Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
VPS13D	55187	broad.mit.edu	37	1	12321050	12321050	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12321050G>A	uc001atv.2	+	12	1399	c.1258G>A	c.(1258-1260)GCC>ACC	p.A420T	VPS13D_uc001atw.2_Missense_Mutation_p.A420T	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	420					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CTGTCCGGGAGCCCCAGAACC	0.562													104	88	---	---	---	---	PASS
NECAP2	55707	broad.mit.edu	37	1	16767245	16767245	+	5'UTR	SNP	C	T	T	rs149798654	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16767245C>T	uc001ayo.2	+	1					NECAP2_uc001ayp.3_RNA|NECAP2_uc010ocd.1_5'UTR|NECAP2_uc001ayq.2_5'UTR	NM_018090	NP_060560	Q9NVZ3	NECP2_HUMAN	NECAP endocytosis associated 2 isoform 1						endocytosis|protein transport	clathrin vesicle coat|coated pit|plasma membrane					0		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|Kidney(64;0.000181)|KIRC - Kidney renal clear cell carcinoma(64;0.00268)|STAD - Stomach adenocarcinoma(196;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		TCGGTGGGCTCCAGGCGTCGC	0.657											OREG0013136	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	50	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16890647	16890647	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16890647C>T	uc009vos.1	-	31	4324	c.3436G>A	c.(3436-3438)GAA>AAA	p.E1146K	uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	1146	NBPF 8.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGCAAGACTTCAGGCTCTTCC	0.463													31	557	---	---	---	---	PASS
CNKSR1	10256	broad.mit.edu	37	1	26508395	26508395	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26508395G>T	uc001bln.3	+	4	498	c.440G>T	c.(439-441)CGA>CTA	p.R147L	CNKSR1_uc010oex.1_RNA|CNKSR1_uc001blm.3_Missense_Mutation_p.R147L|CNKSR1_uc009vsd.2_5'UTR|CNKSR1_uc009vse.2_5'UTR|CNKSR1_uc001blo.2_5'UTR	NM_006314	NP_006305	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras	147	CRIC.				Rho protein signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cell cortex|cell-cell junction	protein binding, bridging			lung(1)|kidney(1)	2		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		CAGGAGATCCGAGACTTGTTG	0.493													9	149	---	---	---	---	PASS
RCC1	1104	broad.mit.edu	37	1	28861792	28861792	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28861792G>A	uc001bqg.1	+	6	646	c.561G>A	c.(559-561)CTG>CTA	p.L187L	SNHG3-RCC1_uc001bqa.1_Silent_p.L187L|SNHG3-RCC1_uc001bqb.1_Silent_p.L187L|SNHG3-RCC1_uc001bqc.1_Silent_p.L187L|RCC1_uc001bqe.1_Silent_p.L204L|RCC1_uc001bqf.1_Silent_p.L218L	NM_001269	NP_001260	P18754	RCC1_HUMAN	regulator of chromosome condensation 1 isoform	187	RCC1 3.				cell division|chromosome segregation|G1/S transition of mitotic cell cycle|mitosis|mitotic spindle organization|regulation of mitosis|regulation of S phase of mitotic cell cycle|spindle assembly|viral reproduction	condensed nuclear chromosome|cytoplasm|nuclear chromatin|nuclear membrane|nucleoplasm	histone binding|nucleosomal DNA binding|Ran guanyl-nucleotide exchange factor activity			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		TGGTGATGCTGACAGCTGATG	0.587													25	32	---	---	---	---	PASS
KPNA6	23633	broad.mit.edu	37	1	32620245	32620245	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32620245G>T	uc001bug.2	+	2	149	c.61G>T	c.(61-63)GCT>TCT	p.A21S	KPNA6_uc001buh.2_5'UTR|KPNA6_uc010ogx.1_Missense_Mutation_p.A18S|KPNA6_uc010ogy.1_Missense_Mutation_p.A26S|KPNA6_uc009vtz.2_5'Flank	NM_012316	NP_036448	O60684	IMA7_HUMAN	karyopherin alpha 6	21	IBB.				NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				TAAGAACAATGCTCTAAACCC	0.448													26	60	---	---	---	---	PASS
EIF2C4	192670	broad.mit.edu	37	1	36292343	36292343	+	Intron	SNP	T	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36292343T>A	uc001bzj.1	+							NM_017629	NP_060099	Q9HCK5	AGO4_HUMAN	eukaryotic translation initiation factor 2C, 4						mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTAAAAAAAATTTCAGGTCTC	0.358													12	28	---	---	---	---	PASS
RRAGC	64121	broad.mit.edu	37	1	39318163	39318163	+	Intron	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39318163G>A	uc001ccq.2	-						RRAGC_uc010oim.1_Intron|RRAGC_uc001ccr.2_Intron	NM_022157	NP_071440	Q9HB90	RRAGC_HUMAN	Ras-related GTP binding C						apoptosis|cell growth|cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade|RNA splicing|small GTPase mediated signal transduction|transcription, DNA-dependent	lysosome|nucleus	GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein heterodimerization activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)				GATAAAAGCTGAAAAACACAA	0.303													133	137	---	---	---	---	PASS
ZMPSTE24	10269	broad.mit.edu	37	1	40726594	40726594	+	Silent	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40726594C>G	uc001cfg.2	+	2	418	c.207C>G	c.(205-207)CTC>CTG	p.L69L	uc001cff.2_5'Flank	NM_005857	NP_005848	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	69						endoplasmic reticulum membrane|Golgi membrane|integral to membrane	metal ion binding|metalloexopeptidase activity				0	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			AATCTCGACTCTATCAACTGG	0.388													46	158	---	---	---	---	PASS
WDR65	149465	broad.mit.edu	37	1	43650992	43650992	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43650992G>A	uc001cip.1	+	5	1055	c.934G>A	c.(934-936)GAA>AAA	p.E312K	EBNA1BP2_uc001cio.2_Intron|WDR65_uc010ojz.1_Missense_Mutation_p.E301K|WDR65_uc001ciq.1_Missense_Mutation_p.E312K	NM_152498	NP_689711	Q96MR6	WDR65_HUMAN	WD repeat domain 65	312										skin(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GAAGATGGAAGAAAAGGATTT	0.483													31	85	---	---	---	---	PASS
WDR65	149465	broad.mit.edu	37	1	43651019	43651019	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43651019G>C	uc001cip.1	+	5	1082	c.961G>C	c.(961-963)GAA>CAA	p.E321Q	EBNA1BP2_uc001cio.2_Intron|WDR65_uc010ojz.1_Missense_Mutation_p.E310Q|WDR65_uc001ciq.1_Missense_Mutation_p.E321Q	NM_152498	NP_689711	Q96MR6	WDR65_HUMAN	WD repeat domain 65	321										skin(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGAGAGCAGAGAAATCAGGGT	0.473													24	63	---	---	---	---	PASS
EIF2B3	8891	broad.mit.edu	37	1	45363062	45363062	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45363062C>T	uc001cmt.1	-	6	748	c.621G>A	c.(619-621)TTG>TTA	p.L207L	EIF2B3_uc001cmu.1_Silent_p.L207L|EIF2B3_uc001cmv.1_Silent_p.L207L|EIF2B3_uc001cmw.2_Silent_p.L207L	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,	207					negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					TGTATTTTTTCAAACAGTAGA	0.368													19	27	---	---	---	---	PASS
S1PR1	1901	broad.mit.edu	37	1	101704600	101704600	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101704600C>T	uc001dud.2	+	2	574	c.60C>T	c.(58-60)GTC>GTT	p.V20V	S1PR1_uc009weg.2_Silent_p.V20V	NM_001400	NP_001391	P21453	S1PR1_HUMAN	sphingosine-1-phosphate receptor 1	20	Extracellular (By similarity).				cell adhesion	integral to membrane	lysosphingolipid and lysophosphatidic acid receptor activity			ovary(2)|lung(1)	3						CTGACTACGTCAACTATGATA	0.577											OREG0013620	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	49	---	---	---	---	PASS
C1orf161	126868	broad.mit.edu	37	1	116670208	116670208	+	Silent	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116670208C>A	uc001egc.1	+	5	868	c.603C>A	c.(601-603)GCC>GCA	p.A201A		NM_152367	NP_689580	Q8N8X9	MB213_HUMAN	hypothetical protein LOC126868	201											0	Lung SC(450;0.184)	all_cancers(81;0.00142)|all_lung(203;0.000139)|all_epithelial(167;0.000401)|Lung NSC(69;0.000705)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CCAAGAAAGCCCGGTGGCCTC	0.592													4	62	---	---	---	---	PASS
CHD1L	9557	broad.mit.edu	37	1	146736155	146736155	+	Silent	SNP	C	T	T	rs141884816	byFrequency	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146736155C>T	uc001epm.3	+	7	714	c.651C>T	c.(649-651)CTC>CTT	p.L217L	uc001epp.2_Intron|CHD1L_uc001epn.3_Silent_p.L104L|CHD1L_uc010ozo.1_RNA|CHD1L_uc009wjg.2_RNA|CHD1L_uc009wjh.2_Silent_p.L217L|CHD1L_uc010ozp.1_Intron|CHD1L_uc001epo.3_Intron|CHD1L_uc010ozq.1_5'UTR|CHD1L_uc009wji.2_5'UTR	NM_004284	NP_004275	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein	217	Helicase ATP-binding.				chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.0487)					ACTCCCTCCTCAGTTTTGTGG	0.423													47	55	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160262345	160262345	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160262345G>A	uc009wti.2	-	28	3283	c.2889C>T	c.(2887-2889)TAC>TAT	p.Y963Y	COPA_uc001fvv.3_Silent_p.Y972Y	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	963					COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGCCTCGGGCGTATGTCTGTA	0.473													36	112	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169525907	169525907	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169525907G>C	uc001ggg.1	-	6	1074	c.929C>G	c.(928-930)TCT>TGT	p.S310C	F5_uc010plr.1_RNA	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	310	F5/8 type A 1.|Plastocyanin-like 2.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	TGGGGTGAGAGAAGATATGAT	0.478													37	46	---	---	---	---	PASS
PRRX1	5396	broad.mit.edu	37	1	170705270	170705270	+	Silent	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170705270G>C	uc001ghf.2	+	4	728	c.681G>C	c.(679-681)CTG>CTC	p.L227L	PRRX1_uc001ghe.2_3'UTR	NM_022716	NP_073207	P54821	PRRX1_HUMAN	paired mesoderm homeobox 1 isoform pmx-1b	227	OAR.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTGCCAACCTGAGACTGAAGG	0.458													111	145	---	---	---	---	PASS
ZBTB37	84614	broad.mit.edu	37	1	173840150	173840150	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173840150G>C	uc009wwp.1	+	3	1063	c.787G>C	c.(787-789)GAA>CAA	p.E263Q	ZBTB37_uc001gjp.1_Missense_Mutation_p.E263Q|ZBTB37_uc001gjq.3_Missense_Mutation_p.E263Q|ZBTB37_uc001gjr.2_Missense_Mutation_p.E263Q	NM_001122770	NP_001116242	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37 isoform	263					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCCTTCTGGAGAAGATGGGAG	0.478													16	26	---	---	---	---	PASS
ZBTB37	84614	broad.mit.edu	37	1	173840188	173840188	+	Silent	SNP	G	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173840188G>T	uc009wwp.1	+	3	1101	c.825G>T	c.(823-825)GTG>GTT	p.V275V	ZBTB37_uc001gjp.1_Silent_p.V275V|ZBTB37_uc001gjq.3_Silent_p.V275V|ZBTB37_uc001gjr.2_Silent_p.V275V	NM_001122770	NP_001116242	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37 isoform	275					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAGCCATGGTGATTGATACCA	0.488													24	33	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177250575	177250575	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177250575G>C	uc001glf.2	+	8	2575	c.2263G>C	c.(2263-2265)GAG>CAG	p.E755Q	FAM5B_uc001glg.2_Missense_Mutation_p.E650Q	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	755						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						GGCCAACAATGAGGTGGGCAG	0.557													23	56	---	---	---	---	PASS
NMNAT2	23057	broad.mit.edu	37	1	183273865	183273865	+	Intron	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183273865G>A	uc001gqc.1	-						NMNAT2_uc001gqb.1_Nonsense_Mutation_p.Q4*	NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1						TCTAGTTCCTGGATTTCCATC	0.527													9	107	---	---	---	---	PASS
MARK1	4139	broad.mit.edu	37	1	220804416	220804416	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220804416G>C	uc001hmn.3	+	10	1546	c.949G>C	c.(949-951)GAG>CAG	p.E317Q	MARK1_uc009xdw.2_Missense_Mutation_p.E317Q|MARK1_uc010pun.1_Missense_Mutation_p.E317Q|MARK1_uc001hmm.3_Missense_Mutation_p.E295Q	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1	317					intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)		TGGTCATGAAGAGGAAGAACT	0.368													20	61	---	---	---	---	PASS
H3F3A	3020	broad.mit.edu	37	1	226252059	226252059	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226252059C>T	uc001hpw.2	+	2	122	c.7C>T	c.(7-9)CGT>TGT	p.R3C	H3F3A_uc010pvl.1_Missense_Mutation_p.R3C	NM_005324	NP_005315	P84243	H33_HUMAN	H3 histone, family 3B	3					blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding				0	Breast(184;0.179)			GBM - Glioblastoma multiforme(131;0.203)		TACCATGGCTCGTACAAAGCA	0.498											OREG0014293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	46	---	---	---	---	PASS
NLRP3	114548	broad.mit.edu	37	1	247588394	247588394	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247588394G>A	uc001icr.2	+	5	1787	c.1649G>A	c.(1648-1650)CGT>CAT	p.R550H	NLRP3_uc001ics.2_Missense_Mutation_p.R550H|NLRP3_uc001icu.2_Missense_Mutation_p.R550H|NLRP3_uc001icw.2_Missense_Mutation_p.R550H|NLRP3_uc001icv.2_Missense_Mutation_p.R550H|NLRP3_uc010pyw.1_Missense_Mutation_p.R548H|NLRP3_uc001ict.1_Missense_Mutation_p.R548H	NM_001079821	NP_001073289	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3 isoform a	550					detection of biotic stimulus|induction of apoptosis|inflammatory response|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|positive regulation of interleukin-1 beta secretion|protein oligomerization|signal transduction	cytoplasm	ATP binding|peptidoglycan binding|protein binding			lung(8)|skin(8)|ovary(7)|upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	26	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CCAGGGAGTCGTTTGAAGCTT	0.473													24	28	---	---	---	---	PASS
RNASEH1	246243	broad.mit.edu	37	2	3596638	3596638	+	Intron	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3596638G>C	uc002qxt.2	-						RNASEH1_uc002qxs.2_Intron	NM_002936	NP_002927	O60930	RNH1_HUMAN	ribonuclease H1						RNA catabolic process	cytoplasm	magnesium ion binding|ribonuclease H activity|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)		AAACGTATCTGATAACTTACA	0.303													293	223	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8890468	8890468	+	Intron	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8890468G>C	uc002qzc.2	-						KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Intron|KIDINS220_uc010yiw.1_Intron|KIDINS220_uc002qzb.2_5'Flank|KIDINS220_uc002qze.2_Intron	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACGAACATCTGAAAGATTCAA	0.488													28	18	---	---	---	---	PASS
HADHA	3030	broad.mit.edu	37	2	26424052	26424052	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26424052C>A	uc002rgy.2	-	13	1488	c.1358G>T	c.(1357-1359)AGT>ATT	p.S453I	HADHA_uc010yks.1_Missense_Mutation_p.S366I	NM_000182	NP_000173	P40939	ECHA_HUMAN	mitochondrial trifunctional protein, alpha	453					fatty acid beta-oxidation	fatty acid beta-oxidation multienzyme complex|mitochondrial nucleoid|nucleolus	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acetyltransferase activity|coenzyme binding|enoyl-CoA hydratase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				NADH(DB00157)	GTGCTTAAGACTAAGGTCCTC	0.418													5	83	---	---	---	---	PASS
EIF2AK2	5610	broad.mit.edu	37	2	37349711	37349711	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37349711C>T	uc010ynh.1	-	12	1562	c.1005G>A	c.(1003-1005)GAG>GAA	p.E335E	EIF2AK2_uc010fab.1_Silent_p.E294E|EIF2AK2_uc010yng.1_Silent_p.E335E|EIF2AK2_uc010fac.2_Silent_p.E335E|EIF2AK2_uc010fad.2_Intron	NM_002759	NP_002750	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha	335	2 X 13 AA approximate repeats.|1.|Protein kinase.				evasion by virus of host immune response|modulation by virus of host cellular process|negative regulation of osteoblast proliferation|protein autophosphorylation|response to virus|viral infectious cycle	cytosol	ATP binding|double-stranded RNA binding|eukaryotic translation initiation factor 2alpha kinase activity|protein binding|protein phosphatase type 2A regulator activity			ovary(2)|lung(2)|pancreas(1)	5		all_hematologic(82;0.248)				CATCACTGGTCTCAGGATCAT	0.378													11	173	---	---	---	---	PASS
CEBPZ	10153	broad.mit.edu	37	2	37455204	37455204	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37455204C>T	uc002rpz.2	-	2	1162	c.1132G>A	c.(1132-1134)GAG>AAG	p.E378K		NM_005760	NP_005751	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein zeta	378					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding			pancreas(1)	1		all_hematologic(82;0.21)				TTTTCTTCCTCAGGCTTGTTA	0.413													20	237	---	---	---	---	PASS
