Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KLHL17	339451	broad.mit.edu	37	1	900368	900368	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:900368G>T	uc001aca.1	+	12	1833	c.1726G>T	c.(1726-1728)GAC>TAC	p.D576Y	KLHL17_uc001acc.1_RNA|PLEKHN1_uc001acd.2_5'Flank|PLEKHN1_uc001acf.2_5'Flank|PLEKHN1_uc001ace.2_5'Flank	NM_198317	NP_938073	Q6TDP4	KLH17_HUMAN	kelch-like 17	576	Interaction with F-actin (By similarity).|Kelch 5.				actin cytoskeleton organization	actin cytoskeleton|cell junction|postsynaptic density|postsynaptic membrane	protein complex scaffold				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.52e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.59e-23)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|BRCA - Breast invasive adenocarcinoma(365;0.000469)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GGTGGCCATGGACGGATGGTT	0.647													14	10	---	---	---	---	PASS
PRDM16	63976	broad.mit.edu	37	1	3328010	3328010	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3328010G>A	uc001akf.2	+	9	1329	c.1249G>A	c.(1249-1251)GCC>ACC	p.A417T	PRDM16_uc001akc.2_Missense_Mutation_p.A417T|PRDM16_uc001akd.2_Missense_Mutation_p.A417T|PRDM16_uc001ake.2_Missense_Mutation_p.A417T|PRDM16_uc009vlh.2_Missense_Mutation_p.A118T	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1	417					brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GCGGATGCACGCCGACTGCCG	0.572			T	EVI1	MDS|AML								9	30	---	---	---	---	PASS
MASP2	10747	broad.mit.edu	37	1	11102931	11102931	+	Splice_Site	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11102931C>T	uc001aru.2	-	6	910	c.889_splice	c.e6+1	p.A297_splice		NM_006610	NP_006601	O00187	MASP2_HUMAN	mannan-binding lectin serine protease 2 isoform						complement activation, classical pathway|complement activation, lectin pathway|proteolysis	extracellular region	calcium ion binding|calcium-dependent protein binding|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.071)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.12e-07)|COAD - Colon adenocarcinoma(227;7.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)		CACTTGCTCACCTGTGCTCGT	0.547													25	92	---	---	---	---	PASS
C1orf158	93190	broad.mit.edu	37	1	12819302	12819302	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12819302C>G	uc001auh.2	+	3	501	c.285C>G	c.(283-285)ATC>ATG	p.I95M	C1orf158_uc010obe.1_Missense_Mutation_p.I95M	NM_152290	NP_689503	Q8N1D5	CA158_HUMAN	hypothetical protein LOC93190	95										ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00575)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		GCTACCTGATCAGCACCTATG	0.567													54	178	---	---	---	---	PASS
C1orf158	93190	broad.mit.edu	37	1	12820737	12820737	+	Silent	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12820737C>G	uc001auh.2	+	4	654	c.438C>G	c.(436-438)CTC>CTG	p.L146L		NM_152290	NP_689503	Q8N1D5	CA158_HUMAN	hypothetical protein LOC93190	146										ovary(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00575)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		ATGAGCAGCTCAAGCAGAGAC	0.527													12	57	---	---	---	---	PASS
PRAMEF11	440560	broad.mit.edu	37	1	12887575	12887575	+	Silent	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12887575T>A	uc001auk.2	-	3	478	c.282A>T	c.(280-282)CCA>CCT	p.P94P		NM_001146344	NP_001139816	O60813	PRA11_HUMAN	PRAME family member 11	94											0						AGTCCTGCACTGGTGTTTTGT	0.498													17	265	---	---	---	---	PASS
CLCNKB	1188	broad.mit.edu	37	1	16372138	16372138	+	Silent	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16372138G>C	uc001axw.3	+	3	266	c.186G>C	c.(184-186)CTG>CTC	p.L62L	FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Silent_p.L62L	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1	62	Helical; (Potential).				excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TCATGGCCCTGGTCAGCTGTG	0.627													17	43	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16895671	16895671	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16895671C>T	uc009vos.1	-	23	3399	c.2511G>A	c.(2509-2511)TCG>TCA	p.S837S	NBPF1_uc009vot.1_Silent_p.S295S|NBPF1_uc001ayz.1_Silent_p.S295S|NBPF1_uc010oce.1_Silent_p.S566S	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672	837	NBPF 4.					cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TTGAGAGAGTCGAATAACCTT	0.488													49	302	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19491386	19491386	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19491386G>C	uc001bbi.2	-	32	4422	c.4418C>G	c.(4417-4419)ACA>AGA	p.T1473R	UBR4_uc001bbm.1_Missense_Mutation_p.T684R	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	1473					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGGGGGCGATGTAGTCATGCG	0.552													4	73	---	---	---	---	PASS
