Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SLC16A1	6566	broad.mit.edu	37	1	113460091	113460091	+	Silent	SNP	G	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113460091G>T	uc001ecx.2	-	4	1769	c.937C>A	c.(937-939)CGA>AGA	p.R313R	SLC16A1_uc001ecy.2_Silent_p.R313R|SLC16A1_uc001ecz.2_Silent_p.R313R	NM_003051	NP_003042	P53985	MOT1_HUMAN	solute carrier family 16, member 1	313	Helical; (Potential).				blood coagulation|leukocyte migration|organic anion transport|pyruvate metabolic process	integral to membrane|membrane fraction|plasma membrane	mevalonate transmembrane transporter activity|protein binding|secondary active monocarboxylate transmembrane transporter activity|symporter activity			central_nervous_system(1)	1	Lung SC(450;0.246)	all_cancers(81;7.6e-08)|all_epithelial(167;3.82e-07)|all_lung(203;3.07e-05)|Lung NSC(69;5.51e-05)|Prostate(1639;0.00232)		Epithelial(280;7.31e-13)|all cancers(265;5.1e-10)|Kidney(133;5.29e-07)|KIRC - Kidney renal clear cell carcinoma(1967;8.63e-06)|OV - Ovarian serous cystadenocarcinoma(397;1.48e-05)|BRCA - Breast invasive adenocarcinoma(282;0.003)|LUSC - Lung squamous cell carcinoma(189;0.008)|Lung(183;0.00948)|Colorectal(144;0.0325)|COAD - Colon adenocarcinoma(174;0.0643)	Pyruvic acid(DB00119)	ATAGATGGTCGGGCTACCATG	0.433													3	44	---	---	---	---	PASS
ADAR	103	broad.mit.edu	37	1	154558839	154558839	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154558839C>G	uc001ffh.2	-	12	3220	c.3020G>C	c.(3019-3021)GGA>GCA	p.G1007A	ADAR_uc001ffj.2_Missense_Mutation_p.G962A|ADAR_uc001ffi.2_Missense_Mutation_p.G981A|ADAR_uc001ffk.2_Missense_Mutation_p.G712A	NM_001111	NP_001102	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific isoform a	1007	A to I editase.				adenosine to inosine editing|gene silencing by RNA|mRNA modification|mRNA processing|type I interferon-mediated signaling pathway	cytoplasm|nucleolus|nucleoplasm	DNA binding|double-stranded RNA adenosine deaminase activity|metal ion binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		TGTGCCTTCTCCTGTGTGAGA	0.542													16	17	---	---	---	---	PASS
CD84	8832	broad.mit.edu	37	1	160535532	160535532	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160535532G>A	uc001fwh.3	-	2	74	c.50C>T	c.(49-51)CCG>CTG	p.P17L	CD84_uc001fwf.3_Missense_Mutation_p.P17L|CD84_uc001fwg.3_Missense_Mutation_p.P17L|CD84_uc009wtn.2_Missense_Mutation_p.P17L|CD84_uc001fwi.3_Intron|CD84_uc001fwj.2_Missense_Mutation_p.P17L|CD84_uc001fwk.2_Missense_Mutation_p.P17L	NM_003874	NP_003865	Q9UIB8	SLAF5_HUMAN	CD84 molecule	17					blood coagulation|defense response|homophilic cell adhesion|leukocyte migration	integral to plasma membrane	receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			AGCTGCTTCCGGCCCTGAGAA	0.453													11	15	---	---	---	---	PASS
CR1L	1379	broad.mit.edu	37	1	207890923	207890923	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207890923G>C	uc001hga.3	+	11	1650	c.1529G>C	c.(1528-1530)AGA>ACA	p.R510T	CR1L_uc001hfz.2_RNA|CR1L_uc001hgb.1_RNA	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	510	Sushi 8.					cytoplasm|extracellular region|membrane					0						CACCCAGACAGAGGGATGACC	0.527													13	101	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237841392	237841392	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237841392G>C	uc001hyl.1	+	61	8995	c.8875G>C	c.(8875-8877)GAA>CAA	p.E2959Q	RYR2_uc010pxz.1_Intron	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2959	Modulator (Potential).|Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTATGAACAAGAAATCAAGTT	0.358													3	17	---	---	---	---	PASS
RNASEH1	246243	broad.mit.edu	37	2	3595526	3595526	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3595526G>A	uc002qxt.2	-	7	859	c.769C>T	c.(769-771)CAG>TAG	p.Q257*	RNASEH1_uc002qxs.2_Nonsense_Mutation_p.Q140*	NM_002936	NP_002927	O60930	RNH1_HUMAN	ribonuclease H1	257	RNase H.				RNA catabolic process	cytoplasm	magnesium ion binding|ribonuclease H activity|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)		CTCACCCACTGAATGTCCATC	0.413													10	126	---	---	---	---	PASS
AGBL5	60509	broad.mit.edu	37	2	27275933	27275933	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27275933G>C	uc002rie.2	+	2	324	c.107G>C	c.(106-108)GGA>GCA	p.G36A	AGBL5_uc002ric.2_Missense_Mutation_p.G36A|AGBL5_uc002rid.2_Missense_Mutation_p.G36A|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	36					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGGGGTAGGAGGTGGGGCG	0.542													10	58	---	---	---	---	PASS
AGBL5	60509	broad.mit.edu	37	2	27276028	27276028	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27276028G>A	uc002rie.2	+	2	419	c.202G>A	c.(202-204)GAG>AAG	p.E68K	AGBL5_uc002ric.2_Missense_Mutation_p.E68K|AGBL5_uc002rid.2_Missense_Mutation_p.E68K|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	68					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AACGGAATTTGAGAATGGGAA	0.512													15	55	---	---	---	---	PASS
AGBL5	60509	broad.mit.edu	37	2	27276036	27276036	+	Silent	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27276036G>A	uc002rie.2	+	2	427	c.210G>A	c.(208-210)GGG>GGA	p.G70G	AGBL5_uc002ric.2_Silent_p.G70G|AGBL5_uc002rid.2_Silent_p.G70G|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	70					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGAGAATGGGAACAGGTATA	0.512													16	53	---	---	---	---	PASS
AGBL5	60509	broad.mit.edu	37	2	27276872	27276872	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27276872G>T	uc002rie.2	+	4	713	c.496G>T	c.(496-498)GAA>TAA	p.E166*	AGBL5_uc002ric.2_Nonsense_Mutation_p.E166*|AGBL5_uc002rid.2_Nonsense_Mutation_p.E166*|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	166					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGACTGCCAGGAACTGCTAAA	0.562													36	106	---	---	---	---	PASS