LRPPRC	10128	broad.mit.edu	37	2	44123818	44123818	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44123818C>T	uc002rtr.2	-	35	3913	c.3855G>A	c.(3853-3855)CCG>CCA	p.P1285P		NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	1285	RNA-binding.				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ACAACAAAATCGGGGTTTGTT	0.363													25	96	---	---	---	---	PASS
LRPPRC	10128	broad.mit.edu	37	2	44190816	44190816	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44190816C>A	uc002rtr.2	-	12	1457	c.1399G>T	c.(1399-1401)GAA>TAA	p.E467*	LRPPRC_uc010yob.1_Nonsense_Mutation_p.E367*	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	467	PPR 8.				mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ACTCCCAATTCTTGCATTCCT	0.363													47	230	---	---	---	---	PASS
DNAH6	1768	broad.mit.edu	37	2	84806723	84806723	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84806723G>A	uc010fgb.2	+	14	2286	c.2149G>A	c.(2149-2151)GAG>AAG	p.E717K	DNAH6_uc002soo.2_Missense_Mutation_p.E296K|DNAH6_uc002sop.2_Missense_Mutation_p.E296K	NM_001370	NP_001361	Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy polypeptide 6	717	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1						ACAAGATGCAGAGTATAAACT	0.353													31	133	---	---	---	---	PASS
DNAH6	1768	broad.mit.edu	37	2	84806735	84806735	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84806735G>A	uc010fgb.2	+	14	2298	c.2161G>A	c.(2161-2163)GAG>AAG	p.E721K	DNAH6_uc002soo.2_Missense_Mutation_p.E300K|DNAH6_uc002sop.2_Missense_Mutation_p.E300K	NM_001370	NP_001361	Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy polypeptide 6	721	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1						GTATAAACTTGAGTTTGTTCC	0.348													29	127	---	---	---	---	PASS
C2orf55	343990	broad.mit.edu	37	2	99439361	99439361	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99439361C>G	uc002szf.1	-	7	1669	c.1375G>C	c.(1375-1377)GAG>CAG	p.E459Q		NM_207362	NP_997245	Q6NV74	CB055_HUMAN	hypothetical protein LOC343990	459	Pro-rich.										0						CTCTCGGGCTCAGGCGCCGGC	0.637													3	19	---	---	---	---	PASS
SULT1C3	442038	broad.mit.edu	37	2	108881768	108881768	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108881768G>A	uc010ywo.1	+	7	876	c.876G>A	c.(874-876)AAG>AAA	p.K292K		NM_001008743	NP_001008743	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member	292						cytoplasm	alcohol sulfotransferase activity			skin(1)	1						ACCAGAAGAAGATGGCAGGAA	0.448													47	49	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136546079	136546079	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136546079C>T	uc002tuu.1	-	17	5610	c.5599G>A	c.(5599-5601)GAG>AAG	p.E1867K		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1867	Extracellular (Potential).				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		AACTGCACCTCCTCCTGTCTC	0.537													9	188	---	---	---	---	PASS
GCG	2641	broad.mit.edu	37	2	163002156	163002156	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163002156C>G	uc002ucc.2	-	4	385	c.286G>C	c.(286-288)GAG>CAG	p.E96Q		NM_002054	NP_002045	P01275	GLUC_HUMAN	glucagon preproprotein	96					cell proliferation|cellular response to glucagon stimulus|energy reserve metabolic process|feeding behavior|regulation of insulin secretion	plasma membrane|soluble fraction	hormone activity				0					Exenatide(DB01276)|Phentolamine(DB00692)	GCATGTCTCTCAAATTCATCG	0.408													74	262	---	---	---	---	PASS
CASP10	843	broad.mit.edu	37	2	202073970	202073970	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202073970C>T	uc002uxl.1	+	9	1518	c.1100C>T	c.(1099-1101)TCG>TTG	p.S367L	CASP10_uc002uxj.1_Missense_Mutation_p.S367L|CASP10_uc002uxk.1_Missense_Mutation_p.S324L|CASP10_uc010fta.1_Missense_Mutation_p.S300L|CASP10_uc002uxm.1_Missense_Mutation_p.S324L|CASP10_uc010ftb.1_RNA	NM_032974	NP_116756	Q92851	CASPA_HUMAN	caspase 10 isoform b preproprotein	367					apoptosis|induction of apoptosis by extracellular signals|proteolysis	cytosol|plasma membrane	cysteine-type endopeptidase activity|identical protein binding|protein binding			skin(3)|ovary(1)|pancreas(1)|breast(1)	6						GTCTACTCTTCGGATGAGGCC	0.527													18	159	---	---	---	---	PASS
EDEM1	9695	broad.mit.edu	37	3	5251877	5251877	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5251877C>G	uc003bqi.2	+	9	1659	c.1527C>G	c.(1525-1527)TTC>TTG	p.F509L	EDEM1_uc003bqh.2_Missense_Mutation_p.F509L	NM_014674	NP_055489	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like	509	Lumenal (Potential).				ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			ovary(2)|breast(1)	3				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		AGAATCCCTTCTACCTCCATG	0.448													30	83	---	---	---	---	PASS
IQSEC1	9922	broad.mit.edu	37	3	12983327	12983327	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12983327G>A	uc003bxt.2	-	2	113	c.104C>T	c.(103-105)TCC>TTC	p.S35F	IQSEC1_uc003bxu.3_5'UTR|IQSEC1_uc011auw.1_Missense_Mutation_p.S21F	NM_014869	NP_055684	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1 isoform b	35					regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1						GCTGTCCAGGGATGTGCCAGT	0.647													13	4	---	---	---	---	PASS
OXNAD1	92106	broad.mit.edu	37	3	16345057	16345057	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16345057G>T	uc003caw.2	+	9	1384	c.927G>T	c.(925-927)GAG>GAT	p.E309D	OXNAD1_uc003cax.2_Missense_Mutation_p.E309D|OXNAD1_uc011awb.1_Missense_Mutation_p.E327D	NM_138381	NP_612390	Q96HP4	OXND1_HUMAN	oxidoreductase NAD-binding domain containing 1	309							oxidoreductase activity			skin(1)	1						TTTGCTTTGAGAAGTGGTGGT	0.408													20	31	---	---	---	---	PASS
TRAK1	22906	broad.mit.edu	37	3	42132994	42132994	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42132994C>T	uc003cky.2	+	1	249	c.33C>T	c.(31-33)GTC>GTT	p.V11V	TRAK1_uc011azh.1_Silent_p.V11V|TRAK1_uc011azi.1_Silent_p.V11V	NM_001042646	NP_001036111	Q9UPV9	TRAK1_HUMAN	OGT(O-Glc-NAc transferase)-interacting protein	11					endosome to lysosome transport|protein O-linked glycosylation|protein targeting|regulation of transcription from RNA polymerase II promoter	early endosome|mitochondrion|nucleus				ovary(1)	1						GGCAGCCCGTCAGGGCTCAGC	0.537													20	13	---	---	---	---	PASS
FYCO1	79443	broad.mit.edu	37	3	46008968	46008968	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46008968C>T	uc003cpb.3	-	8	2064	c.1858G>A	c.(1858-1860)GAG>AAG	p.E620K	FYCO1_uc011bal.1_Missense_Mutation_p.E620K	NM_024513	NP_078789	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	620	Potential.				transport	integral to membrane	metal ion binding|protein binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TTCTCCAGCTCCCTGTTGGCC	0.622													43	74	---	---	---	---	PASS
GNAT1	2779	broad.mit.edu	37	3	50231257	50231257	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50231257G>A	uc003cym.2	+	5	637	c.521G>A	c.(520-522)CGA>CAA	p.R174Q	GNAT1_uc003cyl.2_Missense_Mutation_p.R174Q	NM_144499	NP_653082	P11488	GNAT1_HUMAN	rod-type transducin alpha subunit	174	GTP (By similarity).				detection of chemical stimulus involved in sensory perception of bitter taste|G-protein signaling, coupled to cAMP nucleotide second messenger|negative regulation of cyclic-nucleotide phosphodiesterase activity|rhodopsin mediated phototransduction|sensory perception of umami taste	heterotrimeric G-protein complex|photoreceptor inner segment|photoreceptor outer segment membrane	acyl binding|G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GDP binding|GTP binding|GTPase activity|protein kinase binding|signal transducer activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		CTGCGCTCGCGAGTCAAGACC	0.652													30	7	---	---	---	---	PASS
PCBP4	57060	broad.mit.edu	37	3	51993277	51993277	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51993277G>A	uc003dcd.1	-	9	1064	c.668C>T	c.(667-669)GCG>GTG	p.A223V	PCBP4_uc003dcb.1_Missense_Mutation_p.A189V|PCBP4_uc003dcc.1_Missense_Mutation_p.A244V|PCBP4_uc003dce.1_Silent_p.C224C|PCBP4_uc003dcf.1_Missense_Mutation_p.A223V|PCBP4_uc003dcg.1_Missense_Mutation_p.A189V|PCBP4_uc003dch.1_Missense_Mutation_p.A223V|PCBP4_uc003dci.1_Missense_Mutation_p.A63V|PCBP4_uc003dcj.1_Missense_Mutation_p.A223V|PCBP4_uc003dck.1_Missense_Mutation_p.A180V|PCBP4_uc003dcl.1_Missense_Mutation_p.A223V	NM_033010	NP_127503	P57723	PCBP4_HUMAN	poly(rC) binding protein 4 isoform c	223						cytoplasm|ribonucleoprotein complex	DNA binding|RNA binding				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AAAGGGGACCGCATGGCTTGA	0.637													4	54	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52651372	52651372	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52651372A>T	uc003des.2	-	14	1736	c.1724T>A	c.(1723-1725)ATC>AAC	p.I575N	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.I575N|PBRM1_uc003der.2_Missense_Mutation_p.I543N|PBRM1_uc003det.2_Missense_Mutation_p.I590N|PBRM1_uc003deu.2_Missense_Mutation_p.I590N|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.I575N|PBRM1_uc010hmk.1_Missense_Mutation_p.I575N|PBRM1_uc003dey.2_Missense_Mutation_p.I575N|PBRM1_uc003dez.1_Missense_Mutation_p.I575N|PBRM1_uc003dfb.1_Missense_Mutation_p.I488N|PBRM1_uc003dfc.2_5'Flank	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	575	Bromo 4.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GTCATTGCGGATGTTATGCTC	0.403			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								48	40	---	---	---	---	PASS
WNT5A	7474	broad.mit.edu	37	3	55504316	55504316	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55504316C>T	uc003dhn.2	-	5	1265	c.947G>A	c.(946-948)GGC>GAC	p.G316D	WNT5A_uc003dhm.2_Missense_Mutation_p.G301D|WNT5A_uc010hmw.2_Missense_Mutation_p.G301D|WNT5A_uc010hmx.2_Missense_Mutation_p.G227D	NM_003392	NP_003383	P41221	WNT5A_HUMAN	wingless-type MMTV integration site family,	316					activation of JUN kinase activity|activation of protein kinase B activity|axon guidance|cartilage development|cellular protein localization|cellular response to calcium ion|cellular response to interferon-gamma|cellular response to lipopolysaccharide|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|cervix development|cochlea morphogenesis|convergent extension involved in organogenesis|dopaminergic neuron differentiation|dorsal/ventral axis specification|embryonic digit morphogenesis|embryonic skeletal system development|epithelial cell proliferation involved in mammary gland duct elongation|epithelial to mesenchymal transition|face development|genitalia development|heart looping|hemopoietic stem cell proliferation|keratinocyte differentiation|lateral sprouting involved in mammary gland duct morphogenesis|lens development in camera-type eye|male gonad development|mammary gland branching involved in thelarche|negative regulation of apoptosis|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of mesenchymal cell proliferation|negative regulation of transcription, DNA-dependent|neural tube closure|olfactory bulb interneuron development|optic cup formation involved in camera-type eye development|palate development|positive regulation of angiogenesis|positive regulation of cartilage development|positive regulation of cGMP metabolic process|positive regulation of chemokine biosynthetic process|positive regulation of cytokine secretion involved in immune response|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of fibroblast proliferation|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of macrophage activation|positive regulation of macrophage cytokine production|positive regulation of mesenchymal cell proliferation|positive regulation of neuron projection development|positive regulation of NF-kappaB transcription factor activity|positive regulation of ossification|positive regulation of protein catabolic process|positive regulation of protein kinase C signaling cascade|positive regulation of T cell chemotaxis|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|primitive streak formation|regulation of branching involved in mammary gland duct morphogenesis|somitogenesis|tail morphogenesis|type B pancreatic cell development|urinary bladder development|uterus development|vagina development|Wnt receptor signaling pathway, calcium modulating pathway|wound healing	extracellular space|membrane fraction|plasma membrane|proteinaceous extracellular matrix	frizzled binding|frizzled-2 binding|receptor tyrosine kinase-like orphan receptor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		GCCCAGCGAGCCGGTGCTCTC	0.622													3	20	---	---	---	---	PASS
SPATA12	353324	broad.mit.edu	37	3	57108134	57108134	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57108134G>A	uc003dij.1	+	2	1087	c.412G>A	c.(412-414)GAG>AAG	p.E138K	ARHGEF3_uc003dih.2_Intron	NM_181727	NP_859078	Q7Z6I5	SPT12_HUMAN	spermatogenesis associated 12	138											0				KIRC - Kidney renal clear cell carcinoma(284;0.0111)|Kidney(284;0.0129)		tggggataatgagaggaccac	0.209													51	28	---	---	---	---	PASS
CRYBG3	131544	broad.mit.edu	37	3	97596165	97596165	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97596165G>C	uc003drx.2	+	1	347	c.283G>C	c.(283-285)GAG>CAG	p.E95Q		NM_153605	NP_705833			beta-gamma crystallin domain containing 3												0						TGAAAGGTCTGAGAGTAGAAC	0.433													21	130	---	---	---	---	PASS
KIAA1524	57650	broad.mit.edu	37	3	108288401	108288401	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108288401G>A	uc003dxb.3	-	9	1217	c.948C>T	c.(946-948)CTC>CTT	p.L316L	KIAA1524_uc010hpv.1_5'Flank|KIAA1524_uc003dxc.1_Silent_p.L157L|KIAA1524_uc010hpw.1_Silent_p.L157L	NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen	316						cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3						TCATCTGAGTGAGCATATGGC	0.433													6	82	---	---	---	---	PASS
KIAA2018	205717	broad.mit.edu	37	3	113376032	113376032	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113376032C>G	uc003eam.2	-	7	4908	c.4497G>C	c.(4495-4497)GAG>GAC	p.E1499D	KIAA2018_uc003eal.2_Missense_Mutation_p.E1443D	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717	1499	Gln-rich.				regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						GGACAGAGCTCTCTGCATGAG	0.393													14	177	---	---	---	---	PASS
PLA1A	51365	broad.mit.edu	37	3	119344010	119344010	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119344010G>C	uc003ecu.2	+	9	1091	c.1052G>C	c.(1051-1053)AGA>ACA	p.R351T	PLA1A_uc003ecv.2_Missense_Mutation_p.R335T|PLA1A_uc003ecw.2_RNA|PLA1A_uc011bjc.1_Missense_Mutation_p.R178T	NM_015900	NP_056984	Q53H76	PLA1A_HUMAN	phospholipase A1 member A precursor	351					lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						AAGGAACTGAGAAACAAGGAC	0.403													15	90	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121414503	121414503	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121414503G>C	uc003eei.3	-	13	4978	c.4852C>G	c.(4852-4854)CTT>GTT	p.L1618V	GOLGB1_uc010hrc.2_Missense_Mutation_p.L1623V|GOLGB1_uc003eej.3_Missense_Mutation_p.L1584V|GOLGB1_uc011bjm.1_Missense_Mutation_p.L1504V|GOLGB1_uc010hrd.1_Missense_Mutation_p.L1582V	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	1618	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		GACTGCAGAAGAATTTCATAC	0.378													109	237	---	---	---	---	PASS
ZNF148	7707	broad.mit.edu	37	3	124951197	124951197	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124951197C>G	uc003ehx.3	-	9	2859	c.2373G>C	c.(2371-2373)CAG>CAC	p.Q791H	SLC12A8_uc003ehw.3_Intron|ZNF148_uc003ehz.3_Missense_Mutation_p.Q791H|ZNF148_uc010hsa.2_Missense_Mutation_p.Q791H|ZNF148_uc003eia.3_Missense_Mutation_p.Q791H|ZNF148_uc003ehy.2_Missense_Mutation_p.Q128H	NM_021964	NP_068799	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	791					cellular defense response|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4						AGCCAAAAGTCTGGCCAGTTG	0.398													17	97	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129284294	129284294	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129284294G>A	uc003emx.2	-	25	4510	c.4410C>T	c.(4408-4410)CTC>CTT	p.L1470L	PLXND1_uc011blb.1_Silent_p.L138L	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1470	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						AGGCGTCAATGAGGTCCACCA	0.602													13	101	---	---	---	---	PASS
