Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MTOR	2475	broad.mit.edu	37	1	11316086	11316086	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11316086C>A	uc001asd.2	-	5	789	c.668G>T	c.(667-669)CGT>CTT	p.R223L		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	223					cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						CTTCGGCTCACGCTGGGTTGT	0.552													3	41	---	---	---	---	PASS
PADI2	11240	broad.mit.edu	37	1	17396669	17396669	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17396669C>T	uc001baf.2	-	15	1760	c.1678G>A	c.(1678-1680)GGA>AGA	p.G560R	PADI2_uc010ocm.1_Missense_Mutation_p.G444R	NM_007365	NP_031391	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	560					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(3)|pancreas(1)|central_nervous_system(1)|skin(1)	6		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	TCTGTCAGTCCCAGCTCCTTC	0.592													64	125	---	---	---	---	PASS
PTPRF	5792	broad.mit.edu	37	1	44054441	44054441	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44054441G>A	uc001cjr.2	+	8	1059	c.719G>A	c.(718-720)AGC>AAC	p.S240N	PTPRF_uc001cjs.2_Missense_Mutation_p.S240N|PTPRF_uc001cju.2_5'Flank|PTPRF_uc009vwt.2_5'Flank|PTPRF_uc001cjv.2_5'Flank	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	240	Extracellular (Potential).|Ig-like C2-type 3.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CCTCCCAGCAGCCAGGAGGTG	0.657													13	24	---	---	---	---	PASS
KIF2C	11004	broad.mit.edu	37	1	45228219	45228219	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45228219A>T	uc001cmg.3	+	19	1975	c.1860A>T	c.(1858-1860)TTA>TTT	p.L620F	KIF2C_uc010olb.1_Missense_Mutation_p.L579F|KIF2C_uc010olc.1_Missense_Mutation_p.L507F|KIF2C_uc001cmh.3_Missense_Mutation_p.L566F	NM_006845	NP_006836	Q99661	KIF2C_HUMAN	kinesin family member 2C	620	Potential.				blood coagulation|cell division|cell proliferation|chromosome segregation|establishment or maintenance of microtubule cytoskeleton polarity|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|kinesin complex|microtubule|nucleus	ATP binding|centromeric DNA binding|microtubule motor activity|microtubule plus-end binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					CCTCTCAGTTATCCAAGGAAG	0.522													25	63	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67139031	67139031	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67139031G>C	uc001dcr.2	+	12	845	c.628G>C	c.(628-630)GAT>CAT	p.D210H	SGIP1_uc010opd.1_5'UTR|SGIP1_uc001dcs.2_5'UTR|SGIP1_uc001dct.2_5'UTR|uc010ope.1_Intron|SGIP1_uc009wat.2_5'UTR	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	210	Pro-rich.				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						ATCAGCTTTTGATGAACAGAA	0.358													74	161	---	---	---	---	PASS
NEGR1	257194	broad.mit.edu	37	1	72400957	72400957	+	Silent	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72400957G>A	uc001dfw.2	-	2	314	c.214C>T	c.(214-216)CTG>TTG	p.L72L	NEGR1_uc001dfv.2_5'UTR|NEGR1_uc010oqs.1_Silent_p.L72L	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1 precursor	72	Ig-like C2-type 1.				cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		GACCGGTTCAGCCAGGCACCC	0.378													14	27	---	---	---	---	PASS
LRRC8B	23507	broad.mit.edu	37	1	90048796	90048796	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90048796C>T	uc001dni.2	+	7	1094	c.587C>T	c.(586-588)TCA>TTA	p.S196L	LRRC8B_uc001dnh.2_Missense_Mutation_p.S196L|LRRC8B_uc001dnj.2_Missense_Mutation_p.S196L	NM_001134476	NP_001127948	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member	196						integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TCAGGGTGTTCAGCTGACATA	0.532													32	64	---	---	---	---	PASS
LRRC8B	23507	broad.mit.edu	37	1	90049129	90049129	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90049129C>G	uc001dni.2	+	7	1427	c.920C>G	c.(919-921)TCC>TGC	p.S307C	LRRC8B_uc001dnh.2_Missense_Mutation_p.S307C|LRRC8B_uc001dnj.2_Missense_Mutation_p.S307C	NM_001134476	NP_001127948	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member	307						integral to membrane				ovary(2)	2		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TGTGTCTATTCCTTGGCAGAA	0.408													77	188	---	---	---	---	PASS
AMY2A	279	broad.mit.edu	37	1	104160109	104160109	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104160109A>T	uc001dut.2	+	1	111	c.47A>T	c.(46-48)CAG>CTG	p.Q16L	AMY2A_uc010ouq.1_Missense_Mutation_p.Q16L	NM_000699	NP_000690	P04746	AMYP_HUMAN	pancreatic amylase alpha 2A precursor	16					carbohydrate catabolic process|polysaccharide digestion	extracellular space	alpha-amylase activity|calcium ion binding|chloride ion binding			ovary(1)|skin(1)	2		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Bentiromide(DB00522)|Icodextrin(DB00702)|Miglitol(DB00491)|Pancrelipase(DB00085)	TGCTGGGCTCAGTATTCCCCA	0.403													52	119	---	---	---	---	PASS
SETDB1	9869	broad.mit.edu	37	1	150935585	150935585	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150935585G>T	uc001evu.2	+	19	3617	c.3427G>T	c.(3427-3429)GAT>TAT	p.D1143Y	SETDB1_uc001evv.2_Missense_Mutation_p.D1143Y|SETDB1_uc009wmg.1_Missense_Mutation_p.D1143Y	NM_001145415	NP_001138887	Q15047	SETB1_HUMAN	SET domain, bifurcated 1 isoform 1	1143	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|Golgi apparatus|nucleus|plasma membrane	DNA binding|histone-lysine N-methyltransferase activity|protein binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTCTGAAGGGGATGACTTTGA	0.478													25	56	---	---	---	---	PASS
ATP1A4	480	broad.mit.edu	37	1	160156142	160156142	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160156142C>T	uc001fve.3	+	21	3525	c.3046C>T	c.(3046-3048)CGT>TGT	p.R1016C	ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Missense_Mutation_p.R519C|ATP1A4_uc001fvh.2_Missense_Mutation_p.R152C	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	1016	Cytoplasmic (Potential).			ITWWLCAIPYSILIFVYDEIRKLLIRQ -> WSFALTAQAG VKWRILGLLQPLPPRFK (in Ref. 6; BAC05228).	ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACTCCTCATCCGTCAGCACCC	0.567													97	198	---	---	---	---	PASS
C1orf112	55732	broad.mit.edu	37	1	169798416	169798416	+	Silent	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169798416C>T	uc001ggp.2	+	14	1450	c.1140C>T	c.(1138-1140)CTC>CTT	p.L380L	C1orf112_uc001ggj.2_RNA|C1orf112_uc001ggq.2_Silent_p.L380L|C1orf112_uc009wvt.2_Silent_p.L57L|C1orf112_uc010plu.1_Missense_Mutation_p.S308L|C1orf112_uc009wvu.1_Silent_p.L256L|C1orf112_uc001ggr.2_Silent_p.L245L|C1orf112_uc010plv.1_Silent_p.L322L	NM_018186	NP_060656	Q9NSG2	CA112_HUMAN	hypothetical protein LOC55732	380											0	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TATCTCTACTCAAAGCCGTTT	0.368													23	46	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215802256	215802256	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215802256G>A	uc001hku.1	-	71	15806	c.15419C>T	c.(15418-15420)TCT>TTT	p.S5140F		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	5140	Cytoplasmic (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCGGTGAAGAGAACCCTGGGA	0.557										HNSCC(13;0.011)			39	101	---	---	---	---	PASS
GCG	2641	broad.mit.edu	37	2	163002166	163002166	+	Silent	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163002166G>A	uc002ucc.2	-	4	375	c.276C>T	c.(274-276)CAC>CAT	p.H92H		NM_002054	NP_002045	P01275	GLUC_HUMAN	glucagon preproprotein	92		Cleavage; by PCSK1.			cell proliferation|cellular response to glucagon stimulus|energy reserve metabolic process|feeding behavior|regulation of insulin secretion	plasma membrane|soluble fraction	hormone activity				0					Exenatide(DB01276)|Phentolamine(DB00692)	CAAATTCATCGTGACGTTTGG	0.373													41	76	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198948756	198948756	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198948756C>T	uc010fsp.2	+	2	806	c.515C>T	c.(514-516)ACG>ATG	p.T172M	PLCL1_uc002uuv.3_Missense_Mutation_p.T93M	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	172	PH.|Interaction with PPP1C.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	GGGAAAAACACGGAAACATTT	0.463													4	55	---	---	---	---	PASS
DYNC1LI1	51143	broad.mit.edu	37	3	32587353	32587353	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32587353C>T	uc003cfb.3	-	3	413	c.325G>A	c.(325-327)GAA>AAA	p.E109K	DYNC1LI1_uc011axh.1_Intron	NM_016141	NP_057225	Q9Y6G9	DC1L1_HUMAN	dynein, cytoplasmic 1, light intermediate chain	109					cell division|interspecies interaction between organisms|mitosis|positive regulation of mitotic cell cycle spindle assembly checkpoint|transport	centrosome|condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|plasma membrane|spindle pole	ATP binding|motor activity			ovary(1)	1						TCCCTGTCTTCATCATGCACA	0.338													50	105	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178938934	178938934	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178938934G>A	uc003fjk.2	+	14	2333	c.2176G>A	c.(2176-2178)GAA>AAA	p.E726K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	726					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E726K(2)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GAAGAAGGATGAAACACAAAA	0.363		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			76	17	---	---	---	---	PASS
MAP3K13	9175	broad.mit.edu	37	3	185191432	185191432	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185191432G>C	uc010hyf.2	+	12	2579	c.2313G>C	c.(2311-2313)CAG>CAC	p.Q771H	MAP3K13_uc011brt.1_Missense_Mutation_p.Q564H|MAP3K13_uc011bru.1_Missense_Mutation_p.Q627H|MAP3K13_uc003fpi.2_Missense_Mutation_p.Q771H|MAP3K13_uc010hyg.2_Missense_Mutation_p.Q461H	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase	771					activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			AAAACGCCCAGAGTTCTGAGA	0.527													77	590	---	---	---	---	PASS
