694592_115694593insA								NHLRC2 (26140 upstream) : ADRB1 (109213 downstream)																																			---	---	---	---
C10orf118	55088	broad.mit.edu	37	10	115905802	115905802	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115905802delT	uc001lbb.1	-						C10orf118_uc009xyd.1_5'Flank|C10orf118_uc001lbc.1_Intron|C10orf118_uc009xye.1_Intron	NM_018017	NP_060487			CTCL tumor antigen L14-2											ovary(2)	2		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)														---	---	---	---
VWA2	340706	broad.mit.edu	37	10	116036927	116036928	+	Intron	INS	-	T	T	rs10650526		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116036927_116036928insT	uc001lbl.1	+						VWA2_uc001lbk.1_Intron|VWA2_uc009xyf.1_Intron	NM_198496	NP_940898			von Willebrand factor A domain containing 2							extracellular region				ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5				Epithelial(162;0.036)|all cancers(201;0.0793)														---	---	---	---
ABLIM1	3983	broad.mit.edu	37	10	116477750	116477751	+	Intron	INS	-	AAGG	AAGG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116477750_116477751insAAGG	uc001lbz.1	-											Homo sapiens cDNA FLJ25105 fis, clone CBR01442.						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)														---	---	---	---
GFRA1	2674	broad.mit.edu	37	10	117923834	117923835	+	Intron	INS	-	A	A	rs145339915		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117923834_117923835insA	uc001lcj.2	-						GFRA1_uc001lci.2_Intron|GFRA1_uc009xyr.2_Intron	NM_005264	NP_005255			GDNF family receptor alpha 1 isoform a						axon guidance	anchored to membrane|extrinsic to membrane|plasma membrane	glial cell-derived neurotrophic factor receptor activity			ovary(1)|pancreas(1)	2		Lung NSC(174;0.21)		all cancers(201;0.0337)														---	---	---	---
HSPA12A	259217	broad.mit.edu	37	10	118500184	118500187	+	Intron	DEL	TGTC	-	-	rs72162257		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118500184_118500187delTGTC	uc001lct.2	-						HSPA12A_uc001lcu.2_Intron	NM_025015	NP_079291			heat shock 70kDa protein 12A								ATP binding			ovary(1)	1				all cancers(201;0.0158)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	118642481	118642482	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118642481_118642482delAC								HSPA12A (32765 upstream) : KIAA1598 (1826 downstream)																																			---	---	---	---
VAX1	11023	broad.mit.edu	37	10	118897632	118897632	+	5'UTR	DEL	C	-	-	rs56950787		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118897632delC	uc009xyx.2	-	1					VAX1_uc001ldb.1_5'UTR	NM_001112704	NP_001106175			ventral anterior homeobox 1 isoform a							nucleus	sequence-specific DNA binding			ovary(2)	2				all cancers(201;0.0108)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	120285702	120285703	+	IGR	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120285702_120285703delCT								C10orf84 (183863 upstream) : PRLHR (67213 downstream)																																			---	---	---	---
EIF3A	8661	broad.mit.edu	37	10	120824589	120824592	+	Intron	DEL	TTAA	-	-	rs150354160		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120824589_120824592delTTAA	uc001ldu.2	-						EIF3A_uc010qsu.1_Intron	NM_003750	NP_003741			eukaryotic translation initiation factor 3,						formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)														---	---	---	---
TIAL1	7073	broad.mit.edu	37	10	121347140	121347141	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121347140_121347141insA	uc001lei.1	-						TIAL1_uc001leh.1_Intron|TIAL1_uc001lej.1_Intron|TIAL1_uc001lek.1_Intron|TIAL1_uc009xzi.1_Intron|TIAL1_uc010qtb.1_Intron	NM_003252	NP_003243			TIA-1 related protein isoform 1						apoptosis|defense response|induction of apoptosis|regulation of transcription from RNA polymerase II promoter	lysosome|nucleus|stress granule	nucleotide binding|RNA binding			ovary(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)														---	---	---	---
SEC23IP	11196	broad.mit.edu	37	10	121701221	121701221	+	3'UTR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121701221delA	uc001leu.1	+	19					SEC23IP_uc010qtc.1_3'UTR|SEC23IP_uc009xzk.1_RNA	NM_007190	NP_009121			Sec23-interacting protein p125						Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	121909080	121909081	+	IGR	INS	-	T	T	rs67803337		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121909080_121909081insT								SEC23IP (207835 upstream) : PPAPDC1A (307385 downstream)																																			---	---	---	---
PPAPDC1A	196051	broad.mit.edu	37	10	122258921	122258921	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122258921delT	uc001lev.1	+						PPAPDC1A_uc010qtd.1_Intron|PPAPDC1A_uc009xzl.1_Intron|PPAPDC1A_uc001lew.1_Intron|PPAPDC1A_uc001lex.1_Intron	NM_001030059	NP_001025230			phosphatidic acid phosphatase type 2 domain						phospholipid dephosphorylation	integral to membrane	phosphatidate phosphatase activity			breast(1)	1		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	122542212	122542213	+	Intron	INS	-	GT	GT	rs142605675	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122542212_122542213insGT	uc001lfa.1	-						uc001lfb.1_Intron					Homo sapiens cDNA FLJ37330 fis, clone BRAMY2019509.																														---	---	---	---
Unknown	0	broad.mit.edu	37	10	122951002	122951002	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122951002delA								WDR11 (281967 upstream) : FGFR2 (286843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	123426772	123426783	+	IGR	DEL	ATGGATGGATGG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123426772_123426783delATGGATGGATGG								FGFR2 (68800 upstream) : ATE1 (75843 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	124495393	124495394	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124495393_124495394delTG								C10orf120 (36055 upstream) : FLJ46361 (20816 downstream)																																			---	---	---	---
GPR26	2849	broad.mit.edu	37	10	125450781	125450781	+	3'UTR	DEL	T	-	-	rs149253281		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125450781delT	uc001lhh.2	+	3						NM_153442	NP_703143			G protein-coupled receptor 26						activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)																---	---	---	---
CHST15	51363	broad.mit.edu	37	10	125840856	125840873	+	Intron	DEL	GCATGCACACACATGCAC	-	-	rs72197768		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125840856_125840873delGCATGCACACACATGCAC	uc001lhm.2	-						CHST15_uc001lhn.2_Intron|CHST15_uc010que.1_Intron|CHST15_uc001lho.2_Intron	NM_015892	NP_056976			B cell RAG associated protein						hexose biosynthetic process	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	126072366	126072367	+	IGR	INS	-	T	T	rs78669500		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126072366_126072367insT								CHST15 (219160 upstream) : OAT (13505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	126858361	126858362	+	IGR	DEL	TG	-	-	rs74759752		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126858361_126858362delTG								CTBP2 (8737 upstream) : LOC100169752 (404578 downstream)																																			---	---	---	---
LOC100169752	100169752	broad.mit.edu	37	10	127263688	127263688	+	RNA	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127263688delA	uc001lii.2	+	2		c.274delA				NR_023362				Homo sapiens cDNA clone IMAGE:5295247.												0																		---	---	---	---
DHX32	55760	broad.mit.edu	37	10	127579933	127579934	+	Intron	INS	-	A	A	rs33930520		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127579933_127579934insA	uc001ljg.1	-							NM_018180	NP_060650			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---
ADAM12	8038	broad.mit.edu	37	10	127984479	127984480	+	Intron	INS	-	AC	AC	rs143594939	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127984479_127984480insAC	uc001ljk.2	-						ADAM12_uc010qul.1_Intron|ADAM12_uc001ljm.2_Intron|ADAM12_uc001ljn.2_Intron|ADAM12_uc001ljl.3_Intron	NM_003474	NP_003465			ADAM metallopeptidase domain 12 isoform 1						cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)														---	---	---	---
DOCK1	1793	broad.mit.edu	37	10	129119629	129119630	+	Intron	INS	-	TT	TT	rs142632121	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129119629_129119630insTT	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371			dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	10	129503957	129503958	+	IGR	INS	-	CA	CA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129503957_129503958insCA								NPS (153022 upstream) : FOXI2 (31580 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	130315640	130315641	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130315640_130315641delTG								MKI67 (391172 upstream) : MGMT (949813 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	132345981	132345981	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132345981delT								GLRX3 (363197 upstream) : TCERG1L (544675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133502425	133502426	+	IGR	INS	-	GGATGGAT	GGATGGAT	rs12146413		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133502425_133502426insGGATGGAT								TCERG1L (392441 upstream) : PPP2R2D (245534 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133558753	133558756	+	IGR	DEL	CTCC	-	-	rs145435136		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133558753_133558756delCTCC								TCERG1L (448769 upstream) : PPP2R2D (189204 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133577496	133577519	+	IGR	DEL	GGAGCACAGGAAGAAGGGAGGATA	-	-	rs76136012		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133577496_133577519delGGAGCACAGGAAGAAGGGAGGATA								TCERG1L (467512 upstream) : PPP2R2D (170441 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	133913388	133913389	+	IGR	INS	-	T	T	rs150100407	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133913388_133913389insT								BNIP3 (117953 upstream) : JAKMIP3 (4924 downstream)																																			---	---	---	---
MIR202	574448	broad.mit.edu	37	10	135063600	135063622	+	5'Flank	DEL	CTCCCTGTTTCTCCCCGTTGTTT	-	-	rs11268793	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135063600_135063622delCTCCCTGTTTCTCCCCGTTGTTT	hsa-mir-202|MI0003130	-						uc009ybh.1_5'Flank																	0																		---	---	---	---
SYCE1	93426	broad.mit.edu	37	10	135375766	135375779	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs67784420		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135375766_135375779delTGTGTGTGTGTGTG	uc001lno.2	-						SYCE1_uc001lnm.2_5'Flank|SYCE1_uc009ybn.2_Intron|SYCE1_uc001lnn.2_Intron	NM_001143764	NP_001137236			synaptonemal complex central element protein 1						cell division	central element				ovary(1)	1		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	356536	356537	+	IGR	INS	-	ACAC	ACAC	rs111895489		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:356536_356537insACAC								IFITM3 (35622 upstream) : B4GALNT4 (13258 downstream)																																			---	---	---	---
LRRC56	115399	broad.mit.edu	37	11	546568	546568	+	Intron	DEL	A	-	-	rs34365475		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:546568delA	uc010qvz.1	+							NM_198075	NP_932341			leucine rich repeat containing 56											skin(1)	1		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---
MUC5B	727897	broad.mit.edu	37	11	1280575	1280575	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1280575delC	uc009ycr.1	+						MUC5B_uc001ltb.2_Intron	NM_017511	NP_059981			SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	1515188	1515188	+	IGR	DEL	A	-	-	rs71464142		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1515188delA								MOB2 (7212 upstream) : DUSP8 (60093 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	1935812	1935813	+	IGR	INS	-	TG	TG	rs139129847	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1935812_1935813insTG								LSP1 (22320 upstream) : TNNT3 (4986 downstream)																																			---	---	---	---
CD81	975	broad.mit.edu	37	11	2400471	2400472	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2400471_2400472delAC	uc001lwf.1	+						uc001lwe.2_5'Flank	NM_004356	NP_004347			CD81 antigen						activation of MAPK activity|cell proliferation|phosphatidylinositol biosynthetic process|positive regulation of 1-phosphatidylinositol 4-kinase activity|positive regulation of cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|protein localization|regulation of immune response|virion attachment, binding of host cell surface receptor	integral to plasma membrane	protein binding				0		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)														---	---	---	---
CD81	975	broad.mit.edu	37	11	2400657	2400658	+	Intron	DEL	GA	-	-	rs113548877		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2400657_2400658delGA	uc001lwf.1	+						uc001lwe.2_5'Flank	NM_004356	NP_004347			CD81 antigen						activation of MAPK activity|cell proliferation|phosphatidylinositol biosynthetic process|positive regulation of 1-phosphatidylinositol 4-kinase activity|positive regulation of cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|protein localization|regulation of immune response|virion attachment, binding of host cell surface receptor	integral to plasma membrane	protein binding				0		all_epithelial(84;0.000161)|Breast(177;0.000962)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|all_neural(188;0.0137)|Lung NSC(207;0.209)		BRCA - Breast invasive adenocarcinoma(625;0.000338)|LUSC - Lung squamous cell carcinoma(625;0.191)														---	---	---	---
ZNF195	7748	broad.mit.edu	37	11	3387901	3387902	+	Intron	INS	-	A	A	rs34558476		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3387901_3387902insA	uc001lxt.2	-						ZNF195_uc001lxv.2_Intron|ZNF195_uc001lxs.2_Intron|ZNF195_uc010qxr.1_Intron|ZNF195_uc009ydz.2_Intron|ZNF195_uc001lxu.2_Intron	NM_001130520	NP_001123992			zinc finger protein 195 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)														---	---	---	---
NUP98	4928	broad.mit.edu	37	11	3750542	3750542	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3750542delA	uc001lyh.2	-						NUP98_uc001lyi.2_Intron|NUP98_uc001lyj.1_Intron|NUP98_uc001lyk.1_Intron	NM_016320	NP_057404			nucleoporin 98kD isoform 1						carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)				T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								---	---	---	---
STIM1	6786	broad.mit.edu	37	11	3955451	3955451	+	Intron	DEL	T	-	-	rs112601248		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3955451delT	uc001lyv.2	+						STIM1_uc009yef.2_Intron	NM_003156	NP_003147			stromal interaction molecule 1 precursor						activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	5995339	5995340	+	IGR	INS	-	T	T	rs143607288		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5995339_5995340insT								OR56A5 (5615 upstream) : OR52L1 (11782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	7500828	7500828	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7500828delC	uc001mff.1	-											Homo sapiens cDNA FLJ46728 fis, clone TRACH3019142.																														---	---	---	---
OLFML1	283298	broad.mit.edu	37	11	7527070	7527071	+	Intron	INS	-	A	A	rs66828765		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7527070_7527071insA	uc001mfi.2	+						uc001mff.1_5'Flank|OLFML1_uc010raz.1_Intron|OLFML1_uc010rba.1_Intron	NM_198474	NP_940876			olfactomedin-like 1 precursor							extracellular region				ovary(2)	2				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)														---	---	---	---
PPFIBP2	8495	broad.mit.edu	37	11	7598561	7598562	+	Intron	INS	-	GC	GC	rs147820838	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7598561_7598562insGC	uc001mfj.3	+						PPFIBP2_uc010rbb.1_5'UTR|PPFIBP2_uc001mfk.1_RNA|PPFIBP2_uc010rbc.1_5'UTR|PPFIBP2_uc010rbd.1_Intron	NM_003621	NP_003612			PTPRF interacting protein, binding protein 2						cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)														---	---	---	---
SWAP70	23075	broad.mit.edu	37	11	9688779	9688780	+	Intron	INS	-	TG	TG	rs139870073	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9688779_9688780insTG	uc001mhw.2	+						SWAP70_uc001mhv.2_Intron|SWAP70_uc001mhx.2_Intron	NM_015055	NP_055870			SWAP-70 protein							cytoplasm|lamellipodium|nucleus|plasma membrane	calcium ion binding|DNA binding			ovary(2)|central_nervous_system(1)	3				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)														---	---	---	---
GALNTL4	374378	broad.mit.edu	37	11	11327352	11327352	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11327352delT	uc001mjo.2	-							NM_198516	NP_940918			UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	12080797	12080797	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12080797delG								DKK3 (49481 upstream) : MICAL2 (34746 downstream)																																			---	---	---	---
MICAL2	9645	broad.mit.edu	37	11	12213333	12213334	+	Intron	DEL	AG	-	-	rs147070854		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12213333_12213334delAG	uc001mjz.2	+						MICAL2_uc010rch.1_Intron|MICAL2_uc001mjy.2_Intron|MICAL2_uc001mka.2_Intron|MICAL2_uc010rci.1_Intron|MICAL2_uc001mkb.2_Intron|MICAL2_uc001mkc.2_Intron	NM_014632	NP_055447			microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding			upper_aerodigestive_tract(2)	2				Epithelial(150;0.00552)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	13899773	13899774	+	IGR	INS	-	A	A	rs147605395		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13899773_13899774insA								FAR1 (145882 upstream) : SPON1 (84140 downstream)																																			---	---	---	---
INSC	387755	broad.mit.edu	37	11	15212525	15212525	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15212525delT	uc001mly.2	+						INSC_uc001mlz.2_Intron|INSC_uc001mma.2_Intron|INSC_uc010rcs.1_Intron|INSC_uc001mmb.2_Intron|INSC_uc001mmc.2_Intron	NM_001031853	NP_001027024			inscuteable isoform a						cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	15674151	15674152	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15674151_15674152delAC								INSC (405399 upstream) : SOX6 (313844 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	15872417	15872417	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15872417delT								INSC (603665 upstream) : SOX6 (115579 downstream)																																			---	---	---	---
PLEKHA7	144100	broad.mit.edu	37	11	16839636	16839637	+	Intron	INS	-	CAGT	CAGT	rs75409057		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16839636_16839637insCAGT	uc001mmo.2	-						PLEKHA7_uc010rcu.1_Intron|PLEKHA7_uc010rcv.1_5'Flank|PLEKHA7_uc001mmn.2_Intron	NM_175058	NP_778228			pleckstrin homology domain containing, family A						epithelial cell-cell adhesion|zonula adherens maintenance	centrosome|zonula adherens	delta-catenin binding			skin(2)|central_nervous_system(1)	3																		---	---	---	---
HPS5	11234	broad.mit.edu	37	11	18340803	18340804	+	Intron	DEL	CA	-	-	rs140209412		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18340803_18340804delCA	uc001mod.1	-						HPS5_uc001moe.1_Intron|HPS5_uc001mof.1_Intron|HPS5_uc001mog.1_Intron	NM_181507	NP_852608			Hermansky-Pudlak syndrome 5 isoform a							cytosol				ovary(1)|pancreas(1)|skin(1)	3														Hermansky-Pudlak_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	11	20200322	20200322	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20200322delT								DBX1 (18452 upstream) : HTATIP2 (184909 downstream)																																			---	---	---	---
NELL1	4745	broad.mit.edu	37	11	20742547	20742548	+	Intron	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20742547_20742548insC	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148			nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
NELL1	4745	broad.mit.edu	37	11	21312973	21312973	+	Intron	DEL	T	-	-	rs60752736		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21312973delT	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron|NELL1_uc001mqg.2_Intron|NELL1_uc001mqh.2_Intron	NM_006157	NP_006148			nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
NELL1	4745	broad.mit.edu	37	11	21443640	21443647	+	Intron	DEL	TATGTGTG	-	-	rs144312685	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21443640_21443647delTATGTGTG	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron|NELL1_uc001mqg.2_Intron|NELL1_uc001mqh.2_Intron	NM_006157	NP_006148			nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
NELL1	4745	broad.mit.edu	37	11	21443642	21443645	+	Intron	DEL	TGTG	-	-	rs143659965		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21443642_21443645delTGTG	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron|NELL1_uc001mqg.2_Intron|NELL1_uc001mqh.2_Intron	NM_006157	NP_006148			nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3																		---	---	---	---
GAS2	2620	broad.mit.edu	37	11	22787789	22787789	+	Intron	DEL	T	-	-	rs67536825		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22787789delT	uc009yie.2	+						GAS2_uc001mqm.2_Intron|GAS2_uc001mqn.2_Intron|GAS2_uc001mqo.2_Intron	NM_001143830	NP_001137302			growth arrest-specific 2						cell cycle arrest|cellular component disassembly involved in apoptosis|regulation of cell shape	actin filament|cytosol|membrane				ovary(1)|skin(1)	2																		---	---	---	---
LUZP2	338645	broad.mit.edu	37	11	24927914	24927914	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:24927914delT	uc001mqs.2	+						LUZP2_uc009yif.2_Intron|LUZP2_uc009yig.2_Intron	NM_001009909	NP_001009909			leucine zipper protein 2 precursor							extracellular region				ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	26871911	26871911	+	IGR	DEL	A	-	-	rs33916241		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26871911delA								SLC5A12 (126937 upstream) : FIBIN (143717 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29715749	29715752	+	IGR	DEL	TGTA	-	-	rs60437853		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29715749_29715752delTGTA								None (None upstream) : KCNA4 (316014 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	29943441	29943441	+	IGR	DEL	A	-	-	rs138786605		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:29943441delA								None (None upstream) : KCNA4 (88325 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	30906790	30906790	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30906790delA	uc001mss.1	-						uc009yjk.1_Intron|uc009yjj.1_Intron					Homo sapiens mRNA for KIAA1493 protein, partial cds.																														---	---	---	---
RCN1	5954	broad.mit.edu	37	11	31862526	31862527	+	Intron	INS	-	TTCC	TTCC	rs5790871		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31862526_31862527insTTCC	uc010rea.1	+							NM_002901	NP_002892			reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)																	---	---	---	---
RCN1	5954	broad.mit.edu	37	11	32058154	32058155	+	Intron	INS	-	AC	AC	rs145194084	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32058154_32058155insAC	uc010rea.1	+							NM_002901	NP_002892			reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)																	---	---	---	---
CCDC73	493860	broad.mit.edu	37	11	32712593	32712594	+	Intron	INS	-	T	T	rs145108336		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32712593_32712594insT	uc001mtv.2	-						CCDC73_uc001mtw.1_Intron|CCDC73_uc009yjt.2_Intron	NM_001008391	NP_001008392			sarcoma antigen NY-SAR-79											ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)																	---	---	---	---
CCDC73	493860	broad.mit.edu	37	11	32813538	32813539	+	Intron	DEL	AC	-	-	rs143184205		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32813538_32813539delAC	uc001mtv.2	-						CCDC73_uc001mtw.1_Intron|CCDC73_uc009yjt.2_Intron	NM_001008391	NP_001008392			sarcoma antigen NY-SAR-79											ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)																	---	---	---	---
Unknown	0	broad.mit.edu	37	11	32883121	32883121	+	IGR	DEL	A	-	-	rs71648086		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32883121delA								PRRG4 (7018 upstream) : QSER1 (31671 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	33445577	33445577	+	IGR	DEL	A	-	-	rs79006929		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33445577delA								HIPK3 (69638 upstream) : C11orf41 (118300 downstream)																																			---	---	---	---
C11orf41	25758	broad.mit.edu	37	11	33676670	33676670	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33676670delG	uc001mup.3	+							NM_012194	NP_036326			hypothetical protein LOC25758							integral to membrane				ovary(2)	2																		---	---	---	---
LDLRAD3	143458	broad.mit.edu	37	11	36221151	36221152	+	Intron	DEL	GC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36221151_36221152delGC	uc001mwk.1	+						LDLRAD3_uc010rey.1_Intron|LDLRAD3_uc010rez.1_Intron|LDLRAD3_uc010rfa.1_Intron	NM_174902	NP_777562			low density lipoprotein receptor class A domain							integral to membrane	receptor activity			central_nervous_system(1)	1	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	40020909	40020910	+	IGR	INS	-	AG	AG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40020909_40020910insAG								None (None upstream) : LRRC4C (114843 downstream)																																			---	---	---	---
LRRC4C	57689	broad.mit.edu	37	11	40879567	40879571	+	Intron	DEL	GGAAG	-	-	rs143092598		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40879567_40879571delGGAAG	uc001mxc.1	-						LRRC4C_uc001mxd.1_Intron	NM_020929	NP_065980			netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	44045992	44045993	+	IGR	DEL	TG	-	-	rs9988889	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44045992_44045993delTG								AG2 (80560 upstream) : ACCSL (23538 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	44816904	44816905	+	IGR	INS	-	T	T	rs138987853	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44816904_44816905insT								CD82 (175591 upstream) : TSPAN18 (64974 downstream)																																			---	---	---	---
TSPAN18	90139	broad.mit.edu	37	11	44924951	44924951	+	Intron	DEL	C	-	-	rs5791652		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44924951delC	uc001mye.3	+						TP53I11_uc001myf.1_RNA	NM_130783	NP_570139			tetraspanin 18 isoform 2							integral to membrane					0																		---	---	---	---
TP53I11	9537	broad.mit.edu	37	11	44963526	44963527	+	Intron	INS	-	AC	AC	rs72431383		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44963526_44963527insAC	uc001myi.2	-						TP53I11_uc001myf.1_Intron|TP53I11_uc001myj.2_Intron|TP53I11_uc001myk.2_Intron|TP53I11_uc001myl.2_Intron|TP53I11_uc001mym.2_Intron	NM_006034	NP_006025			p53-induced protein						negative regulation of cell proliferation|response to stress	integral to membrane				ovary(1)	1																		---	---	---	---
C11orf49	79096	broad.mit.edu	37	11	46995331	46995332	+	Intron	INS	-	TGTGTG	TGTGTG	rs140235172	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46995331_46995332insTGTGTG	uc001ndp.2	+						C11orf49_uc001nds.2_Intron|C11orf49_uc001ndq.2_Intron|C11orf49_uc001ndr.2_Intron|C11orf49_uc010rgx.1_Intron|C11orf49_uc010rgy.1_Intron|C11orf49_uc010rgz.1_Intron	NM_024113	NP_077018			hypothetical protein LOC79096 isoform 3												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	49026429	49026430	+	IGR	INS	-	AC	AC	rs139724646	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49026429_49026430insAC								OR4A47 (515157 upstream) : FOLH1 (141758 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	49046040	49046040	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49046040delG								OR4A47 (534768 upstream) : FOLH1 (122148 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50210001	50210002	+	IGR	INS	-	A	A	rs149694634		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50210001_50210002insA								OR4C12 (205964 upstream) : LOC441601 (28998 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50669139	50669139	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50669139delC								LOC646813 (289336 upstream) : OR4A5 (742309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	50751522	50751523	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50751522_50751523insA								LOC646813 (371719 upstream) : OR4A5 (659925 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	54943034	54943035	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:54943034_54943035insA								None (None upstream) : TRIM48 (86623 downstream)																																			---	---	---	---
APLNR	187	broad.mit.edu	37	11	57002218	57002221	+	3'UTR	DEL	ACAC	-	-	rs140473375		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57002218_57002221delACAC	uc001njo.2	-	1					APLNR_uc001njn.3_Intron	NM_005161	NP_005152			apelin receptor							integral to plasma membrane	G-protein coupled receptor activity			lung(5)|ovary(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	57010774	57010775	+	IGR	INS	-	A	A	rs79387222		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57010774_57010775insA								APLNR (5847 upstream) : TNKS1BP1 (56329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	57782186	57782189	+	IGR	DEL	CTAT	-	-	rs71454307		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57782186_57782189delCTAT								CTNND1 (195535 upstream) : OR9Q1 (9164 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	58823086	58823087	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58823086_58823087delAC	uc001nng.1	-											Homo sapiens cDNA FLJ34127 fis, clone FCBBF3010124.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	59066135	59066136	+	IGR	INS	-	GGAAGGAA	GGAAGGAA	rs36130299		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59066135_59066136insGGAAGGAA								MPEG1 (85641 upstream) : OR5AN1 (65796 downstream)																																			---	---	---	---
C11orf64	283197	broad.mit.edu	37	11	60414196	60414196	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60414196delC	uc001npt.2	+						C11orf64_uc001npu.2_Intron	NR_026946				Homo sapiens cDNA FLJ25394 fis, clone TST02552.												0																		---	---	---	---
VWCE	220001	broad.mit.edu	37	11	61046533	61046534	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61046533_61046534insA	uc001nra.2	-						VWCE_uc001nrb.2_Intron	NM_152718	NP_689931			von Willebrand factor C and EGF domains							extracellular region	calcium ion binding			ovary(1)	1																		---	---	---	---
SYT7	9066	broad.mit.edu	37	11	61334815	61334816	+	Intron	INS	-	CC	CC	rs139138714	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61334815_61334816insCC	uc001nrv.2	-						SYT7_uc009ynr.2_Intron	NM_004200	NP_004191			synaptotagmin VII							cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			ovary(3)|pancreas(1)	4																OREG0021006	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	11	61441791	61441794	+	IGR	DEL	TGGA	-	-	rs113185418		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61441791_61441794delTGGA								RPLP0P2 (34870 upstream) : DAGLA (6116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	61938414	61938415	+	IGR	INS	-	TTC	TTC	rs78691375		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61938414_61938415insTTC								INCENP (17779 upstream) : SCGB1D1 (19295 downstream)																																			---	---	---	---
TTC9C	283237	broad.mit.edu	37	11	62504167	62504168	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62504167_62504168insA	uc001nuy.2	+						TTC9C_uc001nux.2_Intron	NM_173810	NP_776171			tetratricopeptide repeat domain 9C								binding			ovary(1)|pancreas(1)	2																		---	---	---	---
SLC22A6	9356	broad.mit.edu	37	11	62745012	62745013	+	Intron	INS	-	T	T	rs77512817		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62745012_62745013insT	uc001nwk.2	-						SLC22A6_uc001nwl.2_Intron|SLC22A6_uc001nwj.2_Intron|SLC22A6_uc001nwm.2_Intron	NM_004790	NP_004781			solute carrier family 22 member 6 isoform a						alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0																		---	---	---	---
SLC22A24	283238	broad.mit.edu	37	11	62854534	62854535	+	Intron	INS	-	GA	GA	rs139630125	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62854534_62854535insGA	uc009yop.2	-							NM_001136506	NP_001129978			solute carrier family 22, member 24												0																		---	---	---	---
MACROD1	28992	broad.mit.edu	37	11	63811287	63811287	+	Intron	DEL	T	-	-	rs72331534		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63811287delT	uc001nyh.2	-							NM_014067	NP_054786			MACRO domain containing 1												0																		---	---	---	---
MACROD1	28992	broad.mit.edu	37	11	63832149	63832150	+	Intron	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63832149_63832150delGA	uc001nyh.2	-							NM_014067	NP_054786			MACRO domain containing 1												0																		---	---	---	---
MACROD1	28992	broad.mit.edu	37	11	63849102	63849103	+	Intron	DEL	TG	-	-	rs35385817		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63849102_63849103delTG	uc001nyh.2	-							NM_014067	NP_054786			MACRO domain containing 1												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	64270669	64270670	+	IGR	INS	-	GATA	GATA	rs139272758	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64270669_64270670insGATA								RPS6KA4 (130983 upstream) : SLC22A11 (52428 downstream)																																			---	---	---	---
NRXN2	9379	broad.mit.edu	37	11	64414680	64414681	+	Intron	DEL	TG	-	-	rs10535079		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64414680_64414681delTG	uc001oar.2	-						NRXN2_uc001oas.2_Intron|NRXN2_uc001oaq.2_Intron	NM_015080	NP_055895			neurexin 2 isoform alpha-1 precursor						cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	64777424	64777425	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64777424_64777425insT								BATF2 (12907 upstream) : ARL2 (4161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	65447199	65447199	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65447199delA								RELA (16756 upstream) : KAT5 (32290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	65475041	65475042	+	IGR	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65475041_65475042delGA								RELA (44598 upstream) : KAT5 (4447 downstream)																																			---	---	---	---
PACS1	55690	broad.mit.edu	37	11	65865752	65865753	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65865752_65865753delTG	uc001oha.1	+						PACS1_uc001ogz.1_Intron	NM_018026	NP_060496			phosphofurin acidic cluster sorting protein 1						interspecies interaction between organisms|regulation of defense response to virus by virus|viral reproduction	cytosol	protein binding			ovary(6)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	66094993	66094994	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66094993_66094994delTG								CD248 (10478 upstream) : RIN1 (4548 downstream)																																			---	---	---	---
NPAS4	266743	broad.mit.edu	37	11	66193601	66193601	+	3'UTR	DEL	G	-	-	rs66808652		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66193601delG	uc001ohx.1	+	8					NPAS4_uc010rpc.1_3'UTR	NM_178864	NP_849195			neuronal PAS domain protein 4						transcription, DNA-dependent		DNA binding|signal transducer activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	67904047	67904047	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67904047delA								CHKA (15189 upstream) : SUV420H1 (19460 downstream)																																			---	---	---	---
SAPS3	55291	broad.mit.edu	37	11	68239382	68239383	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68239382_68239383insT	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633			SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)															---	---	---	---
SAPS3	55291	broad.mit.edu	37	11	68257019	68257020	+	Intron	DEL	TT	-	-	rs60973933		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68257019_68257020delTT	uc001onw.2	+						SAPS3_uc010rqb.1_Intron|SAPS3_uc001onv.2_Intron|SAPS3_uc001ony.3_Intron|SAPS3_uc001onx.2_Intron|SAPS3_uc009ysh.2_Intron|SAPS3_uc001onu.2_Intron|SAPS3_uc010rqc.1_Intron	NM_001164161	NP_001157633			SAPS domain family, member 3 isoform 6						regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)															---	---	---	---
FGF3	2248	broad.mit.edu	37	11	69629876	69629883	+	Intron	DEL	TGGATGGA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69629876_69629883delTGGATGGA	uc001oph.2	-							NM_005247	NP_005238			fibroblast growth factor 3 precursor						fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of cardiac muscle tissue development|positive regulation of cell division|positive regulation of cell proliferation	extracellular region	growth factor activity			ovary(1)|lung(1)	2			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)															---	---	---	---
ANO1	55107	broad.mit.edu	37	11	70027885	70027886	+	Intron	DEL	AA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70027885_70027886delAA	uc001opj.2	+						ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron|ANO1_uc010rql.1_Intron	NM_018043	NP_060513			anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	70103043	70103043	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70103043delA								FADD (49535 upstream) : PPFIA1 (13780 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	71035839	71035840	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71035839_71035840insA								SHANK2 (100031 upstream) : DHCR7 (109619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	71126220	71126221	+	Intron	INS	-	ATGG	ATGG	rs144495225	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71126220_71126221insATGG	uc001oqj.1	-											Homo sapiens cDNA FLJ42102 fis, clone TESOP2006746.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	71470130	71470130	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71470130delT								KRTAP5-11 (176209 upstream) : FAM86C (28427 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	72223324	72223325	+	IGR	DEL	TC	-	-	rs139244323		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72223324_72223325delTC								CLPB (77640 upstream) : PDE2A (63861 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	72226873	72226873	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72226873delA								CLPB (81189 upstream) : PDE2A (60313 downstream)																																			---	---	---	---
ARAP1	116985	broad.mit.edu	37	11	72425530	72425530	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72425530delA	uc001osu.2	-						ARAP1_uc001osv.2_Intron|ARAP1_uc001osr.2_5'Flank|ARAP1_uc001oss.2_Intron|ARAP1_uc009yth.2_Intron|ARAP1_uc010rre.1_Intron	NM_001040118	NP_001035207			ArfGAP with RhoGAP domain, ankyrin repeat and PH						actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding			skin(1)	1																		---	---	---	---
XRRA1	143570	broad.mit.edu	37	11	74558755	74558755	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74558755delT	uc009yub.2	-						XRRA1_uc001ovm.2_Intron|XRRA1_uc001ovn.2_Intron|XRRA1_uc001ovo.2_Intron|XRRA1_uc001ovq.3_Intron|XRRA1_uc001ovp.3_Intron|XRRA1_uc001ovr.2_Intron|XRRA1_uc001ovs.1_Intron	NM_182969	NP_892014			X-ray radiation resistance associated 1						response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1																		---	---	---	---
RPS3	6188	broad.mit.edu	37	11	75107810	75107811	+	5'Flank	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75107810_75107811insA	uc001owh.2	+						RPS3_uc001owg.2_5'Flank|RPS3_uc001owi.2_5'Flank	NM_001005	NP_000996			ribosomal protein S3						activation of caspase activity|endocrine pancreas development|induction of apoptosis|negative regulation of DNA repair|negative regulation of NF-kappaB transcription factor activity|response to DNA damage stimulus|translational elongation|translational initiation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleus|ruffle membrane	damaged DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|endonuclease activity|iron-sulfur cluster binding|mRNA binding|NF-kappaB binding|protein kinase binding|structural constituent of ribosome				0																		---	---	---	---
UVRAG	7405	broad.mit.edu	37	11	75680501	75680501	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75680501delG	uc001oxc.2	+						UVRAG_uc010rrw.1_Intron|UVRAG_uc009yuh.1_Intron	NM_003369	NP_003360			UV radiation resistance associated						DNA repair|positive regulation of autophagy	early endosome|late endosome|lysosome	protein binding			skin(4)|lung(2)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	11	76100513	76100513	+	Intron	DEL	C	-	-	rs3832743		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76100513delC	uc001oxi.1	+											Homo sapiens cDNA FLJ30390 fis, clone BRACE2008308.																														---	---	---	---
TSKU	25987	broad.mit.edu	37	11	76496682	76496682	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76496682delG	uc001oxt.2	+							NM_015516	NP_056331			tsukushin precursor							extracellular region					0	Ovarian(111;0.112)																	---	---	---	---
CLNS1A	1207	broad.mit.edu	37	11	77341833	77341833	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77341833delA	uc001oyk.2	-						CLNS1A_uc001oyl.2_Intron	NM_001293	NP_001284			chloride channel, nucleotide-sensitive, 1A						blood circulation|cell volume homeostasis|chloride transport|ncRNA metabolic process|spliceosomal snRNP assembly	cytoskeleton|cytosol|nucleus|plasma membrane	protein binding			ovary(1)	1	all_cancers(14;5.43e-17)|all_epithelial(13;1.78e-19)		Epithelial(5;1.02e-48)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)															---	---	---	---
RSF1	51773	broad.mit.edu	37	11	77410144	77410144	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77410144delG	uc001oyn.2	-						RSF1_uc001oym.2_Intron	NM_016578	NP_057662			remodeling and spacing factor 1						CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)															---	---	---	---
RSF1	51773	broad.mit.edu	37	11	77456101	77456102	+	Intron	INS	-	T	T	rs143046979	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77456101_77456102insT	uc001oyn.2	-							NM_016578	NP_057662			remodeling and spacing factor 1						CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)															---	---	---	---
INTS4	92105	broad.mit.edu	37	11	77685649	77685649	+	Intron	DEL	T	-	-	rs34323538		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77685649delT	uc001oys.2	-						INTS4_uc001oyt.2_Intron|INTS4_uc001oyu.1_Intron	NM_033547	NP_291025			integrator complex subunit 4						snRNA processing	integrator complex	protein binding			ovary(2)	2	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)															---	---	---	---
GAB2	9846	broad.mit.edu	37	11	78058167	78058167	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78058167delA	uc001ozh.2	-							NM_080491	NP_536739			GRB2-associated binding protein 2 isoform a						osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)															---	---	---	---
GAB2	9846	broad.mit.edu	37	11	78071615	78071615	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78071615delT	uc001ozh.2	-							NM_080491	NP_536739			GRB2-associated binding protein 2 isoform a						osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)															---	---	---	---
NARS2	79731	broad.mit.edu	37	11	78153668	78153669	+	Intron	DEL	TC	-	-	rs141925190		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78153668_78153669delTC	uc001ozi.2	-						NARS2_uc010rsq.1_Intron	NM_024678	NP_078954			asparaginyl-tRNA synthetase 2, mitochondrial						asparaginyl-tRNA aminoacylation	mitochondrial matrix	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding			ovary(2)	2	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	79552474	79552474	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79552474delT								ODZ4 (400779 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	79607534	79607534	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79607534delA								ODZ4 (455839 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	80196484	80196484	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80196484delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	80776334	80776335	+	IGR	INS	-	CACACACACA	CACACACACA	rs142554104	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80776334_80776335insCACACACACA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	80857423	80857424	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:80857423_80857424delTG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	81978840	81978841	+	Intron	INS	-	T	T	rs139115179	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81978840_81978841insT	uc001ozo.1	-											Homo sapiens cDNA clone IMAGE:5298883.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	82412894	82412895	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82412894_82412895delCA								None (None upstream) : FAM181B (30158 downstream)																																			---	---	---	---
DLG2	1740	broad.mit.edu	37	11	83807095	83807095	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83807095delT	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc001pal.1_Intron|DLG2_uc001pam.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
DLG2	1740	broad.mit.edu	37	11	84524218	84524219	+	Intron	INS	-	AC	AC	rs149689676	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84524218_84524219insAC	uc001paj.2	-						DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc001pal.1_Intron	NM_001364	NP_001355			chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
DLG2	1740	broad.mit.edu	37	11	84874259	84874268	+	Intron	DEL	ACACACACAG	-	-	rs145440080	by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84874259_84874268delACACACACAG	uc001pak.2	-							NM_001142699	NP_001136171			chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---
PRSS23	11098	broad.mit.edu	37	11	86582250	86582251	+	Intron	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86582250_86582251delAG	uc001pcc.1	+						uc001pcd.2_Intron					Homo sapiens serine protease mRNA, complete cds.						proteolysis	extracellular region|nucleus	serine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
PRSS23	11098	broad.mit.edu	37	11	86634171	86634171	+	Intron	DEL	T	-	-	rs34997377		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86634171delT	uc001pcc.1	+						uc001pcd.2_Intron					Homo sapiens serine protease mRNA, complete cds.						proteolysis	extracellular region|nucleus	serine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	87092839	87092840	+	IGR	INS	-	CACA	CACA	rs10628967		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87092839_87092840insCACA								TMEM135 (58271 upstream) : RAB38 (753591 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	87407670	87407671	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87407670_87407671insT								TMEM135 (373102 upstream) : RAB38 (438760 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	87541373	87541373	+	IGR	DEL	A	-	-	rs138247639		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87541373delA								TMEM135 (506805 upstream) : RAB38 (305058 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	87671279	87671280	+	IGR	DEL	AG	-	-	rs67529624		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87671279_87671280delAG								TMEM135 (636711 upstream) : RAB38 (175151 downstream)																																			---	---	---	---
NOX4	50507	broad.mit.edu	37	11	89130151	89130152	+	Intron	INS	-	A	A	rs150500933	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89130151_89130152insA	uc001pct.2	-						NOX4_uc009yvr.2_Intron|NOX4_uc001pcu.2_Intron|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Intron|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Intron|NOX4_uc009yvq.2_Intron	NM_016931	NP_058627			NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)																---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92386403	92386404	+	Intron	INS	-	AT	AT	rs143531824	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92386403_92386404insAT	uc001pdj.3	+							NM_001008781	NP_001008781			FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92388373	92388374	+	Intron	INS	-	AATG	AATG	rs138538905	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92388373_92388374insAATG	uc001pdj.3	+							NM_001008781	NP_001008781			FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
C11orf75	56935	broad.mit.edu	37	11	93259466	93259467	+	Intron	INS	-	A	A	rs34555224		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93259466_93259467insA	uc001pds.3	-							NM_020179	NP_064564			hypothetical protein LOC56935							integral to membrane					0		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)																---	---	---	---
HEPHL1	341208	broad.mit.edu	37	11	93839460	93839460	+	Intron	DEL	T	-	-	rs144455207		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93839460delT	uc001pep.2	+						uc001pen.1_Intron	NM_001098672	NP_001092142			hephaestin-like 1 precursor						copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)																---	---	---	---
Unknown	0	broad.mit.edu	37	11	95110003	95110006	+	IGR	DEL	CCTC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95110003_95110006delCCTC								SESN3 (144298 upstream) : FAM76B (392100 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	96128461	96128461	+	IGR	DEL	T	-	-	rs5793804		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96128461delT								JRKL (1734 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	96146316	96146316	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96146316delA								JRKL (19589 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	96219966	96219967	+	IGR	INS	-	A	A	rs149228553	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96219966_96219967insA								JRKL (93239 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	96819337	96819337	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96819337delA								JRKL (692610 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	98078909	98078909	+	IGR	DEL	G	-	-	rs77443119		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:98078909delG								None (None upstream) : CNTN5 (812962 downstream)																																			---	---	---	---
CNTN5	53942	broad.mit.edu	37	11	99665364	99665364	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99665364delT	uc001pga.2	+						CNTN5_uc009ywv.1_Intron|CNTN5_uc001pfz.2_Intron|CNTN5_uc001pgb.2_Intron	NM_014361	NP_055176			contactin 5 isoform long						cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	100494898	100494898	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100494898delC								CNTN5 (267426 upstream) : ARHGAP42 (63509 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	101017002	101017002	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101017002delT	uc010rum.1	+											FJ515873																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	101058811	101058811	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101058811delT	uc010rum.1	+											FJ515873																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	103570475	103570476	+	IGR	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103570475_103570476insC								DYNC2H1 (219884 upstream) : PDGFD (207439 downstream)																																			---	---	---	---
GRIA4	2893	broad.mit.edu	37	11	105765978	105765979	+	Intron	INS	-	GTGT	GTGT	rs141480761	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105765978_105765979insGTGT	uc001pix.2	+						GRIA4_uc001piu.1_Intron|GRIA4_uc001piw.2_Intron|GRIA4_uc009yxk.1_Intron	NM_000829	NP_000820			glutamate receptor, ionotrophic, AMPA 4 isoform						glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)													---	---	---	---
Unknown	0	broad.mit.edu	37	11	106171975	106171978	+	IGR	DEL	ATAT	-	-	rs142686718		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106171975_106171978delATAT								AASDHPPT (202556 upstream) : GUCY1A2 (385932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	107189957	107189958	+	IGR	INS	-	TT	TT	rs34002758		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107189957_107189958insTT								GUCY1A2 (300786 upstream) : CWF19L2 (7116 downstream)																																			---	---	---	---
ELMOD1	55531	broad.mit.edu	37	11	107465666	107465667	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107465666_107465667insA	uc010rvs.1	+						ELMOD1_uc001pjm.2_Intron|ELMOD1_uc010rvt.1_Intron	NM_018712	NP_061182			ELMO/CED-12 domain containing 1 isoform 1						phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	107793525	107793525	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107793525delG								SLC35F2 (63611 upstream) : RAB39 (5752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	107794385	107794387	+	IGR	DEL	TCC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107794385_107794387delTCC								SLC35F2 (64471 upstream) : RAB39 (4890 downstream)																																			---	---	---	---
CUL5	8065	broad.mit.edu	37	11	107932948	107932949	+	Intron	INS	-	T	T	rs144702600	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107932948_107932949insT	uc001pjv.2	+						CUL5_uc001pju.2_Intron	NM_003478	NP_003469			Vasopressin-activated calcium-mobilizing						cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding			ovary(1)	1		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)														---	---	---	---
C11orf65	160140	broad.mit.edu	37	11	108305232	108305232	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108305232delA	uc001pkh.2	-						C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron	NM_152587	NP_689800			hypothetical protein LOC160140											ovary(1)	1		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;8.21e-06)|BRCA - Breast invasive adenocarcinoma(274;1.01e-05)|all cancers(92;0.000189)|Colorectal(284;0.114)|OV - Ovarian serous cystadenocarcinoma(223;0.144)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	109303875	109303876	+	IGR	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109303875_109303876insG								C11orf87 (4037 upstream) : ZC3H12C (660050 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	109377134	109377135	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109377134_109377135insT								C11orf87 (77296 upstream) : ZC3H12C (586791 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	110203143	110203143	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110203143delC	uc001pkv.1	+											Homo sapiens cDNA FLJ36798 fis, clone ADRGL2007283.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	110345114	110345115	+	IGR	INS	-	T	T	rs72316739		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110345114_110345115insT								FDX1 (9510 upstream) : ARHGAP20 (102651 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	110837150	110837150	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110837150delA								ARHGAP20 (253238 upstream) : C11orf53 (289557 downstream)																																			---	---	---	---
TTC12	54970	broad.mit.edu	37	11	113217375	113217375	+	Intron	DEL	A	-	-	rs35593274		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113217375delA	uc001pnu.2	+						TTC12_uc001pnv.2_Intron|TTC12_uc001pnw.2_Intron|TTC12_uc001pnx.2_Intron	NM_017868	NP_060338			tetratricopeptide repeat domain 12								binding			pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	115574201	115574202	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115574201_115574202delTG								CADM1 (198960 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	115885377	115885378	+	IGR	DEL	TT	-	-	rs138412102		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115885377_115885378delTT								CADM1 (510136 upstream) : BUD13 (733510 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	118716379	118716379	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118716379delT								DDX6 (54407 upstream) : CXCR5 (38162 downstream)																																			---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120553301	120553303	+	Intron	DEL	TTT	-	-	rs34209497		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120553301_120553303delTTT	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434			glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
GRIK4	2900	broad.mit.edu	37	11	120582697	120582698	+	Intron	INS	-	C	C	rs140237921	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120582697_120582698insC	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434			glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)													---	---	---	---
TECTA	7007	broad.mit.edu	37	11	121005054	121005055	+	Intron	INS	-	CG	CG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121005054_121005055insCG	uc010rzo.1	+							NM_005422	NP_005413			tectorin alpha precursor						cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	121281098	121281098	+	IGR	DEL	T	-	-	rs34931720		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121281098delT								SC5DL (96981 upstream) : SORL1 (41863 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	121943863	121943863	+	Intron	DEL	A	-	-	rs57411471		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121943863delA	uc001pxz.1	-											Homo sapiens mRNA; cDNA DKFZp313B1821 (from clone DKFZp313B1821).																														---	---	---	---
UBASH3B	84959	broad.mit.edu	37	11	122605643	122605644	+	Intron	INS	-	T	T	rs149364421	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122605643_122605644insT	uc001pyi.3	+							NM_032873	NP_116262			ubiquitin associated and SH3 domain containing,							cytoplasm|nucleus	protein tyrosine phosphatase activity			central_nervous_system(1)	1		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	122923342	122923343	+	IGR	INS	-	AG	AG	rs145795393	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122923342_122923343insAG								LOC341056 (33024 upstream) : HSPA8 (4858 downstream)																																			---	---	---	---
SIAE	54414	broad.mit.edu	37	11	124537300	124537300	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124537300delA	uc001qan.2	-						SIAE_uc001qao.1_Intron	NM_170601	NP_733746			sialate O-acetylesterase precursor							extracellular region|lysosome	carboxylesterase activity|sialate O-acetylesterase activity				0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)														---	---	---	---
ROBO4	54538	broad.mit.edu	37	11	124767367	124767368	+	Intron	DEL	CT	-	-	rs10553259		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124767367_124767368delCT	uc001qbg.2	-						ROBO4_uc010sas.1_Intron|ROBO4_uc001qbh.2_Intron|ROBO4_uc010sat.1_5'Flank	NM_019055	NP_061928			roundabout homolog 4, magic roundabout						angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	124919872	124919872	+	IGR	DEL	G	-	-	rs34369130		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124919872delG								CCDC15 (8489 upstream) : SLC37A2 (13141 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	125008297	125008297	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125008297delT								TMEM218 (26822 upstream) : PKNOX2 (26262 downstream)																																			---	---	---	---
CDON	50937	broad.mit.edu	37	11	125844236	125844243	+	Intron	DEL	GTAGGTAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125844236_125844243delGTAGGTAG	uc009zbw.2	-						CDON_uc001qdb.3_Intron|CDON_uc001qdc.3_Intron	NM_016952	NP_058648			surface glycoprotein, Ig superfamily member						cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|skin(2)|breast(1)	6	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)														---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126327254	126327255	+	Intron	INS	-	TG	TG	rs138530253	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126327254_126327255insTG	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron	NM_032531	NP_115920			kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
KIRREL3	84623	broad.mit.edu	37	11	126746435	126746435	+	Intron	DEL	T	-	-	rs34978323		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126746435delT	uc001qea.2	-						KIRREL3_uc001qeb.2_Intron|KIRREL3_uc001qec.1_Intron|KIRREL3_uc001qed.3_Intron	NM_032531	NP_115920			kin of IRRE like 3 isoform 1						hemopoiesis	extracellular region|integral to membrane|plasma membrane	protein binding			ovary(3)	3	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)														---	---	---	---
ETS1	2113	broad.mit.edu	37	11	128387756	128387756	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128387756delA	uc010sbs.1	-						ETS1_uc001qej.2_Intron|ETS1_uc009zch.2_Intron|ETS1_uc009zcg.2_Intron	NM_005238	NP_005229			v-ets erythroblastosis virus E26 oncogene						cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)														---	---	---	---
ETS1	2113	broad.mit.edu	37	11	128418007	128418008	+	Intron	INS	-	AAGGA	AAGGA	rs139704582	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128418007_128418008insAAGGA	uc001qej.2	-							NM_001143820	NP_001137292			v-ets erythroblastosis virus E26 oncogene						cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)														---	---	---	---
Unknown	0	broad.mit.edu	37	11	128501294	128501296	+	IGR	DEL	TTT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128501294_128501296delTTT								ETS1 (43841 upstream) : FLI1 (55134 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	129094664	129094672	+	IGR	DEL	AAAAAAAAA	-	-	rs71753062		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129094664_129094672delAAAAAAAAA								ARHGAP32 (32571 upstream) : BARX2 (151209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	130266194	130266195	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130266194_130266195insT	uc010scb.1	+						uc010scc.1_Intron					Homo sapiens cDNA FLJ34521 fis, clone HLUNG2007041.																														---	---	---	---
Unknown	0	broad.mit.edu	37	11	130308387	130308388	+	IGR	INS	-	TT	TT	rs72140368		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130308387_130308388insTT								ADAMTS8 (9848 upstream) : ADAMTS15 (10481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	11	131087863	131087863	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131087863delA								SNX19 (301481 upstream) : NTM (152508 downstream)																																	OREG0021526	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	11	131107676	131107677	+	IGR	INS	-	A	A	rs60672290		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131107676_131107677insA								SNX19 (321294 upstream) : NTM (132694 downstream)																																			---	---	---	---
NTM	50863	broad.mit.edu	37	11	131601271	131601272	+	Intron	DEL	TT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131601271_131601272delTT	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530			neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
NTM	50863	broad.mit.edu	37	11	131735906	131735907	+	Intron	INS	-	CACA	CACA	rs148426420	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131735906_131735907insCACA	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530			neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
