Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIAA0090	23065	broad.mit.edu	37	1	19567646	19567646	+	Intron	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19567646G>A	uc001bbo.2	-						KIAA0090_uc001bbp.2_Intron|KIAA0090_uc001bbq.2_Intron|KIAA0090_uc001bbr.2_Intron	NM_015047	NP_055862	Q8N766	K0090_HUMAN	hypothetical protein LOC23065 precursor							integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)		ACTAAGAGAGGGAAGAAGAAA	0.468											OREG0013169	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	30	60	---	---	---	---	PASS
ZCCHC11	23318	broad.mit.edu	37	1	52891171	52891171	+	Missense_Mutation	SNP	A	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52891171A>C	uc001ctx.2	-	29	4951	c.4717T>G	c.(4717-4719)TTT>GTT	p.F1573V	ZCCHC11_uc001cty.2_Missense_Mutation_p.F1574V|ZCCHC11_uc001ctz.2_Missense_Mutation_p.F1569V	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform	1573	Pro-rich.				miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						AGTCCTCGAAAGCCTGGCTCT	0.368													9	17	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74835136	74835136	+	Missense_Mutation	SNP	A	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74835136A>G	uc001dgf.1	+	16	1585	c.1534A>G	c.(1534-1536)ATT>GTT	p.I512V	TNNI3K_uc001dgc.1_Missense_Mutation_p.I613V|TNNI3K_uc001dgd.2_Missense_Mutation_p.I613V|TNNI3K_uc001dge.1_Missense_Mutation_p.I613V	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	512	Protein kinase.					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						AGAGGTGTCCATTCTCTGCCA	0.458													22	69	---	---	---	---	PASS
GBP4	115361	broad.mit.edu	37	1	89659022	89659022	+	Missense_Mutation	SNP	A	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89659022A>G	uc001dnb.2	-	4	553	c.437T>C	c.(436-438)GTG>GCG	p.V146A		NM_052941	NP_443173	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	146						cytoplasm	GTP binding|GTPase activity				0				all cancers(265;0.00723)|Epithelial(280;0.0291)		GATGGTGCTCACGCTGTTATA	0.473													27	30	---	---	---	---	PASS
ADAM30	11085	broad.mit.edu	37	1	120437902	120437902	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120437902C>T	uc001eij.2	-	1	1212	c.1058G>A	c.(1057-1059)TGC>TAC	p.C353Y		NM_021794	NP_068566	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30 preproprotein	353	Peptidase M12B.|Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		CCTACATTGGCAGTATTGTTC	0.438													44	87	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157773703	157773703	+	Missense_Mutation	SNP	T	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157773703T>C	uc001frg.2	-	3	364	c.251A>G	c.(250-252)TAC>TGC	p.Y84C	FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Missense_Mutation_p.Y84C|FCRL1_uc001fri.2_Missense_Mutation_p.Y84C|FCRL1_uc001frj.2_RNA	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	84	Extracellular (Potential).|Ig-like C2-type 1.					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CTCGCACCAGTATGACCCTGT	0.562													41	38	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171755064	171755064	+	Missense_Mutation	SNP	G	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171755064G>C	uc001ghz.2	+	3	1306	c.959G>C	c.(958-960)GGC>GCC	p.G320A	METTL13_uc001gia.2_Missense_Mutation_p.G234A|METTL13_uc001gib.2_Missense_Mutation_p.G164A|METTL13_uc010pml.1_Missense_Mutation_p.G319A	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	320							methyltransferase activity|protein binding			kidney(1)	1						ATGGATGAGGGCCGGAAACAG	0.557													6	23	---	---	---	---	PASS
PPP1R15B	84919	broad.mit.edu	37	1	204380406	204380406	+	Missense_Mutation	SNP	G	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204380406G>C	uc001hav.3	-	1	539	c.134C>G	c.(133-135)TCC>TGC	p.S45C		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	45					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			GGGGTTCCCGGAGTTTTCCGG	0.632													49	71	---	---	---	---	PASS
FAM71A	149647	broad.mit.edu	37	1	212798889	212798889	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212798889C>T	uc001hjk.2	+	1	1074	c.670C>T	c.(670-672)CTC>TTC	p.L224F	uc010pth.1_RNA	NM_153606	NP_705834	Q8IYT1	FA71A_HUMAN	hypothetical protein LOC149647	224										skin(3)|ovary(1)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		CATCCAAAGCCTCCACATGGT	0.537													50	61	---	---	---	---	PASS
ATL2	64225	broad.mit.edu	37	2	38537520	38537520	+	Missense_Mutation	SNP	C	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38537520C>G	uc002rqq.2	-	8	904	c.874G>C	c.(874-876)GGT>CGT	p.G292R	ATL2_uc010ynm.1_Missense_Mutation_p.G274R|ATL2_uc010ynn.1_Missense_Mutation_p.G274R|ATL2_uc010yno.1_Missense_Mutation_p.G121R|ATL2_uc002rqs.2_Missense_Mutation_p.G292R|ATL2_uc002rqr.2_Missense_Mutation_p.G121R	NM_001135673	NP_001129145	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2 isoform 2	292	Cytoplasmic.				endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding	p.G292D(1)		ovary(1)|kidney(1)|skin(1)	3						AGGAAGCAACCAAGATTTGAG	0.393													13	52	---	---	---	---	PASS
SFXN5	94097	broad.mit.edu	37	2	73285676	73285676	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73285676C>T	uc002siq.2	-	2	283	c.152G>A	c.(151-153)CGC>CAC	p.R51H	SFXN5_uc002sio.2_5'UTR|SFXN5_uc010yrc.1_5'UTR|SFXN5_uc002sip.2_RNA|SFXN5_uc010fet.2_Missense_Mutation_p.R51H|SFXN5_uc002sir.1_RNA	NM_144579	NP_653180	Q8TD22	SFXN5_HUMAN	sideroflexin 5	51					iron ion homeostasis	integral to membrane	cation transmembrane transporter activity			ovary(1)	1						AAAGAGTGTGCGAGGGTCGAT	0.507													26	44	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179440160	179440160	+	Missense_Mutation	SNP	A	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179440160A>T	uc010zfg.1	-	275	63219	c.62995T>A	c.(62995-62997)TAT>AAT	p.Y20999N	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Y14694N|TTN_uc010zfi.1_Missense_Mutation_p.Y14627N|TTN_uc010zfj.1_Missense_Mutation_p.Y14502N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21926							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAATCACATAGCCAGTGATC	0.493													66	74	---	---	---	---	PASS
STAT1	6772	broad.mit.edu	37	2	191862577	191862577	+	Intron	SNP	C	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191862577C>A	uc002usj.2	-						STAT1_uc010fse.1_Intron|STAT1_uc002usk.2_Intron|STAT1_uc002usl.2_Intron|STAT1_uc010fsf.1_Intron	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription						activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity			lung(3)|breast(3)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Fludarabine(DB01073)	TTTGGAGAATCTTACCAGTTC	0.473													21	24	---	---	---	---	PASS
TMEFF2	23671	broad.mit.edu	37	2	193059224	193059224	+	Silent	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193059224C>T	uc002utc.2	-	1	421	c.27G>A	c.(25-27)CAG>CAA	p.Q9Q	TMEFF2_uc002utd.1_Silent_p.Q9Q	NM_016192	NP_057276	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two	9						extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			AGCTGCTGCACTGCCGCGGGG	0.637													20	34	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212248574	212248574	+	Missense_Mutation	SNP	C	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212248574C>G	uc002veg.1	-	28	3791	c.3693G>C	c.(3691-3693)GAG>GAC	p.E1231D	ERBB4_uc002veh.1_Missense_Mutation_p.E1215D|ERBB4_uc010zji.1_Missense_Mutation_p.E1221D|ERBB4_uc010zjj.1_Missense_Mutation_p.E1205D	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	1231	Cytoplasmic (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		TCTTGGCCTTCTCTGGCATTG	0.517										TSP Lung(8;0.080)			65	19	---	---	---	---	PASS
SLC19A3	80704	broad.mit.edu	37	2	228564076	228564076	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228564076C>T	uc002vpi.2	-	3	444	c.355G>A	c.(355-357)GCC>ACC	p.A119T	SLC19A3_uc002vpj.2_RNA|SLC19A3_uc010zlv.1_Missense_Mutation_p.A115T	NM_025243	NP_079519	Q9BZV2	S19A3_HUMAN	solute carrier family 19, member 3	119	Helical; (Potential).				thiamine-containing compound metabolic process	integral to membrane|plasma membrane	folic acid binding|reduced folate carrier activity|thiamine uptake transmembrane transporter activity			ovary(2)	2		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	GCCACCTCGGCGGCGGTGACC	0.567													61	11	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140401821	140401821	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140401821G>A	uc003eto.1	+	2	1050	c.859G>A	c.(859-861)GAG>AAG	p.E287K		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	287	B box-type 2.					intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						GGAACAGGACGAGAAGATCTG	0.557													17	32	---	---	---	---	PASS
