Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRAMEF4	400735	broad.mit.edu	37	1	12939661	12939661	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12939661C>G	uc001aun.2	-	4	1212	c.1141G>C	c.(1141-1143)GAG>CAG	p.E381Q		NM_001009611	NP_001009611	O60810	PRAM4_HUMAN	PRAME family member 4	381	LRR 6.									ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GTGTTGAGCTCAAAGCAGCGG	0.507													79	259	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22202370	22202370	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22202370C>A	uc001bfj.2	-	24	3209	c.3169G>T	c.(3169-3171)GTG>TTG	p.V1057L	HSPG2_uc009vqd.2_Missense_Mutation_p.V1058L	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	1057	Laminin IV type A 2.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	CGGAAAGGCACAATGAAGGTG	0.637													14	62	---	---	---	---	PASS
EPHB2	2048	broad.mit.edu	37	1	23208941	23208941	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23208941G>T	uc009vqj.1	+	6	1538	c.1393G>T	c.(1393-1395)GTG>TTG	p.V465L	EPHB2_uc001bge.2_Missense_Mutation_p.V465L|EPHB2_uc001bgf.2_Missense_Mutation_p.V465L|EPHB2_uc010odu.1_Missense_Mutation_p.V465L	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor	465	Fibronectin type-III 2.|Extracellular (Potential).				axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		GCCCAATGGCGTGATCCTGGA	0.607									Hereditary_Prostate_Cancer				23	43	---	---	---	---	PASS
PUM1	9698	broad.mit.edu	37	1	31437722	31437722	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31437722C>T	uc001bsi.1	-	14	2235	c.2122G>A	c.(2122-2124)GAC>AAC	p.D708N	PUM1_uc001bsf.1_Missense_Mutation_p.D374N|PUM1_uc001bsg.1_Intron|PUM1_uc001bsh.1_Missense_Mutation_p.D708N|PUM1_uc001bsj.1_Missense_Mutation_p.D682N|PUM1_uc010oga.1_Missense_Mutation_p.D564N|PUM1_uc001bsk.1_Missense_Mutation_p.D744N|PUM1_uc010ogb.1_Missense_Mutation_p.D649N	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	708	Ser-rich.				cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		GTCAGGGAGTCACGGCGGGAG	0.488													21	33	---	---	---	---	PASS
WDR65	149465	broad.mit.edu	37	1	43663242	43663242	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43663242G>A	uc001cip.1	+	7	1262	c.1141G>A	c.(1141-1143)GAG>AAG	p.E381K	EBNA1BP2_uc001cio.2_Intron|WDR65_uc010ojz.1_Missense_Mutation_p.E370K|WDR65_uc001ciq.1_Missense_Mutation_p.E381K	NM_152498	NP_689711	Q96MR6	WDR65_HUMAN	WD repeat domain 65	381										skin(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGCTCACTTTGAGTATTTGAT	0.493													52	88	---	---	---	---	PASS
PLK3	1263	broad.mit.edu	37	1	45268429	45268429	+	Intron	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45268429C>T	uc001cmn.2	+						PLK3_uc001cmo.2_Intron	NM_004073	NP_004064	Q9H4B4	PLK3_HUMAN	polo-like kinase 3							membrane	ATP binding|protein binding|protein serine/threonine kinase activity				0	Acute lymphoblastic leukemia(166;0.155)					CACCCTCTTTCAGGACCATCT	0.612													22	34	---	---	---	---	PASS
USP1	7398	broad.mit.edu	37	1	62916624	62916624	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62916624C>T	uc001daj.1	+	9	2658	c.2330C>T	c.(2329-2331)CCT>CTT	p.P777L	USP1_uc001dak.1_Missense_Mutation_p.P777L|USP1_uc001dal.1_Missense_Mutation_p.P777L	NM_001017415	NP_001017415	O94782	UBP1_HUMAN	ubiquitin specific protease 1	777					DNA repair|monoubiquitinated protein deubiquitination|regulation of DNA repair|response to UV|ubiquitin-dependent protein catabolic process	nucleoplasm	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)	1		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		ACTTCTACTCCTTACTTGCTA	0.343													8	34	---	---	---	---	PASS
ABCD3	5825	broad.mit.edu	37	1	94972174	94972174	+	Silent	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94972174C>A	uc001dqn.3	+	21	1923	c.1821C>A	c.(1819-1821)GGC>GGA	p.G607G	ABCD3_uc010oto.1_Silent_p.G631G|ABCD3_uc010otp.1_Silent_p.G534G|ABCD3_uc009wdr.2_Silent_p.G497G|ABCD3_uc001dqo.3_Silent_p.G295G	NM_002858	NP_002849	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D, member 3	607	ABC transporter.				peroxisomal long-chain fatty acid import|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			skin(1)	1		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		ACGTGGAAGGCTACATTTATA	0.403													22	57	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109813168	109813168	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109813168G>A	uc001dxa.3	+	24	7490	c.7429G>A	c.(7429-7431)GGC>AGC	p.G2477S		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	2477	Cytoplasmic (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TGTCAACACCGGCCCCATGCG	0.617													27	32	---	---	---	---	PASS
GPR61	83873	broad.mit.edu	37	1	110086927	110086927	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110086927A>G	uc001dxy.2	+	2	1966	c.1283A>G	c.(1282-1284)CAG>CGG	p.Q428R		NM_031936	NP_114142	Q9BZJ8	GPR61_HUMAN	G protein-coupled receptor 61	428	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(2)	2		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0426)|Colorectal(144;0.11)|Epithelial(280;0.128)|all cancers(265;0.132)|LUSC - Lung squamous cell carcinoma(189;0.228)		TTCCTGGAGCAGCAACTCACC	0.602													16	19	---	---	---	---	PASS
WDR3	10885	broad.mit.edu	37	1	118477108	118477108	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118477108C>T	uc010oxe.1	+	3	250	c.184C>T	c.(184-186)CAG>TAG	p.Q62*	WDR3_uc001ehi.2_Intron|WDR3_uc001ehh.2_5'UTR	NM_006784	NP_006775	Q9UNX4	WDR3_HUMAN	WD repeat-containing protein 3	62						nuclear membrane|nucleolus				upper_aerodigestive_tract(1)	1	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		TCTTATCCTTCAGGGGCTTAA	0.403													39	46	---	---	---	---	PASS
KPRP	448834	broad.mit.edu	37	1	152732421	152732421	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152732421C>T	uc001fal.1	+	2	415	c.357C>T	c.(355-357)TAC>TAT	p.Y119Y		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	119	Gln-rich.					cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGGTGTCCTACGTGCAGTGCG	0.488													108	141	---	---	---	---	PASS
NPR1	4881	broad.mit.edu	37	1	153660530	153660530	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153660530G>A	uc001fcs.3	+	15	2671	c.2250G>A	c.(2248-2250)GAG>GAA	p.E750E	NPR1_uc010pdz.1_Silent_p.E496E|NPR1_uc010pea.1_Silent_p.E228E	NM_000906	NP_000897	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1 precursor	750	Cytoplasmic (Potential).|Protein kinase.				body fluid secretion|intracellular signal transduction|negative regulation of angiogenesis|negative regulation of cell growth|positive regulation of renal sodium excretion|positive regulation of urine volume|receptor guanylyl cyclase signaling pathway|regulation of blood pressure|regulation of blood vessel size|regulation of vascular permeability|regulation of vasodilation		ATP binding|GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|peptide receptor activity, G-protein coupled|protein kinase activity			ovary(3)|lung(2)|stomach(1)|breast(1)	7	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Nesiritide(DB04899)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	CCAATACAGAGATCATCGAGC	0.652													12	29	---	---	---	---	PASS
DCAF6	55827	broad.mit.edu	37	1	167973911	167973911	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167973911C>G	uc001gew.2	+	10	1500	c.1258C>G	c.(1258-1260)CAG>GAG	p.Q420E	DCAF6_uc001gev.2_Missense_Mutation_p.Q420E|DCAF6_uc001gex.2_Missense_Mutation_p.Q420E|DCAF6_uc010plk.1_Missense_Mutation_p.Q389E|DCAF6_uc001gey.2_Missense_Mutation_p.Q273E	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b	420					positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						aatgtcagctcaggctcaTTC	0.219													8	21	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177226388	177226388	+	Silent	SNP	A	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177226388A>T	uc001glf.2	+	4	849	c.537A>T	c.(535-537)ATA>ATT	p.I179I	FAM5B_uc010pna.1_5'UTR|FAM5B_uc001glg.2_Silent_p.I74I	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	179						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						GTGCCTCTATAATCGGGGGCA	0.552													17	18	---	---	---	---	PASS
ACTA1	58	broad.mit.edu	37	1	229568027	229568027	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229568027G>A	uc001htm.2	-	4	711	c.606C>T	c.(604-606)TTC>TTT	p.F202F		NM_001100	NP_001091	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	202					muscle filament sliding|skeletal muscle fiber development|skeletal muscle thin filament assembly	actin filament|cytosol|stress fiber|striated muscle thin filament	ADP binding|ATP binding|myosin binding|structural constituent of cytoskeleton				0	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)			Dornase Alfa(DB00003)	CTGTGGTCACGAAGGAGTAGC	0.498													6	19	---	---	---	---	PASS
ARID4B	51742	broad.mit.edu	37	1	235383751	235383751	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235383751C>G	uc001hwq.2	-	15	1771	c.1273G>C	c.(1273-1275)GAA>CAA	p.E425Q	ARID4B_uc001hwr.2_Missense_Mutation_p.E425Q|ARID4B_uc001hws.3_Missense_Mutation_p.E425Q|ARID4B_uc001hwt.3_Missense_Mutation_p.E106Q	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1	425	Glu-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			ACTTTTATTTCTTTTACATTT	0.353													16	30	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236716983	236716983	+	Silent	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236716983C>G	uc001hyd.1	-	43	6260	c.6135G>C	c.(6133-6135)CTG>CTC	p.L2045L	HEATR1_uc009xgh.1_Silent_p.L1207L	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	2045					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TGCATGGTATCAGGTGCTTTG	0.478													17	32	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237777446	237777446	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237777446C>T	uc001hyl.1	+	37	5138	c.5018C>T	c.(5017-5019)GCC>GTC	p.A1673V		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1673	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CACCGGGTGGCCCATGCCCTG	0.532													15	16	---	---	---	---	PASS
NT5C1B	93034	broad.mit.edu	37	2	18765969	18765969	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18765969C>T	uc002rcz.2	-	5	818	c.714G>A	c.(712-714)ACG>ACA	p.T238T	NT5C1B_uc002rcy.2_Silent_p.T238T|NT5C1B_uc010exr.2_Silent_p.T180T|NT5C1B_uc010yju.1_Silent_p.T178T|NT5C1B_uc002rda.2_Silent_p.T178T|NT5C1B_uc010yjv.1_Silent_p.T255T|NT5C1B_uc010yjw.1_Silent_p.T221T|NT5C1B_uc010exs.2_Silent_p.T240T|NT5C1B_uc002rdb.1_Silent_p.T30T	NM_001002006	NP_001002006	Q96P26	5NT1B_HUMAN	5' nucleotidase, cytosolic IB isoform 1	238					purine base metabolic process|purine nucleotide catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			skin(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				CGGTGGGGGACGTGCGCGAAT	0.657													6	12	---	---	---	---	PASS
LCLAT1	253558	broad.mit.edu	37	2	30863168	30863168	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30863168G>A	uc002rnj.2	+	7	1137	c.928G>A	c.(928-930)GAG>AAG	p.E310K	LCLAT1_uc010ymp.1_Missense_Mutation_p.E148K|LCLAT1_uc002rnl.2_Missense_Mutation_p.E272K|LCLAT1_uc010ymq.1_Missense_Mutation_p.E272K	NM_182551	NP_872357	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1 isoform 1	310					multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2						ACGGTGGGAAGAGAAAGAAGA	0.498													33	66	---	---	---	---	PASS
LCLAT1	253558	broad.mit.edu	37	2	30863174	30863174	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30863174G>A	uc002rnj.2	+	7	1143	c.934G>A	c.(934-936)GAA>AAA	p.E312K	LCLAT1_uc010ymp.1_Missense_Mutation_p.E150K|LCLAT1_uc002rnl.2_Missense_Mutation_p.E274K|LCLAT1_uc010ymq.1_Missense_Mutation_p.E274K	NM_182551	NP_872357	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1 isoform 1	312					multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2						GGAAGAGAAAGAAGAGAGGCT	0.498													38	73	---	---	---	---	PASS
CDC42EP3	10602	broad.mit.edu	37	2	37873588	37873588	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37873588C>A	uc002rqi.1	-	2	1136	c.143G>T	c.(142-144)GGC>GTC	p.G48V		NM_006449	NP_006440	Q9UKI2	BORG2_HUMAN	Cdc42 effector protein 3	48					regulation of cell shape|signal transduction	actin cytoskeleton|cytoplasm|endomembrane system|membrane	cytoskeletal regulatory protein binding				0		all_hematologic(82;0.172)				ATCGTGCTGGCCCTCTTTGCC	0.483													62	101	---	---	---	---	PASS
STAMBP	10617	broad.mit.edu	37	2	74077619	74077619	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74077619C>T	uc002sjs.2	+	7	1034	c.984C>T	c.(982-984)CTC>CTT	p.L328L	STAMBP_uc002sjt.2_Silent_p.L328L|STAMBP_uc002sju.2_Silent_p.L328L|STAMBP_uc002sjv.2_Silent_p.L328L	NM_201647	NP_964010	O95630	STABP_HUMAN	STAM binding protein	328	MPN.				JAK-STAT cascade|positive regulation of cell proliferation	early endosome|membrane|nucleus	metal ion binding|metallopeptidase activity|protein binding			ovary(1)|lung(1)|breast(1)|pancreas(1)	4						AGCAGGGCCTCATCACACTGG	0.463													16	37	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80773162	80773162	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80773162C>T	uc010ysh.1	+	10	1519	c.1514C>T	c.(1513-1515)TCA>TTA	p.S505L	CTNNA2_uc010yse.1_Missense_Mutation_p.S505L|CTNNA2_uc010ysf.1_Missense_Mutation_p.S505L|CTNNA2_uc010ysg.1_Missense_Mutation_p.S505L|CTNNA2_uc010ysi.1_Missense_Mutation_p.S137L	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	505					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GACATCACCTCAGTGGATGAC	0.512													11	19	---	---	---	---	PASS
ANAPC1	64682	broad.mit.edu	37	2	112588897	112588897	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112588897G>A	uc002thi.2	-	21	2838	c.2591C>T	c.(2590-2592)CCT>CTT	p.P864L		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	864					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						ACAGATTCCAGGGAGGTAAGG	0.388													17	29	---	---	---	---	PASS
IL1F8	27177	broad.mit.edu	37	2	113788646	113788646	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113788646G>C	uc002tiq.1	-	3	204	c.100C>G	c.(100-102)CTT>GTT	p.L34V	IL1F8_uc002tir.1_Missense_Mutation_p.L34V	NM_014438	NP_055253	Q9NZH7	IL36B_HUMAN	interleukin 1 family, member 8 isoform 1	34					immune response	extracellular space	cytokine activity|interleukin-1 receptor binding			ovary(1)	1						CTGCGGCTAAGAGGAGCTGCT	0.498													12	30	---	---	---	---	PASS
