Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele
CDK11B	984	broad.mit.edu	37	1	1600092	1600093	+	Intron	DEL	TG	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1600092_1600093delTG	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc009vkl.1_Intron|SLC35E2B_uc001ahe.3_Intron|SLC35E2B_uc001ahf.3_Intron|SLC35E2B_uc001ahg.3_Intron|SLC35E2B_uc001ahh.3_Intron	NM_033486	NP_277021			cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1																		---	---	---	---
AKR7L	246181	broad.mit.edu	37	1	19600479	19600501	+	Frame_Shift_Del	DEL	TGCGGCGCTGGTGGGCGCGTCCA	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19600479_19600501delTGCGGCGCTGGTGGGCGCGTCCA	uc010ocx.1	-	1	68_90	c.68_90delTGGACGCGCCCACCAGCGCCGCA	c.(67-90)ATGGACGCGCCCACCAGCGCCGCAfs	p.M23fs	AKR7L_uc010ocy.1_Frame_Shift_Del_p.M23fs	NM_201252	NP_957704			aflatoxin B1 aldehyde reductase 3 isoform 1												0																		---	---	---	---
PPP1R8	5511	broad.mit.edu	37	1	28169568	28169568	+	Intron	DEL	A	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28169568delA	uc001bov.1	+						PPP1R8_uc001bow.1_Intron|PPP1R8_uc001box.1_Intron|PPP1R8_uc009vtc.1_Intron|PPP1R8_uc009vtd.1_Intron	NM_014110	NP_054829			protein phosphatase 1 regulatory inhibitor						mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|RNA splicing|transcription, DNA-dependent	cytoplasm|nuclear speck|spliceosomal complex	DNA binding|endonuclease activity|protein binding|protein serine/threonine phosphatase inhibitor activity|ribonuclease E activity|RNA binding				0		Colorectal(325;3.46e-05)|all_lung(284;0.000129)|Lung NSC(340;0.000259)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.76e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00248)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---
RPA2	6118	broad.mit.edu	37	1	28223824	28223825	+	Intron	INS	-	T	T	rs150650563	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28223824_28223825insT	uc001bpe.1	-						RPA2_uc001bpd.1_Intron|RPA2_uc010ofp.1_Intron	NM_002946	NP_002937			replication protein A2, 32kDa						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|regulation of double-strand break repair via homologous recombination|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor A complex|PML body	protein phosphatase binding|single-stranded DNA binding			skin(1)	1		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)									Direct_reversal_of_damage|NER					---	---	---	---
DEDD	9191	broad.mit.edu	37	1	161093426	161093426	+	Intron	DEL	A	-	-	rs148026706		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161093426delA	uc001fxz.2	-						NIT1_uc001fxw.2_Intron|DEDD_uc009wty.2_Intron|DEDD_uc001fya.2_Intron|DEDD_uc001fyb.2_Intron|DEDD_uc010pkb.1_Intron|DEDD_uc001fyc.2_Intron	NM_001039712	NP_001034801			death effector domain-containing protein						apoptosis|induction of apoptosis via death domain receptors|negative regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding				0	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	64603286	64603288	+	IGR	DEL	CAC	-	-	rs141929982		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64603286_64603288delCAC								PELI1 (231681 upstream) : HSPC159 (78039 downstream)																																			---	---	---	---
EXOC6B	23233	broad.mit.edu	37	2	72725736	72725736	+	Intron	DEL	T	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72725736delT	uc010fep.2	-						EXOC6B_uc002sij.2_Intron	NM_015189	NP_056004			SEC15-like 2						protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2																		---	---	---	---
LYG2	254773	broad.mit.edu	37	2	99862075	99862076	+	Intron	INS	-	A	A	rs34440649		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99862075_99862076insA	uc002szw.1	-						MRPL30_uc002szl.1_Intron|LYG2_uc010fip.1_Intron|LYG2_uc002szx.1_Intron	NM_175735	NP_783862			lysozyme G-like 2 precursor						cell wall macromolecule catabolic process|peptidoglycan catabolic process	extracellular region	lysozyme activity			ovary(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	2	108434821	108434822	+	IGR	INS	-	TT	TT	rs70956230		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108434821_108434822insTT								ST6GAL2 (931258 upstream) : LOC729121 (4698 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	130676240	130676241	+	IGR	INS	-	AGGA	AGGA			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130676240_130676241insAGGA								None (None upstream) : LOC389033 (4194 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	2	175585079	175585079	+	Intron	DEL	A	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175585079delA	uc002uiw.2	+											Homo sapiens cDNA FLJ11228 fis, clone PLACE1008329.																												OREG0015078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
MPP4	58538	broad.mit.edu	37	2	202549684	202549685	+	Intron	INS	-	A	A	rs141808717		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202549684_202549685insA	uc002uyk.3	-						MPP4_uc010ftj.2_Intron|MPP4_uc010zhq.1_Intron|MPP4_uc010zhr.1_Intron|MPP4_uc010zhs.1_Intron|MPP4_uc002uyj.3_Intron|MPP4_uc010zht.1_Intron|MPP4_uc002uyl.3_Intron|MPP4_uc010ftk.2_Intron|MPP4_uc002uym.1_Intron|MPP4_uc002uyn.2_Intron	NM_033066	NP_149055			membrane protein, palmitoylated 4							cytoplasm	protein binding				0																		---	---	---	---
NDUFS1	4719	broad.mit.edu	37	2	207006522	207006523	+	Intron	INS	-	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207006522_207006523insA	uc002vbe.2	-						NDUFS1_uc010ziq.1_Intron|NDUFS1_uc010zir.1_Intron|NDUFS1_uc010zis.1_Intron|NDUFS1_uc010zit.1_Intron|NDUFS1_uc010ziu.1_Intron	NM_005006	NP_004997			NADH dehydrogenase (ubiquinone) Fe-S protein 1,						apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)													---	---	---	---
IL17RE	132014	broad.mit.edu	37	3	9951039	9951040	+	Intron	DEL	AC	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9951039_9951040delAC	uc003btu.2	+						CIDEC_uc003bto.2_Intron|IL17RE_uc003btv.2_3'UTR|IL17RE_uc011atn.1_Intron|IL17RE_uc003btw.2_Intron|IL17RE_uc003btx.2_Intron|IL17RE_uc010hcq.2_Intron|IL17RE_uc003bty.2_Intron	NM_153483	NP_705616			interleukin 17 receptor E isoform 1							cytoplasm|extracellular region|integral to membrane	receptor activity			central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)														---	---	---	---
FANCD2	2177	broad.mit.edu	37	3	10089935	10089936	+	Intron	DEL	TC	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10089935_10089936delTC	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_5'Flank	NM_033084	NP_149075			Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)				D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---
VIPR1	7433	broad.mit.edu	37	3	42577729	42577730	+	Frame_Shift_Ins	INS	-	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42577729_42577730insC	uc003clf.2	+	13	1454_1455	c.1330_1331insC	c.(1330-1332)GCCfs	p.A444fs	VIPR1_uc011azl.1_Frame_Shift_Ins_p.A396fs|VIPR1_uc011azm.1_Frame_Shift_Ins_p.A234fs|VIPR1_uc011azn.1_Frame_Shift_Ins_p.A417fs|VIPR1_uc003clg.2_Frame_Shift_Ins_p.A89fs	NM_004624	NP_004615	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1	444	Cytoplasmic (Potential).				digestion|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|muscle contraction|positive regulation of cell proliferation|synaptic transmission	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.241)														---	---	---	---
DNAH12	201625	broad.mit.edu	37	3	57493928	57493928	+	Intron	DEL	A	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57493928delA	uc003dit.2	-						DNAH12_uc003diu.2_Intron	NM_178504	NP_848599			dynein heavy chain domain 2 isoform 1						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2																		---	---	---	---
MYLK	4638	broad.mit.edu	37	3	123384929	123384929	+	Intron	DEL	A	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123384929delA	uc003ego.2	-						MYLK_uc010hrr.2_5'Flank|MYLK_uc011bjv.1_Intron|MYLK_uc011bjw.1_Intron|MYLK_uc003egp.2_Intron|MYLK_uc003egq.2_Intron|MYLK_uc003egr.2_Intron|MYLK_uc003egs.2_Intron	NM_053025	NP_444253			myosin light chain kinase isoform 1						aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)														---	---	---	---
DBR1	51163	broad.mit.edu	37	3	137892312	137892313	+	Intron	DEL	AA	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137892312_137892313delAA	uc003erv.2	-						DBR1_uc003eru.2_Intron	NM_016216	NP_057300			debranching enzyme homolog 1							nucleus	metal ion binding|RNA lariat debranching enzyme activity				0																		---	---	---	---
SLIT2	9353	broad.mit.edu	37	4	20544485	20544486	+	Intron	DEL	GC	-	-	rs68143710		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20544485_20544486delGC	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778			slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11																		---	---	---	---
FRYL	285527	broad.mit.edu	37	4	48578322	48578322	+	Intron	DEL	T	-	-	rs35812501		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48578322delT	uc003gyh.1	-						FRYL_uc003gyk.2_Intron	NM_015030	NP_055845			furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1																		---	---	---	---
MAPK10	5602	broad.mit.edu	37	4	87432980	87432980	+	Intron	DEL	A	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87432980delA	uc010ikh.1	-											Synthetic construct DNA, clone: pF1KB9001, Homo sapiens MAPK10 gene for mitogen-activated protein kinase 10, without stop codon, in Flexi system.						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|JUN kinase activity|MAP kinase kinase activity|protein binding			stomach(1)|breast(1)|central_nervous_system(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)														---	---	---	---
C4orf21	55345	broad.mit.edu	37	4	113486586	113486587	+	Intron	INS	-	A	A	rs35098422		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113486586_113486587insA	uc003iau.2	-						C4orf21_uc003iav.2_Intron	NM_018392	NP_060862			prematurely terminated mRNA decay factor-like							integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)														---	---	---	---
FER	2241	broad.mit.edu	37	5	108133721	108133721	+	Intron	DEL	T	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108133721delT	uc003kop.1	+						FER_uc011cve.1_Intron|FER_uc011cvf.1_Intron|FER_uc003koq.2_Intron|FER_uc011cvg.1_Intron	NM_005246	NP_005237			fer (fps/fes related) tyrosine kinase						intracellular signal transduction|peptidyl-tyrosine phosphorylation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|kidney(1)	5		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)														---	---	---	---
Unknown	0	broad.mit.edu	37	5	117114451	117114452	+	IGR	INS	-	C	C	rs139793094	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:117114451_117114452insC								None (None upstream) : None (None downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	171005646	171005647	+	IGR	INS	-	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171005646_171005647insG								FGF18 (121484 upstream) : FBXW11 (282909 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	5	171978717	171978720	+	IGR	DEL	TTCC	-	-	rs58467067		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171978717_171978720delTTCC								SH3PXD2B (97190 upstream) : NEURL1B (89556 downstream)																																			---	---	---	---
ANKS1A	23294	broad.mit.edu	37	6	35054984	35054997	+	Intron	DEL	GCAGCGTAGACGCT	-	-	rs143879091		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35054984_35054997delGCAGCGTAGACGCT	uc003ojx.3	+						ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_Intron|ANKS1A_uc010jvp.1_Intron	NM_015245	NP_056060			ankyrin repeat and sterile alpha motif domain							cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---
SRPK1	6732	broad.mit.edu	37	6	35810501	35810501	+	Intron	DEL	T	-	-	rs71652741		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35810501delT	uc003olj.2	-						SRPK1_uc011dtg.1_Intron|SRPK1_uc003olh.2_Intron|SRPK1_uc003oli.2_Intron	NM_003137	NP_003128			SFRS protein kinase 1						cell differentiation|chromosome segregation|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1																		---	---	---	---
SLC26A8	116369	broad.mit.edu	37	6	35928440	35928441	+	Intron	INS	-	A	A	rs68027857		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35928440_35928441insA	uc003olm.2	-						SLC26A8_uc010jwa.2_Intron|SLC26A8_uc003olk.2_Intron|SLC26A8_uc003oln.2_Intron|SLC26A8_uc003oll.2_Intron	NM_052961	NP_443193			solute carrier family 26, member 8 isoform a						cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2																		---	---	---	---
C6orf165	154313	broad.mit.edu	37	6	88125702	88125702	+	Intron	DEL	A	-	-	rs34892535		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88125702delA	uc003plv.2	+						C6orf165_uc003plw.2_Intron|C6orf165_uc010kbv.1_Intron|C6orf165_uc003plu.1_Intron	NM_001031743	NP_001026913			hypothetical protein LOC154313 isoform 1											central_nervous_system(1)	1		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)														---	---	---	---
IFNGR1	3459	broad.mit.edu	37	6	137518967	137518967	+	3'UTR	DEL	A	-	-	rs75851921		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137518967delA	uc003qho.2	-	7					IFNGR1_uc011edm.1_3'UTR	NM_000416	NP_000407			interferon gamma receptor 1 precursor						regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity			upper_aerodigestive_tract(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)													---	---	---	---
AVL9	23080	broad.mit.edu	37	7	33066270	33066270	+	Intron	DEL	T	-	-	rs34317509		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33066270delT	uc011kai.1	+						NT5C3_uc003tdi.2_Intron|NT5C3_uc003tdj.2_Intron|NT5C3_uc003tdk.2_Intron	NM_015060	NP_055875			AVL9 homolog (S. cerevisiase)							integral to membrane					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	7	56357562	56357563	+	IGR	INS	-	AAA	AAA			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56357562_56357563insAAA								PSPH (173472 upstream) : DKFZp434L192 (206353 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	7	65082885	65082886	+	IGR	DEL	AT	-	-	rs67619741		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65082885_65082886delAT								ZNF92 (216888 upstream) : INTS4L2 (29891 downstream)																																			---	---	---	---
MLL3	58508	broad.mit.edu	37	7	152004277	152004284	+	Intron	DEL	AGGGAGGA	-	-	rs62495469	by1000genomes;by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152004277_152004284delAGGGAGGA	uc003wla.2	-							NM_170606	NP_733751			myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---
JAK2	3717	broad.mit.edu	37	9	5080892	5080892	+	Intron	DEL	C	-	-	rs33925764		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5080892delC	uc010mhm.2	+						JAK2_uc003ziw.2_Intron	NM_004972	NP_004963			Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)			1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				---	---	---	---
Unknown	0	broad.mit.edu	37	9	11085586	11085586	+	IGR	DEL	A	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11085586delA								PTPRD (472863 upstream) : None (None downstream)																																			---	---	---	---
MTAP	4507	broad.mit.edu	37	9	22028213	22028214	+	Intron	DEL	AT	-	-	rs142048183		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:22028213_22028214delAT	uc003zpi.1	+						CDKN2BAS_uc010miw.1_Intron|CDKN2BAS_uc010mix.1_Intron|CDKN2BAS_uc003zpm.2_Intron	NM_002451	NP_002442			5'-methylthioadenosine phosphorylase						nucleoside metabolic process	cytoplasm	phosphorylase activity|S-methyl-5-thioadenosine phosphorylase activity			central_nervous_system(1)	1		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)	Adenine(DB00173)													---	---	---	---
DDX58	23586	broad.mit.edu	37	9	32493620	32493621	+	Intron	INS	-	A	A	rs75982479		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32493620_32493621insA	uc003zra.2	-						DDX58_uc010mjj.2_Intron|DDX58_uc010mjk.1_Intron|DDX58_uc011lnr.1_Intron|DDX58_uc010mji.2_Intron	NM_014314	NP_055129			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide						detection of virus|innate immune response|negative regulation of type I interferon production|positive regulation of defense response to virus by host|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter	cytosol	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|protein binding|zinc ion binding			ovary(2)|liver(1)|pancreas(1)	4			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)														---	---	---	---
AQP7	364	broad.mit.edu	37	9	33386733	33386734	+	Intron	INS	-	A	A	rs144694820	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386733_33386734insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161			aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)														---	---	---	---