APOD	347	broad.mit.edu	37	3	195306200	195306200	+	Intron	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195306200C>T	uc003fur.2	-						APOD_uc011bsx.1_Intron	NM_001647	NP_001638	P05090	APOD_HUMAN	apolipoprotein D precursor						lipid metabolic process	extracellular space	lipid binding|lipid transporter activity|protein binding			ovary(2)	2	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		ACGGGAGGTTCGCCTTTTACC	0.493													89	730	---	---	---	---	PASS
STX18	53407	broad.mit.edu	37	4	4436545	4436545	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4436545C>T	uc003gic.2	-	7	738	c.654G>A	c.(652-654)TGG>TGA	p.W218*		NM_016930	NP_058626	Q9P2W9	STX18_HUMAN	syntaxin 18	218	Cytoplasmic (Potential).				ER to Golgi vesicle-mediated transport|intracellular protein transport	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	SNAP receptor activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.0534)		TGCCATCTCCCCACGTTCCCA	0.333													3	75	---	---	---	---	PASS
NR3C2	4306	broad.mit.edu	37	4	149356645	149356645	+	Silent	SNP	C	T	T	rs72645627		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149356645C>T	uc003ilj.3	-	2	1702	c.1368G>A	c.(1366-1368)TCG>TCA	p.S456S	NR3C2_uc003ilk.3_Silent_p.S456S|NR3C2_uc010iph.2_RNA	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	456	Modulating.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	AGGAAAAATACGAGCCATCCA	0.418													22	50	---	---	---	---	PASS
CDKN2AIP	55602	broad.mit.edu	37	4	184367413	184367413	+	Silent	SNP	G	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184367413G>C	uc003ivp.1	+	3	738	c.576G>C	c.(574-576)CGG>CGC	p.R192R	CDKN2AIP_uc003ivq.1_5'UTR	NM_017632	NP_060102	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	192	Ser-rich.				negative regulation of cell growth|positive regulation of signal transduction|regulation of protein stability	granular component|nucleoplasm	double-stranded RNA binding|p53 binding				0		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		ACTCAGCTCGGAGCTCTGGCA	0.507													32	62	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	228381	228381	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:228381A>T	uc003jao.3	+	6	818	c.703A>T	c.(703-705)ATC>TTC	p.I235F	SDHA_uc003jan.2_Missense_Mutation_p.I235F|SDHA_uc011clv.1_Missense_Mutation_p.I235F|SDHA_uc011clw.1_Missense_Mutation_p.I187F|SDHA_uc003jap.3_Missense_Mutation_p.I235F|SDHA_uc003jaq.3_Missense_Mutation_p.I10F|SDHA_uc003jar.3_5'Flank	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,	235					nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	CCGTGGTGTCATCGCACTGTG	0.428									Familial_Paragangliomas				3	72	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	228396	228396	+	Missense_Mutation	SNP	G	C	C	rs1041946		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:228396G>C	uc003jao.3	+	6	833	c.718G>C	c.(718-720)GAG>CAG	p.E240Q	SDHA_uc003jan.2_Missense_Mutation_p.E240Q|SDHA_uc011clv.1_Missense_Mutation_p.E240Q|SDHA_uc011clw.1_Missense_Mutation_p.E192Q|SDHA_uc003jap.3_Missense_Mutation_p.E240Q|SDHA_uc003jaq.3_Missense_Mutation_p.E15Q|SDHA_uc003jar.3_5'Flank	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,	240					nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	ACTGTGCATAGAGGACGGGTC	0.418									Familial_Paragangliomas				3	72	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	231090	231090	+	Silent	SNP	A	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:231090A>C	uc003jao.3	+	7	985	c.870A>C	c.(868-870)CTA>CTC	p.L290L	SDHA_uc003jan.2_Silent_p.L290L|SDHA_uc011clv.1_Silent_p.L290L|SDHA_uc011clw.1_Silent_p.L242L|SDHA_uc003jap.3_Silent_p.L290L|SDHA_uc003jaq.3_Silent_p.L65L|SDHA_uc003jar.3_5'UTR	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,	290					nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GCCAGGACCTAGAGTTTGTTC	0.592									Familial_Paragangliomas				3	37	---	---	---	---	PASS
AQPEP	206338	broad.mit.edu	37	5	115351368	115351368	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115351368G>A	uc003kro.2	+	18	2826	c.2662G>A	c.(2662-2664)GAA>AAA	p.E888K	AQPEP_uc003krp.2_RNA|AQPEP_uc003krq.2_RNA|AQPEP_uc003krr.2_RNA|AQPEP_uc003krs.2_RNA	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin	888	Lumenal (Potential).				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						CACTTCTAATGAAACAAATAT	0.353													12	17	---	---	---	---	PASS
AQPEP	206338	broad.mit.edu	37	5	115351379	115351379	+	Silent	SNP	A	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115351379A>C	uc003kro.2	+	18	2837	c.2673A>C	c.(2671-2673)ATA>ATC	p.I891I	AQPEP_uc003krp.2_RNA|AQPEP_uc003krq.2_RNA|AQPEP_uc003krr.2_RNA|AQPEP_uc003krs.2_RNA	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin	891	Lumenal (Potential).				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						AAACAAATATAATTGAGGTTG	0.368													12	14	---	---	---	---	PASS
SLC17A1	6568	broad.mit.edu	37	6	25826752	25826752	+	Silent	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25826752C>T	uc003nfh.3	-	3	260	c.144G>A	c.(142-144)GTG>GTA	p.V48V	SLC17A1_uc011djy.1_RNA|SLC17A1_uc010jqb.1_Silent_p.V46V|SLC17A1_uc010jqc.1_Silent_p.V46V	NM_005074	NP_005065	Q14916	NPT1_HUMAN	solute carrier family 17 (sodium phosphate),	48					sodium ion transport|urate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(3)|pancreas(1)	4						CTGTGCTATTCACCATGACTA	0.413													37	72	---	---	---	---	PASS
FGD2	221472	broad.mit.edu	37	6	36979601	36979601	+	Silent	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36979601C>T	uc010jwp.1	+	4	669	c.498C>T	c.(496-498)CTC>CTT	p.L166L	FGD2_uc003ong.2_5'UTR|FGD2_uc011dtv.1_Intron|FGD2_uc003oni.1_5'Flank	NM_173558	NP_775829	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	166	DH.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|early endosome membrane|Golgi apparatus|lamellipodium|nucleus|ruffle membrane	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			upper_aerodigestive_tract(1)|lung(1)|pancreas(1)	3						AGTTCTTCCTCCCAGAGCTGC	0.617													15	50	---	---	---	---	PASS
CLIC5	53405	broad.mit.edu	37	6	45909283	45909283	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45909283C>T	uc003oxv.3	-	4	989	c.883_splice	c.e4+1	p.A295_splice	CLIC5_uc003oxu.3_Splice_Site_p.A136_splice|CLIC5_uc003oxx.2_Splice_Site_p.A136_splice	NM_001114086	NP_001107558	Q9NZA1	CLIC5_HUMAN	chloride intracellular channel 5 isoform a						female pregnancy	actin cytoskeleton|cell cortex|chloride channel complex|Golgi apparatus|Golgi apparatus|insoluble fraction|microtubule organizing center	protein binding|voltage-gated chloride channel activity			ovary(1)|skin(1)	2						GAGTCACTCACCAGCATTGTT	0.488													37	86	---	---	---	---	PASS
TDRD6	221400	broad.mit.edu	37	6	46661781	46661781	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46661781G>T	uc003oyj.2	+	1	5916	c.5916G>T	c.(5914-5916)ATG>ATT	p.M1972I	TDRD6_uc010jze.2_Missense_Mutation_p.M1966I	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	1972					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			AGAATGAAATGAATATATGTG	0.393													5	124	---	---	---	---	PASS
TDRD6	221400	broad.mit.edu	37	6	46661806	46661806	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46661806G>C	uc003oyj.2	+	1	5941	c.5941G>C	c.(5941-5943)GAG>CAG	p.E1981Q	TDRD6_uc010jze.2_Missense_Mutation_p.E1975Q	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	1981					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			AGAATTTGTAGAGTATAAAAA	0.383													6	114	---	---	---	---	PASS
NR2E1	7101	broad.mit.edu	37	6	108497844	108497844	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108497844G>A	uc003psg.2	+	4	1152	c.397G>A	c.(397-399)GCG>ACG	p.A133T		NM_003269	NP_003260	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1	133					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		CTTCTTCACCGCGGTCACGCA	0.706													3	7	---	---	---	---	PASS
STK31	56164	broad.mit.edu	37	7	23768836	23768836	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23768836C>T	uc003sws.3	+	6	518	c.451C>T	c.(451-453)CCT>TCT	p.P151S	STK31_uc003swt.3_Missense_Mutation_p.P128S|STK31_uc011jze.1_Missense_Mutation_p.P151S|STK31_uc010kuq.2_Missense_Mutation_p.P128S	NM_031414	NP_113602	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31 isoform a	151							ATP binding|nucleic acid binding|protein serine/threonine kinase activity			skin(3)|lung(2)|ovary(2)|stomach(2)	9						ACTACACATTCCTTCTGATCA	0.328													35	54	---	---	---	---	PASS
ZNF138	7697	broad.mit.edu	37	7	64292514	64292514	+	3'UTR	SNP	G	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64292514G>C	uc011kdp.1	+	5					ZNF138_uc003ttg.2_Missense_Mutation_p.Q241H|ZNF138_uc011kdq.1_Missense_Mutation_p.Q272H|ZNF138_uc003tth.2_RNA|ZNF138_uc010kzs.2_Missense_Mutation_p.Q266H	NM_001160183	NP_001153655	B4DFX2	B4DFX2_HUMAN	zinc finger protein 138 isoform 2						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding				0		Lung NSC(55;0.0795)|all_lung(88;0.18)				CTAAACATCAGATAATTTATA	0.353													15	43	---	---	---	---	PASS