AGBL5	60509	broad.mit.edu	37	2	27278030	27278030	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27278030G>A	uc002rie.2	+	6	1034	c.817G>A	c.(817-819)GAT>AAT	p.D273N	AGBL5_uc002ric.2_Missense_Mutation_p.D273N|AGBL5_uc002rid.2_Missense_Mutation_p.D273N|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	273					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTCCGACCTGATGATCCCCG	0.532													42	107	---	---	---	---	PASS
AGBL5	60509	broad.mit.edu	37	2	27278089	27278089	+	Silent	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27278089G>A	uc002rie.2	+	6	1093	c.876G>A	c.(874-876)TTG>TTA	p.L292L	AGBL5_uc002ric.2_Silent_p.L292L|AGBL5_uc002rid.2_Silent_p.L292L|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	292					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCCCATGTTGAACCCCGATG	0.552													40	93	---	---	---	---	PASS
AGBL5	60509	broad.mit.edu	37	2	27278589	27278589	+	Silent	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27278589G>A	uc002rie.2	+	7	1165	c.948G>A	c.(946-948)CTG>CTA	p.L316L	AGBL5_uc002ric.2_Silent_p.L316L|AGBL5_uc002rid.2_Silent_p.L316L|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	316					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCAGTACCTGAAGCCTGATG	0.547													19	41	---	---	---	---	PASS
AGBL5	60509	broad.mit.edu	37	2	27278878	27278878	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27278878G>T	uc002rie.2	+	7	1454	c.1237G>T	c.(1237-1239)GAA>TAA	p.E413*	AGBL5_uc002ric.2_Nonsense_Mutation_p.E413*|AGBL5_uc002rid.2_Nonsense_Mutation_p.E413*|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	413					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCGGGGCTTGAAGAGTCAGC	0.532													58	146	---	---	---	---	PASS
AGBL5	60509	broad.mit.edu	37	2	27278963	27278963	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27278963G>A	uc002rie.2	+	7	1539	c.1322G>A	c.(1321-1323)GGC>GAC	p.G441D	AGBL5_uc002ric.2_Missense_Mutation_p.G441D|AGBL5_uc002rid.2_Missense_Mutation_p.G441D|AGBL5_uc002rif.2_RNA	NM_021831	NP_068603	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5 isoform 1	441					protein branching point deglutamylation|proteolysis	cytosol|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCAAAAGGGGCTGCTTCATG	0.517													44	137	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170163851	170163851	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170163851T>A	uc002ues.2	-	4	580	c.367A>T	c.(367-369)AGT>TGT	p.S123C	LRP2_uc010zdf.1_Missense_Mutation_p.S123C	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	123	Extracellular (Potential).|LDL-receptor class A 3.				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CTGTATTCACTTGGGATACAC	0.418													7	67	---	---	---	---	PASS
C3orf20	84077	broad.mit.edu	37	3	14798948	14798948	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14798948C>T	uc003byy.2	+	13	2415	c.2011C>T	c.(2011-2013)CGG>TGG	p.R671W	C3orf20_uc003byz.2_Missense_Mutation_p.R549W|C3orf20_uc003bza.2_Missense_Mutation_p.R549W|C3orf20_uc003bzb.1_Missense_Mutation_p.R172W|C3orf20_uc011avj.1_5'UTR	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	671						cytoplasm|integral to membrane				ovary(3)|skin(1)	4						GCTGGTGCTGCGGAAGCTCAT	0.682													10	47	---	---	---	---	PASS
NBEAL2	23218	broad.mit.edu	37	3	47041508	47041508	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47041508C>A	uc003cqp.2	+	27	4098	c.3919C>A	c.(3919-3921)CCA>ACA	p.P1307T	NBEAL2_uc010hjm.1_Intron|NBEAL2_uc010hjn.1_5'Flank	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1307	Pro-rich.						binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		TCCGTCTTCCCCAGAGTCACC	0.657													3	25	---	---	---	---	PASS
ARIH2	10425	broad.mit.edu	37	3	49002355	49002355	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49002355C>G	uc003cvb.2	+	5	639	c.327C>G	c.(325-327)TAC>TAG	p.Y109*	ARIH2_uc003cvc.2_Nonsense_Mutation_p.Y109*|ARIH2_uc003cvf.2_Nonsense_Mutation_p.Y27*|ARIH2_uc010hkl.2_Nonsense_Mutation_p.Y109*	NM_006321	NP_006312	O95376	ARI2_HUMAN	ariadne homolog 2	109					developmental cell growth|hemopoietic stem cell proliferation|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		TTTGTAGATACAAGTCCAATT	0.383													13	38	---	---	---	---	PASS
DALRD3	55152	broad.mit.edu	37	3	49055216	49055216	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49055216G>A	uc003cvk.1	-	3	568	c.548C>T	c.(547-549)TCG>TTG	p.S183L	DALRD3_uc003cvl.1_Missense_Mutation_p.S183L|DALRD3_uc003cvm.1_Missense_Mutation_p.S16L|DALRD3_uc010hko.1_Missense_Mutation_p.S16L|DALRD3_uc011bca.1_Missense_Mutation_p.S183L|NDUFAF3_uc003cvn.2_5'Flank	NM_001009996	NP_001009996	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	183					arginyl-tRNA aminoacylation	cytoplasm	arginine-tRNA ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGCTCTCTCCGAGGCAGCGGG	0.637													9	20	---	---	---	---	PASS
ITIH1	3697	broad.mit.edu	37	3	52821211	52821211	+	Silent	SNP	G	A	A	rs145798485		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52821211G>A	uc003dfs.2	+	15	1920	c.1896G>A	c.(1894-1896)CCG>CCA	p.P632P	ITIH1_uc010hmn.1_RNA|ITIH1_uc003dft.2_Silent_p.P233P|ITIH1_uc010hmo.1_Intron|ITIH1_uc003dfu.2_5'Flank	NM_002215	NP_002206	P19827	ITIH1_HUMAN	inter-alpha (globulin) inhibitor H1	632	Hyaluronan-binding.				hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		CAGATTCTCCGCCTTTGGGTG	0.547													23	71	---	---	---	---	PASS
ALCAM	214	broad.mit.edu	37	3	105290745	105290745	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105290745A>C	uc003dvx.2	+	15	2254	c.1714A>C	c.(1714-1716)AAA>CAA	p.K572Q	ALCAM_uc003dvy.2_Missense_Mutation_p.K559Q|ALCAM_uc010hpp.2_Missense_Mutation_p.K294Q|ALCAM_uc003dvz.2_Missense_Mutation_p.K206Q	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	572	Cytoplasmic (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						GGAAGAAAACAAAAAGTTAGA	0.353													3	16	---	---	---	---	PASS