KCNAB1	7881	broad.mit.edu	37	3	156249272	156249272	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156249272C>T	uc003far.2	+	13	1220	c.1156C>T	c.(1156-1158)CTT>TTT	p.L386F	KCNAB1_uc011bon.1_Missense_Mutation_p.L357F|KCNAB1_uc003fas.2_Missense_Mutation_p.L375F|KCNAB1_uc003fat.2_Missense_Mutation_p.L368F|KCNAB1_uc010hvt.1_Missense_Mutation_p.L339F|KCNAB1_uc011boo.1_Missense_Mutation_p.L262F	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related	386						cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CATTGAAAACCTTGGTGCCAT	0.527													78	50	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164907457	164907457	+	Missense_Mutation	SNP	A	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164907457A>C	uc003fej.3	-	2	1606	c.1162T>G	c.(1162-1164)TTG>GTG	p.L388V	SLITRK3_uc003fek.2_Missense_Mutation_p.L388V	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	388	LRRNT.|Extracellular (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						TTGACAGTCAAGCCAAGGTCA	0.448										HNSCC(40;0.11)			28	174	---	---	---	---	PASS
KLHL6	89857	broad.mit.edu	37	3	183273417	183273417	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183273417C>T	uc003flr.2	-	1	83	c.25G>A	c.(25-27)GCC>ACC	p.A9T	KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_Missense_Mutation_p.A7T	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	kelch-like 6	9										haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			ATGGTCCAGGCGCCCCTTTGT	0.587													52	84	---	---	---	---	PASS
FBXO45	200933	broad.mit.edu	37	3	196304665	196304665	+	Silent	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196304665C>T	uc010iai.2	+	2	791	c.660C>T	c.(658-660)AAC>AAT	p.N220N		NM_001105573	NP_001099043	P0C2W1	FBSP1_HUMAN	F-box protein 45	220	B30.2/SPRY.				nervous system development|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	cell junction|postsynaptic membrane|presynaptic membrane	protein binding			skin(1)	1	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;2.75e-23)|all cancers(36;2.47e-21)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		AGTGCAACAACGCACCAAAAT	0.403													12	23	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79373445	79373445	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79373445G>A	uc003hlb.2	+	47	7140	c.6700G>A	c.(6700-6702)GAA>AAA	p.E2234K		NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	2233	CSPG 10.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						TGGGCCTACAGAATTGATCTA	0.473													38	2	---	---	---	---	PASS
ANXA3	306	broad.mit.edu	37	4	79475618	79475618	+	5'UTR	SNP	G	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79475618G>T	uc003hld.2	+	2					ANXA3_uc003hle.2_5'UTR|ANXA3_uc010ijk.2_5'UTR	NM_005139	NP_005130	P12429	ANXA3_HUMAN	annexin A3						defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity				0						CAAGGCAAAGGTGGGATATCA	0.348													25	36	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41176763	41176763	+	Nonsense_Mutation	SNP	T	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41176763T>A	uc003jmk.2	-	8	1192	c.982A>T	c.(982-984)AAA>TAA	p.K328*	C6_uc003jml.1_Nonsense_Mutation_p.K328*	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	328	MACPF.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TCTTTAGCTTTCGTTGTGAAG	0.338													24	27	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176687059	176687059	+	Nonsense_Mutation	SNP	C	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176687059C>G	uc003mfr.3	+	14	5174	c.5036C>G	c.(5035-5037)TCA>TGA	p.S1679*	NSD1_uc003mft.3_Nonsense_Mutation_p.S1410*|NSD1_uc003mfs.1_Nonsense_Mutation_p.S1576*|NSD1_uc011dfx.1_Nonsense_Mutation_p.S1327*	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1679					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GCTGCTGGGTCAAAGATCCTT	0.498			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			46	10	---	---	---	---	PASS
NOTCH4	4855	broad.mit.edu	37	6	32190320	32190320	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32190320C>T	uc003obb.2	-	3	558	c.419G>A	c.(418-420)CGC>CAC	p.R140H	NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA|NOTCH4_uc003obc.2_Missense_Mutation_p.R140H	NM_004557	NP_004548	Q99466	NOTC4_HUMAN	notch4 preproprotein	140	EGF-like 3.|Extracellular (Potential).				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						GCACTGTGGGCGGCCCGAGGC	0.642													17	34	---	---	---	---	PASS
RWDD2A	112611	broad.mit.edu	37	6	83904315	83904315	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83904315G>A	uc003pjx.3	+	2	416	c.145G>A	c.(145-147)GAG>AAG	p.E49K	PGM3_uc003pjv.2_5'Flank|PGM3_uc003pjw.2_5'Flank|PGM3_uc011dyz.1_5'Flank|RWDD2A_uc011dza.1_5'UTR	NM_033411	NP_219479	Q9UIY3	RWD2A_HUMAN	RWD domain containing 2A	49	RWD.										0		all_cancers(76;2.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00217)		BRCA - Breast invasive adenocarcinoma(397;0.045)		AGGCACAAGGGAGGCGCTGCC	0.413													27	10	---	---	---	---	PASS
PARK2	5071	broad.mit.edu	37	6	162864488	162864488	+	Missense_Mutation	SNP	A	C	C	rs111356273		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162864488A>C	uc003qtx.3	-	2	159	c.25T>G	c.(25-27)TCC>GCC	p.S9A	PARK2_uc010kkd.2_5'UTR|PARK2_uc003qtw.3_5'UTR|PARK2_uc003qty.3_Missense_Mutation_p.S9A|PARK2_uc003qtz.3_Missense_Mutation_p.S9A|PARK2_uc010kke.1_Missense_Mutation_p.S9A	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1	9	Ubiquitin-like.				aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		CCATGGCTGGAGTTGAACCTG	0.512													35	13	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20685645	20685645	+	5'Flank	SNP	G	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20685645G>T	uc003suw.3	+						ABCB5_uc010kuh.2_Missense_Mutation_p.V289L|ABCB5_uc003suv.3_5'Flank|ABCB5_uc011jyi.1_5'Flank	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5						regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						AGCTTCAAAAGTGTCTCTTGG	0.383													33	56	---	---	---	---	PASS
SRRM3	222183	broad.mit.edu	37	7	75896635	75896635	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75896635G>A	uc010ldi.2	+	11	1099	c.890G>A	c.(889-891)AGC>AAC	p.S297N	SRRM3_uc011kgi.1_5'UTR	NM_001110199	NP_001103669			serine/arginine repetitive matrix 3												0						TCCAGCGGAAGCCGGTCGCCT	0.756													5	9	---	---	---	---	PASS
TRIM56	81844	broad.mit.edu	37	7	100732123	100732123	+	Silent	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100732123C>T	uc003uxq.2	+	3	1761	c.1530C>T	c.(1528-1530)ATC>ATT	p.I510I	TRIM56_uc003uxr.2_Intron	NM_030961	NP_112223	Q9BRZ2	TRI56_HUMAN	tripartite motif-containing 56	510					defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			kidney(1)|central_nervous_system(1)|skin(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)					CCCCCCGGATCACCGGGCTCT	0.652													43	74	---	---	---	---	PASS
CTTNBP2	83992	broad.mit.edu	37	7	117417782	117417782	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117417782C>T	uc003vjf.2	-	8	2653	c.2561G>A	c.(2560-2562)GGT>GAT	p.G854D		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	854	ANK 5.									ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GTCCACATTACCAGTGTCCAC	0.423													22	29	---	---	---	---	PASS
BRAF	673	broad.mit.edu	37	7	140482933	140482933	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140482933G>A	uc003vwc.3	-	10	1263	c.1202C>T	c.(1201-1203)ACC>ATC	p.T401I		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	401					activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	GGCAGGGGGGGTAGCAGACAA	0.438		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				21	30	---	---	---	---	PASS