EPHB2	2048	broad.mit.edu	37	1	23236885	23236885	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23236885C>G	uc009vqj.1	+	14	2658	c.2513C>G	c.(2512-2514)GCC>GGC	p.A838G	EPHB2_uc001bge.2_Missense_Mutation_p.A839G|EPHB2_uc001bgf.2_Missense_Mutation_p.A838G|EPHB2_uc010odu.1_Missense_Mutation_p.A780G	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor	838	Cytoplasmic (Potential).|Protein kinase.				axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		GTAATCAATGCCATTGAGCAG	0.617									Hereditary_Prostate_Cancer				4	57	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24397687	24397687	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24397687G>C	uc001bin.3	-	25	3233	c.3070C>G	c.(3070-3072)CTT>GTT	p.L1024V	MYOM3_uc001bim.3_Missense_Mutation_p.L681V|MYOM3_uc001bio.2_Missense_Mutation_p.L1024V	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	1024										skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		TCCAGCCAAAGCCGCACCTCC	0.547											OREG0013235	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	20	---	---	---	---	PASS
LDLRAP1	26119	broad.mit.edu	37	1	25891685	25891685	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25891685G>A	uc001bkl.3	+	8	883	c.769G>A	c.(769-771)GAA>AAA	p.E257K	LDLRAP1_uc009vrw.2_RNA|LDLRAP1_uc009vrx.2_Missense_Mutation_p.E87K	NM_015627	NP_056442	Q5SW96	ARH_HUMAN	low density lipoprotein receptor adaptor protein	257	AP-2 complex binding.|[DE]-X(1,2)-F-X-X-[FL]-X-X-X-R motif.				amyloid precursor protein metabolic process|cholesterol homeostasis|cholesterol metabolic process|positive regulation of receptor-mediated endocytosis|receptor internalization|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport|regulation of establishment of protein localization in plasma membrane|regulation of protein binding	basal plasma membrane|cytosol|early endosome|internal side of plasma membrane|neurofilament|recycling endosome	beta-amyloid binding|clathrin binding|low-density lipoprotein particle receptor binding|phosphatidylinositol-4,5-bisphosphate binding|phosphotyrosine binding|protein binding, bridging|protein complex binding|receptor signaling complex scaffold activity|signaling adaptor activity			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)		TGGCCTGGATGAAGCGTTTTC	0.587													56	55	---	---	---	---	PASS
EIF3I	8668	broad.mit.edu	37	1	32688180	32688180	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32688180G>C	uc001bur.3	+	3	578	c.45G>C	c.(43-45)CAG>CAC	p.Q15H	C1orf91_uc001buo.3_5'Flank|C1orf91_uc001bup.3_5'Flank|C1orf91_uc009vub.1_5'Flank|C1orf91_uc010oha.1_5'Flank|C1orf91_uc001buq.3_5'Flank|EIF3I_uc009vuc.2_Missense_Mutation_p.Q15H|EIF3I_uc001bus.2_5'UTR	NM_003757	NP_003748	Q13347	EIF3I_HUMAN	eukaryotic translation initiation factor 3,	15	WD 1.					cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				CCATTACGCAGATTAAGTATA	0.597													22	72	---	---	---	---	PASS
DLGAP3	58512	broad.mit.edu	37	1	35370070	35370070	+	Silent	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35370070C>G	uc001byc.2	-	1	915	c.915G>C	c.(913-915)TCG>TCC	p.S305S		NM_001080418	NP_001073887	O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated	305					cell-cell signaling	cell junction|postsynaptic density|postsynaptic membrane				ovary(3)	3		Myeloproliferative disorder(586;0.0393)				CCGACCCGCCCGAGCGCCCCT	0.657													25	29	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43774766	43774766	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43774766C>T	uc001ciu.2	+	8	1231	c.1152C>T	c.(1150-1152)AGC>AGT	p.S384S	TIE1_uc010okd.1_Silent_p.S384S|TIE1_uc010oke.1_Silent_p.S339S|TIE1_uc009vwq.2_Silent_p.S340S|TIE1_uc010okf.1_Silent_p.S29S|TIE1_uc010okg.1_Silent_p.S29S|TIE1_uc010okc.1_Intron	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	384	Ig-like C2-type 2.|Extracellular (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGCGGGGCAGCATAGAGCTAC	0.612													11	21	---	---	---	---	PASS
KIF2C	11004	broad.mit.edu	37	1	45205650	45205650	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45205650G>A	uc001cmg.3	+	1	161	c.46G>A	c.(46-48)GCT>ACT	p.A16T	KIF2C_uc010olb.1_Missense_Mutation_p.A16T	NM_006845	NP_006836	Q99661	KIF2C_HUMAN	kinesin family member 2C	16	Globular (Potential).				blood coagulation|cell division|cell proliferation|chromosome segregation|establishment or maintenance of microtubule cytoskeleton polarity|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|kinesin complex|microtubule|nucleus	ATP binding|centromeric DNA binding|microtubule motor activity|microtubule plus-end binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					TCCCGGTCTCGCTATCAAGAT	0.567													54	319	---	---	---	---	PASS