CCDC93	54520	broad.mit.edu	37	2	118703126	118703126	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118703126C>G	uc002tlj.2	-	17	1455	c.1329G>C	c.(1327-1329)TTG>TTC	p.L443F	CCDC93_uc010fld.1_Missense_Mutation_p.L443F	NM_019044	NP_061917	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	443										large_intestine(1)|ovary(1)	2						TTGCAGAGGTCAAGGTACCAG	0.517													9	24	---	---	---	---	PASS
CCDC74B	91409	broad.mit.edu	37	2	130900839	130900839	+	Intron	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130900839C>T	uc002tqm.1	-						CCDC74B_uc010yzw.1_5'UTR|CCDC74B_uc002tqn.1_Intron|CCDC74B_uc010yzx.1_Missense_Mutation_p.E100K	NM_207310	NP_997193	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B												0	Colorectal(110;0.1)					GCCCAGTTCTCACCTTTCTTC	0.542													21	20	---	---	---	---	PASS
SP3	6670	broad.mit.edu	37	2	174774691	174774691	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174774691G>A	uc002uig.2	-	7	2488	c.2324C>T	c.(2323-2325)TCT>TTT	p.S775F	SP3_uc002uie.2_Missense_Mutation_p.S707F|SP3_uc002uif.2_Missense_Mutation_p.S722F|SP3_uc010zel.1_Missense_Mutation_p.S772F	NM_003111	NP_003102	Q02447	SP3_HUMAN	Sp3 transcription factor isoform 1	775					negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	protein binding|zinc ion binding		EWSR1/SP3(3)	soft_tissue(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.185)			CTCATTTCCAGAAACTGTGAC	0.343													31	59	---	---	---	---	PASS
OLA1	29789	broad.mit.edu	37	2	175094076	175094076	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175094076C>T	uc002uih.2	-	3	391	c.205G>A	c.(205-207)GAA>AAA	p.E69K	OLA1_uc002uii.2_5'UTR|OLA1_uc010fqq.2_Missense_Mutation_p.E69K|OLA1_uc002uij.2_5'UTR|OLA1_uc002uik.2_Missense_Mutation_p.E39K|OLA1_uc010fqr.2_Missense_Mutation_p.E69K	NM_013341	NP_037473	Q9NTK5	OLA1_HUMAN	Obg-like ATPase 1 isoform 1	69	G.				ATP catabolic process	cytoplasm	ATP binding|GTP binding|hydrolase activity|protein binding			ovary(1)|breast(1)	2						TCAAACCTTTCATCTGGCACA	0.373													29	36	---	---	---	---	PASS
HOXD4	3233	broad.mit.edu	37	2	177016484	177016484	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177016484G>A	uc002uks.2	+	1	372	c.123G>A	c.(121-123)GCG>GCA	p.A41A		NM_014621	NP_055436	P09016	HXD4_HUMAN	homeobox D4	41						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00765)|Epithelial(96;0.105)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		GCGGCGGCGCGCAGGGCGCAG	0.697													10	23	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098960	178098960	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098960C>G	uc002ulh.3	-	2	640	c.85G>C	c.(85-87)GAT>CAT	p.D29H	NFE2L2_uc002ulg.3_Missense_Mutation_p.D13H|NFE2L2_uc010zfa.1_Missense_Mutation_p.D13H|NFE2L2_uc002uli.3_Missense_Mutation_p.D13H|NFE2L2_uc010fra.2_Missense_Mutation_p.D13H|NFE2L2_uc010frb.2_Missense_Mutation_p.D13H	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	29					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ACTCCAAGATCTATATCTTGC	0.363			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			12	25	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179393094	179393094	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179393094G>A	uc010zfg.1	-	310	99804	c.99580C>T	c.(99580-99582)CGA>TGA	p.R33194*	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.R26889*|TTN_uc010zfi.1_Nonsense_Mutation_p.R26822*|TTN_uc010zfj.1_Nonsense_Mutation_p.R26697*|TTN_uc002umq.2_Nonsense_Mutation_p.R211*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	34121							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGCATTTCGGATTTCAAGG	0.393													25	39	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179499165	179499165	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179499165G>T	uc010zfg.1	-	179	34863	c.34639C>A	c.(34639-34641)CAA>AAA	p.Q11547K	TTN_uc010zfh.1_Missense_Mutation_p.Q5242K|TTN_uc010zfi.1_Missense_Mutation_p.Q5175K|TTN_uc010zfj.1_Missense_Mutation_p.Q5050K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12474							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCATCAAATTGAGAATCATTA	0.383													9	61	---	---	---	---	PASS
ITGA4	3676	broad.mit.edu	37	2	182360122	182360122	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182360122C>A	uc002unu.2	+	13	2127	c.1364C>A	c.(1363-1365)TCT>TAT	p.S455Y		NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	455	FG-GAP 7.|Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	GCTTTTCGGTCTGATTCTGCT	0.333													32	55	---	---	---	---	PASS
RAPH1	65059	broad.mit.edu	37	2	204304738	204304738	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204304738C>A	uc002vad.2	-	14	3400	c.3175G>T	c.(3175-3177)GAC>TAC	p.D1059Y		NM_213589	NP_998754	Q70E73	RAPH1_HUMAN	Ras association and pleckstrin homology domains	1059					cell-matrix adhesion|signal transduction	cytoplasm|cytoskeleton|filopodium|lamellipodium|nucleus|plasma membrane				ovary(3)|breast(3)|central_nervous_system(2)|lung(1)|skin(1)	10						ACCACGGAGTCCTTTCCACGC	0.522													17	32	---	---	---	---	PASS
CRYGB	1419	broad.mit.edu	37	2	209010507	209010507	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209010507G>A	uc002vcp.3	-	2	276	c.243C>T	c.(241-243)CTC>CTT	p.L81L		NM_005210	NP_005201	P07316	CRGB_HUMAN	crystallin, gamma B	81	Beta/gamma crystallin 'Greek key' 2.				visual perception		structural constituent of eye lens				0				Epithelial(149;0.0641)|LUSC - Lung squamous cell carcinoma(261;0.0703)|Lung(261;0.132)		CCGGGGGGATGAGGCAGCAGG	0.468													46	55	---	---	---	---	PASS
PTPRN	5798	broad.mit.edu	37	2	220154978	220154978	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220154978C>T	uc002vkz.2	-	23	2999	c.2910G>A	c.(2908-2910)GTG>GTA	p.V970V	PTPRN_uc010zlc.1_Silent_p.V880V|PTPRN_uc002vla.2_Silent_p.V941V	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	970	Cytoplasmic (Potential).				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GGATGGCATTCACTTCCTCCG	0.612													21	23	---	---	---	---	PASS
PTPRN	5798	broad.mit.edu	37	2	220164721	220164721	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220164721G>A	uc002vkz.2	-	9	1511	c.1422C>T	c.(1420-1422)ATC>ATT	p.I474I	PTPRN_uc010zlc.1_Silent_p.I384I|PTPRN_uc002vla.2_Silent_p.I474I	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	474	Extracellular (Potential).				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GATCAGTGACGATGTAGCCAT	0.592													26	35	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220354509	220354509	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220354509G>T	uc010fwg.2	+	36	8769	c.8769G>T	c.(8767-8769)GAG>GAT	p.E2923D		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	2923	Pro-rich.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCCCTCCTGAGCCTACCAAGG	0.627													13	29	---	---	---	---	PASS
MFF	56947	broad.mit.edu	37	2	228221826	228221826	+	Missense_Mutation	SNP	G	C	C	rs62190918		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228221826G>C	uc002vos.2	+	11	1440	c.1022G>C	c.(1021-1023)CGC>CCC	p.R341P	MFF_uc002vot.2_Missense_Mutation_p.R290P|MFF_uc002vou.2_Missense_Mutation_p.R263P|MFF_uc002vov.2_Missense_Mutation_p.R237P|MFF_uc002vow.2_Missense_Mutation_p.R242P|MFF_uc002vox.2_Missense_Mutation_p.R217P|MFF_uc002voy.2_Missense_Mutation_p.R341P|MFF_uc002voz.2_Missense_Mutation_p.R217P|MFF_uc002vpa.2_Missense_Mutation_p.R129P	NM_020194	NP_064579	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	341	Mitochondrial intermembrane (Potential).					integral to membrane|mitochondrial outer membrane				large_intestine(1)	1						CTCTGGTTTCGCCGCTAGAGG	0.403													31	56	---	---	---	---	PASS
CAPN10	11132	broad.mit.edu	37	2	241535885	241535885	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241535885C>T	uc002vzk.1	+	8	1612	c.1428C>T	c.(1426-1428)GAC>GAT	p.D476D	CAPN10_uc002vzl.1_Intron|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Silent_p.D348D|CAPN10_uc002vzo.1_RNA|CAPN10_uc010fzg.1_RNA|CAPN10_uc002vzp.1_RNA|CAPN10_uc002vzq.1_Intron	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10 isoform a	476	Domain III 1.				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		TCCTGAAGGACGCGCCAGGGG	0.657													29	46	---	---	---	---	PASS
OXNAD1	92106	broad.mit.edu	37	3	16313177	16313177	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16313177C>T	uc003caw.2	+	4	588	c.131C>T	c.(130-132)TCC>TTC	p.S44F	OXNAD1_uc010her.1_Intron|OXNAD1_uc003cax.2_Missense_Mutation_p.S44F|OXNAD1_uc011awb.1_Missense_Mutation_p.S62F	NM_138381	NP_612390	Q96HP4	OXND1_HUMAN	oxidoreductase NAD-binding domain containing 1	44							oxidoreductase activity			skin(1)	1						ATAATGAAATCCAAAAGGAAA	0.328													26	15	---	---	---	---	PASS
GPR15	2838	broad.mit.edu	37	3	98251163	98251163	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98251163C>G	uc011bgy.1	+	1	286	c.286C>G	c.(286-288)CTA>GTA	p.L96V		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	96	Extracellular (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		AGAAGCATCTCTAGGACTGTG	0.502													17	22	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130399528	130399528	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130399528C>T	uc003enj.2	-	19	4416	c.3835G>A	c.(3835-3837)GTT>ATT	p.V1279I		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	1279					fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						CTTCCTGCAACAACATAGGAC	0.408													6	36	---	---	---	---	PASS
DBR1	51163	broad.mit.edu	37	3	137890464	137890464	+	Intron	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137890464C>G	uc003erv.2	-						DBR1_uc003eru.2_Intron	NM_016216	NP_057300	Q9UK59	DBR1_HUMAN	debranching enzyme homolog 1							nucleus	metal ion binding|RNA lariat debranching enzyme activity				0						AAATAATTCTCAAAACAATAC	0.343													11	39	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197431958	197431958	+	Intron	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197431958C>T	uc003fyc.2	-						KIAA0226_uc003fyd.3_Intron|KIAA0226_uc003fyf.2_Intron|KIAA0226_uc003fyg.2_Intron	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.						autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		TGCTCTCACTCTTACCTTCTC	0.562													10	20	---	---	---	---	PASS
PDS5A	23244	broad.mit.edu	37	4	39924314	39924314	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39924314G>A	uc003guv.3	-	6	1122	c.582C>T	c.(580-582)ATC>ATT	p.I194I	PDS5A_uc010ifo.2_Silent_p.I154I|PDS5A_uc003guw.3_Silent_p.I194I	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog	194					cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						CTTCCATGATGATAGAACTCA	0.333													8	24	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87653763	87653763	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87653763G>A	uc003hpz.2	+	12	2182	c.1702G>A	c.(1702-1704)GAG>AAG	p.E568K	PTPN13_uc003hpy.2_Missense_Mutation_p.E568K|PTPN13_uc003hqa.2_Missense_Mutation_p.E568K|PTPN13_uc003hqb.2_Missense_Mutation_p.E568K	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	568						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		AGGGAAGAATGAGGATAACCG	0.308													22	38	---	---	---	---	PASS
NUDT9	53343	broad.mit.edu	37	4	88356180	88356180	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88356180C>T	uc003hqq.2	+	2	478	c.155C>T	c.(154-156)TCT>TTT	p.S52F	NUDT9_uc003hqr.2_Missense_Mutation_p.S2F|NUDT9_uc010ikl.2_Missense_Mutation_p.S52F	NM_024047	NP_076952	Q9BW91	NUDT9_HUMAN	nudix-type motif 9 isoform a	52						mitochondrion	ADP-ribose diphosphatase activity				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		AACGTCATGTCTGGTTCTAAT	0.358													16	42	---	---	---	---	PASS
GALNTL6	442117	broad.mit.edu	37	4	173942728	173942728	+	Silent	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173942728C>G	uc003isv.2	+	12	2326	c.1590C>G	c.(1588-1590)CTC>CTG	p.L530L		NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6	530	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						CCGTTACACTCTATGACTGTC	0.468													42	23	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9122803	9122803	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9122803G>A	uc003jek.2	-	14	2458	c.1746C>T	c.(1744-1746)TGC>TGT	p.C582C		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	582	Extracellular (Potential).|TSP type-1 1.				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						CAGGGCCCTCGCACTGCCAGC	0.627													20	67	---	---	---	---	PASS
MARCH6	10299	broad.mit.edu	37	5	10415612	10415612	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10415612G>A	uc003jet.1	+	21	2162	c.1979G>A	c.(1978-1980)CGT>CAT	p.R660H	MARCH6_uc011cmu.1_Missense_Mutation_p.R612H|MARCH6_uc003jeu.1_Missense_Mutation_p.R358H|MARCH6_uc011cmv.1_Missense_Mutation_p.R555H	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6	660	Extracellular (Potential).				protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						TTTGCTGGCCGTTGGTTAATG	0.413													103	19	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70808182	70808182	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70808182G>A	uc003kbp.1	+	18	4437	c.4174G>A	c.(4174-4176)GAA>AAA	p.E1392K	BDP1_uc003kbo.2_Missense_Mutation_p.E1392K	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	1392					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		ACAGACTCATGAATCTGATAA	0.338													41	24	---	---	---	---	PASS
HEXB	3074	broad.mit.edu	37	5	73981268	73981268	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:73981268C>T	uc003kdf.3	+	1	300	c.183C>T	c.(181-183)CTC>CTT	p.L61L	HEXB_uc003kdd.2_Intron|HEXB_uc003kde.2_Silent_p.L61L|HEXB_uc010izh.2_RNA	NM_000521	NP_000512	P07686	HEXB_HUMAN	hexosaminidase B preproprotein	61					cell death	lysosome	cation binding|protein heterodimerization activity|protein homodimerization activity			ovary(1)	1		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.72e-57)		CCCTGCCGCTCTTGGTGAAGA	0.706													8	4	---	---	---	---	PASS
TRPC7	57113	broad.mit.edu	37	5	135692672	135692672	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135692672T>C	uc003lbn.1	-	1	404	c.401A>G	c.(400-402)CAG>CGG	p.Q134R	TRPC7_uc010jef.1_Missense_Mutation_p.Q126R|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.Q126R|TRPC7_uc010jei.1_Missense_Mutation_p.Q126R|TRPC7_uc010jej.1_5'UTR	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	135	Cytoplasmic (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CGTCAGGCGCTGGCCCTGCGC	0.672													13	16	---	---	---	---	PASS