CA9	768	broad.mit.edu	37	9	35679545	35679546	+	Intron	INS	-	A	A	rs140143652	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35679545_35679546insA	uc003zxo.3	+						CA9_uc003zxp.3_Intron	NM_001216	NP_001207			carbonic anhydrase IX precursor						one-carbon metabolic process	integral to membrane|microvillus membrane|nucleolus	carbonate dehydratase activity|zinc ion binding			ovary(4)|skin(1)	5	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---
KIAA0368	23392	broad.mit.edu	37	9	114126061	114126061	+	Intron	DEL	T	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114126061delT	uc004bfe.1	-							NM_001080398	NP_001073867			KIAA0368 protein												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	10	49211779	49211781	+	IGR	DEL	GAG	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49211779_49211781delGAG								FRMPD2L1 (348147 upstream) : FRMPD2 (152827 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	10	70968942	70968943	+	IGR	INS	-	TTTT	TTTT	rs147863098	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70968942_70968943insTTTT								SUPV3L1 (93 upstream) : HKDC1 (11116 downstream)																																			---	---	---	---
C10orf76	79591	broad.mit.edu	37	10	103789686	103789686	+	Intron	DEL	T	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103789686delT	uc009xwy.1	-						C10orf76_uc001kui.2_Intron	NM_024541	NP_078817			hypothetical protein LOC79591							integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)														---	---	---	---
PSMD13	5719	broad.mit.edu	37	11	243018	243019	+	Intron	DEL	TC	-	-	rs147993367		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:243018_243019delTC	uc001lol.2	+						PSMD13_uc010qvr.1_Intron|PSMD13_uc001loo.2_Intron|PSMD13_uc001lon.2_Intron|PSMD13_uc001lom.2_Intron	NM_002817	NP_002808			proteasome 26S non-ATPase subunit 13 isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding			ovary(1)	1		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.79e-27)|Epithelial(43;4e-26)|OV - Ovarian serous cystadenocarcinoma(40;6.02e-21)|BRCA - Breast invasive adenocarcinoma(625;3.93e-05)|Lung(200;0.112)|LUSC - Lung squamous cell carcinoma(625;0.129)														---	---	---	---
NAP1L4	4676	broad.mit.edu	37	11	2977235	2977235	+	Intron	DEL	C	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2977235delC	uc001lxc.2	-						NAP1L4_uc009ydt.2_Intron|NAP1L4_uc010qxm.1_Intron|NAP1L4_uc010qxn.1_Intron	NM_005969	NP_005960			nucleosome assembly protein 1-like 4						nucleosome assembly	chromatin assembly complex|cytoplasm	unfolded protein binding			ovary(1)	1		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)														---	---	---	---
NAT10	55226	broad.mit.edu	37	11	34163566	34163567	+	Intron	DEL	TG	-	-	rs74467611	byFrequency;by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34163566_34163567delTG	uc001mvk.2	+						NAT10_uc010ren.1_Intron	NM_024662	NP_078938			N-acetyltransferase 10 isoform a							nucleolus	ATP binding|N-acetyltransferase activity|protein binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)																---	---	---	---
UCP3	7352	broad.mit.edu	37	11	73712708	73712709	+	Intron	INS	-	TC	TC	rs150967250	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73712708_73712709insTC	uc001our.2	-							NM_003356	NP_003347			uncoupling protein 3 isoform UCP3L						mitochondrial transport|respiratory electron transport chain|respiratory gaseous exchange	integral to membrane|mitochondrial inner membrane	binding			pancreas(1)	1	Breast(11;2.08e-05)																	---	---	---	---
NTM	50863	broad.mit.edu	37	11	131468739	131468739	+	Intron	DEL	C	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131468739delC	uc010sci.1	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron	NM_001144058	NP_001137530			neurotrimin isoform 3						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6																		---	---	---	---
CLSTN3	9746	broad.mit.edu	37	12	7290391	7290392	+	Intron	INS	-	GTGTGTGA	GTGTGTGA	rs28433214		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7290391_7290392insGTGTGTGA	uc001qsr.2	+						CLSTN3_uc001qss.2_Intron	NM_014718	NP_055533			calsyntenin 3 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1																		---	---	---	---
Unknown	0	broad.mit.edu	37	12	7338794	7338794	+	IGR	DEL	G	-	-	rs113717305		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7338794delG								CLSTN3 (27266 upstream) : PEX5 (2965 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	22328295	22328296	+	IGR	DEL	CT	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22328295_22328296delCT								CMAS (109694 upstream) : ST8SIA1 (18030 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	12	24737258	24737263	+	5'Flank	DEL	CCCCCA	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24737258_24737263delCCCCCA	uc001rgb.1	-											Homo sapiens cDNA FLJ32894 fis, clone TESTI2004994.																														---	---	---	---
GRIP1	23426	broad.mit.edu	37	12	66856976	66856979	+	Intron	DEL	AAAT	-	-	rs3830371		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66856976_66856979delAAAT	uc001stk.2	-						GRIP1_uc010sta.1_Intron|GRIP1_uc001stj.2_Intron|GRIP1_uc001stl.1_Intron|GRIP1_uc001stm.2_Intron	NM_021150	NP_066973			glutamate receptor interacting protein 1						androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)														---	---	---	---
VSIG10	54621	broad.mit.edu	37	12	118517627	118517630	+	Intron	DEL	TTTC	-	-	rs66686401		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118517627_118517630delTTTC	uc001tws.2	-							NM_019086	NP_061959			V-set and immunoglobulin domain containing 10							integral to membrane					0																		---	---	---	---
RAB35	11021	broad.mit.edu	37	12	120537152	120537153	+	Intron	INS	-	T	T	rs150222509	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120537152_120537153insT	uc001txm.1	-						RAB35_uc010szg.1_5'Flank|RAB35_uc009zww.1_Intron|RAB35_uc010szh.1_Intron	NM_006861	NP_006852			RAB35, member RAS oncogene family						cytokinesis|endosome transport|protein transport|small GTPase mediated signal transduction	cell projection membrane|clathrin-coated endocytic vesicle|coated pit|endosome|intercellular bridge|melanosome	GTP binding|GTPase activity|phosphatidylinositol-4,5-bisphosphate binding				0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.248)														---	---	---	---
CLIP1	6249	broad.mit.edu	37	12	122850224	122850225	+	Intron	INS	-	A	A	rs150479919		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122850224_122850225insA	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucj.1_5'Flank|CLIP1_uc010tae.1_Intron	NM_002956	NP_002947			restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)														---	---	---	---
ATP6V0A2	23545	broad.mit.edu	37	12	124208917	124208917	+	Intron	DEL	A	-	-	rs11326601		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124208917delA	uc001ufr.2	+						ATP6V0A2_uc001ufq.1_Intron	NM_012463	NP_036595			ATPase, H+ transporting, lysosomal V0 subunit						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)														---	---	---	---
STARD13	90627	broad.mit.edu	37	13	33751887	33751888	+	Intron	INS	-	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33751887_33751888insG	uc001uuw.2	-						STARD13_uc001uuu.2_Intron|STARD13_uc001uuv.2_Intron|STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron|STARD13_uc010abh.1_Intron	NM_178006	NP_821074			StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)														---	---	---	---
OR4L1	122742	broad.mit.edu	37	14	20527999	20528000	+	5'Flank	DEL	TT	-	-	rs34867172		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20527999_20528000delTT	uc001vwn.1	+							NM_001004717	NP_001004717			olfactory receptor, family 4, subfamily L,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)														---	---	---	---
RPS6KL1	83694	broad.mit.edu	37	14	75378297	75378302	+	Intron	DEL	TGTGTA	-	-	rs34121418		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75378297_75378302delTGTGTA	uc010tux.1	-						RPS6KL1_uc001xqx.1_5'Flank|RPS6KL1_uc001xqw.2_Intron|RPS6KL1_uc010asd.1_Intron|RPS6KL1_uc001xqy.1_Intron	NM_031464	NP_113652			ribosomal protein S6 kinase-like 1							ribosome	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)|central_nervous_system(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00658)														---	---	---	---
ATG2B	55102	broad.mit.edu	37	14	96772926	96772927	+	Intron	DEL	AA	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96772926_96772927delAA	uc001yfi.2	-							NM_018036	NP_060506			ATG2 autophagy related 2 homolog B											ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)														---	---	---	---
Unknown	0	broad.mit.edu	37	14	97235205	97235205	+	IGR	DEL	T	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97235205delT								PAPOLA (201759 upstream) : VRK1 (28479 downstream)																																			---	---	---	---
RCOR1	23186	broad.mit.edu	37	14	103159106	103159106	+	Intron	DEL	T	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103159106delT	uc001ymb.2	+							NM_015156	NP_055971			REST corepressor 1						blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding			ovary(1)	1																		---	---	---	---
SV2B	9899	broad.mit.edu	37	15	91754738	91754738	+	Intron	DEL	T	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91754738delT	uc010uqv.1	+						SV2B_uc002bqt.2_Intron|SV2B_uc002bqu.3_Intron	NM_014848	NP_055663			synaptic vesicle protein 2B homolog						neurotransmitter transport	acrosomal vesicle|cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)|upper_aerodigestive_tract(1)	8	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)															---	---	---	---
CORO7	79585	broad.mit.edu	37	16	4407345	4407348	+	Intron	DEL	TTTC	-	-	rs71402532		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4407345_4407348delTTTC	uc002cwh.3	-						CORO7_uc002cwe.2_Intron|CORO7_uc002cwf.2_Intron|CORO7_uc002cwg.3_Intron|CORO7_uc010uxh.1_Intron|CORO7_uc010uxi.1_Intron	NM_024535	NP_078811			coronin 7							cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	16	27088704	27088705	+	IGR	INS	-	CTTT	CTTT	rs143025532	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27088704_27088705insCTTT								C16orf82 (8218 upstream) : JMJD5 (126102 downstream)																																			---	---	---	---
VPS35	55737	broad.mit.edu	37	16	46714944	46714945	+	Intron	INS	-	ACAC	ACAC	rs148688318	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46714944_46714945insACAC	uc002eef.3	-						VPS35_uc002eed.2_5'Flank|VPS35_uc002eee.2_Intron	NM_018206	NP_060676			vacuolar protein sorting 35						protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)																---	---	---	---
ARL2BP	23568	broad.mit.edu	37	16	57282269	57282271	+	Intron	DEL	AGG	-	-	rs113190195		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57282269_57282271delAGG	uc002elf.1	+						ARL2BP_uc010ccy.1_Intron|ARL2BP_uc010vhl.1_Intron	NM_012106	NP_036238			binder of Arl Two						maintenance of protein location in nucleus|positive regulation of tyrosine phosphorylation of Stat3 protein|signal transduction	centrosome|midbody|mitochondrial intermembrane space|nucleus|spindle	protein binding|small GTPase regulator activity|transcription coactivator activity				0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	14608988	14608988	+	IGR	DEL	T	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14608988delT								HS3ST3B1 (359496 upstream) : PMP22 (524109 downstream)																																			---	---	---	---
ULK2	9706	broad.mit.edu	37	17	19684555	19684555	+	Intron	DEL	C	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19684555delC	uc002gwm.3	-						ULK2_uc002gwn.2_Intron	NM_001142610	NP_001136082			unc-51-like kinase 2						signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)																	---	---	---	---
GSDMA	284110	broad.mit.edu	37	17	38121480	38121482	+	Intron	DEL	AAG	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38121480_38121482delAAG	uc002htl.1	+						GSDMA_uc002htm.1_5'Flank	NM_178171	NP_835465			gasdermin 1						apoptosis|induction of apoptosis	perinuclear region of cytoplasm					0																		---	---	---	---
Unknown	0	broad.mit.edu	37	17	38353832	38353836	+	IGR	DEL	AAAAA	-	-	rs56239385	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38353832_38353836delAAAAA								RAPGEFL1 (1926 upstream) : WIPF2 (21738 downstream)																																			---	---	---	---
SLC35B1	10237	broad.mit.edu	37	17	47783738	47783738	+	Intron	DEL	G	-	-	rs144238441		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47783738delG	uc002iph.1	-						SLC35B1_uc002ipi.1_Intron|SLC35B1_uc002ipj.1_Intron|SLC35B1_uc010wly.1_Intron	NM_005827	NP_005818			solute carrier family 35, member B1							endoplasmic reticulum membrane|integral to membrane|microsome	UDP-galactose transmembrane transporter activity				0																		---	---	---	---
SLC25A19	60386	broad.mit.edu	37	17	73269841	73269842	+	Intron	INS	-	TTATT	TTATT	rs150528573	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73269841_73269842insTTATT	uc002jns.3	-						SLC25A19_uc010dge.2_Intron|SLC25A19_uc002jnv.3_Intron|SLC25A19_uc002jnu.3_Intron|SLC25A19_uc002jnw.3_Intron|SLC25A19_uc002jnt.3_Intron	NM_021734	NP_068380			solute carrier family 25, member 19							integral to membrane|mitochondrial inner membrane	binding|deoxynucleotide transmembrane transporter activity			ovary(1)	1	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)															---	---	---	---
DNAH17	8632	broad.mit.edu	37	17	76425005	76425008	+	Intron	DEL	TAAA	-	-	rs60351485		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76425005_76425008delTAAA	uc010dhp.1	-						DNAH17_uc002jvq.2_Intron|DNAH17_uc002jvs.2_Intron					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)															---	---	---	---
Unknown	0	broad.mit.edu	37	17	76488938	76488938	+	IGR	DEL	T	-	-	rs35406046		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76488938delT								DNAH17 (20082 upstream) : CYTH1 (181193 downstream)																																			---	---	---	---
FAM38B	63895	broad.mit.edu	37	18	10788504	10788505	+	Intron	INS	-	T	T	rs143297013	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10788504_10788505insT	uc002kou.1	-											RecName: Full=Transmembrane protein C18orf30;							integral to membrane	ion channel activity			ovary(1)	1																		---	---	---	---
NPC1	4864	broad.mit.edu	37	18	21123296	21123297	+	Intron	INS	-	A	A	rs34563465		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21123296_21123297insA	uc002kum.3	-						NPC1_uc010xaz.1_Intron|NPC1_uc010xba.1_Intron	NM_000271	NP_000262			Niemann-Pick disease, type C1 precursor						autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)																	---	---	---	---
LAMA3	3909	broad.mit.edu	37	18	21447533	21447533	+	Intron	DEL	G	-	-	rs59733215		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21447533delG	uc002kuq.2	+						LAMA3_uc002kur.2_Intron	NM_198129	NP_937762			laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	18	47823607	47823607	+	IGR	DEL	A	-	-	rs143466162	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47823607delA								CXXC1 (8915 upstream) : SKA1 (77785 downstream)																																			---	---	---	---
WDR7	23335	broad.mit.edu	37	18	54694561	54694562	+	3'UTR	INS	-	CGGC	CGGC	rs139087894	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54694561_54694562insCGGC	uc002lgk.1	+	28					WDR7_uc002lgl.1_3'UTR	NM_015285	NP_056100			rabconnectin-3 beta isoform 1											ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)														---	---	---	---
Unknown	0	broad.mit.edu	37	19	7440297	7440297	+	IGR	DEL	A	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7440297delA								INSR (146286 upstream) : ARHGEF18 (7423 downstream)																																			---	---	---	---
Unknown	0	broad.mit.edu	37	19	42107416	42107427	+	IGR	DEL	CGCGCGCGCGCG	-	-	rs71904143		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107416_42107427delCGCGCGCGCGCG								CEACAM21 (14220 upstream) : CEACAM4 (17917 downstream)																																			---	---	---	---
BCL3	602	broad.mit.edu	37	19	45262965	45262965	+	3'UTR	DEL	C	-	-	rs67518145		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45262965delC	uc010xxe.1	+	9						NM_005178	NP_005169			B-cell CLL/lymphoma 3						DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|I-kappaB kinase/NF-kappaB cascade|maintenance of protein location in nucleus|negative regulation of apoptosis|negative regulation of interleukin-8 biosynthetic process|negative regulation of transcription, DNA-dependent|positive regulation of translation|protein import into nucleus, translocation|regulation of DNA binding|regulation of NF-kappaB import into nucleus|response to UV-C|response to virus	Bcl3-Bcl10 complex|Bcl3/NF-kappaB2 complex|nucleus|perinuclear region of cytoplasm	protein binding, bridging|transcription factor binding			ovary(1)|lung(1)	2	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)						T	IGH@	CLL 								---	---	---	---