MTMR9	66036	broad.mit.edu	37	8	11162520	11162520	+	Silent	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11162520G>A	uc003wtm.2	+	4	986	c.588G>A	c.(586-588)GGG>GGA	p.G196G	MTMR9_uc010lrx.2_Silent_p.G89G|MTMR9_uc011kxa.1_Silent_p.G111G	NM_015458	NP_056273	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	196	Myotubularin phosphatase.					cytoplasm	phosphatase activity|protein binding				0			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		AAAAAAATGGGATGGTAAGTG	0.453													17	3	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53092776	53092776	+	Silent	SNP	G	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53092776G>C	uc003xqz.2	-	4	339	c.183C>G	c.(181-183)CCC>CCG	p.P61P	ST18_uc011ldq.1_5'UTR|ST18_uc011ldr.1_Silent_p.P26P|ST18_uc011lds.1_5'UTR|ST18_uc003xra.2_Silent_p.P61P|ST18_uc003xrb.2_Silent_p.P61P|ST18_uc010lyb.2_RNA	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	61						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGTAGTGTCGGGGCTTCATTA	0.517													62	81	---	---	---	---	PASS
PAG1	55824	broad.mit.edu	37	8	81903702	81903702	+	Intron	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81903702G>A	uc003ybz.2	-							NM_018440	NP_060910	Q9NWQ8	PAG1_HUMAN	phosphoprotein associated with glycosphingolipid						epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity				0	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			CAGACGACACGCGCAGGCTCA	0.517													11	21	---	---	---	---	PASS
IMPA1	3612	broad.mit.edu	37	8	82586095	82586095	+	Silent	SNP	T	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82586095T>C	uc003ych.2	-	6	565	c.438A>G	c.(436-438)CTA>CTG	p.L146L	IMPA1_uc011lfq.1_Silent_p.L205L|IMPA1_uc011lfr.1_Silent_p.L146L	NM_005536	NP_005527	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1 isoform	146					inositol phosphate dephosphorylation|phosphatidylinositol biosynthetic process|signal transduction	cytoplasm	inositol-1(or 4)-monophosphatase activity|metal ion binding|protein homodimerization activity			skin(1)	1					Lithium(DB01356)	GTGAAACTTGTAGTTTTTGAC	0.338													38	38	---	---	---	---	PASS
EEF1D	1936	broad.mit.edu	37	8	144663214	144663214	+	Intron	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144663214G>A	uc011lki.1	-						NAPRT1_uc003yym.3_5'Flank|NAPRT1_uc003yyn.3_5'Flank|NAPRT1_uc011lkh.1_5'Flank|NAPRT1_uc003yyo.3_5'Flank|EEF1D_uc003yyp.1_Intron|EEF1D_uc003yyq.1_Intron|EEF1D_uc011lkj.1_Intron|EEF1D_uc003yyr.2_Intron|EEF1D_uc003yyt.2_Intron|EEF1D_uc011lkk.1_Intron|EEF1D_uc003yys.2_Intron|EEF1D_uc003yyv.2_Intron|EEF1D_uc003yyu.2_Intron|EEF1D_uc011lkl.1_Intron	NM_001130057	NP_001123529	P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta						positive regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|signal transducer activity|translation elongation factor activity			ovary(1)|kidney(1)|skin(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			GGCGTGGGGAGAGCATTCACC	0.682													44	43	---	---	---	---	PASS
LYZL1	84569	broad.mit.edu	37	10	29581549	29581549	+	Missense_Mutation	SNP	G	A	A	rs146364281	byFrequency	TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29581549G>A	uc001iul.2	+	3	436	c.379G>A	c.(379-381)GCG>ACG	p.A127T		NM_032517	NP_115906	Q6UWQ5	LYZL1_HUMAN	lysozyme-like 1	81					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Breast(68;0.203)				CAACAGCTTCGCGTGGTGCAG	0.557													31	45	---	---	---	---	PASS
ZNF37A	7587	broad.mit.edu	37	10	38403718	38403718	+	Silent	SNP	C	T	T	rs149074366		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38403718C>T	uc001izk.2	+	6	870	c.51C>T	c.(49-51)TTC>TTT	p.F17F	ZNF37A_uc001izl.2_Silent_p.F17F|ZNF37A_uc001izm.2_Silent_p.F17F	NM_001007094	NP_001007095	P17032	ZN37A_HUMAN	zinc finger protein 37a	17	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)	1						CTGTGGGCTTCACTCAAGAGG	0.478													35	54	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68979626	68979626	+	Missense_Mutation	SNP	G	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68979626G>T	uc009xpn.1	-	6	705	c.582C>A	c.(580-582)GAC>GAA	p.D194E	CTNNA3_uc001jmw.2_Missense_Mutation_p.D194E|CTNNA3_uc001jmx.3_Missense_Mutation_p.D194E|CTNNA3_uc009xpo.1_Missense_Mutation_p.D54E|CTNNA3_uc001jna.2_Missense_Mutation_p.D206E	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	194					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						GAGATTTTAAGTCCTGAGAAG	0.363													24	44	---	---	---	---	PASS
MXI1	4601	broad.mit.edu	37	10	111987978	111987978	+	Silent	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111987978G>A	uc001kza.2	+	2	312	c.105G>A	c.(103-105)CCG>CCA	p.P35P	MXI1_uc001kyy.2_Silent_p.P102P|MXI1_uc001kyz.2_5'UTR|MXI1_uc010qrc.1_Silent_p.P35P|MXI1_uc009xxu.2_Silent_p.P32P|MXI1_uc009xxv.2_RNA	NM_005962	NP_005953	P50539	MXI1_HUMAN	MAX interactor 1 isoform a	35					cytoplasmic sequestering of transcription factor|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription corepressor activity				0		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;1.33e-05)|all cancers(201;0.000277)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CTTCATTCCCGTCCATGCCGA	0.522													32	42	---	---	---	---	PASS
MUC2	4583	broad.mit.edu	37	11	1078304	1078304	+	Silent	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1078304G>A	uc001lsx.1	+	5	618	c.591G>A	c.(589-591)CAG>CAA	p.Q197Q		NM_002457	NP_002448	Q02817	MUC2_HUMAN	mucin 2 precursor	197	VWFD 1.					inner mucus layer|outer mucus layer	protein binding			lung(1)|breast(1)	2		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GGAACATGCAGAAGATCAACC	0.662													41	7	---	---	---	---	PASS
KCNA4	3739	broad.mit.edu	37	11	30034064	30034064	+	Silent	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30034064G>A	uc001msk.2	-	2	1314	c.162C>T	c.(160-162)AGC>AGT	p.S54S		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	54						voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CAGAACCCCCGCTACCTTCGA	0.697													9	51	---	---	---	---	PASS
OR5M10	390167	broad.mit.edu	37	11	56344766	56344766	+	Silent	SNP	C	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56344766C>A	uc001niz.1	-	1	432	c.432G>T	c.(430-432)CTG>CTT	p.L144L		NM_001004741	NP_001004741	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M,	144	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GCACAGTGACCAGAGAGATGC	0.438													30	56	---	---	---	---	PASS
TMEM132A	54972	broad.mit.edu	37	11	60703567	60703567	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60703567C>T	uc001nqj.2	+	11	2453	c.2260C>T	c.(2260-2262)CGT>TGT	p.R754C	TMEM132A_uc001nqi.2_Missense_Mutation_p.R755C|TMEM132A_uc001nqm.2_5'UTR	NM_178031	NP_821174	Q24JP5	T132A_HUMAN	transmembrane protein 132A isoform b	754	Binds to HSPA5/GRP78 (By similarity).|Confers cellular localization similar to full-length form (By similarity).|Extracellular (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				skin(1)	1						GGGCCGCCACCGTGTGCCTCT	0.756													7	15	---	---	---	---	PASS
CTTN	2017	broad.mit.edu	37	11	70279767	70279767	+	Missense_Mutation	SNP	G	A	A	rs144726386		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70279767G>A	uc001opv.3	+	17	1665	c.1459G>A	c.(1459-1461)GAT>AAT	p.D487N	CTTN_uc001opu.2_Missense_Mutation_p.D450N|CTTN_uc001opw.3_Missense_Mutation_p.D450N|CTTN_uc010rqm.1_Missense_Mutation_p.D171N|CTTN_uc001opx.2_Missense_Mutation_p.D171N	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a	487						cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		CAGCACCTACGATGAGTACGA	0.537													95	307	---	---	---	---	PASS
PHC1	1911	broad.mit.edu	37	12	9089894	9089894	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9089894G>A	uc001qvd.2	+	13	2756	c.2600G>A	c.(2599-2601)CGT>CAT	p.R867H	PHC1_uc001qve.2_Missense_Mutation_p.R867H	NM_004426	NP_004417	P78364	PHC1_HUMAN	polyhomeotic 1-like	867					multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|breast(1)	2						GACATTGCCCGTGCCAAGATT	0.522													12	2	---	---	---	---	PASS
STRAP	11171	broad.mit.edu	37	12	16043528	16043528	+	Intron	SNP	C	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16043528C>G	uc001rdc.3	+						STRAP_uc010shw.1_Intron|STRAP_uc001rdd.3_Intron	NM_007178	NP_009109	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated						mRNA processing|RNA splicing	cell junction|mitochondrion|spliceosomal complex	identical protein binding			skin(1)	1		Hepatocellular(102;0.121)				TTTGTGTTTTCAGGATAGTAA	0.308													31	9	---	---	---	---	PASS