IK	3550	broad.mit.edu	37	5	140037256	140037256	+	Intron	SNP	A	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140037256A>G	uc003lgq.2	+						IK_uc011czk.1_3'UTR	NM_006083	NP_006074	Q13123	RED_HUMAN	RED protein						cell-cell signaling|immune response	extracellular space|nucleus|soluble fraction				large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTACCTGGAGGGTTAGAGA	0.478													19	12	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150887058	150887058	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150887058G>C	uc003lue.3	-	22	12187	c.12174C>G	c.(12172-12174)TTC>TTG	p.F4058L	GM2A_uc011dcs.1_Intron|FAT2_uc003lud.3_Missense_Mutation_p.F665L	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	4058	Helical; (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTATGATAATGAACGCCACGG	0.577													30	21	---	---	---	---	PASS
DOK3	79930	broad.mit.edu	37	5	176936488	176936488	+	Silent	SNP	G	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176936488G>T	uc003mhk.2	-	2	227	c.222C>A	c.(220-222)GTC>GTA	p.V74V	DOK3_uc003mhh.3_5'Flank|DOK3_uc003mhi.3_Silent_p.V18V|DOK3_uc003mhj.3_Silent_p.V18V|DOK3_uc003mhl.2_Silent_p.V18V	NM_024872	NP_079148	Q7L591	DOK3_HUMAN	docking protein 3 isoform 1	74	PH.					cytoplasm|plasma membrane	insulin receptor binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TGCCAAACTTGACATGCTGCT	0.637													21	14	---	---	---	---	PASS
TFAP2A	7020	broad.mit.edu	37	6	10404765	10404765	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10404765G>A	uc003myr.2	-	4	992	c.740C>T	c.(739-741)TCG>TTG	p.S247L	TFAP2A_uc003myq.2_Missense_Mutation_p.S241L|TFAP2A_uc003mys.2_RNA|TFAP2A_uc011dih.1_Missense_Mutation_p.S247L|TFAP2A_uc003myt.2_Missense_Mutation_p.S243L|TFAP2A_uc003myu.1_Missense_Mutation_p.S247L	NM_003220	NP_003211	P05549	AP2A_HUMAN	transcription factor AP-2 alpha isoform a	247					ectoderm development|positive regulation of bone mineralization|positive regulation of tooth mineralization|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	centrosome|Golgi apparatus|nucleus	chromatin binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				GCCCAGCAGCGACGCGTTGAG	0.547													7	8	---	---	---	---	PASS
KIAA0319	9856	broad.mit.edu	37	6	24569028	24569028	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24569028G>A	uc011djo.1	-	13	2358	c.2121C>T	c.(2119-2121)CTC>CTT	p.L707L	KIAA0319_uc011djp.1_Silent_p.L662L|KIAA0319_uc003neh.1_Silent_p.L707L|KIAA0319_uc011djq.1_Silent_p.L698L|KIAA0319_uc011djr.1_Silent_p.L707L|KIAA0319_uc010jpt.1_Silent_p.L118L	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	707	PKD 4.|Extracellular (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						CAGCCACAGTGAGGGTGGACG	0.572													33	12	---	---	---	---	PASS
TCTE1	202500	broad.mit.edu	37	6	44254102	44254102	+	Missense_Mutation	SNP	C	T	T	rs149566851		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44254102C>T	uc003oxi.2	-	3	601	c.445G>A	c.(445-447)GGC>AGC	p.G149S	SPATS1_uc003oxg.2_Intron|TMEM151B_uc003oxf.2_Intron	NM_182539	NP_872345	Q5JU00	TCTE1_HUMAN	t-complex-associated testis expressed 1	149										ovary(2)|skin(2)	4	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TTCCAGCTGCCGCCATGGTGG	0.612													11	54	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	56006594	56006594	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56006594C>T	uc003pcs.2	-	12	1763	c.1531G>A	c.(1531-1533)GAT>AAT	p.D511N	COL21A1_uc003pct.1_RNA|COL21A1_uc011dxi.1_Missense_Mutation_p.D511N|COL21A1_uc003pcu.1_Missense_Mutation_p.D508N	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor	511					cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TTGTCACCATCTCGCCCTGGT	0.373													16	41	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56468158	56468158	+	Intron	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56468158C>T	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AAAAACTCTTCTGCCAACTTC	0.393													12	19	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101312040	101312040	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101312040C>T	uc003pqk.2	-	3	470	c.141G>A	c.(139-141)TGG>TGA	p.W47*	ASCC3_uc011eai.1_Intron|ASCC3_uc003pql.2_Nonsense_Mutation_p.W47*|ASCC3_uc010kcv.2_Nonsense_Mutation_p.W47*|ASCC3_uc003pqm.2_Nonsense_Mutation_p.W47*	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	47	Potential.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TTATCTTCTTCCATGTCAGGC	0.299													40	90	---	---	---	---	PASS
SOBP	55084	broad.mit.edu	37	6	107908338	107908338	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107908338G>A	uc003prx.2	+	5	1132	c.628G>A	c.(628-630)GAA>AAA	p.E210K	SOBP_uc003prw.1_Missense_Mutation_p.E210K	NM_018013	NP_060483	A7XYQ1	SOBP_HUMAN	sine oculis binding protein homolog	210							metal ion binding			ovary(1)	1		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		CTATGCTAAGGAAACTCCAAG	0.378													48	82	---	---	---	---	PASS
FAM184A	79632	broad.mit.edu	37	6	119345412	119345412	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119345412C>A	uc003pyj.2	-	2	1074	c.726G>T	c.(724-726)AAG>AAT	p.K242N	FAM184A_uc003pyk.3_Missense_Mutation_p.K122N|FAM184A_uc003pyl.3_Missense_Mutation_p.K122N	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1	242	Potential.									ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						CAATTAGTTTCTTCCGTTCAA	0.408													18	45	---	---	---	---	PASS
AHI1	54806	broad.mit.edu	37	6	135679284	135679284	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135679284C>G	uc003qgi.2	-	24	3535	c.3151G>C	c.(3151-3153)GAT>CAT	p.D1051H	AHI1_uc003qgf.2_RNA|AHI1_uc003qgg.2_Missense_Mutation_p.D501H|AHI1_uc003qgh.2_Missense_Mutation_p.D1051H|AHI1_uc003qgj.2_Missense_Mutation_p.D1051H|AHI1_uc003qgk.3_RNA	NM_001134831	NP_001128303	Q8N157	AHI1_HUMAN	Abelson helper integration site 1 isoform a	1051	SH3.					adherens junction|cilium|microtubule basal body				ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		GGTGCTGTATCTACCTGATGG	0.353													74	135	---	---	---	---	PASS
PHF14	9678	broad.mit.edu	37	7	11053396	11053396	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11053396G>A	uc003sry.1	+	5	1503	c.1068G>A	c.(1066-1068)GAG>GAA	p.E356E	PHF14_uc011jxi.1_Silent_p.E71E|PHF14_uc003srz.2_Silent_p.E356E|PHF14_uc011jxj.1_Silent_p.E71E	NM_014660	NP_055475	O94880	PHF14_HUMAN	PHD finger protein 14 isoform 2	356	PHD-type 1.						zinc ion binding			kidney(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		TTGATGGAGAGAGTGACTCTA	0.338													6	9	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43484575	43484575	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43484575G>A	uc003tid.1	+	11	2409	c.1804G>A	c.(1804-1806)GAG>AAG	p.E602K	HECW1_uc011kbi.1_Missense_Mutation_p.E602K	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	602					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						TGGGCTCAGCGAGGTGGACAC	0.711													12	14	---	---	---	---	PASS
OGDH	4967	broad.mit.edu	37	7	44747548	44747548	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44747548C>A	uc003tln.2	+	23	3131	c.3022C>A	c.(3022-3024)CGC>AGC	p.R1008S	OGDH_uc011kbx.1_Missense_Mutation_p.R1004S|OGDH_uc011kby.1_Missense_Mutation_p.R858S|OGDH_uc003tlp.2_Missense_Mutation_p.R1019S|OGDH_uc011kbz.1_Missense_Mutation_p.R803S	NM_002541	NP_002532	Q02218	ODO1_HUMAN	oxoglutarate dehydrogenase isoform 1 precursor	1008					glycolysis|lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|mitochondrial membrane	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			upper_aerodigestive_tract(1)|ovary(1)	2					NADH(DB00157)	GGAGCTGCAGCGCCTCCTGGA	0.642													3	45	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48273629	48273629	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48273629C>T	uc003toq.2	+	8	803	c.778C>T	c.(778-780)CTG>TTG	p.L260L	ABCA13_uc010kyr.2_5'UTR	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	260					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						AGTTTACCACCTGTCCATGCA	0.368													10	28	---	---	---	---	PASS
RFC2	5982	broad.mit.edu	37	7	73657531	73657531	+	Silent	SNP	G	A	A	rs143077432		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73657531G>A	uc003uaj.2	-	6	505	c.480C>T	c.(478-480)ATC>ATT	p.I160I	RFC2_uc011kfa.1_RNA|RFC2_uc003uak.2_Silent_p.I126I|RFC2_uc010lbp.2_Silent_p.I89I|RFC2_uc003ual.2_Silent_p.I59I	NM_181471	NP_852136	P35250	RFC2_HUMAN	replication factor C 2 isoform 1	160					cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2						TTTTAGAGTAGATTTCCATGG	0.517													16	63	---	---	---	---	PASS
FZD1	8321	broad.mit.edu	37	7	90894521	90894521	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90894521C>G	uc003ula.2	+	1	739	c.326C>G	c.(325-327)TCC>TGC	p.S109C		NM_003505	NP_003496	Q9UP38	FZD1_HUMAN	frizzled 1 precursor	109	Extracellular (Potential).				autocrine signaling|axonogenesis|brain development|canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|embryo development|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|lung alveolus development|negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|response to drug|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cell surface|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|receptor binding|Wnt receptor activity|Wnt-protein binding				0	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			CGGGGCATCTCCGTCCCGGAC	0.547													17	25	---	---	---	---	PASS
NAPEPLD	222236	broad.mit.edu	37	7	102760181	102760181	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102760181C>G	uc003vbc.2	-	3	1112	c.784G>C	c.(784-786)GAC>CAC	p.D262H	NAPEPLD_uc003vbd.2_Missense_Mutation_p.D262H|NAPEPLD_uc011klj.1_Missense_Mutation_p.D335H|NAPEPLD_uc003vbe.2_RNA	NM_198990	NP_945341	Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	262					phospholipid catabolic process	membrane	metal ion binding			skin(1)	1						ACCTTGTTGTCATCCATTAGA	0.478													16	36	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142148944	142148944	+	Intron	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142148944G>A	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc010lnw.1_Silent_p.L109L					SubName: Full=V_segment translation product; Flags: Fragment;																		TGCTGGCACAGAGATACAGGG	0.532													45	67	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146829596	146829596	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146829596C>G	uc003weu.1	+	8	1859	c.1343C>G	c.(1342-1344)TCC>TGC	p.S448C		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	448	Extracellular (Potential).|Laminin G-like 2.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ATCGATATTTCCTCAGGTCAG	0.408										HNSCC(39;0.1)			25	27	---	---	---	---	PASS
ABCB8	11194	broad.mit.edu	37	7	150725968	150725968	+	Intron	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150725968C>A	uc003wil.3	+						ABCB8_uc003wii.2_Missense_Mutation_p.P59Q|ABCB8_uc003wij.3_Intron|ABCB8_uc010lpw.1_Intron|ABCB8_uc010lpx.2_Intron|ABCB8_uc011kvd.1_Intron|ABCB8_uc003wim.3_Intron|ABCB8_uc003wik.3_Intron	NM_007188	NP_009119	Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B, member 8							ATP-binding cassette (ABC) transporter complex|integral to membrane|membrane fraction|mitochondrial inner membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCCGCACTCCCGACCGGGGGT	0.592											OREG0018445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	5	---	---	---	---	PASS
SH2D4A	63898	broad.mit.edu	37	8	19250842	19250842	+	Silent	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19250842C>G	uc003wzb.2	+	9	1398	c.1062C>G	c.(1060-1062)CTC>CTG	p.L354L	SH2D4A_uc011kym.1_Silent_p.L309L|SH2D4A_uc003wzc.2_Silent_p.L354L	NM_022071	NP_071354	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	354	SH2.					cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)		TTCTCACACTCAAGAAAGCAA	0.453													20	21	---	---	---	---	PASS
DPYSL2	1808	broad.mit.edu	37	8	26509955	26509955	+	Intron	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26509955G>A	uc003xfb.1	+						DPYSL2_uc003xfa.2_Intron|DPYSL2_uc010luk.1_Intron|DPYSL2_uc011lah.1_Intron	NM_001386	NP_001377	Q16555	DPYL2_HUMAN	dihydropyrimidinase-like 2						axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	dihydropyrimidinase activity|protein binding			large_intestine(1)	1		all_cancers(63;0.121)|Ovarian(32;2.68e-05)|all_epithelial(46;0.116)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;3.33e-10)|Colorectal(74;0.183)		GGAGCAGGGTGAGTAGTTTTG	0.363													23	15	---	---	---	---	PASS
KCNK9	51305	broad.mit.edu	37	8	140630927	140630927	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140630927C>T	uc003yvf.1	-	2	763	c.699G>A	c.(697-699)ACG>ACA	p.T233T	KCNK9_uc003yvg.1_Silent_p.T233T|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	233	Helical; (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			CCCCGATGACCGTCAGCCCCA	0.592													24	6	---	---	---	---	PASS
JAK2	3717	broad.mit.edu	37	9	5080270	5080270	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5080270G>A	uc010mhm.2	+	16	2286	c.2173G>A	c.(2173-2175)GAA>AAA	p.E725K	JAK2_uc003ziw.2_Missense_Mutation_p.E725K	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2	725	Protein kinase 1.				actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding		PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		TGAATGCATTGAAAATCCTAA	0.363		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				82	82	---	---	---	---	PASS
TRPM6	140803	broad.mit.edu	37	9	77353418	77353418	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77353418A>T	uc004ajl.1	-	36	5919	c.5681T>A	c.(5680-5682)ATC>AAC	p.I1894N	TRPM6_uc004ajk.1_Missense_Mutation_p.I1889N|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.I845N|TRPM6_uc010mpd.1_Missense_Mutation_p.I727N|TRPM6_uc010mpe.1_Missense_Mutation_p.I441N|TRPM6_uc004ajj.1_Missense_Mutation_p.I850N	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	1894	Alpha-type protein kinase.|Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						GGTGGGGGTGATTTCATCACC	0.468													29	81	---	---	---	---	PASS
ZCCHC6	79670	broad.mit.edu	37	9	88916323	88916323	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88916323C>T	uc004aoq.2	-	26	4503	c.4288G>A	c.(4288-4290)GAG>AAG	p.E1430K	ZCCHC6_uc010mqe.2_Missense_Mutation_p.E330K|ZCCHC6_uc011ltf.1_RNA|ZCCHC6_uc004aor.2_RNA|ZCCHC6_uc004aos.2_RNA|ZCCHC6_uc004aot.2_Missense_Mutation_p.E1194K|ZCCHC6_uc004aou.2_Missense_Mutation_p.E1430K	NM_024617	NP_078893	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	1430					RNA 3'-end processing		nucleic acid binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)	2						AGGATCTTCTCCCTCCCCAGG	0.463													25	32	---	---	---	---	PASS