KLK1	3816	broad.mit.edu	37	19	51327164	51327164	+	5'Flank	DEL	C	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51327164delC	uc002ptk.1	-						KLK1_uc010ycg.1_5'Flank	NM_002257	NP_002248			kallikrein 1 preproprotein						proteolysis	nucleus	serine-type endopeptidase activity				0		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00224)|GBM - Glioblastoma multiforme(134;0.00399)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
Unknown	0	broad.mit.edu	37	20	4008764	4008783	+	IGR	DEL	CTTCCTTCTTTCCTTCCTTC	-	-	rs71195879		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4008764_4008783delCTTCCTTCTTTCCTTCCTTC								RNF24 (12548 upstream) : SMOX (120667 downstream)																																			---	---	---	---
MACROD2	140733	broad.mit.edu	37	20	15843206	15843207	+	Intron	DEL	CA	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15843206_15843207delCA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron	NM_080676	NP_542407			MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)																---	---	---	---
SLC13A3	64849	broad.mit.edu	37	20	45220862	45220863	+	Intron	INS	-	CATA	CATA	rs142792823	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45220862_45220863insCATA	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron	NM_022829	NP_073740			solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)													---	---	---	---
CSE1L	1434	broad.mit.edu	37	20	47693690	47693690	+	Intron	DEL	C	-	-	rs11481347		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47693690delC	uc002xty.2	+						CSE1L_uc010zyg.1_Intron|CSE1L_uc010ghx.2_Intron|CSE1L_uc010ghy.2_Intron|CSE1L_uc010zyh.1_Intron	NM_001316	NP_001307			CSE1 chromosome segregation 1-like protein						apoptosis|cell proliferation|intracellular protein transport	cytoplasm|nucleus	importin-alpha export receptor activity			large_intestine(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)															---	---	---	---
NTSR1	4923	broad.mit.edu	37	20	61391126	61391127	+	Intron	INS	-	A	A	rs71331957		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61391126_61391127insA	uc002ydf.2	+							NM_002531	NP_002522			neurotensin receptor 1							endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	neurotensin receptor activity, G-protein coupled			skin(2)|lung(1)|central_nervous_system(1)	4	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)															---	---	---	---
ARFGAP1	55738	broad.mit.edu	37	20	61909773	61909774	+	Intron	INS	-	G	G	rs142622083	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61909773_61909774insG	uc002yem.2	+						ARFGAP1_uc011aas.1_Intron|ARFGAP1_uc011aat.1_Intron|ARFGAP1_uc002yel.2_Intron|ARFGAP1_uc002yen.2_Intron	NM_018209	NP_060679			ADP-ribosylation factor GTPase activating						COPI coating of Golgi vesicle|protein transport|regulation of ARF GTPase activity|retrograde vesicle-mediated transport, Golgi to ER	cytosol|Golgi-associated vesicle membrane	ARF GTPase activator activity|zinc ion binding			pancreas(1)	1	all_cancers(38;1.59e-09)																	---	---	---	---
SON	6651	broad.mit.edu	37	21	34929319	34929320	+	Intron	INS	-	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34929319_34929320insT	uc002yse.1	+						SON_uc002ysb.1_Intron|SON_uc002ysc.2_Intron|SON_uc002ysd.2_Intron|SON_uc002ysf.1_Intron|SON_uc002ysg.2_Intron	NM_138927	NP_620305			SON DNA-binding protein isoform F						anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	20151656	20151657	+	IGR	INS	-	ACC	ACC	rs141600104		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151656_20151657insACC								ZDHHC8 (16127 upstream) : LOC150197 (42198 downstream)																																			---	---	---	---
LOC96610	96610	broad.mit.edu	37	22	22657416	22657419	+	Intron	DEL	ACTA	-	-	rs138873705		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22657416_22657419delACTA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0																		---	---	---	---
Unknown	0	broad.mit.edu	37	22	30616071	30616072	+	IGR	INS	-	TC	TC	rs139192726	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30616071_30616072insTC								HORMAD2 (43013 upstream) : LIF (20370 downstream)																																			---	---	---	---
PPPDE2	27351	broad.mit.edu	37	22	42001384	42001385	+	Intron	INS	-	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42001384_42001385insC	uc003ban.1	-						PPPDE2_uc011apb.1_Intron	NM_015704	NP_056519			PPPDE peptidase domain containing 2												0																		---	---	---	---
ODF3B	440836	broad.mit.edu	37	22	50969503	50969514	+	Intron	DEL	GGCTCGGGGGTA	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50969503_50969514delGGCTCGGGGGTA	uc003bmh.2	-						TYMP_uc003bmb.3_5'Flank|TYMP_uc003bmc.3_5'Flank|TYMP_uc003bmd.3_5'Flank|TYMP_uc010hbd.2_5'Flank|TYMP_uc003bme.3_5'Flank|TYMP_uc003bmf.3_5'Flank|TYMP_uc011arz.1_5'Flank|ODF3B_uc003bmg.2_Intron	NM_001014440	NP_001014440			outer dense fiber of sperm tails 3B												0																		---	---	---	---
IL3RA	3563	broad.mit.edu	37	X	1467599	1467600	+	Intron	INS	-	TTTC	TTTC			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467599_1467600insTTTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174			interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)													---	---	---	---
CXorf36	79742	broad.mit.edu	37	X	45013524	45013527	+	Intron	DEL	CTAT	-	-	rs72059118		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45013524_45013527delCTAT	uc004dgg.2	-							NM_176819	NP_789789			hypothetical protein LOC79742 isoform 1							extracellular region				lung(1)	1																		---	---	---	---
TMEM164	84187	broad.mit.edu	37	X	109387871	109387871	+	Intron	DEL	T	-	-			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109387871delT	uc004eom.2	+						TMEM164_uc004eol.2_Intron|TMEM164_uc010npq.2_Intron	NM_032227	NP_115603			transmembrane protein 164 isoform b							integral to membrane				large_intestine(1)|lung(1)|skin(1)	3																		---	---	---	---
THOC2	57187	broad.mit.edu	37	X	122830464	122830465	+	Intron	INS	-	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122830464_122830465insA	uc004etu.2	-						THOC2_uc011muh.1_Intron|THOC2_uc011mui.1_Intron	NM_001081550	NP_001075019			THO complex 2						intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3																		---	---	---	---
PLCH2	9651	broad.mit.edu	37	1	2415915	2415915	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2415915C>T	uc001aji.1	+	5	948	c.674C>T	c.(673-675)ACG>ATG	p.T225M	PLCH2_uc010nyz.1_Missense_Mutation_p.T13M|PLCH2_uc009vle.1_Missense_Mutation_p.T13M|PLCH2_uc001ajj.1_Missense_Mutation_p.T13M|PLCH2_uc001ajk.1_Missense_Mutation_p.T13M	NM_014638	NP_055453	O75038	PLCH2_HUMAN	phospholipase C, eta 2	225	EF-hand 2.				intracellular signal transduction|lipid catabolic process	cytoplasm|plasma membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			central_nervous_system(3)|ovary(1)|skin(1)	5	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)														---	---	---	---
GPATCH3	63906	broad.mit.edu	37	1	27223867	27223867	+	Silent	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27223867A>G	uc001bne.2	-	2	830	c.801T>C	c.(799-801)GAT>GAC	p.D267D	GPATCH3_uc009vsp.1_Silent_p.D78D	NM_022078	NP_071361	Q96I76	GPTC3_HUMAN	G patch domain containing 3	267	Glu-rich.					intracellular	nucleic acid binding				0		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)														---	---	---	---
PTPRU	10076	broad.mit.edu	37	1	29644433	29644433	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29644433C>T	uc001bru.2	+	26	3827	c.3717C>T	c.(3715-3717)GAC>GAT	p.D1239D	PTPRU_uc001brv.2_Silent_p.D1235D|PTPRU_uc001brw.2_Silent_p.D1229D|PTPRU_uc009vtq.2_Silent_p.D1235D|PTPRU_uc009vtr.2_Silent_p.D1226D|PTPRU_uc001brx.2_5'Flank	NM_005704	NP_005695	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	1239	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				canonical Wnt receptor signaling pathway|cell differentiation|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transmembrane receptor protein tyrosine phosphatase signaling pathway	cell-cell junction|integral to plasma membrane	beta-catenin binding|transmembrane receptor protein tyrosine phosphatase activity			large_intestine(3)|ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	7		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)														---	---	---	---
DIRAS3	9077	broad.mit.edu	37	1	68512741	68512741	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68512741G>T	uc001ded.2	-	2	535	c.240C>A	c.(238-240)TGC>TGA	p.C80*	uc001deb.1_Intron|uc001dec.1_Intron	NM_004675	NP_004666	O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	80					regulation of cyclin-dependent protein kinase activity|regulation of gene expression by genetic imprinting|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1																		---	---	---	---
WDR47	22911	broad.mit.edu	37	1	109514146	109514146	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109514146T>A	uc001dwj.2	-	15	3042	c.2666A>T	c.(2665-2667)GAC>GTC	p.D889V	WDR47_uc001dwl.2_Missense_Mutation_p.D897V|WDR47_uc001dwi.2_Missense_Mutation_p.D890V|WDR47_uc010ovf.1_Missense_Mutation_p.D814V	NM_001142551	NP_001136023	O94967	WDR47_HUMAN	WD repeat domain 47 isoform 3	889	WD 7.									ovary(1)	1		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)														---	---	---	---
LCE2A	353139	broad.mit.edu	37	1	152671534	152671534	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152671534G>A	uc001faj.2	+	2	208	c.157G>A	c.(157-159)GGC>AGC	p.G53S		NM_178428	NP_848515	Q5TA79	LCE2A_HUMAN	late cornified envelope 2A	53	Cys-rich.				keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---
TRIM46	80128	broad.mit.edu	37	1	155154567	155154567	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155154567G>A	uc001fhs.1	+	9	1911	c.1828G>A	c.(1828-1830)GGG>AGG	p.G610R	RAG1AP1_uc010pey.1_Intron|TRIM46_uc009wpe.1_RNA|TRIM46_uc001fht.1_RNA|TRIM46_uc010pfa.1_Missense_Mutation_p.G484R|TRIM46_uc001fhu.1_Missense_Mutation_p.G587R|TRIM46_uc009wpg.1_Missense_Mutation_p.G597R|TRIM46_uc001fhw.1_RNA	NM_025058	NP_079334	Q7Z4K8	TRI46_HUMAN	tripartite motif-containing 46	610	B30.2/SPRY.					intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)															---	---	---	---
KCNT2	343450	broad.mit.edu	37	1	196300297	196300297	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196300297T>C	uc001gtd.1	-	18	2152	c.2092A>G	c.(2092-2094)AGA>GGA	p.R698G	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Missense_Mutation_p.R648G|KCNT2_uc001gtf.1_Missense_Mutation_p.R698G|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Missense_Mutation_p.R698G|KCNT2_uc001gth.1_Missense_Mutation_p.R219G	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	698	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7																		---	---	---	---
ASPM	259266	broad.mit.edu	37	1	197072455	197072455	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197072455T>A	uc001gtu.2	-	18	6183	c.5926A>T	c.(5926-5928)ATC>TTC	p.I1976F	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	1976	IQ 13.|IQ 12.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6																		---	---	---	---
CRB1	23418	broad.mit.edu	37	1	197390846	197390846	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197390846T>G	uc001gtz.2	+	6	2023	c.1888T>G	c.(1888-1890)TTC>GTC	p.F630V	CRB1_uc010poz.1_Missense_Mutation_p.F561V|CRB1_uc010ppa.1_Intron|CRB1_uc009wza.2_Missense_Mutation_p.F518V|CRB1_uc010ppb.1_Missense_Mutation_p.F630V|CRB1_uc010ppc.1_Intron|CRB1_uc010ppd.1_Missense_Mutation_p.F111V|CRB1_uc001gub.1_Missense_Mutation_p.F279V	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	630	Extracellular (Potential).|Laminin G-like 1.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9																		---	---	---	---
IPO9	55705	broad.mit.edu	37	1	201821277	201821277	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201821277C>A	uc001gwz.2	+	5	610	c.560C>A	c.(559-561)CCT>CAT	p.P187H		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	187					protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2																		---	---	---	---
LGTN	1939	broad.mit.edu	37	1	206772957	206772957	+	Silent	SNP	A	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206772957A>T	uc001heh.2	-	10	1271	c.1062T>A	c.(1060-1062)TCT>TCA	p.S354S	LGTN_uc009xbw.2_Silent_p.S230S	NM_006893	NP_008824	P41214	EIF2D_HUMAN	ligatin	354					intracellular protein transport	cytoplasm	protein binding|receptor activity|translation initiation factor activity				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)															---	---	---	---
CR1	1378	broad.mit.edu	37	1	207737372	207737372	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207737372C>T	uc001hfy.2	+	14	2540	c.2400C>T	c.(2398-2400)GCC>GCT	p.A800A	CR1_uc009xcl.1_Intron|CR1_uc001hfx.2_Silent_p.A1250A|CR1_uc009xck.1_Intron	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	800	Sushi 12.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3																		---	---	---	---
OBSCN	84033	broad.mit.edu	37	1	228404777	228404777	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228404777C>T	uc009xez.1	+	8	2485	c.2441C>T	c.(2440-2442)CCG>CTG	p.P814L	OBSCN_uc001hsn.2_Missense_Mutation_p.P814L	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	814	Ig-like 8.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---
C1orf101	257044	broad.mit.edu	37	1	244735822	244735822	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244735822T>A	uc001iam.2	+	11	1757	c.1698T>A	c.(1696-1698)TAT>TAA	p.Y566*	C1orf101_uc001iak.1_Nonsense_Mutation_p.Y120*|C1orf101_uc001ial.2_Nonsense_Mutation_p.Y566*|C1orf101_uc010pym.1_Nonsense_Mutation_p.Y415*|C1orf101_uc010pyn.1_Nonsense_Mutation_p.Y499*	NM_001130957	NP_001124429	Q5SY80	CA101_HUMAN	hypothetical protein LOC257044 isoform 1	566	Extracellular (Potential).					integral to membrane				ovary(1)|breast(1)	2	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)															---	---	---	---
NCOA1	8648	broad.mit.edu	37	2	24964989	24964989	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24964989G>C	uc002rfk.2	+	17	3898	c.3640G>C	c.(3640-3642)GGA>CGA	p.G1214R	NCOA1_uc010eye.2_Missense_Mutation_p.G1214R|NCOA1_uc002rfi.2_Missense_Mutation_p.G1063R|NCOA1_uc002rfj.2_Missense_Mutation_p.G1214R|NCOA1_uc002rfl.2_Missense_Mutation_p.G1214R|NCOA1_uc010eyf.2_Missense_Mutation_p.G107R	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1	1214									PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)							T	PAX3	alveolar rhadomyosarcoma								---	---	---	---
RAB10	10890	broad.mit.edu	37	2	26350778	26350778	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26350778C>T	uc002rgv.2	+	5	1226	c.477C>T	c.(475-477)ATC>ATT	p.I159I		NM_016131	NP_057215	P61026	RAB10_HUMAN	ras-related GTP-binding protein RAB10	159					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
OTOF	9381	broad.mit.edu	37	2	26695389	26695389	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26695389C>T	uc002rhk.2	-	30	3989	c.3862G>A	c.(3862-3864)GCG>ACG	p.A1288T	OTOF_uc010yla.1_Missense_Mutation_p.A18T|OTOF_uc002rhh.2_Missense_Mutation_p.A521T|OTOF_uc002rhi.2_Missense_Mutation_p.A598T|OTOF_uc002rhj.2_Missense_Mutation_p.A521T	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	1288	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---
EHD3	30845	broad.mit.edu	37	2	31483732	31483732	+	Nonsense_Mutation	SNP	C	T	T	rs143059948		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31483732C>T	uc002rnu.2	+	4	1467	c.859C>T	c.(859-861)CGA>TGA	p.R287*	EHD3_uc010ymt.1_Intron	NM_014600	NP_055415	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	287					blood coagulation|endocytic recycling|protein homooligomerization	nucleus|plasma membrane|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding	p.R287*(1)		skin(2)	2	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---
ALMS1	7840	broad.mit.edu	37	2	73680445	73680445	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73680445C>T	uc002sje.1	+	10	6905	c.6794C>T	c.(6793-6795)ACA>ATA	p.T2265I	ALMS1_uc002sjf.1_Missense_Mutation_p.T2221I|ALMS1_uc002sjg.2_Missense_Mutation_p.T1651I|ALMS1_uc002sjh.1_Missense_Mutation_p.T1651I	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2263					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9																		---	---	---	---
PTPN18	26469	broad.mit.edu	37	2	131128152	131128152	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131128152G>A	uc002trc.2	+	9	813	c.712G>A	c.(712-714)GTC>ATC	p.V238I	PTPN18_uc002trd.2_Missense_Mutation_p.V217I|PTPN18_uc002trb.2_Missense_Mutation_p.V131I|PTPN18_uc002tre.2_5'Flank	NM_014369	NP_055184	Q99952	PTN18_HUMAN	protein tyrosine phosphatase, non-receptor type	238	Tyrosine-protein phosphatase.					cytoplasm|nucleus	non-membrane spanning protein tyrosine phosphatase activity			ovary(3)|kidney(1)	4	Colorectal(110;0.1)																	---	---	---	---