PLXNA1	5361	broad.mit.edu	37	3	126736417	126736417	+	Silent	SNP	C	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126736417C>T	uc003ejg.2	+	17	3361	c.3357C>T	c.(3355-3357)ACC>ACT	p.T1119T		NM_032242	NP_115618	Q9UIW2	PLXA1_HUMAN	plexin A1	1142	Extracellular (Potential).|IPT/TIG 3.				axon guidance	integral to membrane|intracellular|plasma membrane	semaphorin receptor activity			ovary(1)|pancreas(1)|skin(1)	3				GBM - Glioblastoma multiforme(114;0.155)		TCAACTCCACCTCCTTCCTCT	0.647													45	132	---	---	---	---	PASS
TMEM207	131920	broad.mit.edu	37	3	190147473	190147473	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190147473G>T	uc003fsj.2	-	5	419	c.352C>A	c.(352-354)CAA>AAA	p.Q118K		NM_207316	NP_997199	Q6UWW9	TM207_HUMAN	transmembrane protein 207 precursor	118						integral to membrane					0	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		TCAGGGGTTTGAGTTTGAAGG	0.418													15	64	---	---	---	---	PASS
EVC2	132884	broad.mit.edu	37	4	5620291	5620291	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5620291G>A	uc003gij.2	-	15	2674	c.2620C>T	c.(2620-2622)CGA>TGA	p.R874*	EVC2_uc011bwb.1_Nonsense_Mutation_p.R314*|EVC2_uc003gik.2_Nonsense_Mutation_p.R794*	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	874						integral to membrane				large_intestine(3)|ovary(2)	5						AGCAGAACTCGGGCCCGGATC	0.607													7	22	---	---	---	---	PASS
C5orf35	133383	broad.mit.edu	37	5	56205485	56205485	+	Silent	SNP	C	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56205485C>T	uc003jqx.2	+	1	386	c.13C>T	c.(13-15)CTG>TTG	p.L5L	C5orf35_uc003jqy.2_RNA	NM_153706	NP_714917	Q8NE22	CE035_HUMAN	hypothetical protein LOC133383	5										ovary(1)	1		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.173)		OV - Ovarian serous cystadenocarcinoma(10;2.58e-39)		GCCTGGCCGTCTGCTGCGGGG	0.731													6	13	---	---	---	---	PASS
ARHGEF37	389337	broad.mit.edu	37	5	149008510	149008510	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149008510C>G	uc003lra.1	+	12	1863	c.1799C>G	c.(1798-1800)TCT>TGT	p.S600C		NM_001001669	NP_001001669	A1IGU5	ARH37_HUMAN	hypothetical protein LOC389337	600					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity				0						CTAGTGCCCTCTATTCCCACC	0.587													4	29	---	---	---	---	PASS
C5orf40	408263	broad.mit.edu	37	5	156770011	156770011	+	Silent	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156770011G>A	uc003lwu.2	-	2	722	c.534C>T	c.(532-534)CTC>CTT	p.L178L	CYFIP2_uc003lwq.2_Intron|CYFIP2_uc011ddn.1_Intron|CYFIP2_uc011ddo.1_Intron|CYFIP2_uc003lwr.2_Intron|CYFIP2_uc003lws.2_Intron|CYFIP2_uc003lwt.2_Intron|CYFIP2_uc011ddp.1_Intron	NM_001001343	NP_001001343	Q8TBE3	FNDC9_HUMAN	hypothetical protein LOC408263	178						integral to membrane					0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCACCAGGGGGAGCCCCTGCA	0.622											OREG0016977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	122	---	---	---	---	PASS
GNB2L1	10399	broad.mit.edu	37	5	180669216	180669216	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180669216G>C	uc003mni.1	-	2	345	c.239C>G	c.(238-240)TCA>TGA	p.S80*	GNB2L1_uc003mnh.1_Nonsense_Mutation_p.S39*|GNB2L1_uc003mnk.1_5'UTR|GNB2L1_uc003mnj.1_Missense_Mutation_p.Q33E|GNB2L1_uc003mnl.1_5'Flank|GNB2L1_uc011dhk.1_Nonsense_Mutation_p.S80*|GNB2L1_uc010jls.2_Nonsense_Mutation_p.S39*|GNB2L1_uc011dhl.1_Nonsense_Mutation_p.S80*|SNORD96A_uc010jlt.1_5'Flank	NM_006098	NP_006089	P63244	GBLP_HUMAN	guanine nucleotide binding protein (G protein),	80	WD 2.			Missing (in Ref. 4; BAG53102).	apoptosis|cell cycle|gastrulation|interspecies interaction between organisms|negative regulation of cell growth|negative regulation of phagocytosis|negative regulation of translation|negative regulation of Wnt receptor signaling pathway|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of gastrulation|positive regulation of GTPase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein homooligomerization|positive regulation of protein phosphorylation|regulation of cell cycle|regulation of cell division|regulation of establishment of cell polarity|regulation of protein localization|rhythmic process	cytoskeleton|dendrite|midbody|nucleus|perikaryon|perinuclear region of cytoplasm|phagocytic cup|small ribosomal subunit	ion channel inhibitor activity|protein kinase C binding|protein phosphatase binding|protein tyrosine kinase inhibitor activity|receptor tyrosine kinase binding|SH2 domain binding				0	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.101)|all cancers(165;0.11)		CCAGGAGCCTGAGAGGGCAAA	0.552													4	68	---	---	---	---	PASS
HIST1H3E	8353	broad.mit.edu	37	6	26225698	26225698	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26225698G>C	uc003nhb.2	+	2	676	c.316G>C	c.(316-318)GAG>CAG	p.E106Q	HIST1H3E_uc003nhc.3_Missense_Mutation_p.E106Q	NM_021018	NP_066298	P68431	H31_HUMAN	histone cluster 1, H3f	106					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)				GGGGCTTTTCGAGGACACCAA	0.587											OREG0017240	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	47	18	---	---	---	---	PASS
MDGA1	266727	broad.mit.edu	37	6	37611649	37611649	+	Silent	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37611649G>A	uc003onu.1	-	14	3651	c.2472C>T	c.(2470-2472)CTC>CTT	p.L824L	MDGA1_uc003onv.1_Silent_p.L93L	NM_153487	NP_705691	Q8NFP4	MDGA1_HUMAN	MAM domain containing	824	MAM.				brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2						TGGCATTGTAGAGGGGACTCA	0.572													40	18	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51701256	51701256	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51701256C>A	uc003pah.1	-	51	8395	c.8119G>T	c.(8119-8121)GGC>TGC	p.G2707C	PKHD1_uc010jzn.1_Missense_Mutation_p.G690C|PKHD1_uc003pai.2_Missense_Mutation_p.G2707C	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2707	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TGAACTTGGCCTTCACCTGAA	0.393													16	42	---	---	---	---	PASS
CARD11	84433	broad.mit.edu	37	7	2952970	2952970	+	Silent	SNP	C	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2952970C>T	uc003smv.2	-	22	3374	c.2970G>A	c.(2968-2970)CAG>CAA	p.Q990Q		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	990	Guanylate kinase-like.				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TGAGCAGCCTCTGCACCAGCG	0.667			Mis		DLBCL								40	68	---	---	---	---	PASS