PIK3R3	8503	broad.mit.edu	37	1	46509289	46509289	+	3'UTR	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46509289C>G	uc001cpb.3	-	10					PIK3R3_uc009vyb.2_3'UTR|PIK3R3_uc009vyc.2_3'UTR|PIK3R3_uc001cpc.3_3'UTR|PIK3R3_uc010olw.1_3'UTR|PIK3R3_uc010olv.1_3'UTR	NM_003629	NP_003620	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3						insulin receptor signaling pathway|platelet activation|T cell costimulation		1-phosphatidylinositol-3-kinase activity|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					TCATCGTAGTCTAATAAAAAC	0.468													4	12	---	---	---	---	PASS
CYP4Z2P	163720	broad.mit.edu	37	1	47333715	47333715	+	RNA	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47333715G>C	uc001cqo.1	-	8		c.1012C>G			CYP4Z2P_uc009vyn.1_RNA	NR_002788				Homo sapiens cDNA FLJ40054 fis, clone TBAES2000315, weakly similar to CYTOCHROME P450 4A1 (EC 1.14.15.3).												0						AAAGATCCAGGAGATAGCAGT	0.443													26	28	---	---	---	---	PASS
EPS15	2060	broad.mit.edu	37	1	51929378	51929378	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51929378G>A	uc001csq.1	-	7	560	c.468C>T	c.(466-468)CTC>CTT	p.L156L	EPS15_uc009vyz.1_Silent_p.L156L	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway	156	EH 2.				cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						ACTTAGAGTTGAGCAACACTG	0.328			T	MLL	ALL								5	40	---	---	---	---	PASS
EPS15	2060	broad.mit.edu	37	1	51934235	51934235	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51934235G>C	uc001csq.1	-	5	311	c.219C>G	c.(217-219)TTC>TTG	p.F73L	EPS15_uc009vyz.1_Missense_Mutation_p.F73L	NM_001981	NP_001972	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway	73	EH 1.				cell proliferation|clathrin coat assembly|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|protein transport	cytosol|early endosome membrane	calcium ion binding|SH3 domain binding			lung(1)|kidney(1)	2						AAGCAACAAAGAATTCCTAAG	0.368			T	MLL	ALL								6	21	---	---	---	---	PASS
GLIS1	148979	broad.mit.edu	37	1	54060429	54060429	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54060429C>A	uc001cvr.1	-	3	714	c.147G>T	c.(145-147)CTG>CTT	p.L49L		NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1	49					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						GCTGGAGGCCCAGGCCAGAGC	0.711													4	18	---	---	---	---	PASS
WLS	79971	broad.mit.edu	37	1	68620905	68620905	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68620905G>A	uc001def.1	-	4	814	c.543C>T	c.(541-543)GTC>GTT	p.V181V	uc001deb.1_Intron|uc001dec.1_Intron|WLS_uc001dee.2_Silent_p.V179V|WLS_uc001deg.1_Silent_p.V90V|WLS_uc009wbf.1_Silent_p.V136V	NM_024911	NP_079187	Q5T9L3	WLS_HUMAN	G protein-coupled receptor 177 isoform 1	181	Lumenal (Potential).|Interacts with Wnt proteins (By similarity).				multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Wnt receptor signaling pathway	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	signal transducer activity				0						TGAAAGGAAGGACATCACATT	0.453													38	40	---	---	---	---	PASS
NEGR1	257194	broad.mit.edu	37	1	72748265	72748265	+	5'UTR	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:72748265G>C	uc001dfw.2	-	1					NEGR1_uc010oqs.1_5'UTR	NM_173808	NP_776169	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1 precursor						cell adhesion	anchored to membrane|plasma membrane				ovary(1)	1		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		GAACCAGGCGGCGCGCCACAG	0.522													8	4	---	---	---	---	PASS
ACADM	34	broad.mit.edu	37	1	76190368	76190368	+	5'UTR	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76190368G>C	uc001dgw.3	+	1					uc001dgv.2_5'Flank|ACADM_uc010orc.1_5'UTR|ACADM_uc010ord.1_5'UTR|ACADM_uc009wbp.2_5'UTR|ACADM_uc009wbr.2_5'UTR|ACADM_uc010ore.1_5'UTR|ACADM_uc010orf.1_5'UTR|ACADM_uc001dgx.3_5'Flank	NM_000016	NP_000007	P11310	ACADM_HUMAN	medium-chain acyl-CoA dehydrogenase isoform a						carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity			breast(2)|ovary(1)|skin(1)	4						gccccatcccgcccACGGGCT	0.433													6	9	---	---	---	---	PASS
TTLL7	79739	broad.mit.edu	37	1	84387005	84387005	+	Silent	SNP	T	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84387005T>G	uc001djc.2	-	11	1611	c.1215A>C	c.(1213-1215)TCA>TCC	p.S405S	TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_RNA|TTLL7_uc001djf.2_RNA|TTLL7_uc001djg.2_RNA	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	405					cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity			ovary(1)	1				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		GCCTTTTAATTGAATTTTGAC	0.413													17	63	---	---	---	---	PASS