PRPF40B	25766	broad.mit.edu	37	12	50027802	50027802	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50027802G>A	uc001rur.1	+	9	737	c.673G>A	c.(673-675)GAT>AAT	p.D225N	PRPF40B_uc001rup.1_Missense_Mutation_p.D247N|PRPF40B_uc001ruq.1_Missense_Mutation_p.D219N|PRPF40B_uc001rus.1_Missense_Mutation_p.D168N	NM_001031698	NP_001026868	Q6NWY9	PR40B_HUMAN	Huntingtin interacting protein C isoform 1	225					mRNA processing|RNA splicing	nuclear speck				skin(2)|ovary(1)|pancreas(1)|kidney(1)	5						TGGGAGTGAAGATTGTGATGT	0.677													41	38	---	---	---	---	PASS
ZNF385A	25946	broad.mit.edu	37	12	54764853	54764853	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54764853G>A	uc001sfw.1	-	5	815	c.632C>T	c.(631-633)GCC>GTC	p.A211V	ZNF385A_uc001sfv.1_Missense_Mutation_p.A192V|ZNF385A_uc009zno.1_RNA|ZNF385A_uc010sov.1_Missense_Mutation_p.A130V|ZNF385A_uc001sfx.1_Missense_Mutation_p.A211V|ZNF385A_uc001sfy.3_Missense_Mutation_p.A231V|ZNF385A_uc001sfz.3_Missense_Mutation_p.A150V	NM_015481	NP_056296	Q96PM9	Z385A_HUMAN	zinc finger protein 385A isoform c	211					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1						CCCACTTCGGGCCTCCAGAAT	0.602													50	70	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57559991	57559991	+	Silent	SNP	A	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57559991A>G	uc001snd.2	+	17	3262	c.2796A>G	c.(2794-2796)TCA>TCG	p.S932S	LRP1_uc009zph.1_5'Flank|LRP1_uc009zpi.1_5'Flank	NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	932	Extracellular (Potential).|LDL-receptor class A 4.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCACTTGTTCAGGTGTGGAGC	0.488													2	6	---	---	---	---	PASS
GLT1D1	144423	broad.mit.edu	37	12	129467532	129467532	+	Missense_Mutation	SNP	T	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129467532T>A	uc010tbh.1	+	13	962	c.953T>A	c.(952-954)GTA>GAA	p.V318E	GLT1D1_uc001uhx.1_Missense_Mutation_p.V233E|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	313					biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		AAGGAAATCGTAGTGAACGGA	0.428													56	87	---	---	---	---	PASS
PCDH9	5101	broad.mit.edu	37	13	67800080	67800080	+	Silent	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67800080G>A	uc001vik.2	-	2	3185	c.2493C>T	c.(2491-2493)TTC>TTT	p.F831F	PCDH9_uc001vil.2_Silent_p.F831F|PCDH9_uc010thl.1_Silent_p.F831F|PCDH9_uc001vin.3_Silent_p.F831F	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	831	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GAACGGTGACGAAGATCACAA	0.512													53	19	---	---	---	---	PASS
PARP2	10038	broad.mit.edu	37	14	20818765	20818765	+	Missense_Mutation	SNP	G	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20818765G>C	uc001vxc.2	+	5	472	c.444G>C	c.(442-444)TGG>TGC	p.W148C	PARP2_uc001vxd.2_Missense_Mutation_p.W135C|PARP2_uc001vxb.1_Missense_Mutation_p.W148C	NM_005484	NP_005475	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase family, member 2	148					protein ADP-ribosylation	nucleolus|nucleoplasm	DNA binding|NAD+ ADP-ribosyltransferase activity			ovary(1)|pancreas(1)	2	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		TCAGTGTTTGGATGAGATGGG	0.408								Direct_reversal_of_damage|PARP_enzymes_that_bind_to_DNA					46	45	---	---	---	---	PASS
PPP4R4	57718	broad.mit.edu	37	14	94725173	94725173	+	Intron	SNP	C	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94725173C>G	uc001ycs.1	+							NM_058237	NP_478144	Q6NUP7	PP4R4_HUMAN	HEAT-like repeat-containing protein isoform 1							cytoplasm|protein serine/threonine phosphatase complex	protein binding			skin(3)|upper_aerodigestive_tract(1)	4						TAAGTATACTCTCTTTACCTT	0.149													11	30	---	---	---	---	PASS
TRIM69	140691	broad.mit.edu	37	15	45047237	45047237	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45047237G>A	uc001zuf.2	+	3	1041	c.146G>A	c.(145-147)CGA>CAA	p.R49Q	TRIM69_uc001zui.1_Intron|TRIM69_uc010bdy.1_Intron|TRIM69_uc001zug.1_Missense_Mutation_p.R49Q|TRIM69_uc001zuh.1_Intron	NM_182985	NP_892030	Q86WT6	TRI69_HUMAN	tripartite motif-containing 69 isoform a	49	Necessary for nuclear localization (By similarity).|RING-type.				apoptosis	nuclear speck	zinc ion binding				0		all_cancers(109;2.47e-13)|all_epithelial(112;2.84e-11)|Lung NSC(122;2.23e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;5.5e-19)|GBM - Glioblastoma multiforme(94;1.07e-06)|Colorectal(105;0.138)|COAD - Colon adenocarcinoma(120;0.141)		GATTGGTTCCGAGACCCACTG	0.448													56	74	---	---	---	---	PASS
TBC1D2B	23102	broad.mit.edu	37	15	78290635	78290635	+	Missense_Mutation	SNP	C	T	T	rs117285325	by1000genomes	TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78290635C>T	uc002bcy.3	-	13	2759	c.2759G>A	c.(2758-2760)CGA>CAA	p.R920Q	TBC1D2B_uc010bla.2_Missense_Mutation_p.D903N	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a	920						intracellular	protein binding|Rab GTPase activator activity	p.D903N(1)		ovary(1)|large_intestine(1)|breast(1)	3						GTAGGCGCGTCGGTTCCGGAT	0.617													3	9	---	---	---	---	PASS
KIAA1024	23251	broad.mit.edu	37	15	79760682	79760682	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79760682G>A	uc002bew.1	+	4	2782	c.2707G>A	c.(2707-2709)GTC>ATC	p.V903I	KIAA1024_uc010unk.1_3'UTR	NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	903	Helical; (Potential).					integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4						GGCATGCACCGTCATCCTCGT	0.463													13	13	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1397928	1397928	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1397928G>A	uc002clk.1	+	32	3164	c.3164G>A	c.(3163-3165)GGC>GAC	p.G1055D	BAIAP3_uc002clj.2_Missense_Mutation_p.G1037D|BAIAP3_uc010uuz.1_Missense_Mutation_p.G1020D|BAIAP3_uc010uva.1_Missense_Mutation_p.G992D|BAIAP3_uc010uvc.1_Missense_Mutation_p.G984D	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	1055	C2 2.				G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				GTGGAGCTGGGCCCACCGCAT	0.627													44	65	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3786138	3786138	+	Missense_Mutation	SNP	C	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3786138C>G	uc002cvv.2	-	28	4831	c.4627G>C	c.(4627-4629)GAT>CAT	p.D1543H	CREBBP_uc002cvw.2_Missense_Mutation_p.D1505H	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1543	Interaction with TRERF1.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGCCAGAAATCACCTTCAAAA	0.463			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				28	43	---	---	---	---	PASS
VWA3A	146177	broad.mit.edu	37	16	22126767	22126767	+	Missense_Mutation	SNP	T	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22126767T>G	uc010vbq.1	+	9	885	c.789T>G	c.(787-789)GAT>GAG	p.D263E	VWA3A_uc010bxc.2_Missense_Mutation_p.D250E	NM_173615	NP_775886	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	263						extracellular region				skin(1)	1				GBM - Glioblastoma multiforme(48;0.0439)		AGGGACTGGATTCCCTGGTGG	0.478													3	7	---	---	---	---	PASS
CES7	221223	broad.mit.edu	37	16	55886941	55886941	+	Splice_Site	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55886941C>T	uc002eip.2	-	10	1275	c.1126_splice	c.e10-1	p.H376_splice	CES7_uc002eio.2_Splice_Site_p.H376_splice|CES7_uc002eiq.2_Splice_Site_p.H137_splice|CES7_uc002eir.2_Splice_Site_p.H270_splice	NM_001143685	NP_001137157	Q6NT32	EST5A_HUMAN	carboxylesterase 7 isoform 1							extracellular region	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.229)|Epithelial(162;0.231)		GCGGGATGTGCTGTAAAAATA	0.368													27	6	---	---	---	---	PASS
AARS	16	broad.mit.edu	37	16	70301613	70301613	+	Missense_Mutation	SNP	G	A	A	rs147580372		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70301613G>A	uc002eyn.1	-	9	1281	c.1171C>T	c.(1171-1173)CGC>TGC	p.R391C	AARS_uc010vlu.1_Missense_Mutation_p.R221C	NM_001605	NP_001596	P49588	SYAC_HUMAN	alanyl-tRNA synthetase	391					alanyl-tRNA aminoacylation|tRNA processing	cytosol|soluble fraction	alanine-tRNA ligase activity|ATP binding|metal ion binding|tRNA binding			pancreas(1)	1		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)	L-Alanine(DB00160)	TCCAGGATGCGACGCCCTCTG	0.507											OREG0023913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	25	39	---	---	---	---	PASS