NUDT16	131870	broad.mit.edu	37	3	131101037	131101037	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131101037C>A	uc003eof.2	+	2	228	c.187C>A	c.(187-189)CGC>AGC	p.R63S	uc003eoc.1_5'Flank|NUDT16_uc011bln.1_Missense_Mutation_p.R50S|NUDT16_uc003eog.1_Missense_Mutation_p.R63S	NM_152395	NP_689608	Q96DE0	NUD16_HUMAN	nudix-type motif 16	96	Nudix hydrolase.					nucleolus|nucleoplasm	hydrolase activity|metal ion binding|RNA binding				0						CACTGACTACCGCAGCTCCCA	0.677													3	40	---	---	---	---	PASS
WDR49	151790	broad.mit.edu	37	3	167293737	167293737	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167293737G>A	uc003fev.1	-	4	761	c.455C>T	c.(454-456)ACT>ATT	p.T152I	WDR49_uc003feu.1_5'Flank|WDR49_uc011bpd.1_Missense_Mutation_p.T205I|WDR49_uc003few.1_Missense_Mutation_p.T493I	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49	152	WD 3.									large_intestine(1)|ovary(1)|skin(1)	3						AAGAACACAAGTGACTGCTTT	0.403													48	332	---	---	---	---	PASS
SEC62	7095	broad.mit.edu	37	3	169700543	169700543	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169700543G>C	uc003fgg.2	+	4	331	c.300G>C	c.(298-300)ATG>ATC	p.M100I	SEC62_uc003fgh.2_Missense_Mutation_p.M100I	NM_003262	NP_003253	Q99442	SEC62_HUMAN	translocation protein 1	100	Cytoplasmic (Potential).				cotranslational protein targeting to membrane|transmembrane transport	aggresome|endoplasmic reticulum membrane|integral to membrane|intermediate filament cytoskeleton|rough endoplasmic reticulum	protein transporter activity|receptor activity			ovary(1)	1						TAATGAAAATGAAATATGATa	0.194													5	292	---	---	---	---	PASS
CCDC50	152137	broad.mit.edu	37	3	191047505	191047505	+	Silent	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191047505C>G	uc003fsw.2	+	1	632	c.42C>G	c.(40-42)GTC>GTG	p.V14V	CCDC50_uc003fsv.2_Silent_p.V14V|UTS2D_uc003fsu.2_Intron	NM_174908	NP_777568	Q8IVM0	CCD50_HUMAN	Ymer protein short isoform	14						cytoplasm	protein binding				0	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		TGCCTGGAGTCAAGGAAGGTA	0.692													4	14	---	---	---	---	PASS
OPA1	4976	broad.mit.edu	37	3	193380646	193380646	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193380646G>A	uc003ftm.2	+	24	2625	c.2391G>A	c.(2389-2391)AAG>AAA	p.K797K	OPA1_uc003ftg.2_Silent_p.K852K|OPA1_uc003fth.2_Silent_p.K816K|OPA1_uc003fti.2_Silent_p.K834K|OPA1_uc003ftj.2_Silent_p.K815K|OPA1_uc003ftk.2_Silent_p.K798K|OPA1_uc003ftl.2_Silent_p.K779K|OPA1_uc003ftn.2_Silent_p.K761K	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1	797	Mitochondrial intermembrane (By similarity).				apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		AATTGGAGAAGATGTTGAAAT	0.373													14	94	---	---	---	---	PASS
ACAP2	23527	broad.mit.edu	37	3	195022341	195022341	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195022341G>C	uc003fun.3	-	15	1599	c.1358C>G	c.(1357-1359)TCT>TGT	p.S453C		NM_012287	NP_036419	Q15057	ACAP2_HUMAN	centaurin, beta 2	453	Arf-GAP.				regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)	2						TAAAGTTAAAGATCGTACTTT	0.323													25	152	---	---	---	---	PASS
ADRA2C	152	broad.mit.edu	37	4	3769431	3769431	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3769431C>A	uc003ghm.2	+	1	1136	c.1098C>A	c.(1096-1098)AGC>AGA	p.S366R	ADRA2C_uc010icx.2_Intron	NM_000683	NP_000674	P18825	ADA2C_HUMAN	alpha-2C-adrenergic receptor	366	Cytoplasmic (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|energy reserve metabolic process|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation|regulation of insulin secretion	endosome|integral to plasma membrane	alpha-2A adrenergic receptor binding|alpha2-adrenergic receptor activity|epinephrine binding|protein heterodimerization activity|protein homodimerization activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)	CGCGCAGCAGCGTGTGCCGCC	0.716													3	21	---	---	---	---	PASS
CLRN2	645104	broad.mit.edu	37	4	17517069	17517069	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17517069C>A	uc003gpg.1	+	1	282	c.180C>A	c.(178-180)GAC>GAA	p.D60E		NM_001079827	NP_001073296	A0PK11	CLRN2_HUMAN	clarin 2	60						integral to membrane					0						TCATTGGGGACATTTACTACG	0.547													3	31	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47565612	47565612	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47565612G>A	uc003gxk.1	+	15	2847	c.2683G>A	c.(2683-2685)GAA>AAA	p.E895K	ATP10D_uc003gxl.1_Missense_Mutation_p.E143K	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	895	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						TACTGGCATTGAAGACCGTCT	0.463													11	28	---	---	---	---	PASS
SRD5A3	79644	broad.mit.edu	37	4	56212638	56212638	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56212638C>G	uc003hau.2	+	1	230	c.135C>G	c.(133-135)ATC>ATG	p.I45M		NM_024592	NP_078868	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3	45	Lumenal (Potential).				androgen biosynthetic process|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|polyprenol catabolic process	endoplasmic reticulum membrane|integral to membrane	3-oxo-5-alpha-steroid 4-dehydrogenase activity|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor				0	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)			GCTGCGCGATCTTCCAGGACC	0.697													4	5	---	---	---	---	PASS
UGT2B15	7366	broad.mit.edu	37	4	69513036	69513036	+	Missense_Mutation	SNP	C	T	T	rs148054959	byFrequency	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69513036C>T	uc011cal.1	-	6	1417	c.1379G>A	c.(1378-1380)CGA>CAA	p.R460Q		NM_001076	NP_001067	P54855	UDB15_HUMAN	UDP glycosyltransferase 2B15 precursor	460					steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity				0						GAAGACTGCTCGATCCAGGGG	0.423													46	89	---	---	---	---	PASS
PRKG2	5593	broad.mit.edu	37	4	82088333	82088333	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82088333G>A	uc003hmh.2	-	5	908	c.894C>T	c.(892-894)ATC>ATT	p.I298I	PRKG2_uc011cch.1_Silent_p.I298I	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	298	cGMP 2.				platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						AGCAGTCAATGATCTTGGTTA	0.239													4	17	---	---	---	---	PASS
EXOSC9	5393	broad.mit.edu	37	4	122724120	122724120	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122724120G>C	uc003iea.2	+	4	440	c.332G>C	c.(331-333)AGA>ACA	p.R111T	EXOSC9_uc003idz.2_Missense_Mutation_p.R111T|EXOSC9_uc003ieb.2_Missense_Mutation_p.R95T|EXOSC9_uc010inp.1_5'Flank	NM_005033	NP_005024	Q06265	EXOS9_HUMAN	exosome component 9 isoform 2	111	ARE binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|immune response|nuclear mRNA surveillance|nuclear polyadenylation-dependent rRNA catabolic process|positive regulation of cell growth|rRNA processing	cytosol|nuclear exosome (RNase complex)|nucleolus|nucleolus|nucleus	3'-5'-exoribonuclease activity|AU-rich element binding|protein binding				0						AGATGTCTAAGAAATTCGAAG	0.388													9	73	---	---	---	---	PASS
CDKN2AIP	55602	broad.mit.edu	37	4	184367811	184367811	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184367811C>T	uc003ivp.1	+	3	1136	c.974C>T	c.(973-975)TCA>TTA	p.S325L	CDKN2AIP_uc003ivq.1_Missense_Mutation_p.S70L	NM_017632	NP_060102	Q9NXV6	CARF_HUMAN	CDKN2A interacting protein	325	Ser-rich.				negative regulation of cell growth|positive regulation of signal transduction|regulation of protein stability	granular component|nucleoplasm	double-stranded RNA binding|p53 binding				0		all_lung(41;6.9e-12)|Lung NSC(41;1.28e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		AAAACTAGTTCAGAGGCAAGT	0.443													22	30	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10417496	10417496	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10417496C>G	uc003jet.1	+	22	2446	c.2263C>G	c.(2263-2265)CCT>GCT	p.P755A	MARCH6_uc011cmu.1_Missense_Mutation_p.P707A|MARCH6_uc003jeu.1_Missense_Mutation_p.P453A|MARCH6_uc011cmv.1_Missense_Mutation_p.P650A	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	755	Extracellular (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						GGATCAGACTCCTCTTTTTTA	0.413													61	274	---	---	---	---	PASS
RANBP3L	202151	broad.mit.edu	37	5	36255561	36255561	+	Intron	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36255561G>A	uc003jkh.2	-						RANBP3L_uc011cow.1_Intron	NM_145000	NP_659437	Q86VV4	RNB3L_HUMAN	RAN binding protein 3-like isoform 2						intracellular transport					ovary(1)	1	all_lung(31;4.52e-05)		Epithelial(62;0.0543)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.149)|Colorectal(62;0.202)			CTTTACAAAAGGATTCCTTAC	0.383													10	89	---	---	---	---	PASS
C5orf34	375444	broad.mit.edu	37	5	43492321	43492321	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43492321C>T	uc003jnz.1	-	11	1893	c.1576G>A	c.(1576-1578)GAA>AAA	p.E526K		NM_198566	NP_940968	Q96MH7	CE034_HUMAN	hypothetical protein LOC375444	526										breast(1)	1	Lung NSC(6;2.07e-05)					CAGTACCTTTCATATGGTTCA	0.279													10	188	---	---	---	---	PASS
HTR1A	3350	broad.mit.edu	37	5	63257202	63257202	+	Silent	SNP	G	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63257202G>T	uc011cqt.1	-	1	345	c.345C>A	c.(343-345)CTC>CTA	p.L115L		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	115	Helical; Name=3; (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	ACAGCACGTCGAGGGCGATGA	0.602													3	19	---	---	---	---	PASS
MAST4	375449	broad.mit.edu	37	5	66427716	66427716	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:66427716C>T	uc003jut.1	+	15	1531	c.1463C>T	c.(1462-1464)ACG>ATG	p.T488M	MAST4_uc003juu.1_Missense_Mutation_p.T498M|MAST4_uc011cra.1_Missense_Mutation_p.T471M|MAST4_uc003juv.2_Missense_Mutation_p.T483M|MAST4_uc003juw.2_Missense_Mutation_p.T483M	NM_015183	NP_055998	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase	680	Protein kinase.			FAETV -> YIVKL (in Ref. 4; BAB71532).		cytoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(6)|ovary(2)|kidney(2)|breast(2)|central_nervous_system(1)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TTTGCTGAGACGGTCTTGGCC	0.393													39	108	---	---	---	---	PASS
PTCD2	79810	broad.mit.edu	37	5	71654177	71654177	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71654177C>G	uc003kcb.2	+	10	1100	c.1090C>G	c.(1090-1092)CAC>GAC	p.H364D	PTCD2_uc011csf.1_Missense_Mutation_p.H174D|PTCD2_uc003kcc.2_Missense_Mutation_p.H212D|PTCD2_uc011csg.1_Missense_Mutation_p.H192D|PTCD2_uc011csh.1_Missense_Mutation_p.H255D|PTCD2_uc003kcd.2_RNA	NM_024754	NP_079030	Q8WV60	PTCD2_HUMAN	pentatricopeptide repeat domain 2	364											0		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.73e-53)		CAGGAAATCTCACACGTTGCT	0.527													3	39	---	---	---	---	PASS
RAD50	10111	broad.mit.edu	37	5	131977957	131977957	+	Silent	SNP	T	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131977957T>G	uc003kxi.2	+	25	4227	c.3840T>G	c.(3838-3840)TCT>TCG	p.S1280S	RAD50_uc003kxh.2_Silent_p.S1141S	NM_005732	NP_005723	Q92878	RAD50_HUMAN	RAD50 homolog isoform 1	1280					DNA duplex unwinding|double-strand break repair via homologous recombination|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|telomere maintenance via telomerase	Mre11 complex|nuclear chromosome, telomeric region|nucleoplasm	ATP binding|DNA binding|nuclease activity|protein binding, bridging|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TAGGACGTTCTGAATATGTGG	0.383								Homologous_recombination					9	106	---	---	---	---	PASS
SMAD5	4090	broad.mit.edu	37	5	135513103	135513103	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135513103C>T	uc003lbj.1	+	11	1777	c.1333C>T	c.(1333-1335)CAG>TAG	p.Q445*	SMAD5_uc003lbk.1_Nonsense_Mutation_p.Q445*|SMAD5_uc003lbl.1_Nonsense_Mutation_p.Q445*	NM_001001419	NP_001001419	Q99717	SMAD5_HUMAN	SMAD family member 5	445	MH2.				BMP signaling pathway|embryonic pattern specification|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGGGCCTCTTCAGTGGCTGGA	0.428													6	26	---	---	---	---	PASS
SMAD5	4090	broad.mit.edu	37	5	135513158	135513158	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135513158C>T	uc003lbj.1	+	11	1832	c.1388C>T	c.(1387-1389)TCT>TTT	p.S463F	SMAD5_uc003lbk.1_Missense_Mutation_p.S463F|SMAD5_uc003lbl.1_Missense_Mutation_p.S463F	NM_001001419	NP_001001419	Q99717	SMAD5_HUMAN	SMAD family member 5	463	MH2.				BMP signaling pathway|embryonic pattern specification|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|transcription factor complex	sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCCATATCTTCTGTTTCATAA	0.388													4	22	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140476487	140476487	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140476487T>C	uc003lil.2	+	1	2251	c.2113T>C	c.(2113-2115)TTC>CTC	p.F705L	PCDHB2_uc003lim.1_Missense_Mutation_p.F366L	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	705	Helical; (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCTTCCTCTTCTCGGTGCT	0.697													20	65	---	---	---	---	PASS
ANXA6	309	broad.mit.edu	37	5	150497334	150497334	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150497334G>A	uc003ltl.1	-	19	1655	c.1503C>T	c.(1501-1503)CTC>CTT	p.L501L	ANXA6_uc011dcp.1_Silent_p.L469L|ANXA6_uc003ltm.1_Silent_p.L501L|ANXA6_uc003ltn.1_Silent_p.L294L|ANXA6_uc003lto.1_Silent_p.L88L	NM_001155	NP_001146	P08133	ANXA6_HUMAN	annexin VI isoform 1	501	Annexin 6.					melanosome	calcium ion binding|calcium-dependent phospholipid binding|protein binding				0		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCAGAGAAATGAGGATCCTCC	0.592													4	9	---	---	---	---	PASS
RNF39	80352	broad.mit.edu	37	6	30043424	30043424	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30043424G>C	uc003npe.2	-	1	205	c.143C>G	c.(142-144)TCT>TGT	p.S48C	RNF39_uc003npd.2_Missense_Mutation_p.S48C	NM_025236	NP_079512	Q9H2S5	RNF39_HUMAN	ring finger protein 39 isoform 1	48						cytoplasm	zinc ion binding				0						CGAGCGCGCAGATGGCGGGCC	0.667													3	37	---	---	---	---	PASS
PHF1	5252	broad.mit.edu	37	6	33381346	33381346	+	Intron	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33381346G>C	uc003oeh.2	+						PHF1_uc011drh.1_Intron|PHF1_uc003oei.2_Intron|PHF1_uc010jux.2_5'UTR	NM_024165	NP_077084	O43189	PHF1_HUMAN	PHD finger protein 1 isoform b						chromatin modification	nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Ovarian(999;0.0443)				TGAGTAATGAGAGGGGAGCAG	0.527													7	42	---	---	---	---	PASS
KCTD20	222658	broad.mit.edu	37	6	36452488	36452488	+	Intron	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36452488C>T	uc003ome.2	+						KCTD20_uc011dtm.1_Intron|KCTD20_uc011dtn.1_Intron|KCTD20_uc010jwk.2_Intron|KCTD20_uc011dto.1_Intron	NM_173562	NP_775833	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerisation domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)	2						TTTTCTTTTTCAGTTCTTTAT	0.353													54	192	---	---	---	---	PASS
AKIRIN2	55122	broad.mit.edu	37	6	88391343	88391343	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88391343G>A	uc003pmk.2	-	2	957	c.374C>T	c.(373-375)TCA>TTA	p.S125L		NM_018064	NP_060534	Q53H80	AKIR2_HUMAN	akirin 2	125					innate immune response|transcription, DNA-dependent	transcriptional repressor complex					0						ATTACCTGGTGAAGCTGGTCC	0.383													41	12	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90440513	90440513	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90440513C>T	uc003pnn.1	-	35	5188	c.5072G>A	c.(5071-5073)AGA>AAA	p.R1691K		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	1691					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GGCCTTCATTCTGTCATAAAT	0.328													4	132	---	---	---	---	PASS
POU3F2	5454	broad.mit.edu	37	6	99283888	99283888	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99283888C>A	uc003ppe.2	+	1	1309	c.1139C>A	c.(1138-1140)TCG>TAG	p.S380*		NM_005604	NP_005595	P20265	PO3F2_HUMAN	POU domain, class 3, transcription factor 2	380	Homeobox.				positive regulation of cell proliferation		identical protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		CCCAAGCCCTCGGCCCAGGAG	0.567													54	21	---	---	---	---	PASS