POMZP3	22932	broad.mit.edu	37	7	76239524	76239524	+	3'UTR	SNP	C	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76239524C>A	uc003uft.2	-	7					uc003ufs.1_Intron|POMZP3_uc003ufu.2_3'UTR|POMZP3_uc003ufv.2_RNA|POMZP3_uc011kgm.1_RNA	NM_012230	NP_036362	Q6PJE2	POZP3_HUMAN	POMZP3 fusion protein isoform 1												0		Myeloproliferative disorder(862;0.204)				ACATCTGCTTCTTCTGTCACT	0.522													9	40	---	---	---	---	PASS
CCDC146	57639	broad.mit.edu	37	7	76889321	76889321	+	Intron	SNP	T	C	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76889321T>C	uc003uga.2	+						CCDC146_uc010ldp.2_5'UTR	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				gtgtATCCCCTACAGAGAAAT	0.264													4	17	---	---	---	---	PASS
MCM7	4176	broad.mit.edu	37	7	99695255	99695255	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99695255G>A	uc003usw.1	-	9	1609	c.1099C>T	c.(1099-1101)CGA>TGA	p.R367*	MCM7_uc003usv.1_Nonsense_Mutation_p.R191*|MCM7_uc003usx.1_Nonsense_Mutation_p.R191*	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	367	MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)	TTCATGCCTCGAGGAGACTGG	0.517													111	293	---	---	---	---	PASS
LAMB1	3912	broad.mit.edu	37	7	107577541	107577541	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107577541G>A	uc003vew.2	-	26	4278	c.3943C>T	c.(3943-3945)CGG>TGG	p.R1315W	LAMB1_uc003vev.2_Missense_Mutation_p.R1339W	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	1315	Potential.|Domain II.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGCTCACCCCGAATATCTGAG	0.368													5	130	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111617297	111617297	+	Silent	SNP	G	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111617297G>T	uc003vfx.2	-	8	860	c.591C>A	c.(589-591)GCC>GCA	p.A197A	DOCK4_uc003vfy.2_Silent_p.A197A|DOCK4_uc003vga.1_5'UTR|DOCK4_uc010ljt.1_Silent_p.A197A|DOCK4_uc003vgb.1_Silent_p.A121A	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	197					cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				GGTGACTGCTGGCCTGCACCG	0.502													3	8	---	---	---	---	PASS
GTF3C5	9328	broad.mit.edu	37	9	135929311	135929311	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135929311C>T	uc004cci.3	+	6	1307	c.970C>T	c.(970-972)CGT>TGT	p.R324C	GTF3C5_uc010mzz.2_Missense_Mutation_p.R199C|GTF3C5_uc004ccj.3_Missense_Mutation_p.R324C	NM_012087	NP_036219	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5	324						transcription factor TFIIIC complex	DNA binding|protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		TTTCCGAATCCGTTGTGGAAT	0.433													5	47	---	---	---	---	PASS
SFRS2B	10929	broad.mit.edu	37	11	94801103	94801103	+	Silent	SNP	C	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94801103C>T	uc001pff.2	+	2	1049	c.714C>T	c.(712-714)TCC>TCT	p.S238S	SFRS2B_uc001pfg.1_RNA	NM_032102	NP_115285	Q9BRL6	SRSF8_HUMAN	splicing factor, arginine/serine-rich 2B	238					mRNA processing|RNA splicing	nucleus	nucleotide binding|RNA binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CCTCGGTCTCCAGGTCTCGCT	0.597													8	29	---	---	---	---	PASS
IGSF9B	22997	broad.mit.edu	37	11	133791101	133791101	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133791101T>C	uc001qgx.3	-	18	2750	c.2519A>G	c.(2518-2520)GAG>GGG	p.E840G		NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	840	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GGCCTCTGCCTCGGCCTCTGC	0.642													9	53	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43826221	43826221	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43826221C>G	uc010skx.1	-	21	2982	c.2982G>C	c.(2980-2982)ATG>ATC	p.M994I	ADAMTS20_uc001rno.1_Missense_Mutation_p.M148I|ADAMTS20_uc001rnp.1_Missense_Mutation_p.M148I	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	994	TSP type-1 4.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CAAAGTTATTCATACAATAAG	0.403													21	40	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101520733	101520733	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101520733G>A	uc010svm.1	+	27	3325	c.2753G>A	c.(2752-2754)AGA>AAA	p.R918K	ANO4_uc001thw.2_Missense_Mutation_p.R883K|ANO4_uc001thx.2_Missense_Mutation_p.R918K|ANO4_uc001thy.2_Missense_Mutation_p.R438K	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	918	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						GATCGAATGAGAAGAGAGAAG	0.433										HNSCC(74;0.22)			4	37	---	---	---	---	PASS
KCTD12	115207	broad.mit.edu	37	13	77460014	77460014	+	Silent	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77460014G>A	uc010aeu.1	-	1	527	c.270C>T	c.(268-270)CGC>CGT	p.R90R	KCTD12_uc001vka.1_Silent_p.R90R	NM_138444	NP_612453	Q96CX2	KCD12_HUMAN	potassium channel tetramerisation domain	90						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			ovary(1)	1		Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.0499)		CCAGGATGTAGCGGAAGAGGA	0.657													6	13	---	---	---	---	PASS
BRF1	2972	broad.mit.edu	37	14	105684015	105684015	+	Silent	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105684015G>A	uc001yqp.2	-	15	2001	c.1638C>T	c.(1636-1638)CTC>CTT	p.L546L	BRF1_uc010tyo.1_Silent_p.L431L|BRF1_uc010typ.1_Silent_p.L453L|BRF1_uc001yqk.2_Silent_p.L72L|BRF1_uc001yql.2_Silent_p.L342L|BRF1_uc001yqo.2_Silent_p.L308L|BRF1_uc010axg.1_Silent_p.L519L|BRF1_uc001yqn.2_Intron|BRF1_uc010axh.1_Intron|BRF1_uc010axi.1_Silent_p.L72L	NM_001519	NP_001510	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1	546					positive regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		CGGCGCTGCTGAGGCCCCGGA	0.632													15	13	---	---	---	---	PASS