NTM	50863	broad.mit.edu	37	11	131957629	131957629	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131957629delA	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606			neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
NTM	50863	broad.mit.edu	37	11	132015295	132015296	+	Intron	INS	-	TG	TG	rs140432643	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132015295_132015296insTG	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606			neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
OPCML	4978	broad.mit.edu	37	11	132901515	132901526	+	Intron	DEL	ATGGGTGGATGG	-	-	rs36229221		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132901515_132901526delATGGGTGGATGG	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
OPCML	4978	broad.mit.edu	37	11	133278047	133278047	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133278047delA	uc001qgu.2	-							NM_001012393	NP_001012393			opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)														---	---	---	---
ACAD8	27034	broad.mit.edu	37	11	134125925	134125925	+	Intron	DEL	A	-	-	rs72144431		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134125925delA	uc001qhk.2	+						THYN1_uc001qhf.2_5'Flank|THYN1_uc001qhg.2_5'Flank|THYN1_uc001qhh.2_5'Flank|THYN1_uc001qhi.2_5'Flank|THYN1_uc001qhj.2_5'Flank|THYN1_uc009zdb.2_5'Flank|ACAD8_uc009zdc.2_Intron|ACAD8_uc010sco.1_Intron|ACAD8_uc010scp.1_Intron|ACAD8_uc010scq.1_Intron|ACAD8_uc001qhl.2_Intron|ACAD8_uc010scr.1_5'Flank|ACAD8_uc009zde.1_5'Flank	NM_014384	NP_055199			acyl-Coenzyme A dehydrogenase family, member 8						branched chain family amino acid catabolic process|lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding				0	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)														---	---	---	---
B4GALNT3	283358	broad.mit.edu	37	12	658074	658078	+	Intron	DEL	CAAAA	-	-	rs67058437		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:658074_658078delCAAAA	uc001qii.1	+						B4GALNT3_uc001qij.1_Intron	NM_173593	NP_775864			beta							Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)															---	---	---	---
FBXL14	144699	broad.mit.edu	37	12	1683640	1683640	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1683640delG	uc001qjh.2	-						WNT5B_uc009zdq.2_5'Flank	NM_152441	NP_689654			F-box and leucine-rich repeat protein 14							cytoplasm				ovary(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00115)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	2149031	2149031	+	IGR	DEL	C	-	-	rs143889502		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2149031delC								DCP1B (35354 upstream) : CACNA1C (13385 downstream)																																			---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2323145	2323146	+	Intron	INS	-	A	A	rs55961529	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2323145_2323146insA	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
CACNA1C	775	broad.mit.edu	37	12	2571471	2571472	+	Intron	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2571471_2571472insC	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630			calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)													---	---	---	---
TSPAN9	10867	broad.mit.edu	37	12	3395030	3395030	+	3'UTR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3395030delG	uc001qlp.2	+	9						NM_006675	NP_006666			tetraspanin 9							integral to plasma membrane|membrane fraction				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	4053352	4053353	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4053352_4053353delAC								PARP11 (70744 upstream) : CCND2 (329549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	4186433	4186434	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4186433_4186434delAC								PARP11 (203825 upstream) : CCND2 (196468 downstream)																																			---	---	---	---
ANO2	57101	broad.mit.edu	37	12	5707576	5707577	+	Intron	INS	-	AG	AG	rs148067254	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5707576_5707577insAG	uc001qnm.2	-							NM_020373	NP_065106			anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7																		---	---	---	---
VWF	7450	broad.mit.edu	37	12	6108669	6108670	+	Intron	INS	-	CA	CA	rs144090783	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6108669_6108670insCA	uc001qnn.1	-						VWF_uc010set.1_Intron	NM_000552	NP_000543			von Willebrand factor preproprotein						blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)													---	---	---	---
ING4	51147	broad.mit.edu	37	12	6773008	6773009	+	5'Flank	INS	-	T	T	rs11439426		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6773008_6773009insT	uc001qpw.3	-						ING4_uc001qpv.3_5'Flank|ING4_uc001qpy.3_5'Flank|ING4_uc001qpx.3_5'Flank|ING4_uc009zes.2_5'Flank|ING4_uc009zet.2_5'Flank|ING4_uc009zeu.2_5'Flank|ING4_uc009zev.2_5'Flank	NM_001127582	NP_001121054			inhibitor of growth family, member 4 isoform 9						apoptosis|cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell proliferation|negative regulation of growth|negative regulation of transcription, DNA-dependent|positive regulation of apoptosis	histone acetyltransferase complex	protein binding|transcription coactivator activity|zinc ion binding			central_nervous_system(3)|ovary(1)	4																		---	---	---	---
LOC653113	653113	broad.mit.edu	37	12	8386700	8386701	+	Intron	INS	-	C	C	rs139204651	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8386700_8386701insC	uc010sgk.1	-							NR_024254				Homo sapiens family with sequence similarity 86, member A pseudogene (LOC653113), non-coding RNA.												0																		---	---	---	---
MFAP5	8076	broad.mit.edu	37	12	8805789	8805789	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8805789delA	uc001qut.1	-						MFAP5_uc001qus.2_Intron|MFAP5_uc009zge.1_Intron	NM_003480	NP_003471			microfibrillar associated protein 5 precursor							microfibril	extracellular matrix structural constituent			breast(1)	1	Lung SC(5;0.184)																	---	---	---	---
LOC374443	374443	broad.mit.edu	37	12	9809454	9809455	+	Intron	INS	-	A	A	rs149090231	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9809454_9809455insA	uc001qwd.1	+						LOC374443_uc001qwe.1_Intron|LOC374443_uc009zgr.1_Intron					Homo sapiens cDNA FLJ38955 fis, clone NT2RI2000107.												0																		---	---	---	---
GABARAPL1	23710	broad.mit.edu	37	12	10369082	10369083	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10369082_10369083insT	uc001qxs.2	+						GABARAPL1_uc010shb.1_Intron|GABARAPL1_uc001qxt.2_Intron|GABARAPL1_uc001qxu.2_Intron	NM_031412	NP_113600			GABA(A) receptor-associated protein like 1							autophagic vacuole|endoplasmic reticulum|Golgi apparatus|membrane|microtubule	beta-tubulin binding|GABA receptor binding				0																		---	---	---	---
ETV6	2120	broad.mit.edu	37	12	11962099	11962100	+	Intron	INS	-	A	A	rs35743843		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11962099_11962100insA	uc001qzz.2	+							NM_001987	NP_001978			ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)						T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	12	13570851	13570851	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13570851delA								C12orf36 (41206 upstream) : GRIN2B (143559 downstream)																																			---	---	---	---
ATF7IP	55729	broad.mit.edu	37	12	14626210	14626211	+	Intron	DEL	CT	-	-	rs61922692		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14626210_14626211delCT	uc001rbw.2	+						ATF7IP_uc001rbu.2_Intron|ATF7IP_uc001rbv.1_Intron|ATF7IP_uc001rbx.2_Intron|ATF7IP_uc001rby.3_Intron|ATF7IP_uc001rca.2_Intron	NM_018179	NP_060649			activating transcription factor 7 interacting						DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	15406325	15406326	+	IGR	INS	-	T	T	rs144368051	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15406325_15406326insT								RERG (32021 upstream) : PTPRO (69161 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	15409062	15409063	+	IGR	INS	-	GTGT	GTGT	rs145288057	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15409062_15409063insGTGT								RERG (34758 upstream) : PTPRO (66424 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	17110371	17110371	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17110371delT								LMO3 (347613 upstream) : None (None downstream)																																			---	---	---	---
PLCZ1	89869	broad.mit.edu	37	12	18892443	18892448	+	5'Flank	DEL	GTGTGA	-	-	rs72056716	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18892443_18892448delGTGTGA	uc010sid.1	-							NM_033123	NP_149114			phospholipase C, zeta 1						intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	19697796	19697796	+	IGR	DEL	C	-	-	rs34463301		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19697796delC								AEBP2 (22623 upstream) : PDE3A (824401 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	19783469	19783470	+	IGR	INS	-	A	A	rs66960143		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19783469_19783470insA								AEBP2 (108296 upstream) : PDE3A (738727 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	20512575	20512576	+	IGR	INS	-	CACACA	CACACA	rs143251010	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20512575_20512576insCACACA								AEBP2 (837402 upstream) : PDE3A (9621 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	22980082	22980082	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22980082delT								ETNK1 (136475 upstream) : SOX5 (705150 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	23218396	23218396	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23218396delA	uc001rfu.1	+											Homo sapiens cDNA FLJ37414 fis, clone BRAWH1000157.																														---	---	---	---
Unknown	0	broad.mit.edu	37	12	23683732	23683733	+	IGR	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs140893725	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23683732_23683733insGTGTGTGTGT								ETNK1 (840125 upstream) : SOX5 (1499 downstream)																																			---	---	---	---
SOX5	6660	broad.mit.edu	37	12	24368734	24368735	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24368734_24368735insA	uc001rfx.2	-						SOX5_uc001rfy.2_Intron	NM_152989	NP_694534			SRY (sex determining region Y)-box 5 isoform b						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6																		---	---	---	---
ITPR2	3709	broad.mit.edu	37	12	26894622	26894623	+	Intron	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26894622_26894623delGT	uc001rhg.2	-						ITPR2_uc001rhh.1_Intron|ITPR2_uc001rhi.1_Intron	NM_002223	NP_002214			inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	27963328	27963328	+	IGR	DEL	A	-	-	rs72418340		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27963328delA								KLHDC5 (7356 upstream) : PTHLH (147690 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	28878579	28878579	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28878579delT								CCDC91 (175481 upstream) : FAR2 (423653 downstream)																																			---	---	---	---
FAR2	55711	broad.mit.edu	37	12	29478381	29478381	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29478381delT	uc001ris.3	+						FAR2_uc001rit.2_Intron|FAR2_uc009zjm.2_Intron	NM_018099	NP_060569			fatty acyl CoA reductase 2						ether lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor				0																		---	---	---	---
OVCH1	341350	broad.mit.edu	37	12	29641932	29641933	+	Intron	INS	-	TT	TT	rs147915849	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29641932_29641933insTT	uc001rix.1	-							NM_183378	NP_899234			ovochymase 1 precursor						proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	30083608	30083608	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30083608delA								TMTC1 (145916 upstream) : IPO8 (698315 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	30352818	30352825	+	IGR	DEL	ACACACAC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30352818_30352825delACACACAC								TMTC1 (415126 upstream) : IPO8 (429098 downstream)																																			---	---	---	---
DENND5B	160518	broad.mit.edu	37	12	31545073	31545073	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31545073delA	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron	NM_144973	NP_659410			DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	33452396	33452397	+	IGR	INS	-	AAGG	AAGG	rs143444187	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33452396_33452397insAAGG								PKP2 (402616 upstream) : SYT10 (75951 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	33728884	33728884	+	IGR	DEL	A	-	-	rs76099187		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33728884delA								SYT10 (136130 upstream) : ALG10 (446332 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34376625	34376626	+	IGR	INS	-	A	A	rs141575903		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34376625_34376626insA								ALG10 (195391 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	34480468	34480469	+	IGR	INS	-	T	T	rs116779774	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34480468_34480469insT								ALG10 (299234 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38039250	38039250	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38039250delT								None (None upstream) : ALG10B (671307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38040979	38040980	+	IGR	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38040979_38040980insC								None (None upstream) : ALG10B (669577 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38151315	38151316	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38151315_38151316insT								None (None upstream) : ALG10B (559241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	38555208	38555208	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38555208delG								None (None upstream) : ALG10B (155349 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	39551166	39551167	+	IGR	INS	-	AA	AA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39551166_39551167insAA								CPNE8 (251746 upstream) : KIF21A (135864 downstream)																																			---	---	---	---
PDZRN4	29951	broad.mit.edu	37	12	41951485	41951485	+	Intron	DEL	T	-	-	rs34041922		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41951485delT	uc010skn.1	+						PDZRN4_uc001rmq.3_Intron|PDZRN4_uc009zjz.2_Intron|PDZRN4_uc001rmr.2_Intron	NM_013377	NP_037509			PDZ domain containing RING finger 4 isoform 2								ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)																---	---	---	---
Unknown	0	broad.mit.edu	37	12	42024839	42024840	+	IGR	INS	-	A	A	rs5797746		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42024839_42024840insA								PDZRN4 (56455 upstream) : GXYLT1 (450810 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	42029347	42029348	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42029347_42029348insT								PDZRN4 (60963 upstream) : GXYLT1 (446302 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	43383393	43383394	+	IGR	INS	-	A	A	rs79016613		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43383393_43383394insA								PRICKLE1 (399821 upstream) : ADAMTS20 (364619 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	47373560	47373583	+	IGR	DEL	GGAAGGAAGGAAGGAACAAGGGAG	-	-	rs117195238		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:47373560_47373583delGGAAGGAAGGAAGGAACAAGGGAG								SLC38A4 (153780 upstream) : AMIGO2 (95908 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	48016040	48016041	+	IGR	DEL	TG	-	-	rs35393466		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48016040_48016041delTG								FAM113B (385599 upstream) : RPAP3 (39675 downstream)																																			---	---	---	---
HDAC7	51564	broad.mit.edu	37	12	48198308	48198308	+	Intron	DEL	A	-	-	rs35819372		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48198308delA	uc010slo.1	-						HDAC7_uc001rqj.3_Intron|HDAC7_uc001rqk.3_Intron	NM_015401	NP_056216			histone deacetylase 7 isoform a						negative regulation of interleukin-2 production|negative regulation of osteoblast differentiation|positive regulation of cell migration involved in sprouting angiogenesis|transcription, DNA-dependent	cytoplasm|histone deacetylase complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein kinase C binding|repressing transcription factor binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.137)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	49282775	49282776	+	IGR	INS	-	T	T	rs35174380		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49282775_49282776insT								RND1 (23122 upstream) : CCDC65 (15117 downstream)																																			---	---	---	---
ESPL1	9700	broad.mit.edu	37	12	53681159	53681159	+	Intron	DEL	T	-	-	rs113102716		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53681159delT	uc001sck.2	+						ESPL1_uc001scj.2_Intron|ESPL1_uc010soe.1_Intron	NM_012291	NP_036423			separase						apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	58488993	58488993	+	IGR	DEL	T	-	-	rs11332024		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58488993delT								XRCC6BP1 (137942 upstream) : LRIG3 (776945 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	59821922	59821925	+	IGR	DEL	TTTG	-	-	rs149220029		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59821922_59821925delTTTG								LRIG3 (507660 upstream) : SLC16A7 (167923 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	59830925	59830928	+	IGR	DEL	GAAA	-	-	rs71778797	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59830925_59830928delGAAA								LRIG3 (516663 upstream) : SLC16A7 (158920 downstream)																																			---	---	---	---
FAM19A2	338811	broad.mit.edu	37	12	62398343	62398344	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62398343_62398344insA	uc001sqw.2	-						FAM19A2_uc001sqx.2_Intron|FAM19A2_uc001sqy.2_Intron	NM_178539	NP_848634			family with sequence similarity 19 (chemokine							cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	63539404	63539404	+	IGR	DEL	A	-	-	rs113796564		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63539404delA								PPM1H (210489 upstream) : AVPR1A (812 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	64128010	64128011	+	IGR	INS	-	T	T	rs138412006		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64128010_64128011insT								DPY19L2 (65656 upstream) : TMEM5 (45626 downstream)																																			---	---	---	---
SRGAP1	57522	broad.mit.edu	37	12	64288251	64288252	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64288251_64288252insT	uc010ssp.1	+						SRGAP1_uc001srt.2_Intron	NM_020762	NP_065813			SLIT-ROBO Rho GTPase activating protein 1						axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)														---	---	---	---
TBK1	29110	broad.mit.edu	37	12	64886885	64886885	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64886885delA	uc001ssc.1	+							NM_013254	NP_037386			TANK-binding kinase 1						I-kappaB kinase/NF-kappaB cascade|innate immune response|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription from RNA polymerase II promoter|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|large_intestine(1)|breast(1)	5				GBM - Glioblastoma multiforme(28;0.0386)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	65189484	65189485	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65189484_65189485insT	uc001ssh.1	+											RecName: Full=TBC1 domain family member 30;																														---	---	---	---
GRIP1	23426	broad.mit.edu	37	12	67153639	67153639	+	Intron	DEL	T	-	-	rs143497576		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67153639delT	uc010sta.1	-							NM_021150	NP_066973			glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	67432799	67432800	+	IGR	DEL	AC	-	-	rs138590015		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67432799_67432800delAC								GRIP1 (234905 upstream) : CAND1 (230261 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	67648680	67648681	+	IGR	INS	-	A	A	rs150200242	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67648680_67648681insA								GRIP1 (450786 upstream) : CAND1 (14380 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	68777749	68777749	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68777749delG								MDM1 (51588 upstream) : RAP1B (226903 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	68955339	68955340	+	IGR	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68955339_68955340insC								MDM1 (229178 upstream) : RAP1B (49312 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	69184340	69184340	+	IGR	DEL	A	-	-	rs75413340		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69184340delA								SLC35E3 (24489 upstream) : MDM2 (17631 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	69365090	69365090	+	IGR	DEL	A	-	-	rs74453598		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69365090delA								CPM (8070 upstream) : CPSF6 (268227 downstream)																																			---	---	---	---
YEATS4	8089	broad.mit.edu	37	12	69775857	69775857	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69775857delA	uc001sux.2	+							NM_006530	NP_006521			glioma-amplified sequence-41						histone H2A acetylation|histone H4 acetylation|mitosis|positive regulation of transcription, DNA-dependent|regulation of growth	NuA4 histone acetyltransferase complex|nuclear matrix	DNA binding|protein C-terminus binding|sequence-specific DNA binding transcription factor activity|structural constituent of cytoskeleton				0	all_epithelial(5;9.25e-35)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;6.89e-18)|BRCA - Breast invasive adenocarcinoma(5;3.14e-09)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)															---	---	---	---
Unknown	0	broad.mit.edu	37	12	70435352	70435353	+	IGR	INS	-	AG	AG	rs141666483	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70435352_70435353insAG								RAB3IP (218370 upstream) : CNOT2 (201424 downstream)																																			---	---	---	---
LGR5	8549	broad.mit.edu	37	12	71848557	71848558	+	Intron	DEL	AC	-	-	rs35219754		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71848557_71848558delAC	uc001swl.2	+						LGR5_uc001swm.2_Intron|LGR5_uc001swn.1_Intron	NM_003667	NP_003658			leucine-rich repeat-containing G protein-coupled							integral to plasma membrane	protein-hormone receptor activity			lung(4)|skin(3)|ovary(1)|pancreas(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	72112304	72112304	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72112304delT								TMEM19 (14467 upstream) : RAB21 (36354 downstream)																																			---	---	---	---
TRHDE	29953	broad.mit.edu	37	12	72850473	72850474	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72850473_72850474insA	uc001sxa.2	+							NM_013381	NP_037513			thyrotropin-releasing hormone degrading enzyme						cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
TRHDE	29953	broad.mit.edu	37	12	72915158	72915158	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72915158delA	uc001sxa.2	+							NM_013381	NP_037513			thyrotropin-releasing hormone degrading enzyme						cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	73690988	73690989	+	IGR	INS	-	ACAC	ACAC	rs148589635	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73690988_73690989insACAC								TRHDE (631567 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	74259324	74259324	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74259324delA								None (None upstream) : ATXN7L3B (672227 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	77667015	77667015	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77667015delA								E2F7 (207655 upstream) : NAV3 (558054 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	80775784	80775784	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80775784delA								PPP1R12A (446549 upstream) : PTPRQ (62342 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	83764279	83764279	+	IGR	DEL	A	-	-	rs75851471		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:83764279delA								TMTC2 (236216 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	84577896	84577897	+	IGR	INS	-	C	C	rs140114066	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:84577896_84577897insC								None (None upstream) : SLC6A15 (675372 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	87764653	87764653	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:87764653delA								MGAT4C (531972 upstream) : C12orf50 (609163 downstream)																																			---	---	---	---
KITLG	4254	broad.mit.edu	37	12	88964314	88964315	+	Intron	INS	-	A	A	rs143162307	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88964314_88964315insA	uc001tav.2	-						KITLG_uc001taw.2_Intron	NM_000899	NP_000890			KIT ligand isoform b precursor						cell adhesion|cell proliferation|hemopoiesis|male gonad development|positive regulation of DNA replication|signal transduction	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	growth factor activity|identical protein binding|stem cell factor receptor binding			ovary(1)	1														Testicular_Cancer_Familial_Clustering_of				---	---	---	---
EEA1	8411	broad.mit.edu	37	12	93277044	93277044	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93277044delC	uc001tck.2	-							NM_003566	NP_003557			early endosome antigen 1, 162kD						early endosome to late endosome transport|synaptic vesicle to endosome fusion|vesicle fusion	cytosol|early endosome membrane|extrinsic to plasma membrane|membrane fraction	1-phosphatidylinositol binding|calmodulin binding|GTP-dependent protein binding|protein homodimerization activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	93687148	93687149	+	IGR	INS	-	GTTC	GTTC	rs140261198	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93687148_93687149insGTTC								EEA1 (364041 upstream) : NUDT4 (84552 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	94372330	94372334	+	IGR	DEL	AAGAG	-	-	rs10587754		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94372330_94372334delAAGAG								CRADD (83714 upstream) : PLXNC1 (170165 downstream)																																			---	---	---	---
FGD6	55785	broad.mit.edu	37	12	95489790	95489791	+	Intron	INS	-	A	A	rs35814265		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95489790_95489791insA	uc001tdp.3	-						FGD6_uc009zsx.2_Intron|FGD6_uc001tdq.1_Intron	NM_018351	NP_060821			FYVE, RhoGEF and PH domain containing 6						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3																		---	---	---	---
USP44	84101	broad.mit.edu	37	12	95925943	95925944	+	Intron	INS	-	T	T	rs148015527		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95925943_95925944insT	uc001teg.2	-						USP44_uc001teh.2_Intron|USP44_uc009zte.2_Intron	NM_001042403	NP_001035862			ubiquitin thiolesterase 44						anaphase|cell division|mitosis|negative regulation of mitotic anaphase-promoting complex activity|protein deubiquitination|regulation of spindle checkpoint|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	96192656	96192658	+	IGR	DEL	AGG	-	-	rs35498484		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96192656_96192658delAGG								NTN4 (7726 upstream) : SNRPF (60051 downstream)																																			---	---	---	---
AMDHD1	144193	broad.mit.edu	37	12	96339834	96339835	+	Intron	DEL	TC	-	-	rs77667379		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96339834_96339835delTC	uc001tel.1	+						AMDHD1_uc009zth.1_Intron	NM_152435	NP_689648			amidohydrolase domain containing 1						histidine catabolic process to glutamate and formamide	cytosol	imidazolonepropionase activity|metal ion binding			central_nervous_system(1)	1																		---	---	---	---
C12orf63	374467	broad.mit.edu	37	12	97075353	97075353	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97075353delT	uc001tet.1	+							NM_198520	NP_940922			hypothetical protein LOC374467											skin(6)|ovary(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	97996218	97996218	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97996218delT								RMST (37425 upstream) : LOC100128191 (910535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	98700807	98700808	+	IGR	INS	-	GTGTGC	GTGTGC	rs143672297	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98700807_98700808insGTGTGC								RMST (742014 upstream) : LOC100128191 (205945 downstream)																																			---	---	---	---
APAF1	317	broad.mit.edu	37	12	99083214	99083221	+	Intron	DEL	GAGAGAGA	-	-	rs10562439		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99083214_99083221delGAGAGAGA	uc001tfz.2	+						APAF1_uc001tfy.2_Intron|APAF1_uc001tga.2_Intron|APAF1_uc001tgb.2_Intron|APAF1_uc001tgc.2_Intron|APAF1_uc009zto.2_Intron	NM_181861	NP_863651			apoptotic peptidase activating factor 1 isoform						activation of caspase activity by cytochrome c|defense response|induction of apoptosis by intracellular signals|nervous system development	cytosol|Golgi apparatus|nucleus	ATP binding|caspase activator activity|protein binding			ovary(2)|lung(1)	3					Adenosine triphosphate(DB00171)													---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	100057686	100057686	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100057686delT	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
ANKS1B	56899	broad.mit.edu	37	12	100192212	100192213	+	Intron	INS	-	AC	AC	rs141076175		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100192212_100192213insAC	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_152788	NP_690001			cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	102365666	102365667	+	IGR	INS	-	A	A	rs34165749		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102365666_102365667insA								DRAM1 (48267 upstream) : CCDC53 (41051 downstream)																																			---	---	---	---
CCDC53	51019	broad.mit.edu	37	12	102406983	102406983	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102406983delA	uc010svw.1	-						CCDC53_uc010svx.1_Intron|CCDC53_uc010svy.1_Intron|CCDC53_uc010svz.1_Intron	NM_016053	NP_057137			coiled-coil domain containing 53							WASH complex	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	102772189	102772190	+	IGR	DEL	TG	-	-	rs35610055		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102772189_102772190delTG								PMCH (180575 upstream) : IGF1 (17455 downstream)																																			---	---	---	---
STAB2	55576	broad.mit.edu	37	12	104114912	104114913	+	Intron	INS	-	CAC	CAC	rs146216363	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104114912_104114913insCAC	uc001tjw.2	+						STAB2_uc009zug.2_Intron	NM_017564	NP_060034			stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	104582373	104582374	+	IGR	INS	-	A	A	rs112309276		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104582373_104582374insA								NFYB (50333 upstream) : TXNRD1 (24114 downstream)																																			---	---	---	---
CHST11	50515	broad.mit.edu	37	12	104998815	104998816	+	Intron	DEL	AG	-	-	rs10604627		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104998815_104998816delAG	uc001tkx.1	+						CHST11_uc001tky.2_Intron	NM_018413	NP_060883			carbohydrate sulfotransferase 11						chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0																		---	---	---	---
C12orf75	387882	broad.mit.edu	37	12	105748484	105748484	+	Intron	DEL	T	-	-	rs66504975		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105748484delT	uc001tlh.3	+						C12orf75_uc001tli.3_Intron	NM_001145199	NP_001138671			hypothetical protein LOC387882												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	105824765	105824765	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105824765delA								C12orf75 (59470 upstream) : NUAK1 (632360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	106256807	106256807	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106256807delA								C12orf75 (491512 upstream) : NUAK1 (200318 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	106613538	106613538	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106613538delA								NUAK1 (79727 upstream) : CKAP4 (18122 downstream)																																			---	---	---	---
CRY1	1407	broad.mit.edu	37	12	107409123	107409123	+	Intron	DEL	T	-	-	rs3835384		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107409123delT	uc001tmi.3	-							NM_004075	NP_004066			cryptochrome 1 (photolyase-like)						DNA repair|protein-chromophore linkage|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	blue light photoreceptor activity|DNA photolyase activity|double-stranded DNA binding|nucleotide binding|protein binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	107563372	107563377	+	IGR	DEL	ACACAG	-	-	rs10550841	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107563372_107563377delACACAG								CRY1 (75774 upstream) : BTBD11 (148820 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	109297721	109297721	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109297721delG								DAO (3012 upstream) : SVOP (6937 downstream)																																			---	---	---	---
ACACB	32	broad.mit.edu	37	12	109644233	109644234	+	Intron	INS	-	A	A	rs35315851		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109644233_109644234insA	uc001tob.2	+						ACACB_uc001toc.2_Intron	NM_001093	NP_001084			acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)													---	---	---	---
ACACB	32	broad.mit.edu	37	12	109692586	109692587	+	Intron	INS	-	T	T	rs111235224		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109692586_109692587insT	uc001tob.2	+						ACACB_uc001toc.2_Intron|ACACB_uc010sxl.1_Intron|ACACB_uc001tod.2_Intron|ACACB_uc010sxm.1_Intron	NM_001093	NP_001084			acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)													---	---	---	---
MYO1H	283446	broad.mit.edu	37	12	109849552	109849553	+	Intron	INS	-	CT	CT	rs146618593	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109849552_109849553insCT	uc010sxn.1	+							NM_001101421	NP_001094891			myosin 1H							myosin complex	motor activity				0																		---	---	---	---
MYO1H	283446	broad.mit.edu	37	12	109881161	109881166	+	Intron	DEL	ACACAC	-	-	rs10545297		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109881161_109881166delACACAC	uc010sxo.1	+						MYO1H_uc010sxn.1_Intron					SubName: Full=cDNA FLJ54829, moderately similar to Myosin Ic; SubName: Full=Myosin IH, isoform CRA_a;							myosin complex	motor activity				0																		---	---	---	---
C12orf51	283450	broad.mit.edu	37	12	112655104	112655105	+	Intron	INS	-	AC	AC	rs138913540	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112655104_112655105insAC	uc009zwc.2	-						C12orf51_uc001ttr.1_Intron	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2																		---	---	---	---
C12orf51	283450	broad.mit.edu	37	12	112724319	112724320	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112724319_112724320delAC	uc009zwc.2	-							NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2																		---	---	---	---
RPH3A	22895	broad.mit.edu	37	12	113128164	113128164	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113128164delT	uc010syl.1	+							NM_001143854	NP_001137326			rabphilin 3A homolog isoform 1						intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	113776041	113776041	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113776041delC								SLC24A6 (3116 upstream) : PLBD2 (20330 downstream)																																			---	---	---	---
RBM19	9904	broad.mit.edu	37	12	114301017	114301018	+	Intron	DEL	TG	-	-	rs72504497		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114301017_114301018delTG	uc009zwi.2	-						RBM19_uc001tvn.3_Intron|RBM19_uc001tvm.2_Intron	NM_001146699	NP_001140171			RNA binding motif protein 19						multicellular organismal development|positive regulation of embryonic development	chromosome|cytoplasm|nucleolus|nucleoplasm	nucleotide binding|RNA binding			skin(3)|ovary(1)|liver(1)|central_nervous_system(1)	6	Medulloblastoma(191;0.163)|all_neural(191;0.178)																	---	---	---	---
Unknown	0	broad.mit.edu	37	12	115078357	115078360	+	IGR	DEL	CCTT	-	-	rs7139366		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115078357_115078360delCCTT								TBX5 (232110 upstream) : TBX3 (29699 downstream)																																			---	---	---	---
NOS1	4842	broad.mit.edu	37	12	117760696	117760697	+	Intron	INS	-	CCTC	CCTC	rs147707829	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117760696_117760697insCCTC	uc001twm.1	-							NM_000620	NP_000611			nitric oxide synthase 1, neuronal						multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)													---	---	---	---
KSR2	283455	broad.mit.edu	37	12	117965094	117965107	+	Intron	DEL	ACACACACACACAG	-	-	rs59836858		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117965094_117965107delACACACACACACAG	uc001two.2	-							NM_173598	NP_775869			kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
KSR2	283455	broad.mit.edu	37	12	118399378	118399378	+	Intron	DEL	G	-	-	rs149314751		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118399378delG	uc001two.2	-							NM_173598	NP_775869			kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---
VSIG10	54621	broad.mit.edu	37	12	118519822	118519823	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118519822_118519823insA	uc001tws.2	-							NM_019086	NP_061959			V-set and immunoglobulin domain containing 10							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	121391471	121391471	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121391471delT								SPPL3 (49320 upstream) : C12orf27 (16170 downstream)																																			---	---	---	---
OASL	8638	broad.mit.edu	37	12	121462419	121462419	+	Intron	DEL	A	-	-	rs77318180		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121462419delA	uc001tzj.1	-						OASL_uc001tzk.1_Intron	NM_003733	NP_003724			2'-5'-oligoadenylate synthetase-like isoform a						interferon-gamma-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoplasm|nucleolus	ATP binding|DNA binding|double-stranded RNA binding|thyroid hormone receptor binding|transferase activity			skin(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---
KDM2B	84678	broad.mit.edu	37	12	121945376	121945376	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121945376delA	uc001uat.2	-						KDM2B_uc001uar.2_Intron|KDM2B_uc001uas.2_Intron|KDM2B_uc001uau.2_Intron|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979			F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	123402955	123402955	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123402955delT								VPS37B (22243 upstream) : ABCB9 (10585 downstream)																																			---	---	---	---
MPHOSPH9	10198	broad.mit.edu	37	12	123690093	123690093	+	Intron	DEL	A	-	-	rs77931504		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123690093delA	uc001uel.2	-						MPHOSPH9_uc010tal.1_Intron|MPHOSPH9_uc010tam.1_Intron|MPHOSPH9_uc001uem.2_Intron	NM_022782	NP_073619			M-phase phosphoprotein 9						M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)														---	---	---	---
RILPL2	196383	broad.mit.edu	37	12	123900706	123900707	+	Intron	INS	-	A	A	rs144225262		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123900706_123900707insA	uc001uey.1	-							NM_145058	NP_659495			Rab interacting lysosomal protein-like 2							cytosol|plasma membrane	identical protein binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000546)|Epithelial(86;0.00179)|all cancers(50;0.0168)														---	---	---	---
ATP6V0A2	23545	broad.mit.edu	37	12	124205737	124205738	+	Intron	INS	-	TGTTT	TGTTT	rs142454152	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124205737_124205738insTGTTT	uc001ufr.2	+						ATP6V0A2_uc001ufq.1_Intron	NM_012463	NP_036595			ATPase, H+ transporting, lysosomal V0 subunit						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)														---	---	---	---
NCOR2	9612	broad.mit.edu	37	12	125044244	125044244	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125044244delA	uc001ugj.1	-							NM_006312	NP_006303			nuclear receptor co-repressor 2 isoform 1						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	125414965	125414966	+	IGR	INS	-	T	T	rs140943746	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125414965_125414966insT								UBC (15388 upstream) : DHX37 (16407 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	125781688	125781688	+	IGR	DEL	G	-	-	rs147846248		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125781688delG								AACS (153816 upstream) : TMEM132B (29474 downstream)																																			---	---	---	---
TMEM132B	114795	broad.mit.edu	37	12	125938937	125938938	+	Intron	DEL	TT	-	-	rs36015767		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125938937_125938938delTT	uc001uhe.1	+							NM_052907	NP_443139			transmembrane protein 132B							integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	126407383	126407384	+	IGR	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126407383_126407384delGA								TMEM132B (263794 upstream) : LOC100128554 (519643 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	127562509	127562510	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127562509_127562510delTC								LOC100128554 (605179 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	127641136	127641137	+	IGR	INS	-	CCTCCCAG	CCTCCCAG	rs142713085	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:127641136_127641137insCCTCCCAG								LOC100128554 (683806 upstream) : None (None downstream)																																			---	---	---	---
TMEM132C	92293	broad.mit.edu	37	12	129105463	129105463	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129105463delT	uc001uhs.3	+							NM_001136103	NP_001129575			transmembrane protein 132C							integral to membrane				central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	129220827	129220828	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129220827_129220828insA								TMEM132C (28364 upstream) : SLC15A4 (56911 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	129537807	129537807	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129537807delC								GLT1D1 (68298 upstream) : TMEM132D (18464 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	130427098	130427099	+	IGR	INS	-	T	T	rs11402049		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130427098_130427099insT								TMEM132D (38886 upstream) : LOC100190940 (90900 downstream)																																			---	---	---	---
RIMBP2	23504	broad.mit.edu	37	12	130923990	130923997	+	Intron	DEL	GTGTGGGT	-	-	rs71966085		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130923990_130923997delGTGTGGGT	uc001uil.2	-						RIMBP2_uc001uim.2_Intron|RIMBP2_uc001uin.1_Intron	NM_015347	NP_056162			RIM-binding protein 2							cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)														---	---	---	---
Unknown	0	broad.mit.edu	37	12	133040183	133040188	+	IGR	DEL	CATCAC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133040183_133040188delCATCAC								GALNT9 (134278 upstream) : FBRSL1 (26969 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	133047380	133047381	+	IGR	DEL	GA	-	-	rs140809522	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133047380_133047381delGA								GALNT9 (141475 upstream) : FBRSL1 (19776 downstream)																																			---	---	---	---
GOLGA3	2802	broad.mit.edu	37	12	133361299	133361300	+	Intron	DEL	CA	-	-	rs138918325		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133361299_133361300delCA	uc001ukz.1	-						GOLGA3_uc001ula.1_Intron|GOLGA3_uc001ulb.2_Intron	NM_005895	NP_005886			Golgi autoantigen, golgin subfamily a, 3						intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)														---	---	---	---
DKFZp686A1627	266695	broad.mit.edu	37	13	19644084	19644085	+	Intron	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19644084_19644085insG	uc001umb.1	-							NR_002801				Homo sapiens mRNA; cDNA DKFZp686A1627 (from clone DKFZp686A1627).												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	20444690	20444691	+	IGR	INS	-	CTTC	CTTC	rs145125818	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20444690_20444691insCTTC								ZMYM5 (6914 upstream) : ZMYM2 (88119 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	21122508	21122509	+	IGR	INS	-	AGG	AGG	rs142996577	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21122508_21122509insAGG								CRYL1 (22496 upstream) : IFT88 (18699 downstream)																																			---	---	---	---
ZDHHC20	253832	broad.mit.edu	37	13	21951666	21951667	+	Intron	DEL	CT	-	-	rs67195871		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21951666_21951667delCT	uc001uob.2	-						ZDHHC20_uc001uod.2_Intron|ZDHHC20_uc001uoc.2_Intron|ZDHHC20_uc001uoe.2_Intron|ZDHHC20_uc010tcs.1_Intron	NM_153251	NP_694983			zinc finger, DHHC-type containing 20							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)														---	---	---	---
EFHA1	221154	broad.mit.edu	37	13	22153482	22153483	+	Intron	INS	-	T	T	rs11372645		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22153482_22153483insT	uc001uof.2	-							NM_152726	NP_689939			EF-hand domain family, member A1								calcium ion binding				0		all_cancers(29;1.24e-15)|all_epithelial(30;5.4e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000171)|Epithelial(112;0.000398)|OV - Ovarian serous cystadenocarcinoma(117;0.00641)|Lung(94;0.189)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	22858998	22858999	+	IGR	INS	-	CTTCCCTAATCACT	CTTCCCTAATCACT	rs148473468	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22858998_22858999insCTTCCCTAATCACT								FGF9 (580358 upstream) : SGCG (896061 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	23478171	23478171	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23478171delA								None (None upstream) : SGCG (276889 downstream)																																			---	---	---	---
C1QTNF9B	387911	broad.mit.edu	37	13	24469895	24469896	+	Intron	INS	-	AC	AC	rs149183155	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24469895_24469896insAC	uc010tcw.1	-						C1QTNF9B_uc010tcv.1_Intron|C1QTNF9B_uc001uoz.1_Intron|C1QTNF9B_uc010tcx.1_Intron	NM_001007537	NP_001007538			C1q and tumor necrosis factor related protein 9B							collagen					0																		---	---	---	---
PARP4	143	broad.mit.edu	37	13	25089095	25089096	+	5'Flank	INS	-	A	A	rs74860274		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25089095_25089096insA	uc001upl.2	-						PARP4_uc010tdc.1_5'Flank	NM_006437	NP_006428			poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	26982903	26982904	+	IGR	INS	-	AC	AC	rs56288761		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26982903_26982904insAC								CDK8 (4334 upstream) : WASF3 (148936 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	27578450	27578451	+	IGR	INS	-	CA	CA	rs142716604	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27578450_27578451insCA								GPR12 (243528 upstream) : USP12 (63987 downstream)																																			---	---	---	---
USP12	219333	broad.mit.edu	37	13	27658718	27658719	+	Intron	INS	-	GG	GG	rs149624642	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27658718_27658719insGG	uc001uqy.2	-							NM_182488	NP_872294			ubiquitin thiolesterase 12						protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)	1		Lung SC(185;0.0161)		all cancers(112;0.0508)|GBM - Glioblastoma multiforme(144;0.168)|Epithelial(112;0.244)|OV - Ovarian serous cystadenocarcinoma(117;0.246)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	27913894	27913894	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27913894delA								RASL11A (66067 upstream) : GTF3A (84787 downstream)																																			---	---	---	---
LNX2	222484	broad.mit.edu	37	13	28147581	28147581	+	Intron	DEL	A	-	-	rs112337536		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28147581delA	uc001url.3	-						LNX2_uc001urm.1_Intron	NM_153371	NP_699202			ligand of numb-protein X 2								zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	6		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)														---	---	---	---
FLT1	2321	broad.mit.edu	37	13	28916612	28916612	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28916612delT	uc001usb.3	-						FLT1_uc001usa.3_Intron	NM_002019	NP_002010			fms-related tyrosine kinase 1 isoform 1						cell differentiation|female pregnancy|positive regulation of vascular endothelial growth factor receptor signaling pathway	extracellular space|Golgi apparatus|integral to plasma membrane|nucleus	ATP binding|growth factor binding|vascular endothelial growth factor receptor activity			lung(10)|central_nervous_system(5)|ovary(3)|stomach(2)|skin(2)|urinary_tract(1)|breast(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Sunitinib(DB01268)													---	---	---	---
Unknown	0	broad.mit.edu	37	13	29549601	29549621	+	IGR	DEL	CCTGCGGCAGCATCGCCCTCC	-	-	rs67844229		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29549601_29549621delCCTGCGGCAGCATCGCCCTCC								SLC46A3 (256451 upstream) : MTUS2 (49127 downstream)																																			---	---	---	---
MTUS2	23281	broad.mit.edu	37	13	29602492	29602493	+	Intron	INS	-	A	A	rs145813904	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29602492_29602493insA	uc001usl.3	+							NM_001033602	NP_001028774			hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0																		---	---	---	---
MTUS2	23281	broad.mit.edu	37	13	29755361	29755361	+	Intron	DEL	A	-	-	rs67287656		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29755361delA	uc001usl.3	+							NM_001033602	NP_001028774			hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0																		---	---	---	---
UBL3	5412	broad.mit.edu	37	13	30368488	30368489	+	Intron	INS	-	AC	AC	rs144278443	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30368488_30368489insAC	uc001usp.2	-							NM_007106	NP_009037			ubiquitin-like 3 precursor							intracellular|plasma membrane					0		Lung SC(185;0.0281)		all cancers(112;0.0598)|GBM - Glioblastoma multiforme(144;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.147)														---	---	---	---
UBL3	5412	broad.mit.edu	37	13	30409545	30409546	+	Intron	INS	-	CT	CT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30409545_30409546insCT	uc001usp.2	-							NM_007106	NP_009037			ubiquitin-like 3 precursor							intracellular|plasma membrane					0		Lung SC(185;0.0281)		all cancers(112;0.0598)|GBM - Glioblastoma multiforme(144;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.147)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	30574561	30574562	+	IGR	INS	-	TTC	TTC	rs142293890	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:30574561_30574562insTTC								UBL3 (149741 upstream) : KATNAL1 (202206 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	31416436	31416437	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31416436_31416437delGT								ALOX5AP (77880 upstream) : C13orf33 (63875 downstream)																																			---	---	---	---
B3GALTL	145173	broad.mit.edu	37	13	31891440	31891441	+	Intron	INS	-	G	G	rs150159151	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31891440_31891441insG	uc010aaz.2	+						B3GALTL_uc001utn.3_Intron	NM_194318	NP_919299			beta 1,3-galactosyltransferase-like						fucose metabolic process	endoplasmic reticulum membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	32007031	32007031	+	IGR	DEL	A	-	-	rs71724388		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32007031delA								B3GALTL (100622 upstream) : RXFP2 (306648 downstream)																																			---	---	---	---
PDS5B	23047	broad.mit.edu	37	13	33315189	33315190	+	Intron	INS	-	T	T	rs2320470		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33315189_33315190insT	uc010abf.2	+						PDS5B_uc010abg.2_Intron	NM_015032	NP_055847			PDS5, regulator of cohesion maintenance, homolog						cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	33533918	33533919	+	IGR	DEL	GT	-	-	rs10544865		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33533918_33533919delGT								PDS5B (181763 upstream) : KL (56282 downstream)																																			---	---	---	---
KL	9365	broad.mit.edu	37	13	33593870	33593871	+	Intron	INS	-	GAGA	GAGA	rs139721497	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33593870_33593871insGAGA	uc001uus.2	+						KL_uc001uur.1_Intron	NM_004795	NP_004786			klotho precursor						aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)														---	---	---	---
STARD13	90627	broad.mit.edu	37	13	33785943	33785946	+	Intron	DEL	TGTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33785943_33785946delTGTG	uc001uuw.2	-						STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron|STARD13_uc010abh.1_Intron	NM_178006	NP_821074			StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	36290235	36290236	+	IGR	INS	-	T	T	rs144846453		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36290235_36290236insT								NBEA (43363 upstream) : DCLK1 (52887 downstream)																																			---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36514428	36514429	+	Intron	INS	-	A	A	rs35613029		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36514428_36514429insA	uc001uvf.2	-							NM_004734	NP_004725			doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
FAM48A	55578	broad.mit.edu	37	13	37596556	37596557	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37596556_37596557insT	uc001uwg.2	-						FAM48A_uc010abt.2_Intron|FAM48A_uc001uwh.2_Intron|FAM48A_uc001uwi.2_Intron|FAM48A_uc001uwj.2_Intron|FAM48A_uc001uwk.2_Intron|FAM48A_uc001uwd.2_5'UTR|FAM48A_uc001uwe.2_Intron|FAM48A_uc001uwf.2_Intron	NM_001014286	NP_001014308			family with sequence similarity 48, member A						autophagy|gastrulation	SAGA-type complex	protein binding				0		Lung NSC(96;2.09e-06)|Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.0959)		all cancers(112;6.06e-07)|Epithelial(112;1.87e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00794)|BRCA - Breast invasive adenocarcinoma(63;0.0128)|GBM - Glioblastoma multiforme(144;0.0477)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	37950183	37950183	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:37950183delT								CSNK1A1L (270382 upstream) : POSTN (186537 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	38541501	38541502	+	IGR	INS	-	C	C	rs2786635		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38541501_38541502insC								TRPC4 (97562 upstream) : UFM1 (382440 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	38911701	38911702	+	IGR	DEL	TA	-	-	rs71832635		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38911701_38911702delTA								TRPC4 (467762 upstream) : UFM1 (12240 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	39216783	39216784	+	IGR	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39216783_39216784delAG								UFM1 (279641 upstream) : FREM2 (44389 downstream)																																			---	---	---	---
FREM2	341640	broad.mit.edu	37	13	39417408	39417408	+	Intron	DEL	T	-	-	rs34983724		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39417408delT	uc001uwv.2	+						FREM2_uc001uww.2_Intron	NM_207361	NP_997244			FRAS1-related extracellular matrix protein 2						cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	39804021	39804024	+	IGR	DEL	ACAC	-	-	rs144595877		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39804021_39804024delACAC								NHLRC3 (179779 upstream) : LHFP (113006 downstream)																																			---	---	---	---
LHFP	10186	broad.mit.edu	37	13	39981490	39981490	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39981490delG	uc001uxf.2	-							NM_005780	NP_005771			lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)				T	HMGA2	lipoma								---	---	---	---
LOC646982	646982	broad.mit.edu	37	13	41042779	41042780	+	Intron	INS	-	TCTG	TCTG	rs140430216	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41042779_41042780insTCTG	uc010tfa.1	-						LOC646982_uc001uxj.3_Intron|LOC646982_uc001uxk.2_Intron	NR_024507				Homo sapiens cDNA, FLJ17553.												0																		---	---	---	---
FOXO1	2308	broad.mit.edu	37	13	41101925	41101926	+	Intron	INS	-	T	T	rs146341783	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41101925_41101926insT	uc010acc.1	-							NM_002015	NP_002006			forkhead box O1						anti-apoptosis|blood vessel development|embryo development|endocrine pancreas development|insulin receptor signaling pathway|negative regulation of stress-activated MAPK cascade|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|response to DNA damage stimulus|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding		PAX3/FOXO1(749)|PAX7/FOXO1(197)	soft_tissue(946)|lung(1)|central_nervous_system(1)	948		Lung NSC(96;1.18e-05)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;7.32e-09)|Epithelial(112;2.87e-06)|OV - Ovarian serous cystadenocarcinoma(117;6.98e-05)|GBM - Glioblastoma multiforme(144;0.00394)|BRCA - Breast invasive adenocarcinoma(63;0.0815)														---	---	---	---
MRPS31	10240	broad.mit.edu	37	13	41346467	41346468	+	5'Flank	INS	-	A	A	rs78614807		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41346467_41346468insA	uc001uxm.3	-							NM_005830	NP_005821			mitochondrial ribosomal protein S31 precursor							mitochondrion|ribosome	protein domain specific binding				0		Lung NSC(96;3.55e-06)|Breast(139;0.00394)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(188;0.194)		all cancers(112;1.52e-08)|Epithelial(112;7.63e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000192)|GBM - Glioblastoma multiforme(144;0.00233)|BRCA - Breast invasive adenocarcinoma(63;0.0706)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	41729855	41729856	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41729855_41729856insT	uc001uxv.1	+											Homo sapiens cDNA FLJ31620 fis, clone NT2RI2003184.																														---	---	---	---
Unknown	0	broad.mit.edu	37	13	42068286	42068287	+	IGR	DEL	TG	-	-	rs34425406		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42068286_42068287delTG								C13orf15 (23273 upstream) : KIAA0564 (72675 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	42925064	42925065	+	IGR	INS	-	C	C	rs144886953	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42925064_42925065insC								AKAP11 (27662 upstream) : TNFSF11 (211807 downstream)																																			---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	44018203	44018203	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44018203delA	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron	NM_001127615	NP_001121087			ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
ENOX1	55068	broad.mit.edu	37	13	44136129	44136132	+	Intron	DEL	GAGG	-	-	rs35601287		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44136129_44136132delGAGG	uc001uza.3	-						ENOX1_uc001uzb.3_Intron|ENOX1_uc001uzc.3_Intron	NM_001127615	NP_001121087			ecto-NOX disulfide-thiol exchanger 1						electron transport chain|rhythmic process|transport	extracellular space|plasma membrane	nucleic acid binding|nucleotide binding|oxidoreductase activity			pancreas(1)|skin(1)	2		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)														---	---	---	---
GTF2F2	2963	broad.mit.edu	37	13	45760113	45760114	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45760113_45760114insT	uc001uzw.2	+						GTF2F2_uc001uzv.2_Intron	NM_004128	NP_004119			general transcription factor IIF, polypeptide 2,						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	microtubule cytoskeleton|transcription factor TFIIF complex	ATP binding|ATP-dependent helicase activity|DNA binding|protein binding				0		Lung NSC(96;0.00115)|Prostate(109;0.00578)|Breast(139;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.133)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000647)														---	---	---	---
C13orf18	80183	broad.mit.edu	37	13	47001168	47001169	+	Intron	INS	-	T	T	rs111701363		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47001168_47001169insT	uc001vbi.3	-							NM_025113	NP_079389			hypothetical protein LOC80183												0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)														---	---	---	---
LRCH1	23143	broad.mit.edu	37	13	47165109	47165109	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47165109delT	uc001vbj.2	+						LRCH1_uc010acp.2_Intron|LRCH1_uc001vbk.2_Intron|LRCH1_uc001vbl.3_Intron	NM_015116	NP_055931			leucine-rich repeats and calponin homology (CH)											ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	48340719	48340720	+	IGR	INS	-	T	T	rs112736233		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48340719_48340720insT								HTR2A (869669 upstream) : SUCLA2 (176072 downstream)																																			---	---	---	---
CAB39L	81617	broad.mit.edu	37	13	49917705	49917706	+	Intron	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49917705_49917706delAG	uc001vcw.2	-						CAB39L_uc001vcx.2_Intron|CAB39L_uc010adf.2_Intron	NM_030925	NP_112187			calcium binding protein 39-like						cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	protein binding				0		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	51553949	51553950	+	IGR	INS	-	A	A	rs140483834	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51553949_51553950insA								RNASEH2B (9355 upstream) : GUCY1B2 (14699 downstream)																																			---	---	---	---
HNRNPA1L2	144983	broad.mit.edu	37	13	53195887	53195887	+	Intron	DEL	A	-	-	rs144401147		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53195887delA	uc001vgx.1	+						HNRNPA1L2_uc001vgy.1_Intron|HNRNPA1L2_uc001vgz.1_Intron	NM_001011724	NP_001011724			heterogeneous nuclear ribonucleoprotein A1-like						mRNA processing|mRNA transport|RNA splicing	cytoplasm|spliceosomal complex	nucleotide binding|RNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	54591861	54591862	+	IGR	INS	-	GGAA	GGAA	rs145327528	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54591861_54591862insGGAA								OLFM4 (965675 upstream) : MIR1297 (294245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	54929863	54929863	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:54929863delC								MIR1297 (43680 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	56279592	56279593	+	IGR	INS	-	T	T	rs143211503	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:56279592_56279593insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	58467355	58467356	+	IGR	INS	-	T	T	rs149140676		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58467355_58467356insT								PCDH17 (164290 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59226549	59226552	+	IGR	DEL	TATA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59226549_59226552delTATA								PCDH17 (923484 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59317873	59317873	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59317873delA								None (None upstream) : DIAPH3 (921852 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	59709829	59709830	+	IGR	INS	-	CCCCCTA	CCCCCTA	rs138050394	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:59709829_59709830insCCCCCTA								None (None upstream) : DIAPH3 (529895 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	61869747	61869747	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61869747delT								TDRD3 (721735 upstream) : PCDH20 (114074 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	62749832	62749833	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:62749832_62749833delTC								PCDH20 (747753 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	65602504	65602504	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:65602504delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	66107088	66107089	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66107088_66107089insA								None (None upstream) : PCDH9 (769878 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	66178106	66178106	+	IGR	DEL	A	-	-	rs113960341		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66178106delA								None (None upstream) : PCDH9 (698861 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	66489789	66489789	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66489789delT								None (None upstream) : PCDH9 (387178 downstream)																																			---	---	---	---