ANKS6	203286	broad.mit.edu	37	9	101513319	101513319	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101513319C>T	uc004ayu.2	-	13	2407	c.2386G>A	c.(2386-2388)GAA>AAA	p.E796K	ANKS6_uc004ayt.2_Missense_Mutation_p.E495K|ANKS6_uc004ayv.1_Missense_Mutation_p.E259K|ANKS6_uc004ayw.1_Missense_Mutation_p.E379K|ANKS6_uc004ayx.1_RNA|ANKS6_uc004ayy.1_RNA	NM_173551	NP_775822	Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain	796	SAM.									ovary(2)	2		Acute lymphoblastic leukemia(62;0.0527)				ACCTCTTGTTCCTCAAAAATG	0.303													13	23	---	---	---	---	PASS
INVS	27130	broad.mit.edu	37	9	103035180	103035180	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103035180C>T	uc004bap.1	+	12	1818	c.1606C>T	c.(1606-1608)CGC>TGC	p.R536C	INVS_uc010mta.1_Missense_Mutation_p.R440C|INVS_uc011lve.1_Missense_Mutation_p.R440C|INVS_uc004bao.1_Missense_Mutation_p.R536C|INVS_uc004baq.1_Missense_Mutation_p.R440C|INVS_uc004bar.1_Missense_Mutation_p.R440C|INVS_uc010mtb.1_Missense_Mutation_p.R210C	NM_014425	NP_055240	Q9Y283	INVS_HUMAN	inversin isoform a	536	ANK 16.				negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|membrane|microtubule|nucleus|spindle	calmodulin binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.056)				GCTTGGTGAGCGCCATGAAGT	0.433													75	132	---	---	---	---	PASS
LPAR1	1902	broad.mit.edu	37	9	113704217	113704217	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113704217C>A	uc004bfa.2	-	4	532	c.277G>T	c.(277-279)GCT>TCT	p.A93S	LPAR1_uc011lwm.1_Missense_Mutation_p.A94S|LPAR1_uc004bfb.2_Missense_Mutation_p.A93S|LPAR1_uc004bfc.2_Missense_Mutation_p.A93S|LPAR1_uc011lwn.1_Missense_Mutation_p.A75S|LPAR1_uc011lwo.1_Missense_Mutation_p.A94S|LPAR1_uc010mub.2_Missense_Mutation_p.A93S	NM_057159	NP_476500	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1	93	Helical; Name=2; (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	cell surface|integral to plasma membrane				ovary(2)	2						AAGTCTGCAGCAGCCAGATTA	0.468													43	96	---	---	---	---	PASS
PKN3	29941	broad.mit.edu	37	9	131476384	131476384	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131476384C>G	uc004bvw.2	+	10	1689	c.1296C>G	c.(1294-1296)ATC>ATG	p.I432M	PKN3_uc010myh.2_Missense_Mutation_p.I432M|PKN3_uc011mbk.1_Translation_Start_Site	NM_013355	NP_037487	Q6P5Z2	PKN3_HUMAN	protein kinase PKNbeta	432					signal transduction	Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein binding|protein kinase C activity			stomach(2)|lung(2)	4						AGGAACGCATCTTCTCTAAAC	0.632													34	63	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139399887	139399887	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139399887C>G	uc004chz.2	-	25	4461	c.4461G>C	c.(4459-4461)TGG>TGC	p.W1487C	NOTCH1_uc004cia.1_Missense_Mutation_p.W717C	NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	1487	Extracellular (Potential).|LNR 1.				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TGCAGTTCTTCCAGGGGTCAT	0.612			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			20	8	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139400124	139400124	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139400124C>A	uc004chz.2	-	25	4224	c.4224G>T	c.(4222-4224)GAG>GAT	p.E1408D	NOTCH1_uc004cia.1_Missense_Mutation_p.E638D	NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	1408	Extracellular (Potential).|EGF-like 36.				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		AGAAGGGGCTCTCGGATGTGG	0.682			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			19	5	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139400126	139400126	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139400126C>T	uc004chz.2	-	25	4222	c.4222G>A	c.(4222-4224)GAG>AAG	p.E1408K	NOTCH1_uc004cia.1_Missense_Mutation_p.E638K	NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	1408	Extracellular (Potential).|EGF-like 36.				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		AAGGGGCTCTCGGATGTGGGC	0.682			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			19	5	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139401856	139401856	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139401856C>G	uc004chz.2	-	22	3544	c.3544G>C	c.(3544-3546)GAG>CAG	p.E1182Q	NOTCH1_uc004cia.1_Missense_Mutation_p.E412Q	NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	1182	Extracellular (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TCGATCTCCTCAGAGCAGTTC	0.682			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			17	0	---	---	---	---	PASS
GRIN1	2902	broad.mit.edu	37	9	140040366	140040366	+	Intron	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140040366C>T	uc004clk.2	+						GRIN1_uc004cli.1_Intron|GRIN1_uc004clj.1_Intron|GRIN1_uc004cll.2_Intron|GRIN1_uc004clm.2_Intron|GRIN1_uc004cln.2_Intron|GRIN1_uc004clo.2_Intron	NM_007327	NP_015566	Q05586	NMDZ1_HUMAN	NMDA receptor 1 isoform NR1-3 precursor						ionotropic glutamate receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|regulation of excitatory postsynaptic membrane potential|response to ethanol|visual learning	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane|synaptic vesicle|synaptosome	calcium ion binding|calmodulin binding|extracellular-glutamate-gated ion channel activity|glutamate binding|glycine binding			skin(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	TGAGGGTCGGCGCCGCGGGTG	0.672													7	5	---	---	---	---	PASS
SGPL1	8879	broad.mit.edu	37	10	72637064	72637064	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72637064A>G	uc001jrm.2	+	15	1901	c.1679A>G	c.(1678-1680)CAG>CGG	p.Q560R	SGPL1_uc009xqk.2_RNA	NM_003901	NP_003892	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	560	Cytoplasmic (Potential).				apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity				0					Pyridoxal Phosphate(DB00114)	CAGGGCAGCCAGATGAATGGT	0.517													14	32	---	---	---	---	PASS
ZNF518A	9849	broad.mit.edu	37	10	97919065	97919065	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97919065G>A	uc001klp.2	+	6	3843	c.2986G>A	c.(2986-2988)GAG>AAG	p.E996K	ZNF518A_uc001klo.1_Missense_Mutation_p.E466K|ZNF518A_uc001klq.2_Missense_Mutation_p.E996K|ZNF518A_uc001klr.2_Missense_Mutation_p.E996K	NM_014803	NP_055618	Q6AHZ1	Z518A_HUMAN	zinc finger protein 518	996					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TGTCAAAACCGAGGGTGCCCC	0.423													31	58	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	117607476	117607476	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117607476C>T	uc001lcg.2	+	28	4378	c.3992C>T	c.(3991-3993)TCA>TTA	p.S1331L	ATRNL1_uc010qsm.1_Missense_Mutation_p.S460L|ATRNL1_uc010qsn.1_RNA	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	1331	Cytoplasmic (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CGAGGATCATCAGGTGCCCCT	0.468													13	21	---	---	---	---	PASS
CYP2E1	1571	broad.mit.edu	37	10	135369482	135369482	+	3'UTR	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135369482C>G	uc001lnl.1	+	6					SYCE1_uc001lnm.2_Intron|SYCE1_uc009ybn.2_Intron|SYCE1_uc001lnn.2_Intron|SYCE1_uc001lno.2_Intron			P05181	CP2E1_HUMAN	SubName: Full=Cytochrome P450, family 2, subfamily E, polypeptide 1 variant; Flags: Fragment;						drug metabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding			central_nervous_system(3)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Dacarbazine(DB00851)|Dapsone(DB00250)|Enflurane(DB00228)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethosuximide(DB00593)|Fomepizole(DB01213)|Glutathione(DB00143)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Isoniazid(DB00951)|Menadione(DB00170)|Mephenytoin(DB00532)|Methoxyflurane(DB01028)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitrofurantoin(DB00698)|Orphenadrine(DB01173)|Phenelzine(DB00780)|Quinidine(DB00908)|S-Adenosylmethionine(DB00118)|Sevoflurane(DB01236)|Theophylline(DB00277)|Tolbutamide(DB01124)	TCCCTGGTCTCACCTTCCTTG	0.582									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				20	94	---	---	---	---	PASS
ZNF143	7702	broad.mit.edu	37	11	9494253	9494253	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9494253G>A	uc001mhr.2	+	3	260	c.142G>A	c.(142-144)GTA>ATA	p.V48I	ZNF143_uc009yfu.2_Missense_Mutation_p.V48I|ZNF143_uc010rby.1_Intron	NM_003442	NP_003433	P52747	ZN143_HUMAN	zinc finger protein 143	48					regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|zinc ion binding				0				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		TATGGAAGGCGTAAGCTTGCA	0.343													41	58	---	---	---	---	PASS
MRGPRX1	259249	broad.mit.edu	37	11	18956110	18956110	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18956110G>A	uc001mpg.2	-	1	440	c.222C>T	c.(220-222)CTC>CTT	p.L74L		NM_147199	NP_671732	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	74	Helical; Name=2; (Potential).				acute-phase response	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(2)|central_nervous_system(1)	3						CGCTGAGGAAGAGGAAGTCTG	0.517													38	165	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	30930673	30930673	+	Intron	SNP	G	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30930673G>C	uc001mss.1	-						uc009yjk.1_Intron|uc009yjj.1_5'Flank					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		TCTGAAAAAAGAGGCAAAATA	0.338													14	22	---	---	---	---	PASS
GLYAT	10249	broad.mit.edu	37	11	58477548	58477548	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58477548C>T	uc001nnb.2	-	6	737	c.582G>A	c.(580-582)CAG>CAA	p.Q194Q		NM_201648	NP_964011	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase isoform a	194					acyl-CoA metabolic process|response to toxin|xenobiotic metabolic process	mitochondrial matrix	glycine N-acyltransferase activity|glycine N-benzoyltransferase activity				0		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	CAATGAATCTCTGGCTCCTCT	0.498													31	51	---	---	---	---	PASS
DDB1	1642	broad.mit.edu	37	11	61084025	61084025	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61084025G>A	uc001nrc.3	-	11	1466	c.1240C>T	c.(1240-1242)CGG>TGG	p.R414W	DDB1_uc010rle.1_Intron|DDB1_uc010rlf.1_Missense_Mutation_p.R414W|DDB1_uc010rlg.1_RNA|DDB1_uc001nrd.2_Missense_Mutation_p.R414W	NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	414	Interaction with CDT1.|Interaction with CUL4A.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4						GGGTCAGACCGCAGTGGCCAT	0.478								NER					55	75	---	---	---	---	PASS
GANAB	23193	broad.mit.edu	37	11	62397703	62397703	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62397703C>T	uc001nub.2	-	13	1592	c.1559G>A	c.(1558-1560)TGG>TAG	p.W520*	GANAB_uc001ntz.2_5'Flank|GANAB_uc001nua.2_Nonsense_Mutation_p.W542*|GANAB_uc001nuc.2_Nonsense_Mutation_p.W423*|GANAB_uc010rma.1_Nonsense_Mutation_p.W428*|GANAB_uc010rmb.1_Nonsense_Mutation_p.W406*	NM_198334	NP_938148	Q14697	GANAB_HUMAN	neutral alpha-glucosidase AB isoform 2	520					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|Golgi apparatus|melanosome	carbohydrate binding|glucan 1,3-alpha-glucosidase activity|protein binding			ovary(3)|central_nervous_system(1)|skin(1)	5						GTTAGCCCACCAGGCCCTCAT	0.542													5	9	---	---	---	---	PASS
KDM2A	22992	broad.mit.edu	37	11	66975079	66975079	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66975079G>A	uc001ojw.2	+	6	1270	c.406G>A	c.(406-408)GAG>AAG	p.E136K	KDM2A_uc001ojx.2_RNA|KDM2A_uc001ojy.2_5'UTR	NM_012308	NP_036440	Q9Y2K7	KDM2A_HUMAN	F-box and leucine-rich repeat protein 11	136					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			ovary(4)|lung(3)|breast(1)|skin(1)	9						CCCAGAGGAGGAGCGAGAGAA	0.502													9	17	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78381424	78381424	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78381424A>G	uc001ozl.3	-	32	6429	c.5966T>C	c.(5965-5967)ATA>ACA	p.I1989T	ODZ4_uc001ozk.3_Missense_Mutation_p.I214T|ODZ4_uc009yvb.1_Missense_Mutation_p.I573T	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1989	Extracellular (Potential).|YD 8.				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						GAAGTCCTGTATGACTGAGGC	0.557													4	21	---	---	---	---	PASS
MMP8	4317	broad.mit.edu	37	11	102589172	102589172	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102589172C>T	uc001phe.2	-	5	856	c.757G>A	c.(757-759)GAC>AAC	p.D253N	MMP8_uc010rut.1_Missense_Mutation_p.D188N|MMP8_uc010ruu.1_Missense_Mutation_p.D230N	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein	253					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)		CCATCGATGTCATCTTGAGGG	0.493													7	15	---	---	---	---	PASS
KBTBD3	143879	broad.mit.edu	37	11	105923634	105923634	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105923634G>A	uc001pja.2	-	4	2422	c.1782C>T	c.(1780-1782)TGC>TGT	p.C594C	KBTBD3_uc001pjb.2_Silent_p.C594C|KBTBD3_uc009yxm.2_Silent_p.C515C	NM_198439	NP_940841	Q8NAB2	KBTB3_HUMAN	BTB and kelch domain containing 3	590	Kelch 5.									ovary(1)|central_nervous_system(1)	2		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		GAATCACCTGGCAGTAAAATT	0.388													29	59	---	---	---	---	PASS
SLC37A2	219855	broad.mit.edu	37	11	124955860	124955860	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124955860G>A	uc001qbn.2	+	17	1687	c.1436G>A	c.(1435-1437)CGG>CAG	p.R479Q	SLC37A2_uc010sau.1_Missense_Mutation_p.R479Q|SLC37A2_uc010sav.1_Missense_Mutation_p.R104Q|SLC37A2_uc001qbp.2_Missense_Mutation_p.R104Q	NM_001145290	NP_001138762	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glycerol-3-phosphate	479	Helical; (Potential).				carbohydrate transport|transmembrane transport	integral to membrane				ovary(2)	2	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		CTCCTTTGCCGGTTAGTATAC	0.592													22	47	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20709614	20709614	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20709614G>T	uc001reh.1	+	2	1003	c.981G>T	c.(979-981)TGG>TGT	p.W327C		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	327					lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	ATTCAGAATGGGACCACAAAC	0.343													14	28	---	---	---	---	PASS