HPR	3250	broad.mit.edu	37	16	72107831	72107831	+	Missense_Mutation	SNP	C	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72107831C>A	uc002fby.2	+	2	76	c.46C>A	c.(46-48)CAG>AAG	p.Q16K	TXNL4B_uc010cgl.2_Intron	NM_020995	NP_066275	P00739	HPTR_HUMAN	haptoglobin-related protein precursor	16					proteolysis	spherical high-density lipoprotein particle	hemoglobin binding|serine-type endopeptidase activity			central_nervous_system(1)	1		Ovarian(137;0.125)				CTGGGGACGACAGCTTTTTGC	0.527													82	112	---	---	---	---	PASS
ANKFY1	51479	broad.mit.edu	37	17	4098307	4098307	+	Silent	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4098307G>A	uc002fxq.1	-	10	1376	c.1338C>T	c.(1336-1338)CGC>CGT	p.R446R	ANKFY1_uc002fxn.2_Silent_p.R488R|ANKFY1_uc002fxo.2_Silent_p.R446R|ANKFY1_uc002fxp.2_Silent_p.R445R|ANKFY1_uc010ckp.2_Silent_p.R387R|ANKFY1_uc002fxr.2_Silent_p.R446R	NM_016376	NP_057460	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	446						endosome membrane	metal ion binding|protein binding			ovary(2)|skin(1)	3						TGTGGCTGCCGCGCTGGATGA	0.572													22	6	---	---	---	---	PASS
ENO3	2027	broad.mit.edu	37	17	4859441	4859441	+	Intron	SNP	G	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4859441G>C	uc002gab.3	+						ENO3_uc002gac.3_Intron|ENO3_uc010vss.1_Intron|ENO3_uc010vst.1_Intron	NM_053013	NP_443739	P13929	ENOB_HUMAN	enolase 3						gluconeogenesis|glycolysis	phosphopyruvate hydratase complex	magnesium ion binding|phosphopyruvate hydratase activity			ovary(1)	1						ATCCAGGCGTGAGTGCCTCCT	0.592													20	4	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8253378	8253378	+	Missense_Mutation	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8253378G>A	uc002knn.3	+	17	3184	c.2681G>A	c.(2680-2682)TGT>TAT	p.C894Y	PTPRM_uc010dkv.2_Missense_Mutation_p.C907Y|PTPRM_uc010wzl.1_Missense_Mutation_p.C681Y	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	894	Cytoplasmic (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				CAGATGAAGTGTGCGGAGGGC	0.587													4	2	---	---	---	---	PASS
PIK3C3	5289	broad.mit.edu	37	18	39593447	39593447	+	Missense_Mutation	SNP	A	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39593447A>C	uc002lap.2	+	11	1270	c.1212A>C	c.(1210-1212)AAA>AAC	p.K404N	PIK3C3_uc010xcl.1_Missense_Mutation_p.K341N	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN	catalytic phosphatidylinositol 3-kinase 3	404					cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding			lung(8)|ovary(1)|breast(1)	10						AGGCTCTCAAATATGAAAATT	0.308										TSP Lung(28;0.18)			41	13	---	---	---	---	PASS
ZNF358	140467	broad.mit.edu	37	19	7584342	7584342	+	Missense_Mutation	SNP	G	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7584342G>T	uc002mgn.2	+	2	384	c.214G>T	c.(214-216)GAC>TAC	p.D72Y		NM_018083	NP_060553	Q9NW07	ZN358_HUMAN	zinc finger protein 358	72					embryonic forelimb morphogenesis|neural tube development|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						GGAGGATCTGGACCCCGACGC	0.597													29	50	---	---	---	---	PASS
BRD4	23476	broad.mit.edu	37	19	15355409	15355409	+	Missense_Mutation	SNP	G	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15355409G>C	uc002nar.2	-	13	2436	c.2214C>G	c.(2212-2214)CAC>CAG	p.H738Q		NM_058243	NP_490597	O60885	BRD4_HUMAN	bromodomain-containing protein 4 isoform long	738	Poly-His.				interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GGTGATGATGGTGCTGcagac	0.368			T	NUT|C15orf55	lethal midline carcinoma of young people								31	32	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17108023	17108023	+	Silent	SNP	G	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17108023G>A	uc002nfb.2	-	11	1166	c.1134C>T	c.(1132-1134)GTC>GTT	p.V378V		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	331						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						CATCGAACGCGACCTGCTGGC	0.647													14	14	---	---	---	---	PASS
ZNF43	7594	broad.mit.edu	37	19	21991572	21991572	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21991572C>T	uc002nqj.2	-	4	1397	c.1267G>A	c.(1267-1269)GAG>AAG	p.E423K	ZNF43_uc010ecv.2_Missense_Mutation_p.E417K|ZNF43_uc002nql.2_Missense_Mutation_p.E417K|ZNF43_uc002nqm.2_Missense_Mutation_p.E417K|ZNF43_uc002nqk.2_Missense_Mutation_p.E353K	NM_003423	NP_003414	P17038	ZNF43_HUMAN	zinc finger protein 43	423					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		TAGGGTTTCTCTCCAGTATGA	0.378													6	65	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23542271	23542271	+	Silent	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23542271C>T	uc002nre.2	-	4	3623	c.3510G>A	c.(3508-3510)GCG>GCA	p.A1170A	ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Silent_p.A1138A	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	1170						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				gtgatccgcccgcctcggcct	0.100													9	9	---	---	---	---	PASS
FBXO27	126433	broad.mit.edu	37	19	39521915	39521915	+	Missense_Mutation	SNP	A	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39521915A>C	uc002okh.2	-	3	492	c.410T>G	c.(409-411)GTG>GGG	p.V137G		NM_178820	NP_849142	Q8NI29	FBX27_HUMAN	F-box protein 27	137	FBA.				protein catabolic process	SCF ubiquitin ligase complex	glycoprotein binding			ovary(1)	1	all_cancers(60;3.79e-07)|all_lung(34;1.26e-07)|Lung NSC(34;1.46e-07)|all_epithelial(25;4.69e-07)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TTCCTCCACCACCCAGCCGTC	0.577													14	65	---	---	---	---	PASS
MEGF8	1954	broad.mit.edu	37	19	42872634	42872634	+	Missense_Mutation	SNP	C	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42872634C>G	uc002otl.3	+	35	6735	c.6100C>G	c.(6100-6102)CGA>GGA	p.R2034G	MEGF8_uc002otm.3_Missense_Mutation_p.R1642G|MEGF8_uc002otn.3_5'Flank	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2101	Extracellular (Potential).|PSI 6.					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				CCTGCCCCTGCGATGTATGGC	0.622													3	7	---	---	---	---	PASS
TEAD2	8463	broad.mit.edu	37	19	49850490	49850490	+	Missense_Mutation	SNP	T	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49850490T>C	uc002pnj.2	-	9	957	c.866A>G	c.(865-867)TAT>TGT	p.Y289C	TEAD2_uc002png.2_Missense_Mutation_p.Y292C|TEAD2_uc002pnh.2_Missense_Mutation_p.Y293C|TEAD2_uc002pni.2_Missense_Mutation_p.Y292C|TEAD2_uc010yao.1_Missense_Mutation_p.Y161C|TEAD2_uc010emw.2_Missense_Mutation_p.Y292C	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2	289	Transcriptional activation (Potential).				hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		GCCACGATCATATAGCTCTCG	0.572													84	158	---	---	---	---	PASS
PAX1	5075	broad.mit.edu	37	20	21687618	21687618	+	Missense_Mutation	SNP	G	C	C			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21687618G>C	uc002wsj.2	+	2	883	c.829G>C	c.(829-831)GCG>CCG	p.A277P	PAX1_uc010zsl.1_Missense_Mutation_p.A277P|PAX1_uc010zsm.1_Missense_Mutation_p.A253P	NM_006192	NP_006183	P15863	PAX1_HUMAN	paired box 1	277					regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding			upper_aerodigestive_tract(1)|kidney(1)	2						CCCGGGCACGGCGGGCCACGT	0.667													17	4	---	---	---	---	PASS
CLTCL1	8218	broad.mit.edu	37	22	19221125	19221125	+	Missense_Mutation	SNP	C	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19221125C>A	uc002zpb.2	-	8	1263	c.1188G>T	c.(1186-1188)GAG>GAT	p.E396D	CLTCL1_uc011agv.1_Missense_Mutation_p.E396D|CLTCL1_uc011agw.1_Missense_Mutation_p.E396D	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1	396	Globular terminal domain.				anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)					TCTGGACCGTCTCTCTGGTAC	0.458			T	?	ALCL								24	27	---	---	---	---	PASS
PRPS2	5634	broad.mit.edu	37	X	12828219	12828219	+	Missense_Mutation	SNP	T	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12828219T>A	uc004cvb.2	+	4	608	c.484T>A	c.(484-486)TGG>AGG	p.W162R	PRPS2_uc004cva.2_Missense_Mutation_p.W165R|PRPS2_uc010nec.2_Missense_Mutation_p.W98R	NM_002765	NP_002756	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	162					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity				0						CATTGCCGAGTGGAAGAACTG	0.473													32	54	---	---	---	---	PASS
MAP3K15	389840	broad.mit.edu	37	X	19378902	19378902	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19378902C>T	uc004czk.1	-	30	3969	c.2332G>A	c.(2332-2334)GCT>ACT	p.A778T	MAP3K15_uc004czj.1_Missense_Mutation_p.A738T|PDHA1_uc004czg.3_3'UTR|PDHA1_uc004czh.3_3'UTR|PDHA1_uc011mjc.1_3'UTR|PDHA1_uc011mjd.1_3'UTR|PDHA1_uc010nfk.2_3'UTR|PDHA1_uc010nfl.2_3'UTR|MAP3K15_uc004czi.1_Missense_Mutation_p.A237T	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase	1303							ATP binding|MAP kinase kinase kinase activity|metal ion binding	p.A778S(1)		ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					GCCTCCTGAGCCCTTCTGTAC	0.512													26	37	---	---	---	---	PASS