CADPS2	93664	broad.mit.edu	37	7	122255280	122255280	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122255280T>C	uc010lkp.2	-	6	1341	c.1178A>G	c.(1177-1179)GAA>GGA	p.E393G	CADPS2_uc003vkg.3_Missense_Mutation_p.E93G|CADPS2_uc010lkq.2_Missense_Mutation_p.E393G	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	393	C2.				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TTTTTCTCCTTCCACTTCCAT	0.373													2	2	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41563760	41563760	+	Splice_Site	SNP	C	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41563760C>A	uc003xok.2	-	18	2083	c.1999_splice	c.e18-1	p.S667_splice	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Splice_Site|ANK1_uc003xoi.2_Splice_Site_p.S667_splice|ANK1_uc003xoj.2_Splice_Site_p.S667_splice|ANK1_uc003xol.2_Splice_Site_p.S667_splice|ANK1_uc003xom.2_Splice_Site_p.S700_splice	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TGAGTCCGCTCTGCAAAGAAA	0.438													18	27	---	---	---	---	PASS
XKR4	114786	broad.mit.edu	37	8	56436429	56436429	+	Silent	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56436429C>T	uc003xsf.2	+	3	1628	c.1596C>T	c.(1594-1596)GCC>GCT	p.A532A		NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related	532						integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)			AGGACCCAGCCGCTGCCTTCA	0.527													37	75	---	---	---	---	PASS
PRDM14	63978	broad.mit.edu	37	8	70964459	70964459	+	Silent	SNP	A	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70964459A>T	uc003xym.2	-	8	1771	c.1569T>A	c.(1567-1569)GGT>GGA	p.G523G		NM_024504	NP_078780	Q9GZV8	PRD14_HUMAN	PR domain containing 14	523	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			CAAAAGATTTACCACAGTACT	0.517													8	211	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139790622	139790622	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139790622C>T	uc003yvd.2	-	15	2179	c.1732G>A	c.(1732-1734)GGA>AGA	p.G578R		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	578	Pro-rich.|Gly-rich.|Collagen-like 3.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCAGGAGGTCCGGGGAGTCCA	0.547										HNSCC(7;0.00092)			17	49	---	---	---	---	PASS
ADAMTSL1	92949	broad.mit.edu	37	9	18776905	18776905	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18776905C>T	uc003zne.3	+	19	2805	c.2678C>T	c.(2677-2679)ACG>ATG	p.T893M		NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	893	Ig-like C2-type 1.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		CTCCCCAAGACGGCGGTGGTG	0.677													10	13	---	---	---	---	PASS
APBA1	320	broad.mit.edu	37	9	72071269	72071269	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72071269C>T	uc004ahh.2	-	8	1958	c.1682G>A	c.(1681-1683)CGG>CAG	p.R561Q		NM_001163	NP_001154	Q02410	APBA1_HUMAN	amyloid beta A4 precursor protein-binding,	561	PID.				axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle				lung(1)	1						AGGCATCCGCCGGCGGGCCAT	0.577													95	264	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7618411	7618411	+	Intron	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7618411C>T	uc001ijq.2	-						ITIH5_uc001ijp.2_Intron|ITIH5_uc001ijr.1_Intron	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain						hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						ACAGGTGCCTCGTACCTGGCT	0.652													4	5	---	---	---	---	PASS
C10orf79	80217	broad.mit.edu	37	10	105956648	105956648	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105956648T>C	uc001kxw.2	-	10	1372	c.1256A>G	c.(1255-1257)GAT>GGT	p.D419G	C10orf79_uc001kxx.3_Missense_Mutation_p.D420G|C10orf79_uc001kxy.1_Missense_Mutation_p.D420G	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN	hypothetical protein LOC80217	419	WD 6.										0		Colorectal(252;0.178)		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)		ACAAGCACAATCCTCCAGCCA	0.313													29	44	---	---	---	---	PASS
PPP2R2D	55844	broad.mit.edu	37	10	133769261	133769261	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133769261G>A	uc001lks.2	+	7	1300	c.1057G>A	c.(1057-1059)GAG>AAG	p.E353K	PPP2R2D_uc001lkr.2_Missense_Mutation_p.E159K|PPP2R2D_uc001lkt.2_Missense_Mutation_p.E159K|PPP2R2D_uc009yay.2_Missense_Mutation_p.E221K	NM_018461	NP_060931	Q66LE6	2ABD_HUMAN	protein phosphatase 2, regulatory subunit B,	386					cell division|exit from mitosis|mitosis|signal transduction	cytoplasm|protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			skin(1)	1		all_cancers(35;2.16e-12)|all_epithelial(44;2.77e-09)|Lung NSC(174;0.00237)|all_lung(145;0.00354)|Colorectal(31;0.0124)|Breast(234;0.023)|all_neural(114;0.0299)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.86e-05)|Epithelial(32;8.82e-05)|all cancers(32;0.000106)|BRCA - Breast invasive adenocarcinoma(275;0.21)		TGTGACCCTGGAGGCCTCGAG	0.562													13	51	---	---	---	---	PASS
MS4A13	503497	broad.mit.edu	37	11	60292711	60292711	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60292711G>A	uc001nps.2	+	5	541	c.218G>A	c.(217-219)TGC>TAC	p.C73Y	MS4A13_uc009ync.2_Intron|MS4A13_uc009ynd.2_Intron	NM_001012417	NP_001012417	Q5J8X5	M4A13_HUMAN	membrane-spanning 4-domains, subfamily A, member	73	Helical; (Potential).					integral to membrane					0						AACATCATCTGCATAATTACT	0.303													5	88	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6128535	6128535	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6128535G>A	uc001qnn.1	-	28	4299	c.4049C>T	c.(4048-4050)GCG>GTG	p.A1350V	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1350	VWFA 1; binding site for platelet glycoprotein Ib.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	CTGGCTGCCCGCATACTTCAC	0.622													20	63	---	---	---	---	PASS
TAS2R43	259289	broad.mit.edu	37	12	11244372	11244372	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11244372C>G	uc001qzq.1	-	1	541	c.457G>C	c.(457-459)GTG>CTG	p.V153L	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176884	NP_795365	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	153	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of bitter taste	cilium membrane|motile cilium	bitter taste receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TTTGTCCGCACAATCTCATTC	0.363													37	29	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13906449	13906449	+	Missense_Mutation	SNP	G	A	A	rs138098032	byFrequency	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13906449G>A	uc001rbt.2	-	3	991	c.812C>T	c.(811-813)GCG>GTG	p.A271V		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	271	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	GGGGAACTCCGCAGGCACTGT	0.542													21	36	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43925915	43925915	+	Missense_Mutation	SNP	G	T	T	rs80268015		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43925915G>T	uc010skx.1	-	3	537	c.537C>A	c.(535-537)CAC>CAA	p.H179Q		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	179						proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GTGGCTTGTTGTGACCATCTT	0.358													5	20	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57578215	57578215	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57578215G>A	uc001snd.2	+	38	6632	c.6166G>A	c.(6166-6168)GGC>AGC	p.G2056S		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	2056	LDL-receptor class B 19.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTGGCCCAACGGCATCTCAGT	0.597													28	58	---	---	---	---	PASS
ACACB	32	broad.mit.edu	37	12	109623483	109623483	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109623483A>G	uc001tob.2	+	12	2037	c.1918A>G	c.(1918-1920)AAC>GAC	p.N640D	ACACB_uc001toc.2_Missense_Mutation_p.N640D	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta	640	Biotin carboxylation.				acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	AACCCCCTCAAACCCTCCCCT	0.582													16	48	---	---	---	---	PASS
MLNR	2862	broad.mit.edu	37	13	49796301	49796301	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49796301C>A	uc010tgj.1	+	2	1027	c.1027C>A	c.(1027-1029)CTT>ATT	p.L343I		NM_001507	NP_001498	O43193	MTLR_HUMAN	motilin receptor	343	Helical; Name=7; (Potential).				digestion	integral to plasma membrane	growth hormone-releasing hormone receptor activity				0		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		CGCTCTGCAACTTTTCTATCT	0.463													90	132	---	---	---	---	PASS
IPO5	3843	broad.mit.edu	37	13	98622062	98622062	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98622062G>A	uc001vne.2	+	3	208	c.28G>A	c.(28-30)GAA>AAA	p.E10K		NM_002271	NP_002262	O00410	IPO5_HUMAN	importin 5	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					interspecies interaction between organisms|NLS-bearing substrate import into nucleus|ribosomal protein import into nucleus	cytoplasm|nuclear pore|nucleolus	GTPase inhibitor activity|protein transporter activity|Ran GTPase binding			ovary(1)|lung(1)|skin(1)	3						TGGAAAACTAGAAGCAACAGA	0.323													17	67	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108861175	108861175	+	Silent	SNP	T	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108861175T>A	uc001vqn.2	-	2	2715	c.2442A>T	c.(2440-2442)CGA>CGT	p.R814R	LIG4_uc001vqo.2_Silent_p.R814R|LIG4_uc010agg.1_Silent_p.R747R|LIG4_uc010agf.2_Silent_p.R814R|LIG4_uc001vqp.2_Silent_p.R814R	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	814	BRCT 2.				cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					CGGTGTGGCGTCGAAACATAC	0.418								NHEJ					28	68	---	---	---	---	PASS
RNF31	55072	broad.mit.edu	37	14	24619469	24619469	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24619469G>A	uc001wmn.1	+	7	1258	c.1009G>A	c.(1009-1011)GAG>AAG	p.E337K	RNF31_uc001wml.1_Missense_Mutation_p.E186K|RNF31_uc001wmm.1_Intron|RNF31_uc010alg.1_Missense_Mutation_p.E152K|RNF31_uc001wmo.1_5'Flank|RNF31_uc001wmp.2_5'Flank	NM_017999	NP_060469	Q96EP0	RNF31_HUMAN	ring finger protein 31	337	Polyubiquitin-binding.				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(265;0.00861)		GTTGGGAACTGAGGGTCCCCA	0.602													20	52	---	---	---	---	PASS