BRDT	676	broad.mit.edu	37	1	92446894	92446894	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92446894T>G	uc001dok.3	+	11	2169	c.1820T>G	c.(1819-1821)CTG>CGG	p.L607R	BRDT_uc001dol.3_Missense_Mutation_p.L607R|BRDT_uc010osz.1_Missense_Mutation_p.L611R|BRDT_uc009wdf.2_Missense_Mutation_p.L534R|BRDT_uc010ota.1_Missense_Mutation_p.L561R|BRDT_uc010otb.1_Missense_Mutation_p.L561R|BRDT_uc001dom.3_Missense_Mutation_p.L607R	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein	607	Potential.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		AAGCGGTTACTGGATGTTAAT	0.274													9	42	---	---	---	---	PASS
AMIGO1	57463	broad.mit.edu	37	1	110050899	110050899	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110050899G>C	uc001dxx.3	-	2	1018	c.636C>G	c.(634-636)ATC>ATG	p.I212M		NM_020703	NP_065754	Q86WK6	AMGO1_HUMAN	AMIGO protein precursor	212	Extracellular (Potential).				axonal fasciculation|heterophilic cell-cell adhesion|homophilic cell adhesion|myelination|positive regulation of axonogenesis	axon|integral to membrane				ovary(1)|breast(1)	2		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0182)|Epithelial(280;0.046)|all cancers(265;0.0492)|READ - Rectum adenocarcinoma(129;0.0689)|LUSC - Lung squamous cell carcinoma(189;0.227)		GCCCATTCTTGATCCAGGCCG	0.532													52	28	---	---	---	---	PASS
C1orf103	55791	broad.mit.edu	37	1	111494891	111494891	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111494891C>A	uc001eaa.2	-	2	871	c.615G>T	c.(613-615)GTG>GTT	p.V205V	C1orf103_uc001dzz.2_Intron|C1orf103_uc001eab.2_Intron|C1orf103_uc001eac.1_Intron	NM_018372	NP_060842	Q5T3J3	LRIF1_HUMAN	receptor-interacting factor 1 isoform 1	205					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)		TCTTTTGCTGCACTGAAGGAG	0.463													3	41	---	---	---	---	PASS
ST7L	54879	broad.mit.edu	37	1	113161719	113161719	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113161719C>A	uc001ecd.2	-	1	322	c.17G>T	c.(16-18)GGC>GTC	p.G6V	ST7L_uc001ecc.2_5'Flank|ST7L_uc010owg.1_Missense_Mutation_p.G6V|ST7L_uc010owh.1_Missense_Mutation_p.G6V|ST7L_uc001ece.2_Missense_Mutation_p.G6V|ST7L_uc001ecf.2_Missense_Mutation_p.G6V|ST7L_uc001ecg.2_RNA|ST7L_uc010owi.1_5'Flank|ST7L_uc001ech.2_Missense_Mutation_p.G6V|ST7L_uc001eci.2_Missense_Mutation_p.G6V|ST7L_uc009wgi.1_RNA|ST7L_uc010owj.1_Missense_Mutation_p.G6V|CAPZA1_uc001ecj.1_5'Flank	NM_017744	NP_060214	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7-like isoform 1	6					negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTCACCCACGCCGCCACGGTC	0.687													8	5	---	---	---	---	PASS
ST7L	54879	broad.mit.edu	37	1	113161720	113161720	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113161720C>G	uc001ecd.2	-	1	321	c.16G>C	c.(16-18)GGC>CGC	p.G6R	ST7L_uc001ecc.2_5'Flank|ST7L_uc010owg.1_Missense_Mutation_p.G6R|ST7L_uc010owh.1_Missense_Mutation_p.G6R|ST7L_uc001ece.2_Missense_Mutation_p.G6R|ST7L_uc001ecf.2_Missense_Mutation_p.G6R|ST7L_uc001ecg.2_RNA|ST7L_uc010owi.1_5'Flank|ST7L_uc001ech.2_Missense_Mutation_p.G6R|ST7L_uc001eci.2_Missense_Mutation_p.G6R|ST7L_uc009wgi.1_RNA|ST7L_uc010owj.1_Missense_Mutation_p.G6R|CAPZA1_uc001ecj.1_5'Flank	NM_017744	NP_060214	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7-like isoform 1	6					negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCACCCACGCCGCCACGGTCC	0.682													8	5	---	---	---	---	PASS
PDIA3P	171423	broad.mit.edu	37	1	146649800	146649800	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146649800G>C	uc001epg.1	+	1	371	c.108G>C	c.(106-108)GAG>GAC	p.E36D		NR_002305				SubName: Full=cDNA FLJ53558, highly similar to Protein disulfide-isomerase A3 (EC 5.3.4.1);												0						ACAACTTGGAGAGTCGCATCT	0.667													3	74	---	---	---	---	PASS