ARHGAP11A	9824	broad.mit.edu	37	15	32926203	32926203	+	Silent	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32926203G>A	uc001zgy.1	+	10	2027	c.1305G>A	c.(1303-1305)CTG>CTA	p.L435L	ARHGAP11A_uc010ubw.1_Silent_p.L246L|ARHGAP11A_uc001zgw.2_Silent_p.L435L|ARHGAP11A_uc001zgx.2_Silent_p.L407L|ARHGAP11A_uc010ubx.1_Silent_p.L246L	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A isoform 1	435					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			skin(3)|breast(2)|urinary_tract(1)	6		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		GAAGATCTCTGCGTTTGAAAT	0.333													5	17	---	---	---	---	PASS
SPTBN5	51332	broad.mit.edu	37	15	42167077	42167077	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42167077G>T	uc001zos.2	-	23	4693	c.4360C>A	c.(4360-4362)CCG>ACG	p.P1454T		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1489					actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		AGGATGGCCGGGGAGGCGGCC	0.632													3	25	---	---	---	---	PASS
CORO2B	10391	broad.mit.edu	37	15	69006362	69006362	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69006362G>C	uc002arj.3	+	6	776	c.747G>C	c.(745-747)CAG>CAC	p.Q249H	CORO2B_uc010bic.2_Missense_Mutation_p.Q244H|CORO2B_uc002ark.2_Missense_Mutation_p.Q16H	NM_006091	NP_006082	Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	249	WD 4.				actin cytoskeleton organization	actin cytoskeleton|cytoplasm|membrane	actin filament binding			ovary(3)|skin(2)|large_intestine(1)	6						ACACAAGACAGATTGCCCTCT	0.587													3	34	---	---	---	---	PASS
NARFL	64428	broad.mit.edu	37	16	787225	787225	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:787225C>G	uc002cjr.2	-	3	279	c.267G>C	c.(265-267)CAG>CAC	p.Q89H	NARFL_uc002cjp.2_5'UTR|NARFL_uc002cjq.2_5'UTR|NARFL_uc002cjs.2_5'UTR|NARFL_uc010brc.1_Missense_Mutation_p.Q89H|NARFL_uc010uur.1_Missense_Mutation_p.Q89H	NM_022493	NP_071938	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like	89					iron-sulfur cluster assembly|oxygen homeostasis|regulation of transcription, DNA-dependent|response to hypoxia		4 iron, 4 sulfur cluster binding|metal ion binding				0		Hepatocellular(780;0.0218)				CCTCGTGGCTCTGCTGGGTGA	0.587													7	136	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1392980	1392980	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1392980G>A	uc002clk.1	+	14	1333	c.1333G>A	c.(1333-1335)GCC>ACC	p.A445T	BAIAP3_uc002clj.2_Missense_Mutation_p.A427T|BAIAP3_uc010uuz.1_Missense_Mutation_p.A410T|BAIAP3_uc010uva.1_Missense_Mutation_p.A382T|BAIAP3_uc010uvc.1_Missense_Mutation_p.A374T	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	445					G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				CCTGCACGGAGCCCAGAGCAA	0.687													16	32	---	---	---	---	PASS
MYH3	4621	broad.mit.edu	37	17	10541420	10541420	+	Silent	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10541420G>A	uc002gmq.1	-	26	3746	c.3669C>T	c.(3667-3669)AGC>AGT	p.S1223S		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1223	Potential.				muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						GCTTGAACTCGCTCTTCTCCT	0.582													31	50	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18023480	18023480	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18023480G>A	uc010vxh.1	+	2	1704	c.1366G>A	c.(1366-1368)GCC>ACC	p.A456T		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	456	Myosin head-like.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					GCCCAGCGCCGCCTTCTTCGA	0.647													12	28	---	---	---	---	PASS
LGALS9B	284194	broad.mit.edu	37	17	20354961	20354961	+	Intron	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20354961G>A	uc002gxa.1	-						LGALS9B_uc002gwz.1_Intron|LGALS9B_uc010vzh.1_Intron	NM_001042685	NP_001036150	Q3B8N2	LEG9B_HUMAN	galectin-9 like								sugar binding			skin(1)	1						TGGAACCTGCGGTGGGCAGCC	0.557													7	77	---	---	---	---	PASS
PLIN4	729359	broad.mit.edu	37	19	4511357	4511357	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4511357G>A	uc002mar.1	-	3	2573	c.2573C>T	c.(2572-2574)GCT>GTT	p.A858V	PLIN4_uc010dub.1_Intron	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	858	27 X 33 AA approximate tandem repeat.|24.					lipid particle|plasma membrane					0						CACTTTCGCAGCACCGGTCAC	0.587													8	99	---	---	---	---	PASS
BCL3	602	broad.mit.edu	37	19	45261971	45261971	+	Intron	SNP	C	G	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45261971C>G	uc010xxe.1	+							NM_005178	NP_005169	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3						DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|I-kappaB kinase/NF-kappaB cascade|maintenance of protein location in nucleus|negative regulation of apoptosis|negative regulation of interleukin-8 biosynthetic process|negative regulation of transcription, DNA-dependent|positive regulation of translation|protein import into nucleus, translocation|regulation of DNA binding|regulation of NF-kappaB import into nucleus|response to UV-C|response to virus	Bcl3-Bcl10 complex|Bcl3/NF-kappaB2 complex|nucleus|perinuclear region of cytoplasm	protein binding, bridging|transcription factor binding			ovary(1)|lung(1)	2	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				TCACGCCCATCTTCCTACAGG	0.627			T	IGH@	CLL 								2	6	---	---	---	---	PASS
BCL3	602	broad.mit.edu	37	19	45261992	45261992	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45261992C>G	uc010xxe.1	+	8	1141	c.1071C>G	c.(1069-1071)ATC>ATG	p.I357M		NM_005178	NP_005169	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	357	ANK 7.				DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|I-kappaB kinase/NF-kappaB cascade|maintenance of protein location in nucleus|negative regulation of apoptosis|negative regulation of interleukin-8 biosynthetic process|negative regulation of transcription, DNA-dependent|positive regulation of translation|protein import into nucleus, translocation|regulation of DNA binding|regulation of NF-kappaB import into nucleus|response to UV-C|response to virus	Bcl3-Bcl10 complex|Bcl3/NF-kappaB2 complex|nucleus|perinuclear region of cytoplasm	protein binding, bridging|transcription factor binding			ovary(1)|lung(1)	2	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				TCATCGACATCCTGAGGGGGA	0.652			T	IGH@	CLL 								4	4	---	---	---	---	PASS