C14orf104	55172	broad.mit.edu	37	14	50100351	50100351	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50100351G>T	uc001wws.3	-	1	1598	c.1517C>A	c.(1516-1518)TCA>TAA	p.S506*	SDCCAG1_uc010anj.1_Intron|C14orf104_uc001wwt.3_Nonsense_Mutation_p.S506*	NM_018139	NP_060609	Q9NVR5	KTU_HUMAN	kintoun isoform 1	506					axonemal dynein complex assembly|ciliary cell motility|flagellar cell motility	cytoplasm					0	all_epithelial(31;0.0021)|Breast(41;0.0124)					GGCGCAGGCTGAGCGCTGGCC	0.622									Kartagener_syndrome				9	28	---	---	---	---	PASS
DACT1	51339	broad.mit.edu	37	14	59112964	59112964	+	Silent	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59112964G>A	uc001xdw.2	+	4	1787	c.1623G>A	c.(1621-1623)AAG>AAA	p.K541K	DACT1_uc010trv.1_Silent_p.K260K|DACT1_uc001xdx.2_Silent_p.K504K|DACT1_uc010trw.1_Silent_p.K260K	NM_016651	NP_057735	Q9NYF0	DACT1_HUMAN	dapper 1 isoform 1	541					multicellular organismal development|Wnt receptor signaling pathway	cytoplasm|nucleus				large_intestine(2)|lung(2)|ovary(1)	5						TGGATTTCAAGAGCGAGGGCT	0.627													39	90	---	---	---	---	PASS
EIF2S1	1965	broad.mit.edu	37	14	67850056	67850056	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67850056G>A	uc001xjg.2	+	8	988	c.847G>A	c.(847-849)GAG>AAG	p.E283K		NM_004094	NP_004085	P05198	IF2A_HUMAN	eukaryotic translation initiation factor 2,	283						cytosol|eukaryotic translation initiation factor 2 complex|polysome|stress granule	protein binding|ribosome binding|translation initiation factor activity			ovary(1)	1				all cancers(60;0.000683)|OV - Ovarian serous cystadenocarcinoma(108;0.00579)|BRCA - Breast invasive adenocarcinoma(234;0.00937)		AGATACAGATGAGACTGAACT	0.393													14	40	---	---	---	---	PASS
COQ6	51004	broad.mit.edu	37	14	74427970	74427970	+	Missense_Mutation	SNP	G	C	C	rs147273831	byFrequency	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74427970G>C	uc001xph.2	+	9	1066	c.986G>C	c.(985-987)CGC>CCC	p.R329P	ENTPD5_uc001xpi.2_Intron|COQ6_uc001xpe.2_Missense_Mutation_p.R254P|COQ6_uc001xpf.2_Missense_Mutation_p.R254P|COQ6_uc010tuk.1_Missense_Mutation_p.R304P|COQ6_uc001xpg.2_Missense_Mutation_p.R329P	NM_182476	NP_872282	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 homolog isoform a	329					ubiquinone biosynthetic process	mitochondrion	flavin adenine dinucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen				0				BRCA - Breast invasive adenocarcinoma(234;0.00337)		GTCTCGGCTCGCCAGCTGCCC	0.597													7	33	---	---	---	---	PASS
YLPM1	56252	broad.mit.edu	37	14	75265124	75265124	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75265124G>A	uc001xqj.3	+	5	3248	c.3124G>A	c.(3124-3126)GGC>AGC	p.G1042S	YLPM1_uc001xql.3_RNA	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	847	Arg-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CAGAGGTCGCGGCCAGGCAAT	0.483													4	109	---	---	---	---	PASS
FLVCR2	55640	broad.mit.edu	37	14	76045637	76045637	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76045637A>C	uc001xrs.2	+	1	698	c.322A>C	c.(322-324)ATC>CTC	p.I108L		NM_017791	NP_060261	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular	108	Helical; (Potential).				transmembrane transport	integral to membrane|plasma membrane	heme binding|heme transporter activity				0				BRCA - Breast invasive adenocarcinoma(234;0.029)		GTACGGCTCCATCAATAACAT	0.537													9	126	---	---	---	---	PASS
PAPOLA	10914	broad.mit.edu	37	14	96998947	96998947	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96998947C>G	uc001yfq.2	+	9	1007	c.797C>G	c.(796-798)TCA>TGA	p.S266*	PAPOLA_uc001yfp.2_Nonsense_Mutation_p.S266*|PAPOLA_uc001yfr.2_Nonsense_Mutation_p.S266*|PAPOLA_uc010twv.1_Nonsense_Mutation_p.S266*|PAPOLA_uc010avp.2_Nonsense_Mutation_p.S16*	NM_032632	NP_116021	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	266					mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding				0		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		GCAATAGCATCAACTCTTGTA	0.328													6	153	---	---	---	---	PASS
CYFIP1	23191	broad.mit.edu	37	15	22990123	22990123	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22990123C>T	uc001yus.2	+	24	2847	c.2743C>T	c.(2743-2745)CAA>TAA	p.Q915*	CYFIP1_uc001yut.2_Nonsense_Mutation_p.Q915*|CYFIP1_uc010aya.1_Nonsense_Mutation_p.Q943*|CYFIP1_uc001yuu.2_Nonsense_Mutation_p.Q484*|CYFIP1_uc001yuv.2_Nonsense_Mutation_p.Q109*	NM_014608	NP_055423	Q7L576	CYFP1_HUMAN	cytoplasmic FMR1 interacting protein 1 isoform	915					axon extension|lamellipodium assembly|regulation of cell shape|ruffle organization	cell junction|lamellipodium|mRNA cap binding complex|perinuclear region of cytoplasm|ruffle|synapse|synaptosome	actin filament binding|Rac GTPase binding			ovary(4)|pancreas(3)|liver(1)|skin(1)	9		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		TCCACACTTTCAAGTCATCTG	0.562													33	72	---	---	---	---	PASS
SEMA4B	10509	broad.mit.edu	37	15	90767093	90767093	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90767093C>G	uc002boy.2	+	10	1350	c.1067C>G	c.(1066-1068)TCT>TGT	p.S356C	SEMA4B_uc002boz.2_Missense_Mutation_p.S356C|SEMA4B_uc010uqd.1_Missense_Mutation_p.S194C|SEMA4B_uc002bpa.2_Missense_Mutation_p.S194C|SEMA4B_uc010bnv.1_5'UTR	NM_020210	NP_064595			semaphorin 4B precursor											ovary(1)|breast(1)|kidney(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			ACAGAAGGCTCTGCCGTCTGT	0.572													14	34	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21147833	21147833	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21147833C>T	uc010vbe.1	-	6	698	c.698G>A	c.(697-699)AGA>AAA	p.R233K	DNAH3_uc002die.2_Missense_Mutation_p.R204K	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	233	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		GTAATAGTATCTCTTCCATAA	0.458													44	89	---	---	---	---	PASS
VWA3A	146177	broad.mit.edu	37	16	22126785	22126785	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22126785G>A	uc010vbq.1	+	9	903	c.807G>A	c.(805-807)ATG>ATA	p.M269I	VWA3A_uc010bxc.2_Missense_Mutation_p.M256I	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	269						extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		TGGCCATCATGAGAAGCTGGT	0.448													8	12	---	---	---	---	PASS
BCKDK	10295	broad.mit.edu	37	16	31123215	31123215	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31123215G>A	uc002eaw.3	+	11	1277	c.961G>A	c.(961-963)GCT>ACT	p.A321T	BCKDK_uc002eav.3_Missense_Mutation_p.A321T|BCKDK_uc010cah.2_RNA|BCKDK_uc010cai.2_Missense_Mutation_p.A291T	NM_005881	NP_005872	O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	321	Histidine kinase.				branched chain family amino acid catabolic process|peptidyl-histidine phosphorylation	mitochondrial alpha-ketoglutarate dehydrogenase complex	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity|ATP binding|protein binding|protein serine/threonine kinase activity|two-component sensor activity			stomach(1)|breast(1)	2						TGGAGGAATCGCTCACAAAGA	0.567													4	111	---	---	---	---	PASS
GPT2	84706	broad.mit.edu	37	16	46943727	46943727	+	Silent	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46943727C>T	uc002eel.2	+	6	802	c.708C>T	c.(706-708)GAC>GAT	p.D236D	GPT2_uc002eem.2_Silent_p.D136D	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase 2 isoform 1	236					2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	ACTACCTGGACGAGGAGAACT	0.552													44	107	---	---	---	---	PASS
EFTUD2	9343	broad.mit.edu	37	17	42930947	42930947	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42930947G>A	uc002ihn.2	-	24	2665	c.2404C>T	c.(2404-2406)CAC>TAC	p.H802Y	EFTUD2_uc010wje.1_Missense_Mutation_p.H767Y|EFTUD2_uc010wjf.1_Missense_Mutation_p.H792Y	NM_004247	NP_004238	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain	802						Cajal body|catalytic step 2 spliceosome|cytoplasm|nuclear speck	GTP binding|GTPase activity|protein binding			ovary(1)	1		Prostate(33;0.109)				CCGCCCCGGTGCAGGGGCTCC	0.592													19	45	---	---	---	---	PASS
RSAD1	55316	broad.mit.edu	37	17	48559580	48559580	+	Silent	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48559580G>A	uc002iqw.1	+	4	659	c.603G>A	c.(601-603)CCG>CCA	p.P201P	RSAD1_uc010wmq.1_RNA	NM_018346	NP_060816	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing	201					porphyrin biosynthetic process	mitochondrion	4 iron, 4 sulfur cluster binding|coproporphyrinogen oxidase activity|metal ion binding				0	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			TGGGGCTGCCGGCACAGCAGG	0.687											OREG0024567	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	32	---	---	---	---	PASS
BCAS3	54828	broad.mit.edu	37	17	59155836	59155836	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59155836C>T	uc002iyv.3	+	22	2427	c.2318C>T	c.(2317-2319)ACG>ATG	p.T773M	BCAS3_uc002iyu.3_Missense_Mutation_p.T758M|BCAS3_uc002iyw.3_Missense_Mutation_p.T754M|BCAS3_uc002iyy.3_Missense_Mutation_p.T529M|BCAS3_uc002iyz.3_Missense_Mutation_p.T327M|BCAS3_uc002iza.3_Missense_Mutation_p.T312M	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1	773						nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			CCGAGTGACACGCCACAGCCT	0.433													14	50	---	---	---	---	PASS
INTS2	57508	broad.mit.edu	37	17	59945364	59945364	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59945364G>A	uc002izn.2	-	24	3351	c.3275C>T	c.(3274-3276)ACA>ATA	p.T1092I	INTS2_uc002izm.2_Missense_Mutation_p.T1084I	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	1092					snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3						CTTAGCCTGTGTTAAAACTGT	0.313													8	23	---	---	---	---	PASS