PCDH9	5101	broad.mit.edu	37	13	67302188	67302188	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67302188delG	uc001vik.2	-						PCDH9_uc010aei.2_Intron|PCDH9_uc001vil.2_Intron|PCDH9_uc010thl.1_Intron	NM_203487	NP_982354			protocadherin 9 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	68209167	68209167	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:68209167delA								PCDH9 (404699 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69200777	69200778	+	IGR	INS	-	GT	GT	rs138662276	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69200777_69200778insGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	69341701	69341702	+	IGR	INS	-	AGAAAGCA	AGAAAGCA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69341701_69341702insAGAAAGCA								None (None upstream) : KLHL1 (933024 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	71407964	71407965	+	IGR	INS	-	TGG	TGG	rs145439031	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:71407964_71407965insTGG								ATXN8OS (694079 upstream) : DACH1 (604133 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	71818306	71818306	+	IGR	DEL	G	-	-	rs11148868		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:71818306delG								None (None upstream) : DACH1 (193792 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	73801396	73801396	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73801396delA								KLF5 (149721 upstream) : KLF12 (458754 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	74994843	74994844	+	5'Flank	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74994843_74994844delGA	uc001vjj.1	-											Homo sapiens cDNA FLJ35839 fis, clone TESTI2006659.																														---	---	---	---
MYCBP2	23077	broad.mit.edu	37	13	77839003	77839004	+	Intron	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77839003_77839004delCA	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron	NM_015057	NP_055872			MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)														---	---	---	---
MYCBP2	23077	broad.mit.edu	37	13	77859993	77860007	+	Intron	DEL	GGAAAGGAAAGGAAA	-	-	rs145619884	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77859993_77860007delGGAAAGGAAAGGAAA	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron	NM_015057	NP_055872			MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	78220827	78220827	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78220827delT								SCEL (1431 upstream) : SLAIN1 (51643 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	78937702	78937703	+	Intron	INS	-	A	A	rs140310637	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78937702_78937703insA	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																														---	---	---	---
NDFIP2	54602	broad.mit.edu	37	13	80071795	80071796	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80071795_80071796insT	uc001vlf.2	+						NDFIP2_uc010tib.1_Intron	NM_019080	NP_061953			Nedd4 family interacting protein 2 isoform 1						negative regulation of gene expression|negative regulation of protein transport|negative regulation of transporter activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein ubiquitination	endoplasmic reticulum|Golgi membrane|integral to membrane|mitochondrion|multivesicular body membrane|perinuclear region of cytoplasm	signal transducer activity|WW domain binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0196)														---	---	---	---
Unknown	0	broad.mit.edu	37	13	80356755	80356756	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80356755_80356756delCA								NDFIP2 (226550 upstream) : SPRY2 (553358 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	80628003	80628004	+	IGR	INS	-	T	T	rs147041757	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80628003_80628004insT								NDFIP2 (497798 upstream) : SPRY2 (282110 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	85086842	85086843	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:85086842_85086843insA								SLITRK1 (630314 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	87494345	87494345	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:87494345delG								None (None upstream) : SLITRK5 (830525 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	88672190	88672190	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88672190delT								SLITRK5 (340322 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	91916811	91916811	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91916811delC								LOC144776 (337960 upstream) : MIR17HG (83263 downstream)																																			---	---	---	---
GPC5	2262	broad.mit.edu	37	13	93330834	93330834	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93330834delT	uc010tif.1	+							NM_004466	NP_004457			glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
GPC5	2262	broad.mit.edu	37	13	93379667	93379669	+	Intron	DEL	TTT	-	-	rs71806874		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93379667_93379669delTTT	uc010tif.1	+							NM_004466	NP_004457			glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)																---	---	---	---
DZIP1	22873	broad.mit.edu	37	13	96290933	96290933	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96290933delA	uc001vmk.2	-						DZIP1_uc001vml.2_Intron|DZIP1_uc001vmn.2_Intron	NM_198968	NP_945319			DAZ interacting protein 1 isoform 2						germ cell development|multicellular organismal development|spermatogenesis	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)															---	---	---	---
MBNL2	10150	broad.mit.edu	37	13	97941688	97941688	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97941688delT	uc010aft.2	+						MBNL2_uc001vmz.2_Intron|MBNL2_uc001vna.2_Intron|MBNL2_uc001vnb.2_Intron|MBNL2_uc010tij.1_Intron	NM_144778	NP_659002			muscleblind-like 2 isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	cytoplasm|nucleus	RNA binding|zinc ion binding				0	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	98504946	98504947	+	IGR	INS	-	TGGA	TGGA	rs138903199	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98504946_98504947insTGGA								RAP2A (384695 upstream) : IPO5 (100982 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	98719596	98719597	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98719596_98719597insT								IPO5 (43047 upstream) : FARP1 (75219 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	98734513	98734514	+	IGR	DEL	AC	-	-	rs143927225		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98734513_98734514delAC								IPO5 (57964 upstream) : FARP1 (60302 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	99418329	99418330	+	IGR	INS	-	TG	TG	rs147995293	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99418329_99418330insTG								SLC15A1 (13400 upstream) : DOCK9 (27411 downstream)																																			---	---	---	---
DOCK9	23348	broad.mit.edu	37	13	99502790	99502793	+	Intron	DEL	CTCT	-	-	rs66955689		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99502790_99502793delCTCT	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc001vns.2_5'Flank|DOCK9_uc010tio.1_5'Flank|DOCK9_uc010tip.1_Intron|DOCK9_uc001vnu.1_5'Flank|DOCK9_uc010tiq.1_Intron	NM_015296	NP_056111			dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
DOCK9	23348	broad.mit.edu	37	13	99610184	99610189	+	Intron	DEL	GCACAG	-	-	rs71998545		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99610184_99610189delGCACAG	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tis.1_Intron|DOCK9_uc010tit.1_Intron	NM_015296	NP_056111			dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	100720182	100720183	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100720182_100720183insA								ZIC2 (81164 upstream) : PCCA (21154 downstream)																																			---	---	---	---
PCCA	5095	broad.mit.edu	37	13	100945188	100945189	+	Intron	INS	-	GTGTGTGT	GTGTGTGT	rs141432911	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100945188_100945189insGTGTGTGT	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron	NM_000282	NP_000273			propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)													---	---	---	---
TMTC4	84899	broad.mit.edu	37	13	101282276	101282281	+	Intron	DEL	TGTGTA	-	-	rs59820464		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101282276_101282281delTGTGTA	uc001vou.2	-						TMTC4_uc001vot.2_Intron|TMTC4_uc010tja.1_Intron|TMTC4_uc001vov.1_Intron|TMTC4_uc001vow.1_Intron	NM_001079669	NP_001073137			transmembrane and tetratricopeptide repeat							integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)																	---	---	---	---
ITGBL1	9358	broad.mit.edu	37	13	102142719	102142719	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102142719delT	uc001vpb.2	+						ITGBL1_uc010agb.2_Intron|ITGBL1_uc001vpc.3_Intron	NM_004791	NP_004782			integrin, beta-like 1 (with EGF-like repeat						cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity			ovary(1)|skin(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
ITGBL1	9358	broad.mit.edu	37	13	102260723	102260723	+	Intron	DEL	T	-	-	rs76825853		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102260723delT	uc001vpb.2	+						ITGBL1_uc010agb.2_Intron|ITGBL1_uc001vpc.3_Intron	NM_004791	NP_004782			integrin, beta-like 1 (with EGF-like repeat						cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity			ovary(1)|skin(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
FGF14	2259	broad.mit.edu	37	13	102373515	102373517	+	3'UTR	DEL	GAG	-	-	rs67763618		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102373515_102373517delGAG	uc001vpe.2	-	5					FGF14_uc001vpf.2_3'UTR|FGF14_uc001vpd.1_RNA	NM_004115	NP_004106			fibroblast growth factor 14 isoform 1A						cell death|cell-cell signaling|JNK cascade|nervous system development|signal transduction	nucleus	growth factor activity|heparin binding			ovary(2)|lung(1)|large_intestine(1)	4	all_neural(89;0.0239)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---
Unknown	0	broad.mit.edu	37	13	104200259	104200259	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:104200259delT								SLC10A2 (481063 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	105301101	105301102	+	IGR	INS	-	T	T	rs148470279	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105301101_105301102insT								None (None upstream) : DAOA (817114 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	105989177	105989177	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:105989177delA								None (None upstream) : DAOA (129039 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	106165281	106165282	+	IGR	INS	-	T	T	rs145316877	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106165281_106165282insT								DAOA (21899 upstream) : EFNB2 (976816 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	106516413	106516414	+	IGR	INS	-	GT	GT	rs143659638	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106516413_106516414insGT								DAOA (373031 upstream) : EFNB2 (625684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	106619675	106619675	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106619675delC								DAOA (476293 upstream) : EFNB2 (522423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	106937944	106937945	+	IGR	INS	-	ACACACAC	ACACACAC	rs140100310	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106937944_106937945insACACACAC								DAOA (794562 upstream) : EFNB2 (204153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	108672844	108672845	+	IGR	INS	-	AA	AA	rs140491150	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108672844_108672845insAA								FAM155A (153384 upstream) : LIG4 (186949 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	110185583	110185584	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110185583_110185584delTG								MYO16 (325228 upstream) : IRS2 (220602 downstream)																																			---	---	---	---
COL4A2	1284	broad.mit.edu	37	13	111038188	111038211	+	Intron	DEL	GTGTGGATAGGCCGTGGTTGCAGC	-	-	rs72288443	by1000genomes;by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111038188_111038211delGTGTGGATAGGCCGTGGTTGCAGC	uc001vqx.2	+							NM_001846	NP_001837			alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)															---	---	---	---
CARKD	55739	broad.mit.edu	37	13	111290288	111290289	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111290288_111290289delAC	uc001vrb.2	+						CARKD_uc010tjj.1_Intron|CARKD_uc001vqz.2_Intron|CARKD_uc001vra.2_Intron|CARKD_uc010tjk.1_Intron|CARKD_uc010tjl.1_Intron|CARKD_uc001vrc.2_Intron					RecName: Full=Carbohydrate kinase domain-containing protein; Flags: Precursor;											skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	13	112220736	112220737	+	IGR	INS	-	AC	AC	rs150891767		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112220736_112220737insAC								C13orf16 (224143 upstream) : SOX1 (501176 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	13	112588814	112588814	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112588814delT								C13orf16 (592221 upstream) : SOX1 (133099 downstream)																																			---	---	---	---
C13orf28	122258	broad.mit.edu	37	13	113079957	113079958	+	Intron	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113079957_113079958delAG	uc001vsd.1	+							NM_145248	NP_660291			hypothetical protein LOC122258 precursor							extracellular region					0	all_lung(23;0.000633)|Lung NSC(43;0.0161)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0997)|Medulloblastoma(90;0.163)																	---	---	---	---
C13orf35	400165	broad.mit.edu	37	13	113320562	113320563	+	Intron	INS	-	TG	TG	rs148011327	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113320562_113320563insTG	uc001vsh.1	+							NM_207440	NP_997323			hypothetical protein LOC400165											ovary(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)		all cancers(43;0.201)															---	---	---	---
LAMP1	3916	broad.mit.edu	37	13	113957838	113957838	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113957838delT	uc001vtm.1	+						LAMP1_uc010tka.1_Intron	NM_005561	NP_005552			lysosomal-associated membrane protein 1							endosome membrane|integral to plasma membrane|lysosomal membrane|membrane fraction				central_nervous_system(2)	2	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)															---	---	---	---
Unknown	0	broad.mit.edu	37	13	114063154	114063155	+	IGR	INS	-	AGGGGAGGAGGGGGCTGCAGAGAGG	AGGGGAGGAGGGGGCTGCAGAGAGG	rs66821226		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114063154_114063155insAGGGGAGGAGGGGGCTGCAGAGAGG								GRTP1 (44691 upstream) : ADPRHL1 (13105 downstream)																																			---	---	---	---
FAM70B	348013	broad.mit.edu	37	13	114460346	114460349	+	5'Flank	DEL	TGTG	-	-	rs56961700		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114460346_114460349delTGTG	uc001vuh.2	+						FAM70B_uc010tkh.1_5'Flank	NM_182614	NP_872420			family with sequence similarity 70, member B							integral to membrane					0	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.123)|all_epithelial(44;0.133)	all cancers(43;0.181)															---	---	---	---
FAM70B	348013	broad.mit.edu	37	13	114460490	114460491	+	5'Flank	DEL	TG	-	-	rs61524971		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114460490_114460491delTG	uc001vuh.2	+						FAM70B_uc010tkh.1_5'Flank	NM_182614	NP_872420			family with sequence similarity 70, member B							integral to membrane					0	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.123)|all_epithelial(44;0.133)	all cancers(43;0.181)															---	---	---	---
GAS6	2621	broad.mit.edu	37	13	114545059	114545060	+	Intron	INS	-	CA	CA	rs150359477	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114545059_114545060insCA	uc001vud.2	-						uc010tki.1_5'Flank	NM_000820	NP_000811			growth arrest-specific 6 isoform 1 precursor						cell proliferation|leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|positive regulation of ERK1 and ERK2 cascade|positive regulation of fibroblast proliferation|post-translational protein modification|proteolysis|regulation of growth	endoplasmic reticulum lumen|extracellular space|Golgi lumen|platelet alpha granule lumen	calcium ion binding|receptor agonist activity			central_nervous_system(4)	4	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)																---	---	---	---
UPF3A	65110	broad.mit.edu	37	13	115049858	115049859	+	Intron	INS	-	TG	TG	rs138557766	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115049858_115049859insTG	uc001vup.2	+						UPF3A_uc001vuq.2_Intron|UPF3A_uc001vus.2_Intron|UPF3A_uc001vur.2_Intron|UPF3A_uc001vut.2_5'Flank|UPF3A_uc001vuu.2_5'Flank	NM_023011	NP_075387			UPF3 regulator of nonsense transcripts homolog A						mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation	cytoplasm|nucleus|plasma membrane	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			skin(1)	1	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	19099242	19099242	+	IGR	DEL	A	-	-	rs111827694		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19099242delA								None (None upstream) : OR11H12 (278352 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	19864035	19864036	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19864035_19864036insA	uc001vvq.1	-											Homo sapiens cDNA FLJ12852 fis, clone NT2RP2003445.																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	19904603	19904603	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19904603delA	uc001vvq.1	-						uc001vvr.1_Intron|uc010ahe.1_Intron|uc001vvs.1_Intron					Homo sapiens cDNA FLJ12852 fis, clone NT2RP2003445.																														---	---	---	---
DAD1	1603	broad.mit.edu	37	14	23060794	23060794	+	5'Flank	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23060794delT	uc001wgl.2	-							NM_001344	NP_001335			defender against cell death 1						anti-apoptosis|apoptosis|post-translational protein modification	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity			ovary(1)	1	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0156)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	25230596	25230596	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25230596delT								GZMB (127164 upstream) : STXBP6 (50712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	26292900	26292901	+	IGR	INS	-	TG	TG	rs143200055	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26292900_26292901insTG								STXBP6 (773729 upstream) : NOVA1 (622189 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28310983	28310984	+	IGR	INS	-	A	A	rs150907659	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28310983_28310984insA								None (None upstream) : FOXG1 (925303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28311114	28311115	+	IGR	INS	-	T	T	rs143273411	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28311114_28311115insT								None (None upstream) : FOXG1 (925172 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	28415471	28415472	+	IGR	INS	-	AT	AT	rs149057572	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28415471_28415472insAT								None (None upstream) : FOXG1 (820815 downstream)																																			---	---	---	---
AKAP6	9472	broad.mit.edu	37	14	32844706	32844707	+	Intron	INS	-	A	A	rs71432049		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32844706_32844707insA	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265			A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)														---	---	---	---
NPAS3	64067	broad.mit.edu	37	14	34256143	34256144	+	Intron	INS	-	A	A	rs146331998	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34256143_34256144insA	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron	NM_173159	NP_071406			neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	34949317	34949317	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34949317delA								C14orf147 (17849 upstream) : EAPP (35818 downstream)																																			---	---	---	---
BAZ1A	11177	broad.mit.edu	37	14	35339480	35339480	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35339480delC	uc001wsk.2	-						BAZ1A_uc001wsl.2_Intron|BAZ1A_uc001wsm.1_Intron	NM_013448	NP_038476			bromodomain adjacent to zinc finger domain, 1A						chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	35838680	35838680	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35838680delA								KIAA0391 (52007 upstream) : NFKBIA (32037 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	35902986	35902986	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35902986delT								NFKBIA (29026 upstream) : INSM2 (100262 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	35980694	35980694	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35980694delC								NFKBIA (106734 upstream) : INSM2 (22554 downstream)																																			---	---	---	---
RALGAPA1	253959	broad.mit.edu	37	14	36268198	36268199	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36268198_36268199insA	uc001wti.2	-						RALGAPA1_uc001wtj.2_Intron|RALGAPA1_uc010tpv.1_Intron|RALGAPA1_uc010tpw.1_Intron	NM_014990	NP_055805			Ral GTPase activating protein, alpha subunit 1						activation of Ral GTPase activity	cytosol|mitochondrion|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(3)|breast(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	36283199	36283200	+	IGR	INS	-	C	C	rs144507800	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36283199_36283200insC								RALGAPA1 (4767 upstream) : BRMS1L (12397 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	36463290	36463291	+	IGR	INS	-	TCCT	TCCT	rs66569553		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36463290_36463291insTCCT								BRMS1L (122122 upstream) : MBIP (304473 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	36998025	36998025	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36998025delT								NKX2-1 (8609 upstream) : NKX2-8 (51192 downstream)																																			---	---	---	---
SLC25A21	89874	broad.mit.edu	37	14	37614126	37614128	+	Intron	DEL	GGT	-	-	rs35217998		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37614126_37614128delGGT	uc001wtz.1	-							NM_030631	NP_085134			solute carrier family 25 (mitochondrial						lysine catabolic process	integral to membrane|mitochondrial inner membrane	alpha-ketoglutarate transmembrane transporter activity|binding			skin(1)	1	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)														---	---	---	---
MIPOL1	145282	broad.mit.edu	37	14	37674314	37674315	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37674314_37674315insT	uc001wuc.2	+						MIPOL1_uc010amr.2_Intron|MIPOL1_uc001wub.3_Intron|MIPOL1_uc001wud.2_Intron|MIPOL1_uc010ams.2_Intron|MIPOL1_uc001wue.2_Intron|MIPOL1_uc010amt.2_Intron	NM_138731	NP_620059			mirror-image polydactyly 1											ovary(1)|central_nervous_system(1)	2	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	39476174	39476174	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39476174delT								CLEC14A (750600 upstream) : SEC23A (24949 downstream)																																			---	---	---	---
CTAGE5	4253	broad.mit.edu	37	14	39784041	39784042	+	Intron	DEL	TA	-	-	rs2415540	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39784041_39784042delTA	uc001wvg.3	+						CTAGE5_uc010tqe.1_Intron|CTAGE5_uc001wuz.3_Intron|CTAGE5_uc001wuy.3_Intron|CTAGE5_uc001wvb.3_Intron|CTAGE5_uc001wvc.3_Intron|CTAGE5_uc001wva.3_Intron|CTAGE5_uc001wvh.3_Intron|CTAGE5_uc001wvf.3_Intron|CTAGE5_uc001wvi.3_Intron|CTAGE5_uc010amz.2_Intron|CTAGE5_uc001wvj.3_Intron	NM_005930	NP_005921			CTAGE family, member 5 isoform 1								enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	39908620	39908620	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39908620delG								FBXO33 (6916 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	40389832	40389838	+	IGR	DEL	GACCCTT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40389832_40389838delGACCCTT								FBXO33 (488128 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	40667515	40667517	+	IGR	DEL	AAG	-	-	rs71437354		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40667515_40667517delAAG								FBXO33 (765811 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	43262652	43262652	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43262652delT								LRFN5 (888902 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	47177852	47177853	+	IGR	INS	-	TTT	TTT	rs35772075		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47177852_47177853insTTT								RPL10L (56824 upstream) : MDGA2 (130977 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	48231136	48231137	+	IGR	DEL	AC	-	-	rs34065755		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48231136_48231137delAC								MDGA2 (87148 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	48314371	48314371	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48314371delA								MDGA2 (170383 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	49316183	49316183	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49316183delA								None (None upstream) : SDCCAG1 (716844 downstream)																																			---	---	---	---
NID2	22795	broad.mit.edu	37	14	52512274	52512275	+	Intron	INS	-	AAT	AAT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52512274_52512275insAAT	uc001wzo.2	-						NID2_uc010tqs.1_Intron|NID2_uc010tqt.1_Intron|NID2_uc001wzp.2_Intron	NM_007361	NP_031387			nidogen 2 precursor							basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)																	---	---	---	---
Unknown	0	broad.mit.edu	37	14	53438126	53438126	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53438126delT								FERMT2 (20311 upstream) : DDHD1 (65333 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	53761150	53761150	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53761150delT								DDHD1 (141104 upstream) : BMP4 (655307 downstream)																																			---	---	---	---
SAMD4A	23034	broad.mit.edu	37	14	55160899	55160899	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55160899delT	uc001xbb.2	+						SAMD4A_uc001xba.2_Intron|SAMD4A_uc001xbc.2_Intron|SAMD4A_uc001xbf.1_RNA|SAMD4A_uc001xbe.2_Intron	NM_015589	NP_056404			sterile alpha motif domain containing 4 isoform						positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	55683048	55683049	+	IGR	DEL	GT	-	-	rs71658347		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55683048_55683049delGT								DLGAP5 (24652 upstream) : FBXO34 (54972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	55733503	55733503	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55733503delT								DLGAP5 (75107 upstream) : FBXO34 (4518 downstream)																																			---	---	---	---
KIAA0831	22863	broad.mit.edu	37	14	55852007	55852008	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55852007_55852008insT	uc001xbx.1	-						FBXO34_uc001xbv.2_Intron|KIAA0831_uc001xbw.1_Intron	NM_014924	NP_055739			Barkor						autophagic vacuole assembly|positive regulation of autophagy	autophagic vacuole|endoplasmic reticulum|pre-autophagosomal structure membrane	protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	56161784	56161785	+	IGR	INS	-	A	A	rs143147309	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56161784_56161785insA								KTN1 (10483 upstream) : RPL13AP3 (71178 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	56307429	56307430	+	IGR	INS	-	G	G	rs146822133	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56307429_56307430insG								C14orf34 (44037 upstream) : PELI2 (277663 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	57131804	57131805	+	IGR	DEL	AA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57131804_57131805delAA								C14orf101 (15574 upstream) : OTX2 (135622 downstream)																																			---	---	---	---
EXOC5	10640	broad.mit.edu	37	14	57730625	57730625	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57730625delC	uc001xct.2	-						EXOC5_uc010trg.1_Intron|EXOC5_uc010trh.1_Intron	NM_006544	NP_006535			SEC10 protein						exocytosis|post-Golgi vesicle-mediated transport|protein transport|vesicle docking	cytoplasm				ovary(2)|breast(1)	3																		---	---	---	---
SLC35F4	341880	broad.mit.edu	37	14	58060173	58060174	+	Intron	DEL	GG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58060173_58060174delGG	uc001xdb.1	-						SLC35F4_uc010aoz.1_Intron|SLC35F4_uc010apa.1_Intron	NM_001080455	NP_001073924			solute carrier family 35, member F4											ovary(2)	2																		---	---	---	---
C14orf37	145407	broad.mit.edu	37	14	58741149	58741149	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58741149delA	uc010tro.1	-						uc001xdl.2_Intron|uc001xdm.1_Intron|uc001xdn.1_Intron	NM_001001872	NP_001001872			hypothetical protein LOC145407 precursor							integral to membrane	binding				0																		---	---	---	---
ARID4A	5926	broad.mit.edu	37	14	58832185	58832186	+	Intron	INS	-	T	T	rs71448949		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58832185_58832186insT	uc001xdp.2	+						ARID4A_uc001xdo.2_Intron|ARID4A_uc001xdq.2_Intron	NM_002892	NP_002883			retinoblastoma-binding protein 1 isoform I						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	60774497	60774498	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60774497_60774498insT								PPM1A (8694 upstream) : C14orf39 (128177 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	62608368	62608368	+	IGR	DEL	T	-	-	rs72162312		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62608368delT								FLJ43390 (11136 upstream) : KCNH5 (565579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	64825154	64825158	+	IGR	DEL	TTTGT	-	-	rs112225199		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64825154_64825158delTTTGT								ESR2 (19886 upstream) : MTHFD1 (29601 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	65369670	65369671	+	IGR	DEL	AT	-	-	rs140919260		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65369670_65369671delAT								SPTB (23069 upstream) : CHURC1 (11469 downstream)																																			---	---	---	---
ARG2	384	broad.mit.edu	37	14	68088172	68088172	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68088172delT	uc001xjs.2	+							NM_001172	NP_001163			arginase 2 precursor						arginine metabolic process|nitric oxide biosynthetic process|urea cycle	mitochondrial matrix	arginase activity|metal ion binding				0				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)													---	---	---	---
Unknown	0	broad.mit.edu	37	14	70072640	70072641	+	IGR	DEL	TG	-	-	rs34080517		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70072640_70072641delTG								C14orf162 (34722 upstream) : KIAA0247 (5669 downstream)																																			---	---	---	---
RGS6	9628	broad.mit.edu	37	14	72524792	72524793	+	Intron	INS	-	TT	TT	rs112257816		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72524792_72524793insTT	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287			regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	73067715	73067716	+	IGR	INS	-	GAG	GAG	rs149157490	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73067715_73067716insGAG								RGS6 (34478 upstream) : DPF3 (18288 downstream)																																			---	---	---	---
DPF3	8110	broad.mit.edu	37	14	73267086	73267089	+	Intron	DEL	ATGG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73267086_73267089delATGG	uc001xnc.2	-						DPF3_uc001xnf.2_Intron|DPF3_uc010ari.1_Intron|DPF3_uc010ttq.1_Intron	NM_012074	NP_036206			D4, zinc and double PHD fingers, family 3						chromatin modification|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nBAF complex	nucleic acid binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	74278762	74278763	+	IGR	INS	-	A	A	rs72130013		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74278762_74278763insA								C14orf43 (24866 upstream) : PTGR2 (39771 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	74857524	74857524	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74857524delT								C14orf115 (30814 upstream) : TMEM90A (15072 downstream)																																			---	---	---	---
EIF2B2	8892	broad.mit.edu	37	14	75470629	75470630	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75470629_75470630insA	uc001xrc.1	+							NM_014239	NP_055054			eukaryotic translation initiation factor 2B,						cellular response to stimulus|myelination|oligodendrocyte development|ovarian follicle development|regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	ATP binding|GTP binding|protein binding|translation initiation factor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00661)														---	---	---	---
FLVCR2	55640	broad.mit.edu	37	14	76097862	76097862	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76097862delT	uc001xrs.2	+						FLVCR2_uc010tvd.1_Intron	NM_017791	NP_060261			feline leukemia virus subgroup C cellular						transmembrane transport	integral to membrane|plasma membrane	heme binding|heme transporter activity				0				BRCA - Breast invasive adenocarcinoma(234;0.029)														---	---	---	---
TTLL5	23093	broad.mit.edu	37	14	76292639	76292640	+	Intron	INS	-	AC	AC	rs143627113	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76292639_76292640insAC	uc001xrx.2	+						TTLL5_uc010ask.1_Intron|TTLL5_uc001xrz.2_Intron|TTLL5_uc001xsa.2_Intron	NM_015072	NP_055887			tubulin tyrosine ligase-like family, member 5						protein modification process|transcription, DNA-dependent	centrosome|cilium|microtubule basal body|nucleus	tubulin-tyrosine ligase activity			ovary(2)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.029)														---	---	---	---
C14orf118	55668	broad.mit.edu	37	14	76644050	76644050	+	Intron	DEL	G	-	-	rs75873441		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76644050delG	uc001xsh.2	+						C14orf118_uc001xsi.2_Intron|C14orf118_uc001xsl.2_Intron	NM_017926	NP_060396			hypothetical protein LOC55668 isoform 1											ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.0172)														---	---	---	---
TMEM63C	57156	broad.mit.edu	37	14	77648238	77648240	+	Splice_Site	DEL	GTG	-	-	rs142649313		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77648238_77648240delGTG	uc001xtf.2	+	1	136	c.-76_splice	c.e1+1		TMEM63C_uc010asq.1_Splice_Site	NM_020431	NP_065164			transmembrane protein 63C							integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)														---	---	---	---
ADCK1	57143	broad.mit.edu	37	14	78303117	78303117	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78303117delT	uc001xui.2	+						ADCK1_uc010tvo.1_Intron|ADCK1_uc001xuj.2_Intron	NM_020421	NP_065154			aarF domain containing kinase 1 isoform a							extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)														---	---	---	---
NRXN3	9369	broad.mit.edu	37	14	79885949	79885950	+	Intron	INS	-	GA	GA	rs142706684	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79885949_79885950insGA	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc001xup.2_Intron|NRXN3_uc001xuq.2_Intron|NRXN3_uc010asw.2_Intron|NRXN3_uc001xur.3_Intron	NM_004796	NP_004787			neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---
C14orf145	145508	broad.mit.edu	37	14	81042979	81042980	+	Intron	INS	-	TT	TT	rs5019764		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81042979_81042980insTT	uc001xux.2	-						C14orf145_uc010asz.1_Intron	NM_152446	NP_689659			hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	82057234	82057235	+	IGR	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82057234_82057235delCT								SEL1L (57029 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	82717315	82717315	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82717315delT								SEL1L (717110 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	83187108	83187109	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83187108_83187109delGT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84177316	84177318	+	IGR	DEL	GAA	-	-	rs149395949		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84177316_84177318delGAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	84276247	84276247	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84276247delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85281016	85281023	+	IGR	DEL	CCTCCCTC	-	-	rs76839618		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85281016_85281023delCCTCCCTC								None (None upstream) : FLRT2 (715465 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	85740997	85740997	+	IGR	DEL	T	-	-	rs147620833		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:85740997delT								None (None upstream) : FLRT2 (255491 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	86931155	86931158	+	IGR	DEL	TCTT	-	-	rs112125436		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86931155_86931158delTCTT								FLRT2 (836886 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	87378915	87378916	+	Intron	INS	-	TG	TG	rs146695316	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87378915_87378916insTG	uc001xvs.2	+											Homo sapiens cDNA clone IMAGE:4821442.																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	87534281	87534281	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87534281delA								None (None upstream) : GALC (769883 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	88071189	88071190	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88071189_88071190delAC								None (None upstream) : GALC (232974 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	88627857	88627870	+	5'Flank	DEL	CGCGCGCACACACA	-	-	rs58106802		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88627857_88627870delCGCGCGCACACACA	uc001xwj.2	+						uc001xwk.2_5'Flank|uc001xwl.2_5'Flank					DQ572214																														---	---	---	---
Unknown	0	broad.mit.edu	37	14	89425637	89425638	+	IGR	DEL	AA	-	-	rs111538568		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89425637_89425638delAA								TTC8 (81303 upstream) : FOXN3 (196879 downstream)																																			---	---	---	---
FOXN3	1112	broad.mit.edu	37	14	89905113	89905114	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89905113_89905114insT	uc001xxo.3	-						FOXN3_uc010atk.2_Intron|FOXN3_uc001xxp.2_Intron	NM_001085471	NP_001078940			checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	90663934	90663934	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90663934delC								KCNK13 (11739 upstream) : PSMC1 (58960 downstream)																																			---	---	---	---
C14orf159	80017	broad.mit.edu	37	14	91643303	91643304	+	Intron	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91643303_91643304delTC	uc001xzb.2	+						C14orf159_uc010atv.1_Intron|C14orf159_uc001xyy.2_Intron|C14orf159_uc001xyx.2_Intron|C14orf159_uc001xyw.2_Intron|C14orf159_uc001xzc.2_Intron|C14orf159_uc001xza.2_Intron|C14orf159_uc001xyv.2_Intron|C14orf159_uc001xyz.2_Intron|C14orf159_uc001xze.2_Intron	NM_001102366	NP_001095836			hypothetical protein LOC80017 isoform a							mitochondrion				central_nervous_system(2)|ovary(1)	3		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)														---	---	---	---
SERPINA9	327657	broad.mit.edu	37	14	94938045	94938045	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94938045delC	uc001ydf.2	-						SERPINA9_uc001yde.2_Intron|SERPINA9_uc010avc.2_Intron|SERPINA9_uc001ydg.2_Intron|SERPINA9_uc001ydh.1_Intron|SERPINA9_uc001ydi.1_Intron	NM_175739	NP_783866			serine (or cysteine) proteinase inhibitor, clade						regulation of proteolysis	cytoplasm|extracellular region|membrane	serine-type endopeptidase inhibitor activity			lung(1)|central_nervous_system(1)	2		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	95293576	95293577	+	IGR	INS	-	T	T	rs79446959		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95293576_95293577insT								GSC (57077 upstream) : DICER1 (258988 downstream)																																			---	---	---	---
DICER1	23405	broad.mit.edu	37	14	95607858	95607859	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95607858_95607859insA	uc001ydw.2	-						DICER1_uc001ydx.2_Intron|DICER1_uc001ydz.1_Intron|DICER1_uc001yea.1_Intron|DICER1_uc001yeb.1_Intron|DICER1_uc001yec.1_Intron	NM_030621	NP_085124			dicer1						negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)				Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				---	---	---	---
CLMN	79789	broad.mit.edu	37	14	95705281	95705282	+	Intron	DEL	TA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95705281_95705282delTA	uc001yef.2	-							NM_024734	NP_079010			calmin							integral to membrane	actin binding				0				Epithelial(152;0.193)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	96099546	96099547	+	IGR	INS	-	GTGT	GTGT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96099546_96099547insGTGT								GLRX5 (88491 upstream) : TCL6 (17288 downstream)																																			---	---	---	---
PAPOLA	10914	broad.mit.edu	37	14	96985433	96985433	+	Intron	DEL	T	-	-	rs113416617		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96985433delT	uc001yfq.2	+						PAPOLA_uc001yfo.2_Intron|PAPOLA_uc001yfp.2_Intron|PAPOLA_uc001yfr.2_Intron|PAPOLA_uc010twv.1_Intron|PAPOLA_uc010avp.2_Intron	NM_032632	NP_116021			poly(A) polymerase alpha						mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding				0		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	97619014	97619015	+	IGR	INS	-	TT	TT	rs141227751	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97619014_97619015insTT								VRK1 (271064 upstream) : C14orf64 (772932 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98480461	98480462	+	IGR	INS	-	CTTT	CTTT	rs149441117	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98480461_98480462insCTTT								C14orf64 (36000 upstream) : C14orf177 (697488 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	98736391	98736392	+	IGR	INS	-	CT	CT	rs140105439	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98736391_98736392insCT								C14orf64 (291930 upstream) : C14orf177 (441558 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99146992	99146992	+	IGR	DEL	A	-	-	rs113318802		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99146992delA								C14orf64 (702531 upstream) : C14orf177 (30958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	99439134	99439135	+	IGR	INS	-	TTTTTTTTTTTTTTTTT	TTTTTTTTTTTTTTTTT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99439134_99439135insTTTTTTTTTTTTTTTTT								C14orf177 (255037 upstream) : BCL11B (196492 downstream)																																			---	---	---	---
BCL11B	64919	broad.mit.edu	37	14	99725342	99725343	+	Intron	INS	-	G	G	rs146435971	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99725342_99725343insG	uc001yga.2	-						BCL11B_uc001ygb.2_Intron	NM_138576	NP_612808			B-cell CLL/lymphoma 11B isoform 1							nucleus	zinc ion binding			central_nervous_system(8)|large_intestine(1)|lung(1)	10		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)				T	TLX3	T-ALL								---	---	---	---
DEGS2	123099	broad.mit.edu	37	14	100619218	100619219	+	Intron	INS	-	ATGG	ATGG	rs138869050	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100619218_100619219insATGG	uc001ygx.2	-							NM_206918	NP_996801			degenerative spermatocyte homolog 2, lipid						fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	sphingosine hydroxylase activity				0		Melanoma(154;0.212)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	101173609	101173610	+	IGR	DEL	AC	-	-	rs34776695		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101173609_101173610delAC								C14orf70 (34528 upstream) : DLK1 (19643 downstream)																																			---	---	---	---
MIR544	664613	broad.mit.edu	37	14	101514904	101514905	+	5'Flank	DEL	GT	-	-	rs112536165		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101514904_101514905delGT	hsa-mir-544|MI0003515	+						MIR655_hsa-mir-655|MI0003677_5'Flank																	0																		---	---	---	---
Unknown	0	broad.mit.edu	37	14	103238405	103238406	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103238405_103238406delTG								RCOR1 (41493 upstream) : TRAF3 (5410 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	14	103775352	103775353	+	IGR	INS	-	GAAA	GAAA	rs138743388	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103775352_103775353insGAAA								TNFAIP2 (171576 upstream) : EIF5 (25140 downstream)																																			---	---	---	---
PPP1R13B	23368	broad.mit.edu	37	14	104258536	104258539	+	Intron	DEL	TGTA	-	-	rs143780105		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104258536_104258539delTGTA	uc001yof.1	-						PPP1R13B_uc001yog.1_Intron	NM_015316	NP_056131			apoptosis-stimulating protein of p53, 1						apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)																---	---	---	---
Unknown	0	broad.mit.edu	37	14	104364939	104364940	+	IGR	INS	-	C	C	rs150207897	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104364939_104364940insC								PPP1R13B (51012 upstream) : C14orf2 (13686 downstream)																																			---	---	---	---
ADAM6	8755	broad.mit.edu	37	14	106770438	106770439	+	Splice_Site	INS	-	CT	CT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106770438_106770439insCT	uc010tyt.1	-	442		c.15776_splice	c.e442-1							Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	20070021	20070022	+	IGR	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20070021_20070022insG								None (None upstream) : GOLGA6L6 (667072 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20454589	20454589	+	IGR	DEL	T	-	-	rs71399653		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20454589delT								None (None upstream) : GOLGA6L6 (282505 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20514646	20514648	+	IGR	DEL	ATG	-	-	rs137979527	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20514646_20514648delATG								None (None upstream) : GOLGA6L6 (222446 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20515176	20515180	+	IGR	DEL	GATGA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20515176_20515180delGATGA								None (None upstream) : GOLGA6L6 (221914 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20527370	20527372	+	IGR	DEL	ATC	-	-	rs148807711		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20527370_20527372delATC								None (None upstream) : GOLGA6L6 (209722 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20560992	20560993	+	IGR	INS	-	G	G	rs138749934		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20560992_20560993insG								None (None upstream) : GOLGA6L6 (176101 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	20626429	20626460	+	Intron	DEL	ACTTGATCATATAATTTTATTCTCCTGCTTTA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20626429_20626460delACTTGATCATATAATTTTATTCTCCTGCTTTA	uc001ytg.2	-						uc010tyx.1_Intron|uc001yth.3_Intron					RecName: Full=Putative HERC2-like protein 3;																														---	---	---	---
CYFIP1	23191	broad.mit.edu	37	15	22952525	22952525	+	Intron	DEL	A	-	-	rs74844639		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22952525delA	uc001yus.2	+						CYFIP1_uc001yut.2_Intron|CYFIP1_uc010aya.1_Intron	NM_014608	NP_055423			cytoplasmic FMR1 interacting protein 1 isoform						axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	23684300	23684301	+	IGR	INS	-	TT	TT	rs34626596		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23684300_23684301insTT								GOLGA8E (235877 upstream) : MKRN3 (126153 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	23686010	23686011	+	IGR	INS	-	CTC	CTC			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23686010_23686011insCTC								GOLGA8E (237587 upstream) : MKRN3 (124443 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	24710875	24710875	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24710875delT								PWRN2 (295780 upstream) : PWRN1 (67964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	25017900	25017900	+	IGR	DEL	A	-	-	rs71124298		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25017900delA								C15orf2 (89308 upstream) : SNRPN (50894 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	25748119	25748136	+	IGR	DEL	ACACACACACACACACAG	-	-	rs61440101		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25748119_25748136delACACACACACACACACAG								UBE3A (63991 upstream) : ATP10A (175726 downstream)																																			---	---	---	---
ATP10A	57194	broad.mit.edu	37	15	26018965	26018968	+	Intron	DEL	CCAC	-	-	rs150225706	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26018965_26018968delCCAC	uc010ayu.2	-							NM_024490	NP_077816			ATPase, class V, type 10A						ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	26358209	26358209	+	5'Flank	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26358209delT	uc001zay.2	+											Homo sapiens hypothetical LOC503519, mRNA (cDNA clone IMAGE:5271234).																														---	---	---	---
HERC2	8924	broad.mit.edu	37	15	28462478	28462479	+	Intron	INS	-	ACAT	ACAT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28462478_28462479insACAT	uc001zbj.2	-							NM_004667	NP_004658			hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	30316893	30316894	+	IGR	DEL	GT	-	-	rs10048000	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30316893_30316894delGT								TJP1 (202187 upstream) : FAM7A3 (79041 downstream)																																			---	---	---	---
OTUD7A	161725	broad.mit.edu	37	15	32070460	32070461	+	Intron	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32070460_32070461delCT	uc001zfr.2	-						OTUD7A_uc001zfs.1_Intron|OTUD7A_uc010baa.1_Intron	NM_130901	NP_570971			OTU domain containing 7A							cytoplasm|nucleus	cysteine-type peptidase activity|DNA binding|zinc ion binding			pancreas(1)|skin(1)	2		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)														---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33600969	33600970	+	5'Flank	DEL	CC	-	-	rs3082642	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33600969_33600970delCC	uc001zhi.2	+						RYR3_uc010bar.2_5'Flank	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
RYR3	6263	broad.mit.edu	37	15	33890965	33890965	+	Intron	DEL	T	-	-	rs71415525		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33890965delT	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027			ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)														---	---	---	---
C15orf29	79768	broad.mit.edu	37	15	34498291	34498291	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34498291delA	uc001zhp.2	-						C15orf29_uc010ubz.1_Intron|C15orf29_uc010uca.1_Intron	NM_024713	NP_078989			hypothetical protein LOC79768							nucleolus				ovary(1)	1		all_lung(180;1.86e-06)		all cancers(64;5.49e-18)|GBM - Glioblastoma multiforme(113;8.91e-07)|BRCA - Breast invasive adenocarcinoma(123;0.026)|Lung(196;0.229)														---	---	---	---
LPCAT4	254531	broad.mit.edu	37	15	34661809	34661810	+	5'Flank	INS	-	TT	TT	rs57908492		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34661809_34661810insTT	uc001zig.2	-						LPCAT4_uc010bav.1_5'Flank	NM_153613	NP_705841			lysophosphatidylcholine acyltransferase 4						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|calcium ion binding				0																		---	---	---	---
AQR	9716	broad.mit.edu	37	15	35150522	35150522	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35150522delA	uc001ziv.2	-							NM_014691	NP_055506			aquarius							catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)														---	---	---	---
AQR	9716	broad.mit.edu	37	15	35174666	35174667	+	Intron	INS	-	A	A	rs34949352		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35174666_35174667insA	uc001ziv.2	-							NM_014691	NP_055506			aquarius							catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	37572309	37572310	+	IGR	INS	-	T	T	rs138655828	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37572309_37572310insT								MEIS2 (178809 upstream) : TMCO5A (654517 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	38420843	38420843	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38420843delA								TMCO5A (160918 upstream) : SPRED1 (124209 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	38515879	38515879	+	Intron	DEL	G	-	-	rs10712244		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:38515879delG	uc001zjy.2	-											Homo sapiens, clone IMAGE:3923347, mRNA.																														---	---	---	---
EIF2AK4	440275	broad.mit.edu	37	15	40312366	40312367	+	Intron	INS	-	A	A	rs149687705		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40312366_40312367insA	uc001zkm.1	+						EIF2AK4_uc010bbj.1_Intron|EIF2AK4_uc001zkn.1_Intron|EIF2AK4_uc001zko.1_Intron|EIF2AK4_uc010bbk.1_Intron	NM_001013703	NP_001013725			eukaryotic translation initiation factor 2 alpha						translation	cytosolic ribosome	aminoacyl-tRNA ligase activity|ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|protein homodimerization activity			lung(2)|stomach(1)|skin(1)	4		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)														---	---	---	---
RAD51	5888	broad.mit.edu	37	15	40993575	40993575	+	Intron	DEL	T	-	-	rs67977099		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40993575delT	uc001zmi.3	+						RAD51_uc010bbw.2_Intron|RAD51_uc010bbx.2_Intron|RAD51_uc001zmk.3_Intron|RAD51_uc001zml.3_Intron|RAD51_uc001zmm.1_Intron|RAD51_uc001zmn.1_Intron	NM_002875	NP_002866			RAD51 homolog protein isoform 1						DNA recombinase assembly|DNA unwinding involved in replication|mitotic recombination|positive regulation of DNA ligation|protein homooligomerization|reciprocal meiotic recombination	mitochondrial matrix|nucleus|perinuclear region of cytoplasm|PML body	ATP binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|protein C-terminus binding|single-stranded DNA binding|single-stranded DNA-dependent ATPase activity				0		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)									Homologous_recombination					---	---	---	---
FAM82A2	55177	broad.mit.edu	37	15	41034369	41034370	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41034369_41034370insT	uc001zmo.1	-						FAM82A2_uc001zmp.1_Intron|FAM82A2_uc001zmq.1_Intron	NM_018145	NP_060615			family with sequence similarity 82, member A2						apoptosis|cell differentiation	integral to membrane|microtubule|mitochondrial membrane|nucleus|spindle pole	protein binding				0																		---	---	---	---
OIP5	11339	broad.mit.edu	37	15	41611273	41611273	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41611273delT	uc001znp.2	-							NM_007280	NP_009211			Opa interacting protein 5						cell communication|cell division|CenH3-containing nucleosome assembly at centromere|mitosis	Cajal body|chromatin|chromosome, centromeric region	protein binding				0		all_cancers(109;4.16e-14)|all_epithelial(112;7.09e-12)|Lung NSC(122;1.14e-09)|all_lung(180;2.56e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)		OV - Ovarian serous cystadenocarcinoma(18;1.49e-16)|GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.163)														---	---	---	---
MGA	23269	broad.mit.edu	37	15	41943881	41943897	+	Intron	DEL	TTCCCCTCTCTTACCCC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41943881_41943897delTTCCCCTCTCTTACCCC	uc001zog.1	+							NM_001080541	NP_001074010			MAX-interacting protein isoform 2							MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)														---	---	---	---
MAPKBP1	23005	broad.mit.edu	37	15	42088804	42088804	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42088804delC	uc001zok.3	+						MAPKBP1_uc001zoj.3_Intron|MAPKBP1_uc010bcj.2_Intron|MAPKBP1_uc010bci.2_Intron|MAPKBP1_uc010udb.1_Intron|MAPKBP1_uc010bck.2_Intron	NM_001128608	NP_001122080			mitogen-activated protein kinase binding protein											central_nervous_system(5)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	10		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	44514133	44514136	+	IGR	DEL	GTGT	-	-	rs34390669		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44514133_44514136delGTGT								FRMD5 (26704 upstream) : CASC4 (66793 downstream)																																			---	---	---	---
SPG11	80208	broad.mit.edu	37	15	44919791	44919792	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44919791_44919792insT	uc001ztx.2	-						SPG11_uc010ueh.1_Intron|SPG11_uc010uei.1_Intron|SPG11_uc001zua.1_Intron	NM_025137	NP_079413			spatacsin isoform 1						cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)														---	---	---	---
TRIM69	140691	broad.mit.edu	37	15	45027639	45027642	+	Intron	DEL	GAAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45027639_45027642delGAAG	uc001zuf.2	+						TRIM69_uc001zui.1_5'Flank|TRIM69_uc010bdy.1_5'Flank|TRIM69_uc001zug.1_5'Flank|TRIM69_uc001zuh.1_5'Flank	NM_182985	NP_892030			tripartite motif-containing 69 isoform a						apoptosis	nuclear speck	zinc ion binding				0		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)														---	---	---	---
SORD	6652	broad.mit.edu	37	15	45366589	45366589	+	3'UTR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45366589delC	uc001zul.3	+	9					SORD_uc001zum.3_3'UTR|SORD_uc010bdz.2_3'UTR	NM_003104	NP_003095			sorbitol dehydrogenase						fructose biosynthetic process|glucose metabolic process|L-xylitol catabolic process|sorbitol catabolic process|sperm motility	cilium|extracellular space|flagellum|membrane fraction|mitochondrial membrane|soluble fraction	L-iditol 2-dehydrogenase activity|NAD binding|sugar binding|zinc ion binding				0		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)	NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	15	45600755	45600755	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45600755delA								SLC28A2 (32623 upstream) : GATM (52569 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	46278928	46278928	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:46278928delT								SQRDL (295450 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	48948045	48948046	+	IGR	INS	-	GT	GT	rs144629696	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48948045_48948046insGT								FBN1 (10127 upstream) : CEP152 (82303 downstream)																																			---	---	---	---
SHC4	399694	broad.mit.edu	37	15	49176726	49176727	+	Intron	INS	-	T	T	rs146399374	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49176726_49176727insT	uc001zxb.1	-							NM_203349	NP_976224			rai-like protein						intracellular signal transduction	cell junction|postsynaptic membrane				ovary(3)|pancreas(2)	5		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)														---	---	---	---
SECISBP2L	9728	broad.mit.edu	37	15	49326618	49326618	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49326618delT	uc001zxe.1	-						SECISBP2L_uc001zxd.1_Intron|SECISBP2L_uc010bep.1_Intron|SECISBP2L_uc010beq.1_Intron	NM_014701	NP_055516			SECIS binding protein 2-like											breast(1)|skin(1)	2																		---	---	---	---
GALK2	2585	broad.mit.edu	37	15	49516402	49516405	+	Intron	DEL	TTTA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49516402_49516405delTTTA	uc001zxj.1	+						GALK2_uc001zxi.1_Intron|GALK2_uc010ufb.1_Intron|GALK2_uc001zxk.2_Intron|GALK2_uc010ufc.1_Intron	NM_002044	NP_002035			galactokinase 2 isoform 1						galactose metabolic process	cytoplasm	ATP binding|galactokinase activity|N-acetylgalactosamine kinase activity			breast(1)	1		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)														---	---	---	---
DMXL2	23312	broad.mit.edu	37	15	51819453	51819454	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51819453_51819454insA	uc002abf.2	-						DMXL2_uc010ufy.1_Intron|DMXL2_uc010bfa.2_Intron	NM_015263	NP_056078			Dmx-like 2							cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)														---	---	---	---
KIAA1370	56204	broad.mit.edu	37	15	52968740	52968740	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52968740delT	uc002acg.3	-						KIAA1370_uc002ach.3_Intron|KIAA1370_uc010bfg.1_Intron	NM_019600	NP_062546			hypothetical protein LOC56204												0				all cancers(107;0.0803)														---	---	---	---
WDR72	256764	broad.mit.edu	37	15	53992967	53992967	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53992967delA	uc002acj.2	-						WDR72_uc010bfi.1_Intron	NM_182758	NP_877435			WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)														---	---	---	---
PRTG	283659	broad.mit.edu	37	15	55995002	55995003	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55995002_55995003delAC	uc002adg.2	-							NM_173814	NP_776175			protogenin precursor						multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)														---	---	---	---
NEDD4	4734	broad.mit.edu	37	15	56213073	56213073	+	Intron	DEL	A	-	-	rs78910147		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56213073delA	uc002adl.2	-							NM_006154	NP_006145			neural precursor cell expressed, developmentally						development involved in symbiotic interaction|glucocorticoid receptor signaling pathway|negative regulation of sodium ion transport|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage|negative regulation of vascular endothelial growth factor receptor signaling pathway|neuron projection development|positive regulation of nucleocytoplasmic transport|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein catabolic process|progesterone receptor signaling pathway|protein K63-linked ubiquitination|protein targeting to lysosome|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|receptor internalization|regulation of dendrite morphogenesis|response to calcium ion|transmission of virus	apicolateral plasma membrane|cell cortex|chromatin|cytosol|perinuclear region of cytoplasm|ubiquitin ligase complex	beta-2 adrenergic receptor binding|phosphoserine binding|phosphothreonine binding|proline-rich region binding|protein domain specific binding|RNA polymerase binding|sodium channel inhibitor activity|ubiquitin binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|breast(1)	4				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	56892459	56892460	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56892459_56892460insT	uc002ads.2	-											Homo sapiens cDNA clone IMAGE:5275275.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	57581198	57581198	+	IGR	DEL	A	-	-	rs11354631		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57581198delA								TCF12 (486 upstream) : LOC283663 (11365 downstream)																																			---	---	---	---