DENND5B	160518	broad.mit.edu	37	12	31540647	31540647	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31540647C>T	uc001rki.1	-	21	3901	c.3715G>A	c.(3715-3717)GCT>ACT	p.A1239T	DENND5B_uc001rkh.1_Missense_Mutation_p.A1274T|DENND5B_uc009zjq.1_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1239	RUN 2.					integral to membrane				ovary(1)|central_nervous_system(1)	2						CGCAGGAGAGCGCTCTCTTCA	0.493													12	6	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49438040	49438040	+	Nonsense_Mutation	SNP	T	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49438040T>A	uc001rta.3	-	21	5131	c.5131A>T	c.(5131-5133)AAA>TAA	p.K1711*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1711					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GGCCCCTTTTTCGTGCGTGTG	0.622			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)	OREG0021780	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	17	---	---	---	---	PASS
SLC25A3	5250	broad.mit.edu	37	12	98995213	98995213	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98995213C>G	uc001tfo.2	+	8	1116	c.996C>G	c.(994-996)ATC>ATG	p.I332M	SLC25A3_uc001tfm.2_Missense_Mutation_p.I331M|SLC25A3_uc001tfn.2_Missense_Mutation_p.I331M|SLC25A3_uc001tfp.2_Missense_Mutation_p.I331M|SLC25A3_uc001tfq.2_Missense_Mutation_p.I201M|SLC25A3_uc001tfr.2_Missense_Mutation_p.I332M|SLC25A3_uc001tfs.2_Missense_Mutation_p.I288M|SLC25A3_uc009ztn.2_Missense_Mutation_p.I294M|SLC25A3_uc001tft.2_Missense_Mutation_p.I331M	NM_005888	NP_005879	Q00325	MPCP_HUMAN	solute carrier family 25 member 3 isoform a	332	Solcar 3.|Helical; Name=6; (Potential).				generation of precursor metabolites and energy	integral to plasma membrane|mitochondrial inner membrane	phosphate carrier activity|symporter activity				0		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		AGTGGTTTATCTATGACTCCG	0.458													29	52	---	---	---	---	PASS
SLC25A3	5250	broad.mit.edu	37	12	98995275	98995275	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98995275C>G	uc001tfo.2	+	8	1178	c.1058C>G	c.(1057-1059)TCT>TGT	p.S353C	SLC25A3_uc001tfm.2_Missense_Mutation_p.S352C|SLC25A3_uc001tfn.2_Missense_Mutation_p.S352C|SLC25A3_uc001tfp.2_Missense_Mutation_p.S352C|SLC25A3_uc001tfq.2_Missense_Mutation_p.S222C|SLC25A3_uc001tfr.2_Missense_Mutation_p.S353C|SLC25A3_uc001tfs.2_Missense_Mutation_p.S309C|SLC25A3_uc009ztn.2_Missense_Mutation_p.S315C|SLC25A3_uc001tft.2_Missense_Mutation_p.S352C	NM_005888	NP_005879	Q00325	MPCP_HUMAN	solute carrier family 25 member 3 isoform a	353	Mitochondrial intermembrane (Potential).				generation of precursor metabolites and energy	integral to plasma membrane|mitochondrial inner membrane	phosphate carrier activity|symporter activity				0		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		ATGCCAGAGTCTCTGAAGAAG	0.448													9	26	---	---	---	---	PASS
CPB2	1361	broad.mit.edu	37	13	46638848	46638848	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46638848A>C	uc001vaw.2	-	8	798	c.731T>G	c.(730-732)TTC>TGC	p.F244C	uc001vau.1_Intron|uc001vav.1_Intron|CPB2_uc001vax.2_Missense_Mutation_p.F207C	NM_001872	NP_001863	Q96IY4	CBPB2_HUMAN	plasma carboxypeptidase B2 isoform a	244					blood coagulation|fibrinolysis|proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			ovary(1)|skin(1)	2		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		GTTCGCATAGAAAGAACGGTT	0.413													21	35	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77862415	77862415	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77862415G>C	uc001vkf.2	-	4	452	c.361C>G	c.(361-363)CTG>GTG	p.L121V	MYCBP2_uc010aev.2_5'UTR	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	121					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TGCCATTCCAGAACGCAATGG	0.393													38	60	---	---	---	---	PASS
ZNF219	51222	broad.mit.edu	37	14	21560966	21560966	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21560966G>A	uc001vzr.2	-	3	911	c.490C>T	c.(490-492)CGT>TGT	p.R164C	ZNF219_uc001vzs.2_Missense_Mutation_p.R164C|ZNF219_uc010aik.1_Missense_Mutation_p.R164C	NM_016423	NP_057507	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	164	C2H2-type 3.				negative regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|histamine receptor activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(1)	1	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		TAGGGGCAACGGAAGGCGGAC	0.677											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	8	---	---	---	---	PASS
TINF2	26277	broad.mit.edu	37	14	24711514	24711514	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24711514G>A	uc001woa.3	-	1	367	c.25C>T	c.(25-27)CCC>TCC	p.P9S	TINF2_uc010alm.2_5'Flank|TINF2_uc001wob.3_Missense_Mutation_p.P9S|TINF2_uc010tof.1_Missense_Mutation_p.P9S|TINF2_uc001woc.3_Missense_Mutation_p.P9S	NM_001099274	NP_001092744	Q9BSI4	TINF2_HUMAN	TERF1 (TRF1)-interacting nuclear factor 2	9					negative regulation of epithelial cell proliferation|negative regulation of protein ADP-ribosylation|negative regulation of telomere maintenance via telomerase|positive regulation of telomere maintenance|protein localization to chromosome, telomeric region|telomere assembly|telomere maintenance via telomere lengthening	nuclear telomere cap complex|nucleoplasm|perinucleolar chromocenter	protein binding|protein binding|telomeric DNA binding				0				GBM - Glioblastoma multiforme(265;0.0185)		AGAGCTGCGGGACCCGCCACC	0.677									Ataxia_Pancytopenia_syndrome|Congenital_Dyskeratosis		OREG0022621	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	20	---	---	---	---	PASS
STXBP6	29091	broad.mit.edu	37	14	25326285	25326285	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25326285G>A	uc001wpu.2	-	3	948	c.233C>T	c.(232-234)TCA>TTA	p.S78L	STXBP6_uc001wpv.2_Missense_Mutation_p.S78L|STXBP6_uc001wpw.2_Missense_Mutation_p.S78L|STXBP6_uc001wpx.1_RNA	NM_014178	NP_054897	Q8NFX7	STXB6_HUMAN	amisyn	78					vesicle-mediated transport	cytoplasm|integral to membrane					0				GBM - Glioblastoma multiforme(265;0.0296)		CATCCACTGTGATCTCCGAAC	0.463													42	72	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71495433	71495433	+	Silent	SNP	T	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71495433T>C	uc001xmo.2	+	16	3929	c.3483T>C	c.(3481-3483)CTT>CTC	p.L1161L	PCNX_uc010are.1_Silent_p.L1050L|PCNX_uc010arf.1_Silent_p.L21L	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1161	Helical; (Potential).					integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CAAGCCTGCTTGCAGCACTTT	0.303													35	44	---	---	---	---	PASS
YLPM1	56252	broad.mit.edu	37	14	75266402	75266402	+	Splice_Site	SNP	T	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75266402T>C	uc001xqj.3	+	5	4524	c.4400_splice	c.e5+2	p.R1467_splice	YLPM1_uc001xql.3_Splice_Site	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		AATGCTTCGGTAAGTTGACTC	0.373													12	22	---	---	---	---	PASS
EIF5	1983	broad.mit.edu	37	14	103806896	103806896	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103806896G>A	uc001ymq.2	+	11	1726	c.1204G>A	c.(1204-1206)GAG>AAG	p.E402K	EIF5_uc001ymr.2_Missense_Mutation_p.E402K|EIF5_uc001yms.2_Missense_Mutation_p.E402K|EIF5_uc001ymt.2_Missense_Mutation_p.E402K|EIF5_uc001ymu.2_Missense_Mutation_p.E402K	NM_001969	NP_001960	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	402	Asp/Glu-rich (highly acidic).				regulation of translational initiation|RNA metabolic process	cytosol	GTP binding|GTPase activity|translation initiation factor activity			pancreas(1)|breast(1)|skin(1)	3		Melanoma(154;0.155)	Epithelial(46;0.182)			TGAGAACATTGAGGTAAACAT	0.423													32	52	---	---	---	---	PASS
C15orf63	25764	broad.mit.edu	37	15	44092974	44092974	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44092974C>T	uc001ztf.2	+	1	354	c.178C>T	c.(178-180)CTG>TTG	p.L60L	ELL3_uc001zsx.1_5'Flank|C15orf63_uc001ztb.2_Silent_p.L106L|SERINC4_uc001ztc.1_5'Flank|SERINC4_uc001ztd.1_5'Flank|SERINC4_uc010bds.1_5'Flank|SERINC4_uc001zte.1_5'Flank|C15orf63_uc001ztg.1_Silent_p.L52L	NM_016400	NP_057484	Q9NX55	HYPK_HUMAN	chromosome 15 open reading frame 63	60											0						GAGTTCCAATCTGGAGACGGT	0.622													4	10	---	---	---	---	PASS
B2M	567	broad.mit.edu	37	15	45007719	45007719	+	Nonsense_Mutation	SNP	G	T	T	rs11553042		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45007719G>T	uc001zuc.2	+	2	226	c.166G>T	c.(166-168)GAA>TAA	p.E56*	B2M_uc010uek.1_Nonsense_Mutation_p.E56*|B2M_uc010bdx.1_Nonsense_Mutation_p.E56*	NM_004048	NP_004039	P61769	B2MG_HUMAN	beta-2-microglobulin precursor	56	Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|regulation of defense response to virus by virus|viral reproduction	early endosome membrane|Golgi membrane|MHC class I protein complex	protein binding			ovary(2)|skin(1)	3		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		ATCCGACATTGAAGTTGACTT	0.408													31	61	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48936854	48936854	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48936854C>T	uc001zwx.1	-	2	441	c.113G>A	c.(112-114)AGA>AAA	p.R38K		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	38					heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CCGACTGGCTCTGGTTTCCTT	0.577													44	92	---	---	---	---	PASS
MNS1	55329	broad.mit.edu	37	15	56748599	56748599	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56748599C>G	uc002adr.2	-	3	511	c.346G>C	c.(346-348)GAA>CAA	p.E116Q	MNS1_uc010bfo.2_Intron	NM_018365	NP_060835	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	116	Potential.|Glu-rich.				meiosis					ovary(1)	1				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		TACCTGTTTTCTCTTACTTGT	0.323													8	20	---	---	---	---	PASS
CGNL1	84952	broad.mit.edu	37	15	57754079	57754079	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57754079G>A	uc002aeg.2	+	8	2468	c.2392G>A	c.(2392-2394)GAA>AAA	p.E798K	CGNL1_uc010bfw.2_Missense_Mutation_p.E798K	NM_032866	NP_116255	Q0VF96	CGNL1_HUMAN	cingulin-like 1	798	Potential.					myosin complex|tight junction	motor activity			skin(6)|ovary(4)|central_nervous_system(1)	11				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		GAGTGTGGAAGAAGCAACCAA	0.527													7	8	---	---	---	---	PASS
FAM63B	54629	broad.mit.edu	37	15	59080149	59080149	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59080149G>A	uc002afj.2	+	2	1087	c.885G>A	c.(883-885)CTG>CTA	p.L295L	FAM63B_uc002afi.2_Silent_p.L295L|FAM63B_uc002afk.2_RNA|FAM63B_uc002afl.2_RNA	NM_001040450	NP_001035540	Q8NBR6	FA63B_HUMAN	hypothetical protein LOC54629 isoform a	295										central_nervous_system(1)	1						CTGAGCAGCTGATGGAATATT	0.313													12	36	---	---	---	---	PASS
TARSL2	123283	broad.mit.edu	37	15	102244135	102244135	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102244135C>T	uc002bxm.2	-	8	1056	c.1001G>A	c.(1000-1002)GGT>GAT	p.G334D	TARSL2_uc002bxl.2_5'Flank|TARSL2_uc010usi.1_RNA	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	334					threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity			ovary(2)	2	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AATTAATGGACCGCACCTATA	0.333													9	17	---	---	---	---	PASS
SOLH	6650	broad.mit.edu	37	16	602965	602965	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:602965G>A	uc002chi.2	+	13	3370	c.3007G>A	c.(3007-3009)GAC>AAC	p.D1003N	SOLH_uc002chj.2_Missense_Mutation_p.D63N	NM_005632	NP_005623	O75808	CAN15_HUMAN	small optic lobes	1003					proteolysis	intracellular	calcium-dependent cysteine-type endopeptidase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(780;0.00335)				CGTGCAGTGTGACTGCACCGA	0.572													4	24	---	---	---	---	PASS
RHOT2	89941	broad.mit.edu	37	16	721776	721776	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:721776G>A	uc002cip.2	+	12	1016	c.949G>A	c.(949-951)GAC>AAC	p.D317N	RHOT2_uc002ciq.2_Missense_Mutation_p.D210N|RHOT2_uc010bqy.2_Missense_Mutation_p.D96N	NM_138769	NP_620124	Q8IXI1	MIRO2_HUMAN	ras homolog gene family, member T2	317	2 (Potential).|EF-hand 2.|Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			pancreas(1)	1		Hepatocellular(780;0.0218)				TGAGAAGCACGACCAGGTGAG	0.532													15	38	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27761023	27761023	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27761023C>G	uc002dow.2	+	16	2766	c.2742C>G	c.(2740-2742)ATC>ATG	p.I914M		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	914										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						GGGGACGCATCTCCAACACGG	0.652													25	53	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31091077	31091077	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31091077G>A	uc002eap.2	+	2	3721	c.3432G>A	c.(3430-3432)CCG>CCA	p.P1144P		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	1144					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						AGGAGGGGCCGGGGCAAGCAG	0.607													12	23	---	---	---	---	PASS
CES3	23491	broad.mit.edu	37	16	66998385	66998385	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66998385C>G	uc002eqt.2	+	5	759	c.686C>G	c.(685-687)TCT>TGT	p.S229C	CES3_uc010cdz.2_Missense_Mutation_p.S229C|CES3_uc010cea.2_RNA|CES3_uc010viw.1_5'Flank	NM_024922	NP_079198	Q6UWW8	EST3_HUMAN	carboxylesterase 3 precursor	229		Acyl-ester intermediate (By similarity).				endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity			ovary(3)|central_nervous_system(2)	5		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		TTTGGTGGATCTGCCGGTGGG	0.582													17	28	---	---	---	---	PASS
ELMO3	79767	broad.mit.edu	37	16	67233630	67233630	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67233630G>A	uc002esa.2	+	3	365	c.322G>A	c.(322-324)GAT>AAT	p.D108N	ELMO3_uc002esb.2_Missense_Mutation_p.D108N|ELMO3_uc002esc.2_5'UTR	NM_024712	NP_078988	Q96BJ8	ELMO3_HUMAN	engulfment and cell motility 3	55					apoptosis|phagocytosis	cytoplasm|cytoskeleton	SH3 domain binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		GCAGTTTGCGGATGGGCACCG	0.677													4	15	---	---	---	---	PASS
LCAT	3931	broad.mit.edu	37	16	67974269	67974269	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67974269G>A	uc002euy.1	-	6	872	c.861C>T	c.(859-861)CAC>CAT	p.H287H		NM_000229	NP_000220	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase precursor	287					cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|high-density lipoprotein particle remodeling|phosphatidylcholine biosynthetic process|reverse cholesterol transport|very-low-density lipoprotein particle remodeling	high-density lipoprotein particle	apolipoprotein A-I binding|phosphatidylcholine-sterol O-acyltransferase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		AAATGAACACGTGGTCCTCAG	0.557													44	58	---	---	---	---	PASS