CSH2	1443	broad.mit.edu	37	17	61950693	61950693	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61950693C>T	uc002jch.2	-	2	132	c.17G>A	c.(16-18)CGG>CAG	p.R6Q	CSH2_uc002jcg.2_Missense_Mutation_p.R6Q|CSH2_uc002jci.2_Missense_Mutation_p.R6Q|GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Missense_Mutation_p.R6Q	NM_020991	NP_066271	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 2 isoform 1	6					female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding				0						CAGGGACGTCCGGGAGCCTGG	0.607													6	30	---	---	---	---	PASS
ITGB4	3691	broad.mit.edu	37	17	73738775	73738775	+	Silent	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73738775C>T	uc002jpg.2	+	25	3082	c.2895C>T	c.(2893-2895)ATC>ATT	p.I965I	ITGB4_uc002jph.2_Silent_p.I965I|ITGB4_uc002jpi.3_Silent_p.I965I|ITGB4_uc010dgp.1_3'UTR|ITGB4_uc002jpj.2_Silent_p.I965I	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor	965	Cytoplasmic (Potential).				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGGAGGCCATCGACGTGCCCG	0.592													11	22	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8380408	8380408	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8380408G>A	uc002knn.3	+	27	4365	c.3862G>A	c.(3862-3864)GAT>AAT	p.D1288N	PTPRM_uc010dkv.2_Missense_Mutation_p.D1301N|PTPRM_uc010wzl.1_Missense_Mutation_p.D1075N	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1288	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				TATGCTAAATGATGTGGATCC	0.463													32	63	---	---	---	---	PASS
KDSR	2531	broad.mit.edu	37	18	61002600	61002600	+	Intron	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61002600G>A	uc010dpw.2	-						KDSR_uc010xem.1_Intron	NM_002035	NP_002026	Q06136	KDSR_HUMAN	3-ketodihydrosphingosine reductase precursor						3-keto-sphinganine metabolic process	endoplasmic reticulum membrane|extracellular space|integral to membrane	3-dehydrosphinganine reductase activity|binding			skin(1)	1						TGCTAAAAGAGAAGAAAAAGA	0.448													16	41	---	---	---	---	PASS
ZNF14	7561	broad.mit.edu	37	19	19822160	19822160	+	3'UTR	SNP	C	G	G			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19822160C>G	uc002nnk.1	-	4						NM_021030	NP_066358	P17017	ZNF14_HUMAN	zinc finger protein 14						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Renal(1328;0.0474)				TGCTTATATTCTTAGACTTTC	0.398													33	87	---	---	---	---	PASS
C19orf46	163183	broad.mit.edu	37	19	36499193	36499193	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36499193C>A	uc002ocq.1	-	2	294	c.205G>T	c.(205-207)GAG>TAG	p.E69*	C19orf46_uc002ocr.1_Nonsense_Mutation_p.E69*|C19orf46_uc002ocs.1_Nonsense_Mutation_p.E69*|C19orf46_uc010een.1_Intron	NM_001039876	NP_001034965	Q8N205	SYNE4_HUMAN	hypothetical protein LOC163183	69	Cytoplasmic (Potential).				establishment of epithelial cell apical/basal polarity	integral to nuclear outer membrane	actin binding			ovary(1)	1	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCGGCAGGCTCATTGCCCCTT	0.657													6	49	---	---	---	---	PASS
ZNF665	79788	broad.mit.edu	37	19	53669025	53669025	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53669025C>T	uc010eqm.1	-	4	818	c.718G>A	c.(718-720)GGA>AGA	p.G240R		NM_024733	NP_079009	Q9H7R5	ZN665_HUMAN	zinc finger protein 665	175	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(134;0.0196)		AAGACCTTTCCACATTCATTA	0.408													6	258	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16486496	16486496	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16486496C>T	uc002wpg.1	-	9	1029	c.871G>A	c.(871-873)GAT>AAT	p.D291N	KIF16B_uc010gch.1_Missense_Mutation_p.D291N|KIF16B_uc010gci.1_Missense_Mutation_p.D291N|KIF16B_uc010gcj.1_Missense_Mutation_p.D291N	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	291	Kinesin-motor.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						TGAGATAAATCAGCTATGAAA	0.358													15	18	---	---	---	---	PASS
SNTA1	6640	broad.mit.edu	37	20	32000556	32000556	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32000556T>C	uc002wzd.1	-	4	1006	c.734A>G	c.(733-735)GAC>GGC	p.D245G	SNTA1_uc010zuf.1_Missense_Mutation_p.D245G	NM_003098	NP_003089	Q13424	SNTA1_HUMAN	acidic alpha 1 syntrophin	245	PH 1.				muscle contraction	cell junction|cytoplasm|cytoskeleton|sarcolemma	actin binding|calmodulin binding			skin(1)	1						GAAGAGGGTGTCTTGACCATC	0.597													13	27	---	---	---	---	PASS
GSS	2937	broad.mit.edu	37	20	33539596	33539596	+	Silent	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33539596C>T	uc002xbg.2	-	2	140	c.60G>A	c.(58-60)CGG>CGA	p.R20R	GSS_uc010zuo.1_Silent_p.R20R|GSS_uc010zup.1_5'UTR|GSS_uc002xbh.2_RNA|GSS_uc010gez.1_5'UTR	NM_000178	NP_000169	P48637	GSHB_HUMAN	glutathione synthetase	20					nervous system development|response to oxidative stress|xenobiotic metabolic process	cytosol	ATP binding|glutathione binding|glutathione synthase activity|magnesium ion binding|protein homodimerization activity			ovary(3)	3			BRCA - Breast invasive adenocarcinoma(18;0.035)		Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)	CCACGGCCTGCCGTGCCAGCT	0.592													4	97	---	---	---	---	PASS
EIF6	3692	broad.mit.edu	37	20	33868487	33868487	+	Nonsense_Mutation	SNP	G	T	T	rs138400954	byFrequency	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33868487G>T	uc002xbv.1	-	3	555	c.339C>A	c.(337-339)TAC>TAA	p.Y113*	EDEM2_uc010zuv.1_5'Flank|EIF6_uc002xbx.1_Nonsense_Mutation_p.Y113*|EIF6_uc002xbz.1_Intron|EIF6_uc002xby.1_Intron	NM_181468	NP_852133	P56537	IF6_HUMAN	eukaryotic translation initiation factor 6	113					mature ribosome assembly	cytoplasm|nucleolus	protein binding|ribosome binding|translation initiation factor activity			pancreas(1)	1			BRCA - Breast invasive adenocarcinoma(18;0.00252)			CCAAGGCCACGTAGTCATTGC	0.577													3	72	---	---	---	---	PASS
CTNNBL1	56259	broad.mit.edu	37	20	36470756	36470756	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36470756G>C	uc010zvw.1	+	14	1418	c.1327G>C	c.(1327-1329)GAG>CAG	p.E443Q	CTNNBL1_uc002xhh.2_Missense_Mutation_p.E256Q|CTNNBL1_uc002xhi.2_RNA|CTNNBL1_uc002xhj.2_Missense_Mutation_p.E191Q	NM_030877	NP_110517	Q8WYA6	CTBL1_HUMAN	beta catenin-like 1	443					apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)				CAGACTAATGGAGTTGCATTT	0.448													23	66	---	---	---	---	PASS
JPH2	57158	broad.mit.edu	37	20	42815230	42815230	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42815230G>A	uc002xli.1	-	1	989	c.116C>T	c.(115-117)TCT>TTT	p.S39F	JPH2_uc002xlj.2_Missense_Mutation_p.S39F	NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1	39	Gly-rich.|Cytoplasmic (Potential).|MORN 2.				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CCAGGAGCCAGAGTATTCGCC	0.617													13	51	---	---	---	---	PASS
TUBB1	81027	broad.mit.edu	37	20	57598816	57598816	+	Silent	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57598816C>T	uc002yak.2	+	4	603	c.334C>T	c.(334-336)CTG>TTG	p.L112L		NM_030773	NP_110400	Q9H4B7	TBB1_HUMAN	beta tubulin 1, class VI	112					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity			ovary(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)		Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	GGGAGCCGAGCTGATCGAGAA	0.592													50	115	---	---	---	---	PASS
KREMEN1	83999	broad.mit.edu	37	22	29534802	29534802	+	Silent	SNP	T	G	G			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29534802T>G	uc011akm.1	+	7	1168	c.1155T>G	c.(1153-1155)GCT>GCG	p.A385A	KREMEN1_uc003ael.2_Intron|KREMEN1_uc011akn.1_Silent_p.A268A	NM_032045	NP_114434	Q96MU8	KREM1_HUMAN	kringle-containing transmembrane protein 1	383	Extracellular (Potential).				cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5						CCATGGGGGCTGGAAGCCACA	0.552													8	43	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32398806	32398806	+	Intron	SNP	A	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32398806A>T	uc004dda.1	-						DMD_uc004dcw.2_Intron|DMD_uc004dcx.2_Intron|DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ACCTGAAAAGAATTATAATGA	0.299													3	33	---	---	---	---	PASS
UXT	8409	broad.mit.edu	37	X	47517273	47517273	+	Intron	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47517273G>A	uc004din.2	-						UXT_uc004dim.2_Intron|LOC100133957_uc011mls.1_5'Flank|LOC100133957_uc011mlt.1_5'Flank	NM_004182	NP_004173	Q9UBK9	UXT_HUMAN	ubiquitously-expressed transcript isoform 2						centrosome organization|mitochondrion transport along microtubule|protein folding	centrosome|nucleus|prefoldin complex	beta-tubulin binding|microtubule binding|unfolded protein binding				0						CTGATGGGACGAAAGTACAAT	0.463													3	58	---	---	---	---	PASS
CLCN5	1184	broad.mit.edu	37	X	49837244	49837244	+	Splice_Site	SNP	G	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49837244G>T	uc004dos.1	+	3	453	c.205_splice	c.e3+1	p.G69_splice	CLCN5_uc004dor.1_Splice_Site_p.G139_splice|CLCN5_uc004doq.1_Splice_Site_p.G139_splice|CLCN5_uc004dot.1_Splice_Site_p.G69_splice	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b						excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					CTTTTATCAGGTATGGTAAAC	0.308													4	126	---	---	---	---	PASS
SSX7	280658	broad.mit.edu	37	X	52681347	52681347	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52681347G>T	uc004dqx.1	-	4	394	c.235C>A	c.(235-237)CTC>ATC	p.L79I		NM_173358	NP_775494	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	79	KRAB-related.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding			skin(1)	1	Ovarian(276;0.236)					TTCCCCTGGAGGTCTGTGGCC	0.488													52	189	---	---	---	---	PASS