MYADM	91663	broad.mit.edu	37	19	54376790	54376790	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54376790G>A	uc002qcl.2	+	3	155	c.7G>A	c.(7-9)GTG>ATG	p.V3M	MYADM_uc002qcm.2_Missense_Mutation_p.V3M|MYADM_uc002qcn.2_Missense_Mutation_p.V3M|MYADM_uc002qco.2_Missense_Mutation_p.V3M|MYADM_uc002qcp.2_Missense_Mutation_p.V3M	NM_001020820	NP_001018656	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	3						integral to membrane				ovary(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		AGCCATGCCAGTGACGGTAAC	0.557											OREG0003650	type=REGULATORY REGION|Gene=MYADM|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	20	59	---	---	---	---	PASS
PRPF31	26121	broad.mit.edu	37	19	54626824	54626824	+	Intron	SNP	C	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54626824C>T	uc002qdh.2	+						PRPF31_uc010yek.1_Intron	NM_015629	NP_056444	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31 homolog						assembly of spliceosomal tri-snRNP	Cajal body|MLL1 complex|nuclear speck|U4 snRNP|U4/U6 x U5 tri-snRNP complex|U4atac snRNP	RNA binding|snRNP binding			ovary(1)	1	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTTCTCTGCTCGCCCCCAGGA	0.577													35	110	---	---	---	---	PASS
CCT8	10694	broad.mit.edu	37	21	30435830	30435830	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30435830C>T	uc002ynb.2	-	8	883	c.784G>A	c.(784-786)GCT>ACT	p.A262T	CCT8_uc002ymz.2_5'Flank|CCT8_uc011acp.1_Missense_Mutation_p.A243T|CCT8_uc002yna.2_Missense_Mutation_p.A211T|CCT8_uc002ync.2_Missense_Mutation_p.A261T|CCT8_uc010glm.2_Missense_Mutation_p.A203T|CCT8_uc011acq.1_Missense_Mutation_p.A189T	NM_006585	NP_006576	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	262					'de novo' posttranslational protein folding	aggresome|cytosol|intermediate filament cytoskeleton|microtubule organizing center	ATP binding|ATPase activity, coupled|unfolded protein binding				0						AATTCTTCAGCAGTCTTTATC	0.373													5	77	---	---	---	---	PASS
PLA2G3	50487	broad.mit.edu	37	22	31535960	31535960	+	Silent	SNP	C	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31535960C>T	uc003aka.2	-	1	510	c.381G>A	c.(379-381)GGG>GGA	p.G127G		NM_015715	NP_056530	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III precursor	127					cilium morphogenesis|lipid catabolic process|phospholipid metabolic process	centriole|extracellular space|plasma membrane	calcium ion binding|calcium-dependent phospholipase A2 activity				0						TCTTCCTGGCCCCTGCTGGAC	0.637													3	25	---	---	---	---	PASS
GPKOW	27238	broad.mit.edu	37	X	48972077	48972077	+	Intron	SNP	C	T	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48972077C>T	uc004dmr.2	-							NM_015698	NP_056513	Q92917	GPKOW_HUMAN	G patch domain and KOW motifs							nucleus	nucleic acid binding			ovary(2)	2						CGCTCAAACTCACCTTCCAGG	0.517													21	46	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73962692	73962692	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73962692G>A	uc004eby.2	-	3	2317	c.1700C>T	c.(1699-1701)ACA>ATA	p.T567I		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	567					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						CAAATTCACTGTTGTCTCACT	0.433													16	125	---	---	---	---	PASS
RBP7	116362	broad.mit.edu	37	1	10068112	10068112	+	Intron	DEL	A	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10068112delA	uc001aqq.2	+						RBP7_uc009vms.2_Intron	NM_052960	NP_443192	Q96R05	RET7_HUMAN	retinol binding protein 7, cellular							cytoplasm	retinal binding|retinol binding|transporter activity				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|BRCA - Breast invasive adenocarcinoma(304;0.000302)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00856)|READ - Rectum adenocarcinoma(331;0.0419)	Vitamin A(DB00162)	actccatctcaaaaaaaaaaa	0.189													3	3	---	---	---	---	
FAM73A	374986	broad.mit.edu	37	1	78329892	78329892	+	Intron	DEL	A	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78329892delA	uc001dhx.2	+						FAM73A_uc010ork.1_Intron|FAM73A_uc010orl.1_Intron	NM_198549	NP_940951	Q8NAN2	FA73A_HUMAN	hypothetical protein LOC374986							integral to membrane				ovary(1)	1				Colorectal(170;0.226)		ctaaaaatacaaaaaaaaaaa	0.000													5	3	---	---	---	---	
DNAJB4	11080	broad.mit.edu	37	1	78471050	78471050	+	Intron	DEL	T	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78471050delT	uc001dij.2	+						DNAJB4_uc010orn.1_Intron	NM_007034	NP_008965	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4						protein folding|response to heat|response to unfolded protein	cytoplasm|plasma membrane	heat shock protein binding|unfolded protein binding				0						gctctgtctcttttttttttt	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224170870	224170871	+	IGR	INS	-	A	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224170870_224170871insA								TP53BP2 (137196 upstream) : FBXO28 (130920 downstream)																							aactccatctcaaaaaaaaaaa	0.163													4	2	---	---	---	---	
PPPDE1	51029	broad.mit.edu	37	1	244852819	244852820	+	Intron	INS	-	T	T	rs138991913	by1000genomes	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244852819_244852820insT	uc001iao.2	+						PPPDE1_uc001iap.2_Intron	NM_016076	NP_057160	Q9BSY9	PPDE1_HUMAN	PPPDE peptidase domain containing 1											breast(3)	3						Atttcttttccttttttttttg	0.134													4	2	---	---	---	---	
KDM3A	55818	broad.mit.edu	37	2	86682418	86682418	+	Intron	DEL	T	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86682418delT	uc002sri.3	+						KDM3A_uc010ytj.1_Intron|KDM3A_uc010ytk.1_Intron	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						TTCTTttttcttttttttttt	0.179													4	2	---	---	---	---	
NPAS2	4862	broad.mit.edu	37	2	101581935	101581935	+	Intron	DEL	A	-	-	rs34188493		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101581935delA	uc002tap.1	+						NPAS2_uc010yvt.1_Intron	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2						central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4						TCTATATGCCAAAAAAAAAAG	0.388													2	4	---	---	---	---	