CXorf22	170063	broad.mit.edu	37	X	35974251	35974251	+	Missense_Mutation	SNP	A	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35974251A>G	uc004ddj.2	+	8	1407	c.1348A>G	c.(1348-1350)AAA>GAA	p.K450E	CXorf22_uc010ngv.2_RNA	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063	450										large_intestine(1)|lung(1)|ovary(1)	3						GTACCACTTTAAAAAAACTGC	0.358													29	38	---	---	---	---	PASS
P2RY4	5030	broad.mit.edu	37	X	69479287	69479287	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69479287C>T	uc004dxz.1	-	1	368	c.188G>A	c.(187-189)CGC>CAC	p.R63H		NM_002565	NP_002556	P51582	P2RY4_HUMAN	pyrimidinergic receptor P2Y4	63	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)	1						GGGTCGGAGGCGGAAGATGAA	0.537													12	18	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91873845	91873845	+	Missense_Mutation	SNP	C	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91873845C>T	uc004efk.1	+	7	4795	c.3950C>T	c.(3949-3951)TCA>TTA	p.S1317L	PCDH11X_uc004efl.1_Missense_Mutation_p.S1307L|PCDH11X_uc004efo.1_Missense_Mutation_p.S1280L|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Missense_Mutation_p.S1309L|PCDH11X_uc004efn.1_Missense_Mutation_p.S1299L	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	1317	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						AGTGATGATTCAATTAAAGTC	0.463													66	127	---	---	---	---	PASS
FAM199X	139231	broad.mit.edu	37	X	103430825	103430825	+	Missense_Mutation	SNP	C	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103430825C>G	uc004elw.2	+	3	662	c.496C>G	c.(496-498)CTT>GTT	p.L166V	FAM199X_uc004elx.2_5'UTR	NM_207318	NP_997201	Q6PEV8	F199X_HUMAN	hypothetical protein LOC139231	166										ovary(1)	1						ACCTTGCCTGCTTCCTAAAAA	0.398													59	97	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123525989	123525989	+	Missense_Mutation	SNP	A	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123525989A>T	uc004euj.2	-	27	5644	c.5580T>A	c.(5578-5580)AAT>AAA	p.N1860K	ODZ1_uc011muj.1_Missense_Mutation_p.N1866K|ODZ1_uc010nqy.2_Missense_Mutation_p.N1867K	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1860	Extracellular (Potential).|YD 6.				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						CCATTTTTTCATTCCACGTTC	0.393													39	71	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135428590	135428590	+	Missense_Mutation	SNP	A	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135428590A>T	uc004ezu.1	+	6	3016	c.2725A>T	c.(2725-2727)AGT>TGT	p.S909C	GPR112_uc010nsb.1_Missense_Mutation_p.S704C|GPR112_uc010nsc.1_Missense_Mutation_p.S676C	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	909	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					GGTGAGAGAAAGTTGGCTTTT	0.378													88	142	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138680667	138680667	+	Intron	SNP	A	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138680667A>G	uc004fau.2	-						MCF2_uc004fav.2_Intron|MCF2_uc011mwl.1_Intron|MCF2_uc010nsh.1_Intron|MCF2_uc011mwm.1_Intron|MCF2_uc011mwn.1_Intron|MCF2_uc004faw.2_Intron|MCF2_uc011mwo.1_Intron	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					CCTGTCATTAAAAGATAAATA	0.308													12	26	---	---	---	---	PASS
TARDBP	23435	broad.mit.edu	37	1	11080808	11080808	+	Intron	DEL	A	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11080808delA	uc001art.2	+						TARDBP_uc010oap.1_Intron	NM_007375	NP_031401	Q13148	TADBP_HUMAN	TAR DNA binding protein						3'-UTR-mediated mRNA stabilization|cell death|mRNA processing|negative regulation by host of viral transcription|RNA splicing|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|mRNA 3'-UTR binding|nucleotide binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		attaaaatacaaaaaaaaaaa	0.000													3	3	---	---	---	---	
FAM131C	348487	broad.mit.edu	37	1	16386305	16386306	+	Intron	INS	-	C	C	rs143272992		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16386305_16386306insC	uc001axz.3	-						FAM131C_uc010obz.1_Intron	NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487												0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		AGTGATCTGGGCCCCCAAGGAC	0.599													3	5	---	---	---	---	
C1orf135	79000	broad.mit.edu	37	1	26186960	26186960	+	5'Flank	DEL	T	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26186960delT	uc001bkw.1	-							NM_024037	NP_076942	Q9H7T9	CA135_HUMAN	aurora A-binding protein												0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00521)|all_lung(284;0.00764)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.117)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.28e-25)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000787)|BRCA - Breast invasive adenocarcinoma(304;0.00102)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		AATTTTGTAATTTTTTTTTTT	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	78240627	78240627	+	IGR	DEL	T	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78240627delT								USP33 (15090 upstream) : FAM73A (4682 downstream)																							Attcttaacctttttttttta	0.264													3	5	---	---	---	---	
ABCA4	24	broad.mit.edu	37	1	94473030	94473034	+	Intron	DEL	GTTGG	-	-	rs144985439		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94473030_94473034delGTTGG	uc001dqh.2	-						ABCA4_uc001dqi.1_Intron	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4						phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		GGGTCTATGTGTTGGGCTTTTTGGG	0.463													4	4	---	---	---	---	
DAP3	7818	broad.mit.edu	37	1	155701653	155701653	+	Intron	DEL	A	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155701653delA	uc001flq.2	+						DAP3_uc001flr.2_Intron|DAP3_uc001fls.2_Intron|DAP3_uc010pgl.1_Intron|DAP3_uc001flt.2_Intron|DAP3_uc001flu.2_Intron|DAP3_uc010pgm.1_Intron	NM_033657	NP_387506	P51398	RT29_HUMAN	death-associated protein 3						induction of apoptosis by extracellular signals	mitochondrial ribosome|nucleolus|small ribosomal subunit	protein binding			ovary(1)	1	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CCCAAGAAAGAAAAAAAAAAT	0.368													4	2	---	---	---	---	
MFSD4	148808	broad.mit.edu	37	1	205561496	205561496	+	Intron	DEL	C	-	-	rs34928918		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205561496delC	uc001hcv.3	+						MFSD4_uc010prk.1_Intron|MFSD4_uc010prl.1_Intron|MFSD4_uc010prm.1_Intron|MFSD4_uc009xbn.2_Intron	NM_181644	NP_857595	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane				skin(2)|central_nervous_system(1)	3	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			TCTCTGTGCTCTTTTTTTTTT	0.348													7	5	---	---	---	---	
EDARADD	128178	broad.mit.edu	37	1	236572369	236572369	+	Intron	DEL	A	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236572369delA	uc001hxu.1	+						EDARADD_uc001hxv.1_Intron	NM_145861	NP_665860	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain isoform A						cell differentiation|signal transduction	cytoplasm					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			cctatttcttaaaaaaaaaaa	0.144													4	2	---	---	---	---	
IL18R1	8809	broad.mit.edu	37	2	103006447	103006451	+	Intron	DEL	ACGTG	-	-	rs6749014	by1000genomes	TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103006447_103006451delACGTG	uc002tbw.3	+						IL18R1_uc010ywc.1_Intron|IL18R1_uc010ywd.1_Intron|IL18R1_uc010fiy.2_Intron	NM_003855	NP_003846	Q13478	IL18R_HUMAN	interleukin 18 receptor 1 precursor						innate immune response	integral to membrane|plasma membrane	interleukin-1 receptor activity			ovary(2)|pancreas(1)	3						ATGGACAAGCACGTGATGATGGACA	0.434													13	7	---	---	---	---	
CCDC138	165055	broad.mit.edu	37	2	109405179	109405180	+	Intron	INS	-	A	A			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109405179_109405180insA	uc002ten.1	+						CCDC138_uc002teo.1_Intron|CCDC138_uc002tep.1_Intron|CCDC138_uc010fjm.1_Intron	NM_144978	NP_659415	Q96M89	CC138_HUMAN	coiled-coil domain containing 138												0						ccgtctcaaagaaaaaaaaaga	0.114													4	2	---	---	---	---	