MTMR11	10903	broad.mit.edu	37	1	149903256	149903256	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149903256C>T	uc001etl.3	-	13	1437	c.1186G>A	c.(1186-1188)GAA>AAA	p.E396K	MTMR11_uc001etm.1_Missense_Mutation_p.E324K|MTMR11_uc010pbm.1_Intron|MTMR11_uc010pbn.1_Missense_Mutation_p.R222Q	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	396	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GTTCGGGCTTCGGGGGCTGAA	0.572													27	55	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152081550	152081550	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152081550C>G	uc001ezp.2	-	2	4143	c.4143G>C	c.(4141-4143)CAG>CAC	p.Q1381H	TCHH_uc009wne.1_Missense_Mutation_p.Q1381H	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1381	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCGCAGCCGCTGTTCCTCCT	0.602													21	242	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152193791	152193791	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152193791G>T	uc001ezt.1	-	3	390	c.314C>A	c.(313-315)ACT>AAT	p.T105N		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	105	1.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGCTGGTGAGTGTCATCTCT	0.413													10	124	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152283163	152283163	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152283163C>A	uc001ezu.1	-	3	4235	c.4199G>T	c.(4198-4200)GGA>GTA	p.G1400V	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1400	Ser-rich.|Filaggrin 8.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCTGAATGTCCCTCACTGTT	0.567									Ichthyosis				11	585	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152285219	152285219	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152285219G>C	uc001ezu.1	-	3	2179	c.2143C>G	c.(2143-2145)CAG>GAG	p.Q715E	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	715	Filaggrin 4.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTGCTGACTGGAGCTGGTGG	0.567									Ichthyosis				526	360	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152285220	152285220	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152285220G>T	uc001ezu.1	-	3	2178	c.2142C>A	c.(2140-2142)CTC>CTA	p.L714L	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	714	Filaggrin 4.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTGACTGGAGCTGGTGGC	0.567									Ichthyosis				524	364	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152327473	152327473	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152327473C>T	uc001ezw.3	-	3	2862	c.2789G>A	c.(2788-2790)AGT>AAT	p.S930N	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	930	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGATGACTGACTTGAGCCAGA	0.478													33	473	---	---	---	---	PASS
LCE1C	353133	broad.mit.edu	37	1	152777745	152777745	+	Silent	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152777745A>T	uc001fap.1	-	2	261	c.210T>A	c.(208-210)TCT>TCA	p.S70S		NM_178351	NP_848128	Q5T751	LCE1C_HUMAN	late cornified envelope 1C	70	Gly-rich.				keratinization						0	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CACCTCCCCCAGAACTGCAGC	0.682													12	142	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154018563	154018563	+	Silent	SNP	T	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154018563T>G	uc001fdw.2	-	27	3750	c.3678A>C	c.(3676-3678)CTA>CTC	p.L1226L	NUP210L_uc009woq.2_Silent_p.L135L|NUP210L_uc010peh.1_Silent_p.L1226L	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	1226						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GCCTGGGCACTAGATCCAATA	0.373													4	81	---	---	---	---	PASS
TPM3	7170	broad.mit.edu	37	1	154130139	154130139	+	Silent	SNP	G	C	C	rs1051220		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154130139G>C	uc001fdy.1	-	8	853	c.723C>G	c.(721-723)ACC>ACG	p.T241T	TPM3_uc001fdx.1_Silent_p.T226T|TPM3_uc010pei.1_Silent_p.T151T|TPM3_uc001fdz.1_3'UTR|TPM3_uc001fea.1_Silent_p.T241T|TPM3_uc001feb.1_3'UTR|TPM3_uc010pej.1_Silent_p.T174T|TPM3_uc009wor.2_Intron|NUP210L_uc001fdw.2_5'Flank|NUP210L_uc010peh.1_5'Flank	NM_001043351	NP_001036816	P06753	TPM3_HUMAN	tropomyosin 3 isoform 4	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cellular component movement|muscle filament sliding|regulation of muscle contraction	cytosol|muscle thin filament tropomyosin|stress fiber	actin binding		TPM3/ALK(33)	haematopoietic_and_lymphoid_tissue(22)|soft_tissue(11)|skin(1)	34	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					GGTCAAGCAGGGTCTGGTCCA	0.532			T	NTRK1|ALK	papillary thyroid|ALCL								18	217	---	---	---	---	PASS
C1orf43	25912	broad.mit.edu	37	1	154184644	154184644	+	Intron	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154184644C>G	uc001fei.2	-						C1orf43_uc001fef.1_Intron|C1orf43_uc001feg.2_Intron|C1orf43_uc001feh.2_Intron|C1orf43_uc001fej.2_Intron|C1orf43_uc009wos.1_Intron|C1orf43_uc001fek.2_3'UTR|C1orf43_uc001fel.2_3'UTR	NM_001098616	NP_001092086	Q9BWL3	CA043_HUMAN	hypothetical protein LOC25912 isoform 3							integral to membrane	coenzyme binding|oxidoreductase activity				0	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					CATCTGCTTTCTAATGTAAGA	0.209													4	38	---	---	---	---	PASS