ESRP2	80004	broad.mit.edu	37	16	68266312	68266312	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68266312G>A	uc010cfa.1	-	8	1134	c.946C>T	c.(946-948)CAG>TAG	p.Q316*	ESRP2_uc002evp.1_Intron|ESRP2_uc002evq.1_Nonsense_Mutation_p.Q306*	NM_024939	NP_079215	Q9H6T0	ESRP2_HUMAN	RNA binding motif protein 35B	316	RRM 1.				mRNA processing|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding|nucleotide binding			ovary(1)	1						TTGTGTCTCTGCAGCGCTAGG	0.637													23	38	---	---	---	---	PASS
ESRP2	80004	broad.mit.edu	37	16	68266313	68266313	+	Silent	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68266313C>A	uc010cfa.1	-	8	1133	c.945G>T	c.(943-945)CTG>CTT	p.L315L	ESRP2_uc002evp.1_Intron|ESRP2_uc002evq.1_Silent_p.L305L	NM_024939	NP_079215	Q9H6T0	ESRP2_HUMAN	RNA binding motif protein 35B	315	RRM 1.				mRNA processing|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding|nucleotide binding			ovary(1)	1						TGTGTCTCTGCAGCGCTAGGT	0.637													23	37	---	---	---	---	PASS
ATMIN	23300	broad.mit.edu	37	16	81077781	81077781	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81077781G>C	uc002ffz.1	+	4	1696	c.1678G>C	c.(1678-1680)GAG>CAG	p.E560Q	ATMIN_uc002fga.2_Missense_Mutation_p.E402Q|ATMIN_uc010vnn.1_Missense_Mutation_p.E331Q|ATMIN_uc002fgb.1_Missense_Mutation_p.E402Q	NM_015251	NP_056066	O43313	ATMIN_HUMAN	ATM interactor	560					response to DNA damage stimulus	nucleus	zinc ion binding				0						TCAAGATATTGAGAAATCTGC	0.343													14	35	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1554406	1554406	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1554406G>A	uc002fte.2	-	42	6963	c.6849C>T	c.(6847-6849)TTC>TTT	p.F2283F	RILP_uc002ftd.2_5'Flank	NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	2283						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		ACTTACCCATGAAGTTGTAGT	0.587													14	12	---	---	---	---	PASS
KRT28	162605	broad.mit.edu	37	17	38950265	38950265	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38950265C>T	uc002hvh.1	-	6	1078	c.1012G>A	c.(1012-1014)GAG>AAG	p.E338K		NM_181535	NP_853513	Q7Z3Y7	K1C28_HUMAN	keratin 25D	338	Rod.|Coil 2.					cytoplasm|intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)				TAGTTGCTCTCGGTCTCTGTC	0.557													37	75	---	---	---	---	PASS
KRT34	3885	broad.mit.edu	37	17	39537389	39537389	+	Silent	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39537389C>G	uc002hwm.2	-	3	645	c.633G>C	c.(631-633)CTG>CTC	p.L211L		NM_021013	NP_066293	O76011	KRT34_HUMAN	keratin 34	211	Rod.|Coil 1B.				epidermis development	intermediate filament	protein binding|structural molecule activity			central_nervous_system(1)	1		Breast(137;0.000496)				TGCAGAGGGTCAGCTCATCCA	0.547													21	32	---	---	---	---	PASS
KRT38	8687	broad.mit.edu	37	17	39596478	39596478	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39596478G>A	uc002hwq.1	-	2	933	c.510C>T	c.(508-510)GCC>GCT	p.A170A		NM_006771	NP_006762	O76015	KRT38_HUMAN	keratin 38	170	Rod.|Coil 1B.					intermediate filament	structural molecule activity			skin(2)	2		Breast(137;0.000496)				TGGCATTCTCGGCCTTGCTGC	0.522													11	18	---	---	---	---	PASS
ADAM11	4185	broad.mit.edu	37	17	42850447	42850447	+	Silent	SNP	C	T	T	rs140421831		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42850447C>T	uc002ihh.2	+	10	819	c.819C>T	c.(817-819)GCC>GCT	p.A273A	ADAM11_uc010wjd.1_Silent_p.A73A	NM_002390	NP_002381	O75078	ADA11_HUMAN	ADAM metallopeptidase domain 11 preproprotein	273	Extracellular (Potential).|Peptidase M12B.				integrin-mediated signaling pathway|proteolysis	integral to membrane|plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			pancreas(1)	1		Prostate(33;0.0959)				TGAACCTGGCCGATGTGGTAA	0.622													10	19	---	---	---	---	PASS
C1QL1	10882	broad.mit.edu	37	17	43044840	43044840	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43044840C>T	uc002ihv.2	-	1	805	c.577G>A	c.(577-579)GAC>AAC	p.D193N		NM_006688	NP_006679	O75973	C1QRF_HUMAN	complement component 1, q subcomponent-like 1	193	C1q.				locomotory behavior	collagen					0		Prostate(33;0.155)				TTGCAGAGGTCTGCCCACATA	0.657													12	12	---	---	---	---	PASS
STXBP4	252983	broad.mit.edu	37	17	53077096	53077096	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53077096G>T	uc002iuf.1	+	6	598	c.391G>T	c.(391-393)GGA>TGA	p.G131*	STXBP4_uc010dcc.1_Nonsense_Mutation_p.G56*|STXBP4_uc010dcd.1_Nonsense_Mutation_p.G131*	NM_178509	NP_848604	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	131						cytoplasm	calcium ion binding			ovary(1)	1						AGGAGAATATGGACCTCAAGC	0.373													19	22	---	---	---	---	PASS
KCNH6	81033	broad.mit.edu	37	17	61611355	61611355	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61611355C>T	uc002jay.2	+	5	864	c.784C>T	c.(784-786)CTC>TTC	p.L262F	KCNH6_uc002jax.1_Missense_Mutation_p.L262F|KCNH6_uc010wpl.1_Missense_Mutation_p.L139F|KCNH6_uc010wpm.1_Missense_Mutation_p.L262F|KCNH6_uc002jaz.1_Missense_Mutation_p.L262F	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	262	Helical; Name=Segment S1; (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	GTGGGACTGGCTCATCCTGCT	0.647													36	61	---	---	---	---	PASS
ICAM2	3384	broad.mit.edu	37	17	62081145	62081145	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62081145C>A	uc002jdu.3	-	3	740	c.508G>T	c.(508-510)GAG>TAG	p.E170*	C17orf72_uc002jdt.3_3'UTR|C17orf72_uc010wpu.1_3'UTR|C17orf72_uc010wpv.1_3'UTR|C17orf72_uc010wpw.1_3'UTR|ICAM2_uc002jdw.3_Nonsense_Mutation_p.E170*|ICAM2_uc010ded.2_Nonsense_Mutation_p.E170*|ICAM2_uc002jdx.3_Nonsense_Mutation_p.E170*|ICAM2_uc002jdv.3_Nonsense_Mutation_p.E170*	NM_000873	NP_000864	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2 precursor	170	Ig-like C2-type 2.|Extracellular (Potential).				cell-cell adhesion|regulation of immune response	integral to plasma membrane	integrin binding			ovary(1)	1						GCTGTGGCCTCCTGCGGAGCA	0.617													15	37	---	---	---	---	PASS
TMEM104	54868	broad.mit.edu	37	17	72781747	72781747	+	Intron	SNP	G	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72781747G>C	uc002jls.3	+						TMEM104_uc010wrf.1_Intron|TMEM104_uc010wrg.1_Intron|TMEM104_uc010dfx.2_Intron	NM_017728	NP_060198	Q8NE00	TM104_HUMAN	transmembrane protein 104							integral to membrane					0	all_lung(278;0.23)					CATGAGGTGAGAGGCAGCGGG	0.657													16	18	---	---	---	---	PASS
PRCD	768206	broad.mit.edu	37	17	74527783	74527783	+	Intron	SNP	G	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74527783G>C	uc002jrw.1	+						CYGB_uc002jru.1_Intron|CYGB_uc002jrv.1_Intron			Q00LT1	PRCD_HUMAN	Homo sapiens cDNA FLJ43629 fis, clone SPLEN2029727.						response to stimulus|visual perception	cytoplasm|integral to membrane					0						CCTGGCAAGAGGAACAGGGGT	0.622													8	16	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78318498	78318498	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78318498C>T	uc002jyh.1	+	4	805	c.582C>T	c.(580-582)TTC>TTT	p.F194F		NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TACCCCAGTTCAGTTTTCTTG	0.468													98	122	---	---	---	---	PASS
RNF213	57674	broad.mit.edu	37	17	78318661	78318661	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78318661C>G	uc002jyh.1	+	4	968	c.745C>G	c.(745-747)CAA>GAA	p.Q249E		NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACGATTCAATCAAAACCAAGA	0.493													31	41	---	---	---	---	PASS
BAHCC1	57597	broad.mit.edu	37	17	79428055	79428055	+	Silent	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79428055C>G	uc002kaf.2	+	24	6366	c.6366C>G	c.(6364-6366)CTC>CTG	p.L2122L	BAHCC1_uc002kae.2_Silent_p.L1352L	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	2122							DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			TGCAGAACCTCTTCCAGCTCA	0.706													5	12	---	---	---	---	PASS
DLGAP1	9229	broad.mit.edu	37	18	3729211	3729211	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3729211G>A	uc002kmf.2	-	4	1582	c.1515C>T	c.(1513-1515)GAC>GAT	p.D505D	DLGAP1_uc010wyz.1_Silent_p.D505D|DLGAP1_uc002kme.1_Silent_p.D203D|DLGAP1_uc010dkn.2_Silent_p.D203D|DLGAP1_uc010wyw.1_Silent_p.D211D|DLGAP1_uc010wyx.1_Silent_p.D217D|DLGAP1_uc010wyy.1_Silent_p.D217D|DLGAP1_uc002kmg.2_Silent_p.D203D|DLGAP1_uc002kmk.2_Silent_p.D505D	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform	505					synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				CGCACTCGTCGTCCTGGGAGC	0.682													7	7	---	---	---	---	PASS
NOL4	8715	broad.mit.edu	37	18	31432886	31432886	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31432886C>A	uc010dmi.2	-	11	2066	c.1837G>T	c.(1837-1839)GTT>TTT	p.V613F	NOL4_uc010xbs.1_Missense_Mutation_p.V328F|NOL4_uc002kxr.3_Missense_Mutation_p.V385F|NOL4_uc010xbt.1_Missense_Mutation_p.V539F|NOL4_uc010dmh.2_Missense_Mutation_p.V475F|NOL4_uc010xbu.1_Missense_Mutation_p.V549F|NOL4_uc002kxt.3_Missense_Mutation_p.V511F	NM_003787	NP_003778	O94818	NOL4_HUMAN	nucleolar protein 4	613						nucleolus	RNA binding			ovary(3)	3						TATCCTGCAACAAGCTGTCTC	0.463													12	37	---	---	---	---	PASS
DTNA	1837	broad.mit.edu	37	18	32443934	32443934	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32443934C>T	uc010dmn.1	+	16	1571	c.1570C>T	c.(1570-1572)CGC>TGC	p.R524C	DTNA_uc010xbx.1_Missense_Mutation_p.R274C|DTNA_uc002kxv.3_Missense_Mutation_p.R467C|DTNA_uc002kxw.2_Missense_Mutation_p.R467C|DTNA_uc010dmj.2_Missense_Mutation_p.R464C|DTNA_uc002kxz.2_Missense_Mutation_p.R464C|DTNA_uc002kxy.2_Missense_Mutation_p.R464C|DTNA_uc010dml.2_Missense_Mutation_p.R464C|DTNA_uc002kyb.3_Missense_Mutation_p.R521C|DTNA_uc010dmm.2_Missense_Mutation_p.R524C|DTNA_uc010xby.1_Missense_Mutation_p.R214C|DTNA_uc010dmo.2_Silent_p.S144S|DTNA_uc002kyd.3_Missense_Mutation_p.R146C|DTNA_uc010xbz.1_Missense_Mutation_p.R233C|DTNA_uc010xca.1_Missense_Mutation_p.R176C|DTNA_uc002kye.2_Missense_Mutation_p.R172C	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1	524	Potential.				neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						TCTTAGACAGCGCAAAGATGA	0.488													5	7	---	---	---	---	PASS
MOCOS	55034	broad.mit.edu	37	18	33779772	33779772	+	Silent	SNP	G	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33779772G>C	uc002kzq.3	+	4	449	c.426G>C	c.(424-426)GGG>GGC	p.G142G		NM_017947	NP_060417	Q96EN8	MOCOS_HUMAN	molybdenum cofactor sulfurase	142					Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol	lyase activity|Mo-molybdopterin cofactor sulfurase activity|molybdenum ion binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	AGAGCAGTGGGAGTCGCTTCT	0.582													12	22	---	---	---	---	PASS
KIAA0427	9811	broad.mit.edu	37	18	46287750	46287750	+	Intron	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46287750G>A	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron|KIAA0427_uc002lde.3_5'UTR	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						ATTTGTCTCCGACACCCCCAG	0.587													14	21	---	---	---	---	PASS
NACC1	112939	broad.mit.edu	37	19	13246773	13246773	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13246773G>A	uc002mwm.2	+	2	920	c.752G>A	c.(751-753)GGT>GAT	p.G251D		NM_052876	NP_443108	Q96RE7	NACC1_HUMAN	transcriptional repressor NAC1	251					negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|protein homooligomerization|transcription, DNA-dependent	cytoplasm|nuclear body					0						GCAGCAGGGGGTGTGGTGAGT	0.721													3	5	---	---	---	---	PASS
RASAL3	64926	broad.mit.edu	37	19	15562617	15562617	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15562617C>T	uc002nbe.2	-	18	3111	c.3025G>A	c.(3025-3027)GAC>AAC	p.D1009N	WIZ_uc002nbb.3_5'Flank|RASAL3_uc002nbd.2_3'UTR|RASAL3_uc010eaa.1_Missense_Mutation_p.D423N	NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	1009					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						CAGGTGGTGTCTCCATTGAGG	0.597													29	33	---	---	---	---	PASS
COPE	11316	broad.mit.edu	37	19	19010503	19010503	+	Silent	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19010503G>A	uc002nkk.2	-	10	954	c.912C>T	c.(910-912)TAC>TAT	p.Y304Y	LASS1_uc010ebx.2_5'Flank|COPE_uc002nkl.2_Silent_p.Y253Y|COPE_uc002nkm.2_Silent_p.Y252Y|COPE_uc002nkn.2_Silent_p.Y327Y	NM_007263	NP_009194	O14579	COPE_HUMAN	epsilon subunit of coatomer protein complex	304					COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	binding|structural molecule activity				0						CGCTGGGAGCGTACTGTAGCA	0.637													11	25	---	---	---	---	PASS
ZNF100	163227	broad.mit.edu	37	19	21910654	21910654	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21910654C>T	uc002nqi.2	-	5	659	c.460G>A	c.(460-462)GAG>AAG	p.E154K	ZNF100_uc002nqh.2_Missense_Mutation_p.E90K	NM_173531	NP_775802	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	154					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACTTTACACTCATCCACACTT	0.333													38	63	---	---	---	---	PASS
MAG	4099	broad.mit.edu	37	19	35793405	35793405	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35793405C>T	uc002nyy.1	+	7	1174	c.1025C>T	c.(1024-1026)ACG>ATG	p.T342M	MAG_uc002nyx.1_Missense_Mutation_p.T342M|MAG_uc010eds.1_Missense_Mutation_p.T317M|MAG_uc002nyz.1_Missense_Mutation_p.T342M	NM_002361	NP_002352	P20916	MAG_HUMAN	myelin associated glycoprotein isoform a	342	Ig-like C2-type 3.|Extracellular (Potential).				blood coagulation|cell adhesion|leukocyte migration|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane	sugar binding			breast(3)|lung(2)|central_nervous_system(1)|skin(1)	7	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GAGGGGGAGACGGTCTCTATC	0.577													21	34	---	---	---	---	PASS
CIC	23152	broad.mit.edu	37	19	42796810	42796810	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42796810C>A	uc002otf.1	+	14	3308	c.3268C>A	c.(3268-3270)CCT>ACT	p.P1090T		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	1090	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11		Prostate(69;0.00682)				CCCCGGAGGTCCTGTCATAAC	0.667			T	DUX4	soft tissue sarcoma								18	49	---	---	---	---	PASS
CCDC155	147872	broad.mit.edu	37	19	49902771	49902771	+	Intron	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49902771G>A	uc002pnm.1	+						CCDC155_uc002pnl.1_Missense_Mutation_p.G269R|CCDC155_uc010emx.1_Intron	NM_144688	NP_653289	Q8N6L0	CC155_HUMAN	coiled-coil domain containing 155							integral to membrane	calcium ion binding			ovary(1)|central_nervous_system(1)	2						GGAGGTGAGCGGAGGCCCAGC	0.592													3	6	---	---	---	---	PASS