PLEKHB2	55041	broad.mit.edu	37	2	131904309	131904309	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131904309C>T	uc002tsg.3	+	8	1192	c.632C>T	c.(631-633)ACG>ATG	p.T211M	PLEKHB2_uc002tsh.2_Intron|PLEKHB2_uc002tsj.3_Missense_Mutation_p.T210M|PLEKHB2_uc002tsf.3_Missense_Mutation_p.T219M|PLEKHB2_uc010zao.1_Missense_Mutation_p.T161M|PLEKHB2_uc010zap.1_Missense_Mutation_p.R175W|PLEKHB2_uc010zaq.1_Missense_Mutation_p.R167W|PLEKHB2_uc002tsi.3_Missense_Mutation_p.T252M	NM_001100623	NP_001094093	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B	211						membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.0828)														---	---	---	---
NR4A2	4929	broad.mit.edu	37	2	157185018	157185018	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157185018C>T	uc002tyz.3	-	4	1314	c.892G>A	c.(892-894)GTG>ATG	p.V298M	NR4A2_uc002tyx.3_Missense_Mutation_p.V235M|NR4A2_uc010zcf.1_Missense_Mutation_p.V298M|NR4A2_uc010zcg.1_5'Flank	NM_006186	NP_006177	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	298	Nuclear receptor.				cellular response to extracellular stimulus|dopaminergic neuron differentiation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus	nucleoplasm	sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3																		---	---	---	---
TTN	7273	broad.mit.edu	37	2	179440876	179440876	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179440876G>T	uc010zfg.1	-	275	62503	c.62279C>A	c.(62278-62280)GCG>GAG	p.A20760E	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.A14455E|TTN_uc010zfi.1_Missense_Mutation_p.A14388E|TTN_uc010zfj.1_Missense_Mutation_p.A14263E|uc002umv.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21687							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---
Unknown	0	broad.mit.edu	37	2	179445340	179445340	+	Intron	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179445340T>C	uc002umo.2	+						uc002ump.1_Intron|TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|uc002umv.1_3'UTR					Homo sapiens cDNA FLJ36414 fis, clone THYMU2010848.																														---	---	---	---
ALS2CR12	130540	broad.mit.edu	37	2	202154418	202154418	+	Splice_Site	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202154418C>T	uc010ftg.2	-	13	1545	c.1101_splice	c.e13+1	p.E367_splice	ALS2CR12_uc002uya.3_Splice_Site_p.E344_splice|ALS2CR12_uc010fth.2_Splice_Site	NM_139163	NP_631902			amyotrophic lateral sclerosis 2 (juvenile)						regulation of GTPase activity		protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---
FN1	2335	broad.mit.edu	37	2	216232683	216232683	+	Silent	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216232683G>A	uc002vfa.2	-	42	7187	c.6921C>T	c.(6919-6921)GCC>GCT	p.A2307A	FN1_uc002vfb.2_Silent_p.A2095A|FN1_uc002vfc.2_Silent_p.A2070A|FN1_uc002vfd.2_Silent_p.A2251A|FN1_uc002vfe.2_Silent_p.A2185A|FN1_uc002vff.2_Silent_p.A2160A|FN1_uc002vfg.2_Silent_p.A2126A|FN1_uc002vfh.2_Silent_p.A2006A|FN1_uc002vfi.2_Silent_p.A2276A|FN1_uc002vfj.2_Silent_p.A2097A|FN1_uc002vez.2_Silent_p.A470A|FN1_uc010zjp.1_Silent_p.A844A|FN1_uc002vfk.1_Intron|FN1_uc010fva.1_RNA|FN1_uc010fvb.1_RNA	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	2216	Fibronectin type-I 10.|Fibrin-binding 2.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---
ATG9A	79065	broad.mit.edu	37	2	220091655	220091655	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220091655C>T	uc002vke.1	-	5	334	c.148G>A	c.(148-150)GTT>ATT	p.V50I	ATG9A_uc002vkd.1_RNA|ATG9A_uc002vkf.1_Missense_Mutation_p.V50I|ANKZF1_uc010zkv.1_5'Flank|ANKZF1_uc010zkw.1_5'Flank|ANKZF1_uc002vkg.2_5'Flank|ANKZF1_uc002vkh.2_5'Flank|ANKZF1_uc002vki.2_5'Flank	NM_001077198	NP_001070666	Q7Z3C6	ATG9A_HUMAN	APG9 autophagy 9-like 1	50	Cytoplasmic (By similarity).				autophagic vacuole assembly|protein transport	autophagic vacuole membrane|cytoplasmic vesicle|Golgi apparatus|integral to membrane|late endosome membrane				skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---
KIAA1486	57624	broad.mit.edu	37	2	226447571	226447571	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226447571G>A	uc002voe.2	+	4	1613	c.1438G>A	c.(1438-1440)GTG>ATG	p.V480M	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Missense_Mutation_p.V250M	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	480										ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)														---	---	---	---
CXCR7	57007	broad.mit.edu	37	2	237489379	237489379	+	Missense_Mutation	SNP	C	A	A	rs145205829		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237489379C>A	uc010fyq.2	+	3	501	c.271C>A	c.(271-273)CTG>ATG	p.L91M	CXCR7_uc002vwd.2_Missense_Mutation_p.L91M	NM_020311	NP_064707	P25106	CXCR7_HUMAN	chemokine orphan receptor 1	91	Helical; Name=2; (Potential).				interspecies interaction between organisms	integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			large_intestine(1)|central_nervous_system(1)|skin(1)	3		Breast(86;0.000182)|Renal(207;0.00339)|all_hematologic(139;0.0048)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|all_lung(227;0.147)|all_neural(83;0.223)		Epithelial(121;8.35e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.09e-11)|Kidney(56;1.11e-07)|KIRC - Kidney renal clear cell carcinoma(57;3.03e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000176)|Lung(119;0.00468)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.118)														---	---	---	---
SCN11A	11280	broad.mit.edu	37	3	38888949	38888949	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38888949C>A	uc011ays.1	-	26	4811	c.4612G>T	c.(4612-4614)GCC>TCC	p.A1538S		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	1538	IV.				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)													---	---	---	---
TEX264	51368	broad.mit.edu	37	3	51733426	51733426	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51733426G>T	uc010hls.2	+	5	654	c.485G>T	c.(484-486)CGG>CTG	p.R162L	TEX264_uc003dbk.3_Missense_Mutation_p.R162L|TEX264_uc010hlt.2_5'UTR|TEX264_uc003dbl.3_Missense_Mutation_p.R162L|TEX264_uc003dbm.3_Missense_Mutation_p.R201L	NM_001129884	NP_001123356	Q9Y6I9	TX264_HUMAN	testis expressed 264 precursor	162						extracellular region					0				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)														---	---	---	---
ERC2	26059	broad.mit.edu	37	3	56114990	56114990	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56114990A>C	uc003dhr.1	-	7	1752	c.1496T>G	c.(1495-1497)CTG>CGG	p.L499R	ERC2_uc003dht.1_5'UTR	NM_015576	NP_056391	O15083	ERC2_HUMAN	cytomatrix protein p110	499	Potential.					cell junction|cytoplasm|cytoskeleton|growth cone|presynaptic membrane|synaptosome	protein binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)														---	---	---	---
ROBO1	6091	broad.mit.edu	37	3	78795966	78795966	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:78795966C>A	uc003dqe.2	-	5	792	c.584G>T	c.(583-585)CGA>CTA	p.R195L	ROBO1_uc003dqb.2_Missense_Mutation_p.R156L|ROBO1_uc003dqc.2_Missense_Mutation_p.R156L|ROBO1_uc003dqd.2_Missense_Mutation_p.R156L	NM_002941	NP_002932	Q9Y6N7	ROBO1_HUMAN	roundabout 1 isoform a	195	Extracellular (Potential).|Ig-like C2-type 2.				activation of caspase activity|axon midline choice point recognition|cell migration involved in sprouting angiogenesis|chemorepulsion involved in postnatal olfactory bulb interneuron migration|homophilic cell adhesion|negative regulation of chemokine-mediated signaling pathway|negative regulation of mammary gland epithelial cell proliferation|negative regulation of negative chemotaxis|positive regulation of axonogenesis|Roundabout signaling pathway	cell surface|cytoplasm|integral to plasma membrane	axon guidance receptor activity|identical protein binding|LRR domain binding			large_intestine(2)	2		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)														---	---	---	---
B4GALT4	8702	broad.mit.edu	37	3	118948741	118948741	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118948741G>A	uc003ecg.2	-	3	847	c.206C>T	c.(205-207)ACG>ATG	p.T69M	B4GALT4_uc003ece.1_Missense_Mutation_p.T69M|B4GALT4_uc003ecf.2_RNA|B4GALT4_uc003ech.2_Missense_Mutation_p.T69M|B4GALT4_uc003eci.2_Missense_Mutation_p.T69M|B4GALT4_uc011biy.1_Intron	NM_212543	NP_997708	O60513	B4GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-	69	Lumenal (Potential).				membrane lipid metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding|N-acetyllactosamine synthase activity				0				GBM - Glioblastoma multiforme(114;0.222)	N-Acetyl-D-glucosamine(DB00141)													---	---	---	---
ARGFX	503582	broad.mit.edu	37	3	121305435	121305435	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121305435G>T	uc003eef.2	+	5	1031	c.936G>T	c.(934-936)TTG>TTT	p.L312F		NM_001012659	NP_001012677	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	312						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)|ovary(1)	3				GBM - Glioblastoma multiforme(114;0.152)														---	---	---	---
ALDH1L1	10840	broad.mit.edu	37	3	125854391	125854391	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125854391G>A	uc003eim.1	-	12	1649	c.1459C>T	c.(1459-1461)CGG>TGG	p.R487W	ALDH1L1_uc010hse.1_RNA|ALDH1L1_uc011bki.1_Missense_Mutation_p.R386W|ALDH1L1_uc003eio.2_Missense_Mutation_p.R189W|ALDH1L1_uc010hsf.1_Missense_Mutation_p.R513W	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	487	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)													---	---	---	---
CCDC37	348807	broad.mit.edu	37	3	126139048	126139048	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126139048A>G	uc003eiu.1	+	11	1157	c.1058A>G	c.(1057-1059)GAG>GGG	p.E353G	CCDC37_uc010hsg.1_Missense_Mutation_p.E354G	NM_182628	NP_872434	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	353										ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.166)														---	---	---	---
CP	1356	broad.mit.edu	37	3	148927978	148927978	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148927978C>T	uc003ewy.3	-	3	836	c.583G>A	c.(583-585)GGA>AGA	p.G195R	CP_uc011bnr.1_RNA|CP_uc003ewx.3_5'Flank|CP_uc003ewz.2_Missense_Mutation_p.G195R|CP_uc010hvf.1_5'Flank	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	195	F5/8 type A 1.|Plastocyanin-like 1.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)													---	---	---	---
SERPINI2	5276	broad.mit.edu	37	3	167183334	167183334	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167183334A>C	uc003fer.1	-	3	664	c.606T>G	c.(604-606)AAT>AAG	p.N202K	SERPINI2_uc003fes.1_Missense_Mutation_p.N212K|SERPINI2_uc003fet.1_Missense_Mutation_p.N202K	NM_006217	NP_006208	O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin),	202					cellular component movement|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(2)|urinary_tract(1)	3																		---	---	---	---
TNFSF10	8743	broad.mit.edu	37	3	172241149	172241149	+	Missense_Mutation	SNP	C	T	T	rs138912628		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172241149C>T	uc003fid.2	-	1	121	c.26G>A	c.(25-27)GGA>GAA	p.G9E	TNFSF10_uc003fie.2_Missense_Mutation_p.G9E|TNFSF10_uc010hwu.1_RNA	NM_003810	NP_003801	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily,	9	Cytoplasmic (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane|soluble fraction	cytokine activity|metal ion binding|tumor necrosis factor receptor binding			skin(4)|lung(1)	5	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)															---	---	---	---
CHRNA9	55584	broad.mit.edu	37	4	40356537	40356537	+	Nonstop_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40356537G>T	uc003gva.1	+	5	1456	c.1440G>T	c.(1438-1440)TAG>TAT	p.*480Y		NM_017581	NP_060051	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9	480					elevation of cytosolic calcium ion concentration|synaptic transmission	cell junction|postsynaptic membrane	calcium channel activity|receptor activity			breast(3)|skin(3)|central_nervous_system(1)	7					Nicotine(DB00184)													---	---	---	---
MUC7	4589	broad.mit.edu	37	4	71347033	71347033	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71347033C>T	uc011cat.1	+	4	860	c.572C>T	c.(571-573)GCC>GTC	p.A191V	MUC7_uc011cau.1_Missense_Mutation_p.A191V|MUC7_uc003hfj.2_Missense_Mutation_p.A191V|uc011cav.1_RNA	NM_001145006	NP_001138478	Q8TAX7	MUC7_HUMAN	mucin 7, secreted precursor	191	2.|Thr-rich.					extracellular region	protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4			Lung(101;0.211)															---	---	---	---
BANK1	55024	broad.mit.edu	37	4	102783799	102783799	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102783799A>C	uc003hvy.3	+	4	1015	c.741A>C	c.(739-741)AAA>AAC	p.K247N	BANK1_uc003hvx.3_Missense_Mutation_p.K232N|BANK1_uc010ill.2_Missense_Mutation_p.K114N|BANK1_uc003hvz.3_Missense_Mutation_p.K217N	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	247	DBB.				B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)														---	---	---	---
Unknown	0	broad.mit.edu	37	4	165980630	165980630	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165980630G>A	uc011cjl.1	+	1	331	c.331G>A	c.(331-333)GAC>AAC	p.D111N		NM_001105575	NP_001099045			tripartite motif-containing 75																														---	---	---	---
WDR17	116966	broad.mit.edu	37	4	177084327	177084327	+	Missense_Mutation	SNP	G	A	A	rs144009080		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177084327G>A	uc003iuj.2	+	23	3101	c.2945G>A	c.(2944-2946)CGC>CAC	p.R982H	WDR17_uc003iuk.2_Missense_Mutation_p.R958H|WDR17_uc003ium.3_Missense_Mutation_p.R958H|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Missense_Mutation_p.R201H	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	982										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)														---	---	---	---
IRX1	79192	broad.mit.edu	37	5	3600751	3600751	+	Silent	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3600751G>T	uc003jde.2	+	3	1393	c.1341G>T	c.(1339-1341)TCG>TCT	p.S447S		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	447						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2																		---	---	---	---
IRX1	79192	broad.mit.edu	37	5	3600752	3600752	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3600752C>T	uc003jde.2	+	3	1394	c.1342C>T	c.(1342-1344)CCG>TCG	p.P448S		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	448						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2																		---	---	---	---
NSUN2	54888	broad.mit.edu	37	5	6616908	6616908	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6616908T>C	uc003jdu.2	-	9	1018	c.953A>G	c.(952-954)TAT>TGT	p.Y318C	NSUN2_uc003jdt.2_Missense_Mutation_p.Y82C|NSUN2_uc011cmk.1_Missense_Mutation_p.Y283C|NSUN2_uc003jdv.2_Missense_Mutation_p.Y82C	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	318						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1																		---	---	---	---
TRIO	7204	broad.mit.edu	37	5	14368883	14368883	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14368883G>A	uc003jff.2	+	17	2947	c.2941G>A	c.(2941-2943)GAC>AAC	p.D981N	TRIO_uc003jfg.2_RNA|TRIO_uc011cna.1_Missense_Mutation_p.D932N|TRIO_uc003jfh.1_Missense_Mutation_p.D630N	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	981	Spectrin 3.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)																	---	---	---	---
COL4A3BP	10087	broad.mit.edu	37	5	74721289	74721289	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:74721289C>A	uc011csu.1	-	5	914	c.492G>T	c.(490-492)ATG>ATT	p.M164I	COL4A3BP_uc003kds.2_Missense_Mutation_p.M164I|COL4A3BP_uc003kdt.2_Missense_Mutation_p.M292I|COL4A3BP_uc003kdu.2_Missense_Mutation_p.M164I	NM_005713	NP_005704	Q9Y5P4	C43BP_HUMAN	alpha 3 type IV collagen binding protein isoform	164					ER to Golgi ceramide transport|immune response	cytosol|endoplasmic reticulum membrane|Golgi apparatus	ceramide binding|phosphatidylinositol-4-phosphate binding|protein binding|protein kinase activity			skin(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;1e-53)														---	---	---	---
ATP6AP1L	92270	broad.mit.edu	37	5	81605974	81605974	+	Splice_Site	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81605974A>G	uc003khv.2	+	8	1406	c.81_splice	c.e8-2	p.W27_splice	ATP6AP1L_uc003khw.2_Splice_Site_p.W27_splice	NM_001017971	NP_001017971			ATPase, H+ transporting, lysosomal accessory						ATP hydrolysis coupled proton transport	integral to membrane|proton-transporting V-type ATPase, V1 domain	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0																		---	---	---	---
VCAN	1462	broad.mit.edu	37	5	82849208	82849208	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82849208G>A	uc003kii.3	+	11	9875	c.9519G>A	c.(9517-9519)TGG>TGA	p.W3173*	VCAN_uc003kij.3_Nonsense_Mutation_p.W2186*|VCAN_uc010jau.2_Nonsense_Mutation_p.W1419*|VCAN_uc003kik.3_Nonsense_Mutation_p.W432*|VCAN_uc003kil.3_Nonsense_Mutation_p.W1837*	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	3173					cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)														---	---	---	---
SLCO4C1	353189	broad.mit.edu	37	5	101583042	101583042	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101583042C>T	uc003knm.2	-	10	2012	c.1725G>A	c.(1723-1725)GCG>GCA	p.A575A		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	575	Extracellular (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)														---	---	---	---