ADAM10	102	broad.mit.edu	37	15	59006491	59006492	+	Intron	INS	-	AC	AC	rs146534670	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59006491_59006492insAC	uc002afd.1	-						ADAM10_uc010bgc.1_Intron|ADAM10_uc010ugz.1_Intron|ADAM10_uc002afe.1_Intron|ADAM10_uc002afg.2_Intron	NM_001110	NP_001101			ADAM metallopeptidase domain 10 precursor						cell-cell signaling|constitutive protein ectodomain proteolysis|epidermal growth factor receptor signaling pathway|in utero embryonic development|integrin-mediated signaling pathway|monocyte activation|negative regulation of cell adhesion|Notch receptor processing|Notch signaling pathway|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of T cell chemotaxis|protein phosphorylation|response to tumor necrosis factor	cell surface|endomembrane system|Golgi-associated vesicle|integral to membrane|nucleus|plasma membrane	integrin binding|metalloendopeptidase activity|protein homodimerization activity|protein kinase binding|SH3 domain binding|zinc ion binding			skin(2)	2				GBM - Glioblastoma multiforme(80;0.202)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	60337511	60337512	+	IGR	INS	-	T	T	rs148551789	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60337511_60337512insT								FOXB1 (9103 upstream) : ANXA2 (301839 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	60515149	60515150	+	IGR	INS	-	AC	AC	rs140842045	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60515149_60515150insAC								FOXB1 (186741 upstream) : ANXA2 (124201 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	60628089	60628090	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60628089_60628090delTC								FOXB1 (299681 upstream) : ANXA2 (11261 downstream)																																			---	---	---	---
VPS13C	54832	broad.mit.edu	37	15	62150517	62150524	+	Intron	DEL	CTATCTAT	-	-	rs67541856		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62150517_62150524delCTATCTAT	uc002agz.2	-						VPS13C_uc002aha.2_Intron	NM_020821	NP_065872			vacuolar protein sorting 13C protein isoform 2A						protein localization					ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	62899933	62899934	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62899933_62899934insT								C2CD4B (442451 upstream) : MGC15885 (29437 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	63298526	63298529	+	IGR	DEL	ACAT	-	-	rs10580376		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63298526_63298529delACAT								TLN2 (161699 upstream) : TPM1 (36309 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	64130303	64130303	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64130303delT								HERC1 (4156 upstream) : MIR422A (32826 downstream)																																			---	---	---	---
ZNF609	23060	broad.mit.edu	37	15	64880851	64880851	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64880851delT	uc002ann.2	+							NM_015042	NP_055857			zinc finger protein 609							nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3																		---	---	---	---
MAP2K5	5607	broad.mit.edu	37	15	67839510	67839511	+	Intron	INS	-	G	G	rs139383200	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67839510_67839511insG	uc002aqu.2	+						MAP2K5_uc002aqt.1_Intron|MAP2K5_uc002aqv.2_Intron|MAP2K5_uc010ujw.1_5'Flank	NM_145160	NP_660143			mitogen-activated protein kinase kinase 5						nerve growth factor receptor signaling pathway		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)	2																		---	---	---	---
FEM1B	10116	broad.mit.edu	37	15	68586928	68586929	+	3'UTR	INS	-	T	T	rs28498450		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68586928_68586929insT	uc002arh.2	+	1						NM_015322	NP_056137			fem-1 homolog b						apoptosis|induction of apoptosis|regulation of DNA damage checkpoint|regulation of ubiquitin-protein ligase activity	cytoplasm|nucleus	death receptor binding|ubiquitin-protein ligase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	70293894	70293894	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70293894delT								C15orf50 (158589 upstream) : TLE3 (46649 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	70858272	70858273	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70858272_70858273delAC								TLE3 (468016 upstream) : UACA (88622 downstream)																																			---	---	---	---
THSD4	79875	broad.mit.edu	37	15	72027419	72027420	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72027419_72027420delAC	uc002atb.1	+						THSD4_uc010ukg.1_Intron|THSD4_uc002ate.2_Intron	NM_024817	NP_079093			thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	74462428	74462429	+	IGR	DEL	GC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74462428_74462429delGC								ISLR2 (33287 upstream) : ISLR (3658 downstream)																																			---	---	---	---
SCAMP5	192683	broad.mit.edu	37	15	75287197	75287198	+	5'Flank	INS	-	CT	CT	rs145239631	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75287197_75287198insCT	uc002azk.1	+						SCAMP5_uc002azl.1_5'Flank|SCAMP5_uc002azm.1_5'Flank|SCAMP5_uc002azn.1_5'Flank|SCAMP5_uc010uly.1_5'Flank|uc010bki.1_5'Flank	NM_138967	NP_620417			secretory carrier membrane protein 5						exocytosis|negative regulation of endocytosis|positive regulation of calcium ion-dependent exocytosis|positive regulation of cytokine secretion|protein transport|response to endoplasmic reticulum stress	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane|trans-Golgi network membrane	protein binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	75349820	75349821	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75349820_75349821insT								PPCDC (6754 upstream) : C15orf39 (141412 downstream)																																			---	---	---	---
SIN3A	25942	broad.mit.edu	37	15	75666096	75666096	+	Intron	DEL	A	-	-	rs76686250		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75666096delA	uc002bai.2	-						SIN3A_uc002baj.2_Intron|SIN3A_uc010uml.1_Intron	NM_015477	NP_056292			transcriptional co-repressor Sin3A						blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	76122934	76122935	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76122934_76122935insA								DNM1P35 (90432 upstream) : UBE2Q2 (12687 downstream)																																			---	---	---	---
NRG4	145957	broad.mit.edu	37	15	76244934	76244934	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76244934delT	uc002bbo.2	-						NRG4_uc010bkm.1_Intron|NRG4_uc002bbn.2_Intron|NRG4_uc010bkn.2_Intron|NRG4_uc010bko.2_Intron	NM_138573	NP_612640			neuregulin 4							extracellular region|integral to membrane|plasma membrane	growth factor activity				0																		---	---	---	---
C15orf27	123591	broad.mit.edu	37	15	76408619	76408619	+	Intron	DEL	T	-	-	rs71444963		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76408619delT	uc002bbq.2	+						C15orf27_uc010bkp.2_Intron	NM_152335	NP_689548			hypothetical protein LOC123591							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	77991839	77991840	+	IGR	DEL	CC	-	-	rs76567457		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77991839_77991840delCC								LINGO1 (3364 upstream) : LOC645752 (214719 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	80093481	80093482	+	IGR	INS	-	CTCT	CTCT	rs71816946		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80093481_80093482insCTCT								KIAA1024 (328839 upstream) : MTHFS (43838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	82016040	82016041	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82016040_82016041delTG								TMC3 (349622 upstream) : MEX3B (318087 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	83982959	83982960	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83982959_83982960insT								BNC1 (29491 upstream) : SH3GL3 (133131 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	85266873	85266874	+	IGR	INS	-	T	T	rs56284713		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85266873_85266874insT								SEC11A (7199 upstream) : ZNF592 (24944 downstream)																																			---	---	---	---
SLC28A1	9154	broad.mit.edu	37	15	85449858	85449859	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85449858_85449859insT	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204			solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)															---	---	---	---
SLC28A1	9154	broad.mit.edu	37	15	85459161	85459163	+	Intron	DEL	TGT	-	-	rs71466061		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85459161_85459163delTGT	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204			solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)															---	---	---	---
PDE8A	5151	broad.mit.edu	37	15	85608282	85608283	+	Intron	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85608282_85608283delAG	uc002blh.2	+						PDE8A_uc002bli.2_Intron|PDE8A_uc010bnc.2_Intron|PDE8A_uc010bnd.2_Intron|PDE8A_uc002blj.2_Intron|PDE8A_uc002blk.2_Intron	NM_002605	NP_002596			phosphodiesterase 8A isoform 1						cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)															---	---	---	---
AKAP13	11214	broad.mit.edu	37	15	86228693	86228694	+	Intron	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86228693_86228694delGT	uc002blv.1	+						AKAP13_uc002blu.1_Intron|AKAP13_uc010bnf.1_Intron|AKAP13_uc002blw.1_Intron|AKAP13_uc002blx.1_Intron	NM_007200	NP_009131			A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	86397860	86397861	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86397860_86397861delGT								KLHL25 (59671 upstream) : AGBL1 (287381 downstream)																																	OREG0023428	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
Unknown	0	broad.mit.edu	37	15	86496247	86496247	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86496247delT								KLHL25 (158058 upstream) : AGBL1 (188995 downstream)																																			---	---	---	---
AGBL1	123624	broad.mit.edu	37	15	86820550	86820551	+	Intron	DEL	TG	-	-	rs113656317		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86820550_86820551delTG	uc002blz.1	+						AGBL1_uc002bma.1_Intron|AGBL1_uc002bmb.1_Intron	NM_152336	NP_689549			ATP/GTP binding protein-like 1						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	15	89150197	89150198	+	5'Flank	INS	-	A	A	rs149819808	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89150197_89150198insA	uc002bms.1	-						MIR1179_hsa-mir-1179|MI0006272_5'Flank					Homo sapiens cDNA FLJ30187 fis, clone BRACE2001239.																														---	---	---	---
Unknown	0	broad.mit.edu	37	15	89156817	89156818	+	IGR	INS	-	G	G	rs142335168	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89156817_89156818insG								MIR7-2 (1652 upstream) : AEN (7709 downstream)																																			---	---	---	---
ACAN	176	broad.mit.edu	37	15	89350978	89350979	+	Intron	INS	-	GTGT	GTGT	rs71462461		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89350978_89350979insGTGT	uc010upo.1	+						ACAN_uc002bmx.2_Intron|ACAN_uc010upp.1_Intron|ACAN_uc002bna.2_Intron	NM_013227	NP_037359			aggrecan isoform 2 precursor						cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	89586685	89586686	+	IGR	INS	-	AGAAGGAGA	AGAAGGAGA	rs58223332		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89586685_89586686insAGAAGGAGA								MFGE8 (130022 upstream) : ABHD2 (44695 downstream)																																			---	---	---	---
AP3S2	10239	broad.mit.edu	37	15	90425599	90425599	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90425599delT	uc002boq.3	-						AP3S2_uc002bos.3_Intron|AP3S2_uc010bns.2_Intron|AP3S2_uc002bor.3_Intron|AP3S2_uc010bnt.2_Intron	NM_005829	NP_005820			adaptor-related protein complex 3, sigma 2						intracellular protein transport|vesicle-mediated transport	cytoplasmic vesicle membrane|Golgi apparatus|membrane coat	protein transporter activity				0	Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)															---	---	---	---
CRTC3	64784	broad.mit.edu	37	15	91181090	91181091	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91181090_91181091insT	uc002bpp.2	+						CRTC3_uc002bpo.2_Intron	NM_022769	NP_073606			transducer of regulated CREB protein 3 isoform						interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus			CRTC3/MAML2(26)	salivary_gland(26)|ovary(1)	27	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)					T	MAML2	salivary gland mucoepidermoid								---	---	---	---
Unknown	0	broad.mit.edu	37	15	92867428	92867428	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92867428delT								SLCO3A1 (151763 upstream) : ST8SIA2 (69712 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	93341122	93341122	+	IGR	DEL	T	-	-	rs68081827		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93341122delT								FAM174B (63818 upstream) : CHD2 (88311 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	94770053	94770054	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:94770053_94770054insT								None (None upstream) : MCTP2 (4747 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	95385363	95385364	+	IGR	INS	-	TG	TG	rs147057096	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95385363_95385364insTG								MCTP2 (358183 upstream) : LOC145820 (590958 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	99076662	99076663	+	IGR	INS	-	AGGA	AGGA	rs150869635	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99076662_99076663insAGGA								FAM169B (19051 upstream) : IGF1R (116098 downstream)																																			---	---	---	---
IGF1R	3480	broad.mit.edu	37	15	99332422	99332422	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99332422delT	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron	NM_000875	NP_000866			insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)													---	---	---	---
IGF1R	3480	broad.mit.edu	37	15	99362531	99362532	+	Intron	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99362531_99362532insC	uc002bul.2	+						IGF1R_uc010urq.1_Intron|IGF1R_uc010bon.2_Intron	NM_000875	NP_000866			insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)													---	---	---	---
TTC23	64927	broad.mit.edu	37	15	99707343	99707346	+	Intron	DEL	GACA	-	-	rs35747956		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99707343_99707346delGACA	uc002bur.2	-						TTC23_uc002bus.2_Intron|TTC23_uc002but.2_Intron|TTC23_uc002buu.2_Intron|TTC23_uc002buv.2_Intron|TTC23_uc002bux.2_Intron|TTC23_uc002buw.2_Intron|TTC23_uc010boq.2_Intron|TTC23_uc002buy.2_Intron|TTC23_uc010bor.2_Intron|TTC23_uc002buz.2_Intron	NM_022905	NP_075056			tetratricopeptide repeat domain 23								binding				0	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)															---	---	---	---
TTC23	64927	broad.mit.edu	37	15	99715088	99715089	+	Intron	INS	-	A	A	rs150115530	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99715088_99715089insA	uc002bur.2	-						TTC23_uc002bus.2_Intron|TTC23_uc002but.2_Intron|TTC23_uc002buu.2_Intron|TTC23_uc002buv.2_Intron|TTC23_uc002bux.2_Intron|TTC23_uc002buw.2_Intron|TTC23_uc010boq.2_Intron|TTC23_uc002buy.2_Intron|TTC23_uc010bor.2_Intron|TTC23_uc002buz.2_Intron	NM_022905	NP_075056			tetratricopeptide repeat domain 23								binding				0	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)															---	---	---	---
ADAMTS17	170691	broad.mit.edu	37	15	100836780	100836781	+	Intron	DEL	GG	-	-	rs142076301		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100836780_100836781delGG	uc002bvv.1	-						ADAMTS17_uc002bvx.1_Intron	NM_139057	NP_620688			ADAM metallopeptidase with thrombospondin type 1						proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)														---	---	---	---
Unknown	0	broad.mit.edu	37	15	101109327	101109328	+	IGR	INS	-	A	A	rs141369497		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101109327_101109328insA								LASS3 (24402 upstream) : LINS1 (108 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	15	101236880	101236880	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101236880delC								ASB7 (44978 upstream) : ALDH1A3 (183129 downstream)																																			---	---	---	---
LRRK1	79705	broad.mit.edu	37	15	101551789	101551790	+	Intron	INS	-	TG	TG	rs144699822	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101551789_101551790insTG	uc002bwr.2	+						LRRK1_uc010usb.1_Intron|LRRK1_uc010usc.1_Intron	NM_024652	NP_078928			leucine-rich repeat kinase 1						small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)															---	---	---	---
Unknown	0	broad.mit.edu	37	15	101622067	101622070	+	IGR	DEL	AGAT	-	-	rs66529807		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101622067_101622070delAGAT								LRRK1 (11752 upstream) : CHSY1 (93862 downstream)																																			---	---	---	---
SOLH	6650	broad.mit.edu	37	16	600809	600810	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:600809_600810insT	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623			small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)																---	---	---	---
SOLH	6650	broad.mit.edu	37	16	601007	601007	+	Intron	DEL	T	-	-	rs76921944		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:601007delT	uc002chi.2	+						SOLH_uc002chj.2_5'Flank	NM_005632	NP_005623			small optic lobes						proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)																---	---	---	---
LMF1	64788	broad.mit.edu	37	16	909086	909087	+	Intron	INS	-	TGTCTCGAGACGGGTGTGCAGTGA	TGTCTCGAGACGGGTGTGCAGTGA	rs74187282		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:909086_909087insTGTCTCGAGACGGGTGTGCAGTGA	uc002ckj.2	-						LMF1_uc010brg.2_Intron|LMF1_uc010brh.2_Intron|LMF1_uc010bri.2_Intron|LMF1_uc002ckk.2_Intron	NM_022773	NP_073610			lipase maturation factor 1							endoplasmic reticulum membrane|integral to membrane					0		Hepatocellular(780;0.00308)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	1075451	1075474	+	IGR	DEL	GGTGTGGAGGGTGCTGAGGTCCCC	-	-	rs72269290	by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1075451_1075474delGGTGTGGAGGGTGCTGAGGTCCCC								SOX8 (38473 upstream) : LOC146336 (38610 downstream)																																			---	---	---	---
UBE2I	7329	broad.mit.edu	37	16	1356344	1356367	+	5'Flank	DEL	ACCTGCTCCATGACCCTCACCCCT	-	-	rs61151448	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1356344_1356367delACCTGCTCCATGACCCTCACCCCT	uc002clc.1	+						uc010uuy.1_RNA|UBE2I_uc002cld.1_5'Flank	NM_194261	NP_919237			ubiquitin-conjugating enzyme E2I						cell division|chromosome segregation|interspecies interaction between organisms|mitosis|negative regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|protein sumoylation	cytoplasm|PML body|synaptonemal complex	ATP binding|enzyme binding|ubiquitin-protein ligase activity			breast(1)|skin(1)	2		Hepatocellular(780;0.00369)																---	---	---	---
HN1L	90861	broad.mit.edu	37	16	1744691	1744692	+	Intron	INS	-	T	T	rs113020653		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1744691_1744692insT	uc002cmg.2	+						HN1L_uc010uvi.1_Intron|HN1L_uc010brt.2_Intron|HN1L_uc010bru.2_Intron|HN1L_uc010uvj.1_Intron|HN1L_uc010uvk.1_Intron	NM_144570	NP_653171			hematological and neurological expressed 1-like							cytoplasm|nucleus				upper_aerodigestive_tract(1)	1																		---	---	---	---
FLYWCH1	84256	broad.mit.edu	37	16	2995634	2995634	+	Intron	DEL	A	-	-	rs145477637		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2995634delA	uc002csd.2	+						FLYWCH1_uc002csc.2_Intron|FLYWCH1_uc010bsv.2_Intron|FLYWCH1_uc002cse.2_Intron	NM_032296	NP_115672			FLYWCH-type zinc finger 1 isoform a							nucleus	DNA binding|metal ion binding				0																		---	---	---	---
ZNF597	146434	broad.mit.edu	37	16	3490634	3490634	+	Intron	DEL	A	-	-	rs79841297		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3490634delA	uc002cvd.2	-							NM_152457	NP_689670			zinc finger protein 597						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	3995577	3995577	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3995577delT								CREBBP (65456 upstream) : ADCY9 (17076 downstream)																																			---	---	---	---
MGRN1	23295	broad.mit.edu	37	16	4737208	4737209	+	3'UTR	INS	-	C	C	rs140104565	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4737208_4737209insC	uc002cwz.2	+	17					MGRN1_uc002cxa.2_Intron|MGRN1_uc010btx.2_Intron|MGRN1_uc010btw.2_3'UTR|MGRN1_uc002cxb.2_Intron|MGRN1_uc010uxo.1_Intron|MGRN1_uc010uxp.1_3'UTR|MGRN1_uc010uxq.1_Intron	NM_001142290	NP_001135762			mahogunin, ring finger 1 isoform 3						endosome to lysosome transport|negative regulation of cAMP-mediated signaling|negative regulation of G-protein coupled receptor protein signaling pathway|protein monoubiquitination	cytosol|early endosome|nucleus|plasma membrane|plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	6598626	6598626	+	Intron	DEL	G	-	-	rs72762903		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6598626delG	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
A2BP1	54715	broad.mit.edu	37	16	7112047	7112047	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7112047delG	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron|A2BP1_uc010uya.1_Intron|A2BP1_uc002cyv.1_Intron|A2BP1_uc010uyb.1_Intron	NM_018723	NP_061193			ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	8156555	8156555	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8156555delT								A2BP1 (393215 upstream) : TMEM114 (462948 downstream)																																			---	---	---	---
CARHSP1	23589	broad.mit.edu	37	16	8954826	8954826	+	Intron	DEL	G	-	-	rs117562507	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8954826delG	uc002czh.1	-						CARHSP1_uc002czi.1_Intron	NM_001042476	NP_001035941			calcium-regulated heat-stable protein 1						intracellular signal transduction|regulation of mRNA stability|regulation of transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|P granule	DNA binding|mRNA 3'-UTR binding|phosphatase binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	9341904	9341904	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9341904delA								C16orf72 (128359 upstream) : GRIN2A (505363 downstream)																																			---	---	---	---
GRIN2A	2903	broad.mit.edu	37	16	10097939	10097939	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10097939delA	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879			N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)													---	---	---	---
TEKT5	146279	broad.mit.edu	37	16	10772987	10772987	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10772987delA	uc002czz.1	-							NM_144674	NP_653275			tektin 5						microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	10921105	10921105	+	IGR	DEL	T	-	-	rs111355780		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10921105delT								FAM18A (8484 upstream) : CIITA (49950 downstream)																																			---	---	---	---
TXNDC11	51061	broad.mit.edu	37	16	11807902	11807903	+	Intron	INS	-	T	T	rs71406278		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11807902_11807903insT	uc010buu.1	-						TXNDC11_uc002dbg.1_Intron	NM_015914	NP_056998			thioredoxin domain containing 11						cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
TXNDC11	51061	broad.mit.edu	37	16	11820079	11820080	+	Intron	DEL	GC	-	-	rs71921101		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11820079_11820080delGC	uc010buu.1	-						TXNDC11_uc002dbg.1_Intron	NM_015914	NP_056998			thioredoxin domain containing 11						cell redox homeostasis	endoplasmic reticulum membrane|integral to membrane					0																		---	---	---	---
SHISA9	729993	broad.mit.edu	37	16	13298068	13298071	+	Intron	DEL	TCTA	-	-	rs56691123	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13298068_13298071delTCTA	uc010uyy.1	+							NM_001145204	NP_001138676			shisa homolog 9 isoform 1						regulation of short-term neuronal synaptic plasticity	cell junction|dendritic spine membrane|ionotropic glutamate receptor complex|synapse					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	13356489	13356496	+	IGR	DEL	GGAAGGAA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:13356489_13356496delGGAAGGAA								SHISA9 (22217 upstream) : ERCC4 (657518 downstream)																																			---	---	---	---
ERCC4	2072	broad.mit.edu	37	16	14013455	14013455	+	5'Flank	DEL	A	-	-	rs148407800		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14013455delA	uc002dce.2	+						ERCC4_uc010bva.2_5'Flank	NM_005236	NP_005227			excision repair cross-complementing rodent						double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10								Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum		OREG0023622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
PARN	5073	broad.mit.edu	37	16	14616158	14616158	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14616158delT	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron	NM_002582	NP_002573			poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2																		---	---	---	---
BFAR	51283	broad.mit.edu	37	16	14733171	14733171	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14733171delT	uc002dco.2	+						BFAR_uc002dcm.2_Intron|BFAR_uc002dcn.2_Intron|BFAR_uc002dcp.2_Intron	NM_016561	NP_057645			bifunctional apoptosis regulator						anti-apoptosis|apoptosis	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	structural molecule activity|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---
NOMO1	23420	broad.mit.edu	37	16	14982078	14982078	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14982078delT	uc002dcv.2	+							NM_014287	NP_055102			nodal modulator 1 precursor							integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			ovary(1)	1																		---	---	---	---
ABCC1	4363	broad.mit.edu	37	16	16140202	16140202	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16140202delT	uc010bvi.2	+						ABCC1_uc010bvj.2_Intron|ABCC1_uc010bvk.2_Intron|ABCC1_uc010bvl.2_Intron|ABCC1_uc010bvm.2_Intron|ABCC1_uc002del.3_Intron|ABCC1_uc010bvn.2_Intron	NM_004996	NP_004987			ATP-binding cassette, sub-family C, member 1						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)													---	---	---	---
GDE1	51573	broad.mit.edu	37	16	19522426	19522426	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19522426delT	uc002dgh.2	-						GDE1_uc002dgi.2_Intron	NM_016641	NP_057725			glycerophosphodiester phosphodiesterase 1						glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol glycerophosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
C16orf62	57020	broad.mit.edu	37	16	19665869	19665869	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19665869delA	uc002dgn.1	+						C16orf62_uc002dgo.1_Intron|C16orf62_uc002dgp.1_Intron	NM_020314	NP_064710			hypothetical protein LOC57020							integral to membrane				ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	20195517	20195518	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20195517_20195518insA								GPR139 (110417 upstream) : GP2 (126294 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	20634128	20634129	+	IGR	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20634128_20634129delCT								ACSM2B (46433 upstream) : ACSM1 (430 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	21514920	21514921	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21514920_21514921insA	uc002diq.3	+						LOC100271836_uc002dja.2_Intron|LOC100271836_uc002djb.2_Intron					Homo sapiens cDNA FLJ59829 complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	21548861	21548862	+	Intron	INS	-	T	T	rs139548125		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21548861_21548862insT	uc002diq.3	+											Homo sapiens cDNA FLJ59829 complete cds.																														---	---	---	---
VWA3A	146177	broad.mit.edu	37	16	22165059	22165060	+	Intron	INS	-	T	T	rs34593549		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22165059_22165060insT	uc010vbq.1	+						VWA3A_uc010bxd.2_Intron|VWA3A_uc002dkg.3_Intron|VWA3A_uc010bxe.1_Intron	NM_173615	NP_775886			von Willebrand factor A domain containing 3A							extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	22649746	22649746	+	IGR	DEL	A	-	-	rs112982138		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22649746delA								LOC653786 (61560 upstream) : HS3ST2 (176114 downstream)																																			---	---	---	---
HS3ST2	9956	broad.mit.edu	37	16	22916745	22916746	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22916745_22916746insT	uc002dli.2	+						HS3ST2_uc002dlj.2_Intron	NM_006043	NP_006034			heparan sulfate D-glucosaminyl							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(48;0.0299)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	23030892	23030892	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23030892delG								HS3ST2 (103235 upstream) : USP31 (41837 downstream)																																			---	---	---	---
PRKCB	5579	broad.mit.edu	37	16	23993493	23993497	+	Intron	DEL	CCTTT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23993493_23993497delCCTTT	uc002dmd.2	+						PRKCB_uc002dme.2_Intron	NM_212535	NP_997700			protein kinase C, beta isoform 1						apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)													---	---	---	---
HS3ST4	9951	broad.mit.edu	37	16	25884642	25884645	+	Intron	DEL	TCCT	-	-	rs56296232	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25884642_25884645delTCCT	uc002dof.2	+							NM_006040	NP_006031			heparan sulfate D-glucosaminyl						heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	26678289	26678289	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26678289delA								HS3ST4 (529281 upstream) : C16orf82 (399930 downstream)																																			---	---	---	---
BOLA2	552900	broad.mit.edu	37	16	29716866	29716866	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29716866delC	uc010bzb.1	-						uc002dtf.2_Intron					SubName: Full=Putative uncharacterized protein ENSP00000369970; Flags: Fragment;												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	30658429	30658444	+	IGR	DEL	GAAGGAAGGAAGGAAG	-	-	rs72263426		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30658429_30658444delGAAGGAAGGAAGGAAG								ZNF689 (36747 upstream) : PRR14 (3797 downstream)																																			---	---	---	---
FBXL19	54620	broad.mit.edu	37	16	30948066	30948067	+	Intron	INS	-	T	T	rs141901288		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30948066_30948067insT	uc002eab.2	+						FBXL19_uc002dzz.1_Intron|FBXL19_uc002eaa.1_Intron	NM_001099784	NP_001093254			F-box and leucine-rich repeat protein 19								DNA binding|zinc ion binding			ovary(2)|lung(1)|breast(1)	4																		---	---	---	---
SETD1A	9739	broad.mit.edu	37	16	30987381	30987381	+	Intron	DEL	T	-	-	rs72258238		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30987381delT	uc002ead.1	+							NM_014712	NP_055527			SET domain containing 1A						regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3																		---	---	---	---
ITGAM	3684	broad.mit.edu	37	16	31342788	31342789	+	Intron	INS	-	TTG	TTG	rs144797541	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31342788_31342789insTTG	uc002ebq.2	+						ITGAM_uc002ebr.2_Intron|ITGAM_uc010can.2_Intron	NM_000632	NP_000623			integrin alpha M isoform 2 precursor						blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	31705425	31705425	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31705425delT								CSDAP1 (124580 upstream) : KIAA0664P3 (6509 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32128059	32128061	+	IGR	DEL	AAT	-	-	rs144687691	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32128059_32128061delAAT								ZNF267 (199433 upstream) : HERC2P4 (34549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32346387	32346389	+	IGR	DEL	TCA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32346387_32346389delTCA								HERC2P4 (182513 upstream) : TP53TG3B (338452 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32432680	32432681	+	IGR	DEL	TA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32432680_32432681delTA								HERC2P4 (268806 upstream) : TP53TG3B (252160 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32591494	32591494	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32591494delG								HERC2P4 (427620 upstream) : TP53TG3B (93347 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	32823261	32823261	+	IGR	DEL	T	-	-	rs112134849		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32823261delT								TP53TG3B (134383 upstream) : SLC6A10P (65536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33042909	33042909	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33042909delA								SLC6A10P (146446 upstream) : MIR1826 (922599 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33574019	33574020	+	IGR	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33574019_33574020delCT								SLC6A10P (677556 upstream) : MIR1826 (391488 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33583338	33583341	+	IGR	DEL	TTTA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33583338_33583341delTTTA								SLC6A10P (686875 upstream) : MIR1826 (382167 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33909568	33909569	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33909568_33909569insT								None (None upstream) : MIR1826 (55939 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	33967963	33967964	+	IGR	INS	-	A	A	rs76802482		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33967963_33967964insA								MIR1826 (2371 upstream) : UBE2MP1 (435838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	34191679	34191680	+	IGR	INS	-	A	A	rs76941580		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34191679_34191680insA								MIR1826 (226087 upstream) : UBE2MP1 (212122 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	46474330	46474330	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46474330delT								None (None upstream) : ANKRD26P1 (28919 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	48771666	48771667	+	IGR	DEL	AG	-	-	rs72373107		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48771666_48771667delAG								N4BP1 (127546 upstream) : CBLN1 (540544 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	50094919	50094919	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50094919delT								TMEM188 (23921 upstream) : HEATR3 (4962 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	50283356	50283357	+	IGR	INS	-	AAC	AAC	rs145801500	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50283356_50283357insAAC								PAPD5 (14139 upstream) : ADCY7 (17105 downstream)																																			---	---	---	---
CYLD	1540	broad.mit.edu	37	16	50832526	50832526	+	3'UTR	DEL	A	-	-	rs111804189		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50832526delA	uc002egp.1	+	19					CYLD_uc002egq.1_3'UTR|CYLD_uc002egr.1_3'UTR	NM_015247	NP_056062			ubiquitin carboxyl-terminal hydrolase CYLD						cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)						Mis|N|F|S		cylindroma	cylindroma			Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial				---	---	---	---
Unknown	0	broad.mit.edu	37	16	51462070	51462071	+	IGR	INS	-	TCCTTCCT	TCCTTCCT	rs142525402	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51462070_51462071insTCCTTCCT								SALL1 (276887 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51589940	51589940	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51589940delT								SALL1 (404757 upstream) : TOX3 (881978 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	51596957	51596958	+	IGR	INS	-	CA	CA	rs146174503	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51596957_51596958insCA								SALL1 (411774 upstream) : TOX3 (874960 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52140208	52140208	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52140208delT								SALL1 (955025 upstream) : TOX3 (331710 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52245165	52245166	+	IGR	DEL	GT	-	-	rs72360707		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52245165_52245166delGT								None (None upstream) : TOX3 (226752 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	52919459	52919460	+	IGR	INS	-	A	A	rs71376184		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52919459_52919460insA								TOX3 (337745 upstream) : CHD9 (169485 downstream)																																			---	---	---	---
FTO	79068	broad.mit.edu	37	16	53848996	53848997	+	Intron	DEL	AG	-	-	rs139458602		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53848996_53848997delAG	uc002ehr.2	+						FTO_uc010vha.1_Intron	NM_001080432	NP_001073901			fat mass and obesity associated						DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	54626821	54626821	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54626821delT								IRX3 (306443 upstream) : IRX5 (338290 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	54683278	54683279	+	IGR	INS	-	AT	AT	rs140785479	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54683278_54683279insAT								IRX3 (362900 upstream) : IRX5 (281832 downstream)																																			---	---	---	---
MMP2	4313	broad.mit.edu	37	16	55531252	55531253	+	Intron	INS	-	A	A	rs140337904	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55531252_55531253insA	uc002ehz.3	+						MMP2_uc010vhd.1_Intron|MMP2_uc010ccc.2_Intron|MMP2_uc002eia.3_Intron	NM_004530	NP_004521			matrix metalloproteinase 2 isoform a						angiogenesis|collagen catabolic process|proteolysis	extracellular space|membrane|nucleus|proteinaceous extracellular matrix	metalloendopeptidase activity|protein binding|zinc ion binding			large_intestine(3)|ovary(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	11		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Marimastat(DB00786)|Sulindac(DB00605)													---	---	---	---
Unknown	0	broad.mit.edu	37	16	55968588	55968591	+	IGR	DEL	GTGC	-	-	rs146498532	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55968588_55968591delGTGC								CES7 (9216 upstream) : LOC283856 (158308 downstream)																																			---	---	---	---
CPNE2	221184	broad.mit.edu	37	16	57134529	57134529	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57134529delG	uc002eks.1	+						CPNE2_uc010cct.1_Intron	NM_152727	NP_689940			copine II											central_nervous_system(1)|skin(1)	2		all_neural(199;0.224)																---	---	---	---
Unknown	0	broad.mit.edu	37	16	59043285	59043285	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:59043285delC								GOT2 (275039 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	60341513	60341514	+	IGR	INS	-	AA	AA	rs140354034	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60341513_60341514insAA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	61092992	61092993	+	IGR	DEL	CT	-	-	rs71709675		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61092992_61092993delCT								None (None upstream) : CDH8 (594242 downstream)																																			---	---	---	---
CDH8	1006	broad.mit.edu	37	16	61782123	61782124	+	Intron	INS	-	TCA	TCA	rs146455033	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61782123_61782124insTCA	uc002eog.1	-						CDH8_uc002eoh.2_Intron	NM_001796	NP_001787			cadherin 8, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	62578949	62578949	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62578949delT								CDH8 (508913 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	62784655	62784656	+	IGR	INS	-	TG	TG	rs147572219		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:62784655_62784656insTG								CDH8 (714619 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	64341169	64341170	+	IGR	INS	-	GT	GT	rs145883559	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64341169_64341170insGT								None (None upstream) : CDH11 (639515 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	64709474	64709475	+	IGR	INS	-	T	T	rs8049713	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64709474_64709475insT								None (None upstream) : CDH11 (271210 downstream)																																			---	---	---	---
CDH11	1009	broad.mit.edu	37	16	65084522	65084524	+	Intron	DEL	AAG	-	-	rs72278828		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65084522_65084524delAAG	uc002eoi.2	-						CDH11_uc002eoj.2_Intron|CDH11_uc010vin.1_Intron|CDH11_uc010vio.1_Intron	NM_001797	NP_001788			cadherin 11, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)				T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			---	---	---	---
Unknown	0	broad.mit.edu	37	16	65732869	65732870	+	IGR	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65732869_65732870delAG								LOC283867 (122666 upstream) : CDH5 (667655 downstream)																																			---	---	---	---
PLA2G15	23659	broad.mit.edu	37	16	68290782	68290782	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68290782delT	uc002evr.2	+						PLA2G15_uc010vld.1_Intron|PLA2G15_uc010vle.1_Intron|PLA2G15_uc010vlf.1_Intron|PLA2G15_uc002evs.2_Intron	NM_012320	NP_036452			lysophospholipase 3 (lysosomal phospholipase A2)						fatty acid catabolic process	extracellular region|lysosome	lysophospholipase activity|phosphatidylcholine-sterol O-acyltransferase activity|phospholipid binding			ovary(1)	1																		---	---	---	---
PRMT7	54496	broad.mit.edu	37	16	68371179	68371179	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68371179delT	uc002evy.1	+						PRMT7_uc002evx.1_Intron|PRMT7_uc010vlg.1_Intron|PRMT7_uc002evz.1_Intron	NM_019023	NP_061896			protein arginine methyltransferase 7						cell differentiation|DNA methylation involved in gamete generation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	[myelin basic protein]-arginine N-methyltransferase activity|histone methyltransferase activity (H4-R3 specific)|protein-arginine omega-N monomethyltransferase activity|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)														---	---	---	---
CDH3	1001	broad.mit.edu	37	16	68713597	68713598	+	Intron	INS	-	AA	AA	rs71382055		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68713597_68713598insAA	uc002ewf.2	+						CDH3_uc010vli.1_Intron	NM_001793	NP_001784			cadherin 3, type 1 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	p.?(1)		ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)														---	---	---	---
CDH3	1001	broad.mit.edu	37	16	68723460	68723460	+	Intron	DEL	G	-	-	rs148025482		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68723460delG	uc002ewf.2	+						CDH3_uc010vli.1_Intron	NM_001793	NP_001784			cadherin 3, type 1 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	p.?(1)		ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)														---	---	---	---
CYB5B	80777	broad.mit.edu	37	16	69472512	69472512	+	Intron	DEL	T	-	-	rs148942099		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69472512delT	uc002exg.1	+						CYB5B_uc002exf.2_Intron|CYB5B_uc010cfl.1_Intron	NM_030579	NP_085056			cytochrome b5 outer mitochondrial membrane						electron transport chain|transport	integral to membrane|mitochondrial outer membrane	heme binding				0		Ovarian(137;0.101)																---	---	---	---
GLG1	2734	broad.mit.edu	37	16	74600518	74600519	+	Intron	INS	-	T	T	rs145212461	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74600518_74600519insT	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139			golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	74823432	74823433	+	IGR	DEL	AC	-	-	rs35423535		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74823432_74823433delAC								FA2H (14711 upstream) : WDR59 (84038 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	74896548	74896549	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74896548_74896549insA								FA2H (87827 upstream) : WDR59 (10922 downstream)																																			---	---	---	---
CFDP1	10428	broad.mit.edu	37	16	75362043	75362043	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75362043delT	uc002fdy.2	-						CFDP1_uc002fdz.2_Intron	NM_006324	NP_006315			craniofacial development protein 1						multicellular organismal development					upper_aerodigestive_tract(1)	1																		---	---	---	---
CNTNAP4	85445	broad.mit.edu	37	16	76505013	76505014	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76505013_76505014delAC	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837			cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2																		---	---	---	---
ADAMTS18	170692	broad.mit.edu	37	16	77322296	77322297	+	Intron	INS	-	T	T	rs138894872	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77322296_77322297insT	uc002ffc.3	-							NM_199355	NP_955387			ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	77607975	77607975	+	IGR	DEL	G	-	-	rs2641792	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77607975delG								ADAMTS18 (138964 upstream) : NUDT7 (148436 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	77694655	77694656	+	IGR	INS	-	GT	GT	rs148650341	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77694655_77694656insGT								ADAMTS18 (225644 upstream) : NUDT7 (61755 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	78015083	78015083	+	IGR	DEL	A	-	-	rs78930480		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78015083delA								VAT1L (1082 upstream) : CLEC3A (41360 downstream)																																			---	---	---	---
WWOX	51741	broad.mit.edu	37	16	78921002	78921002	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78921002delT	uc002ffk.2	+						WWOX_uc010vnk.1_Intron|WWOX_uc002ffl.2_Intron|WWOX_uc010che.2_Intron	NM_016373	NP_057457			WW domain-containing oxidoreductase isoform 1						apoptosis|negative regulation of Wnt receptor signaling pathway|steroid metabolic process|Wnt receptor signaling pathway	Golgi apparatus|mitochondrion|nucleus	coenzyme binding|oxidoreductase activity|protein dimerization activity				0		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	79518698	79518699	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79518698_79518699delGT								WWOX (272135 upstream) : MAF (109047 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	79894620	79894621	+	IGR	DEL	GC	-	-	rs74549528		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79894620_79894621delGC								MAF (259998 upstream) : DYNLRB2 (680233 downstream)																																			---	---	---	---
CDYL2	124359	broad.mit.edu	37	16	80664774	80664774	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80664774delC	uc002ffs.2	-							NM_152342	NP_689555			chromodomain protein, Y-like 2							nucleus	catalytic activity|protein binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	80976803	80976803	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80976803delA								CDYL2 (138628 upstream) : C16orf61 (32898 downstream)																																			---	---	---	---
CMIP	80790	broad.mit.edu	37	16	81559583	81559588	+	Intron	DEL	GTGTGT	-	-	rs151270003		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81559583_81559588delGTGTGT	uc002fgp.2	+						CMIP_uc002fgq.1_Intron	NM_198390	NP_938204			c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	81746909	81746910	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81746909_81746910insA								CMIP (1544 upstream) : PLCG2 (66020 downstream)																																			---	---	---	---
PLCG2	5336	broad.mit.edu	37	16	81973807	81973808	+	Intron	INS	-	TGCA	TGCA	rs141767011	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81973807_81973808insTGCA	uc002fgt.2	+							NM_002661	NP_002652			phospholipase C, gamma 2						intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	82550952	82550953	+	IGR	INS	-	TG	TG	rs137892430	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82550952_82550953insTG								MPHOSPH6 (347123 upstream) : CDH13 (109625 downstream)																																			---	---	---	---
CDH13	1012	broad.mit.edu	37	16	82873987	82873988	+	Intron	INS	-	A	A	rs144671900		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82873987_82873988insA	uc002fgx.2	+						CDH13_uc010chh.2_Intron|CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
CDH13	1012	broad.mit.edu	37	16	83667739	83667740	+	Intron	DEL	TA	-	-	rs143385253		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83667739_83667740delTA	uc002fgx.2	+						CDH13_uc010vns.1_Intron|CDH13_uc010vnt.1_Intron|CDH13_uc010vnu.1_Intron	NM_001257	NP_001248			cadherin 13 preproprotein						adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)														---	---	---	---
OSGIN1	29948	broad.mit.edu	37	16	83984532	83984537	+	Intron	DEL	ACACAT	-	-	rs59635067		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83984532_83984537delACACAT	uc002fha.2	+						OSGIN1_uc002fhb.2_Intron|OSGIN1_uc002fhc.2_5'Flank	NM_013370	NP_037502			oxidative stress induced growth inhibitor 1						cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0																		---	---	---	---
COTL1	23406	broad.mit.edu	37	16	84600387	84600388	+	3'UTR	INS	-	GG	GG	rs147677885	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84600387_84600388insGG	uc002fid.2	-	4					COTL1_uc002fie.2_3'UTR|COTL1_uc010chk.2_RNA|COTL1_uc002fif.1_RNA	NM_021149	NP_066972			coactosin-like 1							cytoplasm|cytoskeleton	actin binding|enzyme binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	85004274	85004275	+	IGR	INS	-	CTT	CTT	rs139987481	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85004274_85004275insCTT								CRISPLD2 (61158 upstream) : ZDHHC7 (3792 downstream)																																	OREG0023993	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
KIAA0513	9764	broad.mit.edu	37	16	85094762	85094763	+	Intron	INS	-	A	A	rs71386073		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85094762_85094763insA	uc002fiu.2	+						KIAA0513_uc002fis.3_Intron|KIAA0513_uc010voj.1_Intron|KIAA0513_uc002fit.2_Intron	NM_014732	NP_055547			hypothetical protein LOC9764							cytoplasm				breast(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.234)														---	---	---	---
Unknown	0	broad.mit.edu	37	16	85128638	85128638	+	IGR	DEL	G	-	-	rs111590225		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85128638delG								KIAA0513 (812 upstream) : FAM92B (3327 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85171527	85171528	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85171527_85171528delTC								FAM92B (25413 upstream) : KIAA0182 (473501 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	85444687	85444687	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85444687delC								FAM92B (298573 upstream) : KIAA0182 (200342 downstream)																																			---	---	---	---
C16orf74	404550	broad.mit.edu	37	16	85747382	85747382	+	Intron	DEL	G	-	-	rs145939749		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85747382delG	uc002fjc.3	-							NM_206967	NP_996850			MGC17624 protein												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	86638462	86638463	+	IGR	DEL	GA	-	-	rs145670754		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86638462_86638463delGA								FOXL1 (23159 upstream) : FBXO31 (724481 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	87055051	87055052	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87055051_87055052insA								FOXL1 (439748 upstream) : FBXO31 (307892 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	87205573	87205574	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87205573_87205574delTG	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	87282996	87282996	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87282996delA	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																														---	---	---	---
Unknown	0	broad.mit.edu	37	16	87565945	87565946	+	IGR	INS	-	T	T	rs11335237		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87565945_87565946insT								ZCCHC14 (40485 upstream) : JPH3 (69495 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	16	87843467	87843467	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87843467delT								KLHDC4 (43925 upstream) : SLC7A5 (20163 downstream)																																			---	---	---	---
ACSF3	197322	broad.mit.edu	37	16	89172597	89172597	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89172597delG	uc002fmp.2	+						ACSF3_uc010cig.1_Intron|ACSF3_uc010cih.1_Intron|ACSF3_uc002fmq.1_Intron|ACSF3_uc010cii.1_Intron|ACSF3_uc002fmr.1_Intron	NM_174917	NP_777577			acyl-CoA synthetase family member 3 precursor						fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)														---	---	---	---
ANKRD11	29123	broad.mit.edu	37	16	89465152	89465153	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89465152_89465153insA	uc002fmx.1	-						ANKRD11_uc002fmy.1_Intron|ANKRD11_uc002fnc.1_Intron|ANKRD11_uc002fnd.2_Intron|ANKRD11_uc002fne.2_Intron|ANKRD11_uc002fng.1_Intron	NM_013275	NP_037407			ankyrin repeat domain 11							nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)														---	---	---	---
DPEP1	1800	broad.mit.edu	37	16	89701363	89701363	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89701363delT	uc010cin.2	+						DPEP1_uc002fnr.3_Intron|DPEP1_uc002fns.3_Intron	NM_001128141	NP_001121613			dipeptidase 1 precursor						proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)													---	---	---	---
TCF25	22980	broad.mit.edu	37	16	89975098	89975125	+	Intron	DEL	CTCCCGCCTCCCAGCTCCCACCTCCCGG	-	-	rs71137689		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89975098_89975125delCTCCCGCCTCCCAGCTCCCACCTCCCGG	uc002fpb.2	+						TCF25_uc002fpc.2_Intron	NM_014972	NP_055787			NULP1						heart development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)														---	---	---	---
AFG3L1	172	broad.mit.edu	37	16	90048073	90048073	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90048073delG	uc002fpy.1	+						AFG3L1_uc002fps.1_Intron|AFG3L1_uc002fpt.1_Intron|AFG3L1_uc002fpu.1_Intron|AFG3L1_uc002fpv.1_Intron|AFG3L1_uc002fpw.1_Intron|AFG3L1_uc002fpx.1_Intron|AFG3L1_uc002fpz.1_Intron|AFG3L1_uc002fqa.1_Intron					Homo sapiens AFG3L1 isoform 1 mRNA, partial sequence.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	90158875	90158875	+	5'Flank	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90158875delG	uc002fqp.2	+						uc002fqq.2_5'Flank					Homo sapiens, Similar to tubulin, beta, 2, clone IMAGE:4873024, mRNA.																														---	---	---	---
ABR	29	broad.mit.edu	37	17	1016106	1016107	+	Intron	INS	-	CCTGACTCAATCAGCAAGCATTTGTTAACG	CCTGACTCAATCAGCAAGCATTTGTTAACG	rs72110551		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1016106_1016107insCCTGACTCAATCAGCAAGCATTTGTTAACG	uc002fsd.2	-						ABR_uc002fse.2_Intron|ABR_uc010cjq.1_Intron	NM_021962	NP_068781			active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)														---	---	---	---
SMG6	23293	broad.mit.edu	37	17	1969666	1969667	+	Intron	INS	-	TG	TG	rs150703318	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1969666_1969667insTG	uc002fub.1	-						SMG6_uc010vqv.1_Intron	NM_017575	NP_060045			Smg-6 homolog, nonsense mediated mRNA decay						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4																		---	---	---	---
SGSM2	9905	broad.mit.edu	37	17	2241715	2241715	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2241715delA	uc002fun.3	+						TSR1_uc002fuj.2_5'Flank|SGSM2_uc002fum.3_Intron|SGSM2_uc010vqw.1_Intron	NM_001098509	NP_001091979			RUN and TBC1 domain containing 1 isoform 2							intracellular	Rab GTPase activator activity				0				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	2589868	2589869	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2589868_2589869insA								PAFAH1B1 (960 upstream) : KIAA0664 (2811 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	3895191	3895191	+	IGR	DEL	C	-	-	rs145456066		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3895191delC								ATP2A3 (27455 upstream) : ZZEF1 (12549 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	4278573	4278573	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4278573delT								UBE2G1 (8604 upstream) : SPNS3 (58646 downstream)																																			---	---	---	---
ZFP3	124961	broad.mit.edu	37	17	4996471	4996472	+	3'UTR	DEL	TT	-	-	rs72184758		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4996471_4996472delTT	uc002gaq.2	+	2						NM_153018	NP_694563			zinc finger protein-3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	5683924	5683924	+	Intron	DEL	T	-	-	rs34621837		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5683924delT	uc002gcm.2	+											Homo sapiens hypothetical protein LOC339166, mRNA (cDNA clone IMAGE:5163423), partial cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	5889416	5889416	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5889416delT								NLRP1 (401584 upstream) : WSCD1 (83021 downstream)																																			---	---	---	---
FXR2	9513	broad.mit.edu	37	17	7495379	7495380	+	Intron	DEL	TC	-	-	rs138014385		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7495379_7495380delTC	uc002gia.1	-						MPDU1_uc010vuc.1_Intron|SOX15_uc002ghy.1_5'Flank|SOX15_uc002ghz.1_5'Flank	NM_004860	NP_004851			fragile X mental retardation syndrome related							cytosolic large ribosomal subunit	protein binding|RNA binding				0				READ - Rectum adenocarcinoma(115;0.17)														---	---	---	---
STX8	9482	broad.mit.edu	37	17	9351491	9351492	+	Intron	INS	-	A	A	rs34726005		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9351491_9351492insA	uc002glx.2	-							NM_004853	NP_004844			syntaxin 8						transport	endoplasmic reticulum|integral to plasma membrane				central_nervous_system(1)	1																		---	---	---	---
GLP2R	9340	broad.mit.edu	37	17	9741278	9741279	+	Intron	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9741278_9741279delAG	uc002gmd.1	+						GLP2R_uc010cog.1_Intron	NM_004246	NP_004237			glucagon-like peptide 2 receptor precursor						G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				lung(2)|ovary(1)	3					Glucagon recombinant(DB00040)													---	---	---	---
GAS7	8522	broad.mit.edu	37	17	10033647	10033648	+	Intron	DEL	AA	-	-	rs76628128	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10033647_10033648delAA	uc002gmg.1	-							NM_201433	NP_958839			growth arrest-specific 7 isoform c						cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2								T	MLL	AML*								---	---	---	---
Unknown	0	broad.mit.edu	37	17	11110758	11110759	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11110758_11110759insT								PIRT (369340 upstream) : SHISA6 (33981 downstream)																																			---	---	---	---
DNAH9	1770	broad.mit.edu	37	17	11796183	11796183	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11796183delT	uc002gne.2	+						DNAH9_uc010coo.2_Intron|DNAH9_uc002gnf.2_Intron|DNAH9_uc010vvh.1_Intron	NM_001372	NP_001363			dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	13539055	13539059	+	IGR	DEL	GAAAG	-	-	rs147676482		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13539055_13539059delGAAAG								HS3ST3A1 (33811 upstream) : CDRT15P (388756 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	14444994	14444997	+	IGR	DEL	CTTC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14444994_14444997delCTTC								HS3ST3B1 (195502 upstream) : PMP22 (688100 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	14593455	14593456	+	IGR	INS	-	TTCT	TTCT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14593455_14593456insTTCT								HS3ST3B1 (343963 upstream) : PMP22 (539641 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	14626464	14626464	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14626464delA								HS3ST3B1 (376972 upstream) : PMP22 (506633 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	14897883	14897883	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14897883delA								HS3ST3B1 (648391 upstream) : PMP22 (235214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	15329450	15329451	+	IGR	INS	-	AC	AC	rs58724086		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15329450_15329451insAC								TEKT3 (84492 upstream) : CDRT4 (9887 downstream)																																			---	---	---	---
CCDC144A	9720	broad.mit.edu	37	17	16623498	16623498	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16623498delT	uc002gqk.1	+						CCDC144A_uc002gql.1_Intron|LOC162632_uc010cpj.1_Intron	NM_014695	NP_055510			coiled-coil domain containing 144A												0																		---	---	---	---
SMCR8	140775	broad.mit.edu	37	17	18227526	18227526	+	3'UTR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18227526delT	uc002gsy.3	+	2						NM_144775	NP_658988			Smith-Magenis syndrome chromosome region,											central_nervous_system(1)	1																		---	---	---	---
RNF112	7732	broad.mit.edu	37	17	19314918	19314919	+	Intron	DEL	TT	-	-	rs35694276		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19314918_19314919delTT	uc010vyw.1	+						RNF112_uc010vyu.1_Intron|RNF112_uc010vyv.1_Intron|RNF112_uc010vyx.1_5'Flank	NM_007148	NP_009079			ring finger protein 112								GTP binding|GTPase activity|zinc ion binding			ovary(2)	2																		---	---	---	---
CYTSB	92521	broad.mit.edu	37	17	20194866	20194866	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20194866delT	uc002gwq.2	+						CYTSB_uc002gws.2_Intron|CYTSB_uc002gwv.2_Intron|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Intron	NM_001033553	NP_001028725			spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	20403888	20403889	+	IGR	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20403888_20403889delAG								LGALS9B (33040 upstream) : CCDC144NL (362821 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	20670600	20670600	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20670600delA								LGALS9B (299752 upstream) : CCDC144NL (96110 downstream)																																			---	---	---	---
CCDC144NL	339184	broad.mit.edu	37	17	20780488	20780489	+	Intron	INS	-	GG	GG	rs138941593	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20780488_20780489insGG	uc002gyf.2	-						uc002gyg.1_Intron|uc002gyh.1_Intron	NM_001004306	NP_001004306			coiled-coil domain containing 144 family,												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	21227599	21227600	+	IGR	INS	-	A	A	rs143708005	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21227599_21227600insA								MAP2K3 (9050 upstream) : KCNJ12 (52099 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21245238	21245239	+	IGR	INS	-	T	T	rs147043183		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21245238_21245239insT								MAP2K3 (26689 upstream) : KCNJ12 (34460 downstream)																																			---	---	---	---