CCDC155	147872	broad.mit.edu	37	19	49902772	49902772	+	Intron	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49902772G>A	uc002pnm.1	+						CCDC155_uc002pnl.1_Missense_Mutation_p.G269E|CCDC155_uc010emx.1_Intron	NM_144688	NP_653289	Q8N6L0	CC155_HUMAN	coiled-coil domain containing 155							integral to membrane	calcium ion binding			ovary(1)|central_nervous_system(1)	2						GAGGTGAGCGGAGGCCCAGCA	0.592													3	6	---	---	---	---	PASS
SIRPD	128646	broad.mit.edu	37	20	1532442	1532442	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1532442C>T	uc002wfi.2	-	2	360	c.316G>A	c.(316-318)GAA>AAA	p.E106K		NM_178460	NP_848555	Q9H106	SIRPD_HUMAN	signal-regulatory protein delta precursor	106	Ig-like V-type.					extracellular region				ovary(1)|kidney(1)|skin(1)	3						AGAGAGATTTCACGGATGCGG	0.448													30	72	---	---	---	---	PASS
CDC25B	994	broad.mit.edu	37	20	3782998	3782998	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3782998G>A	uc002wjn.2	+	11	1947	c.1169G>A	c.(1168-1170)CGA>CAA	p.R390Q	CDC25B_uc010zqk.1_Missense_Mutation_p.R326Q|CDC25B_uc010zql.1_Missense_Mutation_p.R312Q|CDC25B_uc010zqm.1_Missense_Mutation_p.R299Q|CDC25B_uc002wjl.2_Missense_Mutation_p.R278Q|CDC25B_uc002wjm.2_Missense_Mutation_p.R278Q|CDC25B_uc002wjo.2_Missense_Mutation_p.R376Q|CDC25B_uc002wjp.2_Missense_Mutation_p.R349Q|CDC25B_uc002wjq.2_Missense_Mutation_p.R190Q|CDC25B_uc010gbc.2_5'Flank	NM_021873	NP_068659	P30305	MPIP2_HUMAN	cell division cycle 25B isoform 1	390					cell division|G2/M transition of mitotic cell cycle|mitosis|positive regulation of cell proliferation	cytosol|microtubule organizing center|nucleoplasm	protein binding|protein tyrosine phosphatase activity			lung(3)|ovary(2)	5						AGTGACCACCGAGAGCTGATT	0.567													13	37	---	---	---	---	PASS
RRBP1	6238	broad.mit.edu	37	20	17597365	17597365	+	Intron	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17597365C>T	uc002wpv.1	-						RRBP1_uc010zrp.1_Intron|RRBP1_uc002wpt.1_Intron|RRBP1_uc002wpu.2_Intron|RRBP1_uc002wpw.1_Intron|RRBP1_uc010gcl.1_Intron	NM_001042576	NP_001036041	Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1						protein transport|translation|transmembrane transport	integral to endoplasmic reticulum membrane|ribosome	receptor activity			ovary(1)	1						GGGACCAGCTCACCGCCCTAA	0.632													60	56	---	---	---	---	PASS
KIF3B	9371	broad.mit.edu	37	20	30898811	30898811	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30898811G>T	uc002wxq.2	+	2	1398	c.1231G>T	c.(1231-1233)GAT>TAT	p.D411Y	KIF3B_uc010ztv.1_Intron|KIF3B_uc010ztw.1_Intron	NM_004798	NP_004789	O15066	KIF3B_HUMAN	kinesin family member 3B	411	Potential.				anterograde axon cargo transport|blood coagulation|determination of left/right symmetry|mitotic centrosome separation|plus-end-directed vesicle transport along microtubule|spindle assembly involved in mitosis	centrosome|cytosol|kinesin II complex|plus-end kinesin complex|spindle microtubule	ATP binding|plus-end-directed microtubule motor activity|Rho GTPase binding			central_nervous_system(3)|ovary(2)	5			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			ggaTGATAAGGATGATTACTG	0.418													9	17	---	---	---	---	PASS
SUN5	140732	broad.mit.edu	37	20	31571671	31571671	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31571671C>T	uc002wyi.2	-	13	1162	c.1069G>A	c.(1069-1071)GTG>ATG	p.V357M		NM_080675	NP_542406	Q8TC36	SUN5_HUMAN	sperm associated antigen 4-like	357	SUN.				spermatogenesis					skin(1)	1						TGCACTCGCACGCGGTACAGG	0.557													115	79	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22710717	22710717	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22710717C>G	uc002yld.1	+	8	1156	c.907C>G	c.(907-909)CAC>GAC	p.H303D	NCAM2_uc011acb.1_Missense_Mutation_p.H161D|NCAM2_uc011acc.1_Missense_Mutation_p.H328D	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	303	Ig-like C2-type 4.|Extracellular (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AGTACAGCCTCACATAATACA	0.363													11	30	---	---	---	---	PASS
ADAMTS1	9510	broad.mit.edu	37	21	28217230	28217230	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28217230C>G	uc002ymf.2	-	1	499	c.44G>C	c.(43-45)GGC>GCC	p.G15A		NM_006988	NP_008919	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1	15					integrin-mediated signaling pathway|negative regulation of cell proliferation|proteolysis		heparin binding|zinc ion binding			lung(3)|large_intestine(2)|central_nervous_system(1)	6		Breast(209;0.000962)		Lung(58;0.215)		CATGTCGCTGCCCAGCTTGCG	0.692											OREG0026151	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	4	---	---	---	---	PASS
ADAMTS1	9510	broad.mit.edu	37	21	28217233	28217233	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:28217233A>T	uc002ymf.2	-	1	496	c.41T>A	c.(40-42)CTG>CAG	p.L14Q		NM_006988	NP_008919	Q9UHI8	ATS1_HUMAN	ADAM metallopeptidase with thrombospondin type 1	14					integrin-mediated signaling pathway|negative regulation of cell proliferation|proteolysis		heparin binding|zinc ion binding			lung(3)|large_intestine(2)|central_nervous_system(1)	6		Breast(209;0.000962)		Lung(58;0.215)		GTCGCTGCCCAGCTTGCGCCT	0.692											OREG0026151	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	4	---	---	---	---	PASS
DNAJC28	54943	broad.mit.edu	37	21	34860889	34860889	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34860889C>T	uc002yrv.2	-	2	1261	c.812G>A	c.(811-813)AGA>AAA	p.R271K	DNAJC28_uc002yrw.2_Missense_Mutation_p.R271K	NM_017833	NP_060303	Q9NX36	DJC28_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 28	271	Potential.						heat shock protein binding				0						AATTGCCTCTCTGAGTTGCTC	0.398													69	137	---	---	---	---	PASS
USP18	11274	broad.mit.edu	37	22	18640453	18640453	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18640453T>C	uc002zny.2	+	2	361	c.23T>C	c.(22-24)CTG>CCG	p.L8P		NM_017414	NP_059110	Q9UMW8	UBP18_HUMAN	ubiquitin specific protease 18	8					regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway|ubiquitin-dependent protein catabolic process	cytosol|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			breast(1)	1						TTTGGGCTCCTGAGGCAAATC	0.572											OREG0026287	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	356	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22735436	22735436	+	RNA	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22735436C>T	uc011aim.1	+	46		c.5232C>T								Parts of antibodies, mostly variable regions.												0						TGTGCTGACTCAGCCACCCTC	0.552													18	35	---	---	---	---	PASS
SEC14L4	284904	broad.mit.edu	37	22	30890922	30890922	+	Silent	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30890922C>G	uc003aid.2	-	6	550	c.450G>C	c.(448-450)CTG>CTC	p.L150L	SEC14L4_uc011akz.1_Silent_p.L150L|SEC14L4_uc003aie.2_Silent_p.L135L|SEC14L4_uc003aif.2_Silent_p.L96L	NM_174977	NP_777637	Q9UDX3	S14L4_HUMAN	SEC14p-like protein TAP3 isoform a	150	CRAL-TRIO.					integral to membrane|intracellular	lipid binding|transporter activity			skin(1)	1					Vitamin E(DB00163)	CAAACACCATCAGCGCCATCT	0.592													15	43	---	---	---	---	PASS
C22orf28	51493	broad.mit.edu	37	22	32791044	32791044	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32791044G>A	uc003amm.2	-	9	1279	c.1148C>T	c.(1147-1149)CCT>CTT	p.P383L		NM_014306	NP_055121	Q9Y3I0	RTCB_HUMAN	hypothetical protein LOC51493	383					cell-matrix adhesion|substrate adhesion-dependent cell spreading|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|tRNA-splicing ligase complex	ATP binding|metal ion binding|RNA ligase (ATP) activity|vinculin binding				0						GGGATGGTGAGGAGGGAAAGC	0.478													19	35	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38119801	38119801	+	Missense_Mutation	SNP	A	G	G	rs71317064		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38119801A>G	uc003atr.2	+	7	1509	c.1238A>G	c.(1237-1239)AAA>AGA	p.K413R	TRIOBP_uc003atu.2_Missense_Mutation_p.K241R|TRIOBP_uc003atq.1_Missense_Mutation_p.K413R|TRIOBP_uc003ats.1_Missense_Mutation_p.K241R	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	413					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GACAATCCCAAAGCCTCCAGA	0.582													3	65	---	---	---	---	PASS
TTLL1	25809	broad.mit.edu	37	22	43464472	43464472	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43464472G>C	uc003bdi.2	-	5	688	c.447C>G	c.(445-447)TTC>TTG	p.F149L	TTLL1_uc010gzh.2_Missense_Mutation_p.F149L|TTLL1_uc003bdj.2_Missense_Mutation_p.F35L|TTLL1_uc003bdh.2_Missense_Mutation_p.F111L	NM_012263	NP_036395	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	149	TTL.				protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		TGTTGATAAGGAAGATGCCCT	0.547													108	254	---	---	---	---	PASS
TTLL1	25809	broad.mit.edu	37	22	43464588	43464588	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43464588G>C	uc003bdi.2	-	5	572	c.331C>G	c.(331-333)CCA>GCA	p.P111A	TTLL1_uc010gzh.2_Missense_Mutation_p.P111A|TTLL1_uc003bdj.2_5'UTR|TTLL1_uc003bdh.2_Missense_Mutation_p.P73A	NM_012263	NP_036395	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1	111	TTL.				protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		TAGGTGACTGGAACAAAGTCT	0.552													52	134	---	---	---	---	PASS
CDKL5	6792	broad.mit.edu	37	X	18622355	18622355	+	Silent	SNP	C	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18622355C>T	uc004cym.2	+	12	1564	c.1311C>T	c.(1309-1311)AAC>AAT	p.N437N	CDKL5_uc004cyn.2_Silent_p.N437N	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	437					neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					TCAAGTCAAACAGCAGATCTC	0.453													62	120	---	---	---	---	PASS
PHKA2	5256	broad.mit.edu	37	X	18924858	18924858	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18924858G>A	uc004cyv.3	-	24	3102	c.2672C>T	c.(2671-2673)ACG>ATG	p.T891M	PHKA2_uc004cyu.3_Missense_Mutation_p.T189M|PHKA2_uc010nfe.1_5'Flank|PHKA2_uc010nff.1_5'Flank	NM_000292	NP_000283	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	891					glucose metabolic process|glycogen catabolic process	cytosol|phosphorylase kinase complex|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(33;0.183)					CCAGACCTGCGTGAGGACGGC	0.597													83	129	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	26179320	26179320	+	IGR	SNP	G	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26179320G>T								MAGEB18 (20468 upstream) : MAGEB6 (31237 downstream)																							AGGCAAACAAGATGGTGCAAT	0.478													29	57	---	---	---	---	PASS
GK	2710	broad.mit.edu	37	X	30712558	30712558	+	Silent	SNP	G	C	C			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30712558G>C	uc004dch.3	+	6	635	c.456G>C	c.(454-456)GTG>GTC	p.V152V	GK_uc010ngj.2_Silent_p.V152V|GK_uc004dci.3_Silent_p.V152V|GK_uc011mjz.1_5'UTR|GK_uc011mka.1_5'UTR|GK_uc010ngk.2_5'UTR	NM_203391	NP_976325	P32189	GLPK_HUMAN	glycerol kinase isoform a	152					glycerol-3-phosphate metabolic process|triglyceride biosynthetic process	cytosol|mitochondrial outer membrane	ATP binding|glycerol kinase activity			central_nervous_system(1)	1						TCAGTGCAGTGAAACTTCGTT	0.388													48	47	---	---	---	---	PASS
ZNF157	7712	broad.mit.edu	37	X	47272358	47272358	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47272358C>G	uc004dhr.1	+	4	955	c.886C>G	c.(886-888)CAT>GAT	p.H296D		NM_003446	NP_003437	P51786	ZN157_HUMAN	zinc finger protein 157	296	C2H2-type 5.				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CCACAGAACTCATACAGGGGA	0.428													6	12	---	---	---	---	PASS
SSX5	6758	broad.mit.edu	37	X	48047122	48047122	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48047122C>A	uc004dja.1	-	7	565	c.512G>T	c.(511-513)AGA>ATA	p.R171I	SSX5_uc004diz.1_Missense_Mutation_p.R212I	NM_175723	NP_783729	O60225	SSX5_HUMAN	synovial sarcoma, X breakpoint 5 isoform b	171					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding				0						CAGTTGCTTTCTCTCACGCAC	0.502													48	236	---	---	---	---	PASS
AR	367	broad.mit.edu	37	X	66765955	66765955	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66765955G>A	uc004dwu.1	+	1	2082	c.967G>A	c.(967-969)GAG>AAG	p.E323K	AR_uc011mpd.1_Missense_Mutation_p.E323K|AR_uc011mpe.1_RNA|AR_uc011mpf.1_Missense_Mutation_p.E323K	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1	321	Modulating.				cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)	GCTAGAAGGCGAGAGCCTAGG	0.572									Androgen_Insensitivity_Syndrome				12	21	---	---	---	---	PASS
ZNF711	7552	broad.mit.edu	37	X	84525754	84525754	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84525754G>A	uc004eeo.2	+	9	1553	c.1206G>A	c.(1204-1206)ATG>ATA	p.M402I	ZNF711_uc004eep.2_Missense_Mutation_p.M402I|ZNF711_uc004eeq.2_Missense_Mutation_p.M448I|ZNF711_uc011mqy.1_Missense_Mutation_p.M1I	NM_021998	NP_068838	Q9Y462	ZN711_HUMAN	zinc finger protein 711	402	C2H2-type 1.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			ovary(3)|skin(1)	4						AAAGACACATGAAGAATCATC	0.363													10	15	---	---	---	---	PASS
CT45A1	541466	broad.mit.edu	37	X	134856786	134856786	+	Silent	SNP	T	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134856786T>A	uc004eyy.2	+	5	806	c.561T>A	c.(559-561)CGT>CGA	p.R187R		NM_001017417	NP_001017417	Q5HYN5	CT451_HUMAN	cancer/testis antigen family 45, member A1	187											0						AACTGAAACGTATGATTTGAG	0.373													25	634	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135429208	135429208	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135429208A>G	uc004ezu.1	+	6	3634	c.3343A>G	c.(3343-3345)AGA>GGA	p.R1115G	GPR112_uc010nsb.1_Missense_Mutation_p.R910G|GPR112_uc010nsc.1_Missense_Mutation_p.R882G	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	1115	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TCATTCACTGAGACTCTCCAC	0.478													26	147	---	---	---	---	PASS
USP48	84196	broad.mit.edu	37	1	22032806	22032807	+	Intron	INS	-	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22032806_22032807insA	uc001bfb.2	-						USP48_uc001bfa.2_Intron|USP48_uc010odq.1_Intron|USP48_uc009vqc.2_Intron|USP48_uc001bfc.2_Intron|USP48_uc001bfd.1_5'Flank	NM_032236	NP_115612	Q86UV5	UBP48_HUMAN	ubiquitin specific protease 48 isoform a						ubiquitin-dependent protein catabolic process	mitochondrion|nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		AGTCCTCTACCAAAAAATAGCA	0.356													21	14	---	---	---	---	
GDAP2	54834	broad.mit.edu	37	1	118429419	118429420	+	Intron	INS	-	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118429419_118429420insT	uc001ehf.2	-						GDAP2_uc001ehg.2_Intron	NM_017686	NP_060156	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated											ovary(2)	2		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		TCATCTTCCAATTTTTTTTCTA	0.302													4	2	---	---	---	---	