NUDT1	4521	broad.mit.edu	37	7	2284330	2284330	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2284330G>C	uc003slp.1	+	3	292	c.190G>C	c.(190-192)GAA>CAA	p.E64Q	FTSJ2_uc003slk.2_5'Flank|FTSJ2_uc003sll.2_5'Flank|FTSJ2_uc003slm.2_5'Flank|FTSJ2_uc003sln.2_5'Flank|FTSJ2_uc003slo.2_5'Flank|NUDT1_uc003slq.1_Missense_Mutation_p.E41Q|NUDT1_uc003slr.1_Missense_Mutation_p.E41Q|NUDT1_uc003sls.1_Missense_Mutation_p.E64Q|NUDT1_uc003slt.1_Missense_Mutation_p.E41Q|NUDT1_uc003slu.1_Missense_Mutation_p.E64Q|NUDT1_uc003slv.1_Missense_Mutation_p.E41Q	NM_198949	NP_945187	P36639	8ODP_HUMAN	nudix-type motif 1 isoform p22	82	Nudix box.|Nudix hydrolase.				DNA protection|DNA repair|response to oxidative stress	cytoplasm	8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity|8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity|GTPase activity|metal ion binding|protein binding				0		Ovarian(82;0.0253)|Melanoma(862;0.155)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.8e-14)|BRCA - Breast invasive adenocarcinoma(126;0.15)		CAAAGTGCAAGAAGGAGAGAC	0.522								Direct_reversal_of_damage|Modulation_of_nucleotide_pools					4	5	---	---	---	---	PASS
NFE2L3	9603	broad.mit.edu	37	7	26224536	26224536	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26224536C>G	uc003sxq.2	+	4	1490	c.1218C>G	c.(1216-1218)ATC>ATG	p.I406M		NM_004289	NP_004280	Q9Y4A8	NF2L3_HUMAN	nuclear factor erythroid 2-like 3	406					transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			skin(3)|ovary(1)	4						TTGATCCAATCGATGTTTCTC	0.363													44	112	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100355923	100355923	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100355923C>T	uc003uwj.2	+	16	3573	c.3408C>T	c.(3406-3408)ACC>ACT	p.T1136T	ZAN_uc003uwk.2_Silent_p.T1136T|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	1136	VWFC 1.|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGACACACACCGTGTGCCAGC	0.622													13	19	---	---	---	---	PASS
SRRT	51593	broad.mit.edu	37	7	100485384	100485384	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100485384A>G	uc003uwy.2	+	18	2498	c.2230A>G	c.(2230-2232)AAA>GAA	p.K744E	SRRT_uc010lhl.1_Missense_Mutation_p.K743E|SRRT_uc003uxa.2_Missense_Mutation_p.K743E|SRRT_uc003uwz.2_Missense_Mutation_p.K744E	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN	arsenate resistance protein 2 isoform a	744				K -> R (in Ref. 3; CAB46374).	cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding			ovary(2)	2						TGAGGAAGTGAAAAAGGAAGT	0.522													67	91	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111368507	111368507	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111368507C>T	uc003vfx.2	-	52	5993	c.5724G>A	c.(5722-5724)CGG>CGA	p.R1908R	DOCK4_uc011kml.1_Silent_p.R789R|DOCK4_uc011kmm.1_Silent_p.R777R|DOCK4_uc003vfw.2_Silent_p.R1320R|DOCK4_uc003vfy.2_Silent_p.R1953R|DOCK4_uc003vfv.2_Silent_p.R221R	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1908	Pro-rich.				cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				GCCGCAGAGTCCGCTCGTAGA	0.731													12	21	---	---	---	---	PASS
PRSS37	136242	broad.mit.edu	37	7	141539208	141539208	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141539208G>A	uc003vws.1	-	2	478	c.106C>T	c.(106-108)CAC>TAC	p.H36Y	PRSS37_uc011krk.1_Missense_Mutation_p.H23Y|PRSS37_uc011krl.1_Missense_Mutation_p.H36Y|PRSS37_uc003vwt.1_5'UTR	NM_001008270	NP_001008271	A4D1T9	PRS37_HUMAN	protease, serine, 37 precursor	36	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			skin(1)	1						GGGTTGAAGTGAGACTTGAGG	0.473													19	19	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149494368	149494368	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149494368C>G	uc010lpk.2	+	47	6839	c.6839C>G	c.(6838-6840)TCC>TGC	p.S2280C		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	2280					cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGATTCCATTCCACAGCCAAG	0.647													22	22	---	---	---	---	PASS
PTPRN2	5799	broad.mit.edu	37	7	158109594	158109594	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158109594G>A	uc003wno.2	-	3	315	c.194C>T	c.(193-195)CCG>CTG	p.P65L	PTPRN2_uc003wnp.2_Missense_Mutation_p.P48L|PTPRN2_uc003wnq.2_Missense_Mutation_p.P65L|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Missense_Mutation_p.P88L	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	65	Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GTCCATTGCCGGAACCTTCTG	0.582													7	17	---	---	---	---	PASS
SGK223	157285	broad.mit.edu	37	8	8235381	8235381	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8235381C>T	uc003wsh.3	-	2	538	c.538G>A	c.(538-540)GTG>ATG	p.V180M		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	180							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						GGGAAGCTCACCGGGTGGAAG	0.597													51	35	---	---	---	---	PASS
MTMR9	66036	broad.mit.edu	37	8	11180146	11180146	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11180146G>A	uc003wtm.2	+	10	1897	c.1499G>A	c.(1498-1500)CGT>CAT	p.R500H	MTMR9_uc010lrx.2_Missense_Mutation_p.R393H|MTMR9_uc011kxa.1_Missense_Mutation_p.R415H|uc003wtn.1_5'Flank|uc003wto.1_Intron	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	500						cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		ATTTTCCTACGTTGGAATAGA	0.294													21	48	---	---	---	---	PASS
PLAT	5327	broad.mit.edu	37	8	42044948	42044948	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42044948G>A	uc003xos.2	-	6	716	c.507C>T	c.(505-507)ATC>ATT	p.I169I	PLAT_uc010lxf.1_Silent_p.I86I|PLAT_uc010lxg.1_Intron|PLAT_uc003xot.2_Silent_p.I123I|PLAT_uc011lcm.1_Intron|PLAT_uc011lcn.1_Intron	NM_000930	NP_000921	P00750	TPA_HUMAN	plasminogen activator, tissue isoform 1	169	Kringle 1.				blood coagulation|fibrinolysis|negative regulation of proteolysis|protein modification process|proteolysis	cell surface|cytoplasm|extracellular space	protein binding|serine-type endopeptidase activity			breast(1)|skin(1)	2	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Iloprost(DB01088)|Reteplase(DB00015)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	GGCCCAGCCTGATGGCGTCTG	0.627													7	37	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62496591	62496591	+	Intron	SNP	G	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62496591G>T	uc003xuj.2	-						ASPH_uc011leg.1_Intron|ASPH_uc003xuo.2_Intron	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	TTTCTTAACTGAAAGAAAAAA	0.303													6	30	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120650743	120650743	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120650743C>T	uc003yot.1	-	2	144	c.58G>A	c.(58-60)GTT>ATT	p.V20I	ENPP2_uc003yos.1_Missense_Mutation_p.V20I|ENPP2_uc010mdd.1_Missense_Mutation_p.V20I	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	20					cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TTGACTCCAACGGCAAAAGTG	0.388													60	181	---	---	---	---	PASS
ATAD2	29028	broad.mit.edu	37	8	124359381	124359381	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124359381C>T	uc003yqh.3	-	16	2271	c.2163G>A	c.(2161-2163)CAG>CAA	p.Q721Q	ATAD2_uc011lii.1_Silent_p.Q512Q|ATAD2_uc003yqi.3_RNA|ATAD2_uc003yqj.2_Silent_p.Q721Q	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	721					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GAAATACTCTCTGCAGGGCTT	0.403													39	119	---	---	---	---	PASS
SLA	6503	broad.mit.edu	37	8	134050794	134050794	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134050794G>A	uc003ytz.2	-	9	1638	c.806C>T	c.(805-807)TCA>TTA	p.S269L	TG_uc003ytw.2_Intron|TG_uc010mdw.2_Intron|TG_uc011ljb.1_Intron|TG_uc011ljc.1_Intron|SLA_uc011lje.1_Missense_Mutation_p.S286L|SLA_uc011ljf.1_Missense_Mutation_p.S161L|SLA_uc011ljg.1_Missense_Mutation_p.S242L|SLA_uc011ljd.1_Missense_Mutation_p.S309L	NM_001045556	NP_001039021	Q13239	SLAP1_HUMAN	Src-like-adaptor isoform a	269	SLA C-terminal.					endosome	SH3/SH2 adaptor activity			lung(1)|liver(1)	2	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			AGGTGGTGATGAGAAGAATGA	0.468													5	235	---	---	---	---	PASS
FOXD4	2298	broad.mit.edu	37	9	117888	117888	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117888C>T	uc003zfz.2	-	1	530	c.232G>A	c.(232-234)GAC>AAC	p.D78N		NM_207305	NP_997188	Q12950	FOXD4_HUMAN	forkhead box D4	78					axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		TCTGAGGGGTCGCTCGGGCCG	0.711													25	51	---	---	---	---	PASS
ZFAND5	7763	broad.mit.edu	37	9	74971875	74971875	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74971875G>T	uc004aiv.2	-	5	743	c.465C>A	c.(463-465)TTC>TTA	p.F155L	ZFAND5_uc010mox.1_Missense_Mutation_p.F52L|ZFAND5_uc010moy.1_Missense_Mutation_p.F155L|ZFAND5_uc004aix.2_Missense_Mutation_p.F155L|ZFAND5_uc004aiw.2_Missense_Mutation_p.F155L|ZFAND5_uc004aiy.2_Missense_Mutation_p.F155L	NM_006007	NP_005998	O76080	ZFAN5_HUMAN	zinc finger, AN1-type domain 5	155	AN1-type.						DNA binding|zinc ion binding				0						TTCTGCACATGAAACATCTGT	0.408													19	46	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84608577	84608577	+	Silent	SNP	G	C	C	rs142745921	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84608577G>C	uc004amn.2	+	4	3239	c.3192G>C	c.(3190-3192)CTG>CTC	p.L1064L		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	1064						integral to membrane					0						AGGGGACCCTGAGAAGAGAAT	0.458													39	81	---	---	---	---	PASS
OR1N1	138883	broad.mit.edu	37	9	125288641	125288641	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125288641G>A	uc004bmn.1	-	1	932	c.932C>T	c.(931-933)TCT>TTT	p.S311F		NM_012363	NP_036495	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N,	311	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)|breast(1)|skin(1)	3						CCACATCTAAGAGGAAACAAT	0.254													23	40	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15649714	15649714	+	Nonsense_Mutation	SNP	T	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15649714T>A	uc001ioc.1	-	17	1726	c.1726A>T	c.(1726-1728)AAA>TAA	p.K576*	ITGA8_uc010qcb.1_Nonsense_Mutation_p.K561*	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	576	Extracellular (Potential).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						TGGTGGGATTTCTGCCTTTTT	0.433													104	170	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27382726	27382726	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27382726G>A	uc001ith.2	-	2	417	c.245C>T	c.(244-246)ACG>ATG	p.T82M	ANKRD26_uc009xku.1_Missense_Mutation_p.T82M	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	82	ANK 2.					centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						ATGTAGAGCCGTCCTATGAGA	0.383													23	24	---	---	---	---	PASS
FAM21C	253725	broad.mit.edu	37	10	46265066	46265066	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46265066G>C	uc001jcu.2	+	20	2138	c.2039G>C	c.(2038-2040)AGC>ACC	p.S680T	FAM21C_uc001jcs.1_Missense_Mutation_p.S623T|FAM21C_uc001jct.2_Missense_Mutation_p.S678T|FAM21C_uc010qfi.1_Missense_Mutation_p.S656T|FAM21C_uc010qfj.1_5'UTR|FAM21C_uc010qfk.1_5'UTR	NM_015262	NP_056077	A8K5W5	A8K5W5_HUMAN	hypothetical protein LOC253725	680										ovary(1)	1						GCCAAGGACAGGTGAGATAGT	0.468													24	216	---	---	---	---	PASS
FRMPD2	143162	broad.mit.edu	37	10	49459669	49459669	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49459669C>A	uc001jgi.2	-	2	198	c.91G>T	c.(91-93)GAG>TAG	p.E31*	FRMPD2_uc001jgh.2_Nonsense_Mutation_p.E22*|FRMPD2_uc001jgj.2_Nonsense_Mutation_p.E31*	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	31	KIND.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)		CAGATTTCCTCCTCAGACAGA	0.577													25	35	---	---	---	---	PASS
SEC24C	9632	broad.mit.edu	37	10	75529101	75529101	+	Intron	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75529101C>T	uc001juw.2	+						SEC24C_uc009xrj.1_3'UTR|SEC24C_uc001jux.2_Intron|SEC24C_uc010qko.1_Intron|SEC24C_uc010qkp.1_Intron|SEC24C_uc010qkq.1_Intron|FUT11_uc001juy.1_5'Flank|FUT11_uc001juz.1_5'Flank|FUT11_uc001jva.2_5'Flank	NM_004922	NP_004913	P53992	SC24C_HUMAN	SEC24-related protein C						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	protein binding|zinc ion binding			skin(2)|central_nervous_system(1)	3	Prostate(51;0.0112)					CTCCTTTCCCCTAGTGTGCCC	0.552													6	18	---	---	---	---	PASS
CPN1	1369	broad.mit.edu	37	10	101835718	101835718	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101835718G>C	uc001kql.2	-	2	630	c.370C>G	c.(370-372)CAC>GAC	p.H124D		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	124	Catalytic.				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		GGCAGGATGTGAATGCGCGTG	0.607													24	34	---	---	---	---	PASS
PSD	5662	broad.mit.edu	37	10	104162953	104162953	+	3'UTR	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104162953C>T	uc001kvg.1	-	17					PSD_uc001kve.1_3'UTR|PSD_uc001kvf.1_3'UTR|PSD_uc001kvh.1_3'UTR|PSD_uc009xxd.1_3'UTR	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing						regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		CCCTAAACCTCATCTCAGGGC	0.711													8	7	---	---	---	---	PASS
XPNPEP1	7511	broad.mit.edu	37	10	111651526	111651526	+	Silent	SNP	G	C	C	rs149560401		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111651526G>C	uc001kyp.1	-	5	380	c.240C>G	c.(238-240)CTC>CTG	p.L80L	XPNPEP1_uc009xxt.1_Silent_p.L123L|XPNPEP1_uc001kyq.1_Silent_p.L9L|XPNPEP1_uc010qrb.1_Silent_p.L123L	NM_020383	NP_065116	Q9NQW7	XPP1_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 1,	80					bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity			ovary(3)|pancreas(1)	4		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		TGGCAGCCTGGAGAAAGTAGC	0.507													8	109	---	---	---	---	PASS
GPR123	84435	broad.mit.edu	37	10	134898389	134898389	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134898389G>T	uc001llw.2	+	8	1451	c.1451G>T	c.(1450-1452)GGG>GTG	p.G484V				Q86SQ6	GP123_HUMAN	RecName: Full=Probable G-protein coupled receptor 123;	233	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		ATCGCACCTGGGGCAGCAACA	0.607													3	38	---	---	---	---	PASS
PRAP1	118471	broad.mit.edu	37	10	135165615	135165615	+	Missense_Mutation	SNP	G	A	A	rs140360205		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135165615G>A	uc001lmp.2	+	4	311	c.233G>A	c.(232-234)CGA>CAA	p.R78Q	PRAP1_uc001lmr.2_Missense_Mutation_p.R78Q|PRAP1_uc001lmq.1_Missense_Mutation_p.R50Q	NM_145202	NP_660203	Q96NZ9	PRAP1_HUMAN	proline-rich acidic protein 1 isoform 1	78						extracellular region					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.08e-06)|OV - Ovarian serous cystadenocarcinoma(35;7.88e-06)|Epithelial(32;9.48e-06)		GAGAAGCCACGAGGTCAGGGC	0.637													21	35	---	---	---	---	PASS
CTNND1	1500	broad.mit.edu	37	11	57569478	57569478	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57569478C>T	uc001nmc.3	+	7	1801	c.1230C>T	c.(1228-1230)ATC>ATT	p.I410I	CTNND1_uc001nlh.1_Silent_p.I410I|CTNND1_uc001nlu.3_Silent_p.I309I|CTNND1_uc001nlt.3_Silent_p.I309I|CTNND1_uc001nls.3_Silent_p.I309I|CTNND1_uc001nlw.3_Silent_p.I309I|CTNND1_uc001nmf.3_Silent_p.I410I|CTNND1_uc001nmd.3_Silent_p.I356I|CTNND1_uc001nlk.3_Silent_p.I356I|CTNND1_uc001nme.3_Silent_p.I410I|CTNND1_uc001nll.3_Silent_p.I356I|CTNND1_uc001nmg.3_Silent_p.I356I|CTNND1_uc001nlj.3_Silent_p.I356I|CTNND1_uc001nlr.3_Silent_p.I356I|CTNND1_uc001nlp.3_Silent_p.I356I|CTNND1_uc001nlx.3_Silent_p.I87I|CTNND1_uc001nlz.3_Silent_p.I87I|CTNND1_uc009ymn.2_Silent_p.I87I|CTNND1_uc001nlm.3_Silent_p.I410I|CTNND1_uc001nly.3_Silent_p.I87I|CTNND1_uc001nmb.3_Silent_p.I87I|CTNND1_uc001nma.3_Silent_p.I87I|CTNND1_uc001nmi.3_Silent_p.I309I|CTNND1_uc001nmh.3_Silent_p.I410I|CTNND1_uc001nlq.3_Silent_p.I309I|CTNND1_uc001nln.3_Silent_p.I410I|CTNND1_uc001nli.3_Silent_p.I410I|CTNND1_uc001nlo.3_Silent_p.I309I|CTNND1_uc001nlv.3_Silent_p.I309I	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC	410	ARM 2.				adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				TCAAGGGCATCCCAGTACTGG	0.502													28	84	---	---	---	---	PASS
WDR74	54663	broad.mit.edu	37	11	62601346	62601346	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62601346G>C	uc001nvm.1	-	10	1007	c.839C>G	c.(838-840)TCA>TGA	p.S280*	STX5_uc001nvh.2_5'Flank|STX5_uc010rmi.1_5'Flank|STX5_uc009yoh.2_5'Flank|STX5_uc001nvi.2_5'Flank|STX5_uc010rmj.1_5'Flank|STX5_uc001nvj.2_5'Flank|WDR74_uc001nvk.1_Nonsense_Mutation_p.S223*|WDR74_uc001nvl.1_Nonsense_Mutation_p.S280*|WDR74_uc001nvn.1_Nonsense_Mutation_p.S332*|WDR74_uc009yoi.1_Nonsense_Mutation_p.S280*	NM_018093	NP_060563	Q6RFH5	WDR74_HUMAN	WD repeat domain 74	280	WD 6.					nucleolus				ovary(1)	1						TAGAGGCTTTGAAGGGTGGCA	0.572													31	19	---	---	---	---	PASS