RBM45	129831	broad.mit.edu	37	2	178982627	178982653	+	Intron	DEL	ATATTTGCAAATACAAATATGCAATAT	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178982627_178982653delATATTTGCAAATACAAATATGCAATAT	uc002ulv.2	+							NM_152945	NP_694453	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45						cell differentiation|nervous system development	cytoplasm|nucleus	nucleotide binding|RNA binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			tgaaataagcataTTTGCAAATACAAATATGCAATATCTGCATATTT	0.154													2	5	---	---	---	---	
GOLGA4	2803	broad.mit.edu	37	3	37293116	37293116	+	Intron	DEL	C	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37293116delC	uc003cgv.2	+						GOLGA4_uc010hgr.1_Intron|GOLGA4_uc003cgw.2_Intron|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgu.1_Intron	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4						Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						CACAATTGGTCTTTTTTTTTT	0.184													5	3	---	---	---	---	
MAGEF1	64110	broad.mit.edu	37	3	184430794	184430797	+	5'Flank	DEL	TTCT	-	-	rs9683253	by1000genomes	TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184430794_184430797delTTCT	uc003fpa.2	-							NM_022149	NP_071432	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1											ovary(1)	1	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			ccttccttccttctttccttcctt	0.000													4	2	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54325445	54325446	+	Intron	DEL	TT	-	-	rs143855228		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54325445_54325446delTT	uc003haa.2	+						FIP1L1_uc003gzy.2_Intron|FIP1L1_uc011bzu.1_Intron|FIP1L1_uc003gzz.2_Intron|FIP1L1_uc003hab.2_Intron|FIP1L1_uc003hac.2_Intron|FIP1L1_uc010ign.2_Intron|FIP1L1_uc003had.2_Intron|FIP1L1_uc003hae.2_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	AGAACACACCtttttttttttt	0.307			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57500223	57500223	+	IGR	DEL	A	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57500223delA								ARL9 (110165 upstream) : HOPX (13931 downstream)																							ccctccaaccaaaaaaaaaaG	0.229													4	3	---	---	---	---	
EDNRA	1909	broad.mit.edu	37	4	148453478	148453478	+	Intron	DEL	A	-	-	rs34658974		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148453478delA	uc003iky.2	+						EDNRA_uc011cid.1_Intron|EDNRA_uc010ipe.1_Intron|EDNRA_uc010ipf.1_Intron|EDNRA_uc010ipg.1_Intron	NM_001957	NP_001948	P25101	EDNRA_HUMAN	endothelin receptor type A isoform a precursor						activation of adenylate cyclase activity|artery smooth muscle contraction|cell proliferation|glucose transport|respiratory gaseous exchange	integral to plasma membrane	endothelin-A receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)|breast(1)	2	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Bosentan(DB00559)	attttgcctcaaaaaaaaaaa	0.144													6	4	---	---	---	---	
PBX2	5089	broad.mit.edu	37	6	32157697	32157697	+	5'UTR	DEL	G	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32157697delG	uc003oav.1	-	1					PBX2_uc003oaw.2_5'UTR	NM_002586	NP_002577	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2								transcription factor binding			ovary(1)	1						GTCCATAGCTGGGGGGGGGCC	0.602													3	3	---	---	---	---	
COL28A1	340267	broad.mit.edu	37	7	7413336	7413337	+	Intron	INS	-	T	T	rs35277875		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7413336_7413337insT	uc003src.1	-						COL28A1_uc011jxe.1_Intron	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor						cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		ATTCTGGtttcttttttttttt	0.208													6	3	---	---	---	---	
HOXA5	3202	broad.mit.edu	37	7	27185066	27185075	+	5'Flank	DEL	GTTTTGTTTT	-	-	rs70994631		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27185066_27185075delGTTTTGTTTT	uc003syn.1	-						uc003syp.1_5'Flank	NM_019102	NP_061975	P20719	HXA5_HUMAN	homeobox A5						negative regulation of angiogenesis|negative regulation of erythrocyte differentiation|positive regulation of apoptosis|positive regulation of myeloid cell differentiation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGTGTGTGAGgttttgttttgttttgtttt	0.467													6	7	---	---	---	---	
PPP2R2A	5520	broad.mit.edu	37	8	25277141	25277142	+	Intron	INS	-	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25277141_25277142insT	uc003xek.2	+						GNRH1_uc003xem.3_Intron|GNRH1_uc003xen.3_Intron	NM_002717	NP_002708	P63151	2ABA_HUMAN	alpha isoform of regulatory subunit B55, protein						protein dephosphorylation|signal transduction	protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity|protein serine/threonine phosphatase activity			ovary(1)|kidney(1)	2		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		tgtttttctggttttttttttt	0.149													4	3	---	---	---	---	
ABL1	25	broad.mit.edu	37	9	133753889	133753891	+	In_Frame_Del	DEL	AGA	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133753889_133753891delAGA	uc004bzw.2	+	8	1361_1363	c.1358_1360delAGA	c.(1357-1362)GAGAAG>GAG	p.K454del	ABL1_uc004bzv.2_In_Frame_Del_p.K473del	NM_005157	NP_005148	P00519	ABL1_HUMAN	c-abl oncogene 1, receptor tyrosine kinase	454	Protein kinase.				actin cytoskeleton organization|axon guidance|blood coagulation|cell adhesion|DNA damage induced protein phosphorylation|DNA damage response, signal transduction resulting in induction of apoptosis|mismatch repair|muscle cell differentiation|negative regulation of protein serine/threonine kinase activity|peptidyl-tyrosine phosphorylation|positive regulation of muscle cell differentiation|positive regulation of oxidoreductase activity|regulation of transcription involved in S phase of mitotic cell cycle	cytoskeleton|cytosol|nuclear membrane|nucleolus|perinuclear region of cytoplasm	ATP binding|DNA binding|magnesium ion binding|manganese ion binding|mitogen-activated protein kinase binding|non-membrane spanning protein tyrosine kinase activity|proline-rich region binding|protein C-terminus binding|SH3 domain binding			haematopoietic_and_lymphoid_tissue(807)|lung(5)|stomach(2)|central_nervous_system(1)|breast(1)|skin(1)	817		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Dasatinib(DB01254)|Imatinib(DB00619)	GAGCTGCTAGAGAAGGACTACCG	0.507			T|Mis	BCR|ETV6|NUP214	CML|ALL|T-ALL								169	78	---	---	---	---	
TET1	80312	broad.mit.edu	37	10	70392592	70392593	+	Intron	INS	-	A	A	rs34118781		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70392592_70392593insA	uc001jok.3	+							NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6						DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						GTTTAAGTTGTaaaaaaaaaaa	0.262													6	3	---	---	---	---	
TCTN3	26123	broad.mit.edu	37	10	97424226	97424226	+	Intron	DEL	A	-	-	rs71954790		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97424226delA	uc001klb.3	-						TCTN3_uc001kla.3_Intron|TCTN3_uc010qoi.1_Intron	NM_015631	NP_056446	Q6NUS6	TECT3_HUMAN	tectonic 3 isoform a precursor						apoptosis	integral to membrane					0		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		AGACACAAGGAAATGAATATC	0.383													5	3	---	---	---	---	
TRPM5	29850	broad.mit.edu	37	11	2428308	2428337	+	Intron	DEL	CTCGGCCTCACCCAGGTGCTCCCGCTTGTG	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2428308_2428337delCTCGGCCTCACCCAGGTGCTCCCGCTTGTG	uc001lwm.3	-						TRPM5_uc010qxl.1_Intron|TRPM5_uc009ydn.2_Intron	NM_014555	NP_055370	Q9NZQ8	TRPM5_HUMAN	transient receptor potential cation channel,							integral to membrane|plasma membrane	receptor activity|voltage-gated ion channel activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		GACCCGCCACCTCGGCCTCACCCAGGTGCTCCCGCTTGTGCTCGGCCTCA	0.696													4	2	---	---	---	---	
DDB2	1643	broad.mit.edu	37	11	47237784	47237789	+	Intron	DEL	AGAGAT	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47237784_47237789delAGAGAT	uc001neb.2	+						DDB2_uc001nec.2_Intron|DDB2_uc009yli.1_Intron|DDB2_uc001ned.2_Intron|DDB2_uc001nee.2_Intron|DDB2_uc001nef.2_5'UTR|DDB2_uc001neg.2_5'Flank|DDB2_uc001neh.2_5'Flank	NM_000107	NP_000098	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2						nucleotide-excision repair, DNA damage removal|protein autoubiquitination|protein polyubiquitination|response to UV	nucleoplasm|protein complex	damaged DNA binding|protein binding			kidney(2)|ovary(1)	3						GTGATGAGACAGAGATTAACCGTGCC	0.476			Mis|N			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				72	55	---	---	---	---	