TSLP	85480	broad.mit.edu	37	5	110409342	110409342	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110409342A>G	uc003kpb.2	+	3	549	c.350A>G	c.(349-351)CAG>CGG	p.Q117R	TSLP_uc003kpa.2_RNA|TSLP_uc010jbt.1_Missense_Mutation_p.Q21R	NM_033035	NP_149024	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin isoform 1	117						extracellular space	cytokine activity				0		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)														---	---	---	---
NME5	8382	broad.mit.edu	37	5	137454573	137454573	+	Silent	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137454573T>C	uc003lce.2	-	5	567	c.489A>G	c.(487-489)TTA>TTG	p.L163L	BRD8_uc003lcc.1_Intron	NM_003551	NP_003542	P56597	NDK5_HUMAN	non-metastatic cells 5, protein expressed in	163					anti-apoptosis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatid development|UTP biosynthetic process		ATP binding|nucleoside diphosphate kinase activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)															---	---	---	---
FAM53C	51307	broad.mit.edu	37	5	137680803	137680803	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137680803G>C	uc003lcv.2	+	4	896	c.426G>C	c.(424-426)TGG>TGC	p.W142C	FAM53C_uc003lcw.2_Missense_Mutation_p.W142C|FAM53C_uc011cyq.1_Intron|FAM53C_uc011cyr.1_Intron	NM_001135647	NP_001129119	Q9NYF3	FA53C_HUMAN	hypothetical protein LOC51307	142										ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)															---	---	---	---
HSPA9	3313	broad.mit.edu	37	5	137902355	137902355	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137902355G>C	uc003ldf.2	-	9	1040	c.932C>G	c.(931-933)GCT>GGT	p.A311G	HSPA9_uc011cyw.1_Missense_Mutation_p.A242G	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor	311					anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)															---	---	---	---
PCDHB6	56130	broad.mit.edu	37	5	140531197	140531197	+	Silent	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140531197C>A	uc003lir.2	+	1	1359	c.1359C>A	c.(1357-1359)TCC>TCA	p.S453S	PCDHB6_uc011dah.1_Silent_p.S317S	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	453	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHB12	56124	broad.mit.edu	37	5	140590450	140590450	+	Silent	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140590450G>A	uc003liz.2	+	1	2160	c.1971G>A	c.(1969-1971)ACG>ACA	p.T657T	PCDHB12_uc011dak.1_Silent_p.T320T	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	657	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHB13	56123	broad.mit.edu	37	5	140595078	140595078	+	Silent	SNP	C	T	T	rs138445636		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140595078C>T	uc003lja.1	+	1	1570	c.1383C>T	c.(1381-1383)CGC>CGT	p.R461R		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	461	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
PCDHB13	56123	broad.mit.edu	37	5	140596015	140596015	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140596015T>G	uc003lja.1	+	1	2507	c.2320T>G	c.(2320-2322)TTC>GTC	p.F774V		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	774	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---
TIMD4	91937	broad.mit.edu	37	5	156381444	156381444	+	Missense_Mutation	SNP	G	A	A	rs141557472		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156381444G>A	uc003lwh.2	-	2	439	c.382C>T	c.(382-384)CGC>TGC	p.R128C	TIMD4_uc010jii.2_Missense_Mutation_p.R128C	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain	128	Extracellular (Potential).					integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---
GABRG2	2566	broad.mit.edu	37	5	161530999	161530999	+	Silent	SNP	A	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161530999A>C	uc003lyz.3	+	6	1094	c.736A>C	c.(736-738)AGA>CGA	p.R246R	GABRG2_uc010jjc.2_Silent_p.R286R|GABRG2_uc003lyy.3_Silent_p.R246R|GABRG2_uc011dej.1_Silent_p.R151R	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	246	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)														---	---	---	---
C6orf201	404220	broad.mit.edu	37	6	4099426	4099426	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4099426T>A	uc003mwa.3	+	3	1046	c.278T>A	c.(277-279)GTT>GAT	p.V93D	C6orf201_uc003mvz.3_RNA|C6orf201_uc011dhw.1_Missense_Mutation_p.V93D|C6orf201_uc003mwb.3_RNA	NM_001085401	NP_001078870	Q7Z4U5	CF201_HUMAN	hypothetical protein LOC404220	93											0	Ovarian(93;0.0925)	all_hematologic(90;0.0895)																---	---	---	---
ABT1	29777	broad.mit.edu	37	6	26598746	26598746	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26598746G>A	uc003nii.2	+	3	723	c.692G>A	c.(691-693)CGT>CAT	p.R231H		NM_013375	NP_037507	Q9ULW3	ABT1_HUMAN	activator of basal transcription 1	231					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleolus	DNA binding|nucleotide binding|protein binding|RNA binding|transcription coactivator activity			ovary(1)	1																		---	---	---	---
HIST1H1B	3009	broad.mit.edu	37	6	27834674	27834674	+	Nonsense_Mutation	SNP	T	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27834674T>A	uc003njx.2	-	1	686	c.634A>T	c.(634-636)AAA>TAA	p.K212*		NM_005322	NP_005313	P16401	H15_HUMAN	histone cluster 1, H1b	212					nucleosome assembly	nucleosome|nucleus	DNA binding			large_intestine(2)|lung(1)	3																		---	---	---	---
LAMA4	3910	broad.mit.edu	37	6	112462655	112462655	+	Silent	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112462655G>A	uc003pvu.2	-	21	3027	c.2718C>T	c.(2716-2718)TAC>TAT	p.Y906Y	LAMA4_uc003pvv.2_Silent_p.Y899Y|LAMA4_uc003pvt.2_Silent_p.Y899Y	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	906	Laminin G-like 1.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)														---	---	---	---
TRMT11	60487	broad.mit.edu	37	6	126317136	126317136	+	Silent	SNP	T	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126317136T>A	uc003qam.2	+	3	283	c.162T>A	c.(160-162)ATT>ATA	p.I54I	TRMT11_uc003qan.2_RNA|TRMT11_uc010kev.2_Silent_p.I54I	NM_001031712	NP_001026882	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11	54					tRNA processing		methyltransferase activity|nucleic acid binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0356)												OREG0017650	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
REPS1	85021	broad.mit.edu	37	6	139251228	139251228	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139251228C>T	uc003qii.2	-	9	1722	c.1143G>A	c.(1141-1143)GGG>GGA	p.G381G	REPS1_uc003qig.3_Silent_p.G381G|REPS1_uc011edr.1_Silent_p.G381G|REPS1_uc003qij.2_Silent_p.G381G|REPS1_uc003qik.2_Silent_p.G14G	NM_031922	NP_114128	Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	381						coated pit|plasma membrane	calcium ion binding|SH3 domain binding			lung(1)|breast(1)	2				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)														---	---	---	---
HIVEP2	3097	broad.mit.edu	37	6	143093784	143093784	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143093784G>A	uc003qjd.2	-	5	2835	c.2092C>T	c.(2092-2094)CGG>TGG	p.R698W		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	698					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)														---	---	---	---
ARID1B	57492	broad.mit.edu	37	6	157406006	157406006	+	Silent	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157406006C>A	uc003qqn.2	+	5	2187	c.2035C>A	c.(2035-2037)CGA>AGA	p.R679R	ARID1B_uc003qqo.2_Silent_p.R692R|ARID1B_uc003qqp.2_Silent_p.R679R|ARID1B_uc003qqq.1_Silent_p.R121R	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	737	Ser-rich.				chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)														---	---	---	---
THSD7A	221981	broad.mit.edu	37	7	11514005	11514005	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11514005T>G	uc003ssf.3	-	8	2460	c.2208A>C	c.(2206-2208)AAA>AAC	p.K736N		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	736	TSP type-1 7.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)											HNSCC(18;0.044)			---	---	---	---
NUDCD3	23386	broad.mit.edu	37	7	44507486	44507486	+	Intron	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507486C>T	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147			NudC domain containing 3												0																		---	---	---	---
NUDCD3	23386	broad.mit.edu	37	7	44507560	44507560	+	Intron	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507560A>G	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147			NudC domain containing 3												0																		---	---	---	---
NUDCD3	23386	broad.mit.edu	37	7	44507575	44507575	+	Intron	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507575A>G	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147			NudC domain containing 3												0																		---	---	---	---
NUDCD3	23386	broad.mit.edu	37	7	44507617	44507617	+	Intron	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507617C>T	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147			NudC domain containing 3												0																		---	---	---	---
NUDCD3	23386	broad.mit.edu	37	7	44507678	44507678	+	Intron	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507678G>A	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147			NudC domain containing 3												0																		---	---	---	---
NUDCD3	23386	broad.mit.edu	37	7	44507739	44507739	+	Intron	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507739A>G	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147			NudC domain containing 3												0																		---	---	---	---
WBSCR16	81554	broad.mit.edu	37	7	74470004	74470004	+	Intron	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74470004T>G	uc003ubr.2	-						WBSCR16_uc010lca.2_Intron|WBSCR16_uc010lcb.1_Missense_Mutation_p.K412T	NM_030798	NP_110425			Williams-Beuren syndrome chromosome region 16												0																		---	---	---	---
SEMA3D	223117	broad.mit.edu	37	7	84628757	84628757	+	Nonstop_Mutation	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84628757T>C	uc003uic.2	-	17	2373	c.2333A>G	c.(2332-2334)TAG>TGG	p.*778W	SEMA3D_uc010led.2_Nonstop_Mutation_p.*778W|SEMA3D_uc003uib.2_Nonstop_Mutation_p.*417W	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor	778					cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5																		---	---	---	---
GNGT1	2792	broad.mit.edu	37	7	93540228	93540228	+	Nonstop_Mutation	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93540228T>C	uc003unc.1	+	3	371	c.223T>C	c.(223-225)TAA>CAA	p.*75Q	GNGT1_uc003umx.1_RNA	NM_021955	NP_068774	P63211	GBG1_HUMAN	guanine nucleotide binding protein (G protein),	75					G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)															---	---	---	---
RELN	5649	broad.mit.edu	37	7	103155636	103155636	+	Silent	SNP	A	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103155636A>C	uc003vca.2	-	50	8275	c.8115T>G	c.(8113-8115)ACT>ACG	p.T2705T	RELN_uc010liz.2_Silent_p.T2705T	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2705					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---
LRGUK	136332	broad.mit.edu	37	7	133884049	133884049	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133884049G>T	uc003vrm.1	+	14	1639	c.1623G>T	c.(1621-1623)GAG>GAT	p.E541D		NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain	541	Guanylate kinase-like.						ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5																		---	---	---	---
FAM131B	9715	broad.mit.edu	37	7	143053722	143053722	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143053722G>A	uc003wct.2	-	6	2626	c.920C>T	c.(919-921)GCT>GTT	p.A307V	FAM131B_uc010loz.2_Missense_Mutation_p.A275V|FAM131B_uc003wcu.3_Missense_Mutation_p.A307V|FAM131B_uc010lpa.2_Missense_Mutation_p.A335V	NM_014690	NP_055505	Q86XD5	F131B_HUMAN	hypothetical protein LOC9715 isoform b	307											0	Melanoma(164;0.205)																	---	---	---	---
OR2F1	26211	broad.mit.edu	37	7	143657150	143657150	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143657150C>T	uc003wds.1	+	1	131	c.87C>T	c.(85-87)GTC>GTT	p.V29V		NM_012369	NP_036501	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F,	29	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	Melanoma(164;0.0903)																	---	---	---	---
KRBA1	84626	broad.mit.edu	37	7	149420837	149420837	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149420837C>T	uc003wfz.2	+	8	1184	c.785C>T	c.(784-786)GCG>GTG	p.A262V	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_5'UTR	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	262										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)															---	---	---	---
DPP6	1804	broad.mit.edu	37	7	154667658	154667658	+	Silent	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154667658G>A	uc003wlk.2	+	20	2055	c.1926G>A	c.(1924-1926)GAG>GAA	p.E642E	DPP6_uc003wli.2_Silent_p.E578E|DPP6_uc003wlm.2_Silent_p.E580E|DPP6_uc011kvq.1_Silent_p.E535E	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	642	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)															---	---	---	---
PI15	51050	broad.mit.edu	37	8	75756215	75756215	+	Splice_Site	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75756215G>T	uc003yal.2	+	3	453	c.274_splice	c.e3-1	p.V92_splice	uc003yak.1_Intron|PI15_uc003yam.2_Splice_Site_p.V92_splice	NM_015886	NP_056970			protease inhibitor 15 preproprotein							extracellular region	peptidase inhibitor activity			central_nervous_system(2)|ovary(1)	3	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)															---	---	---	---
ZFHX4	79776	broad.mit.edu	37	8	77617116	77617116	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77617116T>G	uc003yav.2	+	2	1180	c.793T>G	c.(793-795)TTC>GTC	p.F265V	ZFHX4_uc003yat.1_Missense_Mutation_p.F265V|ZFHX4_uc003yau.1_Missense_Mutation_p.F265V|ZFHX4_uc003yaw.1_Missense_Mutation_p.F265V	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	265						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---
CA13	377677	broad.mit.edu	37	8	86193528	86193528	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86193528C>T	uc003ydg.2	+	7	1081	c.739C>T	c.(739-741)CGC>TGC	p.R247C	CA13_uc003ydf.1_Intron	NM_198584	NP_940986	Q8N1Q1	CAH13_HUMAN	carbonic anhydrase XIII	247					one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0																		---	---	---	---
TMEM64	169200	broad.mit.edu	37	8	91657358	91657358	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91657358A>G	uc003yen.2	-	1	776	c.776T>C	c.(775-777)CTT>CCT	p.L259P	TMEM64_uc003yeo.2_Intron|TMEM64_uc011lgf.1_Missense_Mutation_p.L259P|uc003yep.2_5'Flank	NM_001008495	NP_001008495	Q6YI46	TMM64_HUMAN	transmembrane protein 64 isoform 1	259						integral to membrane					0			BRCA - Breast invasive adenocarcinoma(11;0.0598)													OREG0018858	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---
POP1	10940	broad.mit.edu	37	8	99140731	99140731	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99140731G>A	uc003yij.3	+	4	549	c.449G>A	c.(448-450)CGC>CAC	p.R150H	POP1_uc011lgv.1_Missense_Mutation_p.R150H|POP1_uc003yik.2_Missense_Mutation_p.R150H	NM_001145860	NP_001139332	Q99575	POP1_HUMAN	processing of precursor 1	150					tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity			ovary(1)|breast(1)	2	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)															---	---	---	---
TRPS1	7227	broad.mit.edu	37	8	116616721	116616721	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116616721G>A	uc003ynz.2	-	3	1895	c.1436C>T	c.(1435-1437)TCT>TTT	p.S479F	TRPS1_uc011lhy.1_Missense_Mutation_p.S483F|TRPS1_uc003yny.2_Missense_Mutation_p.S492F|TRPS1_uc010mcy.2_Missense_Mutation_p.S479F	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	479					negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)											Langer-Giedion_syndrome				---	---	---	---
EXT1	2131	broad.mit.edu	37	8	118847770	118847770	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118847770C>T	uc003yok.1	-	3	1850	c.1077G>A	c.(1075-1077)ATG>ATA	p.M359I		NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1	359	Lumenal (Potential).				glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)					Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				---	---	---	---
LYPD2	137797	broad.mit.edu	37	8	143832577	143832577	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143832577G>A	uc003ywz.2	-	2	153	c.70C>T	c.(70-72)CGC>TGC	p.R24C		NM_205545	NP_991108	Q6UXB3	LYPD2_HUMAN	LY6/PLAUR domain containing 2 precursor	24						anchored to membrane|plasma membrane					0	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)																	---	---	---	---
GML	2765	broad.mit.edu	37	8	143921917	143921917	+	Missense_Mutation	SNP	C	A	A	rs147000121	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143921917C>A	uc003yxg.2	+	2	154	c.64C>A	c.(64-66)CGC>AGC	p.R22S		NM_002066	NP_002057	Q99445	GML_HUMAN	glycosylphosphatidylinositol anchored molecule	22					apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|negative regulation of cell proliferation	anchored to membrane|extrinsic to membrane|plasma membrane				central_nervous_system(2)	2	all_cancers(97;4.26e-11)|all_epithelial(106;1.85e-08)|Lung NSC(106;0.000274)|all_lung(105;0.000755)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)																	---	---	---	---