KCNJ12	3768	broad.mit.edu	37	17	21301404	21301405	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21301404_21301405delTG	uc002gyv.1	+							NM_021012	NP_066292			potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21347043	21347044	+	IGR	DEL	AG	-	-	rs111380221		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21347043_21347044delAG								KCNJ12 (23864 upstream) : C17orf51 (84528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21516327	21516328	+	IGR	INS	-	CAG	CAG	rs138704073	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21516327_21516328insCAG								C17orf51 (38596 upstream) : FAM27L (309042 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21530082	21530083	+	IGR	INS	-	T	T	rs111748744		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21530082_21530083insT								C17orf51 (52351 upstream) : FAM27L (295287 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21565641	21565641	+	IGR	DEL	T	-	-	rs74643846		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21565641delT								C17orf51 (87910 upstream) : FAM27L (259729 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	21827945	21827946	+	IGR	DEL	TG	-	-	rs67407943		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21827945_21827946delTG								FAM27L (1442 upstream) : FLJ36000 (76116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	22066949	22066949	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22066949delT								FLJ36000 (153879 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	22262082	22262095	+	IGR	DEL	TTTTCAAACAGCAG	-	-	rs149855120		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22262082_22262095delTTTTCAAACAGCAG								FLJ36000 (349012 upstream) : None (None downstream)																																			---	---	---	---
WSB1	26118	broad.mit.edu	37	17	25634141	25634142	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25634141_25634142insT	uc002gzd.1	+						WSB1_uc010vzy.1_3'UTR|WSB1_uc010vzz.1_Intron|WSB1_uc010crf.1_Intron|WSB1_uc002gze.1_Intron|WSB1_uc002gzf.1_Intron	NM_015626	NP_056441			WD repeat and SOCS box-containing 1 isoform 1						intracellular signal transduction	intracellular	protein binding				0	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	26339053	26339054	+	IGR	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26339053_26339054delGA								NOS2 (118644 upstream) : NLK (30634 downstream)																																			---	---	---	---
SUPT6H	6830	broad.mit.edu	37	17	26998503	26998503	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26998503delT	uc002hby.2	+						SUPT6H_uc010crt.2_Intron	NM_003170	NP_003161			suppressor of Ty 6 homolog						chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	27544845	27544846	+	IGR	INS	-	GT	GT	rs72365154		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27544845_27544846insGT								MYO18A (37438 upstream) : CRYBA1 (29029 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	30006718	30006719	+	IGR	INS	-	T	T	rs139850556	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30006718_30006719insT								MIR365-2 (104178 upstream) : C17orf79 (172166 downstream)																																			---	---	---	---
ACCN1	40	broad.mit.edu	37	17	32049626	32049627	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32049626_32049627insA	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
ACCN1	40	broad.mit.edu	37	17	32355884	32355884	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32355884delC	uc002hhu.2	-							NM_001094	NP_001085			amiloride-sensitive cation channel 1, neuronal						central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)													---	---	---	---
SLFN13	146857	broad.mit.edu	37	17	33776064	33776066	+	5'Flank	DEL	ACA	-	-	rs141295573		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33776064_33776066delACA	uc010wch.1	-						SLFN13_uc002hjl.2_5'Flank|SLFN13_uc010ctt.2_5'Flank|SLFN13_uc002hjm.2_5'Flank	NM_144682	NP_653283			schlafen family member 13							intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)														---	---	---	---
ACACA	31	broad.mit.edu	37	17	35460658	35460659	+	Intron	DEL	AC	-	-	rs141435886		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35460658_35460659delAC	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuy.2_Intron|ACACA_uc010wdb.1_Intron|ACACA_uc010wdc.1_Intron	NM_198836	NP_942133			acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)													---	---	---	---
TBC1D3	729873	broad.mit.edu	37	17	36351714	36351715	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36351714_36351715insA	uc002hpr.2	-						TBC1D3_uc010cvk.2_Intron|TBC1D3_uc010wdn.1_Intron	NM_001123391	NP_001116863			TBC1 domain family, member 3							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)														---	---	---	---
SRCIN1	80725	broad.mit.edu	37	17	36759479	36759480	+	Intron	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36759479_36759480delAG	uc002hqd.2	-						SRCIN1_uc002hqh.1_Intron	NM_025248	NP_079524			SNAP25-interacting protein						exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0																		---	---	---	---
WIPF2	147179	broad.mit.edu	37	17	38385191	38385191	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38385191delT	uc002hug.1	+						WIPF2_uc010cwv.1_Intron|WIPF2_uc002huh.1_Intron|WIPF2_uc010cww.1_Intron|WIPF2_uc002hui.1_Intron|WIPF2_uc010cwx.1_Intron|WIPF2_uc010cwy.1_Intron	NM_133264	NP_573571			WIRE protein							cytoplasm|cytoskeleton	actin binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	3															HNSCC(43;0.11)			---	---	---	---
TOP2A	7153	broad.mit.edu	37	17	38573182	38573182	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38573182delT	uc002huq.2	-							NM_001067	NP_001058			DNA topoisomerase II, alpha isozyme						apoptotic chromosome condensation|DNA ligation|DNA repair|DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|phosphatidylinositol-mediated signaling|positive regulation of apoptosis|positive regulation of retroviral genome replication|resolution of meiotic recombination intermediates|sister chromatid segregation	cytoplasm|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|drug binding|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity|ubiquitin binding			ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Gatifloxacin(DB01044)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	38592999	38592999	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38592999delA								TOP2A (18830 upstream) : IGFBP4 (6677 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	38841720	38841720	+	IGR	DEL	T	-	-	rs35825070		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38841720delT								KRT222 (20304 upstream) : KRT24 (12524 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	39101489	39101491	+	IGR	DEL	TGC	-	-	rs35457070		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39101489_39101491delTGC								KRT23 (7653 upstream) : KRT39 (13178 downstream)																																			---	---	---	---
KRTAP1-3	81850	broad.mit.edu	37	17	39193431	39193432	+	5'Flank	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39193431_39193432insT	uc002hvv.2	-							NM_030966	NP_112228			keratin associated protein 1-3							extracellular region|keratin filament	structural constituent of epidermis				0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	39241850	39241850	+	IGR	DEL	A	-	-	rs34909404		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39241850delA								KRTAP4-7 (456 upstream) : KRTAP4-8 (11386 downstream)																																			---	---	---	---
KRTAP4-8	728224	broad.mit.edu	37	17	39255685	39255688	+	5'Flank	DEL	TATG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39255685_39255688delTATG	uc010wfo.1	-							NM_031960	NP_114166			keratin associated protein 4.8							keratin filament					0																		---	---	---	---
KRTAP4-11	653240	broad.mit.edu	37	17	39275899	39275902	+	5'Flank	DEL	TATG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39275899_39275902delTATG	uc002hvz.2	-							NM_033059	NP_149048			keratin associated protein 4-11							keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	39329120	39329121	+	IGR	INS	-	A	A	rs33978566		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39329120_39329121insA								KRTAP4-3 (4696 upstream) : KRTAP4-2 (4579 downstream)																																			---	---	---	---
TTC25	83538	broad.mit.edu	37	17	40104559	40104560	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40104559_40104560insA	uc002hyj.3	+						TTC25_uc010cxt.2_Intron	NM_031421	NP_113609			tetratricopeptide repeat domain 25							cytoplasm	protein binding			ovary(1)	1		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)																---	---	---	---
PTRF	284119	broad.mit.edu	37	17	40571901	40571902	+	Intron	DEL	GT	-	-	rs35990055		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40571901_40571902delGT	uc002hzo.2	-						PTRF_uc010wgi.1_Intron	NM_012232	NP_036364			polymerase I and transcript release factor						regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription initiation from RNA polymerase I promoter	caveola|cytosol|endoplasmic reticulum|microsome|mitochondrion|nucleoplasm	protein binding|rRNA primary transcript binding			breast(1)	1		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)														---	---	---	---
FAM134C	162427	broad.mit.edu	37	17	40743360	40743361	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40743360_40743361insT	uc002ial.2	-						FAM134C_uc010wgq.1_Intron|FAM134C_uc002iam.1_Intron|FAM134C_uc010cyk.1_Intron	NM_178126	NP_835227			hypothetical protein LOC162427							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.134)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	40791520	40791521	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40791520_40791521insA								TUBG1 (24266 upstream) : TUBG2 (19745 downstream)																																			---	---	---	---
WNK4	65266	broad.mit.edu	37	17	40943658	40943658	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40943658delA	uc002ibj.2	+						WNK4_uc010wgx.1_Intron|WNK4_uc002ibk.1_Intron|WNK4_uc010wgy.1_Intron	NM_032387	NP_115763			WNK lysine deficient protein kinase 4						intracellular protein kinase cascade	tight junction	ATP binding|protein serine/threonine kinase activity			ovary(3)|skin(3)|stomach(1)	7		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	42025267	42025267	+	IGR	DEL	A	-	-	rs112096102		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42025267delA								PPY (5434 upstream) : PYY (4842 downstream)																																			---	---	---	---
UBTF	7343	broad.mit.edu	37	17	42301630	42301630	+	5'Flank	DEL	T	-	-	rs111732297		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42301630delT	uc010czt.2	-							NM_014233	NP_055048			upstream binding transcription factor, RNA						positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)														---	---	---	---
Unknown	0	broad.mit.edu	37	17	42687104	42687105	+	IGR	INS	-	G	G	rs143418454	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42687104_42687105insG								FZD2 (50197 upstream) : C17orf104 (46877 downstream)																																			---	---	---	---
ADAM11	4185	broad.mit.edu	37	17	42838553	42838555	+	Intron	DEL	GTG	-	-	rs35264978		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42838553_42838555delGTG	uc002ihh.2	+						ADAM11_uc010wjd.1_Intron	NM_002390	NP_002381			ADAM metallopeptidase domain 11 preproprotein						integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			pancreas(1)	1		Prostate(33;0.0959)																---	---	---	---
ADAM11	4185	broad.mit.edu	37	17	42848665	42848666	+	Intron	INS	-	A	A	rs147705797		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42848665_42848666insA	uc002ihh.2	+						ADAM11_uc010wjd.1_Intron	NM_002390	NP_002381			ADAM metallopeptidase domain 11 preproprotein						integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			pancreas(1)	1		Prostate(33;0.0959)																---	---	---	---
MAPT	4137	broad.mit.edu	37	17	43992090	43992090	+	Intron	DEL	T	-	-	rs112549117		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43992090delT	uc002ijr.3	+						MAPT_uc010dau.2_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519			microtubule-associated protein tau isoform 1						cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)																---	---	---	---
MAPT	4137	broad.mit.edu	37	17	44079133	44079133	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44079133delT	uc002ijr.3	+						MAPT_uc010dau.2_Intron|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519			microtubule-associated protein tau isoform 1						cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)																---	---	---	---
Unknown	0	broad.mit.edu	37	17	45154356	45154356	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45154356delA	uc002ilc.1	-											full-length cDNA clone CS0DH004YI07 of T cells (Jurkat cell line) of Homo sapiens (human).																														---	---	---	---
ITGB3	3690	broad.mit.edu	37	17	45377712	45377713	+	Intron	INS	-	GT	GT	rs10221263	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377712_45377713insGT	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203			integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)													---	---	---	---
Unknown	0	broad.mit.edu	37	17	45879398	45879401	+	IGR	DEL	ACAT	-	-	rs68172699		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45879398_45879401delACAT								TBX21 (55913 upstream) : OSBPL7 (5332 downstream)																																	OREG0024500	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
SP2	6668	broad.mit.edu	37	17	46001117	46001118	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46001117_46001118insT	uc002imk.2	+						SP2_uc002iml.2_Intron	NM_003110	NP_003101			Sp2 transcription factor						immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|histone deacetylase binding|zinc ion binding				0																		---	---	---	---
SKAP1	8631	broad.mit.edu	37	17	46388141	46388142	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46388141_46388142insA	uc002ini.1	-						SKAP1_uc002inj.1_Intron|SKAP1_uc010dbd.1_Intron|SKAP1_uc010dbe.1_Intron	NM_003726	NP_003717			src kinase associated phosphoprotein 1 isoform						positive regulation of transcription from RNA polymerase II promoter|T cell receptor signaling pathway	cytoplasm|nucleus|plasma membrane	antigen binding|protein kinase binding|SH2 domain binding				0																		---	---	---	---
TTLL6	284076	broad.mit.edu	37	17	46880858	46880858	+	Intron	DEL	A	-	-	rs4997829		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46880858delA	uc010wlo.1	-						TTLL6_uc002ioc.2_Intron|TTLL6_uc002iod.2_Intron	NM_001130918	NP_001124390			tubulin tyrosine ligase-like family, member 6							cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	46904269	46904270	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46904269_46904270insA								TTLL6 (9800 upstream) : CALCOCO2 (4102 downstream)																																			---	---	---	---
CALCOCO2	10241	broad.mit.edu	37	17	46916367	46916368	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46916367_46916368insT	uc002iof.2	+						CALCOCO2_uc010wlp.1_Intron|CALCOCO2_uc010wlq.1_Intron|CALCOCO2_uc010wlr.1_Intron|CALCOCO2_uc010wls.1_Intron	NM_005831	NP_005822			calcium binding and coiled-coil domain 2						response to interferon-gamma|viral reproduction	cytoskeleton|Golgi apparatus|nucleus|perinuclear region of cytoplasm|soluble fraction	protein homodimerization activity			ovary(1)	1																		---	---	---	---
B4GALNT2	124872	broad.mit.edu	37	17	47214427	47214427	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47214427delT	uc002ion.2	+						B4GALNT2_uc010wlt.1_Intron|B4GALNT2_uc010wlu.1_Intron	NM_153446	NP_703147			beta-1,4-N-acetyl-galactosaminyl transferase 2						lipid glycosylation|negative regulation of cell-cell adhesion|UDP-N-acetylgalactosamine metabolic process	integral to Golgi membrane	acetylgalactosaminyltransferase activity			large_intestine(1)|ovary(1)	2			all cancers(6;0.000316)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	47665689	47665690	+	IGR	DEL	CA	-	-	rs72386585		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47665689_47665690delCA								NXPH3 (4520 upstream) : SPOP (10558 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	47986514	47986515	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47986514_47986515delCA								TAC4 (61135 upstream) : DLX4 (60047 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	50490650	50490650	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:50490650delT								CA10 (253273 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	51041779	51041780	+	IGR	INS	-	GG	GG	rs144993555	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51041779_51041780insGG								CA10 (804402 upstream) : KIF2B (858459 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	51085646	51085655	+	IGR	DEL	CACACACACA	-	-	rs137882779	by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51085646_51085655delCACACACACA								CA10 (848269 upstream) : KIF2B (814584 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	51087955	51087955	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51087955delA								CA10 (850578 upstream) : KIF2B (812284 downstream)																																			---	---	---	---
HLF	3131	broad.mit.edu	37	17	53392108	53392108	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53392108delC	uc002iug.1	+						HLF_uc010dce.1_Intron|HLF_uc002iuh.2_Intron|HLF_uc010wni.1_Intron	NM_002126	NP_002117			hepatic leukemia factor						multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2								T	TCF3	ALL								---	---	---	---
Unknown	0	broad.mit.edu	37	17	54754516	54754516	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54754516delT								NOG (81565 upstream) : C17orf67 (114759 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	54775550	54775550	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54775550delT								NOG (102599 upstream) : C17orf67 (93725 downstream)																																			---	---	---	---
SCPEP1	59342	broad.mit.edu	37	17	55075125	55075125	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55075125delT	uc002iuv.3	+						SCPEP1_uc010dcl.2_Intron|SCPEP1_uc010wnk.1_Intron	NM_021626	NP_067639			serine carboxypeptidase 1 precursor						proteolysis	extracellular region	serine-type carboxypeptidase activity			skin(1)	1	Breast(9;2.86e-08)																	---	---	---	---
AKAP1	8165	broad.mit.edu	37	17	55160433	55160434	+	5'Flank	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55160433_55160434delGA	uc002iux.2	+						AKAP1_uc010wnl.1_5'Flank	NM_003488	NP_003479			A-kinase anchor protein 1 precursor						blood coagulation	cytosol|integral to membrane|mitochondrial outer membrane	protein binding|RNA binding			ovary(1)	1	Breast(9;5.46e-08)																	---	---	---	---
Unknown	0	broad.mit.edu	37	17	55886992	55886992	+	IGR	DEL	A	-	-	rs67702984		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55886992delA								MSI2 (129693 upstream) : MRPS23 (29852 downstream)																																			---	---	---	---
LPO	4025	broad.mit.edu	37	17	56341099	56341099	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56341099delA	uc002ivt.2	+						LPO_uc010wns.1_Intron|LPO_uc010dcp.2_Intron|LPO_uc010dcq.2_Intron|LPO_uc010dcr.2_Intron	NM_006151	NP_006142			lactoperoxidase isoform 1 preproprotein						hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|breast(1)	2																		---	---	---	---
RNF43	54894	broad.mit.edu	37	17	56446430	56446431	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56446430_56446431delAC	uc002iwf.2	-						RNF43_uc010wnv.1_Intron|RNF43_uc002iwh.3_Intron|RNF43_uc002iwg.3_Intron|RNF43_uc010dcw.2_Intron	NM_017763	NP_060233			ring finger protein 43 precursor							endoplasmic reticulum membrane|integral to membrane|nuclear envelope	ligase activity|protein binding|zinc ion binding			ovary(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---
TRIM37	4591	broad.mit.edu	37	17	57140530	57140530	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57140530delT	uc002iwy.3	-						TRIM37_uc002iwz.3_Intron|TRIM37_uc002ixa.3_Intron|TRIM37_uc010woc.1_Intron	NM_001005207	NP_001005207			tripartite motif-containing 37 protein							perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)													Mulibrey_Nanism				---	---	---	---
TMEM49	81671	broad.mit.edu	37	17	57825258	57825258	+	Intron	DEL	A	-	-	rs34390960		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57825258delA	uc002ixu.3	+						TMEM49_uc010wog.1_Intron|TMEM49_uc010woh.1_Intron|TMEM49_uc010woi.1_Intron|TMEM49_uc010woj.1_Intron	NM_030938	NP_112200			transmembrane protein 49						autophagy|cell adhesion	endoplasmic reticulum|ER-Golgi intermediate compartment membrane|integral to membrane|plasma membrane|vacuolar membrane					0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;1.15e-09)|all cancers(12;1.15e-08)															---	---	---	---
BCAS3	54828	broad.mit.edu	37	17	59329353	59329353	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59329353delC	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron|BCAS3_uc002izb.3_Intron|BCAS3_uc002izc.3_Intron	NM_001099432	NP_001092902			breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)															---	---	---	---
TBX2	6909	broad.mit.edu	37	17	59480289	59480308	+	Intron	DEL	GATAGAGAGAGAGAGAGAGA	-	-	rs72277883		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59480289_59480308delGATAGAGAGAGAGAGAGAGA	uc010wox.1	+						TBX2_uc002ize.2_Intron|TBX2_uc002izg.2_Intron	NM_005994	NP_005985			T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0																		---	---	---	---
INTS2	57508	broad.mit.edu	37	17	59985776	59985777	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59985776_59985777insA	uc002izn.2	-						INTS2_uc002izm.2_Intron	NM_020748	NP_065799			integrator complex subunit 2						snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	60986234	60986234	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60986234delT								MARCH10 (100529 upstream) : MIR633 (35342 downstream)																																			---	---	---	---
ICAM2	3384	broad.mit.edu	37	17	62092067	62092090	+	Intron	DEL	AAGGAAGGAAGGAAGGAAGAAAGA	-	-	rs68006305	by1000genomes;by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62092067_62092090delAAGGAAGGAAGGAAGGAAGAAAGA	uc002jdw.3	-						ICAM2_uc010ded.2_Intron|ICAM2_uc002jdx.3_Intron|ICAM2_uc002jdv.3_Intron|ICAM2_uc010wpx.1_Intron	NM_001099788	NP_001093258			intercellular adhesion molecule 2 precursor						cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	62471767	62471767	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62471767delA								C17orf60 (7008 upstream) : POLG2 (2137 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	63396968	63396969	+	IGR	INS	-	CCTTTCTTCTCTTTAC	CCTTTCTTCTCTTTAC	rs72367729		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63396968_63396969insCCTTTCTTCTCTTTAC								RGS9 (173149 upstream) : AXIN2 (127716 downstream)																																			---	---	---	---
CCDC46	201134	broad.mit.edu	37	17	63712276	63712276	+	Intron	DEL	T	-	-	rs67272986		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63712276delT	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron|CCDC46_uc002jfk.2_Intron	NM_145036	NP_659473			coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	64952534	64952535	+	IGR	INS	-	T	T	rs5821492		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64952534_64952535insT								CACNG5 (71178 upstream) : CACNG4 (8478 downstream)																																			---	---	---	---
PRKAR1A	5573	broad.mit.edu	37	17	66527166	66527167	+	3'UTR	INS	-	T	T	rs34358618		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66527166_66527167insT	uc002jhg.2	+	11					PRKAR1A_uc002jhh.2_3'UTR|PRKAR1A_uc002jhi.2_3'UTR|PRKAR1A_uc002jhj.2_3'UTR|PRKAR1A_uc002jhk.2_3'UTR|PRKAR1A_uc002jhl.2_3'UTR|PRKAR1A_uc002jhm.2_Intron	NM_212471	NP_997636			cAMP-dependent protein kinase, regulatory						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity|protein binding			adrenal_gland(4)|lung(3)|thyroid(2)|soft_tissue(2)|breast(1)	12	Breast(10;1.64e-13)							T|Mis|N|F|S	RET	papillary thyroid	myxoma|endocrine|papillary thyroid			Carney_Complex|Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial|Cardiac_Myxomas_Familial_Clustering_of				---	---	---	---
Unknown	0	broad.mit.edu	37	17	66857755	66857755	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66857755delA								FAM20A (260660 upstream) : ABCA8 (5678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	68214064	68214065	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68214064_68214065insT								KCNJ2 (37883 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69119588	69119589	+	Intron	INS	-	T	T	rs148836121	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69119588_69119589insT	uc002jis.3	-											Homo sapiens cDNA clone IMAGE:5267277.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	69152636	69152637	+	Intron	INS	-	ACAC	ACAC	rs138888695	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69152636_69152637insACAC	uc002jis.3	-											Homo sapiens cDNA clone IMAGE:5267277.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	69495821	69495821	+	IGR	DEL	A	-	-	rs35858146		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69495821delA								None (None upstream) : SOX9 (621340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69672613	69672614	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69672613_69672614insT								None (None upstream) : SOX9 (444547 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	69755697	69755701	+	IGR	DEL	TGTTT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69755697_69755701delTGTTT								None (None upstream) : SOX9 (361460 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	70514803	70514803	+	Intron	DEL	C	-	-	rs113434423		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70514803delC	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																														---	---	---	---
Unknown	0	broad.mit.edu	37	17	71105415	71105415	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71105415delG								SLC39A11 (16562 upstream) : SSTR2 (55745 downstream)																																			---	---	---	---
SDK2	54549	broad.mit.edu	37	17	71607362	71607363	+	Intron	DEL	CT	-	-	rs56104919	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71607362_71607363delCT	uc010dfm.2	-							NM_001144952	NP_001138424			sidekick 2						cell adhesion	integral to membrane				ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	71702726	71702727	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71702726_71702727delCA								SDK2 (62499 upstream) : C17orf54 (42682 downstream)																																			---	---	---	---
CD300A	11314	broad.mit.edu	37	17	72476841	72476842	+	Intron	INS	-	T	T	rs146968107	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72476841_72476842insT	uc002jkv.2	+						CD300A_uc002jkw.2_Intron|CD300A_uc010dfr.2_Intron|CD300A_uc010dfs.2_Intron	NM_007261	NP_009192			leukocyte membrane antigen						cell adhesion	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2																		---	---	---	---
CD300LB	124599	broad.mit.edu	37	17	72523841	72523842	+	Intron	INS	-	G	G	rs150532637	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72523841_72523842insG	uc002jkx.2	-						CD300LB_uc010wqz.1_Intron	NM_174892	NP_777552			CD300 molecule-like family member b							integral to membrane|plasma membrane	receptor activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	73707409	73707410	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73707409_73707410insT								SAP30BP (3271 upstream) : ITGB4 (10106 downstream)																																			---	---	---	---
QRICH2	84074	broad.mit.edu	37	17	74280562	74280563	+	Intron	INS	-	A	A	rs146740455	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74280562_74280563insA	uc002jrd.1	-						QRICH2_uc010wsz.1_Intron|QRICH2_uc010dgw.1_Intron	NM_032134	NP_115510			glutamine rich 2								protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	74797158	74797158	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74797158delA								MFSD11 (21822 upstream) : MGAT5B (67640 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	74955429	74955430	+	IGR	INS	-	CCTTT	CCTTT	rs148849252	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74955429_74955430insCCTTT								MGAT5B (8959 upstream) : C17orf86 (129295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	75921980	75921987	+	IGR	DEL	AAGGAAGA	-	-	rs67051242		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75921980_75921987delAAGGAAGA								FLJ45079 (41811 upstream) : TNRC6C (78331 downstream)																																			---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77289516	77289517	+	Intron	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77289516_77289517insC	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
HRNBP3	146713	broad.mit.edu	37	17	77328433	77328435	+	Intron	DEL	GGT	-	-	rs10523076		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77328433_77328435delGGT	uc010dhs.2	-						HRNBP3_uc010wua.1_Intron	NM_001082575	NP_001076044			hexaribonucleotide binding protein 3						mRNA processing|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding				0			BRCA - Breast invasive adenocarcinoma(99;0.0577)|OV - Ovarian serous cystadenocarcinoma(97;0.112)															---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78674222	78674236	+	Intron	DEL	TGATGGTGGTGGTTA	-	-	rs62067884	by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78674222_78674236delTGATGGTGGTGGTTA	uc002jyt.1	+						RPTOR_uc002jys.2_Intron|RPTOR_uc010wuf.1_Intron|RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
RPTOR	57521	broad.mit.edu	37	17	78901532	78901533	+	Intron	INS	-	TGTGTGTCCCTG	TGTGTGTCCCTG	rs145487236	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78901532_78901533insTGTGTGTCCCTG	uc002jyt.1	+						RPTOR_uc010wug.1_Intron	NM_020761	NP_065812			raptor isoform 1						cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	79339132	79339132	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79339132delG								TMEM105 (34658 upstream) : BAHCC1 (34408 downstream)																																			---	---	---	---
FSCN2	25794	broad.mit.edu	37	17	79498342	79498344	+	Intron	DEL	TGA	-	-	rs142557936	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79498342_79498344delTGA	uc010wup.1	+						FSCN2_uc010wuo.1_Intron	NM_012418	NP_036550			fascin 2 isoform 1						actin filament bundle assembly|anatomical structure morphogenesis|visual perception	actin cytoskeleton|cytoplasm|stereocilium	actin filament binding|protein binding, bridging				0	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	79833579	79833580	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79833579_79833580insA								ARHGDIA (4341 upstream) : THOC4 (12131 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	17	79926340	79926340	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79926340delA								NOTUM (7283 upstream) : ASPSCR1 (9086 downstream)																																			---	---	---	---
LRRC45	201255	broad.mit.edu	37	17	79984441	79984444	+	Intron	DEL	TGTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79984441_79984444delTGTG	uc002kde.2	+							NM_144999	NP_659436			leucine rich repeat containing 45							centrosome				pancreas(1)	1	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	80687606	80687607	+	IGR	INS	-	A	A	rs145414992	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80687606_80687607insA								FN3KRP (1717 upstream) : FN3K (5845 downstream)																																			---	---	---	---
TBCD	6904	broad.mit.edu	37	17	80734936	80734936	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80734936delT	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron	NM_005993	NP_005984			beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)															---	---	---	---
COLEC12	81035	broad.mit.edu	37	18	408485	408486	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:408485_408486insA	uc002kkm.2	-							NM_130386	NP_569057			collectin sub-family member 12						carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)																---	---	---	---
COLEC12	81035	broad.mit.edu	37	18	433963	433964	+	Intron	INS	-	A	A	rs11436056		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:433963_433964insA	uc002kkm.2	-							NM_130386	NP_569057			collectin sub-family member 12						carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)																---	---	---	---
COLEC12	81035	broad.mit.edu	37	18	460791	460800	+	Intron	DEL	CTACCGGTCA	-	-	rs35720066		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:460791_460800delCTACCGGTCA	uc002kkm.2	-							NM_130386	NP_569057			collectin sub-family member 12						carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	549963	549964	+	IGR	INS	-	G	G	rs144033013	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:549963_549964insG								COLEC12 (49234 upstream) : CETN1 (30405 downstream)																																			---	---	---	---
TYMS	7298	broad.mit.edu	37	18	671786	671786	+	Intron	DEL	T	-	-	rs76385726		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:671786delT	uc010dka.1	+						TYMS_uc010dkb.1_Intron|TYMS_uc010dkc.1_Intron	NM_001071	NP_001062			thymidylate synthase						DNA repair|DNA replication|phosphatidylinositol-mediated signaling|pyrimidine base metabolic process|pyrimidine nucleoside biosynthetic process|regulation of transcription involved in G1/S phase of mitotic cell cycle|response to organophosphorus	cytosol	thymidylate synthase activity				0					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Pemetrexed(DB00642)|Raltitrexed(DB00293)|Trifluridine(DB00432)													---	---	---	---
Unknown	0	broad.mit.edu	37	18	1059761	1059768	+	IGR	DEL	CCTTCCTT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1059761_1059768delCCTTCCTT								ADCYAP1 (147590 upstream) : C18orf2 (194622 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	2521409	2521409	+	IGR	DEL	T	-	-	rs33913783		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2521409delT								None (None upstream) : METTL4 (16116 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	3054615	3054616	+	IGR	INS	-	T	T	rs141833576	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3054615_3054616insT								LPIN2 (42670 upstream) : MYOM1 (12190 downstream)																																			---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	4099271	4099274	+	Intron	DEL	TCTA	-	-	rs12966704		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4099271_4099274delTCTA	uc010wyz.1	-						uc002kmm.2_Intron	NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	4369290	4369291	+	Intron	INS	-	GT	GT	rs141011243	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4369290_4369291insGT	uc010wyz.1	-							NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
DLGAP1	9229	broad.mit.edu	37	18	4393969	4393971	+	Intron	DEL	CTC	-	-	rs150233165		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4393969_4393971delCTC	uc010wyz.1	-							NM_004746	NP_004737			discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)																---	---	---	---
L3MBTL4	91133	broad.mit.edu	37	18	6060391	6060391	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6060391delT	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron|L3MBTL4_uc002kmy.3_Intron	NM_173464	NP_775735			l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	10565365	10565366	+	IGR	INS	-	T	T	rs145167134	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10565365_10565366insT								NAPG (12603 upstream) : FAM38B (105494 downstream)																																			---	---	---	---
FAM38B	63895	broad.mit.edu	37	18	10887063	10887064	+	Intron	INS	-	TTT	TTT	rs61402527		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10887063_10887064insTTT	uc002kow.1	-											RecName: Full=Uncharacterized protein C18orf58;							integral to membrane	ion channel activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	10931695	10931696	+	IGR	INS	-	GT	GT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10931695_10931696insGT								FAM38B (229716 upstream) : GNAL (757440 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	10970657	10970658	+	IGR	INS	-	TC	TC	rs146379231	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10970657_10970658insTC								FAM38B (268678 upstream) : GNAL (718478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	11067079	11067079	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11067079delA								FAM38B (365100 upstream) : GNAL (622057 downstream)																																			---	---	---	---
CEP192	55125	broad.mit.edu	37	18	13062228	13062228	+	Intron	DEL	T	-	-	rs79663535		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13062228delT	uc010xac.1	+						CEP192_uc010dlf.1_Intron|CEP192_uc010xad.1_Intron|CEP192_uc002kru.2_Intron|CEP192_uc002krv.2_Intron	NM_032142	NP_115518			centrosomal protein 192kDa											ovary(4)|pancreas(1)	5																		---	---	---	---
CEP192	55125	broad.mit.edu	37	18	13118798	13118800	+	Intron	DEL	CAT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13118798_13118800delCAT	uc010xac.1	+						CEP192_uc010xad.1_Intron|CEP192_uc002kru.2_Intron|CEP192_uc002krv.2_Intron|CEP192_uc002krw.2_Intron|CEP192_uc002krx.2_Intron|CEP192_uc002kry.2_Intron	NM_032142	NP_115518			centrosomal protein 192kDa											ovary(4)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	13943141	13943141	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13943141delA								MC2R (27606 upstream) : ZNF519 (132848 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15173121	15173122	+	IGR	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15173121_15173122insC								ANKRD30B (320384 upstream) : LOC644669 (140433 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	15254679	15254679	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15254679delT								ANKRD30B (401942 upstream) : LOC644669 (58876 downstream)																																			---	---	---	---
GREB1L	80000	broad.mit.edu	37	18	19025988	19025991	+	Intron	DEL	TTTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19025988_19025991delTTTG	uc010xam.1	+						GREB1L_uc002ktf.1_Intron|GREB1L_uc010dlp.1_Intron	NM_001142966	NP_001136438			growth regulation by estrogen in breast							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	19525065	19525065	+	IGR	DEL	T	-	-	rs10711420		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19525065delT								MIB1 (74155 upstream) : GATA6 (224351 downstream)																																			---	---	---	---
RBBP8	5932	broad.mit.edu	37	18	20560678	20560678	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20560678delT	uc002ktw.2	+						RBBP8_uc002kty.2_Intron|RBBP8_uc002ktz.2_Intron|RBBP8_uc002kua.2_Intron|RBBP8_uc002ktx.1_Intron	NM_002894	NP_002885			retinoblastoma binding protein 8 isoform a						cell cycle checkpoint|DNA double-strand break processing involved in repair via single-strand annealing|meiosis|regulation of transcription from RNA polymerase II promoter	nucleus	damaged DNA binding|protein binding|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)|lung(1)|skin(1)	3	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)										Direct_reversal_of_damage|Homologous_recombination					---	---	---	---
LAMA3	3909	broad.mit.edu	37	18	21467248	21467248	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21467248delC	uc002kuq.2	+						LAMA3_uc002kur.2_Intron|LAMA3_uc002kus.3_Intron|LAMA3_uc002kut.3_Intron	NM_198129	NP_937762			laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
TTC39C	125488	broad.mit.edu	37	18	21598347	21598348	+	Intron	INS	-	CA	CA	rs139965036	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21598347_21598348insCA	uc002kuw.2	+						TTC39C_uc002kuu.2_Intron|TTC39C_uc002kuv.2_Intron	NM_001135993	NP_001129465			tetratricopeptide repeat domain 39C isoform 1								binding			ovary(1)	1																		---	---	---	---
TTC39C	125488	broad.mit.edu	37	18	21653497	21653497	+	Intron	DEL	T	-	-	rs10711494		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21653497delT	uc002kuw.2	+						TTC39C_uc002kuu.2_Intron	NM_001135993	NP_001129465			tetratricopeptide repeat domain 39C isoform 1								binding			ovary(1)	1																		---	---	---	---
OSBPL1A	114876	broad.mit.edu	37	18	21814489	21814490	+	Intron	INS	-	G	G	rs143292137	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21814489_21814490insG	uc002kve.2	-						OSBPL1A_uc002kvd.2_Intron|OSBPL1A_uc010xbc.1_Intron|OSBPL1A_uc002kvf.3_Intron	NM_080597	NP_542164			oxysterol-binding protein-like 1A isoform B						cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)																	---	---	---	---
Unknown	0	broad.mit.edu	37	18	22420867	22420868	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22420867_22420868delGT								HRH4 (360947 upstream) : ZNF521 (221020 downstream)																																			---	---	---	---
ZNF521	25925	broad.mit.edu	37	18	22865027	22865028	+	Intron	INS	-	A	A	rs75895020	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22865027_22865028insA	uc002kvk.2	-						ZNF521_uc010xbe.1_Intron|ZNF521_uc010dly.2_Intron|ZNF521_uc002kvl.2_Intron	NM_015461	NP_056276			zinc finger protein 521						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)							T	PAX5	ALL								---	---	---	---
TAF4B	6875	broad.mit.edu	37	18	23803987	23803990	+	5'Flank	DEL	ACAT	-	-	rs71985780	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:23803987_23803990delACAT	uc002kvu.3	+						TAF4B_uc002kvs.3_5'Flank|TAF4B_uc002kvt.3_5'Flank	NM_005640	NP_005631			TAF4b RNA polymerase II, TATA box binding						transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleolus|transcription factor TFIID complex	DNA binding|NF-kappaB binding|sequence-specific DNA binding transcription factor activity			lung(1)|central_nervous_system(1)|skin(1)	3	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)															---	---	---	---
Unknown	0	broad.mit.edu	37	18	26658219	26658220	+	IGR	INS	-	C	C	rs139053680	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:26658219_26658220insC								CDH2 (900774 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	26876648	26876648	+	IGR	DEL	T	-	-	rs147619749		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:26876648delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	29714601	29714601	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29714601delT								RNF138 (3078 upstream) : MEP1B (55386 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	29738527	29738528	+	IGR	INS	-	T	T	rs111229724		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29738527_29738528insT								RNF138 (27004 upstream) : MEP1B (31459 downstream)																																			---	---	---	---
MAPRE2	10982	broad.mit.edu	37	18	32657229	32657236	+	Intron	DEL	ACACACAT	-	-	rs71379583		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32657229_32657236delACACACAT	uc002kyg.2	+						MAPRE2_uc010xcb.1_Intron|MAPRE2_uc010xcc.1_Intron|MAPRE2_uc002kyf.2_Intron|MAPRE2_uc002kyh.2_Intron|MAPRE2_uc010xcd.1_Intron	NM_014268	NP_055083			microtubule-associated protein, RP/EB family,						cell division|cell proliferation|mitosis|signal transduction	cytoplasm|microtubule	microtubule binding			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	33682450	33682450	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33682450delT								RPRD1A (35077 upstream) : SLC39A6 (6045 downstream)																																			---	---	---	---
MOCOS	55034	broad.mit.edu	37	18	33771731	33771734	+	Intron	DEL	ACAT	-	-	rs60049249		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33771731_33771734delACAT	uc002kzq.3	+							NM_017947	NP_060417			molybdenum cofactor sulfurase						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)													---	---	---	---
CELF4	56853	broad.mit.edu	37	18	34922196	34922197	+	Intron	INS	-	CA	CA	rs141631816	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34922196_34922197insCA	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565			bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	35951559	35951560	+	IGR	DEL	AG	-	-	rs146337012	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35951559_35951560delAG								CELF4 (805559 upstream) : LOC647946 (835328 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	35971955	35971955	+	IGR	DEL	A	-	-	rs148717151		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35971955delA								CELF4 (825955 upstream) : LOC647946 (814933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	35994954	35994955	+	IGR	INS	-	ATG	ATG	rs140459560	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35994954_35994955insATG								CELF4 (848954 upstream) : LOC647946 (791933 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	36680826	36680827	+	IGR	DEL	AC	-	-	rs112107511		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36680826_36680827delAC								None (None upstream) : LOC647946 (106061 downstream)																																			---	---	---	---
LOC647946	647946	broad.mit.edu	37	18	36885123	36885124	+	Intron	INS	-	AC	AC	rs10624692		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:36885123_36885124insAC	uc002lak.1	-						LOC647946_uc010xcj.1_Intron|LOC647946_uc002lal.1_Intron					Homo sapiens cDNA FLJ33284 fis, clone ASTRO2009458.												0																		---	---	---	---
LOC647946	647946	broad.mit.edu	37	18	37289296	37289296	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37289296delG	uc010xcj.1	-						LOC647946_uc002lal.1_Intron	NR_024391				Homo sapiens cDNA FLJ33284 fis, clone ASTRO2009458.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	37917086	37917087	+	IGR	INS	-	GTGT	GTGT	rs144138237	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37917086_37917087insGTGT								LOC647946 (536804 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	39408022	39408022	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39408022delA								KC6 (307461 upstream) : PIK3C3 (127177 downstream)																																			---	---	---	---
RIT2	6014	broad.mit.edu	37	18	40583727	40583736	+	Intron	DEL	ACACACACAC	-	-	rs146928185		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40583727_40583736delACACACACAC	uc002lav.2	-						RIT2_uc010dnf.2_Intron	NM_002930	NP_002921			Ras-like without CAAX 2						nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	18	41807933	41807934	+	IGR	INS	-	C	C	rs146373141	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41807933_41807934insC								SYT4 (950318 upstream) : SETBP1 (452204 downstream)																																			---	---	---	---
SETBP1	26040	broad.mit.edu	37	18	42315457	42315457	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42315457delT	uc010dni.2	+						SETBP1_uc002lay.2_Intron	NM_015559	NP_056374			SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)										Schinzel-Giedion_syndrome				---	---	---	---
SETBP1	26040	broad.mit.edu	37	18	42424319	42424320	+	Intron	DEL	CA	-	-	rs71177657		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42424319_42424320delCA	uc010dni.2	+						SETBP1_uc002lay.2_Intron	NM_015559	NP_056374			SET binding protein 1 isoform a							nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)										Schinzel-Giedion_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	18	44916984	44916985	+	Intron	INS	-	T	T	rs139328205	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44916984_44916985insT	uc002lcx.2	+											Homo sapiens, clone IMAGE:5538207, mRNA.																														---	---	---	---
MYO5B	4645	broad.mit.edu	37	18	47388366	47388366	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47388366delT	uc002leb.2	-						MYO5B_uc002lea.2_Intron	NM_001080467	NP_001073936			myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)														---	---	---	---
MYO5B	4645	broad.mit.edu	37	18	47403873	47403874	+	Intron	INS	-	T	T	rs143650365	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47403873_47403874insT	uc002leb.2	-						MYO5B_uc002lea.2_Intron	NM_001080467	NP_001073936			myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)														---	---	---	---
TCF4	6925	broad.mit.edu	37	18	53290112	53290113	+	Intron	INS	-	TGTG	TGTG	rs138216350	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53290112_53290113insTGTG	uc002lga.2	-							NM_001083962	NP_001077431			transcription factor 4 isoform a						positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)														---	---	---	---
TCF4	6925	broad.mit.edu	37	18	53304165	53304166	+	5'Flank	DEL	TT	-	-	rs10711940		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:53304165_53304166delTT	uc002lga.2	-							NM_001083962	NP_001077431			transcription factor 4 isoform a						positive regulation of neuron differentiation|protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding			ovary(1)|lung(1)	2				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	54188476	54188476	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54188476delA								TCF4 (885291 upstream) : TXNL1 (81579 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	54811977	54811977	+	5'Flank	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54811977delG	uc002lgm.2	+											RecName: Full=Protein FAM44C;																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	56430087	56430088	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56430087_56430088insT								MALT1 (12717 upstream) : ZNF532 (99973 downstream)																																			---	---	---	---
CCBE1	147372	broad.mit.edu	37	18	57141124	57141125	+	Intron	DEL	CT	-	-	rs112572149		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57141124_57141125delCT	uc002lib.2	-							NM_133459	NP_597716			collagen and calcium binding EGF domains 1						lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	58104330	58104331	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58104330_58104331insA								MC4R (64329 upstream) : CDH20 (896657 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	58881530	58881531	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:58881530_58881531insA								MC4R (841529 upstream) : CDH20 (119457 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	61037843	61037844	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61037843_61037844delTG								KDSR (3337 upstream) : VPS4B (18583 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	61248675	61248676	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61248675_61248676delCA								SERPINB12 (14433 upstream) : SERPINB13 (5858 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	61836177	61836178	+	Intron	INS	-	TG	TG	rs150063735	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61836177_61836178insTG	uc002ljx.2	+											Homo sapiens hypothetical protein LOC284294, mRNA (cDNA clone IMAGE:4823205).																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	61955283	61955283	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61955283delA	uc002ljx.2	+											Homo sapiens hypothetical protein LOC284294, mRNA (cDNA clone IMAGE:4823205).																														---	---	---	---
Unknown	0	broad.mit.edu	37	18	62296675	62296678	+	IGR	DEL	TGCC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62296675_62296678delTGCC								C18orf20 (480415 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	62939095	62939096	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:62939095_62939096delAC								None (None upstream) : CDH7 (478392 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	63413469	63413469	+	IGR	DEL	T	-	-	rs67046974		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63413469delT								None (None upstream) : CDH7 (4019 downstream)																																			---	---	---	---
CDH19	28513	broad.mit.edu	37	18	64232103	64232103	+	Intron	DEL	T	-	-	rs35260986		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64232103delT	uc002lkc.1	-						CDH19_uc010dql.1_Intron|CDH19_uc010xey.1_Intron|CDH19_uc002lkd.2_Intron	NM_021153	NP_066976			cadherin 19, type 2 preproprotein						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)																---	---	---	---
Unknown	0	broad.mit.edu	37	18	64289436	64289436	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64289436delA								CDH19 (18220 upstream) : DSEL (884383 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	64318655	64318655	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64318655delT								CDH19 (47439 upstream) : DSEL (855164 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	64727828	64727829	+	IGR	INS	-	AA	AA	rs35390646		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64727828_64727829insAA								CDH19 (456612 upstream) : DSEL (445990 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	66198805	66198806	+	IGR	INS	-	AGGTAGGT	AGGTAGGT	rs2849828	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66198805_66198806insAGGTAGGT								None (None upstream) : TMX3 (142121 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	66788067	66788067	+	IGR	DEL	A	-	-	rs33979317		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66788067delA								CCDC102B (65641 upstream) : DOK6 (280224 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	68051371	68051372	+	IGR	INS	-	G	G	rs145297949	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68051371_68051372insG								SOCS6 (53937 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	68939295	68939296	+	IGR	INS	-	AAA	AAA	rs137871624	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:68939295_68939296insAAA								SOCS6 (941861 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	69312107	69312107	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69312107delA								None (None upstream) : CBLN2 (891808 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	69808268	69808268	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69808268delA								None (None upstream) : CBLN2 (395647 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	69826663	69826664	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:69826663_69826664insA								None (None upstream) : CBLN2 (377251 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	71293335	71293336	+	IGR	INS	-	GA	GA	rs150477433	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71293335_71293336insGA								NETO1 (758525 upstream) : FBXO15 (447252 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	71447247	71447248	+	IGR	INS	-	A	A	rs146169904	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71447247_71447248insA								NETO1 (912437 upstream) : FBXO15 (293340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	71917529	71917556	+	IGR	DEL	CCAGGTGAGGACTGTCAGGTGAGGACCG	-	-	rs12185306		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71917529_71917556delCCAGGTGAGGACTGTCAGGTGAGGACCG								C18orf55 (91325 upstream) : CYB5A (2972 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	72842560	72842561	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72842560_72842561delTG								ZNF407 (64932 upstream) : ZADH2 (66718 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	73829125	73829136	+	IGR	DEL	ACACACACACAG	-	-	rs146458758	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:73829125_73829136delACACACACACAG								C18orf62 (689536 upstream) : ZNF516 (242483 downstream)																																			---	---	---	---
ZNF236	7776	broad.mit.edu	37	18	74661668	74661669	+	Intron	INS	-	C	C	rs139831190	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74661668_74661669insC	uc002lmi.2	+						ZNF236_uc002lmj.2_Intron	NM_007345	NP_031371			zinc finger protein 236						cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)														---	---	---	---
ZNF236	7776	broad.mit.edu	37	18	74679353	74679353	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74679353delT	uc002lmi.2	+						ZNF236_uc002lmj.2_Intron	NM_007345	NP_031371			zinc finger protein 236						cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)														---	---	---	---
MBP	4155	broad.mit.edu	37	18	74741749	74741750	+	Intron	INS	-	ACAC	ACAC	rs138743570	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74741749_74741750insACAC	uc010xfd.1	-						MBP_uc002lmr.2_Intron	NM_001025101	NP_001020272			Golli-mbp isoform 1						central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath			haematopoietic_and_lymphoid_tissue(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)														---	---	---	---
MBP	4155	broad.mit.edu	37	18	74840478	74840479	+	Intron	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74840478_74840479delCA	uc010xfd.1	-						MBP_uc002lmr.2_Intron	NM_001025101	NP_001020272			Golli-mbp isoform 1						central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath			haematopoietic_and_lymphoid_tissue(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)														---	---	---	---
Unknown	0	broad.mit.edu	37	18	75221658	75221661	+	IGR	DEL	ACTT	-	-	rs141808976		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:75221658_75221661delACTT								GALR1 (239564 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	76088533	76088534	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76088533_76088534delTC								None (None upstream) : SALL3 (651741 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	18	76254268	76254287	+	IGR	DEL	GCCATCCCCCTCAGTGTGTC	-	-	rs139467292	by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76254268_76254287delGCCATCCCCCTCAGTGTGTC								None (None upstream) : SALL3 (485988 downstream)																																			---	---	---	---
PQLC1	80148	broad.mit.edu	37	18	77680313	77680313	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77680313delA	uc002lnl.2	-						PQLC1_uc010dre.2_Intron|PQLC1_uc002lnk.2_Intron|PQLC1_uc010xfm.1_Intron	NM_025078	NP_079354			PQ loop repeat containing 1 isoform 1							integral to membrane				large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)														---	---	---	---
C18orf22	79863	broad.mit.edu	37	18	77831861	77831862	+	Intron	INS	-	C	C	rs150074257	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77831861_77831862insC	uc010dri.1	+						uc002lnu.2_Intron					Homo sapiens hypothetical p38 protein mRNA, complete cds.						rRNA processing	mitochondrion					0		all_cancers(4;3.21e-14)|all_epithelial(4;7.11e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0545)|all_hematologic(56;0.15)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;6.46e-08)|BRCA - Breast invasive adenocarcinoma(31;0.00376)														---	---	---	---
C19orf20	91978	broad.mit.edu	37	19	507417	507418	+	5'Flank	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:507417_507418insA	uc002lou.2	+							NM_033513	NP_277048			tubulin polyglutamylase complex subunit 1						multicellular organismal development	axon|centrosome|cilium axoneme|dendrite|flagellar axoneme|microtubule|microtubule basal body				pancreas(1)	1		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	703592	703592	+	IGR	DEL	T	-	-	rs12461668	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:703592delT								PRSSL1 (8131 upstream) : PALM (5361 downstream)																																			---	---	---	---
PRTN3	5657	broad.mit.edu	37	19	845409	845409	+	Intron	DEL	A	-	-	rs77190755		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:845409delA	uc002lqa.1	+							NM_002777	NP_002768			myeloblastin						collagen catabolic process|positive regulation of cell proliferation|proteolysis		protein binding|serine-type endopeptidase activity			ovary(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
MED16	10025	broad.mit.edu	37	19	877295	877296	+	Intron	INS	-	CT	CT	rs140629440	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:877295_877296insCT	uc002lqd.1	-						MED16_uc010drw.1_Intron|MED16_uc002lqe.2_Intron|MED16_uc002lqf.2_Intron|MED16_uc010xfv.1_Intron|MED16_uc010xfw.1_Intron|MED16_uc010xfx.1_Intron|MED16_uc010xfy.1_Intron	NM_005481	NP_005472			mediator complex subunit 16						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	receptor activity|thyroid hormone receptor binding|thyroid hormone receptor coactivator activity|vitamin D receptor binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
CSNK1G2	1455	broad.mit.edu	37	19	1967049	1967050	+	Intron	INS	-	TTTG	TTTG	rs140544822	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1967049_1967050insTTTG	uc002lul.3	+						CSNK1G2_uc010dsu.2_5'Flank	NM_001319	NP_001310			casein kinase 1, gamma 2						sphingolipid metabolic process|Wnt receptor signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity			stomach(1)	1		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
AP3D1	8943	broad.mit.edu	37	19	2109452	2109452	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2109452delT	uc002luz.2	-						AP3D1_uc010dsv.2_Intron|AP3D1_uc002luy.2_Intron|AP3D1_uc002lva.2_Intron	NM_003938	NP_003929			adaptor-related protein complex 3, delta 1						eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
AP3D1	8943	broad.mit.edu	37	19	2140754	2140755	+	Intron	INS	-	T	T	rs71337116		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2140754_2140755insT	uc002luz.2	-						AP3D1_uc002luy.2_Intron|AP3D1_uc002lva.2_Intron	NM_003938	NP_003929			adaptor-related protein complex 3, delta 1						eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
GNG7	2788	broad.mit.edu	37	19	2539882	2539883	+	Intron	INS	-	CTTT	CTTT	rs141298318	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2539882_2539883insCTTT	uc002lwd.2	-							NM_052847	NP_443079			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
GNG7	2788	broad.mit.edu	37	19	2651554	2651555	+	Intron	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2651554_2651555delTC	uc002lwd.2	-							NM_052847	NP_443079			guanine nucleotide binding protein (G protein),						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
MAP2K2	5605	broad.mit.edu	37	19	4097203	4097204	+	Intron	INS	-	A	A	rs11449985		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4097203_4097204insA	uc002lzk.2	-						MAP2K2_uc002lzj.2_Intron	NM_030662	NP_109587			mitogen-activated protein kinase kinase 2						activation of MAPK activity|activation of MAPKK activity|axon guidance|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|extracellular region	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)										Cardiofaciocutaneous_syndrome				---	---	---	---
TNFAIP8L1	126282	broad.mit.edu	37	19	4638818	4638820	+	5'Flank	DEL	TTT	-	-	rs112182267		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4638818_4638820delTTT	uc002max.2	+							NM_152362	NP_689575			tumor necrosis factor, alpha-induced protein												0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