CHRNB2	1141	broad.mit.edu	37	1	154542804	154542804	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154542804C>G	uc001ffg.2	+	4	590	c.326C>G	c.(325-327)TCC>TGC	p.S109C		NM_000748	NP_000739	P17787	ACHB2_HUMAN	neuronal nicotinic acetylcholine receptor beta 2	109	Extracellular (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)	CGGCTCCCTTCCAAACACATC	0.532													3	23	---	---	---	---	PASS
CHRNB2	1141	broad.mit.edu	37	1	154544007	154544007	+	Missense_Mutation	SNP	C	G	G	rs71628622		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154544007C>G	uc001ffg.2	+	5	972	c.708C>G	c.(706-708)TTC>TTG	p.F236L		NM_000748	NP_000739	P17787	ACHB2_HUMAN	neuronal nicotinic acetylcholine receptor beta 2	236	Helical; (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)	AGCCGCTCTTCTACACCATCA	0.577													10	130	---	---	---	---	PASS
CHRNB2	1141	broad.mit.edu	37	1	154544202	154544202	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154544202C>T	uc001ffg.2	+	5	1167	c.903C>T	c.(901-903)CTC>CTT	p.L301L		NM_000748	NP_000739	P17787	ACHB2_HUMAN	neuronal nicotinic acetylcholine receptor beta 2	301	Helical; (Potential).				B cell activation|behavioral response to nicotine|calcium ion transport|central nervous system projection neuron axonogenesis|lateral geniculate nucleus development|locomotory behavior|membrane depolarization|memory|negative regulation of action potential|optic nerve morphogenesis|positive regulation of B cell proliferation|positive regulation of dopamine secretion|regulation of circadian sleep/wake cycle, REM sleep|regulation of dendrite morphogenesis|regulation of dopamine metabolic process|regulation of synaptogenesis|response to cocaine|response to ethanol|response to hypoxia|sensory perception of pain|sensory perception of sound|smooth muscle contraction|social behavior|synaptic transmission involved in micturition|synaptic transmission, cholinergic|vestibulocochlear nerve development|visual learning|visual perception	cell junction|external side of plasma membrane|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Nicotine(DB00184)	GCAAGTACCTCATGTTCACCA	0.627													8	102	---	---	---	---	PASS
GBA	2629	broad.mit.edu	37	1	155207267	155207267	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155207267C>A	uc001fjh.2	-	7	1014	c.864G>T	c.(862-864)CTG>CTT	p.L288L	RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Silent_p.L175L|GBA_uc010pfx.1_Silent_p.L239L|GBA_uc001fji.2_Silent_p.L288L|GBA_uc001fjj.2_Silent_p.L288L|GBA_uc001fjk.2_Silent_p.L288L|GBA_uc001fjl.2_Silent_p.L288L|GBA_uc010pfy.1_Silent_p.L201L|GBA_uc009wqk.1_Silent_p.L201L	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor	288					carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	GGGTGAAGCCCAGGCACTGGA	0.547									Gaucher_disease_type_I				34	23	---	---	---	---	PASS
GBA	2629	broad.mit.edu	37	1	155209446	155209446	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155209446C>A	uc001fjh.2	-	4	565	c.415G>T	c.(415-417)GCC>TCC	p.A139S	RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Intron|GBA_uc010pfx.1_Intron|GBA_uc001fji.2_Missense_Mutation_p.A139S|GBA_uc001fjj.2_Missense_Mutation_p.A139S|GBA_uc001fjk.2_Missense_Mutation_p.A139S|GBA_uc001fjl.2_Missense_Mutation_p.A139S|GBA_uc010pfy.1_Missense_Mutation_p.A52S|GBA_uc009wqk.1_Missense_Mutation_p.A52S	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor	139					carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	AAATTTTGGGCAGGGGGTGAC	0.448									Gaucher_disease_type_I				16	46	---	---	---	---	PASS
INSRR	3645	broad.mit.edu	37	1	156823630	156823630	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156823630A>G	uc010pht.1	-	2	805	c.551T>C	c.(550-552)CTG>CCG	p.L184P	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron|INSRR_uc009wsj.1_Missense_Mutation_p.L184P	NM_014215	NP_055030	P14616	INSRR_HUMAN	insulin receptor-related receptor precursor	184					protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity			lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGCAGCACCCAGCACACCAGG	0.637													6	57	---	---	---	---	PASS
NTRK1	4914	broad.mit.edu	37	1	156845891	156845891	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156845891C>A	uc001fqh.1	+	13	1577	c.1521C>A	c.(1519-1521)CGC>CGA	p.R507R	NTRK1_uc001fqf.1_Silent_p.R471R|NTRK1_uc009wsi.1_Silent_p.R206R|NTRK1_uc001fqi.1_Silent_p.R501R|NTRK1_uc009wsk.1_Silent_p.R504R	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	507	Cytoplasmic (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	ACATCAAGCGCCGGGACATCG	0.612			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			11	116	---	---	---	---	PASS