CPSF1	29894	broad.mit.edu	37	8	145623313	145623313	+	Silent	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145623313G>A	uc003zcj.2	-	20	2004	c.1929C>T	c.(1927-1929)GGC>GGT	p.G643G		NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	643					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)															---	---	---	---
IFNW1	3467	broad.mit.edu	37	9	21141013	21141013	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21141013C>A	uc003zol.1	-	1	1132	c.557G>T	c.(556-558)AGA>ATA	p.R186I		NM_002177	NP_002168	P05000	IFNW1_HUMAN	interferon, omega 1 precursor	186					cell cycle arrest|defense response|response to virus	extracellular space	cytokine activity|cytokine receptor binding				0				GBM - Glioblastoma multiforme(5;2.35e-185)|Lung(24;2.24e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)														---	---	---	---
IFNA14	3448	broad.mit.edu	37	9	21239632	21239632	+	Silent	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21239632A>G	uc010mis.2	-	1	347	c.303T>C	c.(301-303)GAT>GAC	p.D101D	IFNA14_uc003zoo.1_RNA	NM_002172	NP_002163	P01570	IFN14_HUMAN	interferon, alpha 14 precursor	101					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)														---	---	---	---
ZNF462	58499	broad.mit.edu	37	9	109686646	109686646	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109686646T>G	uc004bcz.2	+	3	742	c.453T>G	c.(451-453)AAT>AAG	p.N151K	ZNF462_uc010mto.2_5'UTR|ZNF462_uc004bda.2_5'UTR	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	151					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5																		---	---	---	---
USP20	10868	broad.mit.edu	37	9	132637711	132637711	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132637711C>T	uc004bys.2	+	20	2382	c.2171C>T	c.(2170-2172)GCG>GTG	p.A724V	USP20_uc004byr.2_Missense_Mutation_p.A724V|USP20_uc004byt.1_Missense_Mutation_p.A724V	NM_001110303	NP_001103773	Q9Y2K6	UBP20_HUMAN	ubiquitin specific protease 20	724	DUSP 1.				endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|ubiquitin thiolesterase activity|zinc ion binding			lung(1)|breast(1)	2		Ovarian(14;0.00556)																---	---	---	---
PTCHD3	374308	broad.mit.edu	37	10	27687305	27687305	+	Nonsense_Mutation	SNP	G	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27687305G>C	uc001itu.2	-	4	2340	c.2222C>G	c.(2221-2223)TCA>TGA	p.S741*		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	741					spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---
C10orf71	118461	broad.mit.edu	37	10	50531052	50531052	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50531052G>T	uc010qgp.1	+	3	801	c.462G>T	c.(460-462)GAG>GAT	p.E154D		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	154											0																		---	---	---	---
KIAA0913	23053	broad.mit.edu	37	10	75552483	75552483	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75552483A>G	uc009xrl.2	+	10	2218	c.2186A>G	c.(2185-2187)TAC>TGC	p.Y729C	KIAA0913_uc001jve.2_Missense_Mutation_p.Y729C|KIAA0913_uc001jvf.2_Missense_Mutation_p.Y729C|KIAA0913_uc001jvh.2_RNA|KIAA0913_uc001jvi.2_Missense_Mutation_p.Y152C|KIAA0913_uc010qkr.1_Missense_Mutation_p.Y152C|KIAA0913_uc001jvj.2_Missense_Mutation_p.Y152C	NM_015037	NP_055852	A7E2V4	K0913_HUMAN	hypothetical protein LOC23053	729							zinc ion binding			breast(1)	1	Prostate(51;0.0112)																	---	---	---	---
PLCE1	51196	broad.mit.edu	37	10	96025643	96025643	+	Silent	SNP	C	T	T	rs145456568	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96025643C>T	uc001kjk.2	+	16	4843	c.4209C>T	c.(4207-4209)ATC>ATT	p.I1403I	PLCE1_uc010qnx.1_Silent_p.I1387I|PLCE1_uc001kjm.2_Silent_p.I1095I	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	1403	PI-PLC X-box.				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)																---	---	---	---
NT5C2	22978	broad.mit.edu	37	10	104855741	104855741	+	Intron	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104855741G>A	uc001kwo.2	-						NT5C2_uc010qqp.1_Intron|NT5C2_uc001kwq.2_Intron|NT5C2_uc001kwp.2_Intron	NM_012229	NP_036361			5'-nucleotidase, cytosolic II						purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|metal ion binding|nucleotide binding|protein binding				0		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)													---	---	---	---
SORCS3	22986	broad.mit.edu	37	10	106959784	106959784	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106959784C>T	uc001kyi.1	+	15	2264	c.2037C>T	c.(2035-2037)TCC>TCT	p.S679S	SORCS3_uc010qqz.1_RNA	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	679	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)														---	---	---	---
SORCS1	114815	broad.mit.edu	37	10	108338883	108338883	+	Intron	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108338883C>T	uc001kym.2	-						SORCS1_uc001kyl.2_Silent_p.Q1166Q|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Silent_p.Q1166Q|SORCS1_uc001kyo.2_3'UTR	NM_052918	NP_443150			SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)														---	---	---	---
FGFR2	2263	broad.mit.edu	37	10	123274680	123274680	+	Missense_Mutation	SNP	G	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123274680G>C	uc010qtk.1	-	9	1885	c.1238C>G	c.(1237-1239)CCG>CGG	p.P413R	FGFR2_uc010qtg.1_Missense_Mutation_p.P301R|FGFR2_uc010qth.1_Missense_Mutation_p.P298R|FGFR2_uc010qti.1_Missense_Mutation_p.P324R|FGFR2_uc010qtj.1_Missense_Mutation_p.P414R|FGFR2_uc010qtl.1_Intron|FGFR2_uc010qtm.1_Missense_Mutation_p.P298R|FGFR2_uc001lfl.3_Missense_Mutation_p.P414R|FGFR2_uc001lfm.2_Missense_Mutation_p.P325R|FGFR2_uc001lfn.3_RNA|FGFR2_uc001lfg.3_Missense_Mutation_p.P23R	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1	413	Cytoplasmic (Potential).				angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				---	---	---	---
ATHL1	80162	broad.mit.edu	37	11	290921	290921	+	Silent	SNP	C	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:290921C>G	uc010qvu.1	+	4	829	c.714C>G	c.(712-714)CTC>CTG	p.L238L	ATHL1_uc001lor.3_Silent_p.L61L|ATHL1_uc001los.1_Silent_p.L238L|ATHL1_uc001lou.3_5'Flank|ATHL1_uc001lov.3_5'Flank	NM_025092	NP_079368	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1	238					carbohydrate metabolic process		hydrolase activity, acting on glycosyl bonds			liver(1)|central_nervous_system(1)|skin(1)	3		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)														---	---	---	---
MUC5B	727897	broad.mit.edu	37	11	1261524	1261524	+	Missense_Mutation	SNP	A	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1261524A>T	uc009ycr.1	+	46	6094	c.5968A>T	c.(5968-5970)AGG>TGG	p.R1990W	MUC5B_uc001ltb.2_Missense_Mutation_p.R1300W|MUC5B_uc001lta.2_Missense_Mutation_p.R965W	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	1297					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)														---	---	---	---
COPB1	1315	broad.mit.edu	37	11	14515257	14515257	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14515257C>T	uc001mli.2	-	4	729	c.422G>A	c.(421-423)CGT>CAT	p.R141H	COPB1_uc001mlg.2_Missense_Mutation_p.R141H|COPB1_uc001mlh.2_Missense_Mutation_p.R141H|PSMA1_uc010rcp.1_RNA	NM_016451	NP_057535	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	141	HEAT 2.				COPI coating of Golgi vesicle|interspecies interaction between organisms|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|ER-Golgi intermediate compartment|plasma membrane	protein binding|structural molecule activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---
PDE3B	5140	broad.mit.edu	37	11	14865418	14865418	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14865418C>T	uc001mln.2	+	12	2719	c.2366C>T	c.(2365-2367)TCG>TTG	p.S789L	PDE3B_uc010rcr.1_Missense_Mutation_p.S738L	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B	789	Catalytic (By similarity).				cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0																		---	---	---	---
OR5L2	26338	broad.mit.edu	37	11	55595391	55595391	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595391A>G	uc001nhy.1	+	1	697	c.697A>G	c.(697-699)AGC>GGC	p.S233G		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	233	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)													HNSCC(27;0.073)			---	---	---	---
OR5L2	26338	broad.mit.edu	37	11	55595405	55595405	+	Silent	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595405T>C	uc001nhy.1	+	1	711	c.711T>C	c.(709-711)GCT>GCC	p.A237A		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	237	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)													HNSCC(27;0.073)			---	---	---	---
OR5T1	390155	broad.mit.edu	37	11	56043937	56043937	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56043937A>C	uc001nio.1	+	1	823	c.823A>C	c.(823-825)AGT>CGT	p.S275R		NM_001004745	NP_001004745	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T,	275	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)	3	Esophageal squamous(21;0.00448)																	---	---	---	---
OR5R1	219479	broad.mit.edu	37	11	56185581	56185581	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56185581A>C	uc010rji.1	-	1	128	c.128T>G	c.(127-129)CTT>CGT	p.L43R		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	43	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)																	---	---	---	---
GLYATL1	92292	broad.mit.edu	37	11	58722373	58722373	+	Intron	SNP	A	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58722373A>C	uc001nnf.2	+						uc001nng.1_Intron|GLYATL1_uc001nnh.1_Intron|GLYATL1_uc001nni.1_Intron|GLYATL1_uc001nnj.1_Intron					SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;							mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)													---	---	---	---
AHNAK	79026	broad.mit.edu	37	11	62293843	62293843	+	Silent	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62293843G>A	uc001ntl.2	-	5	8346	c.8046C>T	c.(8044-8046)AAC>AAT	p.N2682N	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	2682					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)																---	---	---	---
SLC22A12	116085	broad.mit.edu	37	11	64359339	64359339	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64359339C>T	uc001oam.1	+	1	1058	c.311C>T	c.(310-312)ACG>ATG	p.T104M	SLC22A12_uc009ypr.1_Missense_Mutation_p.T104M|SLC22A12_uc001oal.1_Translation_Start_Site|SLC22A12_uc009yps.1_Missense_Mutation_p.T104M|SLC22A12_uc001oan.1_Missense_Mutation_p.T104M|SLC22A12_uc009ypt.2_5'Flank	NM_144585	NP_653186	Q96S37	S22AC_HUMAN	urate anion exchanger 1 isoform a	104					cellular homeostasis|response to drug|urate metabolic process	apical plasma membrane|brush border membrane|integral to membrane	PDZ domain binding|urate transmembrane transporter activity			ovary(1)	1																		---	---	---	---
FAT3	120114	broad.mit.edu	37	11	92086909	92086909	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92086909G>A	uc001pdj.3	+	1	1648	c.1631G>A	c.(1630-1632)AGA>AAA	p.R544K		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	544	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---
MED17	9440	broad.mit.edu	37	11	93527121	93527121	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93527121C>T	uc001pem.3	+	5	1054	c.779C>T	c.(778-780)TCA>TTA	p.S260L		NM_004268	NP_004259	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	260					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)																---	---	---	---
RASSF8	11228	broad.mit.edu	37	12	26217702	26217702	+	Silent	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26217702G>T	uc001rgx.2	+	3	596	c.375G>T	c.(373-375)CCG>CCT	p.P125P	RASSF8_uc001rgy.2_Silent_p.P125P|RASSF8_uc001rgz.2_Silent_p.P125P|RASSF8_uc009zjd.1_Silent_p.P125P|RASSF8_uc009zje.1_Silent_p.P125P	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family	125					signal transduction						0	Colorectal(261;0.0847)																	---	---	---	---
FAR2	55711	broad.mit.edu	37	12	29423406	29423406	+	Nonsense_Mutation	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29423406T>G	uc001ris.3	+	2	171	c.24T>G	c.(22-24)TAT>TAG	p.Y8*	FAR2_uc001rit.2_Nonsense_Mutation_p.Y8*|FAR2_uc009zjm.2_Intron	NM_018099	NP_060569	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	8					ether lipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor				0																		---	---	---	---
CNTN1	1272	broad.mit.edu	37	12	41327301	41327301	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41327301T>C	uc001rmm.1	+	8	855	c.742T>C	c.(742-744)TTC>CTC	p.F248L	CNTN1_uc009zjy.1_Missense_Mutation_p.F248L|CNTN1_uc001rmn.1_Missense_Mutation_p.F237L|CNTN1_uc001rmo.2_Missense_Mutation_p.F248L	NM_001843	NP_001834	Q12860	CNTN1_HUMAN	contactin 1 isoform 1 precursor	248	Ig-like C2-type 3.				axon guidance|cell adhesion|Notch signaling pathway	anchored to membrane|membrane fraction|plasma membrane				lung(4)|ovary(3)|large_intestine(1)|skin(1)	9	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)																---	---	---	---
SLC38A1	81539	broad.mit.edu	37	12	46598091	46598091	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46598091T>G	uc001rpa.2	-	11	1073	c.815A>C	c.(814-816)AAT>ACT	p.N272T	SLC38A1_uc001rpb.2_Missense_Mutation_p.N272T|SLC38A1_uc001rpc.2_Missense_Mutation_p.N272T|SLC38A1_uc001rpd.2_Missense_Mutation_p.N272T|SLC38A1_uc001rpe.2_Missense_Mutation_p.N272T|SLC38A1_uc010slh.1_Missense_Mutation_p.N245T|SLC38A1_uc009zkj.1_Missense_Mutation_p.N272T	NM_030674	NP_109599	Q9H2H9	S38A1_HUMAN	amino acid transporter system A1	272	Extracellular (Potential).				cellular nitrogen compound metabolic process|neurotransmitter uptake	integral to membrane|plasma membrane	sodium:amino acid symporter activity			ovary(2)|skin(2)|central_nervous_system(1)	5	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)															---	---	---	---
ESPL1	9700	broad.mit.edu	37	12	53663425	53663425	+	Silent	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53663425G>A	uc001sck.2	+	3	790	c.699G>A	c.(697-699)GTG>GTA	p.V233V	ESPL1_uc001scj.2_5'UTR	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	233					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3																		---	---	---	---
BAZ2A	11176	broad.mit.edu	37	12	57005592	57005592	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57005592T>C	uc001slq.1	-	6	1774	c.1580A>G	c.(1579-1581)GAG>GGG	p.E527G	BAZ2A_uc001slp.1_Missense_Mutation_p.E525G|BAZ2A_uc009zow.1_Missense_Mutation_p.E495G	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	527					chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0																		---	---	---	---
PLXNC1	10154	broad.mit.edu	37	12	94645229	94645229	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94645229G>A	uc001tdc.2	+	15	3055	c.2806G>A	c.(2806-2808)GTC>ATC	p.V936I		NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	936	Extracellular (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---
CCDC38	120935	broad.mit.edu	37	12	96330276	96330276	+	Silent	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96330276A>G	uc001tek.1	-	2	246	c.12T>C	c.(10-12)AAT>AAC	p.N4N		NM_182496	NP_872302	Q502W7	CCD38_HUMAN	coiled-coil domain containing 38	4										skin(1)	1																		---	---	---	---
C13orf1	57213	broad.mit.edu	37	13	50502102	50502102	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50502102T>C	uc001vdl.2	-	3	605	c.343A>G	c.(343-345)AAA>GAA	p.K115E	C13orf1_uc001vdm.2_Missense_Mutation_p.K76E|C13orf1_uc010tgm.1_Intron|C13orf1_uc010adj.2_Missense_Mutation_p.K115E	NM_020456	NP_065189	Q5W111	SPRY7_HUMAN	chromosome 13 open reading frame 1 isoform 1	115	B30.2/SPRY.										0		Lung NSC(96;7.5e-06)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Acute lymphoblastic leukemia(7;0.117)		GBM - Glioblastoma multiforme(99;1.72e-10)|COAD - Colon adenocarcinoma(199;0.208)														---	---	---	---
C13orf34	79866	broad.mit.edu	37	13	73303242	73303242	+	Intron	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73303242C>T	uc001viv.1	+						C13orf37_uc001viu.2_5'Flank|C13orf34_uc010thq.1_Intron|C13orf34_uc010aen.1_Intron|C13orf34_uc010thr.1_Intron|C13orf34_uc001viw.1_Intron	NM_024808	NP_079084			aurora borealis						cell division|mitosis|regulation of mitosis|regulation of mitotic spindle organization|regulation of protein localization		protein kinase binding				0		Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.000227)														---	---	---	---
TBC1D4	9882	broad.mit.edu	37	13	75898422	75898422	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75898422A>G	uc001vjl.1	-	11	2496	c.2149T>C	c.(2149-2151)TTT>CTT	p.F717L	TBC1D4_uc010aer.2_Missense_Mutation_p.F717L|TBC1D4_uc010aes.2_Intron	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	717	Ser-rich.					cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)														---	---	---	---
SLITRK5	26050	broad.mit.edu	37	13	88330374	88330374	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88330374C>A	uc001vln.2	+	2	2950	c.2731C>A	c.(2731-2733)CTA>ATA	p.L911I	SLITRK5_uc010tic.1_Missense_Mutation_p.L670I	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	911	Cytoplasmic (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)																	---	---	---	---