PASK	23178	broad.mit.edu	37	2	242075147	242075148	+	Intron	INS	-	C	C	rs140491962	by1000genomes	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242075147_242075148insC	uc002wao.1	-						PASK_uc010zol.1_Intron|PASK_uc010zom.1_Intron|PASK_uc010fzl.1_Intron|PASK_uc010zon.1_Intron|PASK_uc002wap.2_5'Flank|PASK_uc002waq.2_Intron	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase						regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GAAAACAGTCACCCCCTACTCC	0.550													4	2	---	---	---	---	
ARHGEF3	50650	broad.mit.edu	37	3	56771523	56771524	+	Intron	INS	-	A	A	rs11443478		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56771523_56771524insA	uc003dig.2	-						ARHGEF3_uc011bew.1_Intron|ARHGEF3_uc003dih.2_Intron|ARHGEF3_uc011bev.1_Intron|ARHGEF3_uc003dif.2_Intron|ARHGEF3_uc010hmy.1_Intron|ARHGEF3_uc003dii.2_Intron	NM_019555	NP_062455	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor 3 isoform						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		TGGGAAAAGAGAAAAAAAAAAA	0.347													4	2	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188242759	188242760	+	Intron	INS	-	T	T	rs11393215		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188242759_188242760insT	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		ctttctttctcttttttttttt	0.035			T	HMGA2|MLL|C12orf9	lipoma|leukemia								3	5	---	---	---	---	
DCHS2	54798	broad.mit.edu	37	4	155190927	155190928	+	Intron	INS	-	A	A	rs142509761	by1000genomes	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155190927_155190928insA	uc003inw.2	-							NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TAGGCTAGCTTAAAAAATTCTT	0.262													2	5	---	---	---	---	
WWC2	80014	broad.mit.edu	37	4	184210956	184210957	+	Intron	INS	-	C	C	rs35217678		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184210956_184210957insC	uc010irx.2	+						WWC2_uc003ivk.3_Intron|WWC2_uc003ivl.3_Intron|WWC2_uc010iry.2_Intron|WWC2_uc003ivn.3_Intron|WWC2_uc010irz.2_Intron|WWC2_uc003ivo.3_Intron	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2											ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		TTTTTTTTTTTCCAAACCAAAA	0.470													4	3	---	---	---	---	
LMBRD2	92255	broad.mit.edu	37	5	36142818	36142818	+	Intron	DEL	C	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36142818delC	uc003jkb.1	-							NM_001007527	NP_001007528	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2							integral to membrane					0	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATGCTTTAttctttttttttt	0.144													6	4	---	---	---	---	
FKBP6	8468	broad.mit.edu	37	7	72754919	72754920	+	Intron	INS	-	TTT	TTT	rs68028107		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72754919_72754920insTTT	uc003tya.2	+						FKBP6_uc003twz.2_Intron|FKBP6_uc011kew.1_Intron|FKBP6_uc010lbe.1_Intron	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a						protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				AAAATGCTGtcttttttttttt	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	12427842	12427846	+	Intron	DEL	TGTTT	-	-	rs56211977		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12427842_12427846delTGTTT	uc003wvy.3	-						uc003wvz.1_RNA|uc003wwa.2_RNA					Homo sapiens cDNA FLJ42906 fis, clone BRHIP3016213.																		TATTTGGTACTGTTTTAAGTCTGAA	0.293													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	18241342	18241342	+	IGR	DEL	A	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18241342delA								NAT1 (160145 upstream) : NAT2 (7413 downstream)																							CACGGTCTCCAAAAACTTCTG	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	26906155	26906155	+	IGR	DEL	A	-	-	rs11339368		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26906155delA								ADRA1A (183233 upstream) : MIR548H-4 (215 downstream)																							actccatctcaaaaaaaaaaa	0.204													4	2	---	---	---	---	
NR4A3	8013	broad.mit.edu	37	9	102589219	102589220	+	Intron	INS	-	T	T	rs142732047	by1000genomes	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102589219_102589220insT	uc004baf.1	+						NR4A3_uc004bae.2_Intron|NR4A3_uc004bag.1_Intron|NR4A3_uc004bai.2_Intron	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				AAAAACCGCCGTTTTTTACCAT	0.386			T	EWSR1	extraskeletal myxoid chondrosarcoma								9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130262669	130262669	+	IGR	DEL	A	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130262669delA								MKI67 (338201 upstream) : None (None downstream)																							ctcctcctccaccatcctccc	0.109													8	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11158570	11158570	+	IGR	DEL	A	-	-	rs10574607		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11158570delA								ZBED5 (278950 upstream) : GALNTL4 (133851 downstream)																							actctgtctcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
UBE4A	9354	broad.mit.edu	37	11	118243700	118243701	+	Intron	INS	-	A	A	rs34104337		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118243700_118243701insA	uc001psw.2	+						UBE4A_uc001psv.2_Intron	NM_004788	NP_004779	Q14139	UBE4A_HUMAN	ubiquitination factor E4A						ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	5	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		cccccagctctaaaaaaaaaaa	0.139													4	2	---	---	---	---	
IGSF9B	22997	broad.mit.edu	37	11	133805441	133805444	+	Intron	DEL	GCCT	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133805441_133805444delGCCT	uc001qgx.3	-						IGSF9B_uc001qgy.1_Intron	NM_014987	NP_055802	Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B							integral to membrane|plasma membrane					0	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CTACCCTCCAGCCTACAGTCTGGC	0.613													4	2	---	---	---	---	