SAPS3	55291	broad.mit.edu	37	11	68341595	68341595	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68341595G>A	uc001onw.2	+	13	1629	c.1362G>A	c.(1360-1362)CGG>CGA	p.R454R	SAPS3_uc001onv.2_Silent_p.R454R|SAPS3_uc001ony.3_Silent_p.R454R|SAPS3_uc001onx.2_Silent_p.R454R|SAPS3_uc009ysh.2_Silent_p.R403R|SAPS3_uc001onu.2_Silent_p.R403R|SAPS3_uc010rqc.1_Silent_p.R222R|SAPS3_uc010rqd.1_Silent_p.R166R|SAPS3_uc001onz.2_5'Flank	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6	454					regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			GAGGAAGACGGCATGGTTACA	0.468													3	55	---	---	---	---	PASS
C2CD3	26005	broad.mit.edu	37	11	73785628	73785628	+	Missense_Mutation	SNP	C	T	T	rs111402521		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73785628C>T	uc001ouu.2	-	24	4848	c.4621G>A	c.(4621-4623)GGA>AGA	p.G1541R	C2CD3_uc001out.2_RNA	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1541						centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					GCATTTCGTCCAAACAGAGGA	0.488													5	4	---	---	---	---	PASS
CUL5	8065	broad.mit.edu	37	11	107943062	107943062	+	Nonsense_Mutation	SNP	T	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107943062T>G	uc001pjv.2	+	9	1545	c.878T>G	c.(877-879)TTA>TGA	p.L293*	CUL5_uc001pju.2_RNA	NM_003478	NP_003469	Q93034	CUL5_HUMAN	Vasopressin-activated calcium-mobilizing	293					cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding			ovary(1)	1		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		CTTCCAGAATTACATTTAATG	0.333													20	17	---	---	---	---	PASS
ZNF384	171017	broad.mit.edu	37	12	6776900	6776900	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6776900C>A	uc010sfh.1	-	11	1922	c.1714G>T	c.(1714-1716)GAG>TAG	p.E572*	ZNF384_uc001qpz.2_Nonsense_Mutation_p.E511*|ZNF384_uc001qqa.2_Nonsense_Mutation_p.E511*|ZNF384_uc001qqb.2_Nonsense_Mutation_p.E495*|ZNF384_uc001qqc.2_Nonsense_Mutation_p.E511*|ZNF384_uc001qqd.2_Nonsense_Mutation_p.E456*|ZNF384_uc001qqe.2_Nonsense_Mutation_p.E495*	NM_001135734	NP_001129206	Q8TF68	ZN384_HUMAN	nuclear matrix transcription factor 4 isoform d	572					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding		EWSR1/ZNF384(4)	haematopoietic_and_lymphoid_tissue(4)|central_nervous_system(3)|kidney(1)	8						GCCAGGTGCTCCACCTGGATG	0.557			T	EWSR1|TAF15 	ALL								71	218	---	---	---	---	PASS
FOXJ2	55810	broad.mit.edu	37	12	8195264	8195264	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8195264G>A	uc001qtu.2	+	3	1429	c.344G>A	c.(343-345)CGG>CAG	p.R115Q	FOXJ2_uc001qtt.1_Missense_Mutation_p.R115Q	NM_018416	NP_060886	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	115	Fork-head.				embryo development|organ development|pattern specification process|positive regulation of transcription, DNA-dependent|regulation of sequence-specific DNA binding transcription factor activity|tissue development	nucleolus|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding	p.R115R(1)		upper_aerodigestive_tract(2)|ovary(2)|skin(1)	5				Kidney(36;0.0944)		AATTCAATACGGCACAACCTT	0.458													47	32	---	---	---	---	PASS
PHC1	1911	broad.mit.edu	37	12	9085316	9085316	+	Silent	SNP	C	G	G	rs71447543		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9085316C>G	uc001qvd.2	+	8	1419	c.1263C>G	c.(1261-1263)CTC>CTG	p.L421L	PHC1_uc001qvc.1_Silent_p.L376L|PHC1_uc010sgn.1_Silent_p.L421L|PHC1_uc001qve.2_Silent_p.L421L	NM_004426	NP_004417	P78364	PHC1_HUMAN	polyhomeotic 1-like	421					multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						CTACACACCTCCAGTTGGCgc	0.458													5	40	---	---	---	---	PASS
AQP2	359	broad.mit.edu	37	12	50348450	50348450	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50348450C>T	uc001rvn.2	+	3	653	c.563C>T	c.(562-564)TCC>TTC	p.S188F	AQP2_uc009zll.1_5'Flank	NM_000486	NP_000477	P41181	AQP2_HUMAN	aquaporin 2	188	Extracellular (Potential).				cellular response to copper ion|cellular response to mercury ion|excretion	apical plasma membrane|integral to membrane|transport vesicle membrane	glycerol transmembrane transporter activity|water channel activity			ovary(2)	2						CCTGCCCGCTCCCTGGCTCCA	0.552													27	209	---	---	---	---	PASS
LETMD1	25875	broad.mit.edu	37	12	51442848	51442848	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51442848G>A	uc001rxm.2	+	2	210	c.154G>A	c.(154-156)GAT>AAT	p.D52N	LETMD1_uc010smz.1_Missense_Mutation_p.D52N|LETMD1_uc010sna.1_Missense_Mutation_p.D52N|LETMD1_uc001rxl.2_5'UTR|LETMD1_uc009zlv.2_RNA|LETMD1_uc001rxs.2_Missense_Mutation_p.D52N|LETMD1_uc009zlw.2_Missense_Mutation_p.D52N|LETMD1_uc001rxn.2_5'UTR|LETMD1_uc001rxo.2_RNA|LETMD1_uc001rxp.2_Intron|LETMD1_uc001rxq.2_Missense_Mutation_p.D52N|LETMD1_uc001rxr.2_RNA|LETMD1_uc001rxt.2_5'UTR	NM_015416	NP_056231	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1 isoform 1	52	Cytoplasmic (Potential).|Required and sufficient for mitochondrial import.					integral to membrane|mitochondrial outer membrane	protein binding			central_nervous_system(2)	2						TCCAAAGGCAGATGTGAAGAA	0.448													132	49	---	---	---	---	PASS
KRT6B	3854	broad.mit.edu	37	12	52843273	52843273	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52843273C>G	uc001sak.2	-	5	1105	c.1057G>C	c.(1057-1059)GAG>CAG	p.E353Q		NM_005555	NP_005546	P04259	K2C6B_HUMAN	keratin 6B	353	Rod.|Coil 2.				ectoderm development	keratin filament	structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.083)		TACCAGGACTCAGCCTCAGCC	0.562													50	128	---	---	---	---	PASS
EIF4B	1975	broad.mit.edu	37	12	53415649	53415649	+	Intron	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53415649G>A	uc001sbh.3	+						EIF4B_uc009zmp.1_Intron|EIF4B_uc010snu.1_Intron|EIF4B_uc010snv.1_Intron|EIF4B_uc001sbi.2_Intron	NM_001417	NP_001408	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B						insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity			breast(1)|kidney(1)	2						ATAAAGGTAAGGAAACTGGTA	0.458													25	60	---	---	---	---	PASS
BAZ2A	11176	broad.mit.edu	37	12	56993982	56993982	+	Intron	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56993982C>G	uc001slq.1	-						BAZ2A_uc001slp.1_Intron|BAZ2A_uc001slo.1_Intron|BAZ2A_uc009zov.1_Intron|BAZ2A_uc009zow.1_Intron	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A						chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0						GGGAGTCACTCACATCTCTGT	0.547													21	18	---	---	---	---	PASS
KIAA1033	23325	broad.mit.edu	37	12	105538628	105538628	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105538628T>A	uc001tld.2	+	22	2399	c.2312T>A	c.(2311-2313)CTT>CAT	p.L771H	KIAA1033_uc010swr.1_Missense_Mutation_p.L772H|KIAA1033_uc010sws.1_Missense_Mutation_p.L583H	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	771					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						GAGGCACATCTTCCCAGTCAG	0.383													60	120	---	---	---	---	PASS
FGF9	2254	broad.mit.edu	37	13	22246199	22246199	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:22246199G>C	uc001uog.2	+	1	985	c.148G>C	c.(148-150)GCA>CCA	p.A50P		NM_002010	NP_002001	P31371	FGF9_HUMAN	fibroblast growth factor 9 precursor	50					cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|male gonad development|positive regulation of cell division	extracellular space	growth factor activity|heparin binding				0		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		CAGGGGACCCGCAGTCACGGA	0.557													24	62	---	---	---	---	PASS
DCLK1	9201	broad.mit.edu	37	13	36686001	36686001	+	Intron	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36686001C>G	uc001uvf.2	-							NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1						cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CAATATGTCTCTTACCTGTTT	0.488													35	55	---	---	---	---	PASS
LAMP1	3916	broad.mit.edu	37	13	113975993	113975993	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113975993C>G	uc001vtm.1	+	8	1346	c.1065C>G	c.(1063-1065)TTC>TTG	p.F355L	LAMP1_uc010tka.1_Missense_Mutation_p.F302L	NM_005561	NP_005552	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	355	Lumenal (Potential).|Second lumenal domain.					endosome membrane|integral to plasma membrane|lysosomal membrane|membrane fraction				central_nervous_system(2)	2	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			TCAATATATTCAAAGTGTGGG	0.587													29	57	---	---	---	---	PASS
SALL2	6297	broad.mit.edu	37	14	21991427	21991427	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21991427A>C	uc001wbe.2	-	2	2717	c.2435T>G	c.(2434-2436)GTG>GGG	p.V812G	SALL2_uc010tly.1_Missense_Mutation_p.V810G|SALL2_uc010tlz.1_Missense_Mutation_p.V675G|SALL2_uc001wbf.3_Intron|SALL2_uc010tma.1_Missense_Mutation_p.V677G|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	812							DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CACTGTCCCCACCTCCTCCTC	0.552													6	46	---	---	---	---	PASS
CPNE6	9362	broad.mit.edu	37	14	24545480	24545480	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24545480G>A	uc001wll.2	+	11	1146	c.1047G>A	c.(1045-1047)CAG>CAA	p.Q349Q	CPNE6_uc010tnv.1_Silent_p.Q404Q|CPNE6_uc001wlm.2_Silent_p.Q174Q|CPNE6_uc001wln.2_5'UTR	NM_006032	NP_006023	O95741	CPNE6_HUMAN	copine 6	349	VWFA.				lipid metabolic process|nervous system development|synaptic transmission|vesicle-mediated transport		calcium ion binding|transporter activity			skin(2)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.0184)		GCATCTGCCAGGACTATGACA	0.622													7	65	---	---	---	---	PASS
FAM158A	51016	broad.mit.edu	37	14	24608392	24608392	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24608392C>T	uc001wmi.2	-	6	617	c.454G>A	c.(454-456)GAC>AAC	p.D152N		NM_016049	NP_057133	Q9Y3B6	F158A_HUMAN	hypothetical protein LOC51016	152											0						TCTTCCCAGTCCCTCCACATC	0.532													20	161	---	---	---	---	PASS
KIAA0317	9870	broad.mit.edu	37	14	75151318	75151318	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75151318G>T	uc001xqb.2	-	4	587	c.82C>A	c.(82-84)CGT>AGT	p.R28S	KIAA0317_uc010tut.1_Intron|KIAA0317_uc001xqc.2_Missense_Mutation_p.R28S|KIAA0317_uc001xqd.1_Intron	NM_001039479	NP_001034568	O15033	K0317_HUMAN	hypothetical protein LOC9870	28					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	integral to membrane|intracellular	ubiquitin-protein ligase activity			ovary(2)|kidney(1)|central_nervous_system(1)|pancreas(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00404)		CTGACTACACGTGCGGCAAGC	0.517													16	57	---	---	---	---	PASS
C14orf145	145508	broad.mit.edu	37	14	80997191	80997191	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80997191C>G	uc001xux.2	-	21	3091	c.2920G>C	c.(2920-2922)GAG>CAG	p.E974Q	C14orf145_uc010asz.1_RNA	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508	974						centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		CTCAGTTTCTCAGGCACAGAC	0.378													21	95	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102466695	102466695	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102466695C>T	uc001yks.2	+	18	4197	c.4033C>T	c.(4033-4035)CAG>TAG	p.Q1345*		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	1345	Stem (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GCAAATCGATCAGATGAAGGA	0.413													76	71	---	---	---	---	PASS
GPR132	29933	broad.mit.edu	37	14	105521759	105521759	+	5'UTR	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105521759C>A	uc001yqd.2	-	3					GPR132_uc001yqc.2_5'UTR|GPR132_uc001yqe.2_Intron|GPR132_uc010axe.1_RNA	NM_013345	NP_037477	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132						response to stress	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)	3		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		tgggcacattcacattcttct	0.015													40	183	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35235415	35235415	+	Intron	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35235415G>C	uc001ziv.2	-							NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius							catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		ACAGGAAGCAGAGTGGCTATG	0.468													13	144	---	---	---	---	PASS
PPIP5K1	9677	broad.mit.edu	37	15	43873496	43873496	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43873496C>G	uc001zrw.2	-	9	1051	c.868G>C	c.(868-870)GAG>CAG	p.E290Q	PPIP5K1_uc001zrx.1_Missense_Mutation_p.E290Q|PPIP5K1_uc001zru.2_Missense_Mutation_p.E290Q|PPIP5K1_uc001zry.3_Missense_Mutation_p.E290Q|PPIP5K1_uc001zrv.2_Missense_Mutation_p.E290Q|PPIP5K1_uc001zrz.1_Missense_Mutation_p.E290Q|PPIP5K1_uc010udr.1_Missense_Mutation_p.E290Q	NM_001130858	NP_001124330	Q6PFW1	VIP1_HUMAN	histidine acid phosphatase domain containing 2A	290					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity				0						TATCGAATCTCTTTCCCCTCA	0.512													59	376	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	62942299	62942299	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62942299C>T	uc002alb.3	+	2	153	c.153C>T	c.(151-153)CTC>CTT	p.L51L		NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	51					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						ACTATGGACTCTTTCTTTCGG	0.488													53	160	---	---	---	---	PASS
CYP1A2	1544	broad.mit.edu	37	15	75043653	75043653	+	Intron	SNP	A	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75043653A>G	uc002ayr.1	+							NM_000761	NP_000752	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A,						alkaloid metabolic process|exogenous drug catabolic process|methylation|monocarboxylic acid metabolic process|monoterpenoid metabolic process|oxidative deethylation|oxidative demethylation|steroid catabolic process|toxin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|caffeine oxidase activity|demethylase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding			ovary(3)|breast(1)	4					Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Aciclovir(DB00787)|Alosetron(DB00969)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Anagrelide(DB00261)|Azelastine(DB00972)|Bortezomib(DB00188)|Caffeine(DB00201)|Carmustine(DB00262)|Chlordiazepoxide(DB00475)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Ciprofloxacin(DB00537)|Clomipramine(DB01242)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Desloratadine(DB00967)|Diazepam(DB00829)|Dibucaine(DB00527)|Diclofenac(DB00586)|Duloxetine(DB00476)|Enoxacin(DB00467)|Esomeprazole(DB00736)|Estradiol(DB00783)|Estrone(DB00655)|Fluorouracil(DB00544)|Flutamide(DB00499)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Grepafloxacin(DB00365)|Haloperidol(DB00502)|Hesperetin(DB01094)|Imipramine(DB00458)|Ketoconazole(DB01026)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Melatonin(DB01065)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mirtazapine(DB00370)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pefloxacin(DB00487)|Pimozide(DB01100)|Propafenone(DB01182)|Propranolol(DB00571)|Quinidine(DB00908)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifampin(DB01045)|Riluzole(DB00740)|Rofecoxib(DB00533)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Tacrine(DB00382)|Telithromycin(DB00976)|Terfenadine(DB00342)|Theophylline(DB00277)|Thiabendazole(DB00730)|Tizanidine(DB00697)|Tolbutamide(DB01124)|Verapamil(DB00661)|Warfarin(DB00682)|Zileuton(DB00744)|Zolmitriptan(DB00315)	TGGAGCAGGTAGGAACCAGAA	0.547													3	81	---	---	---	---	PASS
CTSH	1512	broad.mit.edu	37	15	79217722	79217722	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79217722C>G	uc002ben.2	-	11	821	c.724G>C	c.(724-726)GAG>CAG	p.E242Q	CTSH_uc010unf.1_RNA|CTSH_uc010bll.1_Missense_Mutation_p.E94Q	NM_148979	NP_683880	P09668	CATH_HUMAN	cathepsin H isoform b precursor	254					protein destabilization|proteolysis	lysosome	cysteine-type endopeptidase activity			central_nervous_system(2)|large_intestine(1)	3						TGAGTCACCTCAAAGGCAAAG	0.572													30	31	---	---	---	---	PASS
ARNT2	9915	broad.mit.edu	37	15	80806328	80806328	+	Intron	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80806328C>G	uc002bfr.2	+						ARNT2_uc010unm.1_Intron|ARNT2_uc002bfs.2_Intron	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator						central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			GTCAGTATCTCTTCCGATGTA	0.433													14	56	---	---	---	---	PASS