TXNDC16	57544	broad.mit.edu	37	14	52981665	52981665	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52981665C>T	uc001wzs.2	-	8	987	c.538G>A	c.(538-540)GCT>ACT	p.A180T	TXNDC16_uc010tqu.1_Missense_Mutation_p.A175T|TXNDC16_uc010aoe.2_RNA	NM_020784	NP_065835	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16 isoform 1	180				A -> G (in Ref. 1; BAA92582).	cell redox homeostasis	extracellular region					0	Breast(41;0.0716)																	---	---	---	---
AKAP5	9495	broad.mit.edu	37	14	64935787	64935787	+	Silent	SNP	G	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64935787G>C	uc001xhd.3	+	2	1053	c.675G>C	c.(673-675)ACG>ACC	p.T225T	ZBTB25_uc001xhc.2_Intron	NM_004857	NP_004848	P24588	AKAP5_HUMAN	A-kinase anchor protein 5	225					energy reserve metabolic process|positive regulation of cAMP biosynthetic process|positive regulation of protein kinase A signaling cascade|protein targeting|regulation of insulin secretion|signal transduction|synaptic transmission	cytosol	adenylate cyclase binding|calmodulin binding				0				all cancers(60;0.00749)|OV - Ovarian serous cystadenocarcinoma(108;0.0095)|BRCA - Breast invasive adenocarcinoma(234;0.0449)														---	---	---	---
ADCK1	57143	broad.mit.edu	37	14	78353526	78353526	+	Silent	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78353526G>A	uc001xui.2	+	5	615	c.516G>A	c.(514-516)ACG>ACA	p.T172T	ADCK1_uc010tvo.1_Intron|ADCK1_uc001xuj.2_Silent_p.T104T|ADCK1_uc001xuk.1_Silent_p.T46T	NM_020421	NP_065154	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1 isoform a	179	Protein kinase.					extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)														---	---	---	---
MEIS2	4212	broad.mit.edu	37	15	37184392	37184392	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:37184392C>T	uc001zjr.2	-	12	2453	c.1416G>A	c.(1414-1416)ATG>ATA	p.M472I	MEIS2_uc001zjl.2_3'UTR|MEIS2_uc010ucj.1_Missense_Mutation_p.M452I|MEIS2_uc001zjm.2_3'UTR|MEIS2_uc001zjn.2_3'UTR|MEIS2_uc001zjo.2_3'UTR|MEIS2_uc001zjp.2_3'UTR|MEIS2_uc001zjs.2_Missense_Mutation_p.M465I|MEIS2_uc001zju.2_3'UTR|MEIS2_uc001zjt.2_Missense_Mutation_p.M465I|MEIS2_uc001zjj.2_Missense_Mutation_p.M168I|MEIS2_uc001zjk.2_Missense_Mutation_p.M161I	NM_170675	NP_733775	O14770	MEIS2_HUMAN	Meis homeobox 2 isoform c	472					negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)	2		all_epithelial(112;9.77e-14)|Lung NSC(122;1.42e-09)|all_lung(180;2.2e-08)|Ovarian(310;0.134)|Melanoma(134;0.155)		all cancers(64;9.33e-21)|GBM - Glioblastoma multiforme(113;1.71e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0288)														---	---	---	---
GABPB1	2553	broad.mit.edu	37	15	50570826	50570826	+	3'UTR	SNP	C	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50570826C>G	uc001zyb.2	-	9					GABPB1_uc001zya.2_3'UTR|GABPB1_uc010ufg.1_3'UTR	NM_005254	NP_005245			GA binding protein transcription factor, beta						positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)	1																		---	---	---	---
ISL2	64843	broad.mit.edu	37	15	76632641	76632641	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76632641C>T	uc002bbw.1	+	4	614	c.536C>T	c.(535-537)GCG>GTG	p.A179V		NM_145805	NP_665804	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	179						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---
SGK269	79834	broad.mit.edu	37	15	77473300	77473300	+	Silent	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77473300A>G	uc002bcm.2	-	3	1277	c.969T>C	c.(967-969)AAT>AAC	p.N323N	SGK269_uc002bcn.2_Silent_p.N323N	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	323					cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)														---	---	---	---
CHD2	1106	broad.mit.edu	37	15	93563419	93563419	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93563419C>A	uc002bsp.2	+	38	5659	c.5084C>A	c.(5083-5085)TCC>TAC	p.S1695Y	CHD2_uc002bso.1_Missense_Mutation_p.S1695Y	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1695					regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)															---	---	---	---
TPSG1	25823	broad.mit.edu	37	16	1272676	1272676	+	Missense_Mutation	SNP	C	T	T	rs137977482	byFrequency	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1272676C>T	uc002ckw.2	-	4	489	c.487G>A	c.(487-489)GGC>AGC	p.G163S		NM_012467	NP_036599	Q9NRR2	TRYG1_HUMAN	transmembrane tryptase preproprotein	163	Peptidase S1.				proteolysis	integral to plasma membrane	serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)																---	---	---	---
TELO2	9894	broad.mit.edu	37	16	1549288	1549288	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1549288A>C	uc002cly.2	+	6	1178	c.887A>C	c.(886-888)CAG>CCG	p.Q296P	TELO2_uc010uvg.1_Missense_Mutation_p.Q296P	NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog	296						chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)																---	---	---	---
USP7	7874	broad.mit.edu	37	16	9017167	9017167	+	Silent	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9017167T>C	uc002czl.2	-	3	487	c.288A>G	c.(286-288)CCA>CCG	p.P96P	USP7_uc010uyk.1_5'UTR|USP7_uc010uyj.1_5'UTR|USP7_uc002czk.2_Silent_p.P80P|USP7_uc010uyl.1_RNA	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7	96	Interaction with p53/TP53, MDM2 and EBNA1.|MATH.|Necessary for nuclear localization.|Interaction with TSPYL5.				interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3																		---	---	---	---
C16orf75	116028	broad.mit.edu	37	16	11444592	11444592	+	Missense_Mutation	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11444592T>C	uc002daw.1	+	2	407	c.389T>C	c.(388-390)ATC>ACC	p.I130T	C16orf75_uc002daq.1_RNA	NM_152308	NP_689521	Q96E14	RMI2_HUMAN	RecQ-mediated genome instability protein 2	130					DNA replication	nucleus	DNA binding				0								T	CIITA	PMBL|Hodgkin Lymphona|								---	---	---	---
ATXN2L	11273	broad.mit.edu	37	16	28837136	28837136	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28837136G>A	uc002drc.2	+	4	607	c.439G>A	c.(439-441)GGT>AGT	p.G147S	uc010vct.1_Intron|ATXN2L_uc010byl.1_Missense_Mutation_p.G147S|ATXN2L_uc002drb.2_Missense_Mutation_p.G147S|ATXN2L_uc002dqy.2_Missense_Mutation_p.G147S|ATXN2L_uc002dra.2_Missense_Mutation_p.G147S|ATXN2L_uc002dqz.2_Missense_Mutation_p.G147S|ATXN2L_uc010vdb.1_Missense_Mutation_p.G147S|ATXN2L_uc002dre.2_Missense_Mutation_p.G147S|ATXN2L_uc002drf.2_5'UTR	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	147						membrane				upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
ATXN2L	11273	broad.mit.edu	37	16	28844195	28844195	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28844195G>A	uc002drc.2	+	13	1814	c.1646G>A	c.(1645-1647)GGG>GAG	p.G549E	uc010vct.1_Intron|ATXN2L_uc010byl.1_Missense_Mutation_p.G525E|ATXN2L_uc002drb.2_Missense_Mutation_p.G549E|ATXN2L_uc002dqy.2_Missense_Mutation_p.G549E|ATXN2L_uc002dra.2_Missense_Mutation_p.G549E|ATXN2L_uc002dqz.2_Missense_Mutation_p.G549E|ATXN2L_uc010vdb.1_Missense_Mutation_p.G555E|ATXN2L_uc002dre.2_Missense_Mutation_p.G549E|ATXN2L_uc002drf.2_Intron|ATXN2L_uc002drg.2_5'Flank	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	549						membrane				upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---
PRR14	78994	broad.mit.edu	37	16	30666245	30666245	+	Missense_Mutation	SNP	T	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30666245T>A	uc002dyy.2	+	8	1212	c.954T>A	c.(952-954)AAT>AAA	p.N318K	PRR14_uc002dyz.2_Missense_Mutation_p.N163K|PRR14_uc002dza.2_Missense_Mutation_p.N318K|PRR14_uc002dzb.1_Missense_Mutation_p.N132K	NM_024031	NP_076936	Q9BWN1	PRR14_HUMAN	proline rich 14	318	Pro-rich.										0			Colorectal(24;0.103)															---	---	---	---
ADCY7	113	broad.mit.edu	37	16	50345962	50345962	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50345962C>T	uc002egd.1	+	20	2732	c.2464C>T	c.(2464-2466)CGC>TGC	p.R822C		NM_001114	NP_001105	P51828	ADCY7_HUMAN	adenylate cyclase 7	822	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to ethanol|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of cAMP biosynthetic process|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			skin(1)	1		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)	Bromocriptine(DB01200)													---	---	---	---
TP53	7157	broad.mit.edu	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	A	A	rs28934571		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577534C>A	uc002gim.2	-	7	941	c.747G>T	c.(745-747)AGG>AGT	p.R249S	TP53_uc002gig.1_Missense_Mutation_p.R249S|TP53_uc002gih.2_Missense_Mutation_p.R249S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R117S|TP53_uc010cng.1_Missense_Mutation_p.R117S|TP53_uc002gii.1_Missense_Mutation_p.R117S|TP53_uc010cnh.1_Missense_Mutation_p.R249S|TP53_uc010cni.1_Missense_Mutation_p.R249S|TP53_uc002gij.2_Missense_Mutation_p.R249S|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R156S|TP53_uc002gio.2_Missense_Mutation_p.R117S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	249	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> I (in a sporadic cancer; somatic mutation).|R -> M (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R249S(303)|p.R249M(25)|p.R249G(24)|p.R249W(23)|p.R249T(16)|p.R249K(14)|p.0?(7)|p.R249R(6)|p.R249fs*96(6)|p.M246_P250delMNRRP(2)|p.R249fs*14(2)|p.N247_P250delNRRP(1)|p.R249fs*19(1)|p.R249fs*15(1)|p.R249_I251delRPI(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.R249_T256delRPILTIIT(1)|p.R249_P250>SS(1)|p.P250fs*14(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---
WDR16	146845	broad.mit.edu	37	17	9503482	9503482	+	Silent	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9503482G>A	uc002gly.2	+	6	804	c.735G>A	c.(733-735)GCG>GCA	p.A245A	WDR16_uc002glz.2_Silent_p.A177A|WDR16_uc010coc.2_Silent_p.A255A	NM_145054	NP_659491	Q8N1V2	WDR16_HUMAN	WD40-repeat protein upregulated in HCC isoform	245						cytoplasm|intracellular membrane-bounded organelle	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4																		---	---	---	---
FAM83G	644815	broad.mit.edu	37	17	18907189	18907189	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18907189G>A	uc002guw.2	-	2	333	c.166C>T	c.(166-168)CGA>TGA	p.R56*	SLC5A10_uc002gur.1_Intron|SLC5A10_uc002guu.1_Intron|SLC5A10_uc002gut.1_Intron|SLC5A10_uc002guv.1_Intron|SLC5A10_uc010vyl.1_Intron	NM_001039999	NP_001035088	A6ND36	FA83G_HUMAN	hypothetical protein LOC644815	56										ovary(1)|central_nervous_system(1)	2																		---	---	---	---
WSB1	26118	broad.mit.edu	37	17	25639245	25639245	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25639245C>T	uc002gzd.1	+	9	1432	c.1116C>T	c.(1114-1116)GAC>GAT	p.D372D	WSB1_uc002gze.1_Silent_p.D226D|WSB1_uc002gzf.1_RNA	NM_015626	NP_056441	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box-containing 1 isoform 1	372	SOCS box.				intracellular signal transduction	intracellular	protein binding				0	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)														---	---	---	---
DUSP14	11072	broad.mit.edu	37	17	35872368	35872368	+	5'UTR	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35872368C>T	uc002hnx.2	+	3					DUSP14_uc002hny.2_5'UTR|DUSP14_uc002hnz.2_5'UTR	NM_007026	NP_008957			dual specificity phosphatase 14								MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Breast(25;0.00637)|Ovarian(249;0.15)																---	---	---	---
LASP1	3927	broad.mit.edu	37	17	37075007	37075007	+	Silent	SNP	G	A	A	rs140055048		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37075007G>A	uc002hra.2	+	7	1093	c.762G>A	c.(760-762)CCG>CCA	p.P254P	LASP1_uc010cvq.2_Missense_Mutation_p.R132Q|LASP1_uc010wdz.1_Silent_p.P198P	NM_006148	NP_006139	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	254	SH3.					cortical actin cytoskeleton	ion transmembrane transporter activity|SH3/SH2 adaptor activity|zinc ion binding			lung(1)	1								T	MLL	AML								---	---	---	---
MED1	5469	broad.mit.edu	37	17	37565409	37565409	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37565409G>T	uc002hrv.3	-	17	3277	c.3065C>A	c.(3064-3066)CCA>CAA	p.P1022Q	MED1_uc010wee.1_Missense_Mutation_p.P850Q|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	1022	Interaction with ESR1.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)											HNSCC(31;0.082)			---	---	---	---
NR1D1	9572	broad.mit.edu	37	17	38253616	38253616	+	Silent	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38253616T>G	uc002htz.1	-	2	698	c.72A>C	c.(70-72)CCA>CCC	p.P24P	NR1D1_uc010cwq.1_RNA|NR1D1_uc010cwr.1_5'Flank	NM_021724	NP_068370	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	24					cellular response to lipopolysaccharide|negative regulation of receptor biosynthetic process|negative regulation of toll-like receptor 4 signaling pathway|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nuclear chromatin|nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding			skin(1)	1	Colorectal(19;0.000442)																	---	---	---	---
KRTAP1-5	83895	broad.mit.edu	37	17	39183145	39183145	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39183145A>G	uc002hvu.2	-	1	310	c.263T>C	c.(262-264)ATC>ACC	p.I88T		NM_031957	NP_114163	Q9BYS1	KRA15_HUMAN	keratin associated protein 1.5	88	15 X 5 AA repeats of C-C-[QEPVRC]- [TPIVLE]-[SRHVP].					keratin filament					0		Breast(137;0.00043)	STAD - Stomach adenocarcinoma(17;0.000371)															---	---	---	---
KRTAP4-1	85285	broad.mit.edu	37	17	39340975	39340975	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39340975G>T	uc002hwe.3	-	1	173	c.132C>A	c.(130-132)TGC>TGA	p.C44*	KRTAP4-1_uc010cxm.1_RNA	NM_033060	NP_149049	Q9BYQ7	KRA41_HUMAN	keratin associated protein 4-1	44	18 X 5 AA repeats of C-C-[GRQC]-[SPT]- [VSTL].|5.					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)															---	---	---	---
KRTAP4-1	85285	broad.mit.edu	37	17	39340982	39340982	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39340982G>T	uc002hwe.3	-	1	166	c.125C>A	c.(124-126)TCC>TAC	p.S42Y	KRTAP4-1_uc010cxm.1_RNA	NM_033060	NP_149049	Q9BYQ7	KRA41_HUMAN	keratin associated protein 4-1	42	18 X 5 AA repeats of C-C-[GRQC]-[SPT]- [VSTL].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)															---	---	---	---
KRTAP9-9	81870	broad.mit.edu	37	17	39411940	39411940	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39411940C>T	uc010wfq.1	+	3	260	c.258C>T	c.(256-258)GGC>GGT	p.G86G		NM_030975	NP_112237	B5MDD6	B5MDD6_HUMAN	keratin associated protein 9-9	101						keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)															---	---	---	---
KRT33B	3884	broad.mit.edu	37	17	39525916	39525916	+	Nonsense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39525916G>T	uc002hwl.2	-	1	132	c.87C>A	c.(85-87)TAC>TAA	p.Y29*		NM_002279	NP_002270	Q14525	KT33B_HUMAN	type I hair keratin 3B	29	Head.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)																---	---	---	---
KRT38	8687	broad.mit.edu	37	17	39597030	39597030	+	Silent	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39597030G>A	uc002hwq.1	-	1	567	c.144C>T	c.(142-144)AAC>AAT	p.N48N		NM_006771	NP_006762	O76015	KRT38_HUMAN	keratin 38	48	Head.					intermediate filament	structural molecule activity			skin(2)	2		Breast(137;0.000496)																---	---	---	---
KRT35	3886	broad.mit.edu	37	17	39633999	39633999	+	Intron	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39633999G>T	uc002hws.2	-							NM_002280	NP_002271			keratin 35						anatomical structure morphogenesis	intermediate filament	protein binding|structural molecule activity			ovary(1)|skin(1)	2		Breast(137;0.000286)																---	---	---	---
KRT13	3860	broad.mit.edu	37	17	39659306	39659306	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39659306C>T	uc002hwu.1	-	4	843	c.780G>A	c.(778-780)GTG>GTA	p.V260V	KRT13_uc002hwv.1_Silent_p.V260V|KRT13_uc002hww.2_Silent_p.V153V|KRT13_uc010wfr.1_Silent_p.V153V|KRT13_uc010cxo.2_Silent_p.V260V|KRT13_uc002hwx.1_Silent_p.V248V	NM_153490	NP_705694	P13646	K1C13_HUMAN	keratin 13 isoform a	260	Linker 12.|Rod.				epidermis development	intermediate filament	structural molecule activity			ovary(2)|skin(2)|pancreas(1)	5		Breast(137;0.000286)																---	---	---	---
CDC27	996	broad.mit.edu	37	17	45234322	45234322	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45234322T>G	uc002ild.3	-	7	926	c.799A>C	c.(799-801)AGT>CGT	p.S267R	CDC27_uc002ile.3_Missense_Mutation_p.S267R|CDC27_uc002ilf.3_Missense_Mutation_p.S267R|CDC27_uc010wkp.1_Missense_Mutation_p.S206R|CDC27_uc010wkq.1_RNA	NM_001256	NP_001247	P30260	CDC27_HUMAN	cell division cycle protein 27 isoform 2	267					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	protein phosphatase binding			lung(2)|breast(2)|ovary(1)	5																		---	---	---	---