LMBR1L	55716	broad.mit.edu	37	12	49494862	49494863	+	Intron	INS	-	A	A	rs145985167	by1000genomes	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49494862_49494863insA	uc001rth.3	-						LMBR1L_uc001rtg.3_Intron|LMBR1L_uc001rti.3_Intron	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor						endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						GCCCTCCTTTCAAATTAAGTCT	0.317													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23265335	23265336	+	IGR	INS	-	G	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23265335_23265336insG								GOLGA9P (2592 upstream) : HERC2P2 (16929 downstream)																							AGGCAGGAAGAGGGGGCTCCCA	0.639													4	4	---	---	---	---	
ERN2	10595	broad.mit.edu	37	16	23713292	23713293	+	Intron	INS	-	AAC	AAC			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23713292_23713293insAAC	uc002dma.3	-						ERN2_uc010bxp.2_Intron|ERN2_uc010bxq.1_Intron	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2						apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		tttctggcagtaacaacaacaa	0.178													3	3	---	---	---	---	
ERN2	10595	broad.mit.edu	37	16	23716137	23716138	+	Intron	INS	-	C	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23716137_23716138insC	uc002dma.3	-						ERN2_uc010bxp.2_Intron|ERN2_uc010bxq.1_Intron	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2						apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		atcTCGCCTGGCCATCAGACCC	0.347													45	21	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46393128	46393130	+	IGR	DEL	TGA	-	-	rs28827236		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46393128_46393130delTGA								None (None upstream) : ANKRD26P1 (110119 downstream)																							cgattccatttgatgatttcatt	0.000													4	2	---	---	---	---	
TBX4	9496	broad.mit.edu	37	17	59557756	59557757	+	Intron	DEL	CC	-	-	rs112008276		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59557756_59557757delCC	uc002izi.2	+						TBX4_uc010ddo.2_Intron|TBX4_uc010woy.1_Intron	NM_018488	NP_060958	P57082	TBX4_HUMAN	T-box 4						leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						CTCTGCAGCGCCCCCCCCCCCA	0.594													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	73305889	73305891	+	IGR	DEL	ACA	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73305889_73305891delACA								SLC25A19 (20359 upstream) : GRB2 (8267 downstream)																							CTTCACTGGGACAACATCAGCAG	0.330													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	78950792	78950793	+	IGR	INS	-	A	A	rs112496455		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78950792_78950793insA								RPTOR (10619 upstream) : CHMP6 (14848 downstream)																							atttgacaattaaaaaaaaaaa	0.134													6	3	---	---	---	---	
EMR3	84658	broad.mit.edu	37	19	14732269	14732269	+	Intron	DEL	A	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14732269delA	uc002mzi.3	-						EMR3_uc010dzp.2_Intron|EMR3_uc010xnv.1_Intron	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor						neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						tctgtctcagaaaaaaaaaaa	0.060													5	3	---	---	---	---	
ZNF253	56242	broad.mit.edu	37	19	19989125	19989125	+	Intron	DEL	G	-	-	rs3841054		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19989125delG	uc002noj.2	+						ZNF253_uc002nok.2_Intron|ZNF253_uc002nol.2_Intron	NM_021047	NP_066385	O75346	ZN253_HUMAN	zinc finger protein 253						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAGAGTTAGAGGATACATTAG	0.308													2	5	---	---	---	---	
CEACAM21	90273	broad.mit.edu	37	19	42083433	42083434	+	Intron	DEL	AC	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42083433_42083434delAC	uc002ore.3	+						CEACAM21_uc002orc.1_Intron|CEACAM21_uc002ord.1_Intron|CEACAM21_uc002orf.2_Intron|CEACAM21_uc002org.3_Intron	NM_001098506	NP_001091976	Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to membrane				ovary(1)	1						ACCCAGTAGGacacacacacac	0.302													5	3	---	---	---	---	
BCAM	4059	broad.mit.edu	37	19	45318166	45318166	+	Intron	DEL	T	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45318166delT	uc002ozu.2	+						BCAM_uc002ozt.1_Intron	NM_005581	NP_005572	P50895	BCAM_HUMAN	basal cell adhesion molecule isoform 1						cell-matrix adhesion	integral to plasma membrane	laminin binding|laminin receptor activity			skin(1)	1	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				TTTTTGGttgttttttttttt	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20229947	20229948	+	IGR	INS	-	T	T	rs140136910	by1000genomes	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20229947_20229948insT								TMPRSS15 (453977 upstream) : None (None downstream)																							taagatctgcataaaaaaacaa	0.094													3	3	---	---	---	---	
PPP2R3B	28227	broad.mit.edu	37	X	302445	302445	+	Intron	DEL	C	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:302445delC	uc004cpg.2	-						PPP2R3B_uc004cpf.2_5'UTR	NM_013239	NP_037371	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'',						cell cycle arrest|protein dephosphorylation	nucleus|protein phosphatase type 2A complex	calcium ion binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCTTGTGCCACCCCCCCCCAC	0.652													7	4	---	---	---	---	
PIR	8544	broad.mit.edu	37	X	15478038	15478038	+	Intron	DEL	A	-	-	rs146737236		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15478038delA	uc004cwu.2	-						PIR_uc004cwv.2_Intron	NM_003662	NP_003653	O00625	PIR_HUMAN	pirin						transcription from RNA polymerase II promoter	cytoplasm|nucleus	metal ion binding|protein binding|quercetin 2,3-dioxygenase activity|transcription cofactor activity			ovary(1)	1	Hepatocellular(33;0.183)					ccttttcattAAAAAAAAAAa	0.000													8	5	---	---	---	---	
RAB33A	9363	broad.mit.edu	37	X	129305931	129305932	+	5'UTR	DEL	CA	-	-			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129305931_129305932delCA	uc004evl.2	+	1					RAB33A_uc010nre.2_RNA	NM_004794	NP_004785	Q14088	RB33A_HUMAN	Ras-related protein Rab-33A						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding				0						cacacgcgcgcacacacacacg	0.550													4	2	---	---	---	---	