MAPK8IP3	23162	broad.mit.edu	37	16	1793357	1793357	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1793357G>A	uc002cmk.2	+	5	744	c.624G>A	c.(622-624)CTG>CTA	p.L208L	MAPK8IP3_uc002cmi.1_Silent_p.L208L|MAPK8IP3_uc002cmj.1_RNA|MAPK8IP3_uc002cml.2_Silent_p.L208L|MAPK8IP3_uc010uvl.1_Silent_p.L209L	NM_015133	NP_055948	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting	208					vesicle-mediated transport	Golgi membrane	kinesin binding|MAP-kinase scaffold activity|protein kinase binding			breast(2)|central_nervous_system(1)	3						CCACCTCCCTGAACGTGTTCC	0.657													29	13	---	---	---	---	PASS
ABCC1	4363	broad.mit.edu	37	16	16149944	16149944	+	Intron	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16149944C>T	uc010bvi.2	+						ABCC1_uc010bvj.2_Intron|ABCC1_uc010bvk.2_Intron|ABCC1_uc010bvl.2_Intron|ABCC1_uc010bvm.2_Intron|ABCC1_uc002del.3_Intron|ABCC1_uc010bvn.2_Intron	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1						hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	CCCGTCTCTTCCAAGGTGGCC	0.458													17	104	---	---	---	---	PASS
UBFD1	56061	broad.mit.edu	37	16	23573950	23573950	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23573950G>A	uc002dlv.2	+	5	837	c.635G>A	c.(634-636)CGC>CAC	p.R212H		NM_019116	NP_061989	O14562	UBFD1_HUMAN	ubiquitin-binding protein homolog	212											0				GBM - Glioblastoma multiforme(48;0.0331)		CTTCAGGAGCGCCTGCCAACG	0.388													35	21	---	---	---	---	PASS
GDPD3	79153	broad.mit.edu	37	16	30119759	30119759	+	Intron	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30119759G>A	uc002dwp.2	-						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|GDPD3_uc002dwq.2_Intron	NM_024307	NP_077283	Q7L5L3	GDPD3_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding				0						AGGTCCTGCAGAGAGAAGGAA	0.602													44	67	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30721367	30721367	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30721367C>G	uc002dze.1	+	8	1437	c.1052C>G	c.(1051-1053)TCT>TGT	p.S351C	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.S208C|SRCAP_uc010bzz.1_5'UTR|SNORA30_uc002dzh.1_5'Flank	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	351	Glu-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			TCCAGCCCCTCTCAAACCCCC	0.577													3	26	---	---	---	---	PASS
C16orf70	80262	broad.mit.edu	37	16	67179511	67179511	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67179511G>A	uc002erc.2	+	15	1173	c.1089G>A	c.(1087-1089)GAG>GAA	p.E363E	C16orf70_uc002erd.2_Silent_p.E363E	NM_025187	NP_079463	Q9BSU1	CP070_HUMAN	lin-10	363										ovary(2)	2		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		ACCCTGTGGAGAAGCCTGTTG	0.597													9	74	---	---	---	---	PASS
NUTF2	10204	broad.mit.edu	37	16	67902253	67902253	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67902253C>T	uc002eup.2	+	3	209	c.110C>T	c.(109-111)TCA>TTA	p.S37L	NUTF2_uc010vkf.1_Missense_Mutation_p.S37L|NUTF2_uc002euq.3_5'Flank	NM_005796	NP_005787	P61970	NTF2_HUMAN	nuclear transport factor 2	37	NTF2.				protein transport	cytosol|nuclear pore	protein binding|transporter activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00443)|Epithelial(162;0.0199)|all cancers(182;0.129)		ATTGACGCGTCATGCCTTACG	0.522													16	71	---	---	---	---	PASS
NUTF2	10204	broad.mit.edu	37	16	67902436	67902436	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67902436C>T	uc002eup.2	+	4	303	c.204C>T	c.(202-204)ATC>ATT	p.I68I	NUTF2_uc010vkf.1_Missense_Mutation_p.S98L|NUTF2_uc002euq.3_5'Flank	NM_005796	NP_005787	P61970	NTF2_HUMAN	nuclear transport factor 2	68	NTF2.				protein transport	cytosol|nuclear pore	protein binding|transporter activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00443)|Epithelial(162;0.0199)|all cancers(182;0.129)		AGCACAGCATCACCGCGCAGG	0.572													50	246	---	---	---	---	PASS
IRF8	3394	broad.mit.edu	37	16	85946813	85946813	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85946813C>T	uc002fjh.2	+	5	581	c.524C>T	c.(523-525)CCA>CTA	p.P175L	IRF8_uc010chp.2_Intron	NM_002163	NP_002154	Q02556	IRF8_HUMAN	interferon regulatory factor 8	175					interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			breast(2)|ovary(1)	3		Prostate(104;0.0771)				CAGCTCCTTCCAGACTGGTGG	0.617													10	108	---	---	---	---	PASS
DEF8	54849	broad.mit.edu	37	16	90020648	90020648	+	Intron	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90020648C>G	uc002fpn.1	+						DEF8_uc002fpl.2_Intron|DEF8_uc002fpm.2_Intron|DEF8_uc002fpo.1_Intron|DEF8_uc002fpp.1_Intron|DEF8_uc010vpq.1_Intron|DEF8_uc010vpr.1_Intron	NM_207514	NP_997397	Q6ZN54	DEFI8_HUMAN	differentially expressed in FDCP 8 isoform 1						intracellular signal transduction		zinc ion binding			central_nervous_system(1)	1		all_cancers(9;7.59e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.0019)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0274)		GCCTGGCCCTCAGGTGGGATG	0.632													19	65	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1562854	1562854	+	Intron	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1562854G>A	uc002fte.2	-							NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein							catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TGAGGATGAAGAGGGTTCAAG	0.507													53	30	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1563124	1563124	+	Intron	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1563124G>C	uc002fte.2	-							NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein							catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GCTGGGTCCTGAGGCACTTAC	0.493													28	29	---	---	---	---	PASS
C17orf49	124944	broad.mit.edu	37	17	6919820	6919820	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6919820G>A	uc002gec.2	+	6	1125	c.225G>A	c.(223-225)CAG>CAA	p.Q75Q	C17orf49_uc002geb.3_Silent_p.Q136Q|C17orf49_uc002ged.2_Silent_p.Q75Q|C17orf49_uc002gee.2_Silent_p.Q75Q|C17orf49_uc010vti.1_Silent_p.Q41Q	NM_174893	NP_777553	Q8IXM2	BAP18_HUMAN	hypothetical protein LOC124944 isoform 2	75	SANT.				chromatin modification	MLL1 complex|NURF complex	DNA binding			large_intestine(1)	1						TCAGGGCCCAGATAAAGGCCA	0.522													120	116	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578382	7578382	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578382G>C	uc002gim.2	-	5	742	c.548C>G	c.(547-549)TCA>TGA	p.S183*	TP53_uc002gig.1_Nonsense_Mutation_p.S183*|TP53_uc002gih.2_Nonsense_Mutation_p.S183*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.S51*|TP53_uc010cng.1_Nonsense_Mutation_p.S51*|TP53_uc002gii.1_Nonsense_Mutation_p.S51*|TP53_uc010cnh.1_Nonsense_Mutation_p.S183*|TP53_uc010cni.1_Nonsense_Mutation_p.S183*|TP53_uc002gij.2_Nonsense_Mutation_p.S183*|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Nonsense_Mutation_p.S90*|TP53_uc002gio.2_Nonsense_Mutation_p.S51*|TP53_uc010vug.1_Nonsense_Mutation_p.S144*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	183	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		S -> P (in sporadic cancers; somatic mutation).|S -> L (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.S183*(21)|p.0?(7)|p.R174fs*24(3)|p.S183P(3)|p.?(2)|p.S183L(2)|p.V173fs*59(2)|p.K164_P219del(1)|p.E180_S183del(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R81fs*24(1)|p.R42fs*24(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ATCGCTATCTGAGCAGCGCTC	0.647		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			29	23	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7690336	7690336	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7690336C>T	uc002giu.1	+	41	6602	c.6588C>T	c.(6586-6588)ATC>ATT	p.I2196I		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2196	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCGAGCGCATCGCGATGCCCG	0.637													10	25	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10400712	10400712	+	Missense_Mutation	SNP	G	C	C	rs139132394		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10400712G>C	uc002gmo.2	-	32	4517	c.4423C>G	c.(4423-4425)CAA>GAA	p.Q1475E	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1475	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						GATTCCTTTTGAGAAGCTTCA	0.378													20	67	---	---	---	---	PASS
TOM1L2	146691	broad.mit.edu	37	17	17772740	17772740	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17772740G>A	uc002grz.3	-	8	982	c.825C>T	c.(823-825)CTC>CTT	p.L275L	TOM1L2_uc002gry.3_Silent_p.L225L|TOM1L2_uc010vwy.1_Silent_p.L222L|TOM1L2_uc010cpr.2_Silent_p.L230L|TOM1L2_uc010vwz.1_Silent_p.L127L|TOM1L2_uc010vxa.1_Silent_p.L177L|TOM1L2_uc010vxb.1_Silent_p.L225L|TOM1L2_uc002grv.3_Silent_p.L8L	NM_001082968	NP_001076437	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 isoform 3	275	GAT.				intracellular protein transport	intracellular					0	all_neural(463;0.228)					CGCGGGAGATGAGCTCCACGA	0.577													29	30	---	---	---	---	PASS
RNF135	84282	broad.mit.edu	37	17	29314963	29314963	+	Missense_Mutation	SNP	C	G	G	rs141191751	byFrequency	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29314963C>G	uc002hfz.2	+	3	654	c.518C>G	c.(517-519)GCT>GGT	p.A173G	RNF135_uc002hga.2_Intron|RNF135_uc010csm.2_Missense_Mutation_p.A173G|RNF135_uc002hgb.2_Intron	NM_032322	NP_115698	Q8IUD6	RN135_HUMAN	ring finger protein 135 isoform 1	173					innate immune response|negative regulation of type I interferon production|positive regulation of interferon-beta production|regulation of innate immune response	cytosol	protein binding|ribonucleoprotein binding|ubiquitin-protein ligase activity|zinc ion binding	p.?(1)		skin(2)	2		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				TATCAATAGGCTTTTTCTTCT	0.363													61	96	---	---	---	---	PASS
TADA2A	6871	broad.mit.edu	37	17	35804840	35804840	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35804840T>G	uc002hnt.2	+	8	731	c.574T>G	c.(574-576)TTT>GTT	p.F192V	TADA2A_uc002hnu.1_Missense_Mutation_p.F192V|TADA2A_uc002hnv.2_Missense_Mutation_p.F192V|TADA2A_uc010wdd.1_Missense_Mutation_p.F192V|TADA2A_uc002hnw.2_Missense_Mutation_p.F91V|TADA2A_uc010cvb.2_Translation_Start_Site	NM_001488	NP_001479	O75478	TAD2A_HUMAN	transcriptional adaptor 2A isoform a	192					histone H3 acetylation|transcription from RNA polymerase II promoter	chromosome|PCAF complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity|zinc ion binding			breast(3)|skin(1)	4						AGACATTGATTTTGTTGAAGA	0.279													208	236	---	---	---	---	PASS
GRN	2896	broad.mit.edu	37	17	42427876	42427876	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42427876C>T	uc002igp.1	+	6	748	c.529C>T	c.(529-531)CGC>TGC	p.R177C	GRN_uc002igq.1_3'UTR|GRN_uc002igr.1_5'UTR	NM_002087	NP_002078	P28799	GRN_HUMAN	granulin precursor	177					signal transduction	extracellular space	cytokine activity|growth factor activity			ovary(2)|central_nervous_system(2)|skin(1)	5		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GGTTCACACCCGCTGCATCAC	0.622											OREG0024459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	51	192	---	---	---	---	PASS
ABCC3	8714	broad.mit.edu	37	17	48761448	48761448	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48761448C>T	uc002isl.2	+	28	4173	c.4093C>T	c.(4093-4095)CAG>TAG	p.Q1365*	ABCC3_uc002isn.2_Nonsense_Mutation_p.Q119*	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	1365	Cytoplasmic (By similarity).|ABC transporter 2.				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	CCTGCGCTCTCAGCTGACCAT	0.602													5	42	---	---	---	---	PASS
SPAG9	9043	broad.mit.edu	37	17	49054561	49054561	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49054561G>C	uc002itc.2	-	27	3640	c.3431C>G	c.(3430-3432)TCT>TGT	p.S1144C	SPAG9_uc002itb.2_Missense_Mutation_p.S1130C|SPAG9_uc002itd.2_Missense_Mutation_p.S1134C|SPAG9_uc002ita.2_Missense_Mutation_p.S987C	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1	1144					positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			TCTCACAAAAGAGAAGCCCAG	0.403													50	126	---	---	---	---	PASS
TUBD1	51174	broad.mit.edu	37	17	57958298	57958298	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57958298G>C	uc002ixw.1	-	4	772	c.494C>G	c.(493-495)TCA>TGA	p.S165*	TUBD1_uc010ddf.1_Nonsense_Mutation_p.S165*|TUBD1_uc010ddg.1_Nonsense_Mutation_p.S130*|TUBD1_uc010ddh.1_Nonsense_Mutation_p.S46*|TUBD1_uc010wok.1_Nonsense_Mutation_p.S165*|TUBD1_uc002ixx.1_Nonsense_Mutation_p.S165*|TUBD1_uc010wol.1_Intron|TUBD1_uc010ddi.1_Intron	NM_016261	NP_057345	Q9UJT1	TBD_HUMAN	delta-tubulin	165					cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)			CATTTTCAATGAGTTTGAGTA	0.343													159	232	---	---	---	---	PASS
TBX4	9496	broad.mit.edu	37	17	59557640	59557640	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59557640G>C	uc002izi.2	+	7	1026	c.981G>C	c.(979-981)CAG>CAC	p.Q327H	TBX4_uc010ddo.2_Missense_Mutation_p.Q327H|TBX4_uc010woy.1_Missense_Mutation_p.Q327H	NM_018488	NP_060958	P57082	TBX4_HUMAN	T-box 4	327					leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						TTCCCACCCAGAGGGACTCAA	0.617													11	22	---	---	---	---	PASS
OTOP3	347741	broad.mit.edu	37	17	72943105	72943105	+	Silent	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72943105C>A	uc010wrr.1	+	6	1155	c.1155C>A	c.(1153-1155)ACC>ACA	p.T385T	OTOP3_uc010wrq.1_Silent_p.T367T	NM_178233	NP_839947	Q7RTS5	OTOP3_HUMAN	otopetrin 3	385	Helical; (Potential).					integral to membrane|intracellular	zinc ion binding			ovary(1)	1	all_lung(278;0.151)|Lung NSC(278;0.185)					TGCTGCCCACCATGAGTCTGG	0.597													4	76	---	---	---	---	PASS
TRIM47	91107	broad.mit.edu	37	17	73871532	73871532	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73871532C>G	uc002jpw.2	-	5	1252	c.1225G>C	c.(1225-1227)GAG>CAG	p.E409Q	TRIM47_uc002jpv.2_Missense_Mutation_p.E171Q	NM_033452	NP_258411	Q96LD4	TRI47_HUMAN	tripartite motif-containing 47	409						cytoplasm|nucleus	zinc ion binding			ovary(2)|prostate(1)|lung(1)|breast(1)	5			Epithelial(20;4.23e-06)|all cancers(21;5.24e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTCGTACTCTCGAGGTCTTGG	0.597													15	55	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18562727	18562727	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18562727G>A	uc002kte.2	-	21	3497	c.2556C>T	c.(2554-2556)TTC>TTT	p.F852F		NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein	852	Glu-rich.				actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					CACTTACCGAGAAATATTGCT	0.343													24	58	---	---	---	---	PASS
CTAGE1	64693	broad.mit.edu	37	18	19996994	19996994	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19996994A>T	uc002ktv.1	-	1	885	c.781T>A	c.(781-783)TTG>ATG	p.L261M		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	261						integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					TCTAATTCCAAGTTATCATCA	0.368													8	124	---	---	---	---	PASS
REXO1	57455	broad.mit.edu	37	19	1827430	1827430	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1827430C>T	uc002lua.3	-	2	1453	c.1358G>A	c.(1357-1359)CGG>CAG	p.R453Q	REXO1_uc010dsr.1_Missense_Mutation_p.R407Q	NM_020695	NP_065746	Q8N1G1	REXO1_HUMAN	transcription elongation factor B polypeptide 3	453						nucleus	exonuclease activity|nucleic acid binding				0		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCGCTGGCCGGTCAGGCCT	0.731													4	4	---	---	---	---	PASS
EEF2	1938	broad.mit.edu	37	19	3977937	3977937	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3977937G>A	uc002lze.2	-	12	2030	c.1947C>T	c.(1945-1947)ATC>ATT	p.I649I		NM_001961	NP_001952	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	649						cytosol|ribonucleoprotein complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAAGCACCAGATCTTGCGGG	0.632													4	35	---	---	---	---	PASS
ZNF846	162993	broad.mit.edu	37	19	9868675	9868675	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9868675G>T	uc002mmb.1	-	6	1609	c.1078C>A	c.(1078-1080)CAC>AAC	p.H360N	ZNF846_uc010xky.1_Intron|ZNF846_uc010xkz.1_Intron|ZNF846_uc010dww.2_Intron|ZNF846_uc002mmc.1_Missense_Mutation_p.H231N	NM_001077624	NP_001071092	Q147U1	ZN846_HUMAN	zinc finger protein 846	360	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						TCTCCACTGTGAATCCTTACA	0.388													8	81	---	---	---	---	PASS
ZNF433	163059	broad.mit.edu	37	19	12125757	12125757	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12125757C>G	uc002msy.1	-	4	2096	c.1925G>C	c.(1924-1926)GGA>GCA	p.G642A	uc002msx.1_Intron|ZNF433_uc002msz.1_Missense_Mutation_p.G607A	NM_001080411	NP_001073880	Q8N7K0	ZN433_HUMAN	zinc finger protein 433	642					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGGTTTCTCTCCAGTGTGAGT	0.418													31	15	---	---	---	---	PASS