FNBP4	23360	broad.mit.edu	37	11	47772241	47772246	+	Intron	DEL	AAAAAA	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47772241_47772246delAAAAAA	uc009ylv.2	-						FNBP4_uc001ngj.2_Intron|FNBP4_uc001ngl.2_Intron	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4											ovary(1)	1						actctgtctcaaaaaaaaaaaaaaaa	0.097													5	3	---	---	---	---	
CCDC83	220047	broad.mit.edu	37	11	85622219	85622219	+	Intron	DEL	A	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85622219delA	uc001pbh.1	+						CCDC83_uc001pbg.1_Intron|CCDC83_uc001pbi.1_Intron|CCDC83_uc001pbj.1_Intron	NM_173556	NP_775827	Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83											skin(1)	1		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				cgtctcaaataaaaaaaaaaa	0.095													4	4	---	---	---	---	
GATC	283459	broad.mit.edu	37	12	120897665	120897668	+	Intron	DEL	AAAC	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120897665_120897668delAAAC	uc010szi.1	+							NM_176818	NP_789788	O43716	GATCL_HUMAN	glutamyl-tRNA(Gln) amidotransferase, subunit C						regulation of translational fidelity						0	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ctcaaaacaaaaacaaacaaacaa	0.162													14	9	---	---	---	---	
KDM2B	84678	broad.mit.edu	37	12	122018157	122018158	+	Intron	INS	-	G	G			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122018157_122018158insG	uc001uat.2	-						KDM2B_uc001uas.2_5'UTR|KDM2B_uc001uau.2_Intron|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						TCAGCAGTTGTGGGGGGGGGGA	0.550													4	2	---	---	---	---	
GABPB1	2553	broad.mit.edu	37	15	50571061	50571062	+	Intron	INS	-	A	A	rs71993721		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50571061_50571062insA	uc001zyb.2	-						GABPB1_uc001zya.2_Intron|GABPB1_uc010ufg.1_Intron	NM_005254	NP_005245	Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta						positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)	1						TCCTTCAAATTAAAAAAAAAAA	0.287													9	5	---	---	---	---	
IGF1R	3480	broad.mit.edu	37	15	99192755	99192763	+	5'UTR	DEL	TTTTTTTTT	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99192755_99192763delTTTTTTTTT	uc002bul.2	+	1					IGF1R_uc010urq.1_5'UTR|IGF1R_uc010bon.2_5'UTR	NM_000875	NP_000866	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor precursor						anti-apoptosis|immune response|insulin receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of DNA replication|protein autophosphorylation|protein tetramerization	microsome	ATP binding|identical protein binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor receptor activity|metal ion binding|phosphatidylinositol 3-kinase binding			lung(3)|kidney(3)|ovary(1)|central_nervous_system(1)	8	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Mecasermin(DB01277)	ttttcttttcttttttttttttttttttt	0.388													11	5	---	---	---	---	
ABCA3	21	broad.mit.edu	37	16	2382235	2382235	+	Intron	DEL	T	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2382235delT	uc002cpy.1	-						ABCA3_uc010bsk.1_Intron|ABCA3_uc010bsl.1_Intron|ABCA3_uc002cpz.1_5'Flank	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3						response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				CCTCCATTTCTTTTTTTTTTT	0.418													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29372348	29372348	+	Intron	DEL	T	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29372348delT	uc010vct.1	-						RUNDC2C_uc010bys.1_Intron|RUNDC2C_uc002dsj.1_Intron|RUNDC2C_uc010vdo.1_Intron					RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		TGGGAGGttgttttttttttt	0.259													4	2	---	---	---	---	
MYO1C	4641	broad.mit.edu	37	17	1377722	1377725	+	Intron	DEL	AAAA	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1377722_1377725delAAAA	uc002fsp.2	-						MYO1C_uc002fsn.2_Intron|MYO1C_uc002fso.2_Intron|MYO1C_uc010vqj.1_Intron|MYO1C_uc010vqk.1_Intron	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a						mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		accctgtctcaaaaaaaaaaaaaa	0.245													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	18988562	18988562	+	IGR	DEL	T	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18988562delT								GRAP (38226 upstream) : GRAPL (42220 downstream)																							CTGATGTGTGTTTTTTTTTTT	0.279													6	3	---	---	---	---	
CDH19	28513	broad.mit.edu	37	18	64239243	64239243	+	Intron	DEL	G	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64239243delG	uc002lkc.1	-						CDH19_uc010dql.1_Intron|CDH19_uc010xey.1_Intron|CDH19_uc002lkd.2_Intron	NM_021153	NP_066976	Q9H159	CAD19_HUMAN	cadherin 19, type 2 preproprotein						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2		Esophageal squamous(42;0.0132)				AAATAAATAAGTACCTGGCCG	0.383													7	26	---	---	---	---	
ATRN	8455	broad.mit.edu	37	20	3557326	3557327	+	Intron	INS	-	TCTG	TCTG	rs4989370	by1000genomes	TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3557326_3557327insTCTG	uc002wim.2	+						ATRN_uc002wil.2_Intron	NM_139321	NP_647537	O75882	ATRN_HUMAN	attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2						Ttatctatctatctgtctgtct	0.272													2	4	---	---	---	---	
DYNLRB1	83658	broad.mit.edu	37	20	33114290	33114291	+	Intron	INS	-	T	T	rs77341666		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33114290_33114291insT	uc002xal.2	+						DYNLRB1_uc010zuk.1_Intron|DYNLRB1_uc002xam.2_Intron|DYNLRB1_uc002xan.2_Intron|DYNLRB1_uc002xao.2_Intron	NM_014183	NP_054902	Q9NP97	DLRB1_HUMAN	Roadblock-1						microtubule-based movement|transport|visual behavior	centrosome|cytoplasmic dynein complex|microtubule	microtubule motor activity				0						CTCCAGTGttcttttttttttt	0.198													4	3	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37619142	37619156	+	Intron	DEL	TTATGTTATGTTATG	-	-	rs67162183		TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37619142_37619156delTTATGTTATGTTATG	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron|DOPEY2_uc002yvh.2_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						TTCTGATCCAttatgttatgttatgttatgttatg	0.205													11	5	---	---	---	---	
ERG	2078	broad.mit.edu	37	21	39774634	39774634	+	Intron	DEL	C	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39774634delC	uc010gnw.2	-						ERG_uc002yxa.2_Intron|ERG_uc011aek.1_Intron|ERG_uc010gnv.2_Intron|ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc011aem.1_Intron|ERG_uc002yxc.3_Intron|ERG_uc010gny.1_Intron	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				ACCTTTCTTACaaaaaaaaaa	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16436529	16436529	+	IGR	DEL	G	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16436529delG								POTEH (148592 upstream) : OR11H1 (12297 downstream)																							CTGGAATCCTGGGGGAAAAAA	0.413													8	4	---	---	---	---	
APOBEC3D	140564	broad.mit.edu	37	22	39411880	39411880	+	Intron	DEL	T	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39411880delT	uc011aoe.1	+						APOBEC3D_uc011aod.1_Intron|APOBEC3D_uc011aof.1_Intron|APOBEC3C_uc003awr.2_Intron	NM_152426	NP_689639	Q96AK3	ABC3D_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic						negative regulation of transposition		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding				0	Melanoma(58;0.04)					CACAtttctattttttttttt	0.249													6	3	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49145628	49145629	+	Intron	DEL	CT	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49145628_49145629delCT	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		GAGGCTCACCCTCTCTCTCTCT	0.658													4	2	---	---	---	---	
POLA1	5422	broad.mit.edu	37	X	24735993	24735994	+	Intron	INS	-	T	T			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24735993_24735994insT	uc004dbl.2	+						POLA1_uc004dbm.2_Intron|POLA1_uc004dbn.2_Intron	NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	gtttatttctgttttttttttc	0.252													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	52613556	52613557	+	IGR	DEL	AC	-	-			TCGA-EA-A1QT-01A-11D-A14W-08	TCGA-EA-A1QT-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52613556_52613557delAC								XAGE1D (369605 upstream) : SSX8 (38428 downstream)																							acacacacagacacacacacac	0.361													5	3	---	---	---	---	