NTRK1	4914	broad.mit.edu	37	1	156845892	156845892	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156845892C>T	uc001fqh.1	+	13	1578	c.1522C>T	c.(1522-1524)CGG>TGG	p.R508W	NTRK1_uc001fqf.1_Missense_Mutation_p.R472W|NTRK1_uc009wsi.1_Missense_Mutation_p.R207W|NTRK1_uc001fqi.1_Missense_Mutation_p.R502W|NTRK1_uc009wsk.1_Missense_Mutation_p.R505W	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	508	Cytoplasmic (Potential).				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	CATCAAGCGCCGGGACATCGT	0.612			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			11	114	---	---	---	---	PASS
CD5L	922	broad.mit.edu	37	1	157805906	157805906	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157805906C>T	uc001frk.3	-	3	238	c.95G>A	c.(94-96)CGC>CAC	p.R32H		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	32	SRCR 1.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCCTTCACAGCGGTGGAGGCC	0.622													9	107	---	---	---	---	PASS
OR6Y1	391112	broad.mit.edu	37	1	158517676	158517676	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158517676G>C	uc010pil.1	-	1	220	c.220C>G	c.(220-222)CTG>GTG	p.L74V		NM_001005189	NP_001005189	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					CACATCTCCAGGAAGGAGAGG	0.463													7	88	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158650449	158650449	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158650449T>C	uc001fst.1	-	5	801	c.602A>G	c.(601-603)GAA>GGA	p.E201G		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	201	Spectrin 3.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TTGGAAGTCTTCAAATTTCTT	0.473													4	141	---	---	---	---	PASS
FCER1A	2205	broad.mit.edu	37	1	159273848	159273848	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159273848C>T	uc001ftq.2	+	4	306	c.207C>T	c.(205-207)AGC>AGT	p.S69S		NM_002001	NP_001992	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor	69	Extracellular (Potential).|Ig-like 1.					integral to plasma membrane				lung(2)|skin(2)|prostate(1)	5	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	ACAATGGCAGCCTTTCAGAAG	0.368													67	37	---	---	---	---	PASS
CCDC19	25790	broad.mit.edu	37	1	159854250	159854250	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159854250T>A	uc001fui.2	-	7	891	c.873A>T	c.(871-873)GAA>GAT	p.E291D	CCDC19_uc009wtb.2_RNA|CCDC19_uc001fuj.2_RNA|CCDC19_uc001fuk.2_Missense_Mutation_p.E206D|CCDC19_uc001ful.2_Missense_Mutation_p.E206D|CCDC19_uc009wtc.1_Missense_Mutation_p.E277D	NM_012337	NP_036469	Q9UL16	CCD19_HUMAN	nasopharyngeal epithelium specific protein 1	291	Potential.					mitochondrion|soluble fraction				ovary(1)	1	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			CTTGGAGCTGTTCCATATATT	0.522													23	285	---	---	---	---	PASS
IGSF9	57549	broad.mit.edu	37	1	159897153	159897153	+	Silent	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159897153T>C	uc001fur.2	-	21	3720	c.3522A>G	c.(3520-3522)GAA>GAG	p.E1174E	IGSF9_uc001fuq.2_Silent_p.E1158E|CCDC19_uc001ful.2_5'Flank|TAGLN2_uc001fun.1_5'Flank|TAGLN2_uc001fuo.1_5'Flank|TAGLN2_uc010piy.1_5'Flank|IGSF9_uc001fup.2_Silent_p.E320E	NM_001135050	NP_001128522	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9 isoform a	1174	Cytoplasmic (Potential).					cell junction|integral to membrane|synapse				ovary(2)|central_nervous_system(2)|large_intestine(1)	5	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GAGTGGCCTGTTCGGGGTGGG	0.602													90	61	---	---	---	---	PASS
ARHGAP30	257106	broad.mit.edu	37	1	161023136	161023136	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161023136C>A	uc001fxl.2	-	6	922	c.576G>T	c.(574-576)GCG>GCT	p.A192A	ARHGAP30_uc001fxk.2_Silent_p.A192A|ARHGAP30_uc001fxm.2_Silent_p.A38A|ARHGAP30_uc009wtx.2_5'UTR|ARHGAP30_uc001fxn.1_Silent_p.A38A	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	192	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CCATGAAGGCCGCTGTCCCAT	0.552													3	70	---	---	---	---	PASS
SDHC	6391	broad.mit.edu	37	1	161293414	161293414	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161293414C>T	uc001gag.2	+	2	61	c.31C>T	c.(31-33)CGT>TGT	p.R11C	SDHC_uc001gai.2_Missense_Mutation_p.R11C|SDHC_uc001gaj.2_Intron|SDHC_uc001gak.2_Missense_Mutation_p.R11C|SDHC_uc001gah.2_Missense_Mutation_p.R11C	NM_003001	NP_002992	Q99643	C560_HUMAN	succinate dehydrogenase complex, subunit C	11					respiratory electron transport chain|transport|tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain complex II|plasma membrane succinate dehydrogenase complex	electron carrier activity|heme binding|succinate dehydrogenase activity				0	all_cancers(52;6.96e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Succinic acid(DB00139)	ACACGTTGGTCGTCATTGCCT	0.328			Mis|N|F			paraganglioma|pheochromocytoma			Familial_Paragangliomas|Carney-Stratakis_syndrome				4	66	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176740114	176740114	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176740114T>A	uc001gkz.2	+	17	5677	c.4513T>A	c.(4513-4515)TGG>AGG	p.W1505R	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1505	Sushi 2.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						ACTGAGCCCATGGCTGACATG	0.458													5	73	---	---	---	---	PASS