KDM4B	23030	broad.mit.edu	37	19	5143329	5143330	+	Intron	INS	-	A	A	rs139798494		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5143329_5143330insA	uc002mbq.3	+						KDM4B_uc010xim.1_Intron|KDM4B_uc002mbr.3_Intron	NM_015015	NP_055830			jumonji domain containing 2B						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1																		---	---	---	---
PTPRS	5802	broad.mit.edu	37	19	5180552	5180553	+	Intron	INS	-	A	A	rs112892630		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5180552_5180553insA	uc002mbu.1	-							NM_130853	NP_570923			protein tyrosine phosphatase, receptor type,						cell adhesion	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)														---	---	---	---
LONP1	9361	broad.mit.edu	37	19	5695635	5695636	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5695635_5695636insA	uc002mcx.2	-						LONP1_uc002mcy.2_Intron|LONP1_uc010duh.2_Intron|LONP1_uc010dui.2_Intron|LONP1_uc002mcz.2_Intron	NM_004793	NP_004784			mitochondrial lon peptidase 1 precursor						cellular chaperone-mediated protein complex assembly|cellular response to oxidative stress|misfolded or incompletely synthesized protein catabolic process|mitochondrial DNA metabolic process|oxidation-dependent protein catabolic process|protein homooligomerization|response to hypoxia	mitochondrial nucleoid	ADP binding|ATP binding|ATP-dependent peptidase activity|DNA polymerase binding|G-quadruplex DNA binding|mitochondrial heavy strand promoter anti-sense binding|mitochondrial light strand promoter anti-sense binding|sequence-specific DNA binding|serine-type endopeptidase activity|single-stranded DNA binding|single-stranded RNA binding				0																		---	---	---	---
ACSBG2	81616	broad.mit.edu	37	19	6181232	6181233	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6181232_6181233insA	uc002mef.1	+						ACSBG2_uc002mee.1_Intron|ACSBG2_uc002meg.1_Intron|ACSBG2_uc002meh.1_Intron|ACSBG2_uc002mei.1_Intron|ACSBG2_uc010xiz.1_Intron	NM_030924	NP_112186			bubblegum-related acyl-CoA synthetase 2						cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1																		---	---	---	---
TNFSF9	8744	broad.mit.edu	37	19	6534068	6534071	+	Intron	DEL	TTCC	-	-	rs72356419		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6534068_6534071delTTCC	uc002mfh.2	+							NM_003811	NP_003802			tumor necrosis factor (ligand) superfamily,						apoptosis|cell proliferation|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1																		---	---	---	---
C3	718	broad.mit.edu	37	19	6708145	6708148	+	Intron	DEL	CTCT	-	-	rs149392655		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6708145_6708148delCTCT	uc002mfm.2	-							NM_000064	NP_000055			complement component 3 precursor						complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	7095674	7095675	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7095674_7095675insA								ZNF557 (7698 upstream) : INSR (16591 downstream)																																			---	---	---	---
INSR	3643	broad.mit.edu	37	19	7153362	7153363	+	Intron	INS	-	CA	CA	rs138064880		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153362_7153363insCA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199			insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	7396094	7396095	+	IGR	INS	-	ATC	ATC	rs139860718	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7396094_7396095insATC								INSR (102083 upstream) : ARHGEF18 (51625 downstream)																																			---	---	---	---
ARHGEF18	23370	broad.mit.edu	37	19	7444890	7444890	+	5'Flank	DEL	T	-	-	rs11326216		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7444890delT	uc010xjm.1	+							NM_015318	NP_056133			Rho/Rac guanine nucleotide exchange factor 18						actin cytoskeleton organization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of cell shape|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1		Renal(5;0.0902)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	7782120	7782121	+	IGR	INS	-	T	T	rs147330342		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7782120_7782121insT								FCER2 (15088 upstream) : CLEC4G (11723 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	8102253	8102254	+	IGR	DEL	TT	-	-	rs66510123		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8102253_8102254delTT								ELAVL1 (31724 upstream) : CCL25 (15392 downstream)																																			---	---	---	---
LASS4	79603	broad.mit.edu	37	19	8307866	8307869	+	Intron	DEL	GTCT	-	-	rs148380054		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8307866_8307869delGTCT	uc002mjg.2	+						LASS4_uc002mjh.2_Intron|LASS4_uc002mji.2_Intron|LASS4_uc010dvz.2_Intron	NM_024552	NP_078828			LAG1 homolog, ceramide synthase 4							endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(1)	1																		---	---	---	---
MUC16	94025	broad.mit.edu	37	19	9006152	9006153	+	Intron	INS	-	AA	AA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9006152_9006153insAA	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966			mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---
ZNF560	147741	broad.mit.edu	37	19	9579401	9579402	+	Intron	INS	-	TT	TT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9579401_9579402insTT	uc002mlp.1	-						ZNF560_uc010dwr.1_Intron	NM_152476	NP_689689			zinc finger protein 560						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6																		---	---	---	---
S1PR2	9294	broad.mit.edu	37	19	10342677	10342678	+	5'Flank	INS	-	G	G	rs148394477	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10342677_10342678insG	uc002mnl.2	-							NM_004230	NP_004221			endothelial differentiation, sphingolipid						activation of MAPK activity|positive regulation of cell proliferation	integral to membrane|plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity			lung(1)|central_nervous_system(1)	2																		---	---	---	---
CDKN2D	1032	broad.mit.edu	37	19	10679068	10679070	+	Intron	DEL	AGA	-	-	rs33926515		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10679068_10679070delAGA	uc002mpa.2	-						KRI1_uc002mox.1_5'Flank|KRI1_uc002moy.1_5'Flank|CDKN2D_uc002mpb.2_Intron	NM_001800	NP_001791			cyclin-dependent kinase inhibitor 2D						anti-apoptosis|autophagic cell death|cell cycle arrest|DNA synthesis involved in DNA repair|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|negative regulation of caspase activity|negative regulation of cell growth|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity|response to retinoic acid|response to UV|response to vitamin D	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding				0			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)											Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System				---	---	---	---
SMARCA4	6597	broad.mit.edu	37	19	11074444	11074444	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11074444delT	uc002mqf.3	+						SMARCA4_uc010dxp.2_Intron|SMARCA4_uc010dxo.2_Intron|SMARCA4_uc002mqe.2_Intron	NM_003072	NP_003063			SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)						F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				---	---	---	---
SMARCA4	6597	broad.mit.edu	37	19	11137174	11137174	+	Intron	DEL	T	-	-	rs35017701		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11137174delT	uc002mqf.3	+						SMARCA4_uc010dxp.2_Intron|SMARCA4_uc010dxo.2_Intron|SMARCA4_uc002mqg.1_Intron|SMARCA4_uc010dxq.2_Intron|SMARCA4_uc010dxr.2_Intron|SMARCA4_uc002mqj.3_Intron|SMARCA4_uc010dxs.2_Intron|SMARCA4_uc010dxt.1_Intron|SMARCA4_uc002mqh.3_Intron|SMARCA4_uc002mqi.1_Intron	NM_003072	NP_003063			SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)						F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				---	---	---	---
ELAVL3	1995	broad.mit.edu	37	19	11575575	11575576	+	Intron	INS	-	CA	CA	rs139244093	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11575575_11575576insCA	uc002mry.1	-						ELAVL3_uc002mrx.1_Intron	NM_001420	NP_001411			ELAV-like protein 3 isoform 1						cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3																		---	---	---	---
CNN1	1264	broad.mit.edu	37	19	11656018	11656018	+	Intron	DEL	A	-	-	rs34908887		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11656018delA	uc002msc.1	+						CNN1_uc010xmb.1_Intron|CNN1_uc010xmc.1_Intron	NM_001299	NP_001290			calponin 1, basic, smooth muscle						actomyosin structure organization|regulation of smooth muscle contraction	cytoskeleton	actin binding|calmodulin binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	11696397	11696397	+	IGR	DEL	G	-	-	rs113899921		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11696397delG								ACP5 (6596 upstream) : ZNF627 (11838 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	12666103	12666104	+	IGR	INS	-	AAAG	AAAG	rs140466383	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12666103_12666104insAAAG								ZNF709 (3747 upstream) : ZNF490 (20816 downstream)																																			---	---	---	---
NACC1	112939	broad.mit.edu	37	19	13240813	13240816	+	Intron	DEL	TTTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13240813_13240816delTTTG	uc002mwm.2	+							NM_052876	NP_443108			transcriptional repressor NAC1						negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|protein homooligomerization|transcription, DNA-dependent	cytoplasm|nuclear body					0																		---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13431840	13431840	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13431840delT	uc010dze.2	-						CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc010xne.1_Intron	NM_001127221	NP_001120693			calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---
CACNA1A	773	broad.mit.edu	37	19	13445408	13445411	+	Intron	DEL	TGTG	-	-	rs138143360		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13445408_13445411delTGTG	uc010dze.2	-						CACNA1A_uc002mwy.3_Intron	NM_001127221	NP_001120693			calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---
Unknown	0	broad.mit.edu	37	19	14386138	14386141	+	IGR	DEL	TCTT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14386138_14386141delTCTT								LPHN1 (69141 upstream) : CD97 (106072 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	14455380	14455380	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14455380delA								LPHN1 (138383 upstream) : CD97 (36833 downstream)																																			---	---	---	---
CASP14	23581	broad.mit.edu	37	19	15157470	15157470	+	5'Flank	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15157470delA	uc010dzv.1	+							NM_012114	NP_036246			caspase 14 precursor						apoptosis|cell differentiation|epidermis development|proteolysis	cytoplasm|nucleus	cysteine-type endopeptidase activity			skin(2)|ovary(1)|lung(1)	4																		---	---	---	---
CYP4F22	126410	broad.mit.edu	37	19	15658798	15658807	+	Intron	DEL	GAGAGAGAGG	-	-	rs145247351	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15658798_15658807delGAGAGAGAGG	uc002nbh.3	+							NM_173483	NP_775754			cytochrome P450, family 4, subfamily F,							endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen			ovary(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	15691836	15691837	+	IGR	INS	-	TCTT	TCTT	rs146876025	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15691836_15691837insTCTT								CYP4F22 (28709 upstream) : CYP4F8 (34192 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	15692169	15692170	+	IGR	INS	-	TTCC	TTCC	rs147074248	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15692169_15692170insTTCC								CYP4F22 (29042 upstream) : CYP4F8 (33859 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	16442149	16442152	+	IGR	DEL	AAAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16442149_16442152delAAAG								KLF2 (3812 upstream) : EPS15L1 (23909 downstream)																																			---	---	---	---
PLVAP	83483	broad.mit.edu	37	19	17464741	17464741	+	Intron	DEL	T	-	-	rs76584296		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17464741delT	uc002ngk.1	-							NM_031310	NP_112600			plasmalemma vesicle associated protein							caveola|integral to membrane|perinuclear region of cytoplasm					0																		---	---	---	---
FAM129C	199786	broad.mit.edu	37	19	17656458	17656459	+	Intron	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17656458_17656459delAG	uc010xpr.1	+						FAM129C_uc010xpq.1_Intron|FAM129C_uc002ngy.3_Intron|FAM129C_uc010xpu.1_Intron|FAM129C_uc002ngz.3_RNA|FAM129C_uc010eaw.2_Intron	NM_173544	NP_775815			B-cell novel protein 1 isoform a												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	18782727	18782728	+	IGR	DEL	CA	-	-	rs34161998		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18782727_18782728delCA								KLHL26 (1425 upstream) : CRTC1 (11697 downstream)																																			---	---	---	---
CRTC1	23373	broad.mit.edu	37	19	18851063	18851063	+	Intron	DEL	A	-	-	rs111732669		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18851063delA	uc002nkb.3	+						CRTC1_uc010ebv.2_Intron	NM_015321	NP_056136			mucoepidermoid carcinoma translocated 1 isoform						interspecies interaction between organisms|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	cAMP response element binding protein binding|protein binding		CRTC1/MAML2(516)	salivary_gland(474)|lung(35)|thyroid(4)|breast(3)|skin(2)|ovary(1)	519																		---	---	---	---
COMP	1311	broad.mit.edu	37	19	18902385	18902386	+	5'Flank	DEL	TG	-	-	rs72128764		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18902385_18902386delTG	uc002nke.2	-						COMP_uc002nkd.2_5'Flank|COMP_uc010xqj.1_5'Flank	NM_000095	NP_000086			cartilage oligomeric matrix protein precursor						anti-apoptosis|apoptosis|cell adhesion|limb development	extracellular space|proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent|heparan sulfate proteoglycan binding|heparin binding				0																		---	---	---	---
GMIP	51291	broad.mit.edu	37	19	19749401	19749401	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19749401delT	uc002nnd.2	-						GMIP_uc010xrb.1_Intron|GMIP_uc010xrc.1_Intron	NM_016573	NP_057657			GEM interacting protein						negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	21817605	21817605	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21817605delG								ZNF429 (78537 upstream) : ZNF100 (89239 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	22097733	22097733	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22097733delT								ZNF43 (62903 upstream) : ZNF208 (18027 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	23336890	23336891	+	IGR	INS	-	T	T	rs34468556		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23336890_23336891insT								ZNF99 (384106 upstream) : ZNF91 (184528 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	23744090	23744095	+	IGR	DEL	AAAAGA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23744090_23744095delAAAAGA								ZNF91 (165821 upstream) : ZNF675 (91614 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	24062031	24062032	+	IGR	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24062031_24062032delAG								RPSAP58 (51114 upstream) : ZNF254 (154215 downstream)																																			---	---	---	---
ZNF254	9534	broad.mit.edu	37	19	24218849	24218850	+	Intron	INS	-	TTTTG	TTTTG	rs141784380	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24218849_24218850insTTTTG	uc010xrk.1	+						uc002nrr.1_Intron|uc002nrs.1_Intron	NM_203282	NP_975011			zinc finger protein 254						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)																---	---	---	---
Unknown	0	broad.mit.edu	37	19	28694508	28694508	+	IGR	DEL	A	-	-	rs2868473	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28694508delA								LOC148189 (409660 upstream) : LOC148145 (761532 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29327006	29327007	+	IGR	DEL	GT	-	-	rs149030613	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29327006_29327007delGT								None (None upstream) : LOC148145 (129033 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29346602	29346602	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29346602delT								None (None upstream) : LOC148145 (109438 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	29387684	29387685	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29387684_29387685insA								None (None upstream) : LOC148145 (68355 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	31229190	31229191	+	IGR	DEL	CC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31229190_31229191delCC								ZNF536 (180225 upstream) : DKFZp566F0947 (411592 downstream)																																			---	---	---	---
NUDT19	390916	broad.mit.edu	37	19	33195172	33195172	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33195172delT	uc010edf.2	+							NM_001105570	NP_001099040			nudix (nucleoside diphosphate linked moiety							mitochondrion|peroxisome	hydrolase activity|metal ion binding				0	Esophageal squamous(110;0.137)																	---	---	---	---
GPI	2821	broad.mit.edu	37	19	34861630	34861630	+	Intron	DEL	A	-	-	rs80138743		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34861630delA	uc002nvg.1	+						GPI_uc002nvf.2_Intron|GPI_uc010xrv.1_Intron|GPI_uc010xrw.1_Intron|GPI_uc010edl.1_Intron	NM_000175	NP_000166			glucose phosphate isomerase						angiogenesis|gluconeogenesis|glycolysis|hemostasis|humoral immune response	cytosol|extracellular space|nucleus|plasma membrane	cytokine activity|glucose-6-phosphate isomerase activity|growth factor activity			ovary(1)|kidney(1)	2	Esophageal squamous(110;0.162)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	35136439	35136446	+	Intron	DEL	AGACACAG	-	-	rs61670357		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35136439_35136446delAGACACAG	uc002nvo.1	-											Homo sapiens cDNA FLJ36176 fis, clone TESTI2026491.																														---	---	---	---
Unknown	0	broad.mit.edu	37	19	35919421	35919421	+	IGR	DEL	G	-	-	rs62111660		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35919421delG								FFAR3 (68034 upstream) : FFAR2 (19782 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	36089542	36089543	+	IGR	INS	-	A	A	rs142917684		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36089542_36089543insA								ATP4A (34982 upstream) : HAUS5 (14103 downstream)																																			---	---	---	---
SIPA1L3	23094	broad.mit.edu	37	19	38420222	38420222	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38420222delT	uc002ohk.2	+							NM_015073	NP_055888			signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
SIPA1L3	23094	broad.mit.edu	37	19	38508160	38508161	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38508160_38508161insT	uc002ohk.2	+							NM_015073	NP_055888			signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
SIPA1L3	23094	broad.mit.edu	37	19	38646722	38646722	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38646722delA	uc002ohk.2	+							NM_015073	NP_055888			signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)															---	---	---	---
Unknown	0	broad.mit.edu	37	19	39253116	39253117	+	IGR	INS	-	AAAC	AAAC	rs150886980	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39253116_39253117insAAAC								CAPN12 (18002 upstream) : LGALS7 (8491 downstream)																																			---	---	---	---
FBXO17	115290	broad.mit.edu	37	19	39442470	39442470	+	Intron	DEL	A	-	-	rs112026818		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39442470delA	uc002okg.1	-						SARS2_uc010xuq.1_5'Flank|FBXO17_uc002okf.1_Intron	NM_024907	NP_079183			F-box protein FBG4 isoform 2						protein catabolic process	SCF ubiquitin ligase complex	glycoprotein binding				0	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)															---	---	---	---
PAK4	10298	broad.mit.edu	37	19	39614513	39614530	+	5'Flank	DEL	GAAGGAAAGAAAGAGAAA	-	-	rs72010258	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39614513_39614530delGAAGGAAAGAAAGAGAAA	uc002okj.1	+						PAK4_uc002okl.1_5'Flank|PAK4_uc002okn.1_5'Flank|PAK4_uc002okm.1_5'Flank|PAK4_uc002oko.1_5'Flank|PAK4_uc002okp.1_5'Flank	NM_001014831	NP_001014831			p21-activated kinase 4 isoform 1						cellular component movement|signal transduction	Golgi apparatus	ATP binding|protein binding|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)															---	---	---	---
ZNF780A	284323	broad.mit.edu	37	19	40585192	40585192	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40585192delG	uc002omy.2	-						ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Intron|ZNF780A_uc010xvh.1_Intron	NM_001010880	NP_001010880			zinc finger protein 780A isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	41344722	41344723	+	IGR	DEL	TT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41344722_41344723delTT								EGLN2 (30386 upstream) : CYP2A6 (4721 downstream)																																			---	---	---	---
BCKDHA	593	broad.mit.edu	37	19	41924439	41924440	+	Intron	INS	-	T	T	rs112542121		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41924439_41924440insT	uc002oqq.2	+						CYP2F1_uc010xvw.1_Intron|BCKDHA_uc002oqm.3_Intron|BCKDHA_uc002oqp.1_Intron|BCKDHA_uc002oqr.2_Intron|BCKDHA_uc010xvz.1_Intron	NM_000709	NP_000700			branched chain keto acid dehydrogenase E1, alpha						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|alpha-ketoacid dehydrogenase activity|carboxy-lyase activity|metal ion binding|protein binding				0																		---	---	---	---
BCKDHA	593	broad.mit.edu	37	19	41927362	41927363	+	Intron	INS	-	G	G	rs147534778	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41927362_41927363insG	uc002oqq.2	+						CYP2F1_uc010xvw.1_Intron|BCKDHA_uc002oqm.3_Intron|BCKDHA_uc002oqp.1_Intron|BCKDHA_uc002oqr.2_Intron|BCKDHA_uc010xvz.1_Intron	NM_000709	NP_000700			branched chain keto acid dehydrogenase E1, alpha						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|alpha-ketoacid dehydrogenase activity|carboxy-lyase activity|metal ion binding|protein binding				0																		---	---	---	---
CYP2F1	1572	broad.mit.edu	37	19	41948728	41948729	+	Intron	INS	-	GTG	GTG	rs139370529	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41948728_41948729insGTG	uc010xvw.1	+						ATP5SL_uc002oqw.1_5'Flank|ATP5SL_uc002oqx.1_5'Flank|ATP5SL_uc002oqy.1_5'Flank|ATP5SL_uc002oqz.1_5'Flank|C19orf69_uc010xwc.1_5'Flank					SubName: Full=cDNA FLJ51986, highly similar to Homo sapiens cytochrome P450, family 2, subfamily F, polypeptide 1 (CYP2F1), mRNA;						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	42438483	42438484	+	IGR	INS	-	AA	AA	rs149194550	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42438483_42438484insAA								ARHGEF1 (4189 upstream) : RABAC1 (22350 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	42439263	42439264	+	IGR	INS	-	CTGACC	CTGACC	rs138568360	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42439263_42439264insCTGACC								ARHGEF1 (4969 upstream) : RABAC1 (21570 downstream)																																	OREG0025492	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
ATP1A3	478	broad.mit.edu	37	19	42499923	42499924	+	5'Flank	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42499923_42499924delAG	uc002osg.2	-						ATP1A3_uc010xwf.1_5'Flank|ATP1A3_uc010xwg.1_5'Flank|ATP1A3_uc010xwh.1_5'Flank|ATP1A3_uc002osh.2_5'Flank	NM_152296	NP_689509			Na+/K+ -ATPase alpha 3 subunit						ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	19	42699936	42699938	+	IGR	DEL	TTT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42699936_42699938delTTT								POU2F2 (63306 upstream) : DEDD2 (2814 downstream)																																			---	---	---	---
CEACAM22P	388550	broad.mit.edu	37	19	45054592	45054593	+	Intron	INS	-	CG	CG	rs71171265		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45054592_45054593insCG	uc010ejr.1	-							NR_027754				Homo sapiens cDNA FLJ41856 fis, clone NT2RI3006171, weakly similar to Carcinoembryonic antigen-related celladhesion molecule 5 precursor.												0																		---	---	---	---
NOVA2	4858	broad.mit.edu	37	19	46468988	46468988	+	Intron	DEL	A	-	-	rs74708204		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46468988delA	uc002pdv.2	-							NM_002516	NP_002507			neuro-oncological ventral antigen 2							nucleus	RNA binding				0		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	47372752	47372752	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47372752delT								AP2S1 (18549 upstream) : GRLF1 (49181 downstream)																																			---	---	---	---
GRLF1	2909	broad.mit.edu	37	19	47454707	47454708	+	Intron	INS	-	T	T	rs147138376	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47454707_47454708insT	uc010ekv.2	+							NM_004491	NP_004482			glucocorticoid receptor DNA binding factor 1						axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)														---	---	---	---
TMEM143	55260	broad.mit.edu	37	19	48845190	48845190	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48845190delG	uc002pix.1	-						TMEM143_uc002piw.1_Intron|TMEM143_uc002piy.1_Intron|TMEM143_uc010xzn.1_Intron|TMEM143_uc010elw.1_Intron|TMEM143_uc010xzo.1_Intron	NM_018273	NP_060743			transmembrane protein 143							integral to membrane|mitochondrion					0		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)														---	---	---	---
GRIN2D	2906	broad.mit.edu	37	19	48896336	48896336	+	5'Flank	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48896336delC	uc002pjc.3	+						KDELR1_uc002pja.1_5'Flank|KDELR1_uc002pjb.1_5'Flank	NM_000836	NP_000827			N-methyl-D-aspartate receptor subunit 2D							cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|protein binding			ovary(3)|breast(3)	6		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Orphenadrine(DB01173)													---	---	---	---
PPFIA3	8541	broad.mit.edu	37	19	49642581	49642581	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49642581delA	uc002pmr.2	+						PPFIA3_uc010yai.1_Intron|PPFIA3_uc010yaj.1_Intron|PPFIA3_uc002pms.2_Intron	NM_003660	NP_003651			PTPRF interacting protein alpha 3							cell surface|cytoplasm	protein binding			lung(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)														---	---	---	---
TEAD2	8463	broad.mit.edu	37	19	49864056	49864057	+	Intron	INS	-	G	G	rs139926827	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49864056_49864057insG	uc002pnj.2	-						TEAD2_uc002png.2_5'Flank|TEAD2_uc002pnh.2_Intron|TEAD2_uc002pni.2_Intron|TEAD2_uc010yao.1_Intron|TEAD2_uc010emw.2_Intron|DKKL1_uc002pnk.2_5'Flank	NM_003598	NP_003589			TEA domain family member 2						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)														---	---	---	---
CPT1C	126129	broad.mit.edu	37	19	50206757	50206758	+	Intron	INS	-	TCTT	TCTT	rs142041039	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50206757_50206758insTCTT	uc002ppj.2	+						CPT1C_uc002ppl.3_Intron|CPT1C_uc002ppi.2_Intron|CPT1C_uc002ppk.2_Intron|CPT1C_uc010eng.2_Intron|CPT1C_uc010enh.2_Intron|CPT1C_uc010ybc.1_Intron|CPT1C_uc010eni.1_5'Flank	NM_152359	NP_689572			carnitine palmitoyltransferase 1C isoform 2						fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	50228766	50228767	+	IGR	INS	-	T	T	rs112209543		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50228766_50228767insT								CPT1C (11778 upstream) : TSKS (14245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	51478658	51478658	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51478658delG								KLK6 (5729 upstream) : KLK7 (1072 downstream)																																			---	---	---	---
ZNF577	84765	broad.mit.edu	37	19	52377740	52377741	+	Intron	INS	-	A	A	rs113238422		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52377740_52377741insA	uc010yde.1	-						ZNF577_uc010ydd.1_Intron|ZNF577_uc002pxx.3_Intron|ZNF577_uc002pxv.2_Intron|ZNF577_uc002pxw.2_Intron	NM_032679	NP_116068			zinc finger protein 577 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)														---	---	---	---
ZNF480	147657	broad.mit.edu	37	19	52816081	52816081	+	Intron	DEL	T	-	-	rs36105783		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52816081delT	uc010ydl.1	+						ZNF480_uc002pyv.2_Intron|ZNF480_uc010ydm.1_Intron|ZNF480_uc010epn.2_Intron|uc002pyw.1_Intron	NM_144684	NP_653285			zinc finger protein 480						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	54116768	54116769	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54116768_54116769insT								LOC284379 (10017 upstream) : DPRX (18541 downstream)																																			---	---	---	---
OSCAR	126014	broad.mit.edu	37	19	54600975	54600976	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54600975_54600976insA	uc002qdd.2	-						OSCAR_uc002qcy.2_Intron|OSCAR_uc002qcz.2_Intron|OSCAR_uc002qda.2_Intron|OSCAR_uc002qdb.2_Intron|OSCAR_uc010erc.2_Intron|OSCAR_uc002qdc.2_Intron	NM_206818	NP_996554			osteoclast-associated receptor isoform 1							extracellular region|integral to membrane|plasma membrane	receptor activity				0	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)																	---	---	---	---
Unknown	0	broad.mit.edu	37	19	57553226	57553227	+	IGR	INS	-	GT	GT	rs138886558	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57553226_57553227insGT								MIMT1 (193304 upstream) : USP29 (78282 downstream)																																			---	---	---	---
ZNF547	284306	broad.mit.edu	37	19	57964527	57964530	+	Intron	DEL	TTTT	-	-	rs34454740		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57964527_57964530delTTTT	uc002qpm.3	+											RecName: Full=Zinc finger protein 547;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)														---	---	---	---
Unknown	0	broad.mit.edu	37	20	348365	348366	+	IGR	INS	-	T	T	rs148789269	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:348365_348366insT								NRSN2 (8021 upstream) : TRIB3 (12942 downstream)																																			---	---	---	---
RBCK1	10616	broad.mit.edu	37	20	386576	386579	+	5'Flank	DEL	TTCT	-	-	rs139993720		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:386576_386579delTTCT	uc002wdp.3	+						RBCK1_uc010zpl.1_5'Flank|RBCK1_uc010zpm.1_5'Flank|RBCK1_uc002wdq.3_5'Flank|RBCK1_uc010fzy.2_5'Flank|RBCK1_uc002wdr.3_5'Flank|RBCK1_uc002wdo.2_5'Flank	NM_031229	NP_112506			RanBP-type and C3HC4-type zinc finger containing						interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)																---	---	---	---
CSNK2A1	1457	broad.mit.edu	37	20	480620	480621	+	Intron	INS	-	T	T	rs205904	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:480620_480621insT	uc002wdw.1	-						CSNK2A1_uc002wdx.1_Intron|CSNK2A1_uc002wdy.1_Intron	NM_177559	NP_808227			casein kinase II alpha 1 subunit isoform a						axon guidance|Wnt receptor signaling pathway	cytosol|NuRD complex|plasma membrane|Sin3 complex	ATP binding|protein N-terminus binding|protein serine/threonine kinase activity			ovary(1)	1		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	726276	726278	+	IGR	DEL	AGA	-	-	rs147433595		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:726276_726278delAGA								SRXN1 (69453 upstream) : C20orf54 (14447 downstream)																																			---	---	---	---
PSMF1	9491	broad.mit.edu	37	20	1127808	1127822	+	Intron	DEL	CATCATCATCATCAC	-	-	rs59447136	by1000genomes;byFrequency;by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1127808_1127822delCATCATCATCATCAC	uc002wel.3	+						PSMF1_uc010zpo.1_Intron|PSMF1_uc002wem.3_Intron|PSMF1_uc010zpp.1_Intron|PSMF1_uc002wen.3_Intron|PSMF1_uc002wep.3_Intron	NM_178578	NP_848693			proteasome inhibitor subunit 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome core complex	endopeptidase inhibitor activity|protein binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	1768362	1768363	+	IGR	INS	-	AA	AA	rs145756290	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1768362_1768363insAA								SIRPG (129937 upstream) : SIRPA (106450 downstream)																																			---	---	---	---
TMC2	117532	broad.mit.edu	37	20	2540913	2540913	+	Intron	DEL	A	-	-	rs11475601		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2540913delA	uc002wgf.1	+						TMC2_uc002wgg.1_Intron|TMC2_uc010zpw.1_Intron|TMC2_uc010zpx.1_Intron	NM_080751	NP_542789			transmembrane cochlear-expressed protein 2							integral to membrane				ovary(3)	3																		---	---	---	---
EBF4	57593	broad.mit.edu	37	20	2717896	2717897	+	Intron	INS	-	A	A	rs76361091		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2717896_2717897insA	uc002wgt.3	+						EBF4_uc002wgs.3_Intron	NM_001110514	NP_001103984			early B-cell factor 4						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding				0																		---	---	---	---
ATRN	8455	broad.mit.edu	37	20	3557326	3557327	+	Intron	INS	-	TCTG	TCTG	rs4989370	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3557326_3557327insTCTG	uc002wim.2	+						ATRN_uc002wil.2_Intron	NM_139321	NP_647537			attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2																		---	---	---	---
ADRA1D	146	broad.mit.edu	37	20	4211686	4211689	+	Intron	DEL	TTTC	-	-	rs11474763		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4211686_4211689delTTTC	uc002wkr.2	-							NM_000678	NP_000669			alpha-1D-adrenergic receptor						cell proliferation|cell-cell signaling|DNA metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|multicellular organismal development|positive regulation of cell proliferation	integral to plasma membrane	alpha1-adrenergic receptor activity				0					Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Methotrimeprazine(DB01403)|Norepinephrine(DB00368)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	4589160	4589161	+	IGR	DEL	AC	-	-	rs33988705		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4589160_4589161delAC								ADRA1D (359501 upstream) : PRNP (77636 downstream)																																			---	---	---	---
PROKR2	128674	broad.mit.edu	37	20	5286330	5286331	+	Intron	INS	-	A	A	rs139061058	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5286330_5286331insA	uc010zqw.1	-						PROKR2_uc010zqx.1_Intron|PROKR2_uc010zqy.1_Intron	NM_144773	NP_658986			prokineticin receptor 2							integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5															HNSCC(71;0.22)			---	---	---	---
GPCPD1	56261	broad.mit.edu	37	20	5553732	5553733	+	Intron	INS	-	T	T	rs71918376		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5553732_5553733insT	uc002wme.3	-						GPCPD1_uc002wmd.3_Intron	NM_019593	NP_062539			hypothetical protein LOC56261						glycerol metabolic process|lipid metabolic process		carbohydrate binding|glycerophosphodiester phosphodiesterase activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	5641933	5641934	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5641933_5641934delCA								GPCPD1 (50261 upstream) : C20orf196 (89109 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	5721507	5721508	+	IGR	INS	-	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5721507_5721508insG								GPCPD1 (129835 upstream) : C20orf196 (9535 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	6363320	6363320	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6363320delT								FERMT1 (259129 upstream) : BMP2 (385425 downstream)																																			---	---	---	---
HAO1	54363	broad.mit.edu	37	20	7910893	7910893	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7910893delA	uc002wmw.1	-						HAO1_uc010gbu.2_Intron	NM_017545	NP_060015			hydroxyacid oxidase 1						cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3																		---	---	---	---
TMX4	56255	broad.mit.edu	37	20	7962454	7962454	+	3'UTR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7962454delT	uc002wmx.1	-	8						NM_021156	NP_066979			thioredoxin-related transmembrane protein 4						cell redox homeostasis|electron transport chain|transport	integral to membrane					0																		---	---	---	---
PLCB1	23236	broad.mit.edu	37	20	8446018	8446018	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8446018delT	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc010gbv.1_Intron|PLCB1_uc002wmz.1_Intron|PLCB1_uc002wna.2_Intron	NM_015192	NP_056007			phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---
PLCB4	5332	broad.mit.edu	37	20	9293037	9293038	+	Intron	INS	-	CG	CG	rs139996785	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9293037_9293038insCG	uc002wnf.2	+						PLCB4_uc010gbw.1_Intron|PLCB4_uc010gbx.2_Intron|PLCB4_uc002wne.2_Intron	NM_182797	NP_877949			phospholipase C beta 4 isoform b						intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	10009879	10009880	+	Intron	INS	-	GG	GG	rs112979623	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10009879_10009880insGG	uc002wnn.1	-											Homo sapiens cDNA FLJ42971 fis, clone BRSTN2018083.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	10328277	10328278	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10328277_10328278delAC								SNAP25 (40212 upstream) : MKKS (57555 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	10829290	10829291	+	IGR	INS	-	ATAC	ATAC	rs142915327	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10829290_10829291insATAC								JAG1 (174596 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11192288	11192291	+	IGR	DEL	TGTA	-	-	rs60865372		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11192288_11192291delTGTA								JAG1 (537594 upstream) : BTBD3 (679186 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11287531	11287531	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11287531delT								JAG1 (632837 upstream) : BTBD3 (583946 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11311220	11311232	+	IGR	DEL	ACAAAAAAAAAAA	-	-	rs33926213		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11311220_11311232delACAAAAAAAAAAA								JAG1 (656526 upstream) : BTBD3 (560245 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	11508169	11508170	+	IGR	INS	-	AA	AA	rs111318094		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11508169_11508170insAA								JAG1 (853475 upstream) : BTBD3 (363307 downstream)																																			---	---	---	---
TASP1	55617	broad.mit.edu	37	20	13460111	13460111	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13460111delT	uc002woi.2	-						TASP1_uc010zri.1_Intron|TASP1_uc002woh.2_Intron	NM_017714	NP_060184			taspase 1 precursor						asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0																		---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	14396608	14396609	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14396608_14396609insT	uc002wou.2	+						MACROD2_uc002wot.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	17860648	17860649	+	IGR	INS	-	A	A	rs145902154	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17860648_17860649insA								BANF2 (144131 upstream) : SNX5 (61597 downstream)																																			---	---	---	---
OVOL2	58495	broad.mit.edu	37	20	18017315	18017315	+	Intron	DEL	C	-	-	rs66860035		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18017315delC	uc002wqi.1	-							NM_021220	NP_067043			zinc finger protein 339						negative regulation of keratinocyte differentiation|negative regulation of Notch signaling pathway|negative regulation of transcription by competitive promoter binding|regulation of cell cycle|regulation of keratinocyte proliferation|transcription, DNA-dependent	nucleus	DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	19054565	19054565	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19054565delT								C20orf79 (259532 upstream) : SLC24A3 (138725 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	19136154	19136155	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19136154_19136155delAC								C20orf79 (341121 upstream) : SLC24A3 (57135 downstream)																																			---	---	---	---
RIN2	54453	broad.mit.edu	37	20	19867670	19867671	+	5'Flank	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19867670_19867671insT	uc002wro.1	+						RIN2_uc010gcu.1_5'Flank	NM_018993	NP_061866			Ras and Rab interactor 2						endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity			lung(4)|ovary(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	20777294	20777295	+	IGR	DEL	TG	-	-	rs149083269		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20777294_20777295delTG								RALGAPA2 (84028 upstream) : PLK1S1 (329329 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	20788123	20788126	+	IGR	DEL	AGAT	-	-	rs143444621		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20788123_20788126delAGAT								RALGAPA2 (94857 upstream) : PLK1S1 (318498 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	20913800	20913800	+	IGR	DEL	T	-	-	rs35649383		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20913800delT								RALGAPA2 (220534 upstream) : PLK1S1 (192824 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	20927254	20927255	+	IGR	INS	-	T	T	rs139230763	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20927254_20927255insT								RALGAPA2 (233988 upstream) : PLK1S1 (179369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22319819	22319820	+	IGR	INS	-	T	T	rs147753545	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22319819_22319820insT								PAX1 (623199 upstream) : LOC284788 (61151 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22344335	22344336	+	IGR	DEL	CA	-	-	rs6036093		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22344335_22344336delCA								PAX1 (647715 upstream) : LOC284788 (36635 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	22999741	22999742	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:22999741_22999742delAC	uc002wsq.1	-											Homo sapiens cDNA clone IMAGE:5271939.																														---	---	---	---
NAPB	63908	broad.mit.edu	37	20	23400647	23400647	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23400647delA	uc002wta.2	-						NAPB_uc002wtc.2_Intron|NAPB_uc002wtb.2_Intron|NAPB_uc002wtd.3_Intron|NAPB_uc010zst.1_Intron	NM_022080	NP_071363			N-ethylmaleimide-sensitive factor attachment						intracellular protein transport|vesicle-mediated transport	membrane				ovary(1)	1	Lung NSC(19;0.0646)|Colorectal(13;0.0993)|all_lung(19;0.143)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	24196505	24196505	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24196505delA	uc002wtv.1	+											Homo sapiens cDNA FLJ33581 fis, clone BRAMY2011846.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	24432208	24432209	+	IGR	DEL	AC	-	-	rs72437049		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24432208_24432209delAC								GGTLC1 (462792 upstream) : TMEM90B (17626 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	24707416	24707417	+	IGR	DEL	GA	-	-	rs2143822		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24707416_24707417delGA								TMEM90B (60249 upstream) : CST7 (222449 downstream)																																			---	---	---	---
ENTPD6	955	broad.mit.edu	37	20	25179192	25179192	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25179192delT	uc002wuj.2	+						uc002wui.2_5'Flank|ENTPD6_uc010zsy.1_Intron|ENTPD6_uc010gdj.1_Intron|ENTPD6_uc010zsz.1_Intron|ENTPD6_uc002wum.2_Intron|ENTPD6_uc010zta.1_Intron|ENTPD6_uc002wun.2_Intron|ENTPD6_uc002wuk.2_Intron|ENTPD6_uc002wul.2_Intron|ENTPD6_uc010ztb.1_Intron|ENTPD6_uc010ztc.1_Intron|ENTPD6_uc002wuo.2_Intron	NM_001247	NP_001238			ectonucleoside triphosphate diphosphohydrolase 6							Golgi membrane|integral to membrane	nucleoside-diphosphatase activity				0																		---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25834734	25834735	+	Intron	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25834734_25834735delCA	uc002wvd.1	-						FAM182B_uc002wve.2_Intron					Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
FAM182B	728882	broad.mit.edu	37	20	25850573	25850574	+	5'Flank	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25850573_25850574insC	uc002wvd.1	-											Homo sapiens cDNA FLJ30282 fis, clone BRACE2002803.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	25903695	25903695	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25903695delA								FAM182B (54909 upstream) : LOC100134868 (86740 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	26149510	26149511	+	IGR	INS	-	T	T	rs143651251	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26149510_26149511insT								C20orf191 (54833 upstream) : MIR663 (39311 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	29455506	29455506	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29455506delT								None (None upstream) : FRG1B (156373 downstream)																																			---	---	---	---
FRG1B	284802	broad.mit.edu	37	20	29638132	29638135	+	Intron	DEL	AATA	-	-	rs144096277		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29638132_29638135delAATA	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	29812454	29812473	+	IGR	DEL	ATCGAATGGAATCGAATGGG	-	-	rs61727977	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29812454_29812473delATCGAATGGAATCGAATGGG								FRG1B (158546 upstream) : DEFB115 (32994 downstream)																																			---	---	---	---
TPX2	22974	broad.mit.edu	37	20	30369729	30369730	+	Intron	INS	-	T	T	rs143761360	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30369729_30369730insT	uc002wwp.1	+						TPX2_uc010gdv.1_Intron	NM_012112	NP_036244			TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)															---	---	---	---
XKR7	343702	broad.mit.edu	37	20	30560903	30560903	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30560903delA	uc002wxe.2	+							NM_001011718	NP_001011718			XK, Kell blood group complex subunit-related							integral to membrane				ovary(1)|breast(1)|skin(1)	3			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	30852159	30852160	+	IGR	INS	-	A	A	rs147847770	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30852159_30852160insA								POFUT1 (25693 upstream) : KIF3B (13307 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	31150989	31150990	+	Intron	INS	-	GGA	GGA	rs140865403	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31150989_31150990insGGA	uc002wxx.2	-											SubName: Full=LOC284804 protein; Flags: Fragment;																														---	---	---	---
COMMD7	149951	broad.mit.edu	37	20	31318366	31318368	+	Intron	DEL	AAC	-	-	rs67648428		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31318366_31318368delAAC	uc002wya.3	-						COMMD7_uc010ged.2_Intron|COMMD7_uc002wyb.2_Intron	NM_053041	NP_444269			COMM domain containing 7 isoform 1						negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|tumor necrosis factor-mediated signaling pathway		NF-kappaB binding			breast(1)	1																		---	---	---	---
DNMT3B	1789	broad.mit.edu	37	20	31347512	31347513	+	5'Flank	INS	-	A	A	rs11484259		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31347512_31347513insA	uc002wyc.2	+						DNMT3B_uc010ztx.1_5'Flank|DNMT3B_uc010zty.1_5'Flank|DNMT3B_uc002wyd.2_5'Flank|DNMT3B_uc002wye.2_5'Flank|DNMT3B_uc010gee.2_5'Flank|DNMT3B_uc010gef.2_5'Flank|DNMT3B_uc010ztz.1_5'Flank|DNMT3B_uc010zua.1_5'Flank	NM_006892	NP_008823			DNA cytosine-5 methyltransferase 3 beta isoform						negative regulation of histone H3-K9 methylation|positive regulation of gene expression|positive regulation of histone H3-K4 methylation		metal ion binding|protein binding|transcription corepressor activity			lung(3)|ovary(2)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	31509168	31509169	+	Intron	DEL	TG	-	-	rs143242102		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31509168_31509169delTG	uc010zub.1	+							NM_001143967	NP_001137439			EF-hand calcium binding domain 8																														---	---	---	---
CBFA2T2	9139	broad.mit.edu	37	20	32139726	32139726	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32139726delT	uc002wze.1	+						CBFA2T2_uc010zug.1_Intron	NM_001032999	NP_001028171			core-binding factor, runt domain, alpha subunit							nucleus	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	32485253	32485254	+	IGR	INS	-	C	C	rs148093821	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32485253_32485254insC								CHMP4B (43084 upstream) : RALY (96478 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	32763709	32763710	+	IGR	INS	-	AAAAAAAAAAAA	AAAAAAAAAAAA	rs34908150		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32763709_32763710insAAAAAAAAAAAA								EIF2S2 (63624 upstream) : ASIP (84461 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	32918077	32918077	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32918077delC								AHCY (18469 upstream) : ITCH (32985 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	33689221	33689221	+	IGR	DEL	A	-	-	rs111265717		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33689221delA								TRPC4AP (8603 upstream) : EDEM2 (13939 downstream)																																			---	---	---	---
EDEM2	55741	broad.mit.edu	37	20	33774588	33774588	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33774588delA	uc010zuv.1	-							NM_018217	NP_060687			ER degradation enhancer, mannosidase alpha-like						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane|extracellular region	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding				0			BRCA - Breast invasive adenocarcinoma(18;0.00936)															---	---	---	---
C20orf152	140894	broad.mit.edu	37	20	34584431	34584431	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34584431delT	uc002xes.1	+						C20orf152_uc002xer.1_Intron|C20orf152_uc010gfp.1_Intron					SubName: Full=C20orf152 protein;												0	Breast(12;0.00631)																	---	---	---	---
C20orf117	140710	broad.mit.edu	37	20	35463398	35463398	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35463398delA	uc002xgd.1	-							NM_199181	NP_954650			hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)																---	---	---	---
C20orf132	140699	broad.mit.edu	37	20	35800905	35800905	+	Intron	DEL	T	-	-	rs112099748		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35800905delT	uc010zvu.1	-						C20orf132_uc002xgm.2_Intron|C20orf132_uc002xgn.2_Intron	NM_152503	NP_689716			hypothetical protein LOC140699 isoform 1												0		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	36049142	36049143	+	IGR	INS	-	GT	GT	rs138332840	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36049142_36049143insGT								SRC (15323 upstream) : BLCAP (96677 downstream)																																			---	---	---	---
CTNNBL1	56259	broad.mit.edu	37	20	36319795	36319797	+	5'Flank	DEL	CAA	-	-	rs116554188	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36319795_36319797delCAA	uc010zvw.1	+						CTNNBL1_uc010zvv.1_5'Flank	NM_030877	NP_110517			beta catenin-like 1						apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	37256264	37256265	+	IGR	INS	-	TGTA	TGTA	rs113196336		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37256264_37256265insTGTA								ADIG (39160 upstream) : SLC32A1 (96840 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37294137	37294137	+	IGR	DEL	T	-	-	rs10536305		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37294137delT								ADIG (77033 upstream) : SLC32A1 (58968 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	37769334	37769339	+	IGR	DEL	CCTTTC	-	-	rs10545852		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37769334_37769339delCCTTTC								DHX35 (100971 upstream) : LOC339568 (73085 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	38573224	38573225	+	IGR	DEL	GT	-	-	rs149560636		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38573224_38573225delGT								LOC339568 (719833 upstream) : MAFB (741294 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	38807106	38807107	+	IGR	INS	-	A	A	rs112851302		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38807106_38807107insA								LOC339568 (953715 upstream) : MAFB (507412 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	39053116	39053117	+	IGR	INS	-	CCAT	CCAT	rs142133605	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39053116_39053117insCCAT								None (None upstream) : MAFB (261402 downstream)																																			---	---	---	---
TOP1	7150	broad.mit.edu	37	20	39717661	39717661	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39717661delT	uc002xjl.2	+						TOP1_uc010gge.1_Intron	NM_003286	NP_003277			DNA topoisomerase I						DNA topological change|interspecies interaction between organisms|phosphorylation|programmed cell death|response to drug	chromosome|nucleolus|nucleoplasm	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity|protein binding			breast(3)|ovary(2)|central_nervous_system(1)|kidney(1)	7		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Topotecan(DB01030)			T	NUP98	AML*								---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41474991	41474992	+	Intron	INS	-	A	A	rs145576193	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41474991_41474992insA	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
PTPRT	11122	broad.mit.edu	37	20	41737717	41737717	+	Intron	DEL	T	-	-	rs74366329		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41737717delT	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981			protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	41852105	41852106	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41852105_41852106delTG								PTPRT (33548 upstream) : SFRS6 (234398 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	41939095	41939095	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41939095delA								PTPRT (120538 upstream) : SFRS6 (147409 downstream)																																			---	---	---	---
L3MBTL	26013	broad.mit.edu	37	20	42174005	42174005	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42174005delA	uc002xkn.1	+						SGK2_uc002xkq.1_Intron	NM_032107	NP_115479			l(3)mbt-like isoform II						chromatin modification|hemopoiesis|negative regulation of transcription, DNA-dependent|regulation of megakaryocyte differentiation|regulation of mitosis	chromatin|condensed chromosome|nucleoplasm	identical protein binding|methylated histone residue binding|nucleosomal histone binding|SAM domain binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)															---	---	---	---
TOX2	84969	broad.mit.edu	37	20	42551667	42551668	+	Intron	INS	-	AG	AG	rs141095127	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42551667_42551668insAG	uc010ggo.2	+						TOX2_uc002xle.3_Intron|TOX2_uc010ggp.2_Intron	NM_001098797	NP_001092267			TOX high mobility group box family member 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
HNF4A	3172	broad.mit.edu	37	20	43009684	43009685	+	Intron	INS	-	TTTGA	TTTGA	rs139351181	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43009684_43009685insTTTGA	uc002xlv.2	+						HNF4A_uc010zwo.1_Intron|HNF4A_uc002xlt.2_Intron|HNF4A_uc002xlu.2_Intron|uc002xlw.1_Intron|uc002xlx.2_Intron	NM_175914	NP_787110			hepatocyte nuclear factor 4 alpha isoform d						blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
HNF4A	3172	broad.mit.edu	37	20	43045798	43045799	+	Intron	INS	-	C	C	rs139298686	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43045798_43045799insC	uc002xma.2	+						HNF4A_uc002xlt.2_Intron|HNF4A_uc002xlu.2_Intron|HNF4A_uc002xlv.2_Intron|HNF4A_uc002xly.2_Intron|HNF4A_uc002xlz.2_Intron|HNF4A_uc010ggq.2_Intron	NM_000457	NP_000448			hepatocyte nuclear factor 4 alpha isoform b						blood coagulation|endocrine pancreas development|glucose homeostasis|negative regulation of cell growth|negative regulation of cell proliferation|ornithine metabolic process|phospholipid homeostasis|positive regulation of cholesterol homeostasis|regulation of growth hormone receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to glucose stimulus|triglyceride homeostasis|xenobiotic metabolic process	cytoplasm	activating transcription factor binding|protein homodimerization activity|receptor binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)															---	---	---	---
STK4	6789	broad.mit.edu	37	20	43654769	43654770	+	Intron	INS	-	T	T	rs11483278		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43654769_43654770insT	uc002xnb.2	+						STK4_uc010ggx.2_Intron|STK4_uc010ggy.2_Intron	NM_006282	NP_006273			serine/threonine kinase 4						apoptosis|cell morphogenesis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|peptidyl-serine phosphorylation|positive regulation of apoptosis|protein autophosphorylation	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein homodimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity|transcription factor binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
Unknown	0	broad.mit.edu	37	20	43913209	43913210	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43913209_43913210insA								SLPI (30003 upstream) : MATN4 (8877 downstream)																																			---	---	---	---
SYS1-DBNDD2	767557	broad.mit.edu	37	20	44032604	44032605	+	Intron	INS	-	AA	AA	rs141255988		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44032604_44032605insAA	uc002xnx.2	+						DBNDD2_uc002xnz.2_5'Flank|DBNDD2_uc002xoa.2_5'Flank|DBNDD2_uc002xob.2_5'Flank|DBNDD2_uc002xoc.2_5'Flank|DBNDD2_uc002xod.2_5'Flank|DBNDD2_uc002xoe.2_5'Flank	NM_001048225	NP_001041690			SCF apoptosis response protein 1 isoform a												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	44077866	44077867	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44077866_44077867delTG								PIGT (22982 upstream) : WFDC2 (20527 downstream)																																			---	---	---	---
ZSWIM3	140831	broad.mit.edu	37	20	44488455	44488456	+	Intron	INS	-	AC	AC	rs146830909	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44488455_44488456insAC	uc002xqd.2	+						ACOT8_uc002xqa.1_5'Flank|ACOT8_uc010zxe.1_5'Flank|ACOT8_uc002xqc.1_5'Flank|ACOT8_uc010zxf.1_5'Flank|ZSWIM3_uc010zxg.1_Intron	NM_080752	NP_542790			zinc finger, SWIM domain containing 3								zinc ion binding			ovary(2)	2		Myeloproliferative disorder(115;0.0122)																---	---	---	---
EYA2	2139	broad.mit.edu	37	20	45706958	45706959	+	Intron	DEL	GC	-	-	rs73123774		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45706958_45706959delGC	uc002xsm.2	+						EYA2_uc010ghp.2_Intron|EYA2_uc002xsn.2_Intron|EYA2_uc002xso.2_Intron|EYA2_uc002xsp.2_Intron|EYA2_uc002xsq.2_Intron	NM_005244	NP_005235			eyes absent 2 isoform a						DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)																---	---	---	---
ZMYND8	23613	broad.mit.edu	37	20	45921885	45921904	+	Intron	DEL	AGGAAGGAAGGGAGGGAGGG	-	-	rs143295207	by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45921885_45921904delAGGAAGGAAGGGAGGGAGGG	uc002xta.1	-						ZMYND8_uc010ghr.1_Intron|ZMYND8_uc002xst.1_Intron|ZMYND8_uc002xsu.1_Intron|ZMYND8_uc002xsv.1_Intron|ZMYND8_uc002xsw.1_Intron|ZMYND8_uc002xsx.1_Intron|ZMYND8_uc002xsy.1_Intron|ZMYND8_uc002xsz.1_Intron|ZMYND8_uc010zxy.1_Intron|ZMYND8_uc002xtb.1_Intron|ZMYND8_uc002xss.2_Intron|ZMYND8_uc010zxz.1_Intron|ZMYND8_uc002xtc.1_Intron|ZMYND8_uc002xtd.1_Intron|ZMYND8_uc002xte.1_Intron|ZMYND8_uc010zya.1_Intron|ZMYND8_uc002xtf.1_Intron|ZMYND8_uc002xtg.2_Intron|ZMYND8_uc010ghs.1_Intron	NM_012408	NP_036540			zinc finger, MYND-type containing 8 isoform b								protein binding|zinc ion binding			central_nervous_system(2)|urinary_tract(1)|ovary(1)|skin(1)	5			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	47086424	47086424	+	IGR	DEL	G	-	-	rs73624060		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47086424delG								LOC284749 (87043 upstream) : PREX1 (154369 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	47169143	47169146	+	IGR	DEL	TATG	-	-	rs113622016	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47169143_47169146delTATG								LOC284749 (169762 upstream) : PREX1 (71647 downstream)																																			---	---	---	---
B4GALT5	9334	broad.mit.edu	37	20	48251979	48251980	+	3'UTR	INS	-	G	G	rs143514141	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48251979_48251980insG	uc002xuu.3	-	9						NM_004776	NP_004767			UDP-Gal:betaGlcNAc beta 1,4-						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	galactosyltransferase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	48386955	48386955	+	IGR	DEL	A	-	-	rs71339455		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48386955delA								B4GALT5 (56534 upstream) : SLC9A8 (42295 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49068649	49068650	+	IGR	INS	-	GAAG	GAAG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49068649_49068650insGAAG								CEBPB (259437 upstream) : PTPN1 (58241 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49074319	49074320	+	IGR	INS	-	T	T	rs151090962	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49074319_49074320insT								CEBPB (265107 upstream) : PTPN1 (52571 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49078143	49078154	+	IGR	DEL	GTGTGTGTGCGC	-	-	rs59252638	by1000genomes;by1000genomes;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49078143_49078154delGTGTGTGTGCGC								CEBPB (268931 upstream) : PTPN1 (48737 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	49101453	49101455	+	IGR	DEL	TTT	-	-	rs72309756		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49101453_49101455delTTT								CEBPB (292241 upstream) : PTPN1 (25436 downstream)																																			---	---	---	---
ATP9A	10079	broad.mit.edu	37	20	50311656	50311656	+	Intron	DEL	A	-	-	rs11086354		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50311656delA	uc002xwg.1	-						ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036			ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	50977639	50977639	+	IGR	DEL	T	-	-	rs144818218		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50977639delT								ZFP64 (169115 upstream) : TSHZ2 (611238 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	51074198	51074199	+	IGR	INS	-	GTCA	GTCA	rs144014065	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51074198_51074199insGTCA								ZFP64 (265674 upstream) : TSHZ2 (514678 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52283297	52283297	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52283297delT								ZNF217 (72496 upstream) : SUMO1P1 (207745 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	52366187	52366188	+	IGR	INS	-	A	A	rs74179232		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52366187_52366188insA								ZNF217 (155386 upstream) : SUMO1P1 (124854 downstream)																																			---	---	---	---
BCAS1	8537	broad.mit.edu	37	20	52560855	52560857	+	3'UTR	DEL	TTT	-	-	rs74179253		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52560855_52560857delTTT	uc002xws.2	-	12					BCAS1_uc010zza.1_3'UTR|BCAS1_uc010zzb.1_3'UTR|BCAS1_uc010gim.2_3'UTR|BCAS1_uc002xwt.2_3'UTR|BCAS1_uc010gil.1_3'UTR	NM_003657	NP_003648			breast carcinoma amplified sequence 1							cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	52726771	52726771	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52726771delA								BCAS1 (39467 upstream) : CYP24A1 (43217 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	54680072	54680073	+	IGR	INS	-	TAA	TAA	rs147136177	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54680072_54680073insTAA								CBLN4 (100060 upstream) : MC3R (143715 downstream)																																			---	---	---	---