CYP4F11	57834	broad.mit.edu	37	19	16045204	16045204	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16045204G>A	uc002nbu.2	-	2	51	c.15C>T	c.(13-15)AGC>AGT	p.S5S	CYP4F11_uc010eab.1_Silent_p.S5S|CYP4F11_uc002nbt.2_Silent_p.S5S	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	5					inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1						GCCAGGACAGGCTCAGCTGCG	0.692													5	20	---	---	---	---	PASS
ARMC6	93436	broad.mit.edu	37	19	19166203	19166203	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19166203C>A	uc002nld.2	+	7	1501	c.1153C>A	c.(1153-1155)CAG>AAG	p.Q385K	ARMC6_uc002nlc.2_Missense_Mutation_p.Q360K|ARMC6_uc010xql.1_Missense_Mutation_p.Q292K|ARMC6_uc002nle.2_Missense_Mutation_p.Q360K|ARMC6_uc010xqm.1_Missense_Mutation_p.Q385K	NM_033415	NP_219483	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6	385	ARM 4.						protein binding				0			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)			GACCAGCCCCCAGGTACCCAC	0.602													11	57	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31770291	31770291	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31770291G>A	uc002nsy.3	-	2	473	c.408C>T	c.(406-408)CTC>CTT	p.L136L		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	136					negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					GGTGCAGGTTGAGGTTGAGGT	0.433													29	23	---	---	---	---	PASS
ANKRD27	84079	broad.mit.edu	37	19	33096837	33096837	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33096837C>T	uc002ntn.1	-	24	2553	c.2397G>A	c.(2395-2397)TCG>TCA	p.S799S		NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	799	ANK 9.				early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					GTTTTGCATTCGAATCTAACA	0.458													15	64	---	---	---	---	PASS
ZNF607	84775	broad.mit.edu	37	19	38200684	38200684	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38200684G>C	uc002ohc.1	-	3	645	c.49C>G	c.(49-51)CAT>GAT	p.H17D	ZNF607_uc002ohb.1_Missense_Mutation_p.H17D	NM_032689	NP_116078	Q96SK3	ZN607_HUMAN	zinc finger protein 607	17	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			CACTCCTGATGAGAGAAGTCT	0.423													22	73	---	---	---	---	PASS
ZNF607	84775	broad.mit.edu	37	19	38200719	38200719	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38200719G>C	uc002ohc.1	-	3	610	c.14C>G	c.(13-15)TCA>TGA	p.S5*	ZNF607_uc002ohb.1_Nonsense_Mutation_p.S5*	NM_032689	NP_116078	Q96SK3	ZN607_HUMAN	zinc finger protein 607	5					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			GAATGTTATTGATCCCTGAAA	0.368													15	52	---	---	---	---	PASS
LYPD3	27076	broad.mit.edu	37	19	43968495	43968495	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43968495C>T	uc002owl.1	-	2	301	c.193G>A	c.(193-195)GTG>ATG	p.V65M	LYPD3_uc002owm.2_Missense_Mutation_p.V65M	NM_014400	NP_055215	O95274	LYPD3_HUMAN	GPI-anchored metastasis-associated protein	65	UPAR/Ly6 1.					anchored to plasma membrane				pancreas(1)	1		Prostate(69;0.0153)				ACCGCCCCCACGGCCTCGGTG	0.652													4	13	---	---	---	---	PASS
ZNF155	7711	broad.mit.edu	37	19	44501188	44501188	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44501188C>T	uc002oxy.1	+	5	1384	c.1179C>T	c.(1177-1179)GTC>GTT	p.V393V	ZNF155_uc002oxz.1_Silent_p.V393V|ZNF155_uc010xwt.1_Silent_p.V404V|uc010ejc.1_RNA	NM_003445	NP_003436	Q12901	ZN155_HUMAN	zinc finger protein 155	393	C2H2-type 8.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)	2		Prostate(69;0.0352)				ATCAGCGAGTCCACAGTGGAG	0.418													76	75	---	---	---	---	PASS
ZNF227	7770	broad.mit.edu	37	19	44740134	44740134	+	Silent	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44740134G>A	uc002oyu.2	+	6	1756	c.1551G>A	c.(1549-1551)GAG>GAA	p.E517E	ZNF227_uc010xwu.1_Silent_p.E466E|ZNF227_uc002oyv.2_Silent_p.E517E|ZNF227_uc010xwv.1_Silent_p.E466E|ZNF227_uc010xww.1_Silent_p.E438E|ZNF227_uc002oyw.2_Silent_p.E489E|ZNF227_uc010ejh.2_Silent_p.E510E|ZNF235_uc002oyx.1_Intron	NM_182490	NP_872296	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	517					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0435)				ACACTGGGGAGAAACGATTCA	0.473													13	49	---	---	---	---	PASS
ERCC2	2068	broad.mit.edu	37	19	45873500	45873500	+	Intron	SNP	G	A	A	rs66602691		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45873500G>A	uc002pbj.2	-						ERCC2_uc010ejz.2_Intron|ERCC2_uc002pbk.2_5'UTR|ERCC2_uc002pbl.3_5'UTR|ERCC2_uc010xxj.1_Intron	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent						cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CCTGGCGGCAGGGGCTGCTGG	0.677			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				5	22	---	---	---	---	PASS
IZUMO1	284359	broad.mit.edu	37	19	49248480	49248480	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49248480C>T	uc002pkj.2	-	3	849	c.301G>A	c.(301-303)GAT>AAT	p.D101N	IZUMO1_uc010eme.2_RNA|IZUMO1_uc010emf.2_RNA	NM_182575	NP_872381	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1 precursor	101	Extracellular (Potential).				fusion of sperm to egg plasma membrane	integral to membrane				ovary(1)	1		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CCTTTTACATCACTGTCTGTG	0.448													31	41	---	---	---	---	PASS
CLEC11A	6320	broad.mit.edu	37	19	51228562	51228562	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51228562C>T	uc002psy.2	+	4	988	c.810C>T	c.(808-810)CCC>CCT	p.P270P		NM_002975	NP_002966	Q9Y240	CLC11_HUMAN	stem cell growth factor precursor	270	C-type lectin.				positive regulation of cell proliferation	cytoplasm|extracellular region	growth factor activity|sugar binding			ovary(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CACCCCGCCCCGAGCTCGGCG	0.721													10	7	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56244845	56244845	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56244845G>A	uc002qly.2	-	2	380	c.352C>T	c.(352-354)CAC>TAC	p.H118Y		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	118						cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TCAGGGACGTGAAGACAGGTT	0.393													104	81	---	---	---	---	PASS
ZNF776	284309	broad.mit.edu	37	19	58265347	58265347	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58265347G>C	uc002qpx.2	+	3	1072	c.849G>C	c.(847-849)CAG>CAC	p.Q283H	ZNF587_uc002qqb.2_Intron|ZNF776_uc002qqa.2_Missense_Mutation_p.Q283H	NM_173632	NP_775903	Q68DI1	ZN776_HUMAN	zinc finger protein 776	283	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		CTGAACACCAGAGAGTTCACA	0.418													9	104	---	---	---	---	PASS
RBCK1	10616	broad.mit.edu	37	20	411056	411056	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:411056C>G	uc002wdp.3	+	12	2208	c.1515C>G	c.(1513-1515)AGC>AGG	p.S505R	RBCK1_uc002wdq.3_Missense_Mutation_p.S463R|RBCK1_uc010fzy.2_RNA|RBCK1_uc002wdr.3_Missense_Mutation_p.S335R	NM_031229	NP_112506	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing	505					interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				GCCACCCAAGCTGTCAGAACT	0.582													3	33	---	---	---	---	PASS
NINL	22981	broad.mit.edu	37	20	25493651	25493651	+	Intron	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25493651G>A	uc002wux.1	-						NINL_uc010gdn.1_Intron|NINL_uc010gdo.1_Intron|NINL_uc010ztf.1_Intron	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						AGCTGGAAAGGAAACAGGAAA	0.567													20	66	---	---	---	---	PASS
RALGAPB	57148	broad.mit.edu	37	20	37117221	37117221	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37117221C>T	uc002xiw.2	+	2	403	c.146C>T	c.(145-147)TCA>TTA	p.S49L	RALGAPB_uc010zvz.1_Missense_Mutation_p.S49L|RALGAPB_uc002xix.2_Missense_Mutation_p.S49L|RALGAPB_uc002xiy.1_Missense_Mutation_p.S49L	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	49					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						GGTACCCCTTCAGTGGCTGGT	0.423													9	202	---	---	---	---	PASS
CDH22	64405	broad.mit.edu	37	20	44815349	44815349	+	Intron	SNP	A	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44815349A>T	uc002xrm.2	-						CDH22_uc010ghk.1_Intron	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN	cadherin 22 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				GATGAGCTGAAGGGTGAGGAG	0.617													11	97	---	---	---	---	PASS
SALL4	57167	broad.mit.edu	37	20	50407563	50407563	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50407563G>A	uc002xwh.3	-	2	1560	c.1459C>T	c.(1459-1461)CAG>TAG	p.Q487*	SALL4_uc010gii.2_Intron|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	487					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GAAAGATTCTGAGGTAGCCCT	0.552													53	212	---	---	---	---	PASS
CTSZ	1522	broad.mit.edu	37	20	57570826	57570826	+	Intron	SNP	G	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57570826G>T	uc002yai.2	-							NM_001336	NP_001327	Q9UBR2	CATZ_HUMAN	cathepsin Z preproprotein						proteolysis	endoplasmic reticulum|extracellular space|lysosome	cysteine-type endopeptidase activity			kidney(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)			TGTGAGAAGTGGGATCGCGCG	0.632													3	48	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32598165	32598165	+	Silent	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32598165G>C	uc002yow.1	-	8	2158	c.1686C>G	c.(1684-1686)CTC>CTG	p.L562L	TIAM1_uc011adk.1_Silent_p.L562L|TIAM1_uc011adl.1_Silent_p.L562L|TIAM1_uc002yox.1_Silent_p.L170L	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	562					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						CTGATTTCAGGAGTCGGAGCG	0.502													60	138	---	---	---	---	PASS
SLC5A1	6523	broad.mit.edu	37	22	32495249	32495249	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32495249G>A	uc003amc.2	+	12	1592	c.1360G>A	c.(1360-1362)GAT>AAT	p.D454N	SLC5A1_uc011alz.1_Missense_Mutation_p.D327N	NM_000343	NP_000334	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose	454	Extracellular (Potential).				carbohydrate metabolic process	integral to plasma membrane	glucose:sodium symporter activity|protein binding			skin(1)	1						GCAACTCTTCGATTACATCCA	0.493													43	258	---	---	---	---	PASS
SGSM3	27352	broad.mit.edu	37	22	40801807	40801807	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40801807A>C	uc003ayu.1	+	8	982	c.773A>C	c.(772-774)TAC>TCC	p.Y258S	SGSM3_uc010gyc.1_Missense_Mutation_p.Y258S|SGSM3_uc011aos.1_Missense_Mutation_p.Y191S|SGSM3_uc011aot.1_Missense_Mutation_p.Y195S|SGSM3_uc010gyd.1_Missense_Mutation_p.Y258S	NM_015705	NP_056520	Q96HU1	SGSM3_HUMAN	small G protein signaling modulator 3	258	Rab-GAP TBC.				cell cycle arrest|Rap protein signal transduction	cytoplasm	Rab GTPase activator activity|Rab GTPase binding			ovary(2)	2						ATTGTCCAGTACCTGCCTCGC	0.632													6	36	---	---	---	---	PASS
TTLL12	23170	broad.mit.edu	37	22	43565562	43565562	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43565562C>G	uc003bdq.2	-	12	1620	c.1588G>C	c.(1588-1590)GAG>CAG	p.E530Q	TTLL12_uc003bdp.2_Missense_Mutation_p.K122N|TTLL12_uc003bdr.1_Missense_Mutation_p.E530Q	NM_015140	NP_055955	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	530	TTL.				protein modification process		tubulin-tyrosine ligase activity			central_nervous_system(1)	1		Ovarian(80;0.221)|Glioma(61;0.222)				GGGATGAACTCTTCACAGTGC	0.612													12	6	---	---	---	---	PASS
PCYT1B	9468	broad.mit.edu	37	X	24593430	24593430	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24593430C>G	uc004dbi.2	-	7	947	c.714G>C	c.(712-714)AAG>AAC	p.K238N	PCYT1B_uc004dbk.3_Missense_Mutation_p.K238N|PCYT1B_uc004dbj.2_Missense_Mutation_p.K220N	NM_004845	NP_004836	Q9Y5K3	PCY1B_HUMAN	choline phosphate cytidylyltransferase 1 beta	238						endoplasmic reticulum	choline-phosphate cytidylyltransferase activity				0					Choline(DB00122)	AACGGTACCTCTTCTCCTGGT	0.358													40	18	---	---	---	---	PASS
POLA1	5422	broad.mit.edu	37	X	24755819	24755819	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24755819G>C	uc004dbl.2	+	19	2006	c.1983G>C	c.(1981-1983)AAG>AAC	p.K661N		NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1	661	Potential.				cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	ACTGGTCCAAGATAGGTCGAC	0.358													7	103	---	---	---	---	PASS
GRIPAP1	56850	broad.mit.edu	37	X	48840190	48840190	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48840190C>T	uc004dly.1	-	15	1304	c.1269G>A	c.(1267-1269)CGG>CGA	p.R423R	GRIPAP1_uc004dlz.2_Silent_p.R313R|GRIPAP1_uc004dma.2_Silent_p.R370R	NM_020137	NP_064522	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1 isoform 1	423	Potential.					early endosome				breast(2)|kidney(1)	3						CCCCTACCTTCCGAGCCTCCT	0.517													46	339	---	---	---	---	PASS
RNF113A	7737	broad.mit.edu	37	X	119005291	119005291	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119005291G>C	uc004esb.2	-	1	501	c.286C>G	c.(286-288)CTC>GTC	p.L96V	NDUFA1_uc004esc.3_5'Flank	NM_006978	NP_008909	O15541	R113A_HUMAN	ring finger protein 113A	96							nucleic acid binding|zinc ion binding			breast(2)	2						ACCACGCCGAGACTCTCGGGC	0.542													108	198	---	---	---	---	PASS
ENOX2	10495	broad.mit.edu	37	X	129799721	129799721	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129799721C>G	uc004evw.2	-	10	1415	c.997G>C	c.(997-999)GAG>CAG	p.E333Q	ENOX2_uc004evx.2_Missense_Mutation_p.E304Q|ENOX2_uc004evy.2_Missense_Mutation_p.E304Q|ENOX2_uc004evv.2_Missense_Mutation_p.E160Q	NM_182314	NP_872114	Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2 isoform b	333					cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1						ACTATCTGCTCAACTGCAGCA	0.488													3	10	---	---	---	---	PASS
SOX3	6658	broad.mit.edu	37	X	139586893	139586893	+	Silent	SNP	C	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139586893C>T	uc004fbd.1	-	1	333	c.333G>A	c.(331-333)GCG>GCA	p.A111A		NM_005634	NP_005625	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	111					face development|hypothalamus development|negative regulation of neuron differentiation|pituitary gland development|regulation of transcription, DNA-dependent|sensory organ development|sex determination|transcription, DNA-dependent	nucleus	DNA binding			pancreas(1)	1	Acute lymphoblastic leukemia(192;7.65e-05)					CGGCTGCGTTCGCACTACTCT	0.706													6	3	---	---	---	---	PASS
EMD	2010	broad.mit.edu	37	X	153608140	153608140	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153608140C>G	uc004fkl.2	+	2	421	c.173C>G	c.(172-174)TCT>TGT	p.S58C		NM_000117	NP_000108	P50402	EMD_HUMAN	emerin	58	Interaction with F-actin (Probable).				cellular response to growth factor stimulus|muscle contraction|muscle organ development|negative regulation of catenin import into nucleus|negative regulation of fibroblast proliferation|positive regulation of protein export from nucleus|regulation of canonical Wnt receptor signaling pathway	endoplasmic reticulum|integral to membrane|microtubule|nuclear inner membrane|nuclear outer membrane	actin binding|beta-tubulin binding				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCCGCCTCCTCTTATAGCTTC	0.667													33	11	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	21039808	21039808	+	Intron	DEL	A	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21039808delA	uc001bdr.3	-						KIF17_uc001bds.3_Intron	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a						microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		ttttttaattaaaaaaaaaaa	0.259													4	2	---	---	---	---	
DAP3	7818	broad.mit.edu	37	1	155701652	155701653	+	Intron	INS	-	A	A	rs144369278	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155701652_155701653insA	uc001flq.2	+						DAP3_uc001flr.2_Intron|DAP3_uc001fls.2_Intron|DAP3_uc010pgl.1_Intron|DAP3_uc001flt.2_Intron|DAP3_uc001flu.2_Intron|DAP3_uc010pgm.1_Intron	NM_033657	NP_387506	P51398	RT29_HUMAN	death-associated protein 3						induction of apoptosis by extracellular signals	mitochondrial ribosome|nucleolus|small ribosomal subunit	protein binding			ovary(1)	1	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					GCCCAAGAAAGAAAAAAAAAAT	0.371													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	207273438	207273439	+	IGR	DEL	TA	-	-	rs72516622		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207273438_207273439delTA								C4BPB (103 upstream) : C4BPA (4072 downstream)																							tgtgtgtgtgtatgtgtgtgtg	0.257													4	3	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237850666	237850666	+	Intron	DEL	C	-	-	rs41267515		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237850666delC	uc001hyl.1	+						RYR2_uc010pxz.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ttttcttcttctttttttttt	0.328													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6953876	6953879	+	IGR	DEL	GAGG	-	-	rs112872966		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6953876_6953879delGAGG								LOC400940 (825512 upstream) : CMPK2 (26624 downstream)																							gggagggagagagggagggaggaa	0.005													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	10356310	10356310	+	IGR	DEL	A	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10356310delA								C2orf48 (4454 upstream) : HPCAL1 (86730 downstream)																							ggaaggaaggaaAAAAATTCA	0.199													4	2	---	---	---	---	