FOXO4	4303	broad.mit.edu	37	X	70321381	70321381	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70321381T>C	uc004dys.1	+	2	1654	c.1301T>C	c.(1300-1302)ATA>ACA	p.I434T	FOXO4_uc010nkz.2_Intron|FOXO4_uc004dyt.1_Missense_Mutation_p.I379T	NM_005938	NP_005929	P98177	FOXO4_HUMAN	forkhead box O4	434					cell cycle arrest|cell differentiation|embryo development|G1 phase of mitotic cell cycle|insulin receptor signaling pathway|mitotic cell cycle G2/M transition DNA damage checkpoint|muscle organ development|negative regulation of angiogenesis|negative regulation of cell proliferation|negative regulation of smooth muscle cell differentiation|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			central_nervous_system(2)|prostate(1)	3	Renal(35;0.156)					CTTTCTATGATAGCACCACCT	0.617													14	89	---	---	---	---	PASS
MAGT1	84061	broad.mit.edu	37	X	77150816	77150816	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77150816C>A	uc004fof.2	-	1	250	c.188G>T	c.(187-189)AGA>ATA	p.R63I	MAGT1_uc004fog.3_RNA|MAGT1_uc004ect.3_Missense_Mutation_p.R63I	NM_032121	NP_115497	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	31					protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				upper_aerodigestive_tract(1)	1						CTCCTTCTTTCTTTGGGCAGA	0.587													20	80	---	---	---	---	PASS
BTK	695	broad.mit.edu	37	X	100609655	100609655	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100609655G>C	uc004ehg.2	-	16	1787	c.1594C>G	c.(1594-1596)CAA>GAA	p.Q532E	BTK_uc004ehf.2_Missense_Mutation_p.Q32E|BTK_uc010nnh.2_Intron|BTK_uc010nni.2_Intron|BTK_uc004ehe.2_RNA|BTK_uc010nnj.2_Intron|BTK_uc010nnk.2_Intron|BTK_uc010nnl.2_Intron|BTK_uc010nnm.2_Missense_Mutation_p.Q102E|BTK_uc010nnn.2_Missense_Mutation_p.Q356E|BTK_uc010nno.2_Missense_Mutation_p.Q566E|BTK_uc004ehh.1_RNA	NM_000061	NP_000052	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	532	Protein kinase.				calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding			lung(3)|central_nervous_system(2)|ovary(1)	6						ACAACTCCTTGATCGTTTACC	0.463									Agammaglobulinemia_X-linked				14	451	---	---	---	---	PASS
GUCY2F	2986	broad.mit.edu	37	X	108673542	108673542	+	Silent	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108673542G>A	uc004eod.3	-	8	2061	c.1785C>T	c.(1783-1785)TTC>TTT	p.F595F	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	595	Protein kinase.|Cytoplasmic (Potential).				intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			lung(4)|breast(3)|central_nervous_system(1)	8						ATACCATTTCGAACACATCAC	0.388													257	321	---	---	---	---	PASS
LONRF3	79836	broad.mit.edu	37	X	118108738	118108738	+	5'UTR	SNP	C	G	G			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118108738C>G	uc004eqw.2	+	1					LONRF3_uc004eqx.2_5'UTR|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_5'Flank	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger						proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)	2						CCGTGTCCCTCTTCCCATGGA	0.652													17	9	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118222151	118222151	+	Silent	SNP	C	G	G			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118222151C>G	uc004era.3	-	11	3042	c.3042G>C	c.(3040-3042)GTG>GTC	p.V1014V		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	1014										ovary(4)|skin(1)	5						GTAGTGGCTCCACAGAAATGA	0.458													76	131	---	---	---	---	PASS
ENOX2	10495	broad.mit.edu	37	X	129769012	129769012	+	Silent	SNP	T	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129769012T>C	uc004evw.2	-	13	1870	c.1452A>G	c.(1450-1452)AAA>AAG	p.K484K	ENOX2_uc004evx.2_Silent_p.K455K|ENOX2_uc004evy.2_Silent_p.K455K|ENOX2_uc004evv.2_Silent_p.K309K	NM_182314	NP_872114	Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2 isoform b	484	Potential.				cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1						CATCTTTGAGTTTTTCAAGTT	0.363													31	41	---	---	---	---	PASS
HTATSF1	27336	broad.mit.edu	37	X	135582899	135582899	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135582899G>C	uc004ezw.2	+	5	914	c.492G>C	c.(490-492)CAG>CAC	p.Q164H	HTATSF1_uc004ezx.2_Missense_Mutation_p.Q164H	NM_001163280	NP_001156752	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	164	RRM 1.				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					GAGATCCTCAGACAGAAGAAT	0.308													150	191	---	---	---	---	PASS
UBE2NL	389898	broad.mit.edu	37	X	142967284	142967284	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142967284G>A	uc004fca.2	+	1	112	c.82G>A	c.(82-84)GAT>AAT	p.D28N		NM_001012989	NP_001013007	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like	28							acid-amino acid ligase activity				0	Acute lymphoblastic leukemia(192;6.56e-05)					AGCAGAACCAGATGAAAGCAA	0.507													47	173	---	---	---	---	PASS
ZNF185	7739	broad.mit.edu	37	X	152135716	152135716	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152135716G>A	uc010ntv.1	+	20	1839	c.1802G>A	c.(1801-1803)AGC>AAC	p.S601N	ZNF185_uc011myg.1_Missense_Mutation_p.S633N|ZNF185_uc011myh.1_Missense_Mutation_p.S604N|ZNF185_uc011myi.1_Missense_Mutation_p.S572N|ZNF185_uc011myj.1_Missense_Mutation_p.S542N|ZNF185_uc011myk.1_Missense_Mutation_p.S602N|ZNF185_uc004fgw.3_Missense_Mutation_p.S380N|ZNF185_uc004fgu.2_Missense_Mutation_p.S230N|ZNF185_uc004fgv.2_Missense_Mutation_p.S298N|ZNF185_uc004fgx.2_Missense_Mutation_p.S239N	NM_007150	NP_009081	O15231	ZN185_HUMAN	zinc finger protein 185	601						cytoplasm|cytoskeleton|focal adhesion	zinc ion binding			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TGCAGCGTCAGCAGCATTGAG	0.478													8	126	---	---	---	---	PASS
MAGEA1	4100	broad.mit.edu	37	X	152482140	152482140	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152482140G>A	uc004fhf.2	-	3	1091	c.871C>T	c.(871-873)CGC>TGC	p.R291C		NM_004988	NP_004979	P43355	MAGA1_HUMAN	melanoma antigen family A, 1	291	MAGE.					cytoplasm|plasma membrane				central_nervous_system(7)|ovary(1)|lung(1)|breast(1)	10	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AAGAAAAAGCGAACTCTTGCA	0.557													68	223	---	---	---	---	PASS
HCFC1	3054	broad.mit.edu	37	X	153217996	153217996	+	Silent	SNP	C	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153217996C>T	uc004fjp.2	-	19	5439	c.4911G>A	c.(4909-4911)GCG>GCA	p.A1637A		NM_005334	NP_005325	P51610	HCFC1_HUMAN	host cell factor 1	1637					cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)	2	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCTGGAGCACCGCCTGGATGG	0.721													7	21	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	4235523	4235523	+	IGR	DEL	G	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4235523delG								LOC100133612 (401646 upstream) : LOC284661 (236588 downstream)																							TTTTTTTTTTGCCCGTCTCAG	0.343													4	2	---	---	---	---	
OTUD3	23252	broad.mit.edu	37	1	20234066	20234069	+	Frame_Shift_Del	DEL	ACAA	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20234066_20234069delACAA	uc001bcs.3	+	8	1143_1146	c.1024_1027delACAA	c.(1024-1029)ACAAACfs	p.T342fs		NM_015207	NP_056022	Q5T2D3	OTUD3_HUMAN	OTU domain containing 3	342_343											0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CTCTCAGGTCACAAACAAACAGAG	0.564													51	25	---	---	---	---	
KCNQ4	9132	broad.mit.edu	37	1	41287851	41287852	+	Intron	INS	-	G	G	rs143138349	by1000genomes	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41287851_41287852insG	uc001cgh.1	+						KCNQ4_uc001cgi.1_Intron	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein						sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)			TGTCAGTGGCTGTGGAATTGGA	0.386													5	3	---	---	---	---	
AMY1A	276	broad.mit.edu	37	1	104202832	104202833	+	Intron	DEL	TA	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104202832_104202833delTA	uc001duu.2	+						AMY1A_uc001duv.2_Intron	NM_001008221	NP_001008222	P04745	AMY1_HUMAN	salivary amylase alpha 1A precursor						carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding|protein binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		tgtgtgtgtgtATATATATATA	0.233													4	2	---	---	---	---	
AIDA	64853	broad.mit.edu	37	1	222876705	222876706	+	Intron	INS	-	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222876705_222876706insA	uc001hnn.2	-						AIDA_uc001hno.2_Intron|AIDA_uc010pus.1_Intron	NM_022831	NP_073742	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated						dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity						0						AAATTCTTCTCAAAAAAAAAAA	0.272													6	3	---	---	---	---	
SIPA1L2	57568	broad.mit.edu	37	1	232601294	232601295	+	Intron	DEL	AT	-	-	rs34645211		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232601294_232601295delAT	uc001hvg.2	-							NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				acatacacacatacacacacac	0.218													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	86639203	86639206	+	IGR	DEL	TCTT	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86639203_86639206delTCTT								REEP1 (74426 upstream) : KDM3A (29065 downstream)																							GCTTGCTTGCtctttctttctttc	0.064													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	32975243	32975244	+	IGR	INS	-	A	A	rs78314440		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32975243_32975244insA								TRIM71 (41473 upstream) : CCR4 (17822 downstream)																							gcaagactctgaaaaaaaaaaa	0.020													4	2	---	---	---	---	