CASS4	57091	broad.mit.edu	37	20	54986603	54986603	+	5'Flank	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54986603delA	uc002xxp.2	+						CASS4_uc002xxq.3_5'Flank|CASS4_uc002xxr.2_5'Flank|CASS4_uc010zze.1_5'Flank|CASS4_uc010gio.2_5'Flank	NM_001164116	NP_001157588			HEF-like protein isoform a						cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	20	55168304	55168304	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55168304delC								C20orf107 (56730 upstream) : TFAP2C (36054 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55185626	55185627	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55185626_55185627delCA								C20orf107 (74052 upstream) : TFAP2C (18731 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	55438635	55438642	+	IGR	DEL	GTGTGTGT	-	-	rs141596423		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55438635_55438642delGTGTGTGT								TFAP2C (224299 upstream) : BMP7 (305167 downstream)																																			---	---	---	---
RBM38	55544	broad.mit.edu	37	20	55973144	55973144	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55973144delG	uc010zzj.1	+						RBM38_uc010zzk.1_Intron	NM_017495	NP_059965			RNA-binding region containing protein 1 isoform						3'-UTR-mediated mRNA stabilization|cell cycle|cell cycle arrest|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mRNA processing|negative regulation of cell proliferation|regulation of RNA splicing|RNA splicing	cytosol|cytosol|nucleus|nucleus	mRNA 3'-UTR binding|mRNA binding|nucleotide binding|RNA binding				0	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	56425980	56425983	+	IGR	DEL	AGGA	-	-	rs11469281		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56425980_56425983delAGGA								PMEPA1 (139439 upstream) : C20orf85 (300000 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56492666	56492666	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56492666delC								PMEPA1 (206125 upstream) : C20orf85 (233317 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	56771885	56771886	+	IGR	INS	-	AC	AC	rs62204339		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56771885_56771886insAC								C20orf85 (35704 upstream) : PPP4R1L (34303 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	57315676	57315677	+	IGR	INS	-	G	G	rs139002687	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57315676_57315677insG								NPEPL1 (24309 upstream) : MIR296 (76993 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	57870034	57870035	+	IGR	INS	-	TG	TG	rs141058133	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57870034_57870035insTG								ZNF831 (35869 upstream) : EDN3 (5464 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	20	59082363	59082364	+	Intron	INS	-	AC	AC	rs142208482	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59082363_59082364insAC	uc010gjw.1	+											Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																														---	---	---	---
Unknown	0	broad.mit.edu	37	20	59603639	59603639	+	IGR	DEL	T	-	-	rs111233949		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59603639delT								MIR646 (720014 upstream) : CDH4 (223920 downstream)																																			---	---	---	---
CDH4	1002	broad.mit.edu	37	20	59925922	59925923	+	Intron	INS	-	T	T	rs146422312	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59925922_59925923insT	uc002ybn.1	+							NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60343247	60343248	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60343247_60343248delAC	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
CDH4	1002	broad.mit.edu	37	20	60403571	60403572	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60403571_60403572insT	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785			cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)															---	---	---	---
OSBPL2	9885	broad.mit.edu	37	20	60865779	60865779	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60865779delT	uc002yck.1	+						OSBPL2_uc002ycl.1_Intron|OSBPL2_uc011aah.1_Intron	NM_144498	NP_653081			oxysterol-binding protein-like protein 2 isoform						lipid transport		lipid binding			ovary(1)|central_nervous_system(1)	2	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)															---	---	---	---
NTSR1	4923	broad.mit.edu	37	20	61387216	61387219	+	Intron	DEL	CCAC	-	-	rs116894724	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61387216_61387219delCCAC	uc002ydf.2	+							NM_002531	NP_002522			neurotensin receptor 1							endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)															---	---	---	---
Unknown	0	broad.mit.edu	37	20	61893425	61893425	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61893425delG								FLJ16779 (462 upstream) : ARFGAP1 (10740 downstream)																																			---	---	---	---
ZBTB46	140685	broad.mit.edu	37	20	62437599	62437600	+	5'Flank	INS	-	A	A	rs113225024		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62437599_62437600insA	uc002ygv.1	-						ZBTB46_uc002ygu.2_Intron|uc002ygw.2_5'Flank	NM_025224	NP_079500			zinc finger and BTB domain containing 46						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)|ovary(1)	2	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)																	---	---	---	---
PRPF6	24148	broad.mit.edu	37	20	62652538	62652539	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62652538_62652539delTG	uc002yho.2	+						PRPF6_uc002yhp.2_Intron	NM_012469	NP_036601			PRP6 pre-mRNA processing factor 6 homolog						assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)																	---	---	---	---
MYT1	4661	broad.mit.edu	37	20	62789374	62789374	+	Intron	DEL	T	-	-	rs11477209		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62789374delT	uc002yih.2	+							NM_004535	NP_004526			myelin transcription factor 1						cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)																	---	---	---	---
MYT1	4661	broad.mit.edu	37	20	62845290	62845290	+	Intron	DEL	C	-	-	rs113951577		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62845290delC	uc002yii.2	+						MYT1_uc002yih.2_Intron|MYT1_uc002yij.2_Intron	NM_004535	NP_004526			myelin transcription factor 1						cell differentiation|nervous system development	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)																	---	---	---	---
Unknown	0	broad.mit.edu	37	20	62910357	62910357	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62910357delA								PCMTD2 (2779 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	9828810	9828810	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9828810delG								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10141799	10141800	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10141799_10141800insT								None (None upstream) : TPTE (764943 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10457789	10457791	+	Intron	DEL	TTC	-	-	rs3831350		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10457789_10457791delTTC	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10503272	10503273	+	Intron	DEL	AA	-	-	rs71255876		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10503272_10503273delAA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10569385	10569386	+	Intron	INS	-	T	T	rs71268622		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10569385_10569386insT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	10637207	10637207	+	IGR	DEL	G	-	-	rs71243290		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10637207delG								None (None upstream) : TPTE (269536 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10798528	10798529	+	IGR	INS	-	G	G	rs142172968		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10798528_10798529insG								None (None upstream) : TPTE (108214 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10802117	10802136	+	IGR	DEL	TGGAGTGGAGTGGAGTGGAA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10802117_10802136delTGGAGTGGAGTGGAGTGGAA								None (None upstream) : TPTE (104607 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10821736	10821737	+	IGR	DEL	GA	-	-	rs74970823		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10821736_10821737delGA								None (None upstream) : TPTE (85006 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10835847	10835848	+	IGR	INS	-	AATGGAATGG	AATGGAATGG	rs149399164		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10835847_10835848insAATGGAATGG								None (None upstream) : TPTE (70895 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10841779	10841779	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10841779delT								None (None upstream) : TPTE (64964 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10855527	10855528	+	IGR	INS	-	GAATG	GAATG	rs150774792		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10855527_10855528insGAATG								None (None upstream) : TPTE (51215 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	10873042	10873044	+	IGR	DEL	TTG	-	-	rs111484177		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10873042_10873044delTTG								None (None upstream) : TPTE (33699 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14343231	14343232	+	IGR	INS	-	AG	AG	rs111660103		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14343231_14343232insAG								None (None upstream) : C21orf99 (67255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	14684735	14684736	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14684735_14684736delAC								C21orf99 (194166 upstream) : POTED (297762 downstream)																																			---	---	---	---
LIPI	149998	broad.mit.edu	37	21	15486499	15486499	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15486499delA	uc002yjm.2	-						uc002yjk.2_Intron|uc002yjl.2_Intron	NM_198996	NP_945347			lipase, member I						lipid catabolic process	extracellular region|extracellular space|membrane|plasma membrane	heparin binding|phospholipase activity			ovary(2)	2				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	16087368	16087369	+	IGR	INS	-	A	A	rs151153878	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16087368_16087369insA								SAMSN1 (131645 upstream) : NRIP1 (246187 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	16680330	16680337	+	IGR	DEL	GAAGGAAG	-	-	rs71856492		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16680330_16680337delGAAGGAAG								NRIP1 (243204 upstream) : USP25 (422159 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	18511131	18511132	+	IGR	INS	-	GAAGGAAG	GAAGGAAG	rs140421958	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:18511131_18511132insGAAGGAAG								C21orf34 (529037 upstream) : CXADR (374198 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	20128892	20128893	+	Intron	DEL	AA	-	-	rs60602676		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20128892_20128893delAA	uc002ykx.2	-											Homo sapiens, clone IMAGE:5392784, mRNA.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	21413385	21413385	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21413385delA								None (None upstream) : C21orf131 (701529 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	21648112	21648112	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:21648112delA								None (None upstream) : C21orf131 (466802 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	22205119	22205119	+	IGR	DEL	A	-	-	rs76949326		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22205119delA								C21orf131 (29693 upstream) : NCAM2 (165514 downstream)																																			---	---	---	---
NCAM2	4685	broad.mit.edu	37	21	22378276	22378277	+	Intron	DEL	TT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22378276_22378277delTT	uc002yld.1	+						NCAM2_uc011acb.1_Intron	NM_004540	NP_004531			neural cell adhesion molecule 2 precursor						neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	23390874	23390875	+	Intron	INS	-	GT	GT	rs141531484	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23390874_23390875insGT	uc002ylf.2	-											Homo sapiens cDNA clone IMAGE:5271510.																														---	---	---	---
Unknown	0	broad.mit.edu	37	21	23588137	23588138	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:23588137_23588138delAC								NCAM2 (676923 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	24559377	24559377	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:24559377delA								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	26899215	26899215	+	IGR	DEL	T	-	-	rs61164219		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26899215delT								NCRNA00158 (95202 upstream) : MIR155HG (35242 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	26985864	26985865	+	IGR	DEL	GT	-	-	rs113390190		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26985864_26985865delGT								MRPL39 (6063 upstream) : JAM2 (25724 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	27167747	27167748	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27167747_27167748delGT								GABPA (22977 upstream) : APP (85114 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	27182191	27182200	+	IGR	DEL	TCTCTCGCTT	-	-	rs67367340		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:27182191_27182200delTCTCTCGCTT								GABPA (37421 upstream) : APP (70662 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	28231426	28231427	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28231426_28231427delCA								ADAMTS1 (13698 upstream) : ADAMTS5 (58805 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	28635081	28635082	+	IGR	INS	-	T	T	rs150926514	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28635081_28635082insT								ADAMTS5 (295642 upstream) : NCRNA00113 (459616 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	29186680	29186681	+	IGR	INS	-	AC	AC	rs142870374	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29186680_29186681insAC								NCRNA00113 (63128 upstream) : C21orf94 (199001 downstream)																																			---	---	---	---
C21orf7	56911	broad.mit.edu	37	21	30523092	30523093	+	Intron	INS	-	T	T	rs149587686		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30523092_30523093insT	uc002yne.2	+						C21orf7_uc011acr.1_Intron|C21orf7_uc002ynd.2_Intron|C21orf7_uc010gln.2_Intron|C21orf7_uc002ynf.2_Intron|C21orf7_uc010glo.2_Intron|C21orf7_uc002yng.2_Intron|C21orf7_uc010glp.2_Intron	NM_020152	NP_064537			chromosome 21 open reading frame 7							cytosol|nucleus	protein binding			ovary(2)	2				Colorectal(56;0.248)														---	---	---	---
GRIK1	2897	broad.mit.edu	37	21	31093933	31093933	+	Intron	DEL	T	-	-	rs72440239		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31093933delT	uc002yno.1	-						GRIK1_uc002ynn.2_Intron|GRIK1_uc011acs.1_Intron|GRIK1_uc011act.1_Intron|GRIK1_uc010glq.1_Intron|GRIK1_uc002ynr.2_Intron	NM_000830	NP_000821			glutamate receptor, ionotropic, kainate 1						central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)													---	---	---	---
GRIK1	2897	broad.mit.edu	37	21	31305934	31305935	+	Intron	INS	-	AG	AG	rs147298415	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31305934_31305935insAG	uc002yno.1	-						GRIK1_uc002ynn.2_Intron|GRIK1_uc011acs.1_Intron|GRIK1_uc011act.1_Intron|GRIK1_uc010glq.1_Intron|GRIK1_uc002ynr.2_Intron	NM_000830	NP_000821			glutamate receptor, ionotropic, kainate 1						central nervous system development|synaptic transmission	cell junction|postsynaptic membrane	kainate selective glutamate receptor activity			large_intestine(1)|ovary(1)|skin(1)	3					L-Glutamic Acid(DB00142)|Topiramate(DB00273)													---	---	---	---
Unknown	0	broad.mit.edu	37	21	31784547	31784547	+	IGR	DEL	A	-	-	rs75180342		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31784547delA								KRTAP13-1 (15411 upstream) : KRTAP13-3 (13164 downstream)																																			---	---	---	---
URB1	9875	broad.mit.edu	37	21	33749844	33749844	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33749844delA	uc002ypn.2	-						SNORA80_uc002ypo.2_5'Flank	NM_014825	NP_055640			URB1 ribosome biogenesis 1 homolog							nucleolus	protein binding				0																		---	---	---	---
C21orf63	59271	broad.mit.edu	37	21	33856273	33856274	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33856273_33856274delTG	uc002ypr.1	+						C21orf63_uc002yps.1_Intron|C21orf63_uc010glw.1_Intron|C21orf63_uc002ypt.1_Intron|C21orf63_uc002ypu.1_Intron	NM_058187	NP_478067			hypothetical protein LOC59271 precursor							integral to membrane	sugar binding			ovary(2)|pancreas(1)	3																		---	---	---	---
ITSN1	6453	broad.mit.edu	37	21	35248611	35248614	+	Intron	DEL	TCCT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35248611_35248614delTCCT	uc002yta.1	+						DONSON_uc002ysn.1_Intron|ITSN1_uc002ytb.1_Intron|ITSN1_uc002ytj.2_Intron|ITSN1_uc010gmm.1_Intron|ITSN1_uc010gmn.1_Intron|ITSN1_uc002ytk.1_Intron	NM_003024	NP_003015			intersectin 1 isoform ITSN-l						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic vesicle endocytosis	cell junction|coated pit|cytosol|lamellipodium|synapse|synaptosome	calcium ion binding|proline-rich region binding|protein complex scaffold|Rho guanyl-nucleotide exchange factor activity			ovary(3)|skin(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	35357388	35357398	+	IGR	DEL	CACACATACCA	-	-	rs77837942		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35357388_35357398delCACACATACCA								ATP5O (69230 upstream) : MRPS6 (88425 downstream)																																			---	---	---	---
SLC5A3	6526	broad.mit.edu	37	21	35456575	35456576	+	Intron	INS	-	A	A	rs147596999	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:35456575_35456576insA	uc002yto.2	+						MRPS6_uc002ytp.2_Intron	NM_006933	NP_008864			solute carrier family 5 (inositol transporters),							integral to plasma membrane	myo-inositol:sodium symporter activity			ovary(2)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	37958211	37958218	+	IGR	DEL	CCTTCCTC	-	-	rs34097871		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37958211_37958218delCCTTCCTC								CLDN14 (9344 upstream) : SIM2 (113773 downstream)																																			---	---	---	---
HLCS	3141	broad.mit.edu	37	21	38210599	38210600	+	Intron	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38210599_38210600delCA	uc010gnb.2	-						HLCS_uc002yvs.2_Intron	NM_000411	NP_000402			holocarboxylase synthetase						cell proliferation|histone biotinylation|response to biotin	chromatin|cytosol|mitochondrion|nuclear lamina|nuclear matrix	ATP binding|biotin binding|biotin-[acetyl-CoA-carboxylase] ligase activity|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity|enzyme binding			ovary(2)|breast(1)|kidney(1)|liver(1)	5		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)													---	---	---	---
ERG	2078	broad.mit.edu	37	21	39848143	39848143	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39848143delA	uc010gnw.2	-						ERG_uc002yxa.2_Intron|ERG_uc011aek.1_Intron|ERG_uc010gnv.2_Intron|ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc011aem.1_Intron|ERG_uc002yxc.3_Intron|ERG_uc010gnz.2_Intron	NM_001136155	NP_001129627			ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	40098214	40098214	+	IGR	DEL	T	-	-	rs113837798		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40098214delT								ERG (64510 upstream) : NCRNA00114 (12665 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	40368545	40368546	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40368545_40368546delTG								ETS2 (171669 upstream) : PSMG1 (178844 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	40484065	40484066	+	IGR	INS	-	A	A	rs150100968	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40484065_40484066insA								ETS2 (287189 upstream) : PSMG1 (63324 downstream)																																			---	---	---	---
B3GALT5	10317	broad.mit.edu	37	21	40995129	40995152	+	Intron	DEL	CCTCCCTCCCTCCCTCCCTCCCTC	-	-	rs11270935	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40995129_40995152delCCTCCCTCCCTCCCTCCCTCCCTC	uc002yyb.1	+						B3GALT5_uc002yyf.1_Intron|B3GALT5_uc002yye.2_Intron	NM_033173	NP_149363			UDP-Gal:betaGlcNAc beta						protein glycosylation	endoplasmic reticulum|Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			skin(1)	1		Prostate(19;2.55e-06)																---	---	---	---
Unknown	0	broad.mit.edu	37	21	41188351	41188352	+	IGR	INS	-	GAGAG	GAGAG	rs143121776	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41188351_41188352insGAGAG								IGSF5 (14330 upstream) : PCP4 (50995 downstream)																																			---	---	---	---
DSCAM	1826	broad.mit.edu	37	21	42200585	42200585	+	Intron	DEL	T	-	-	rs143193009		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42200585delT	uc002yyq.1	-						DSCAM_uc002yyr.1_Intron	NM_001389	NP_001380			Down syndrome cell adhesion molecule isoform						cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)																---	---	---	---
UMODL1	89766	broad.mit.edu	37	21	43518578	43518579	+	Intron	INS	-	AA	AA	rs144963163	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43518578_43518579insAA	uc002zaf.1	+						UMODL1_uc002zad.1_Intron|UMODL1_uc002zae.1_Intron|UMODL1_uc002zag.1_Intron|UMODL1_uc010gow.1_Intron|UMODL1_uc002zai.1_Intron|UMODL1_uc010gox.1_Intron|UMODL1_uc010goy.1_Intron|UMODL1_uc002zaj.1_Intron|UMODL1_uc010goz.1_Intron	NM_001004416	NP_001004416			uromodulin-like 1 isoform 1 precursor							cytoplasm|extracellular region|integral to membrane|plasma membrane	calcium ion binding|peptidase inhibitor activity			ovary(2)|skin(1)	3																		---	---	---	---
ABCG1	9619	broad.mit.edu	37	21	43713102	43713108	+	Intron	DEL	TACACAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43713102_43713108delTACACAG	uc002zaq.2	+						ABCG1_uc002zan.2_Intron|ABCG1_uc002zam.2_Intron|ABCG1_uc002zao.2_Intron|ABCG1_uc002zap.2_Intron|ABCG1_uc002zar.2_Intron|ABCG1_uc011aev.1_Intron|ABCG1_uc010gpb.1_Intron	NM_004915	NP_004906			ATP-binding cassette sub-family G member 1						amyloid precursor protein catabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|detection of hormone stimulus|high-density lipoprotein particle remodeling|intracellular cholesterol transport|lipoprotein metabolic process|low-density lipoprotein particle remodeling|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|positive regulation of cholesterol biosynthetic process|regulation of cholesterol esterification|regulation of transcription, DNA-dependent|response to lipid|reverse cholesterol transport	endoplasmic reticulum membrane|external side of plasma membrane|Golgi membrane|recycling endosome	ADP binding|ATP binding|cholesterol transporter activity|glycoprotein transporter activity|phospholipid transporter activity|protein heterodimerization activity|protein homodimerization activity|sterol-transporting ATPase activity|toxin transporter activity			ovary(2)|central_nervous_system(1)	3					Adenosine triphosphate(DB00171)													---	---	---	---
Unknown	0	broad.mit.edu	37	21	44261170	44261172	+	IGR	DEL	GTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44261170_44261172delGTG								PDE9A (65554 upstream) : WDR4 (2034 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	44368825	44368825	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44368825delC								NDUFV3 (39053 upstream) : PKNOX1 (25818 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	44467879	44467880	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44467879_44467880delGT								PKNOX1 (14191 upstream) : CBS (5421 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	44805241	44805242	+	IGR	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44805241_44805242delGT								CRYAA (212328 upstream) : SIK1 (29156 downstream)																																			---	---	---	---
SIK1	150094	broad.mit.edu	37	21	44848234	44848235	+	5'Flank	INS	-	ACAT	ACAT	rs150532609	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44848234_44848235insACAT	uc002zdf.2	-							NM_173354	NP_775490			salt-inducible kinase 1						anoikis|cell cycle|cell differentiation|intracellular protein kinase cascade|multicellular organismal development|regulation of cell differentiation|regulation of mitotic cell cycle	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|testis(2)|ovary(1)|central_nervous_system(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	21	46187001	46187001	+	IGR	DEL	C	-	-	rs71326068		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46187001delC								C21orf29 (55506 upstream) : UBE2G2 (1955 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	46257493	46257494	+	IGR	DEL	GA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46257493_46257494delGA								SUMO3 (19449 upstream) : PTTG1IP (12019 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	21	46731814	46731815	+	IGR	INS	-	CATT	CATT	rs143853410	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46731814_46731815insCATT								LOC642852 (14546 upstream) : COL18A1 (93282 downstream)																																			---	---	---	---
COL18A1	80781	broad.mit.edu	37	21	46915521	46915522	+	Intron	INS	-	ACAT	ACAT	rs150847622	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46915521_46915522insACAT	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron	NM_130444	NP_569711			alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)														---	---	---	---
Unknown	0	broad.mit.edu	37	21	47480251	47480252	+	IGR	INS	-	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47480251_47480252insC								COL6A1 (55288 upstream) : COL6A2 (37781 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	16947897	16947897	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16947897delA								OR11H1 (498093 upstream) : CCT8L2 (123751 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	17745924	17745926	+	IGR	DEL	TTA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17745924_17745926delTTA								CECR1 (43186 upstream) : CECR2 (94913 downstream)																																			---	---	---	---
CECR2	27443	broad.mit.edu	37	22	17898546	17898557	+	Intron	DEL	GAGGAAGAGGAG	-	-	rs55821121		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17898546_17898557delGAGGAAGAGGAG	uc010gqv.1	+							NM_031413	NP_113601			cat eye syndrome chromosome region, candidate 2						chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)														---	---	---	---
ARVCF	421	broad.mit.edu	37	22	19979719	19979719	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19979719delC	uc002zqz.2	-						ARVCF_uc002zra.2_5'Flank	NM_001670	NP_001661			armadillo repeat protein						cell adhesion|multicellular organismal development		protein binding			liver(1)	1	Colorectal(54;0.0993)																	---	---	---	---
MED15	51586	broad.mit.edu	37	22	20888828	20888828	+	Intron	DEL	G	-	-	rs73156979	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20888828delG	uc002zsp.2	+						MED15_uc002zsn.1_Intron|MED15_uc002zso.2_Intron|MED15_uc002zsq.2_Intron|MED15_uc010gso.2_Intron|MED15_uc002zsr.2_Intron|MED15_uc011ahs.1_Intron|MED15_uc011aht.1_Intron	NM_001003891	NP_001003891			mediator complex subunit 15 isoform a						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)															---	---	---	---
Unknown	0	broad.mit.edu	37	22	20956663	20956664	+	IGR	DEL	TC	-	-	rs151054100		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20956663_20956664delTC								MED15 (14745 upstream) : POM121L4P (87179 downstream)																																			---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22741581	22741581	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22741581delG	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	23115308	23115308	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23115308delG	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0																		---	---	---	---
SLC2A11	66035	broad.mit.edu	37	22	24223509	24223510	+	Intron	INS	-	TC	TC	rs142997495	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24223509_24223510insTC	uc002zyn.3	+						SLC2A11_uc002zyl.1_Intron|SLC2A11_uc002zym.3_Intron|SLC2A11_uc002zyo.3_Intron|SLC2A11_uc011ajc.1_Intron|SLC2A11_uc002zyp.3_Intron	NM_001024938	NP_001020109			glucose transporter protein 10 isoform c							integral to membrane|plasma membrane	sugar transmembrane transporter activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	25186352	25186353	+	IGR	INS	-	A	A	rs146095944	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25186352_25186353insA								PIWIL3 (15669 upstream) : SGSM1 (15783 downstream)																																			---	---	---	---
SGSM1	129049	broad.mit.edu	37	22	25203671	25203672	+	Intron	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25203671_25203672delGT	uc003abg.2	+						SGSM1_uc003abh.2_Intron|SGSM1_uc010guu.1_Intron|SGSM1_uc003abj.2_Intron|SGSM1_uc003abf.2_Intron	NM_001039948	NP_001035037			RUN and TBC1 domain containing 2 isoform 1							Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5																		---	---	---	---
ADRBK2	157	broad.mit.edu	37	22	26090709	26090709	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26090709delC	uc003abx.3	+						ADRBK2_uc010gux.2_Intron|ADRBK2_uc003abw.2_Intron|ADRBK2_uc003aby.3_Intron	NM_005160	NP_005151			beta-adrenergic receptor kinase 2								ATP binding|beta-adrenergic receptor kinase activity|signal transducer activity			lung(3)|ovary(2)|stomach(1)|central_nervous_system(1)	7					Adenosine triphosphate(DB00171)													---	---	---	---
Unknown	0	broad.mit.edu	37	22	26474225	26474226	+	IGR	INS	-	ACACAC	ACACAC	rs150646192	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26474225_26474226insACACAC								MYO18B (47218 upstream) : SEZ6L (91254 downstream)																																			---	---	---	---
SEZ6L	23544	broad.mit.edu	37	22	26756849	26756850	+	Intron	INS	-	A	A	rs138175861	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26756849_26756850insA	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron|SEZ6L_uc011ake.1_Intron	NM_021115	NP_066938			seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	27323468	27323468	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27323468delT								MIAT (208519 upstream) : MN1 (820798 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	27787924	27787931	+	IGR	DEL	CACACACG	-	-	rs66540137		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:27787924_27787931delCACACACG								MIAT (672975 upstream) : MN1 (356335 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	28006884	28006885	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28006884_28006885insA								MIAT (891935 upstream) : MN1 (137381 downstream)																																			---	---	---	---
TTC28	23331	broad.mit.edu	37	22	28803460	28803461	+	Intron	INS	-	CA	CA	rs146760827	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28803460_28803461insCA	uc003adp.3	-							NM_001145418	NP_001138890			tetratricopeptide repeat domain 28								binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	29263922	29263922	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29263922delA								XBP1 (67362 upstream) : ZNRF3 (15968 downstream)																																			---	---	---	---
TBC1D10A	83874	broad.mit.edu	37	22	30710800	30710800	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30710800delA	uc011akt.1	-						TBC1D10A_uc010gvu.2_Intron|TBC1D10A_uc003ahk.3_Intron	NM_031937	NP_114143			TBC1 domain family, member 10A							intracellular|microvillus	guanyl-nucleotide exchange factor activity|PDZ domain binding|Rab GTPase activator activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	30873907	30873907	+	IGR	DEL	A	-	-	rs149549945		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30873907delA								SEC14L3 (5873 upstream) : SDC4P (3370 downstream)																																			---	---	---	---
SEC14L4	284904	broad.mit.edu	37	22	30885728	30885728	+	3'UTR	DEL	T	-	-	rs34092815		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30885728delT	uc003aid.2	-	12					SEC14L4_uc011akz.1_3'UTR|SEC14L4_uc003aie.2_3'UTR|SEC14L4_uc003aif.2_3'UTR	NM_174977	NP_777637			SEC14p-like protein TAP3 isoform a							integral to membrane|intracellular	lipid binding|transporter activity			skin(1)	1					Vitamin E(DB00163)													---	---	---	---
TCN2	6948	broad.mit.edu	37	22	31016973	31016974	+	Intron	INS	-	GGT	GGT	rs149532960	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31016973_31016974insGGT	uc003aip.1	+						TCN2_uc003aiq.1_Intron|TCN2_uc003air.1_Intron	NM_000355	NP_000346			transcobalamin II precursor						cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---
OSBP2	23762	broad.mit.edu	37	22	31103880	31103881	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31103880_31103881insT	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc003aix.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron	NM_030758	NP_110385			oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	31463231	31463231	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31463231delT								TUG1 (87854 upstream) : SMTN (14074 downstream)																																			---	---	---	---
INPP5J	27124	broad.mit.edu	37	22	31509421	31509421	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31509421delA	uc010gwf.2	+						SELM_uc011alj.1_Intron					RecName: Full=Phosphatidylinositol 4,5-bisphosphate 5-phosphatase A;          EC=3.1.3.56; AltName: Full=Inositol polyphosphate 5-phosphatase J;							cytoplasm|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|SH3 domain binding			skin(1)	1																		---	---	---	---
DRG1	4733	broad.mit.edu	37	22	31801993	31801993	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31801993delT	uc003aku.2	+							NM_004147	NP_004138			developmentally regulated GTP binding protein 1						multicellular organismal development|transcription, DNA-dependent	cytoplasm|intermediate filament cytoskeleton|nucleus	GTP binding|transcription factor binding			central_nervous_system(1)	1																		---	---	---	---
DRG1	4733	broad.mit.edu	37	22	31825640	31825641	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31825640_31825641insT	uc003aku.2	+							NM_004147	NP_004138			developmentally regulated GTP binding protein 1						multicellular organismal development|transcription, DNA-dependent	cytoplasm|intermediate filament cytoskeleton|nucleus	GTP binding|transcription factor binding			central_nervous_system(1)	1																		---	---	---	---
DEPDC5	9681	broad.mit.edu	37	22	32193915	32193915	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32193915delT	uc003als.2	+						DEPDC5_uc011als.1_Intron|DEPDC5_uc011alu.1_Intron|DEPDC5_uc011alv.1_Intron|DEPDC5_uc003alt.2_Intron|DEPDC5_uc003alr.1_Intron|DEPDC5_uc011alt.1_Intron	NM_014662	NP_055477			DEP domain containing 5 isoform 1						intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8																		---	---	---	---
SLC5A1	6523	broad.mit.edu	37	22	32484323	32484324	+	Intron	INS	-	T	T	rs5844962		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32484323_32484324insT	uc003amc.2	+						SLC5A1_uc011alz.1_Intron	NM_000343	NP_000334			solute carrier family 5 (sodium/glucose						carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	33485300	33485301	+	IGR	INS	-	TTC	TTC	rs71764754		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33485300_33485301insTTC								SYN3 (30923 upstream) : LARGE (183762 downstream)																																			---	---	---	---
LARGE	9215	broad.mit.edu	37	22	34160882	34160883	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34160882_34160883insT	uc003and.3	-						LARGE_uc003ane.3_Intron|LARGE_uc010gwp.2_Intron|LARGE_uc011ame.1_Intron|LARGE_uc011amf.1_Intron	NM_004737	NP_004728			like-glycosyltransferase						glycosphingolipid biosynthetic process|muscle cell homeostasis|N-acetylglucosamine metabolic process|protein glycosylation	integral to Golgi membrane	acetylglucosaminyltransferase activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(1;0.219)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	34724452	34724453	+	IGR	DEL	AT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34724452_34724453delAT								LARGE (405868 upstream) : ISX (737676 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	34872248	34872248	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34872248delA								LARGE (553664 upstream) : ISX (589881 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	35838350	35838351	+	IGR	INS	-	AA	AA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35838350_35838351insAA								MCM5 (17856 upstream) : RASD2 (99001 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	36029738	36029739	+	Intron	DEL	CA	-	-	rs28378648	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36029738_36029739delCA	uc010gwt.1	-											Homo sapiens hypothetical gene supported by BC001801, mRNA (cDNA clone MGC:3170 IMAGE:3355513), complete cds.																														---	---	---	---
Unknown	0	broad.mit.edu	37	22	36810458	36810458	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36810458delT								MYH9 (26395 upstream) : TXN2 (52635 downstream)																																			---	---	---	---
EIF3D	8664	broad.mit.edu	37	22	36914541	36914542	+	Intron	INS	-	A	A	rs111947228		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36914541_36914542insA	uc003apq.2	-						EIF3D_uc011amr.1_Intron|EIF3D_uc003apr.2_Intron|EIF3D_uc011ams.1_Intron|EIF3D_uc011amt.1_Intron	NM_003753	NP_003744			eukaryotic translation initiation factor 3							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			pancreas(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	37368760	37368761	+	IGR	INS	-	AAAA	AAAA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37368760_37368761insAAAA								CSF2RB (32283 upstream) : C22orf33 (18400 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	38421365	38421366	+	IGR	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38421365_38421366delAC								POLR2F (37024 upstream) : PICK1 (31896 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	38585209	38585218	+	IGR	DEL	GGGATGGAGA	-	-	rs35889736	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38585209_38585218delGGGATGGAGA								PLA2G6 (7373 upstream) : MAFF (12721 downstream)																																			---	---	---	---
LOC646851	646851	broad.mit.edu	37	22	39006532	39006533	+	Intron	INS	-	CT	CT	rs146946513		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39006532_39006533insCT	uc011anx.1	-						LOC646851_uc011anw.1_Intron					SubName: Full=Putative uncharacterized protein ENSP00000348086;												0																		---	---	---	---
CBY1	25776	broad.mit.edu	37	22	39056629	39056630	+	Intron	DEL	AC	-	-	rs67187850		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39056629_39056630delAC	uc003awb.2	+						CBY1_uc011any.1_Intron|CBY1_uc003awc.2_Intron	NM_001002880	NP_001002880			PKD2 interactor, golgi and endoplasmic reticulum						cardiac muscle cell differentiation|fat cell differentiation|negative regulation of transcription, DNA-dependent|protein localization	nuclear speck|trans-Golgi network	beta-catenin binding|identical protein binding			ovary(1)	1	Melanoma(58;0.04)																	---	---	---	---
CACNA1I	8911	broad.mit.edu	37	22	39979226	39979227	+	Intron	INS	-	ATCC	ATCC	rs151147807	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39979226_39979227insATCC	uc003ayc.2	+						CACNA1I_uc003ayd.2_Intron	NM_021096	NP_066919			calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)													---	---	---	---
CACNA1I	8911	broad.mit.edu	37	22	40025537	40025538	+	Intron	INS	-	GGCCAGGCAG	GGCCAGGCAG	rs142423850	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40025537_40025538insGGCCAGGCAG	uc003ayc.2	+						CACNA1I_uc003ayd.2_Intron|CACNA1I_uc003aye.2_Intron|CACNA1I_uc003ayf.2_Intron	NM_021096	NP_066919			calcium channel, voltage-dependent, T type,						axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)													---	---	---	---
TNRC6B	23112	broad.mit.edu	37	22	40723853	40723853	+	3'UTR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40723853delT	uc011aor.1	+	23					TNRC6B_uc003aym.2_3'UTR|TNRC6B_uc003ayn.3_3'UTR	NM_001162501	NP_001155973			trinucleotide repeat containing 6B isoform 1						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0																		---	---	---	---
SLC25A17	10478	broad.mit.edu	37	22	41172910	41172911	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41172910_41172911insA	uc003azc.2	-						SLC25A17_uc010gyg.2_Intron|SLC25A17_uc011aou.1_Intron|SLC25A17_uc003azd.2_Intron|SLC25A17_uc011aov.1_Intron	NM_006358	NP_006349			solute carrier family 25 (mitochondrial carrier;						fatty acid alpha-oxidation	integral to plasma membrane|mitochondrial inner membrane|peroxisomal membrane	adenine nucleotide transmembrane transporter activity|protein binding				0																		---	---	---	---
EP300	2033	broad.mit.edu	37	22	41510828	41510829	+	Intron	INS	-	A	A	rs79320170		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41510828_41510829insA	uc003azl.3	+							NM_001429	NP_001420			E1A binding protein p300						apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64								T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				---	---	---	---
Unknown	0	broad.mit.edu	37	22	41806643	41806650	+	IGR	DEL	GTGTGTGC	-	-	rs111611911	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41806643_41806650delGTGTGTGC								TEF (11315 upstream) : TOB2 (22842 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	42619841	42619841	+	IGR	DEL	A	-	-	rs79060891	byFrequency;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42619841delA								TCF20 (8396 upstream) : NFAM1 (156574 downstream)																																			---	---	---	---
SERHL	94009	broad.mit.edu	37	22	42939755	42939756	+	Intron	DEL	AC	-	-	rs35801259		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42939755_42939756delAC	uc011apm.1	+											RecName: Full=Serine hydrolase-like protein;          EC=3.1.-.-;												0																		---	---	---	---
SERHL	94009	broad.mit.edu	37	22	42943591	42943591	+	Intron	DEL	A	-	-	rs111540321		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42943591delA	uc011apm.1	+											RecName: Full=Serine hydrolase-like protein;          EC=3.1.-.-;												0																		---	---	---	---
CYB5R3	1727	broad.mit.edu	37	22	43018081	43018082	+	Intron	INS	-	C	C	rs8190466		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43018081_43018082insC	uc003bcz.2	-						CYB5R3_uc010gzc.1_Intron|CYB5R3_uc003bcw.2_Intron|CYB5R3_uc011aps.1_Intron|CYB5R3_uc003bcy.2_Intron|CYB5R3_uc003bcx.2_Intron	NM_000398	NP_000389			cytochrome b5 reductase 3 isoform m						blood circulation|cholesterol biosynthetic process|water-soluble vitamin metabolic process	endoplasmic reticulum membrane|hemoglobin complex|mitochondrial outer membrane	cytochrome-b5 reductase activity			skin(1)	1					NADH(DB00157)													---	---	---	---
Unknown	0	broad.mit.edu	37	22	43164304	43164305	+	IGR	INS	-	TA	TA	rs80238115		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43164304_43164305insTA								A4GALT (47018 upstream) : ARFGAP3 (28227 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	43186684	43186684	+	IGR	DEL	C	-	-	rs11352003		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43186684delC								A4GALT (69398 upstream) : ARFGAP3 (5848 downstream)																																			---	---	---	---
EFCAB6	64800	broad.mit.edu	37	22	44054518	44054519	+	Intron	INS	-	G	G	rs141880585	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44054518_44054519insG	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc010gzj.1_Intron|EFCAB6_uc010gzk.1_Intron	NM_022785	NP_073622			CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)																---	---	---	---
KIAA1644	85352	broad.mit.edu	37	22	44680766	44680767	+	Intron	INS	-	CTGCCTTCCTGCCTGCCTGC	CTGCCTTCCTGCCTGCCTGC	rs71786962		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44680766_44680767insCTGCCTTCCTGCCTGCCTGC	uc003bet.2	-							NM_001099294	NP_001092764			hypothetical protein LOC85352 precursor							integral to membrane				ovary(1)	1		all_neural(38;0.0762)|Ovarian(80;0.105)|Glioma(61;0.222)																---	---	---	---
Unknown	0	broad.mit.edu	37	22	44831009	44831009	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44831009delA								KIAA1644 (122278 upstream) : LDOC1L (57441 downstream)																																			---	---	---	---
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45150219	45150220	+	Intron	DEL	TG	-	-	rs112782531		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45150219_45150220delTG	uc003bfd.2	+						PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|ARHGAP8_uc003bfi.2_Intron|ARHGAP8_uc010gzv.2_Intron|ARHGAP8_uc003bfj.2_Intron|ARHGAP8_uc003bfk.2_Intron|PRR5-ARHGAP8_uc003bfg.1_Intron	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2																		---	---	---	---
CELSR1	9620	broad.mit.edu	37	22	46920466	46920473	+	Intron	DEL	TGTCTGTC	-	-	rs71667958	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46920466_46920473delTGTCTGTC	uc003bhw.1	-							NM_014246	NP_055061			cadherin EGF LAG seven-pass G-type receptor 1						central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)														---	---	---	---
Unknown	0	broad.mit.edu	37	22	48312844	48312844	+	IGR	DEL	C	-	-	rs111954845		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48312844delC								TBC1D22A (743122 upstream) : FAM19A5 (572444 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	48313609	48313621	+	IGR	DEL	TCCCTCTCCTTCT	-	-	rs139006229	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48313609_48313621delTCCCTCTCCTTCT								TBC1D22A (743887 upstream) : FAM19A5 (571667 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	48836239	48836240	+	IGR	INS	-	C	C	rs141922581	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48836239_48836240insC								None (None upstream) : FAM19A5 (49048 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	22	49638944	49638945	+	IGR	INS	-	TGGC	TGGC	rs6009564	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49638944_49638945insTGGC								FAM19A5 (491202 upstream) : C22orf34 (169231 downstream)																																			---	---	---	---
C22orf34	348645	broad.mit.edu	37	22	49966764	49966767	+	Intron	DEL	ATGC	-	-	rs113484770	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49966764_49966767delATGC	uc003biq.2	-											Homo sapiens cDNA FLJ42972 fis, clone BRSTN2019129.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	50056707	50056708	+	IGR	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50056707_50056708insA								C22orf34 (5517 upstream) : BRD1 (110230 downstream)																																			---	---	---	---
TTLL8	164714	broad.mit.edu	37	22	50459003	50459005	+	Intron	DEL	ACG	-	-	rs111586857		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50459003_50459005delACG	uc011ark.1	-							NM_001080447	NP_001073916			tubulin tyrosine ligase-like family, member 8											ovary(2)	2		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)														---	---	---	---
MOV10L1	54456	broad.mit.edu	37	22	50565055	50565055	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50565055delT	uc003bjj.2	+						MOV10L1_uc003bjk.3_Intron|MOV10L1_uc011arp.1_Intron|MOV10L1_uc011arq.1_Intron|MOV10L1_uc010hao.1_Intron	NM_018995	NP_061868			MOV10-like 1 isoform 1						germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)														---	---	---	---
Unknown	0	broad.mit.edu	37	X	431927	431927	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:431927delG								PPP2R3B (84300 upstream) : SHOX (153152 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	790397	790397	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:790397delA								SHOX (170252 upstream) : CRLF2 (524490 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1031236	1031237	+	IGR	INS	-	AGGA	AGGA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1031236_1031237insAGGA								SHOX (411091 upstream) : CRLF2 (283650 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	1674355	1674361	+	IGR	DEL	TCAAATA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1674355_1674361delTCAAATA								P2RY8 (18318 upstream) : SFRS17A (36125 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	2577069	2577070	+	IGR	INS	-	GAGA	GAGA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2577069_2577070insGAGA								DHRSX (158054 upstream) : CD99 (32158 downstream)																																			---	---	---	---
STS	412	broad.mit.edu	37	X	7175843	7175844	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7175843_7175844delTG	uc004cry.3	+							NM_000351	NP_000342			steryl-sulfatase precursor						female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)									Ichthyosis				---	---	---	---
Unknown	0	broad.mit.edu	37	X	8063678	8063681	+	IGR	DEL	TGTG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8063678_8063681delTGTG								PNPLA4 (167898 upstream) : MIR651 (31325 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	8932236	8932236	+	IGR	DEL	A	-	-	rs145974689		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8932236delA								FAM9A (162812 upstream) : FAM9B (60803 downstream)																																			---	---	---	---
SHROOM2	357	broad.mit.edu	37	X	9791205	9791207	+	Intron	DEL	TTC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9791205_9791207delTTC	uc004csu.1	+							NM_001649	NP_001640			apical protein of Xenopus-like						apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)																---	---	---	---
ARHGAP6	395	broad.mit.edu	37	X	11297674	11297675	+	Intron	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11297674_11297675delTG	uc004cup.1	-						ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cur.1_Intron|ARHGAP6_uc004cun.1_Intron|ARHGAP6_uc010neb.1_Intron|ARHGAP6_uc011mif.1_Intron	NM_013427	NP_038286			Rho GTPase activating protein 6 isoform 1						actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2																		---	---	---	---
ARHGAP6	395	broad.mit.edu	37	X	11630044	11630044	+	Intron	DEL	A	-	-	rs5901449		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11630044delA	uc004cup.1	-						ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cur.1_Intron	NM_013427	NP_038286			Rho GTPase activating protein 6 isoform 1						actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	13461661	13461662	+	IGR	INS	-	CTCT	CTCT	rs35714613		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13461661_13461662insCTCT								ATXN3L (123143 upstream) : EGFL6 (126079 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	13512773	13512774	+	IGR	INS	-	CTAA	CTAA	rs111689944		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13512773_13512774insCTAA								ATXN3L (174255 upstream) : EGFL6 (74967 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	14963825	14963826	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14963825_14963826delTG								MOSPD2 (24370 upstream) : ASB9 (298285 downstream)																																			---	---	---	---
ASB9	140462	broad.mit.edu	37	X	15263558	15263559	+	Intron	DEL	CT	-	-	rs147850311		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15263558_15263559delCT	uc004cwl.2	-						ASB9_uc004cwk.2_Intron|ASB9_uc004cwm.2_Intron|ASB9_uc010ner.2_Intron	NM_001031739	NP_001026909			ankyrin repeat and SOCS box-containing 9 isoform						intracellular signal transduction						0	Hepatocellular(33;0.183)																	---	---	---	---
REPS2	9185	broad.mit.edu	37	X	17106558	17106558	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17106558delT	uc004cxv.1	+						REPS2_uc004cxw.1_Intron|REPS2_uc011miw.1_Intron	NM_004726	NP_004717			RALBP1 associated Eps domain containing 2						epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding			skin(2)|central_nervous_system(1)	3	Hepatocellular(33;0.183)																	---	---	---	---
REPS2	9185	broad.mit.edu	37	X	17150663	17150663	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17150663delT	uc004cxv.1	+						REPS2_uc004cxw.1_Intron|REPS2_uc011miw.1_Intron	NM_004726	NP_004717			RALBP1 associated Eps domain containing 2						epidermal growth factor receptor signaling pathway|protein complex assembly	cytoplasm	calcium ion binding|protein binding			skin(2)|central_nervous_system(1)	3	Hepatocellular(33;0.183)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	18080945	18080945	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18080945delA								RAI2 (201488 upstream) : BEND2 (100108 downstream)																																			---	---	---	---
PPEF1	5475	broad.mit.edu	37	X	18822900	18822900	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18822900delC	uc004cyq.2	+						PPEF1_uc004cyp.2_Intron|PPEF1_uc004cyr.2_Intron|PPEF1_uc004cys.2_Intron|PPEF1_uc011mja.1_Intron|PPEF1_uc011mjb.1_Intron	NM_006240	NP_006231			protein phosphatase with EF hand calcium-binding						detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)																	---	---	---	---
RPS6KA3	6197	broad.mit.edu	37	X	20207244	20207245	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20207244_20207245insT	uc004czu.2	-						RPS6KA3_uc011mjk.1_Intron|RPS6KA3_uc004czv.2_Intron|RPS6KA3_uc011mjl.1_Intron|RPS6KA3_uc011mjm.1_Intron	NM_004586	NP_004577			ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|central nervous system development|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|skeletal system development|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(4)|stomach(1)|ovary(1)|lung(1)|breast(1)	8																		---	---	---	---
RPS6KA3	6197	broad.mit.edu	37	X	20211001	20211002	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20211001_20211002insA	uc004czu.2	-						RPS6KA3_uc011mjk.1_Intron|RPS6KA3_uc004czv.2_Intron|RPS6KA3_uc011mjl.1_Intron|RPS6KA3_uc011mjm.1_Intron	NM_004586	NP_004577			ribosomal protein S6 kinase, 90kDa, polypeptide						axon guidance|central nervous system development|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|skeletal system development|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|caspase inhibitor activity|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(4)|stomach(1)|ovary(1)|lung(1)|breast(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	20344805	20344805	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20344805delT								RPS6KA3 (59282 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	20830762	20830762	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20830762delT								RPS6KA3 (545239 upstream) : CNKSR2 (562218 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	20970098	20970098	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:20970098delA								RPS6KA3 (684575 upstream) : CNKSR2 (422882 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	21910057	21910058	+	IGR	DEL	AA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21910057_21910058delAA								MBTPS2 (6517 upstream) : SMS (48784 downstream)																																			---	---	---	---
PCYT1B	9468	broad.mit.edu	37	X	24684724	24684727	+	Intron	DEL	GTGT	-	-	rs67535986		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24684724_24684727delGTGT	uc004dbj.2	-							NM_001163264	NP_001156736			choline phosphate cytidylyltransferase 1 beta							endoplasmic reticulum	choline-phosphate cytidylyltransferase activity				0					Choline(DB00122)													---	---	---	---
Unknown	0	broad.mit.edu	37	X	26720635	26720636	+	IGR	INS	-	GT	GT	rs72324280		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26720635_26720636insGT								VENTXP1 (141467 upstream) : SMEK3P (757692 downstream)																																			---	---	---	---
IL1RAPL1	11141	broad.mit.edu	37	X	29219811	29219811	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29219811delT	uc004dby.2	+							NM_014271	NP_055086			interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5																		---	---	---	---
IL1RAPL1	11141	broad.mit.edu	37	X	29398344	29398345	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29398344_29398345insT	uc004dby.2	+							NM_014271	NP_055086			interleukin 1 receptor accessory protein-like 1						innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	30669848	30669849	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30669848_30669849insT								CXorf21 (73934 upstream) : GK (1627 downstream)																																			---	---	---	---
DMD	1756	broad.mit.edu	37	X	31317474	31317474	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31317474delA	uc004dda.1	-						DMD_uc004dcq.1_Intron|DMD_uc004dcr.1_Intron|DMD_uc004dcs.1_Intron|DMD_uc004dct.1_Intron|DMD_uc004dcu.1_Intron|DMD_uc004dcv.1_Intron|DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
DMD	1756	broad.mit.edu	37	X	32009878	32009879	+	Intron	INS	-	AA	AA	rs35842948		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32009878_32009879insAA	uc004dda.1	-						DMD_uc004dcr.1_Intron|DMD_uc004dcs.1_Intron|DMD_uc004dct.1_Intron|DMD_uc004dcu.1_Intron|DMD_uc004dcv.1_Intron|DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron|DMD_uc010ngn.1_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
DMD	1756	broad.mit.edu	37	X	32804203	32804204	+	Intron	INS	-	GTGT	GTGT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32804203_32804204insGTGT	uc004dda.1	-						DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Intron|DMD_uc010ngp.1_Intron|DMD_uc010ngq.1_Intron|DMD_uc010ngr.1_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
DMD	1756	broad.mit.edu	37	X	33133485	33133486	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:33133485_33133486insT	uc004dda.1	-						DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron|DMD_uc004ddf.2_Intron|DMD_uc010ngr.1_Intron	NM_004006	NP_003997			dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---
Unknown	0	broad.mit.edu	37	X	33437698	33437700	+	IGR	DEL	ACA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:33437698_33437700delACA								DMD (79972 upstream) : FAM47A (710175 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	36172919	36172919	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36172919delT								CXorf59 (9732 upstream) : CXorf30 (81132 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	36186690	36186691	+	IGR	INS	-	T	T	rs72029953		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36186690_36186691insT								CXorf59 (23503 upstream) : CXorf30 (67360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	36901549	36901549	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36901549delT								CXorf30 (498116 upstream) : FAM47C (124921 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	37712730	37712730	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37712730delA								DYNLT3 (5841 upstream) : CXorf27 (137340 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	39187469	39187469	+	5'Flank	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39187469delT	uc004dek.1	-											Homo sapiens cDNA FLJ36359 fis, clone THYMU2007528.																														---	---	---	---
Unknown	0	broad.mit.edu	37	X	39730400	39730407	+	IGR	DEL	GAGGGAGA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39730400_39730407delGAGGGAGA								None (None upstream) : BCOR (180094 downstream)																																			---	---	---	---
USP9X	8239	broad.mit.edu	37	X	41087878	41087879	+	Intron	INS	-	T	T	rs72539223		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41087878_41087879insT	uc004dfb.2	+						USP9X_uc004dfc.2_Intron	NM_001039590	NP_001034679			ubiquitin specific protease 9, X-linked isoform						BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	42605588	42605588	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42605588delA								CASK (823301 upstream) : PPP1R2P9 (31031 downstream)																																			---	---	---	---
MAOA	4128	broad.mit.edu	37	X	43551284	43551287	+	Intron	DEL	CACG	-	-	rs10548364		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:43551284_43551287delCACG	uc004dfy.2	+						MAOA_uc011mkw.1_Intron	NM_000240	NP_000231			monoamine oxidase A						behavior|neurotransmitter biosynthetic process|neurotransmitter catabolic process|neurotransmitter secretion|xenobiotic metabolic process	integral to membrane|mitochondrial outer membrane	primary amine oxidase activity|protein binding			breast(2)|ovary(1)	3					Almotriptan(DB00918)|Carbidopa(DB00190)|Clonazepam(DB01068)|Dopamine(DB00988)|Fluvoxamine(DB00176)|Ginkgo biloba(DB01381)|Imipramine(DB00458)|Isocarboxazid(DB01247)|Levodopa(DB01235)|Linezolid(DB00601)|Lorazepam(DB00186)|Moclobemide(DB01171)|Nicotine(DB00184)|Norepinephrine(DB00368)|Phenelzine(DB00780)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pseudoephedrine(DB00852)|Rasagiline(DB01367)|Riboflavin(DB00140)|Rizatriptan(DB00953)|Selegiline(DB01037)|Sumatriptan(DB00669)|Testosterone(DB00624)|Tranylcypromine(DB00752)|Zolmitriptan(DB00315)													---	---	---	---
Unknown	0	broad.mit.edu	37	X	44439179	44439179	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44439179delC								FUNDC1 (36958 upstream) : DUSP21 (264070 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	45634632	45634633	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45634632_45634633insT								MIR222 (28102 upstream) : ZNF673 (671991 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	48015986	48015986	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48015986delT								SSX6 (35917 upstream) : SSX5 (29670 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	48301190	48301191	+	IGR	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48301190_48301191delCA								SSX4 (48405 upstream) : SLC38A5 (15737 downstream)																																			---	---	---	---
GPKOW	27238	broad.mit.edu	37	X	48971885	48971885	+	Intron	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48971885delG	uc004dmr.2	-							NM_015698	NP_056513			G patch domain and KOW motifs							nucleus	nucleic acid binding			ovary(2)	2																		---	---	---	---
TSPYL2	64061	broad.mit.edu	37	X	53108771	53108772	+	5'Flank	INS	-	TG	TG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53108771_53108772insTG	uc004drw.2	+						TSPYL2_uc004drv.2_5'Flank	NM_022117	NP_071400			TSPY-like 2						cell cycle|chromatin modification|negative regulation of cell cycle|negative regulation of cell growth|negative regulation of DNA replication|nucleosome assembly|regulation of protein kinase activity|regulation of signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|rDNA binding				0																		---	---	---	---