SPATA17	128153	broad.mit.edu	37	1	217955356	217955358	+	Intron	DEL	TAT	-	-	rs146183443		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217955356_217955358delTAT	uc001hlh.1	+						SPATA17_uc009xdr.1_Intron|SPATA17_uc001hli.2_Intron	NM_138796	NP_620151	Q96L03	SPT17_HUMAN	spermatogenesis associated 17							cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		AAATAAGTGATATTATGTCATGC	0.296													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64603416	64603417	+	IGR	INS	-	CACCACCAT	CACCACCAT	rs141783487	by1000genomes	TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64603416_64603417insCACCACCAT								PELI1 (231811 upstream) : HSPC159 (77910 downstream)																							catgccaccaccaccaccatca	0.040													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113103992	113103992	+	IGR	DEL	C	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113103992delC								ZC3H6 (6352 upstream) : RGPD8 (21974 downstream)																							tcaccaccatcaccactgcca	0.000													3	3	---	---	---	---	
ANKAR	150709	broad.mit.edu	37	2	190541843	190541843	+	Intron	DEL	T	-	-	rs67184798		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190541843delT	uc002uqw.1	+						ANKAR_uc002uqu.2_Intron|ANKAR_uc002uqv.1_Intron	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing							integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			ACTTCTTAAATtttttttttt	0.169													4	2	---	---	---	---	
TTLL4	9654	broad.mit.edu	37	2	219616610	219616611	+	Intron	INS	-	TTT	TTT	rs10694172		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219616610_219616611insTTT	uc002viy.2	+						TTLL4_uc010zkl.1_Intron|TTLL4_uc010fvx.2_Intron|TTLL4_uc010zkm.1_Intron	NM_014640	NP_055455	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4						protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		AACAGCttttcttttttttttt	0.233													4	2	---	---	---	---	
SDHAP1	255812	broad.mit.edu	37	3	195711343	195711344	+	Intron	INS	-	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195711343_195711344insT	uc011btq.1	-						SDHAP1_uc003fvx.3_Intron|SDHAP1_uc011btp.1_Intron					SubName: Full=cDNA FLJ56858, highly similar to Succinate dehydrogenase (ubiquinone) flavoprotein subunit, mitochondrial (EC 1.3.5.1);												0						AAAGACTTCTCTGTGAGCTTTG	0.381													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9273621	9273622	+	IGR	DEL	AC	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9273621_9273622delAC								LOC650293 (321495 upstream) : USP17 (86487 downstream)																							CCCAGcacaaacacacacacac	0.233													4	2	---	---	---	---	
CLOCK	9575	broad.mit.edu	37	4	56314769	56314770	+	Intron	DEL	GT	-	-	rs72339696	by1000genomes	TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56314769_56314770delGT	uc003haz.1	-						CLOCK_uc003hba.1_Intron|CLOCK_uc010igu.1_Intron	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock						circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			GCACGCGCGCgtgtgtgtgtgt	0.134													4	3	---	---	---	---	
SCLT1	132320	broad.mit.edu	37	4	129869491	129869491	+	Intron	DEL	A	-	-	rs145196324		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129869491delA	uc003igp.2	-						SCLT1_uc003ign.2_Intron|SCLT1_uc003igo.2_Intron|SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1							centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						actccattgcaaaaaaaaaaa	0.124													5	3	---	---	---	---	
DDX60	55601	broad.mit.edu	37	4	169213200	169213200	+	Intron	DEL	C	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169213200delC	uc003irp.2	-							NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60								ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		ttctttctttctttttttttt	0.149													4	2	---	---	---	---	
MYO10	4651	broad.mit.edu	37	5	16877909	16877910	+	Intron	INS	-	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16877909_16877910insA	uc003jft.3	-						MYO10_uc003jfu.2_Intron|MYO10_uc003jfv.2_Intron	NM_012334	NP_036466	Q9HD67	MYO10_HUMAN	myosin X						axon guidance|signal transduction	myosin complex	actin binding|ATP binding|motor activity			ovary(2)|pancreas(1)	3						TATATTCCTTTAAAAAAAATCT	0.371													4	2	---	---	---	---	
HIST1H4C	8364	broad.mit.edu	37	6	26104072	26104072	+	5'Flank	DEL	A	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26104072delA	uc003ngi.2	+							NM_003542	NP_003533	P62805	H4_HUMAN	histone cluster 1, H4c						CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding				0						ACCAAATTTGAAAAAAAAAAA	0.413													7	5	---	---	---	---	
GPX6	257202	broad.mit.edu	37	6	28474355	28474356	+	Intron	INS	-	A	A	rs71548341		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28474355_28474356insA	uc011dlj.1	-						GPX6_uc010jrg.1_Intron	NM_182701	NP_874360	P59796	GPX6_HUMAN	glutathione peroxidase 6 precursor						response to oxidative stress	extracellular region	glutathione peroxidase activity			ovary(3)|pancreas(1)|skin(1)	5					Glutathione(DB00143)	AAGGAGTAGAGAAAAAAAAAAA	0.396													3	3	---	---	---	---	
LTA	4049	broad.mit.edu	37	6	31540914	31540915	+	Intron	INS	-	A	A			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31540914_31540915insA	uc011dnu.1	+						LTA_uc003nue.1_Intron|LTA_uc003nuf.2_Intron|LTA_uc003nuh.2_Intron|LTA_uc003nug.2_Intron|LTA_uc010jsr.2_Intron|TNF_uc003nui.2_5'Flank	NM_001159740	NP_001153212	P01374	TNFB_HUMAN	lymphotoxin alpha precursor						cell-cell signaling|induction of apoptosis|signal transduction	extracellular space|membrane	cytokine activity|tumor necrosis factor receptor binding				0					Etanercept(DB00005)	TCCCCCACGCTAAAAAAAACAG	0.584													1	6	---	---	---	---	
ENPP1	5167	broad.mit.edu	37	6	132189068	132189068	+	Intron	DEL	T	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132189068delT	uc011ecf.1	+						ENPP1_uc003qcy.2_Intron	NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase						3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	tgtttctttcttttttttttt	0.294													12	7	---	---	---	---	
TNRC18	84629	broad.mit.edu	37	7	5430011	5430011	+	Intron	DEL	G	-	-	rs34840801		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5430011delG	uc003soi.3	-						TNRC18_uc010ksx.1_Intron|TNRC18_uc003sok.1_Frame_Shift_Del_p.L124fs	NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		aaaaaaaaaaGCCAGCATCCT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65987396	65987397	+	IGR	INS	-	T	T			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65987396_65987397insT								NCRNA00174 (122001 upstream) : LOC493754 (6049 downstream)																							GGGCTTACACCTGCGAATCCTT	0.589													8	4	---	---	---	---	
STAG3L2	442582	broad.mit.edu	37	7	74300557	74300564	+	Frame_Shift_Del	DEL	AGAGCTCC	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74300557_74300564delAGAGCTCC	uc003ubj.3	-	5	625_632	c.243_250delGGAGCTCT	c.(241-252)CTGGAGCTCTTCfs	p.L81fs	STAG3L2_uc011kfj.1_RNA	NM_001025202	NP_001020373	P0CL84	ST3L2_HUMAN	STAG3-like	81_84	SCD.					nucleus	binding				0						CGGCCAGTGAAGAGCTCCAGGCGTGCGG	0.572													5	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3059184	3059184	+	Frame_Shift_Del	DEL	C	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3059184delC	uc011kwk.1	-	32	5441	c.5051delG	c.(5050-5052)GGAfs	p.G1684fs	CSMD1_uc011kwj.1_Frame_Shift_Del_p.G1076fs|CSMD1_uc003wqe.2_Frame_Shift_Del_p.G840fs	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1684	Extracellular (Potential).|CUB 10.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGCATGGGTTCCATCAAATAA	0.448													4	2	---	---	---	---	
MLLT10	8028	broad.mit.edu	37	10	21875206	21875206	+	Intron	DEL	T	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21875206delT	uc001iqs.2	+						MLLT10_uc001iqt.2_Intron|MLLT10_uc001iqv.2_Intron|MLLT10_uc001iqy.2_Intron|MLLT10_uc009xke.1_Intron|MLLT10_uc001iqw.1_Intron|MLLT10_uc001iqx.1_Intron|MLLT10_uc009xkf.1_Intron	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						TACCTGTTTCTTTTTTTTTTT	0.338			T	MLL|PICALM|CDK6	AL								4	2	---	---	---	---	
PPRC1	23082	broad.mit.edu	37	10	103909487	103909487	+	Intron	DEL	A	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103909487delA	uc001kum.2	+						PPRC1_uc001kun.2_Intron|PPRC1_uc010qqj.1_Intron|PPRC1_uc009xxa.2_Intron|NOLC1_uc001kuo.2_5'Flank|NOLC1_uc001kup.2_5'Flank|NOLC1_uc001kuq.2_5'Flank|NOLC1_uc009xxb.1_5'Flank|NOLC1_uc001kur.2_5'Flank	NM_015062	NP_055877	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		agactgtctcaaaaaaaaaaa	0.204													4	3	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	20065349	20065349	+	Intron	DEL	A	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20065349delA	uc010rdm.1	+						NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Intron|NAV2_uc001mpt.2_Intron|NAV2_uc009yhx.2_Intron|NAV2_uc009yhy.1_Intron	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						ttttttttccaaaaaaaaaaa	0.214													6	3	---	---	---	---	
SLC38A2	54407	broad.mit.edu	37	12	46764658	46764661	+	Intron	DEL	ATAT	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46764658_46764661delATAT	uc001rpg.2	-						SLC38A2_uc001rph.2_Intron	NM_018976	NP_061849	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2						cellular nitrogen compound metabolic process|glutamate secretion|neurotransmitter secretion|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			urinary_tract(1)|skin(1)	2	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		AAATATAGACATATATAATTGTAA	0.319													11	7	---	---	---	---	
ATP2B1	490	broad.mit.edu	37	12	90010464	90010464	+	Intron	DEL	A	-	-	rs113951213		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90010464delA	uc001tbh.2	-						ATP2B1_uc001tbg.2_Intron|ATP2B1_uc001tbf.2_Intron	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						GTTCACACAGAAAAAAAAAAA	0.343													4	2	---	---	---	---	
BAIAP3	8938	broad.mit.edu	37	16	1396789	1396806	+	Intron	DEL	GCAGGTGGGGCCAGCGGG	-	-	rs3215518		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1396789_1396806delGCAGGTGGGGCCAGCGGG	uc002clk.1	+						BAIAP3_uc002clj.2_Intron|BAIAP3_uc010uuz.1_Intron|BAIAP3_uc010uva.1_Intron|BAIAP3_uc010uvc.1_Intron	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3						G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				AGGCCATTCTGCAGGTGGGGCCAGCGGGGCAGGTGGGG	0.716													4	2	---	---	---	---	
CPNE2	221184	broad.mit.edu	37	16	57181273	57181274	+	Intron	DEL	AG	-	-	rs10580446		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57181273_57181274delAG	uc002eks.1	+						CPNE2_uc010cct.1_Intron|CPNE2_uc010ccu.1_Intron|CPNE2_uc002ekt.1_3'UTR	NM_152727	NP_689940	Q96FN4	CPNE2_HUMAN	copine II											central_nervous_system(1)|skin(1)	2		all_neural(199;0.224)				CACTGCGATCAGGGGGAATTTC	0.559													3	4	---	---	---	---	
ATP6V0A1	535	broad.mit.edu	37	17	40647391	40647391	+	Intron	DEL	T	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40647391delT	uc002hzr.2	+						ATP6V0A1_uc002hzq.2_Intron|ATP6V0A1_uc002hzs.2_Intron|ATP6V0A1_uc010wgj.1_Intron|ATP6V0A1_uc010wgk.1_Intron|ATP6V0A1_uc010cyg.2_Intron|ATP6V0A1_uc010wgl.1_Intron	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		TTAGAAATGATTTTTTTTTTT	0.363													4	4	---	---	---	---	
NME1-NME2	654364	broad.mit.edu	37	17	49245465	49245466	+	Intron	DEL	TA	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49245465_49245466delTA	uc002itk.2	+						NME1-NME2_uc002itj.2_Intron|NME2_uc002itl.2_Intron|NME2_uc002itm.2_Intron|NME2_uc002itn.2_Intron|NME2_uc002ito.2_Intron	NM_002512	NP_002503	P22392	NDKB_HUMAN	nucleoside diphosphate kinase B						cell adhesion|CTP biosynthetic process|GTP biosynthetic process|negative regulation of apoptosis|nucleobase, nucleoside and nucleotide interconversion|positive regulation of epithelial cell proliferation|positive regulation of keratinocyte differentiation|UTP biosynthetic process	cytosol|lamellipodium|nucleus|ruffle	ATP binding|DNA binding|metal ion binding|nucleoside diphosphate kinase activity|protein binding|protein histidine kinase activity|sequence-specific DNA binding transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			tatatgtgtgtatatatatata	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	57863634	57863635	+	IGR	INS	-	G	G	rs144729393	by1000genomes	TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57863634_57863635insG								PMAIP1 (292096 upstream) : MC4R (174929 downstream)																							GTGAGACCCCCCCCAGTAACAG	0.485													2	4	---	---	---	---	
ZNF880	400713	broad.mit.edu	37	19	52877717	52877717	+	Intron	DEL	T	-	-	rs77187934		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52877717delT	uc002pzc.2	+						ZNF880_uc002pzb.3_Intron	NM_001145434	NP_001138906	Q6PDB4	ZN880_HUMAN	zinc finger protein LOC400713						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						GGCCCCATAAttttttttttt	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	56053834	56053837	+	IGR	DEL	CATC	-	-	rs113583456		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56053834_56053837delCATC								SBK2 (6173 upstream) : ZNF579 (35055 downstream)																							ccaaacctttcatccatccatcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31818936	31818936	+	IGR	DEL	A	-	-	rs140775761		TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31818936delA								C20orf71 (3379 upstream) : PLUNC (4866 downstream)																							gagacagagcaagactaagaa	0.000													3	3	---	---	---	---	
C20orf117	140710	broad.mit.edu	37	20	35445891	35445891	+	Intron	DEL	A	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35445891delA	uc002xgd.1	-						C20orf117_uc002xge.1_5'Flank	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)				AGatttaattaaaaaaaaaaa	0.507													5	3	---	---	---	---	
CLCN5	1184	broad.mit.edu	37	X	49855455	49855455	+	Frame_Shift_Del	DEL	T	-	-			TCGA-C5-A1MN-01A-11D-A14W-08	TCGA-C5-A1MN-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49855455delT	uc004dos.1	+	11	2310	c.2062delT	c.(2062-2064)TTCfs	p.F688fs	CLCN5_uc004dor.1_Frame_Shift_Del_p.F758fs|CLCN5_uc004doq.1_Frame_Shift_Del_p.F758fs|CLCN5_uc004dot.1_Frame_Shift_Del_p.F688fs	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b	688	CBS 2.|Cytoplasmic (By similarity).				excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					TCTCAGCCCCTTCACTGTGAC	0.493													27	15	---	---	---	---	