C18orf8	29919	broad.mit.edu	37	18	21098916	21098916	+	Missense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21098916C>T	uc010xax.1	+	8	837	c.716C>T	c.(715-717)GCG>GTG	p.A239V	C18orf8_uc010xau.1_Missense_Mutation_p.A82V|C18orf8_uc010xav.1_Missense_Mutation_p.A191V|C18orf8_uc010xaw.1_Missense_Mutation_p.A82V|C18orf8_uc002kul.2_RNA	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN	colon cancer-associated protein Mic1	239										ovary(1)	1	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)																	---	---	---	---
WDR7	23335	broad.mit.edu	37	18	54694232	54694232	+	Intron	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54694232C>A	uc002lgk.1	+						WDR7_uc002lgl.1_Intron	NM_015285	NP_056100			rabconnectin-3 beta isoform 1											ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)														---	---	---	---
POLRMT	5442	broad.mit.edu	37	19	621655	621655	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:621655C>T	uc002lpf.1	-	10	2099	c.2043G>A	c.(2041-2043)CAG>CAA	p.Q681Q		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	681					transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---
CHAF1A	10036	broad.mit.edu	37	19	4433127	4433127	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4433127G>A	uc002mal.2	+	13	2364	c.2264G>A	c.(2263-2265)CGG>CAG	p.R755Q		NM_005483	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	755	Binds to p60.				cell cycle|DNA repair|DNA replication|DNA replication-dependent nucleosome assembly|protein complex assembly|regulation of transcription, DNA-dependent|transcription, DNA-dependent	CAF-1 complex|WINAC complex	chromatin binding|chromo shadow domain binding|unfolded protein binding			ovary(1)|skin(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)									Chromatin_Structure					---	---	---	---
KEAP1	9817	broad.mit.edu	37	19	10610425	10610425	+	Silent	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10610425G>T	uc002moq.1	-	2	441	c.285C>A	c.(283-285)GCC>GCA	p.A95A	KEAP1_uc002mor.1_Silent_p.A95A	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	95	BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)															---	---	---	---
C19orf39	126074	broad.mit.edu	37	19	11485533	11485533	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11485533C>T	uc002mrg.1	+	1	151	c.114C>T	c.(112-114)CTC>CTT	p.L38L		NM_175871	NP_787067	Q6NVH7	CS039_HUMAN	hypothetical protein LOC126074	38											0																		---	---	---	---
AP1M1	8907	broad.mit.edu	37	19	16308836	16308836	+	5'UTR	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16308836T>C	uc002ndu.2	+	1					AP1M1_uc002ndv.2_5'UTR|AP1M1_uc010xpd.1_5'UTR	NM_032493	NP_115882			adaptor-related protein complex 1, mu 1 subunit						cellular membrane organization|endosome to melanosome transport|interspecies interaction between organisms|intracellular protein transport|melanosome organization|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding			ovary(3)|breast(1)	4																		---	---	---	---
ELL	8178	broad.mit.edu	37	19	18555639	18555639	+	Missense_Mutation	SNP	A	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18555639A>G	uc002njh.2	-	12	1861	c.1789T>C	c.(1789-1791)TAC>CAC	p.Y597H	ELL_uc010ebq.2_Missense_Mutation_p.Y540H|ELL_uc002njg.2_Missense_Mutation_p.Y464H	NM_006532	NP_006523	P55199	ELL_HUMAN	elongation factor RNA polymerase II	597					positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)				T	MLL	AL								---	---	---	---
ZNF208	7757	broad.mit.edu	37	19	22155346	22155346	+	Silent	SNP	T	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22155346T>C	uc002nqp.2	-	5	2339	c.2190A>G	c.(2188-2190)GAA>GAG	p.E730E	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---
ZNF254	9534	broad.mit.edu	37	19	24310294	24310294	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24310294T>G	uc002nru.2	+	4	1626	c.1492T>G	c.(1492-1494)TCT>GCT	p.S498A	ZNF254_uc010xrk.1_Missense_Mutation_p.S413A	NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254	498	C2H2-type 11.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)																---	---	---	---
ZNF611	81856	broad.mit.edu	37	19	53209605	53209605	+	Missense_Mutation	SNP	T	C	C	rs3859456		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53209605T>C	uc002pzz.2	-	7	1020	c.703A>G	c.(703-705)AAG>GAG	p.K235E	ZNF611_uc010eqc.2_Missense_Mutation_p.K165E|ZNF611_uc010ydo.1_Missense_Mutation_p.K165E|ZNF611_uc010ydr.1_Missense_Mutation_p.K166E|ZNF611_uc010ydp.1_Missense_Mutation_p.K235E|ZNF611_uc010ydq.1_Missense_Mutation_p.K235E|ZNF611_uc002qaa.3_Missense_Mutation_p.K165E	NM_030972	NP_112234	Q8N823	ZN611_HUMAN	zinc finger protein 611 isoform a	235	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)														---	---	---	---
ZNF611	81856	broad.mit.edu	37	19	53209635	53209635	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53209635G>A	uc002pzz.2	-	7	990	c.673C>T	c.(673-675)CAC>TAC	p.H225Y	ZNF611_uc010eqc.2_Missense_Mutation_p.H155Y|ZNF611_uc010ydo.1_Missense_Mutation_p.H155Y|ZNF611_uc010ydr.1_Missense_Mutation_p.H156Y|ZNF611_uc010ydp.1_Missense_Mutation_p.H225Y|ZNF611_uc010ydq.1_Missense_Mutation_p.H225Y|ZNF611_uc002qaa.3_Missense_Mutation_p.H155Y	NM_030972	NP_112234	Q8N823	ZN611_HUMAN	zinc finger protein 611 isoform a	225					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)														---	---	---	---
ZNF761	388561	broad.mit.edu	37	19	53958797	53958797	+	Nonsense_Mutation	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53958797C>T	uc010eqp.2	+	7	1494	c.1036C>T	c.(1036-1038)CGA>TGA	p.R346*	ZNF761_uc010ydy.1_Nonsense_Mutation_p.R292*|ZNF761_uc002qbt.1_Nonsense_Mutation_p.R292*	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761	346	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)														---	---	---	---
LAIR2	3904	broad.mit.edu	37	19	55019214	55019214	+	Missense_Mutation	SNP	T	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55019214T>G	uc002qgc.2	+	3	301	c.179T>G	c.(178-180)CTG>CGG	p.L60R	LAIR2_uc002qga.1_RNA|LAIR2_uc002qgb.1_RNA|LAIR2_uc002qgd.2_Missense_Mutation_p.L60R|LAIR2_uc010erl.2_Missense_Mutation_p.L60R	NM_002288	NP_002279	Q6ISS4	LAIR2_HUMAN	leukocyte-associated immunoglobulin-like	60	Ig-like C2-type.					extracellular region	receptor activity			ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)														---	---	---	---
ZIK1	284307	broad.mit.edu	37	19	58101470	58101470	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58101470G>T	uc002qpg.2	+	4	388	c.291G>T	c.(289-291)CAG>CAT	p.Q97H	ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Missense_Mutation_p.Q42H|ZIK1_uc002qpi.2_Missense_Mutation_p.Q84H|ZIK1_uc002qpj.2_5'UTR	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein	97	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)														---	---	---	---
ZIK1	284307	broad.mit.edu	37	19	58101605	58101605	+	Missense_Mutation	SNP	G	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58101605G>T	uc002qpg.2	+	4	523	c.426G>T	c.(424-426)AAG>AAT	p.K142N	ZNF547_uc002qpm.3_Intron|ZIK1_uc002qph.2_Missense_Mutation_p.K87N|ZIK1_uc002qpi.2_Missense_Mutation_p.K129N|ZIK1_uc002qpj.2_Missense_Mutation_p.K39N	NM_001010879	NP_001010879	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein	142					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)														---	---	---	---
SNPH	9751	broad.mit.edu	37	20	1281207	1281207	+	Missense_Mutation	SNP	C	T	T	rs139099290		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1281207C>T	uc002wes.2	+	5	396	c.160C>T	c.(160-162)CGC>TGC	p.R54C	SNPH_uc002wet.2_Missense_Mutation_p.R98C	NM_014723	NP_055538	O15079	SNPH_HUMAN	syntaphilin	54					synaptic vesicle docking involved in exocytosis	cell junction|integral to membrane|synapse|synaptosome	syntaxin-1 binding			ovary(2)	2																		---	---	---	---
SIRPA	140885	broad.mit.edu	37	20	1902292	1902292	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1902292G>A	uc002wfq.2	+	4	1048	c.688G>A	c.(688-690)GTG>ATG	p.V230M	SIRPA_uc010zps.1_Missense_Mutation_p.V210M|SIRPA_uc002wfr.2_Missense_Mutation_p.V230M|SIRPA_uc002wfs.2_Missense_Mutation_p.V230M|SIRPA_uc002wft.2_Missense_Mutation_p.V230M	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	230	Ig-like C1-type 1.|Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)														---	---	---	---
SIRPA	140885	broad.mit.edu	37	20	1902301	1902301	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1902301G>A	uc002wfq.2	+	4	1057	c.697G>A	c.(697-699)GTC>ATC	p.V233I	SIRPA_uc010zps.1_Missense_Mutation_p.V213I|SIRPA_uc002wfr.2_Missense_Mutation_p.V233I|SIRPA_uc002wfs.2_Missense_Mutation_p.V233I|SIRPA_uc002wft.2_Missense_Mutation_p.V233I	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	233	Ig-like C1-type 1.|Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)														---	---	---	---
TMC2	117532	broad.mit.edu	37	20	2592836	2592836	+	Splice_Site	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2592836G>A	uc002wgf.1	+	13	1609	c.1594_splice	c.e13-1	p.L532_splice	TMC2_uc002wgg.1_Splice_Site_p.L516_splice|TMC2_uc010zpw.1_Splice_Site_p.L364_splice|TMC2_uc010zpx.1_Splice_Site_p.L363_splice	NM_080751	NP_542789			transmembrane cochlear-expressed protein 2							integral to membrane				ovary(3)	3																		---	---	---	---
NOP56	10528	broad.mit.edu	37	20	2634917	2634917	+	Intron	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2634917C>A	uc002wgh.2	+						NOP56_uc010zpy.1_Intron|NOP56_uc002wgi.2_Intron|SNORD110_uc002wgj.2_RNA|SNORA51_uc002wgk.1_5'Flank|NOP56_uc002wgm.1_5'Flank|SNORD86_uc010gaq.1_5'Flank|SNORD56_uc010gar.2_5'Flank|SNORD57_uc002wgo.1_5'Flank	NM_006392	NP_006383			nucleolar protein 5A						rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding			ovary(1)|pancreas(1)	2																		---	---	---	---
HCK	3055	broad.mit.edu	37	20	30686829	30686829	+	Nonsense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30686829G>A	uc002wxh.2	+	12	1440	c.1269G>A	c.(1267-1269)TGG>TGA	p.W423*	HCK_uc010gdy.2_Nonsense_Mutation_p.W402*|HCK_uc002wxi.2_Nonsense_Mutation_p.W401*	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK	423	Protein kinase.				interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)															---	---	---	---
RBL1	5933	broad.mit.edu	37	20	35690621	35690621	+	Missense_Mutation	SNP	C	G	G			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35690621C>G	uc002xgi.2	-	8	1028	c.949G>C	c.(949-951)GAT>CAT	p.D317H	RBL1_uc010zvt.1_RNA|RBL1_uc002xgj.1_Missense_Mutation_p.D317H|RBL1_uc010gfv.1_RNA	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a	317					cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)																---	---	---	---
CHD6	84181	broad.mit.edu	37	20	40045389	40045389	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40045389A>C	uc002xka.1	-	33	6503	c.6325T>G	c.(6325-6327)TTA>GTA	p.L2109V	CHD6_uc002xjz.1_5'Flank	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2109					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)																---	---	---	---
KCNQ2	3785	broad.mit.edu	37	20	62038567	62038567	+	Silent	SNP	G	A	A	rs150982653		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62038567G>A	uc002yey.1	-	17	2226	c.2049C>T	c.(2047-2049)CAC>CAT	p.H683H	KCNQ2_uc002yez.1_Silent_p.H652H|KCNQ2_uc002yfa.1_Silent_p.H665H|KCNQ2_uc002yfb.1_Silent_p.H655H	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein	683	Cytoplasmic (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)													---	---	---	---
PRPF6	24148	broad.mit.edu	37	20	62641640	62641640	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62641640G>A	uc002yho.2	+	10	1442	c.1274G>A	c.(1273-1275)CGA>CAA	p.R425Q	PRPF6_uc002yhp.2_Missense_Mutation_p.R425Q	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog	425	HAT 2.				assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)																	---	---	---	---
RBM11	54033	broad.mit.edu	37	21	15599341	15599341	+	Missense_Mutation	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15599341C>A	uc002yjo.3	+	5	615	c.573C>A	c.(571-573)CAC>CAA	p.H191Q	RBM11_uc002yjn.3_Missense_Mutation_p.H77Q|RBM11_uc002yjp.3_Missense_Mutation_p.H77Q	NM_144770	NP_658983	P57052	RBM11_HUMAN	RNA binding motif protein 11	191							nucleotide binding|RNA binding				0				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)														---	---	---	---
C21orf34	388815	broad.mit.edu	37	21	17763926	17763926	+	Intron	SNP	C	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17763926C>A	uc002ykb.2	+						C21orf34_uc010glc.2_Intron|C21orf34_uc002ykc.2_Intron	NR_027790				Homo sapiens C21ORF34 (C21orf34) mRNA, partial cds, alternatively spliced.												0		Breast(209;0.152)		Epithelial(23;8.3e-05)|all cancers(11;0.000383)|Colorectal(24;0.00387)|COAD - Colon adenocarcinoma(22;0.0113)|OV - Ovarian serous cystadenocarcinoma(11;0.0127)|LUSC - Lung squamous cell carcinoma(23;0.153)														---	---	---	---
RSPH1	89765	broad.mit.edu	37	21	43897396	43897396	+	Intron	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43897396C>T	uc002zbg.2	-							NM_080860	NP_543136			testis-specific gene A2						meiosis	cytosol|nucleus				ovary(1)	1																		---	---	---	---
ATP6V1E1	529	broad.mit.edu	37	22	18082836	18082836	+	Missense_Mutation	SNP	C	T	T	rs144829775	by1000genomes	TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18082836C>T	uc002zmr.1	-	6	579	c.392G>A	c.(391-393)CGA>CAA	p.R131Q	ATP6V1E1_uc002zms.1_Missense_Mutation_p.R101Q|ATP6V1E1_uc002zmt.1_Missense_Mutation_p.R109Q	NM_001696	NP_001687	P36543	VATE1_HUMAN	vacuolar H+ ATPase E1 isoform a	131					cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	apical plasma membrane|cytosol|endosome|proton-transporting two-sector ATPase complex, catalytic domain	protein binding|proton-transporting ATPase activity, rotational mechanism			large_intestine(1)|central_nervous_system(1)	2		all_epithelial(15;0.206)		Lung(27;0.19)														---	---	---	---
RPL3	6122	broad.mit.edu	37	22	39714449	39714449	+	Missense_Mutation	SNP	G	A	A	rs11547980		TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39714449G>A	uc003axi.2	-	2	220	c.152C>T	c.(151-153)GCT>GTT	p.A51V	RPL3_uc003axh.2_Missense_Mutation_p.A51V|RPL3_uc003axj.2_5'UTR|RPL3_uc011aoj.1_Missense_Mutation_p.A51V|RPL3_uc010gxx.2_5'UTR|RPL3_uc003axg.2_5'UTR|RPL3_uc003axk.1_5'UTR	NM_000967	NP_000958	P39023	RL3_HUMAN	ribosomal protein L3 isoform a	51					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome			breast(1)|kidney(1)	2	Melanoma(58;0.04)																	---	---	---	---
SBF1	6305	broad.mit.edu	37	22	50904409	50904409	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50904409G>A	uc003blh.2	-	9	1187	c.992C>T	c.(991-993)ACG>ATG	p.T331M	SBF1_uc011arx.1_Translation_Start_Site|SBF1_uc003bli.2_Missense_Mutation_p.T332M	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	331					protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)														---	---	---	---
ASMT	438	broad.mit.edu	37	X	1748789	1748789	+	Silent	SNP	C	T	T			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1748789C>T	uc004cqd.2	+	6	664	c.519C>T	c.(517-519)ACC>ACT	p.T173T	ASMT_uc010ncy.2_Silent_p.T173T|ASMT_uc004cqe.2_Silent_p.T173T	NM_004043	NP_004034	P46597	HIOM_HUMAN	acetylserotonin O-methyltransferase	173					melatonin biosynthetic process|translation	cytosol	acetylserotonin O-methyltransferase activity|S-methyltransferase activity			skin(1)	1		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---
CD40LG	959	broad.mit.edu	37	X	135730447	135730447	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135730447G>A	uc004faa.2	+	1	112	c.40G>A	c.(40-42)GCC>ACC	p.A14T	CD40LG_uc010nsd.2_Missense_Mutation_p.A14T|CD40LG_uc010nse.1_5'Flank	NM_000074	NP_000065	P29965	CD40L_HUMAN	CD40 ligand	14	Cytoplasmic (Potential).				anti-apoptosis|B cell proliferation|inflammatory response|isotype switching|leukocyte cell-cell adhesion|platelet activation|positive regulation of endothelial cell apoptosis|positive regulation of interleukin-12 production	extracellular space|integral to plasma membrane|soluble fraction	CD40 receptor binding|cytokine activity|tumor necrosis factor receptor binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)				Atorvastatin(DB01076)									Immune_Deficiency_with_Hyper-IgM				---	---	---	---
ARHGEF6	9459	broad.mit.edu	37	X	135770113	135770113	+	Missense_Mutation	SNP	A	C	C			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135770113A>C	uc004fab.2	-	11	1685	c.1223T>G	c.(1222-1224)ATC>AGC	p.I408S	ARHGEF6_uc011mwd.1_Missense_Mutation_p.I281S|ARHGEF6_uc011mwe.1_Missense_Mutation_p.I254S	NM_004840	NP_004831	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor 6	408	DH.				apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---
MAGEA4	4103	broad.mit.edu	37	X	151092504	151092504	+	Missense_Mutation	SNP	G	A	A			TCGA-CG-4300-01A-01D-1158-08	TCGA-CG-4300-10A-01D-1158-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151092504G>A	uc004fez.2	+	3	524	c.368G>A	c.(367-369)CGC>CAC	p.R123H	MAGEA4_uc004ffa.2_Missense_Mutation_p.R123H|MAGEA4_uc004ffb.2_Missense_Mutation_p.R123H|MAGEA4_uc004ffc.2_Missense_Mutation_p.R123H|MAGEA4_uc004ffd.2_Missense_Mutation_p.R123H	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	123	MAGE.						protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---