RBM5	10181	broad.mit.edu	37	3	50142739	50142740	+	Intron	INS	-	A	A	rs77605143		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50142739_50142740insA	uc003cyg.2	+						RBM5_uc011bdj.1_Intron|RBM5_uc011bdk.1_Intron	NM_005778	NP_005769	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptosis|negative regulation of cell proliferation|positive regulation of apoptosis|regulation of alternative nuclear mRNA splicing, via spliceosome|spliceosome assembly	nucleoplasm|spliceosomal complex	DNA binding|mRNA binding|nucleotide binding|protein binding|zinc ion binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		tactcCGTCTCAAAAAAAAAAA	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	76852584	76852585	+	IGR	INS	-	AGGAAGGATGGAGGGAAGGA	AGGAAGGATGGAGGGAAGGA	rs150717502	by1000genomes	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:76852584_76852585insAGGAAGGATGGAGGGAAGGA								None (None upstream) : ROBO2 (236709 downstream)																							TACAAAAGAGGaggaaggatgg	0.025													5	7	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149374544	149374551	+	Intron	DEL	TCTCTCTT	-	-	rs10665547		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374544_149374551delTCTCTCTT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_5'Flank|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ACGCACCAtctctctctttctctctctc	0.365													4	3	---	---	---	---	
YEATS2	55689	broad.mit.edu	37	3	183440066	183440066	+	Intron	DEL	C	-	-	rs151175192		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183440066delC	uc003fly.2	+							NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			gaaaccaaatctttttttttt	0.050													23	10	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195494382	195494384	+	Intron	DEL	CAC	-	-	rs72326391		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195494382_195494384delCAC	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ccaccaccatcaccatcaccacc	0.000													13	6	---	---	---	---	
WDR53	348793	broad.mit.edu	37	3	196281881	196281882	+	Intron	INS	-	AGGTAGAATTA	AGGTAGAATTA	rs147559216	by1000genomes	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196281881_196281882insAGGTAGAATTA	uc003fwt.2	-							NM_182627	NP_872433	Q7Z5U6	WDR53_HUMAN	WD repeat domain 53											breast(1)|skin(1)	2	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.6e-23)|all cancers(36;1.54e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.29e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		AGAGTGCGGTTAGGTAGAATTA	0.371													14	7	---	---	---	---	
FST	10468	broad.mit.edu	37	5	52779635	52779635	+	Intron	DEL	G	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:52779635delG	uc003jpd.2	+						FST_uc003jpc.2_Intron	NM_013409	NP_037541	P19883	FST_HUMAN	follistatin isoform FST344 precursor						hemopoietic progenitor cell differentiation|negative regulation of activin receptor signaling pathway|negative regulation of follicle-stimulating hormone secretion|negative regulation of transcription from RNA polymerase II promoter|positive regulation of hair follicle development	extracellular region	activin binding|protein binding|signal transducer activity				0		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				GAAGACCCTTGGGGGATGGTG	0.448													4	2	---	---	---	---	
FAM114A2	10827	broad.mit.edu	37	5	153382738	153382738	+	Intron	DEL	T	-	-	rs555490	by1000genomes	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153382738delT	uc003lvb.2	-						FAM114A2_uc003lvc.2_Intron|FAM114A2_uc003lvd.2_Intron|FAM114A2_uc003lve.2_Intron|FAM114A2_uc011dda.1_Intron	NM_018691	NP_061161	Q9NRY5	F1142_HUMAN	hypothetical protein LOC10827								purine nucleotide binding				0						TAATTGGTAGTAttttttttt	0.194													4	3	---	---	---	---	
NOP16	51491	broad.mit.edu	37	5	175814066	175814069	+	Intron	DEL	TCTC	-	-	rs145796794		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175814066_175814069delTCTC	uc011dfl.1	-						NOP16_uc003med.2_Intron|NOP16_uc003mee.2_Intron|NOP16_uc011dfm.1_Intron|HIGD2A_uc003meg.2_5'Flank	NM_016391	NP_057475	Q9Y3C1	NOP16_HUMAN	NOP16 nucleolar protein homolog							nucleolus				ovary(1)|central_nervous_system(1)	2						GGAGGCTTTTTCTCTCTCtctctc	0.245													2	4	---	---	---	---	
NOTCH4	4855	broad.mit.edu	37	6	32187669	32187669	+	Intron	DEL	A	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32187669delA	uc003obb.2	-						NOTCH4_uc011dpu.1_Intron|NOTCH4_uc011dpv.1_Intron|NOTCH4_uc003obc.2_Intron	NM_004557	NP_004548	Q99466	NOTC4_HUMAN	notch4 preproprotein						cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						AGACGAGACCAAATTGGGGAA	0.562													4	2	---	---	---	---	
GSTA4	2941	broad.mit.edu	37	6	52847699	52847702	+	Intron	DEL	GAGC	-	-	rs72138999	by1000genomes	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52847699_52847702delGAGC	uc003pbc.2	-						GSTA4_uc003pbd.2_Intron|GSTA4_uc003pbe.2_Intron|GSTA4_uc003pbf.2_Intron	NM_001512	NP_001503	O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4						glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity|protein homodimerization activity				0	Lung NSC(77;0.103)				Glutathione(DB00143)	gagagagagagagcgagagagaga	0.260													4	3	---	---	---	---	
DPY19L2P2	349152	broad.mit.edu	37	7	102815705	102815706	+	3'UTR	INS	-	T	T	rs7796853		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102815705_102815706insT	uc003vbh.3	-	21					DPY19L2P2_uc003vbg.3_RNA|DPY19L2P2_uc010lit.2_RNA	NR_003561				RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						ATCAAGttttgttttttttttt	0.203													4	2	---	---	---	---	
ATP6V0A4	50617	broad.mit.edu	37	7	138456146	138456146	+	Intron	DEL	T	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138456146delT	uc003vuf.2	-						ATP6V0A4_uc003vug.2_Intron|ATP6V0A4_uc003vuh.2_Intron	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit						cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						TTTAGGAGACttttttttttt	0.139													10	5	---	---	---	---	
EXT1	2131	broad.mit.edu	37	8	119108892	119108919	+	Intron	DEL	AGGAAGGAAGGAAGGAAGGAAGGGAGGG	-	-	rs72195120		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:119108892_119108919delAGGAAGGAAGGAAGGAAGGAAGGGAGGG	uc003yok.1	-							NM_000127	NP_000118	Q16394	EXT1_HUMAN	exostosin 1						glycosaminoglycan biosynthetic process|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|ossification|signal transduction|skeletal system development	Golgi membrane|integral to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|heparan sulfate N-acetylglucosaminyltransferase activity|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|lung(2)	4	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			gaaggaaggaaggaaggaaggaaggaaggaagggagggagggagggag	0.079			Mis|N|F|S			exostoses|osteosarcoma			Hereditary_Multiple_Exostoses|Langer-Giedion_syndrome				3	5	---	---	---	---	
PLEC	5339	broad.mit.edu	37	8	145018740	145018741	+	Intron	INS	-	CAGCCC	CAGCCC	rs145989270	by1000genomes	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145018740_145018741insCAGCCC	uc003zaf.1	-						PLEC_uc003zac.1_5'Flank|PLEC_uc003zad.2_5'Flank|PLEC_uc003zae.1_Intron|PLEC_uc003zag.1_Intron|PLEC_uc003zah.2_Intron|PLEC_uc003zaj.2_Intron	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1						cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GCCTCCAGCCTCAGCCCCAGCC	0.663													4	4	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8331407	8331416	+	Intron	DEL	TTATTTTCAC	-	-	rs10976963		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331407_8331416delTTATTTTCAC	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTTCCTCTGATTATTTTCACTTATTTTCAC	0.276										TSP Lung(15;0.13)			4	2	---	---	---	---	
IARS	3376	broad.mit.edu	37	9	94984623	94984623	+	Intron	DEL	A	-	-	rs71511611		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94984623delA	uc004art.1	-						IARS_uc004ars.1_Intron|IARS_uc004aru.3_Intron|IARS_uc010mqr.2_Intron	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	actcagtctcaaaaaaaaaaa	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42378913	42378913	+	IGR	DEL	C	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42378913delC								None (None upstream) : LOC441666 (448402 downstream)																							ccattcctttcctttccattc	0.000													4	4	---	---	---	---	
C10orf71	118461	broad.mit.edu	37	10	50534969	50534970	+	Frame_Shift_Ins	INS	-	ACAC	ACAC	rs66701434		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50534969_50534970insACAC	uc010qgp.1	+	4	2407_2408	c.2068_2069insACAC	c.(2068-2070)AACfs	p.N690fs		NM_199459	NP_955629	Q711Q0	CJ071_HUMAN	hypothetical protein LOC118461 isoform 2	690											0						CAAAACAAGCAacacacacaca	0.406													4	2	---	---	---	---	
HERC4	26091	broad.mit.edu	37	10	69705574	69705578	+	Intron	DEL	AACAT	-	-	rs35496892		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69705574_69705578delAACAT	uc001jng.3	-						HERC4_uc009xpq.2_Intron|HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3						caaatcaaaaaacatacgacagata	0.000													4	2	---	---	---	---	
TMEM9B	56674	broad.mit.edu	37	11	8975054	8975054	+	Intron	DEL	A	-	-	rs3833779		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8975054delA	uc001mhe.1	-						TMEM9B_uc001mhf.1_Intron|TMEM9B_uc010rbt.1_Intron	NM_020644	NP_065695	Q9NQ34	TMM9B_HUMAN	TMEM9 domain family, member B precursor						positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	signal transducer activity				0				Epithelial(150;4.39e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0237)		ATTATTTAAGAAAAAAAGAGG	0.353													4	6	---	---	---	---	
FNBP4	23360	broad.mit.edu	37	11	47786588	47786589	+	Intron	INS	-	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47786588_47786589insA	uc009ylv.2	-						FNBP4_uc001ngj.2_Intron|FNBP4_uc001ngl.2_Intron	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4											ovary(1)	1						ATAGCATCAGGAAAAAAAAACA	0.347													4	2	---	---	---	---	
OR4P4	81300	broad.mit.edu	37	11	55405901	55405901	+	Frame_Shift_Del	DEL	T	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55405901delT	uc010rij.1	+	1	68	c.68delT	c.(67-69)GTCfs	p.V23fs		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	23	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						AACATTGAAGTCCTCTGCTTT	0.368													43	42	---	---	---	---	