TSPYL2	64061	broad.mit.edu	37	X	53116492	53116493	+	Intron	INS	-	AG	AG	rs34843901		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53116492_53116493insAG	uc004drw.2	+						TSPYL2_uc004drv.2_3'UTR	NM_022117	NP_071400			TSPY-like 2						cell cycle|chromatin modification|negative regulation of cell cycle|negative regulation of cell growth|negative regulation of DNA replication|nucleosome assembly|regulation of protein kinase activity|regulation of signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|rDNA binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	56314376	56314376	+	IGR	DEL	A	-	-	rs113022811		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56314376delA								KLF8 (56 upstream) : UBQLN2 (275684 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	56444953	56444954	+	IGR	INS	-	AA	AA	rs74501365		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:56444953_56444954insAA								KLF8 (130633 upstream) : UBQLN2 (145106 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	63232148	63232148	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63232148delA								MIR1468 (226181 upstream) : FAM123B (172850 downstream)														p.0?(2)																					---	---	---	---
Unknown	0	broad.mit.edu	37	X	64374848	64374848	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64374848delT								ZC4H2 (120255 upstream) : ZC3H12B (333858 downstream)																																			---	---	---	---
ZC3H12B	340554	broad.mit.edu	37	X	64723502	64723503	+	3'UTR	INS	-	T	T	rs2038283		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64723502_64723503insT	uc010nko.2	+	5						NM_001010888	NP_001010888			zinc finger CCCH-type containing 12B								endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3																		---	---	---	---
STARD8	9754	broad.mit.edu	37	X	67881788	67881789	+	Intron	DEL	CT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67881788_67881789delCT	uc004dxa.2	+						STARD8_uc004dxb.2_Intron	NM_014725	NP_055540			StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	68204249	68204252	+	IGR	DEL	GTGT	-	-	rs67164669		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68204249_68204252delGTGT								EFNB1 (138220 upstream) : PJA1 (176330 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	68272688	68272689	+	IGR	INS	-	TCTCT	TCTCT			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68272688_68272689insTCTCT								EFNB1 (206659 upstream) : PJA1 (107893 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	68321929	68321930	+	IGR	DEL	GT	-	-	rs71662599		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68321929_68321930delGT								EFNB1 (255900 upstream) : PJA1 (58652 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	68514573	68514574	+	IGR	INS	-	ACACACAC	ACACACAC	rs59375884		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68514573_68514574insACACACAC								PJA1 (129233 upstream) : FAM155B (210504 downstream)																																			---	---	---	---
ARR3	407	broad.mit.edu	37	X	69488730	69488733	+	Intron	DEL	CATT	-	-	rs72353759		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69488730_69488733delCATT	uc004dyb.2	+						ARR3_uc004dya.2_Intron	NM_004312	NP_004303			arrestin 3, retinal (X-arrestin)						signal transduction|visual perception	cytoplasm|soluble fraction				large_intestine(2)|ovary(2)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	70419173	70419173	+	IGR	DEL	A	-	-	rs41364750		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70419173delA								NLGN3 (28124 upstream) : BCYRN1 (10862 downstream)																																			---	---	---	---
NHSL2	340527	broad.mit.edu	37	X	71197063	71197063	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71197063delA	uc011mqa.1	+							NM_001013627	NP_001013649			NHS-like 2												0	Renal(35;0.156)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	72242687	72242690	+	IGR	DEL	AGGC	-	-	rs5937816	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72242687_72242690delAGGC								PABPC1L2B (17137 upstream) : PABPC1L2A (54487 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	73895343	73895343	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73895343delT								RLIM (60882 upstream) : KIAA2022 (57349 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	74755758	74755759	+	IGR	INS	-	TATG	TATG	rs146391269		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74755758_74755759insTATG								ZDHHC15 (12421 upstream) : MAGEE2 (247064 downstream)																																			---	---	---	---
P2RY10	27334	broad.mit.edu	37	X	78212080	78212080	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78212080delA	uc004ede.2	+						P2RY10_uc004edf.2_Intron	NM_014499	NP_055314			G-protein coupled purinergic receptor P2Y10							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(2)|breast(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	78268696	78268697	+	IGR	INS	-	TTTG	TTTG	rs148223008		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78268696_78268697insTTTG								P2RY10 (51259 upstream) : GPR174 (157772 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	82298909	82298909	+	IGR	DEL	A	-	-	rs78827281		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82298909delA								None (None upstream) : POU3F4 (464360 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	84465157	84465157	+	IGR	DEL	T	-	-	rs114726933	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84465157delT								SATL1 (101183 upstream) : ZNF711 (33840 downstream)																																			---	---	---	---
DACH2	117154	broad.mit.edu	37	X	85501175	85501175	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85501175delA	uc004eew.2	+						DACH2_uc004eex.2_Intron|DACH2_uc010nmq.2_Intron	NM_053281	NP_444511			dachshund 2 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5																		---	---	---	---
DACH2	117154	broad.mit.edu	37	X	85643756	85643756	+	Intron	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85643756delC	uc004eew.2	+						DACH2_uc004eex.2_Intron|DACH2_uc010nmq.2_Intron|DACH2_uc011mra.1_Intron|DACH2_uc010nmr.2_Intron	NM_053281	NP_444511			dachshund 2 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	87057097	87057098	+	IGR	DEL	TG	-	-	rs67134475		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:87057097_87057098delTG								KLHL4 (132047 upstream) : CPXCR1 (945128 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	93158559	93158559	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:93158559delT								FAM133A (191298 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	95331412	95331412	+	IGR	DEL	T	-	-	rs112055642		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:95331412delT								None (None upstream) : LOC643486 (260674 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	95630716	95630716	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:95630716delG								LOC643486 (37815 upstream) : DIAPH2 (308946 downstream)																																			---	---	---	---
DIAPH2	1730	broad.mit.edu	37	X	95942443	95942444	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:95942443_95942444insT	uc004efu.3	+						DIAPH2_uc004eft.3_Intron|DIAPH2_uc004efs.2_Intron	NM_006729	NP_006720			diaphanous 2 isoform 156						cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4																		---	---	---	---
DIAPH2	1730	broad.mit.edu	37	X	96646674	96646674	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:96646674delT	uc004efu.3	+						DIAPH2_uc004eft.3_Intron	NM_006729	NP_006720			diaphanous 2 isoform 156						cell differentiation|cytokinesis|multicellular organismal development|oogenesis	cytosol|early endosome|Golgi apparatus|mitochondrion|nucleolus	receptor binding|Rho GTPase binding			ovary(3)|lung(1)	4																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	97192426	97192426	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:97192426delT								DIAPH2 (336830 upstream) : None (None downstream)																																			---	---	---	---
PCDH19	57526	broad.mit.edu	37	X	99648495	99648496	+	Intron	INS	-	ACAC	ACAC	rs6620882		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99648495_99648496insACAC	uc010nmz.2	-						PCDH19_uc004efw.3_Intron|PCDH19_uc004efx.3_Intron	NM_020766	NP_001098713			protocadherin 19 isoform b						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	102458031	102458031	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102458031delA								NXF3 (110009 upstream) : BEX4 (11989 downstream)																																			---	---	---	---
RAB9B	51209	broad.mit.edu	37	X	103057118	103057119	+	Intron	DEL	AG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103057118_103057119delAG	uc004eli.1	-											Homo sapiens mRNA for RAB9-like protein, complete cds.						Golgi to endosome transport|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding			lung(3)	3																		---	---	---	---
ESX1	80712	broad.mit.edu	37	X	103498082	103498083	+	Intron	INS	-	AA	AA			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103498082_103498083insAA	uc004ely.2	-							NM_153448	NP_703149			extraembryonic, spermatogenesis, homeobox						negative regulation of transcription, DNA-dependent|regulation of cell cycle	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1																		---	---	---	---
IL1RAPL2	26280	broad.mit.edu	37	X	103972469	103972469	+	Intron	DEL	G	-	-	rs5962978	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103972469delG	uc004elz.1	+							NM_017416	NP_059112			interleukin 1 receptor accessory protein-like 2						central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	107027089	107027090	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107027089_107027090delTG								TSC22D3 (7887 upstream) : MID2 (41994 downstream)																																			---	---	---	---
MID2	11043	broad.mit.edu	37	X	107093420	107093421	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107093420_107093421delAC	uc004enl.2	+						MID2_uc004enk.2_Intron	NM_012216	NP_036348			midline 2 isoform 1							centrosome|microtubule	ligase activity|zinc ion binding			ovary(1)	1																		---	---	---	---
MID2	11043	broad.mit.edu	37	X	107134509	107134510	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107134509_107134510insT	uc004enl.2	+						MID2_uc004enk.2_Intron	NM_012216	NP_036348			midline 2 isoform 1							centrosome|microtubule	ligase activity|zinc ion binding			ovary(1)	1																		---	---	---	---
MID2	11043	broad.mit.edu	37	X	107140043	107140044	+	Intron	DEL	CA	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107140043_107140044delCA	uc004enl.2	+						MID2_uc004enk.2_Intron	NM_012216	NP_036348			midline 2 isoform 1							centrosome|microtubule	ligase activity|zinc ion binding			ovary(1)	1																		---	---	---	---
COL4A6	1288	broad.mit.edu	37	X	107415595	107415596	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107415595_107415596insA	uc004enw.3	-						COL4A6_uc004env.3_Intron|COL4A6_uc011msn.1_Intron|COL4A6_uc010npk.2_Intron	NM_001847	NP_001838			type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8														Alport_syndrome_with_Diffuse_Leiomyomatosis				---	---	---	---
COL4A6	1288	broad.mit.edu	37	X	107537988	107537988	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107537988delA	uc004enw.3	-						COL4A6_uc004env.3_Intron|COL4A6_uc011msn.1_Intron|COL4A6_uc010npk.2_Intron|COL4A6_uc004enx.2_Intron|COL4A6_uc004eny.2_Intron	NM_001847	NP_001838			type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8														Alport_syndrome_with_Diffuse_Leiomyomatosis				---	---	---	---
Unknown	0	broad.mit.edu	37	X	107984032	107984032	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107984032delA								IRS4 (4425 upstream) : GUCY2F (632104 downstream)																																			---	---	---	---
GUCY2F	2986	broad.mit.edu	37	X	108667998	108667999	+	Intron	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108667998_108667999insT	uc004eod.3	-						GUCY2F_uc011msq.1_Intron	NM_001522	NP_001513			guanylate cyclase 2F precursor						intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	108732709	108732709	+	IGR	DEL	A	-	-	rs142928726		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108732709delA								GUCY2F (7424 upstream) : NXT2 (46301 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	109877393	109877393	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109877393delG								TDGF3 (111144 upstream) : CHRDL1 (39692 downstream)																																			---	---	---	---
PAK3	5063	broad.mit.edu	37	X	110318174	110318174	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110318174delA	uc010npt.1	+						PAK3_uc010npu.1_Intron|PAK3_uc004eoy.1_Intron	NM_001128166	NP_001121638			p21-activated kinase 3 isoform a						multicellular organismal development		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding			lung(6)|ovary(3)|large_intestine(1)	10															TSP Lung(19;0.15)			---	---	---	---
TRPC5	7224	broad.mit.edu	37	X	111256354	111256355	+	Intron	INS	-	TTG	TTG			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111256354_111256355insTTG	uc004epl.1	-						TRPC5_uc004epm.1_Intron	NM_012471	NP_036603			transient receptor potential cation channel,						axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1																		---	---	---	---
ZCCHC16	340595	broad.mit.edu	37	X	111422574	111422575	+	Intron	INS	-	A	A	rs141959721		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111422574_111422575insA	uc004epo.1	+							NM_001004308	NP_001004308			zinc finger, CCHC domain containing 16								nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
DOCK11	139818	broad.mit.edu	37	X	117750490	117750491	+	Intron	INS	-	T	T	rs113632088		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117750490_117750491insT	uc004eqp.2	+						DOCK11_uc004eqq.2_Intron	NM_144658	NP_653259			dedicator of cytokinesis 11						blood coagulation	cytosol	GTP binding			ovary(3)	3																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	119615018	119615018	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119615018delC								LAMP2 (11814 upstream) : CUL4B (43430 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	126606163	126606164	+	IGR	DEL	AC	-	-	rs67086163		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:126606163_126606164delAC								CXorf64 (650397 upstream) : ACTRT1 (578779 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	127952745	127952745	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127952745delG								ACTRT1 (766363 upstream) : SMARCA1 (627735 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	128740973	128740980	+	IGR	DEL	AAGGAAGT	-	-	rs72146220		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128740973_128740980delAAGGAAGT								OCRL (14445 upstream) : APLN (38346 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	129034829	129034829	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129034829delT								ZDHHC9 (56705 upstream) : UTP14A (5330 downstream)																																			---	---	---	---
ELF4	2000	broad.mit.edu	37	X	129208949	129208949	+	Intron	DEL	T	-	-	rs72403170		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129208949delT	uc004evd.3	-						ELF4_uc004eve.3_Intron	NM_001421	NP_001412			E74-like factor 4						natural killer cell proliferation|NK T cell proliferation|positive regulation of transcription from RNA polymerase II promoter	PML body	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1								T	ERG	AML								---	---	---	---
Unknown	0	broad.mit.edu	37	X	129321405	129321416	+	IGR	DEL	TTCCTTCCTTCC	-	-	rs36219182		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129321405_129321416delTTCCTTCCTTCC								RAB33A (2562 upstream) : ZNF280C (15266 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	132273695	132273696	+	IGR	INS	-	ACAGAC	ACAGAC			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132273695_132273696insACAGAC								USP26 (42560 upstream) : TFDP3 (77001 downstream)																																			---	---	---	---
PLAC1	10761	broad.mit.edu	37	X	133720869	133720870	+	Intron	INS	-	TGTGTGTG	TGTGTGTG	rs35735404		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133720869_133720870insTGTGTGTG	uc004exo.1	-						PLAC1_uc004exp.1_Intron	NM_021796	NP_068568			placenta-specific 1 precursor						placenta development	extracellular region				pancreas(1)	1	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
FAM122B	159090	broad.mit.edu	37	X	133930388	133930388	+	5'Flank	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133930388delG	uc004exr.2	-						FAM122C_uc010nru.1_5'Flank|FAM122B_uc004exq.2_5'Flank|FAM122B_uc004exs.2_5'UTR|FAM122B_uc004ext.2_5'Flank|FAM122B_uc004exu.2_RNA|FAM122B_uc011mvp.1_Intron|FAM122B_uc004exv.2_Intron	NM_145284	NP_660327			hypothetical protein LOC159090												0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
ZNF75D	7626	broad.mit.edu	37	X	134390365	134390366	+	Intron	DEL	GT	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134390365_134390366delGT	uc004eym.2	-											Homo sapiens mRNA; cDNA DKFZp451F083 (from clone DKFZp451F083); complete cds.						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	X	135024908	135024908	+	IGR	DEL	C	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135024908delC								SAGE1 (29687 upstream) : MMGT1 (19323 downstream)																																			---	---	---	---
MAP7D3	79649	broad.mit.edu	37	X	135316342	135316343	+	Intron	INS	-	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135316342_135316343insA	uc004ezt.2	-						MAP7D3_uc004ezs.2_Intron|MAP7D3_uc011mwc.1_Intron|MAP7D3_uc010nsa.1_Intron	NM_024597	NP_078873			MAP7 domain containing 3							cytoplasm|spindle				ovary(2)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
GPR112	139378	broad.mit.edu	37	X	135471766	135471766	+	Intron	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135471766delT	uc004ezu.1	+						GPR112_uc010nsb.1_Intron	NM_153834	NP_722576			G-protein coupled receptor 112						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	136368664	136368665	+	IGR	INS	-	T	T	rs150333535		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136368664_136368665insT								GPR101 (254831 upstream) : ZIC3 (279681 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	139357897	139357897	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139357897delT								CXorf66 (310220 upstream) : SOX3 (227255 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	139414333	139414334	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139414333_139414334delTG								CXorf66 (366656 upstream) : SOX3 (170818 downstream)																																			---	---	---	---
SPANXC	64663	broad.mit.edu	37	X	140467868	140467868	+	Intron	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140467868delA	uc004fbl.2	-											Homo sapiens nuclear-associated protein SPAN-Xa (SPANX) mRNA, complete cds.							cytoplasm|nucleus					0	Acute lymphoblastic leukemia(192;7.65e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	X	141932319	141932320	+	IGR	INS	-	AC	AC			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:141932319_141932320insAC								MAGEC2 (639243 upstream) : SPANXN4 (181384 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	141932379	141932380	+	IGR	INS	-	AC	AC			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:141932379_141932380insAC								MAGEC2 (639303 upstream) : SPANXN4 (181324 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	142102464	142102467	+	IGR	DEL	AGAG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142102464_142102467delAGAG								MAGEC2 (809388 upstream) : SPANXN4 (11237 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	142918200	142918200	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142918200delA								SPANXN2 (113684 upstream) : UBE2NL (48973 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	144082693	144082694	+	IGR	DEL	AT	-	-	rs34541225	by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144082693_144082694delAT								None (None upstream) : SPANXN1 (246413 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	146381303	146381303	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146381303delT								MIR514-3 (15057 upstream) : ASFMR1 (609646 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	146676280	146676281	+	IGR	INS	-	GT	GT	rs151216949		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146676280_146676281insGT								MIR514-3 (310034 upstream) : ASFMR1 (314668 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	150090368	150090368	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150090368delA								CD99L2 (23189 upstream) : HMGB3 (61395 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	X	152779074	152779075	+	IGR	DEL	TG	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152779074_152779075delTG								BGN (4070 upstream) : ATP2B3 (22505 downstream)																																			---	---	---	---
L1CAM	3897	broad.mit.edu	37	X	153145699	153145700	+	Intron	DEL	AC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153145699_153145700delAC	uc004fje.1	-											Homo sapiens L1CAM mRNA for L1 cell adhesion molecule, partial cds.						axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10000017	10000017	+	IGR	DEL	G	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10000017delG								TTTY22 (349163 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	10019370	10019371	+	IGR	INS	-	CC	CC	rs147406097		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10019370_10019371insCC								TTTY22 (368516 upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13264218	13264219	+	IGR	DEL	TC	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13264218_13264219delTC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13415408	13415408	+	IGR	DEL	T	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13415408delT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	13628269	13628270	+	IGR	INS	-	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13628269_13628270insT								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	Y	58986177	58986177	+	IGR	DEL	A	-	-			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58986177delA								None (None upstream) : None (None downstream)																																			---	---	---	---
LRRC7	57554	broad.mit.edu	37	1	70504000	70504000	+	Silent	SNP	T	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70504000T>A	uc001dep.2	+	19	2409	c.2379T>A	c.(2377-2379)CCT>CCA	p.P793P	LRRC7_uc009wbg.2_Silent_p.P77P|LRRC7_uc001deq.2_Silent_p.P34P	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	793						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14																		---	---	---	---
SETDB1	9869	broad.mit.edu	37	1	150936529	150936529	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150936529G>A	uc001evu.2	+	21	3918	c.3728G>A	c.(3727-3729)CGC>CAC	p.R1243H	SETDB1_uc001evv.2_Missense_Mutation_p.R1243H	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	1243	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)															---	---	---	---
FCGR2A	2212	broad.mit.edu	37	1	161479604	161479604	+	Intron	SNP	T	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161479604T>G	uc001gan.2	+						FCGR2A_uc001gam.2_Intron|FCGR2A_uc001gao.2_Intron	NM_001136219	NP_001129691			Fc fragment of IgG, low affinity IIa, receptor							integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)													---	---	---	---
SPATA17	128153	broad.mit.edu	37	1	217842363	217842363	+	Intron	SNP	C	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217842363C>A	uc001hlh.1	+						SPATA17_uc009xdr.1_Intron|SPATA17_uc001hli.2_Intron	NM_138796	NP_620151			spermatogenesis associated 17							cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)														---	---	---	---
CEP170	9859	broad.mit.edu	37	1	243328278	243328278	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243328278C>T	uc001hzs.2	-	13	3392	c.2984G>A	c.(2983-2985)CGT>CAT	p.R995H	CEP170_uc001hzt.2_Missense_Mutation_p.R897H|CEP170_uc001hzu.2_Missense_Mutation_p.R897H|CEP170_uc001hzv.1_Missense_Mutation_p.R373H	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	995	Targeting to microtubules.					centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)															---	---	---	---
OR2L3	391192	broad.mit.edu	37	1	248224253	248224253	+	Silent	SNP	T	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248224253T>C	uc001idx.1	+	1	270	c.270T>C	c.(268-270)TCT>TCC	p.S90S	OR2L13_uc001ids.2_Intron	NM_001004687	NP_001004687	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L,	90	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)															---	---	---	---
FAM49A	81553	broad.mit.edu	37	2	16743284	16743284	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16743284C>T	uc010exm.1	-	5	572	c.424G>A	c.(424-426)GAT>AAT	p.D142N	FAM49A_uc002rck.1_Missense_Mutation_p.D142N	NM_030797	NP_110424	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	142						intracellular					0	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)															---	---	---	---
THSD7B	80731	broad.mit.edu	37	2	138169385	138169385	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138169385G>T	uc002tva.1	+	13	2809	c.2809G>T	c.(2809-2811)GTA>TTA	p.V937L	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.V827L	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B									p.C937F(1)		ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)														---	---	---	---
PLCL1	5334	broad.mit.edu	37	2	198949246	198949246	+	Silent	SNP	C	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198949246C>A	uc010fsp.2	+	2	1296	c.1005C>A	c.(1003-1005)CTC>CTA	p.L335L	PLCL1_uc002uuv.3_Silent_p.L256L	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	335					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)													---	---	---	---
DRD3	1814	broad.mit.edu	37	3	113847757	113847757	+	Missense_Mutation	SNP	C	A	A	rs76849972		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113847757C>A	uc003ebd.2	-	8	1432	c.1009G>T	c.(1009-1011)GCC>TCC	p.A337S	DRD3_uc010hqn.1_Missense_Mutation_p.A337S|DRD3_uc003ebb.1_Missense_Mutation_p.A304S|DRD3_uc003ebc.1_Missense_Mutation_p.A337S	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a	337	Helical; Name=6.				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)													---	---	---	---
TRIM42	287015	broad.mit.edu	37	3	140401886	140401886	+	Missense_Mutation	SNP	G	T	T	rs139032350		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140401886G>T	uc003eto.1	+	2	1115	c.924G>T	c.(922-924)TTG>TTT	p.L308F		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	308	B box-type 2.					intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7																		---	---	---	---
Unknown	0	broad.mit.edu	37	3	149700966	149700966	+	IGR	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149700966C>T								PFN2 (12225 upstream) : TSC22D2 (425822 downstream)																																			---	---	---	---
DRD5	1816	broad.mit.edu	37	4	9784905	9784905	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9784905G>A	uc003gmb.3	+	1	1648	c.1252G>A	c.(1252-1254)GTT>ATT	p.V418I		NM_000798	NP_000789	P21918	DRD5_HUMAN	dopamine receptor D5	418	Cytoplasmic (Potential).				activation of adenylate cyclase activity by dopamine receptor signaling pathway|activation of phospholipase C activity by dopamine receptor signaling pathway|cellular calcium ion homeostasis|negative regulation of NAD(P)H oxidase activity|reactive oxygen species metabolic process|synaptic transmission, dopaminergic	integral to plasma membrane				skin(1)	1					Apomorphine(DB00714)|Carphenazine(DB01038)|Fenoldopam(DB00800)|Zuclopenthixol(DB01624)													---	---	---	---
ANKRD50	57182	broad.mit.edu	37	4	125591785	125591785	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125591785G>T	uc003ifg.3	-	3	2913	c.2647C>A	c.(2647-2649)CCT>ACT	p.P883T	ANKRD50_uc011cgo.1_Missense_Mutation_p.P704T|ANKRD50_uc010inw.2_Missense_Mutation_p.P883T	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	883	ANK 13.									central_nervous_system(1)	1																		---	---	---	---
HHIP	64399	broad.mit.edu	37	4	145568089	145568089	+	Missense_Mutation	SNP	G	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145568089G>T	uc003ijs.1	+	1	917	c.262G>T	c.(262-264)GGG>TGG	p.G88W	uc003ijq.1_5'Flank|HHIP_uc003ijr.1_Missense_Mutation_p.G88W	NM_022475	NP_071920	Q96QV1	HHIP_HUMAN	hedgehog-interacting protein precursor	88						cytoplasm|extracellular region	catalytic activity|protein binding|zinc ion binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)														---	---	---	---
OTUD4	54726	broad.mit.edu	37	4	146083799	146083799	+	Missense_Mutation	SNP	C	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146083799C>A	uc003ika.3	-	6	432	c.294G>T	c.(292-294)ATG>ATT	p.M98I	OTUD4_uc003ijz.3_Missense_Mutation_p.M98I|OTUD4_uc003ikb.3_Missense_Mutation_p.M98I	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	163							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)																	---	---	---	---
CDH12	1010	broad.mit.edu	37	5	21755797	21755797	+	Silent	SNP	G	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21755797G>T	uc010iuc.2	-	11	2246	c.1788C>A	c.(1786-1788)GGC>GGA	p.G596G	CDH12_uc011cno.1_Silent_p.G556G|CDH12_uc003jgk.2_Silent_p.G596G|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	596	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---
PCDHA6	56142	broad.mit.edu	37	5	140207888	140207888	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140207888G>A	uc003lho.2	+	1	239	c.212G>A	c.(211-213)CGC>CAC	p.R71H	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.R71H|PCDHA6_uc011dab.1_Missense_Mutation_p.R71H	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	71	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---
PCDHB6	56130	broad.mit.edu	37	5	140530383	140530383	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140530383G>A	uc003lir.2	+	1	545	c.545G>A	c.(544-546)CGC>CAC	p.R182H	PCDHB6_uc011dah.1_Missense_Mutation_p.R46H	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	182	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
DSP	1832	broad.mit.edu	37	6	7583162	7583162	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7583162G>C	uc003mxp.1	+	24	5946	c.5667G>C	c.(5665-5667)GAG>GAC	p.E1889D	DSP_uc003mxq.1_Missense_Mutation_p.E1290D	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1889	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)														---	---	---	---
ELOVL4	6785	broad.mit.edu	37	6	80631391	80631391	+	Silent	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80631391C>T	uc003pja.3	-	4	811	c.492G>A	c.(490-492)ACG>ACA	p.T164T	ELOVL4_uc011dyt.1_RNA	NM_022726	NP_073563	Q9GZR5	ELOV4_HUMAN	elongation of very long chain fatty acids-like	164					fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	integral to endoplasmic reticulum membrane	G-protein coupled photoreceptor activity|protein binding|transferase activity, transferring acyl groups other than amino-acyl groups			ovary(1)|skin(1)	2		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)													---	---	---	---
THEMIS	387357	broad.mit.edu	37	6	128135035	128135035	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128135035C>T	uc003qbi.2	-	5	1070	c.751G>A	c.(751-753)GAA>AAA	p.E251K	THEMIS_uc010kfa.2_Missense_Mutation_p.E154K|THEMIS_uc011ebt.1_Missense_Mutation_p.E251K|THEMIS_uc010kfb.2_Missense_Mutation_p.E216K	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	251	CABIT 1.				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4																		---	---	---	---
SYNE1	23345	broad.mit.edu	37	6	152720867	152720867	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152720867T>C	uc010kiw.2	-	48	7723	c.7121A>G	c.(7120-7122)GAG>GGG	p.E2374G	SYNE1_uc003qot.3_Missense_Mutation_p.E2381G|SYNE1_uc003qou.3_Missense_Mutation_p.E2374G|SYNE1_uc010kjb.1_Missense_Mutation_p.E2357G	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2374	Spectrin 3.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---
FAM120B	84498	broad.mit.edu	37	6	170627883	170627883	+	Missense_Mutation	SNP	T	C	C	rs143059540	byFrequency	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170627883T>C	uc003qxp.2	+	2	1513	c.1405T>C	c.(1405-1407)TCC>CCC	p.S469P	FAM120B_uc003qxo.1_Missense_Mutation_p.S469P|FAM120B_uc011ehd.1_Intron	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	469					cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)														---	---	---	---
RBM28	55131	broad.mit.edu	37	7	127963594	127963594	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127963594C>T	uc003vmp.2	-	13	1505	c.1390G>A	c.(1390-1392)GCC>ACC	p.A464T	RBM28_uc003vmo.2_Missense_Mutation_p.A81T|RBM28_uc011koj.1_Missense_Mutation_p.A323T	NM_018077	NP_060547	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	464					mRNA processing|RNA splicing	Golgi apparatus|nucleolus|spliceosomal complex	nucleotide binding|RNA binding			ovary(2)	2																		---	---	---	---
KIAA1967	57805	broad.mit.edu	37	8	22463618	22463618	+	Silent	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22463618C>T	uc003xch.2	+	3	216	c.79C>T	c.(79-81)CTG>TTG	p.L27L	KIAA1967_uc003xci.2_Silent_p.L27L|KIAA1967_uc003xcj.1_5'Flank	NM_199205	NP_954675	Q8N163	K1967_HUMAN	p30 DBC protein	27					apoptosis|positive regulation of apoptosis	mitochondrial matrix|nucleus	enzyme binding|enzyme inhibitor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00593)|Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)														---	---	---	---
DPYS	1807	broad.mit.edu	37	8	105405032	105405032	+	Nonsense_Mutation	SNP	G	A	A	rs61758444		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105405032G>A	uc003yly.3	-	8	1552	c.1423C>T	c.(1423-1425)CGA>TGA	p.R475*	DPYS_uc010mcf.1_Nonsense_Mutation_p.R45*	NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	475					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)															---	---	---	---
ZFPM2	23414	broad.mit.edu	37	8	106573646	106573646	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106573646A>C	uc003ymd.2	+	4	380	c.357A>C	c.(355-357)CAA>CAC	p.Q119H		NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	119					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---
COL14A1	7373	broad.mit.edu	37	8	121256226	121256226	+	Missense_Mutation	SNP	G	A	A	rs147376839		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121256226G>A	uc003yox.2	+	20	2723	c.2458G>A	c.(2458-2460)GTC>ATC	p.V820I	COL14A1_uc003yoy.2_Missense_Mutation_p.V498I	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	820	Fibronectin type-III 6.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---
ST3GAL1	6482	broad.mit.edu	37	8	134487983	134487983	+	Silent	SNP	G	A	A	rs113350588		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134487983G>A	uc003yuk.2	-	5	1114	c.285C>T	c.(283-285)GAC>GAT	p.D95D	ST3GAL1_uc003yum.2_Silent_p.D95D	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase	95	Lumenal (Potential).				protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)															---	---	---	---
C9orf93	203238	broad.mit.edu	37	9	15777789	15777789	+	Silent	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15777789C>T	uc003zmd.2	+	19	3178	c.2863C>T	c.(2863-2865)CTG>TTG	p.L955L	C9orf93_uc003zme.2_Silent_p.L870L|C9orf93_uc011lmu.1_Silent_p.L963L|C9orf93_uc003zmf.1_Silent_p.L263L	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238	955											0				GBM - Glioblastoma multiforme(50;4.84e-07)														---	---	---	---
ADAMTSL1	92949	broad.mit.edu	37	9	18657713	18657713	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18657713C>T	uc003zne.3	+	8	1038	c.911C>T	c.(910-912)ACG>ATG	p.T304M	ADAMTSL1_uc003znb.2_Missense_Mutation_p.T304M|ADAMTSL1_uc003znc.3_Missense_Mutation_p.T304M	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	304						proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)														---	---	---	---
LRRC19	64922	broad.mit.edu	37	9	26996332	26996332	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26996332G>A	uc003zqh.2	-	4	872	c.761C>T	c.(760-762)TCG>TTG	p.S254L	IFT74_uc010mja.2_Intron|IFT74_uc010mjb.2_Intron|IFT74_uc003zqf.3_Intron|IFT74_uc003zqg.3_Intron	NM_022901	NP_075052	Q9H756	LRC19_HUMAN	leucine rich repeat containing 19 precursor	254	Extracellular (Potential).					integral to membrane					0		all_neural(11;1.81e-09)		Lung(218;1.06e-05)|LUSC - Lung squamous cell carcinoma(38;0.0001)														---	---	---	---
FNBP1	23048	broad.mit.edu	37	9	132689621	132689621	+	Splice_Site	SNP	C	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132689621C>G	uc004byw.1	-	8	862	c.643_splice	c.e8-1	p.K215_splice	FNBP1_uc011mbv.1_Splice_Site_p.K215_splice|FNBP1_uc011mbw.1_Splice_Site_p.K215_splice|FNBP1_uc004bza.2_Splice_Site_p.K215_splice|FNBP1_uc004byz.1_Splice_Site_p.K215_splice|FNBP1_uc004byx.1_Splice_Site_p.K136_splice|FNBP1_uc004byy.1_Splice_Site_p.K136_splice	NM_015033	NP_055848			formin binding protein 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|lysosome|plasma membrane	identical protein binding|lipid binding				0		Ovarian(14;0.000536)		GBM - Glioblastoma multiforme(294;0.0378)				T	MLL	AML								---	---	---	---
NTNG2	84628	broad.mit.edu	37	9	135073814	135073814	+	Silent	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135073814C>T	uc004cbh.2	+	3	1451	c.675C>T	c.(673-675)CCC>CCT	p.P225P		NM_032536	NP_115925	Q96CW9	NTNG2_HUMAN	netrin G2 precursor	225	Laminin N-terminal.				axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)														---	---	---	---
TSC1	7248	broad.mit.edu	37	9	135796793	135796793	+	Missense_Mutation	SNP	C	T	T	rs118203428		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135796793C>T	uc004cca.2	-	8	928	c.694G>A	c.(694-696)GAA>AAA	p.E232K	TSC1_uc004ccb.3_Missense_Mutation_p.E232K|TSC1_uc011mcq.1_Missense_Mutation_p.E181K|TSC1_uc011mcr.1_Missense_Mutation_p.E111K|TSC1_uc011mcs.1_Missense_Mutation_p.E111K|TSC1_uc004ccc.1_Missense_Mutation_p.E232K|TSC1_uc004ccd.2_Missense_Mutation_p.E232K|TSC1_uc004cce.1_Missense_Mutation_p.E232K	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	232					activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding			lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)				D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis				---	---	---	---
ABCA2	20	broad.mit.edu	37	9	139911670	139911670	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139911670G>A	uc011mem.1	-	17	2676	c.2528C>T	c.(2527-2529)ACG>ATG	p.T843M	ABCA2_uc011mel.1_Missense_Mutation_p.T844M|ABCA2_uc004ckl.1_Missense_Mutation_p.T774M|ABCA2_uc004ckm.1_Missense_Mutation_p.T874M|ABCA2_uc004ckn.1_RNA	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	843					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)														---	---	---	---
ERCC6	2074	broad.mit.edu	37	10	50678264	50678264	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50678264C>T	uc001jhs.3	-	18	3896	c.3742G>A	c.(3742-3744)GAC>AAC	p.D1248N	ERCC6_uc009xod.2_Missense_Mutation_p.D408N|ERCC6_uc010qgr.1_Missense_Mutation_p.D618N|ERCC6_uc001jhr.3_Missense_Mutation_p.D616N	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	1248					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16													Direct_reversal_of_damage|NER					---	---	---	---
A1CF	29974	broad.mit.edu	37	10	52580383	52580383	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52580383G>A	uc001jjj.2	-	8	984	c.796C>T	c.(796-798)CGA>TGA	p.R266*	A1CF_uc010qhn.1_Nonsense_Mutation_p.R274*|A1CF_uc001jji.2_Nonsense_Mutation_p.R266*|A1CF_uc001jjh.2_Nonsense_Mutation_p.R274*|A1CF_uc010qho.1_Nonsense_Mutation_p.R274*|A1CF_uc009xov.2_Nonsense_Mutation_p.R266*	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	266	RRM 3.				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1																		---	---	---	---
PAMR1	25891	broad.mit.edu	37	11	35463159	35463159	+	Silent	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35463159G>A	uc001mwg.2	-	7	946	c.903C>T	c.(901-903)AAC>AAT	p.N301N	PAMR1_uc001mwf.2_Silent_p.N318N|PAMR1_uc010rew.1_Silent_p.N190N|PAMR1_uc010rex.1_Silent_p.N261N	NM_001001991	NP_001001991	Q6UXH9	PAMR1_HUMAN	regeneration associated muscle protease isoform	301	Sushi 1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2																		---	---	---	---
NRXN2	9379	broad.mit.edu	37	11	64419568	64419568	+	Silent	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64419568C>T	uc001oar.2	-	14	2914	c.2475G>A	c.(2473-2475)ACG>ACA	p.T825T	NRXN2_uc001oas.2_Silent_p.T785T|NRXN2_uc001oaq.2_Silent_p.T492T	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10																		---	---	---	---
CD163	9332	broad.mit.edu	37	12	7635323	7635323	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7635323C>T	uc001qsz.3	-	14	3291	c.3163G>A	c.(3163-3165)GGG>AGG	p.G1055R	CD163_uc001qta.3_Missense_Mutation_p.G1055R|CD163_uc009zfw.2_Missense_Mutation_p.G1088R	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	1055	Helical; (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8																		---	---	---	---
PDE3A	5139	broad.mit.edu	37	12	20766427	20766427	+	Silent	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20766427C>T	uc001reh.1	+	3	1084	c.1062C>T	c.(1060-1062)CAC>CAT	p.H354H		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	354				HGLITDLLADPSLPPNVC -> TASLPTSWQTLLFHQTCA (in Ref. 3 and 4).	lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)													---	---	---	---
TUBA3C	7278	broad.mit.edu	37	13	19753658	19753658	+	Missense_Mutation	SNP	C	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19753658C>G	uc009zzj.2	-	2	98	c.49G>C	c.(49-51)GGC>CGC	p.G17R		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	17					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)														---	---	---	---
DCLK1	9201	broad.mit.edu	37	13	36700076	36700076	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36700076G>A	uc001uvf.2	-	2	432	c.199C>T	c.(199-201)CGA>TGA	p.R67*		NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	67	Doublecortin 1.				cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)														---	---	---	---
BMP4	652	broad.mit.edu	37	14	54417118	54417118	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54417118G>A	uc001xal.3	-	3	1046	c.859C>T	c.(859-861)CGC>TGC	p.R287C	BMP4_uc010aoh.2_Missense_Mutation_p.R287C|BMP4_uc001xao.3_Missense_Mutation_p.R287C|BMP4_uc001xan.3_Missense_Mutation_p.R287C	NM_130851	NP_570912	P12644	BMP4_HUMAN	bone morphogenetic protein 4 preproprotein	287			R -> H (in OFC11).		activation of MAPKK activity|blood vessel endothelial cell proliferation involved in sprouting angiogenesis|BMP signaling pathway involved in heart induction|BMP signaling pathway involved in nephric duct formation|branching involved in ureteric bud morphogenesis|bronchus development|bud dilation involved in lung branching|cardiac septum development|cartilage development|endocardial cushion development|epithelial cell proliferation involved in lung morphogenesis|intermediate mesodermal cell differentiation|lung alveolus development|lymphoid progenitor cell differentiation|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|negative regulation of branch elongation involved in ureteric bud branching by BMP signaling pathway|negative regulation of branching involved in ureteric bud morphogenesis|negative regulation of cell proliferation involved in heart morphogenesis|negative regulation of glomerular mesangial cell proliferation|negative regulation of glomerulus development|negative regulation of immature T cell proliferation in thymus|negative regulation of MAP kinase activity|negative regulation of metanephric comma-shaped body morphogenesis|negative regulation of metanephric S-shaped body morphogenesis|negative regulation of mitosis|negative regulation of myoblast differentiation|negative regulation of phosphorylation|negative regulation of striated muscle tissue development|negative regulation of thymocyte apoptosis|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of apoptosis|positive regulation of bone mineralization|positive regulation of cardiac muscle fiber development|positive regulation of cartilage development|positive regulation of collagen biosynthetic process|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of kidney development|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of SMAD protein import into nucleus|positive regulation of smooth muscle cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|protein localization to nucleus|pulmonary artery endothelial tube morphogenesis|secondary heart field specification|SMAD protein signal transduction|specification of ureteric bud anterior/posterior symmetry by BMP signaling pathway|steroid hormone mediated signaling pathway	extracellular space|proteinaceous extracellular matrix	BMP receptor binding|chemoattractant activity|cytokine activity|growth factor activity				0																		---	---	---	---
SERPINA9	327657	broad.mit.edu	37	14	94935791	94935791	+	Silent	SNP	G	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94935791G>T	uc001ydf.2	-	2	602	c.441C>A	c.(439-441)ACC>ACA	p.T147T	SERPINA9_uc001yde.2_Intron|SERPINA9_uc010avc.2_5'UTR|SERPINA9_uc001ydg.2_Silent_p.T111T|SERPINA9_uc001ydh.1_Silent_p.T147T|SERPINA9_uc001ydi.1_Silent_p.T111T	NM_175739	NP_783866	Q86WD7	SPA9_HUMAN	serine (or cysteine) proteinase inhibitor, clade	129					regulation of proteolysis	cytoplasm|extracellular region|membrane	serine-type endopeptidase inhibitor activity			lung(1)|central_nervous_system(1)	2		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)														---	---	---	---
NPRL3	8131	broad.mit.edu	37	16	169148	169148	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:169148G>C	uc002cfr.2	-	4	394	c.295C>G	c.(295-297)CTG>GTG	p.L99V	NPRL3_uc010uua.1_RNA|NPRL3_uc002cfp.1_RNA|NPRL3_uc002cfq.2_Intron|NPRL3_uc010uub.1_Missense_Mutation_p.L99V|NPRL3_uc010uuc.1_Missense_Mutation_p.L21V|NPRL3_uc002cfs.1_Missense_Mutation_p.L99V	NM_001077350	NP_001070818	Q12980	NPRL3_HUMAN	conserved gene telomeric to alpha globin cluster	99							protein binding			ovary(1)	1																		---	---	---	---
SMARCE1	6605	broad.mit.edu	37	17	38792176	38792176	+	Intron	SNP	C	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38792176C>G	uc002hux.2	-						SMARCE1_uc010wff.1_Intron|SMARCE1_uc010wfg.1_Intron|SMARCE1_uc002huy.2_Intron|SMARCE1_uc010wfh.1_Intron|SMARCE1_uc010wfi.1_Intron|SMARCE1_uc002huz.1_Missense_Mutation_p.R148T	NM_003079	NP_003070			SWI/SNF-related matrix-associated						chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)																---	---	---	---
SMARCE1	6605	broad.mit.edu	37	17	38792191	38792191	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38792191T>A	uc002hux.2	-	7	657	c.533A>T	c.(532-534)GAT>GTT	p.D178V	SMARCE1_uc010wff.1_Missense_Mutation_p.D143V|SMARCE1_uc010wfg.1_Missense_Mutation_p.D108V|SMARCE1_uc002huy.2_Missense_Mutation_p.D143V|SMARCE1_uc010wfh.1_Missense_Mutation_p.D108V|SMARCE1_uc010wfi.1_Missense_Mutation_p.D160V|SMARCE1_uc002huz.1_Missense_Mutation_p.D143V|SMARCE1_uc010wfj.1_Missense_Mutation_p.D160V	NM_003079	NP_003070	Q969G3	SMCE1_HUMAN	SWI/SNF-related matrix-associated	178					chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)																---	---	---	---
SMARCE1	6605	broad.mit.edu	37	17	38792192	38792192	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38792192C>T	uc002hux.2	-	7	656	c.532G>A	c.(532-534)GAT>AAT	p.D178N	SMARCE1_uc010wff.1_Missense_Mutation_p.D143N|SMARCE1_uc010wfg.1_Missense_Mutation_p.D108N|SMARCE1_uc002huy.2_Missense_Mutation_p.D143N|SMARCE1_uc010wfh.1_Missense_Mutation_p.D108N|SMARCE1_uc010wfi.1_Missense_Mutation_p.D160N|SMARCE1_uc002huz.1_Missense_Mutation_p.D143N|SMARCE1_uc010wfj.1_Missense_Mutation_p.D160N	NM_003079	NP_003070	Q969G3	SMCE1_HUMAN	SWI/SNF-related matrix-associated	178					chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)																---	---	---	---
SMARCE1	6605	broad.mit.edu	37	17	38792231	38792231	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38792231C>T	uc002hux.2	-	7	617	c.493G>A	c.(493-495)GAG>AAG	p.E165K	SMARCE1_uc010wff.1_Missense_Mutation_p.E130K|SMARCE1_uc010wfg.1_Missense_Mutation_p.E95K|SMARCE1_uc002huy.2_Missense_Mutation_p.E130K|SMARCE1_uc010wfh.1_Missense_Mutation_p.E95K|SMARCE1_uc010wfi.1_Missense_Mutation_p.E147K|SMARCE1_uc002huz.1_Missense_Mutation_p.E130K|SMARCE1_uc010wfj.1_Missense_Mutation_p.E147K	NM_003079	NP_003070	Q969G3	SMCE1_HUMAN	SWI/SNF-related matrix-associated	165					chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)																---	---	---	---
SMARCE1	6605	broad.mit.edu	37	17	38792276	38792276	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38792276C>T	uc002hux.2	-	7	572	c.448G>A	c.(448-450)GAA>AAA	p.E150K	SMARCE1_uc010wff.1_Missense_Mutation_p.E115K|SMARCE1_uc010wfg.1_Missense_Mutation_p.E80K|SMARCE1_uc002huy.2_Missense_Mutation_p.E115K|SMARCE1_uc010wfh.1_Missense_Mutation_p.E80K|SMARCE1_uc010wfi.1_Missense_Mutation_p.E132K|SMARCE1_uc002huz.1_Missense_Mutation_p.E115K|SMARCE1_uc010wfj.1_Missense_Mutation_p.E132K	NM_003079	NP_003070	Q969G3	SMCE1_HUMAN	SWI/SNF-related matrix-associated	150					chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)																---	---	---	---
SMARCE1	6605	broad.mit.edu	37	17	38792685	38792685	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38792685C>A	uc002hux.2	-	6	455	c.331G>T	c.(331-333)GAA>TAA	p.E111*	SMARCE1_uc010wff.1_Nonsense_Mutation_p.E76*|SMARCE1_uc010wfg.1_Nonsense_Mutation_p.E41*|SMARCE1_uc002huy.2_Nonsense_Mutation_p.E76*|SMARCE1_uc010wfh.1_Nonsense_Mutation_p.E41*|SMARCE1_uc010wfi.1_Nonsense_Mutation_p.E93*|SMARCE1_uc002huz.1_Nonsense_Mutation_p.E76*|SMARCE1_uc010wfj.1_Nonsense_Mutation_p.E93*	NM_003079	NP_003070	Q969G3	SMCE1_HUMAN	SWI/SNF-related matrix-associated	111	HMG box.				chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)																---	---	---	---
KRTAP1-1	81851	broad.mit.edu	37	17	39197393	39197393	+	Missense_Mutation	SNP	T	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39197393T>C	uc002hvw.1	-	1	321	c.257A>G	c.(256-258)TAC>TGC	p.Y86C		NM_030967	NP_112229	Q07627	KRA11_HUMAN	keratin associated protein 1-1	86			Missing (in allele KAP1.7).			extracellular region|keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)															---	---	---	---
KRTAP4-12	83755	broad.mit.edu	37	17	39280131	39280131	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39280131C>T	uc002hwa.2	-	1	289	c.244G>A	c.(244-246)GTG>ATG	p.V82M		NM_031854	NP_114060	Q9BQ66	KR412_HUMAN	keratin associated protein 4-12	82	14.|31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)															---	---	---	---
KRTAP9-9	81870	broad.mit.edu	37	17	39411940	39411940	+	Silent	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39411940C>T	uc010wfq.1	+	3	260	c.258C>T	c.(256-258)GGC>GGT	p.G86G		NM_030975	NP_112237	B5MDD6	B5MDD6_HUMAN	keratin associated protein 9-9	101						keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)															---	---	---	---
ST6GALNAC2	10610	broad.mit.edu	37	17	74570464	74570464	+	Missense_Mutation	SNP	C	T	T	rs144854134		TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74570464C>T	uc002jsg.3	-	3	599	c.344G>A	c.(343-345)CGG>CAG	p.R115Q		NM_006456	NP_006447	Q9UJ37	SIA7B_HUMAN	sialyltransferase 7B	115	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity				0																		---	---	---	---
SETBP1	26040	broad.mit.edu	37	18	42281472	42281472	+	Missense_Mutation	SNP	G	A	A	rs140717709	byFrequency;by1000genomes	TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42281472G>A	uc010dni.2	+	2	457	c.161G>A	c.(160-162)CGC>CAC	p.R54H	SETBP1_uc002lay.2_Missense_Mutation_p.R54H	NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	54						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)										Schinzel-Giedion_syndrome				---	---	---	---
ALPK2	115701	broad.mit.edu	37	18	56182235	56182235	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56182235C>A	uc002lhj.3	-	10	6233	c.6019G>T	c.(6019-6021)GAA>TAA	p.E2007*		NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	2007	Alpha-type protein kinase.						ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14																		---	---	---	---
ZNF532	55205	broad.mit.edu	37	18	56587161	56587161	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56587161C>T	uc002lho.2	+	4	2189	c.1642C>T	c.(1642-1644)CAG>TAG	p.Q548*	ZNF532_uc002lhp.2_Nonsense_Mutation_p.Q546*|ZNF532_uc010xeg.1_Nonsense_Mutation_p.Q546*|ZNF532_uc002lhr.2_Nonsense_Mutation_p.Q546*|ZNF532_uc002lhs.2_Nonsense_Mutation_p.Q546*	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	548					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2																		---	---	---	---
ZNF555	148254	broad.mit.edu	37	19	2853179	2853179	+	Silent	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2853179G>A	uc002lwo.2	+	4	1205	c.1116G>A	c.(1114-1116)CAG>CAA	p.Q372Q	ZNF555_uc002lwn.3_Silent_p.Q371Q	NM_152791	NP_690004	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	372	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ZNF555	148254	broad.mit.edu	37	19	2853188	2853188	+	Silent	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2853188G>A	uc002lwo.2	+	4	1214	c.1125G>A	c.(1123-1125)AAG>AAA	p.K375K	ZNF555_uc002lwn.3_Silent_p.K374K	NM_152791	NP_690004	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	375	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
ZNF555	148254	broad.mit.edu	37	19	2853202	2853202	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2853202C>T	uc002lwo.2	+	4	1228	c.1139C>T	c.(1138-1140)CCC>CTC	p.P380L	ZNF555_uc002lwn.3_Missense_Mutation_p.P379L	NM_152791	NP_690004	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	380	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
SMARCA4	6597	broad.mit.edu	37	19	11144114	11144114	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11144114G>A	uc002mqf.3	+	26	3979	c.3695G>A	c.(3694-3696)GGC>GAC	p.G1232D	SMARCA4_uc010dxp.2_Missense_Mutation_p.G1232D|SMARCA4_uc010dxo.2_Missense_Mutation_p.G1232D|SMARCA4_uc010dxq.2_Missense_Mutation_p.G1232D|SMARCA4_uc010dxr.2_Missense_Mutation_p.G1232D|SMARCA4_uc002mqj.3_Missense_Mutation_p.G1232D|SMARCA4_uc010dxs.2_Missense_Mutation_p.G1232D|SMARCA4_uc010dxt.1_Missense_Mutation_p.G452D|SMARCA4_uc002mqh.3_Missense_Mutation_p.G355D|SMARCA4_uc002mqi.1_Missense_Mutation_p.G435D	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated	1232	Helicase C-terminal.				chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.G1232D(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)						F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				---	---	---	---
ZNF709	163051	broad.mit.edu	37	19	12575380	12575380	+	Silent	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12575380C>T	uc002mtv.3	-	4	1517	c.1356G>A	c.(1354-1356)CAG>CAA	p.Q452Q	ZNF709_uc002mtw.3_Silent_p.Q420Q|ZNF709_uc002mtx.3_Silent_p.Q452Q	NM_152601	NP_689814	Q8N972	ZN709_HUMAN	zinc finger protein 709 isoform a	452	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---
ZNF230	7773	broad.mit.edu	37	19	44515183	44515183	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44515183C>T	uc002oyb.1	+	5	1243	c.992C>T	c.(991-993)ACA>ATA	p.T331I		NM_006300	NP_006291	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	331					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)																---	---	---	---
ZNF28	7576	broad.mit.edu	37	19	53303731	53303731	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53303731C>T	uc002qad.2	-	4	1487	c.1367G>A	c.(1366-1368)CGC>CAC	p.R456H	ZNF28_uc002qac.2_Missense_Mutation_p.R403H|ZNF28_uc010eqe.2_Missense_Mutation_p.R402H	NM_006969	NP_008900	P17035	ZNF28_HUMAN	zinc finger protein 28	456	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)														---	---	---	---
TGM6	343641	broad.mit.edu	37	20	2384311	2384311	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2384311C>T	uc002wfy.1	+	9	1239	c.1178C>T	c.(1177-1179)GCG>GTG	p.A393V	TGM6_uc010gal.1_Missense_Mutation_p.A393V	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6	393					cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)													---	---	---	---
DUSP15	128853	broad.mit.edu	37	20	30436652	30436652	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30436652G>A	uc002wwu.1	-	9	760	c.683C>T	c.(682-684)CCG>CTG	p.P228L				Q9H1R2	DUS15_HUMAN	RecName: Full=Dual specificity protein phosphatase 15;          EC=3.1.3.48;          EC=3.1.3.16; AltName: Full=Vaccinia virus VH1-related dual-specific protein phosphatase Y; AltName: Full=VH1-related member Y;	228						cytoplasm|plasma membrane	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)															---	---	---	---
PABPC1L	80336	broad.mit.edu	37	20	43566780	43566780	+	Missense_Mutation	SNP	A	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43566780A>G	uc010ggv.1	+	13	1806	c.1724A>G	c.(1723-1725)GAC>GGC	p.D575G	PABPC1L_uc010zwq.1_RNA|PABPC1L_uc002xmv.2_RNA|PABPC1L_uc002xmw.2_Missense_Mutation_p.D129G|PABPC1L_uc002xmx.2_Missense_Mutation_p.D129G	NM_001124756	NP_001118228	Q4VXU2	PAP1L_HUMAN	poly(A)-binding protein, cytoplasmic 1-like	575	PABC.						nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---
KRTAP19-3	337970	broad.mit.edu	37	21	31864074	31864074	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31864074G>A	uc002yog.1	-	1	202	c.202C>T	c.(202-204)CGC>TGC	p.R68C		NM_181609	NP_853640	Q7Z4W3	KR193_HUMAN	keratin associated protein 19-3	68						intermediate filament					0																		---	---	---	---
APOBEC3G	60489	broad.mit.edu	37	22	39479781	39479781	+	Silent	SNP	A	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39479781A>G	uc003awx.2	+	5	969	c.627A>G	c.(625-627)GAA>GAG	p.E209E	APOBEC3G_uc003awy.2_Silent_p.E142E	NM_021822	NP_068594	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	209					base conversion or substitution editing|DNA cytosine deamination|innate immune response|interspecies interaction between organisms|negative regulation of retroviral genome replication|negative regulation of transposition|positive regulation of defense response to virus by host|response to virus|viral reproduction	apolipoprotein B mRNA editing enzyme complex|cytosol|mitochondrion	cytidine deaminase activity|dCTP deaminase activity|protein homodimerization activity|RNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2	Melanoma(58;0.04)																	---	---	---	---
NLGN4X	57502	broad.mit.edu	37	X	5821227	5821227	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:5821227C>T	uc010ndh.2	-	5	1993	c.1492G>A	c.(1492-1494)GGC>AGC	p.G498S	NLGN4X_uc004crp.2_Missense_Mutation_p.G518S|NLGN4X_uc004crq.2_Missense_Mutation_p.G498S|NLGN4X_uc010ndi.2_Missense_Mutation_p.G535S|NLGN4X_uc004crr.2_Missense_Mutation_p.G498S|NLGN4X_uc010ndj.2_Missense_Mutation_p.G498S	NM_181332	NP_851849	Q8N0W4	NLGNX_HUMAN	X-linked neuroligin 4 precursor	498	Extracellular (Potential).				brainstem development|cell adhesion|cell-cell junction organization|cerebellum development|male courtship behavior|positive regulation of organ growth|regulation of excitatory postsynaptic membrane potential|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|dendrite|integral to plasma membrane|synapse	chloride ion binding|neurexin binding|protein homodimerization activity|receptor activity			skin(2)|large_intestine(1)|ovary(1)	4																		---	---	---	---
WWC3	55841	broad.mit.edu	37	X	10085420	10085420	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10085420C>T	uc004csx.3	+	11	1519	c.1321C>T	c.(1321-1323)CGG>TGG	p.R441W	WWC3_uc010nds.2_Missense_Mutation_p.R105W|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	441	Ser-rich.									ovary(4)	4																		---	---	---	---
PTCHD1	139411	broad.mit.edu	37	X	23411808	23411808	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23411808G>A	uc004dal.3	+	3	2181	c.2173G>A	c.(2173-2175)GTC>ATC	p.V725I		NM_173495	NP_775766	Q96NR3	PTHD1_HUMAN	patched domain containing 1	725	Helical; (Potential).				cognition|smoothened signaling pathway	integral to membrane|plasma membrane	hedgehog receptor activity			ovary(4)|kidney(1)|skin(1)	6																		---	---	---	---
FAM47A	158724	broad.mit.edu	37	X	34149904	34149904	+	Silent	SNP	A	G	G			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34149904A>G	uc004ddg.2	-	1	525	c.492T>C	c.(490-492)GCT>GCC	p.A164A		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	164										ovary(4)|central_nervous_system(1)	5																		---	---	---	---
SYN1	6853	broad.mit.edu	37	X	47435964	47435964	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47435964C>T	uc004die.2	-	7	1042	c.913G>A	c.(913-915)GAG>AAG	p.E305K	SYN1_uc004did.2_Missense_Mutation_p.E305K	NM_006950	NP_008881	P17600	SYN1_HUMAN	synapsin I isoform Ia	305	C; actin-binding and synaptic-vesicle binding.					cell junction|Golgi apparatus	actin binding|ATP binding|ligase activity|transporter activity			ovary(1)	1																		---	---	---	---
TSPYL2	64061	broad.mit.edu	37	X	53114443	53114443	+	Missense_Mutation	SNP	G	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53114443G>A	uc004drw.2	+	5	1310	c.1178G>A	c.(1177-1179)CGC>CAC	p.R393H	TSPYL2_uc004drv.2_3'UTR|TSPYL2_uc004drx.1_5'UTR	NM_022117	NP_071400	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	393					cell cycle|chromatin modification|negative regulation of cell cycle|negative regulation of cell growth|negative regulation of DNA replication|nucleosome assembly|regulation of protein kinase activity|regulation of signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|rDNA binding				0																		---	---	---	---
TRO	7216	broad.mit.edu	37	X	54956887	54956887	+	Missense_Mutation	SNP	G	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54956887G>C	uc004dtq.2	+	12	3837	c.3730G>C	c.(3730-3732)GGT>CGT	p.G1244R	TRO_uc004dts.2_Intron|TRO_uc004dtr.2_Intron|TRO_uc004dtt.2_Intron|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Missense_Mutation_p.G775R|TRO_uc004dtw.2_Missense_Mutation_p.G847R|TRO_uc004dtx.2_Missense_Mutation_p.G627R	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	1244	44.|62 X 10 AA approximate tandem repeats.				embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1																		---	---	---	---
ARL13A	392509	broad.mit.edu	37	X	100240718	100240718	+	Missense_Mutation	SNP	T	A	A			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100240718T>A	uc004ego.2	+	4	309	c.193T>A	c.(193-195)TAT>AAT	p.Y65N	ARL13A_uc011mrf.1_Missense_Mutation_p.Y65N|ARL13A_uc010nng.2_Missense_Mutation_p.Y65N	NM_001012990	NP_001013008	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13 isoform a	65							GTP binding			ovary(1)	1																		---	---	---	---
ZCCHC12	170261	broad.mit.edu	37	X	117959515	117959515	+	Missense_Mutation	SNP	C	T	T			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117959515C>T	uc004equ.2	+	4	781	c.308C>T	c.(307-309)GCG>GTG	p.A103V		NM_173798	NP_776159	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	103					regulation of transcription, DNA-dependent|transcription, DNA-dependent		nucleic acid binding|zinc ion binding			ovary(1)	1																		---	---	---	---
SPANXN3	139067	broad.mit.edu	37	X	142596967	142596967	+	Missense_Mutation	SNP	A	C	C			TCGA-BR-4291-01A-01D-1126-08	TCGA-BR-4291-11A-01D-1126-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142596967A>C	uc004fbw.2	-	2	191	c.103T>G	c.(103-105)TTA>GTA	p.L35V		NM_001009609	NP_001009609	Q5MJ09	SPXN3_HUMAN	SPANX-N3 protein	35										ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