RGPD1	400966	broad.mit.edu	37	2	87204958	87204958	+	Intron	DEL	T	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87204958delT	uc010fgv.2	+						RMND5A_uc002srs.3_Intron|RGPD1_uc002ssb.2_Intron|RGPD1_uc002ssc.2_Intron	NM_001024457	NP_001019628	Q68DN6	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1						intracellular transport		binding				0						Gttatttttattttttttttt	0.318													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92320948	92320948	+	IGR	DEL	T	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92320948delT								FKSG73 (190454 upstream) : None (None downstream)																							gagttgaacctttcttttgag	0.000													9	4	---	---	---	---	
RGPD3	653489	broad.mit.edu	37	2	107032131	107032131	+	Intron	DEL	A	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107032131delA	uc010ywi.1	-							NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3						intracellular transport		binding			ovary(1)	1						agactgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
RANBP2	5903	broad.mit.edu	37	2	109369249	109369249	+	Intron	DEL	A	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109369249delA	uc002tem.3	+							NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						actctgtctcaaaaaaaaaaa	0.144													6	4	---	---	---	---	
NOSTRIN	115677	broad.mit.edu	37	2	169691000	169691001	+	Intron	INS	-	GC	GC	rs145224351	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169691000_169691001insGC	uc002ueg.2	+						NOSTRIN_uc002uef.2_Intron|NOSTRIN_uc002uei.2_Intron|NOSTRIN_uc010fpu.2_Intron|NOSTRIN_uc002ueh.2_Intron|NOSTRIN_uc002uej.2_Intron	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2						endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						ATTACTGGCGTGCGCGCGCGCG	0.322													3	3	---	---	---	---	
NOSTRIN	115677	broad.mit.edu	37	2	169712115	169712116	+	Intron	INS	-	A	A	rs74552507		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169712115_169712116insA	uc002ueg.2	+						NOSTRIN_uc002uef.2_Intron|NOSTRIN_uc002uei.2_Intron|NOSTRIN_uc010fpu.2_Intron|NOSTRIN_uc002ueh.2_Intron|NOSTRIN_uc002uej.2_Intron|NOSTRIN_uc002uek.2_5'Flank	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2						endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						GTTGTGTGAACaaaaaaaaaaa	0.248													4	2	---	---	---	---	
KIAA1524	57650	broad.mit.edu	37	3	108300737	108300737	+	Intron	DEL	T	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108300737delT	uc003dxb.3	-						KIAA1524_uc003dxc.1_Intron|KIAA1524_uc010hpw.1_Intron	NM_020890	NP_065941	Q8TCG1	CIP2A_HUMAN	p90 autoantigen							cytoplasm|integral to membrane	protein binding			ovary(2)|central_nervous_system(1)	3						TGCTTTACAATTTTTTTTTCC	0.269													4	2	---	---	---	---	
GAP43	2596	broad.mit.edu	37	3	115342811	115342811	+	Intron	DEL	T	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115342811delT	uc003ebq.2	+						GAP43_uc003ebr.2_Intron	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		CTAGAAATAATTTTTTTTTTT	0.423													5	4	---	---	---	---	
ATP1B3	483	broad.mit.edu	37	3	141632860	141632861	+	Intron	INS	-	A	A	rs147422245	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141632860_141632861insA	uc003eug.1	+						ATP1B3_uc011bne.1_Intron|ATP1B3_uc003euh.1_Intron	NM_001679	NP_001670	P54709	AT1B3_HUMAN	Na+/K+ -ATPase beta 3 subunit						ATP biosynthetic process|blood coagulation|leukocyte migration	melanosome|sodium:potassium-exchanging ATPase complex	protein binding|sodium:potassium-exchanging ATPase activity				0						GTTTATATGGCAAAAAAAAGAG	0.327													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	28669474	28669475	+	IGR	INS	-	CCTT	CCTT	rs2022169	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28669474_28669475insCCTT								None (None upstream) : None (None downstream)																							cttccttccttcctcccttctt	0.129													6	3	---	---	---	---	
FAM114A1	92689	broad.mit.edu	37	4	38907608	38907608	+	Intron	DEL	T	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38907608delT	uc003gtn.2	+						FAM114A1_uc011byh.1_Intron	NM_138389	NP_612398	Q8IWE2	NXP20_HUMAN	hypothetical protein LOC92689							cytoplasm				ovary(1)	1						TGGATTATGGTTTTTTTTTTA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	1649858	1649859	+	IGR	INS	-	TCTC	TCTC			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1649858_1649859insTCTC								LOC728613 (15738 upstream) : MRPL36 (148641 downstream)																							ccttctttctttctctctctct	0.000													8	4	---	---	---	---	
SEC24A	10802	broad.mit.edu	37	5	134002283	134002284	+	Intron	DEL	AA	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134002283_134002284delAA	uc003kzs.2	+						SEC24A_uc011cxu.1_Intron	NM_021982	NP_068817	O95486	SC24A_HUMAN	SEC24 related gene family, member A						COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			agaaagaaagaaagaaaaaagg	0.089													2	4	---	---	---	---	
DSP	1832	broad.mit.edu	37	6	7580551	7580552	+	Frame_Shift_Ins	INS	-	AG	AG			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7580551_7580552insAG	uc003mxp.1	+	23	4407_4408	c.4128_4129insAG	c.(4126-4131)ACCATCfs	p.T1376fs	DSP_uc003mxq.1_Intron	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	1376_1377	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		CCAAGACCACCATCCACCAGCT	0.411													31	92	---	---	---	---	
SFRS3	6428	broad.mit.edu	37	6	36568778	36568778	+	Intron	DEL	C	-	-	rs60747144		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36568778delC	uc003omj.2	+						SFRS3_uc003omk.2_Intron	NM_003017	NP_003008	P84103	SRSF3_HUMAN	splicing factor, arginine/serine-rich 3						mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	nucleotide binding|protein binding|RNA binding				0						tcttttttttctttttttttt	0.343			T	BCL6	follicular lymphoma								3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	121974926	121974926	+	IGR	DEL	T	-	-	rs77718609		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121974926delT								GJA1 (204054 upstream) : HSF2 (745770 downstream)																							GCCCAGTCCCTTCTGGCAGCA	0.547													2	8	---	---	---	---	
SGK1	6446	broad.mit.edu	37	6	134492496	134492497	+	Intron	INS	-	TG	TG	rs141268381	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134492496_134492497insTG	uc003qen.3	-						SGK1_uc003qeo.3_Intron|SGK1_uc011ect.1_Intron|SGK1_uc011ecu.1_Intron|SGK1_uc011ecv.1_Intron|SGK1_uc011ecw.1_Intron	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform						apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		gtgtgtgtgtttgtgtgtgtgt	0.356													4	2	---	---	---	---	
MAP3K5	4217	broad.mit.edu	37	6	136878751	136878752	+	3'UTR	INS	-	T	T	rs71747329		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136878751_136878752insT	uc003qhc.2	-	30					MAP3K5_uc011edj.1_3'UTR	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TGTTTTGTCTGTTTTTTTTTTT	0.342													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659644	57659644	+	IGR	DEL	G	-	-	rs111399871		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659644delG								ZNF716 (126379 upstream) : None (None downstream)																							CATGTTTTTTGTGTTTTTCTT	0.353													2	4	---	---	---	---	
STAG3L4	64940	broad.mit.edu	37	7	66767611	66767611	+	5'Flank	DEL	T	-	-	rs12531701	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66767611delT	uc003tvt.3	+						PMS2L4_uc003tvo.2_5'Flank|PMS2L4_uc003tvq.2_5'Flank|PMS2L4_uc003tvr.3_5'Flank|PMS2L4_uc003tvs.3_5'Flank|STAG3L4_uc010laj.2_5'Flank	NM_022906	NP_075057	Q8TBR4	STG34_HUMAN	stromal antigen 3-like 4												0		Lung NSC(55;0.0839)|all_lung(88;0.181)				ACCGGACTGCTTTTTTTTTTT	0.542													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68455233	68455234	+	IGR	INS	-	GG	GG	rs75586035	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68455233_68455234insGG								FAM27B (661044 upstream) : MIR1299 (547005 downstream)																							GACTTCTGTGCAGAGGCTGAAG	0.574													8	7	---	---	---	---	
KIF27	55582	broad.mit.edu	37	9	86523674	86523674	+	Intron	DEL	T	-	-	rs34030009		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86523674delT	uc004ana.2	-						KIF27_uc010mpw.2_Intron|KIF27_uc010mpx.2_Intron	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27						cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5						ATATTATAACttttttttttt	0.119													4	2	---	---	---	---	
PLXDC2	84898	broad.mit.edu	37	10	20303205	20303206	+	Intron	INS	-	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20303205_20303206insT	uc001iqg.1	+						PLXDC2_uc001iqh.1_Intron	NM_032812	NP_116201	Q6UX71	PXDC2_HUMAN	plexin domain containing 2 precursor							integral to membrane				ovary(2)|central_nervous_system(1)|skin(1)	4						tctctccttccttccttttttc	0.000													4	2	---	---	---	---	
PDCD4	27250	broad.mit.edu	37	10	112657654	112657654	+	Intron	DEL	T	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112657654delT	uc001kzh.2	+						PDCD4_uc001kzg.2_Intron|PDCD4_uc010qre.1_Intron	NM_014456	NP_055271	Q53EL6	PDCD4_HUMAN	programmed cell death 4 isoform 1						apoptosis|cell aging|negative regulation of cell cycle|negative regulation of JUN kinase activity|negative regulation of transcription, DNA-dependent	cytosol|nucleus	protein binding|RNA binding			ovary(1)|breast(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.000526)|all cancers(201;0.00794)|BRCA - Breast invasive adenocarcinoma(275;0.125)		AGAGGCATGCTTTTTTTTTTT	0.264													4	2	---	---	---	---	
PSMA1	5682	broad.mit.edu	37	11	14539651	14539652	+	Intron	INS	-	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14539651_14539652insT	uc001mlk.2	-						PSMA1_uc001mll.2_Intron|PSMA1_uc010rcp.1_Intron|PSMA1_uc001mlj.2_Intron|PSMA1_uc010rcq.1_Intron	NM_002786	NP_002777	P25786	PSA1_HUMAN	proteasome alpha 1 subunit isoform 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|polysome|proteasome core complex, alpha-subunit complex	protein binding|RNA binding|threonine-type endopeptidase activity			upper_aerodigestive_tract(1)|skin(1)	2						ATCAAGAGACCttttttttttt	0.139													4	2	---	---	---	---	
DDX12	440081	broad.mit.edu	37	12	9583365	9583366	+	Intron	INS	-	GGGCG	GGGCG			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9583365_9583366insGGGCG	uc010sgs.1	-							NM_004400	NP_004391			DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 12												0						CCACCTGAGCAGGGCGGGGCTC	0.619													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	21622710	21622711	+	IGR	DEL	GA	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21622710_21622711delGA								ZNF219 (49847 upstream) : OR5AU1 (386 downstream)																							ctcgggggtggagagagagaga	0.020													4	2	---	---	---	---	
WDHD1	11169	broad.mit.edu	37	14	55422594	55422595	+	Intron	INS	-	TTCAGA	TTCAGA	rs140324706	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55422594_55422595insTTCAGA	uc001xbm.1	-						WDHD1_uc010aom.1_Intron|WDHD1_uc001xbn.1_Intron	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1							cytoplasm|nucleoplasm	DNA binding			skin(1)	1						AAAAACTACACTTCAGATTCCA	0.168													4	3	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544130	80544130	+	Intron	DEL	C	-	-	rs57940566	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544130delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			gaaaggtgggccgggggggga	0.149													7	6	---	---	---	---	
ABCA7	10347	broad.mit.edu	37	19	1048821	1048823	+	Intron	DEL	AAC	-	-	rs117094519		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1048821_1048823delAAC	uc002lqw.3	+						ABCA7_uc010dsb.1_Intron	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7						phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aaaaaaaaaaaacaaaaccccaa	0.266													4	2	---	---	---	---	
PLIN4	729359	broad.mit.edu	37	19	4510377	4510378	+	Intron	INS	-	A	A	rs11458793		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4510377_4510378insA	uc002mar.1	-						PLIN4_uc010dub.1_Intron	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12							lipid particle|plasma membrane					0						gactctgtctcaaaaaaaaaaa	0.262													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13709273	13709274	+	IGR	INS	-	AAAG	AAAG	rs148148215	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13709273_13709274insAAAG								CACNA1A (91999 upstream) : CCDC130 (133300 downstream)																							gaccctgtcaaaaaggaaggaa	0.000											OREG0025297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	5	---	---	---	---	
CC2D1A	54862	broad.mit.edu	37	19	14034277	14034278	+	Intron	INS	-	A	A			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14034277_14034278insA	uc002mxo.2	+						CC2D1A_uc002mxp.2_Intron|CC2D1A_uc010dzh.2_Intron|CC2D1A_uc002mxq.1_Intron	NM_017721	NP_060191	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A						positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			AGGTGAGGGGGAGGCCCCCAGC	0.653													65	47	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17750845	17750846	+	Intron	INS	-	T	T			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17750845_17750846insT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						ATTCTATGGCAttttttttttt	0.257													13	7	---	---	---	---	
B3GNT8	374907	broad.mit.edu	37	19	41932446	41932447	+	Frame_Shift_Ins	INS	-	C	C			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41932446_41932447insC	uc002oqs.2	-	3	691_692	c.237_238insG	c.(235-240)CGGCTGfs	p.R79fs	CYP2F1_uc010xvw.1_Intron|B3GNT8_uc002oqt.1_Intron	NM_198540	NP_940942	Q7Z7M8	B3GN8_HUMAN	UDP-GlcNAc:betaGal	79_80	Lumenal (Potential).				poly-N-acetyllactosamine biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity|protein N-acetylglucosaminyltransferase activity				0						AGGGACCCCAGCCGCCACTGCT	0.688													14	7	---	---	---	---	
ZNF320	162967	broad.mit.edu	37	19	53381495	53381507	+	3'UTR	DEL	TTTTTTTTTTTTT	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53381495_53381507delTTTTTTTTTTTTT	uc002qag.2	-	4					ZNF320_uc010eqh.1_Intron|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_3'UTR|ZNF320_uc002qai.2_3'UTR	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		catcactttcttttttttttttttttttttttt	0.117													6	5	---	---	---	---	
SEC23B	10483	broad.mit.edu	37	20	18534795	18534795	+	Intron	DEL	G	-	-			TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18534795delG	uc002wqz.1	+						SEC23B_uc002wra.1_Intron|SEC23B_uc002wrb.1_Intron|SEC23B_uc010zsb.1_Intron|SEC23B_uc002wrc.1_Intron	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B						ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						AACAAGCTCTGGGTGGCGATG	0.458													18	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	26020893	26020896	+	IGR	DEL	TTCC	-	-	rs67729072		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:26020893_26020896delTTCC								None (None upstream) : NCRNA00158 (737238 downstream)																							GATAAtttttttccttccttcctt	0.172													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40499414	40499415	+	IGR	INS	-	T	T	rs147438953	by1000genomes	TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499414_40499415insT								ETS2 (302538 upstream) : PSMG1 (47975 downstream)																							Ttttttttttgttttgttttgt	0.307													4	4	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49103825	49103837	+	Intron	DEL	TCCTGACCATCTG	-	-	rs141710021		TCGA-C5-A1M6-01A-11D-A13W-08	TCGA-C5-A1M6-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49103825_49103837delTCCTGACCATCTG	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		GGTGCTAAATTCCTGACCATCTGTCCTGGGGCA	0.620													3	4	---	---	---	---	