C11orf48	79081	broad.mit.edu	37	11	62436869	62436869	+	Intron	DEL	A	-	-	rs75785265		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62436869delA	uc001nue.2	-						C11orf48_uc001nuf.2_Intron|C11orf48_uc010rmd.1_Intron|C11orf83_uc001nui.3_5'Flank	NM_024099	NP_077004	Q9BQE6	CK048_HUMAN	hypothetical protein LOC79081												0						actcagtctcaaaaaaaaaaa	0.159													4	2	---	---	---	---	
MIR326	442900	broad.mit.edu	37	11	75046147	75046148	+	RNA	INS	-	G	G			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75046147_75046148insG	hsa-mir-326|MI0000808	-			c.83_84insG			ARRB1_uc001owe.1_Intron|ARRB1_uc001owf.1_Intron|uc010rrt.1_RNA																	0						gaatccgcctcGGGGCTGGAGG	0.317													4	2	---	---	---	---	
LRP6	4040	broad.mit.edu	37	12	12291106	12291106	+	Intron	DEL	A	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12291106delA	uc001rah.3	-						BCL2L14_uc001raf.1_Intron|LRP6_uc010shl.1_Intron	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein						cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				ctccgtctccaaaaaaaaaaa	0.139													4	3	---	---	---	---	
KIF21A	55605	broad.mit.edu	37	12	39763594	39763594	+	Frame_Shift_Del	DEL	T	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39763594delT	uc001rly.2	-	3	533	c.387delA	c.(385-387)AAAfs	p.K129fs	KIF21A_uc001rlx.2_Frame_Shift_Del_p.K129fs|KIF21A_uc001rlz.2_Frame_Shift_Del_p.K129fs|KIF21A_uc010skl.1_Frame_Shift_Del_p.K129fs|KIF21A_uc001rma.1_Frame_Shift_Del_p.K129fs	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	129	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				TTGCTATGTGTTTTTTTTCTT	0.318													35	16	---	---	---	---	
TMPO	7112	broad.mit.edu	37	12	98914085	98914088	+	Intron	DEL	TTCT	-	-	rs113936216		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98914085_98914088delTTCT	uc001tfj.2	+						TMPO_uc001tfi.1_Intron|TMPO_uc001tfk.2_Intron|TMPO_uc001tfl.2_Intron|TMPO_uc001tfh.1_Intron	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta							integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						ccttccttccttcTGTGTGTGTGA	0.039													4	2	---	---	---	---	
MED13L	23389	broad.mit.edu	37	12	116675100	116675101	+	Intron	INS	-	A	A	rs144743515	by1000genomes	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116675100_116675101insA	uc001tvw.2	-							NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CAAGAGTTAGGAAAAAAAAACA	0.421													4	2	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120194922	120194922	+	Intron	DEL	A	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120194922delA	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		agactctcttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
A2LD1	87769	broad.mit.edu	37	13	101192069	101192070	+	Intron	INS	-	TTTT	TTTT	rs35498477		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101192069_101192070insTTTT	uc001vor.2	-							NM_033110	NP_149101	Q9BVM4	A2LD1_HUMAN	AIG2-like domain 1						cellular modified amino acid catabolic process		acyltransferase activity|gamma-glutamylcyclotransferase activity				0						tggtcctgggcttttttttttt	0.153													3	6	---	---	---	---	
HECTD1	25831	broad.mit.edu	37	14	31647096	31647096	+	Intron	DEL	T	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31647096delT	uc001wrc.1	-							NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		ATAGGAAGaattttttttttt	0.333													4	2	---	---	---	---	
PRPF39	55015	broad.mit.edu	37	14	45571709	45571710	+	Intron	DEL	TT	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45571709_45571710delTT	uc001wvz.3	+						PRPF39_uc001wvy.3_Intron|PRPF39_uc010and.2_Intron	NM_017922	NP_060392	Q86UA1	PRP39_HUMAN	PRP39 pre-mRNA processing factor 39 homolog						mRNA processing|RNA splicing	nucleus	binding			ovary(1)|breast(1)	2						GAAAGATAACTTAAGAGTAATT	0.297													29	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	83760416	83760416	+	IGR	DEL	G	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:83760416delG								None (None upstream) : None (None downstream)																							tcctctccctgcctctcctct	0.000													4	2	---	---	---	---	
EML5	161436	broad.mit.edu	37	14	89151224	89151224	+	Intron	DEL	T	-	-	rs66754813		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89151224delT	uc001xxg.2	-						EML5_uc001xxh.1_Intron	NM_183387	NP_899243	Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like							cytoplasm|microtubule				ovary(3)	3						ATACATTAAATTTTTTTTCTG	0.189													3	5	---	---	---	---	
TMC7	79905	broad.mit.edu	37	16	19020932	19020932	+	Intron	DEL	A	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19020932delA	uc002dfq.2	+						TMC7_uc010vao.1_Intron|TMC7_uc002dfp.2_Intron|TMC7_uc010vap.1_Intron	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a							integral to membrane				skin(2)|ovary(1)	3						cttAAAAAAGAAAAAAAAAAA	0.159													5	3	---	---	---	---	
PDPR	55066	broad.mit.edu	37	16	70154770	70154771	+	Intron	INS	-	T	T	rs141843737	by1000genomes	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70154770_70154771insT	uc002eyf.1	+						CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Intron	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		CCTGAATTTTGTTTAAGGATGA	0.317													5	3	---	---	---	---	
FLII	2314	broad.mit.edu	37	17	18154413	18154414	+	Intron	INS	-	T	T			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18154413_18154414insT	uc002gsr.1	-						FLII_uc002gsq.1_Intron|FLII_uc010cpy.1_Intron|FLII_uc010vxn.1_Intron|FLII_uc010vxo.1_Intron|FLII_uc002gss.1_Intron	NM_002018	NP_002009	Q13045	FLII_HUMAN	flightless I homolog						multicellular organismal development|muscle contraction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	actin binding			central_nervous_system(1)|skin(1)	2	all_neural(463;0.228)					ACAGCACAGGCTTCCCAGCCCC	0.629													4	2	---	---	---	---	
POLDIP2	26073	broad.mit.edu	37	17	26684390	26684391	+	Splice_Site	INS	-	C	C	rs148075904	by1000genomes	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26684390_26684391insC	uc002haz.2	-	3	211	c.79_splice	c.e3+0	p.P27_splice	POLDIP2_uc010wag.1_RNA|TMEM199_uc002hba.2_5'Flank|SARM1_uc010wah.1_5'Flank	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2							mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GCACAGAGCGGCTTTGCCACCG	0.762													2	4	---	---	---	---	
NPEPPS	9520	broad.mit.edu	37	17	45696920	45696921	+	Intron	INS	-	A	A			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45696920_45696921insA	uc002ilr.3	+						NPEPPS_uc010wkt.1_Intron|NPEPPS_uc010wku.1_Intron|NPEPPS_uc010wkv.1_Intron|NPEPPS_uc002ils.1_3'UTR	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive						proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						aactccgtctcaaaaaaaaaaa	0.168													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15165428	15165431	+	IGR	DEL	ACAA	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15165428_15165431delACAA								ANKRD30B (312691 upstream) : LOC644669 (148124 downstream)																							GCAGCGGAAGACAAACAAAGATGT	0.377													16	7	---	---	---	---	
ATP9B	374868	broad.mit.edu	37	18	77096997	77096998	+	Intron	INS	-	A	A	rs146051223	by1000genomes	TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77096997_77096998insA	uc002lmx.2	+						ATP9B_uc002lmw.1_Intron|ATP9B_uc002lmz.1_Intron	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B						ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		TGAGTACACATAGAGTATGTGC	0.540													4	4	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13445408	13445411	+	Intron	DEL	TGTG	-	-	rs138143360		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13445408_13445411delTGTG	uc010dze.2	-						CACNA1A_uc002mwy.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	tgtgtgtgtttgtgtgtgtgtgtg	0.309													6	6	---	---	---	---	
SEC14L2	23541	broad.mit.edu	37	22	30803703	30803703	+	Intron	DEL	T	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30803703delT	uc003ahr.2	+						SEC14L2_uc003ahq.2_Intron|SEC14L2_uc011akx.1_Intron|SEC14L2_uc003ahs.2_Intron|SEC14L2_uc011aky.1_Intron|SEC14L2_uc003aht.2_5'Flank|SEC14L2_uc003ahu.3_5'Flank|SEC14L2_uc010gvv.2_5'Flank|SEC14L2_uc010gvw.1_5'Flank|MTP18_uc010gvx.1_5'Flank|MTP18_uc003ahv.1_5'Flank|MTP18_uc010gvy.1_5'Flank	NM_012429	NP_036561	O76054	S14L2_HUMAN	SEC14-like 2 isoform 1						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	phospholipid binding|transporter activity|vitamin E binding				0					Vitamin E(DB00163)	AGGCCCAGCCTTTTTTTTTTT	0.269													10	5	---	---	---	---	
C22orf23	84645	broad.mit.edu	37	22	38347219	38347219	+	Intron	DEL	A	-	-			TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38347219delA	uc003auj.1	-						C22orf23_uc003auk.1_Intron|POLR2F_uc010gxi.2_5'Flank|POLR2F_uc003aul.2_5'Flank|POLR2F_uc003aum.2_5'Flank	NM_032561	NP_115950	Q9BZE7	EVG1_HUMAN	hypothetical protein LOC84645												0	Melanoma(58;0.045)					actctgtctcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
TRAPPC2	6399	broad.mit.edu	37	X	13734919	13734920	+	Intron	INS	-	TTTG	TTTG	rs142846606		TCGA-C5-A1BE-01B-11D-A13W-08	TCGA-C5-A1BE-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13734919_13734920insTTTG	uc010nek.1	-						TRAPPC2_uc010nej.1_5'Flank|TRAPPC2_uc010nel.1_Intron|TRAPPC2_uc010nem.1_Intron	NM_001011658	NP_001011658	Q6IBE5	Q6IBE5_HUMAN	trafficking protein particle complex 2 isoform						ER to Golgi vesicle-mediated transport	intracellular					0						TGCTTTTATACTTTGTTATTGT	0.282													6	4	---	---	---	---	