TOR3A	64222	broad.mit.edu	37	1	179051393	179051393	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179051393G>A	uc001gmd.2	+	1	282	c.130G>A	c.(130-132)GGC>AGC	p.G44S	TOR3A_uc010pnd.1_5'UTR	NM_022371	NP_071766	Q9H497	TOR3A_HUMAN	torsin family 3, member A precursor	44					chaperone mediated protein folding requiring cofactor	endoplasmic reticulum	ATP binding			pancreas(1)	1						GGCCTGGCCGGGCTTCCAGCG	0.726													4	7	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	180012207	180012207	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180012207G>T	uc001gnt.2	+	20	4762	c.4379G>T	c.(4378-4380)AGA>ATA	p.R1460I	CEP350_uc009wxl.2_Missense_Mutation_p.R1459I	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	1460						centrosome|nucleus|spindle				ovary(4)	4						GAGTTGACTAGAACTCATATC	0.373													10	194	---	---	---	---	PASS
KIAA1614	57710	broad.mit.edu	37	1	180885721	180885721	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180885721C>A	uc001gok.2	+	2	549	c.482C>A	c.(481-483)CCC>CAC	p.P161H		NM_020950	NP_066001	Q5VZ46	K1614_HUMAN	hypothetical protein LOC57710	161										ovary(3)|skin(1)	4						GAGGAGCAACCCGCCAGGGAT	0.637													6	54	---	---	---	---	PASS
IER5	51278	broad.mit.edu	37	1	181058781	181058781	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181058781A>C	uc001got.3	+	1	1144	c.743A>C	c.(742-744)CAG>CCG	p.Q248P		NM_016545	NP_057629	Q5VY09	IER5_HUMAN	immediate early response 5	248										pancreas(1)	1						AACTTAGAGCAGCCGCCGAGT	0.478													6	34	---	---	---	---	PASS
DHX9	1660	broad.mit.edu	37	1	182823164	182823164	+	Splice_Site	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182823164G>A	uc001gpr.2	+	6	641	c.478_splice	c.e6-1	p.T160_splice	DHX9_uc001gps.2_Splice_Site	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9						CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2						TGATTCTACAGACTCTAGAAT	0.328													5	144	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186062301	186062301	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186062301G>C	uc001grq.1	+	65	10152	c.9923G>C	c.(9922-9924)GGA>GCA	p.G3308A		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3308	Ig-like C2-type 31.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AACATTTATGGAGCTCTTACA	0.383													4	125	---	---	---	---	PASS
RGS18	64407	broad.mit.edu	37	1	192127861	192127861	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192127861G>A	uc001gsg.2	+	1	270	c.94G>A	c.(94-96)GAA>AAA	p.E32K		NM_130782	NP_570138	Q9NS28	RGS18_HUMAN	regulator of G-protein signalling 18	32					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)	3						AGGAAAAGAAGAAACAAGCAA	0.289													3	53	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197073873	197073873	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197073873G>A	uc001gtu.2	-	18	4765	c.4508C>T	c.(4507-4509)GCC>GTC	p.A1503V	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	1503					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						TAACTTTTGGGCTTGAAAGCA	0.323													11	81	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198719627	198719627	+	Missense_Mutation	SNP	T	A	A	rs146768191		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198719627T>A	uc001gur.1	+	29	3253	c.3073T>A	c.(3073-3075)TGG>AGG	p.W1025R	PTPRC_uc001gus.1_Missense_Mutation_p.W977R|PTPRC_uc001gut.1_Missense_Mutation_p.W864R	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1025	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						AAAGAGCTACTGGAAACCTGA	0.383													6	74	---	---	---	---	PASS
NR5A2	2494	broad.mit.edu	37	1	200017817	200017817	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200017817G>A	uc001gvb.2	+	5	1187	c.981G>A	c.(979-981)CAG>CAA	p.Q327Q	NR5A2_uc001gvc.2_Silent_p.Q281Q|NR5A2_uc009wzh.2_Silent_p.Q287Q|NR5A2_uc010pph.1_Silent_p.Q255Q	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	327					embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)					CCTATTTGCAGCAAGAGCAGG	0.493													15	83	---	---	---	---	PASS
NUAK2	81788	broad.mit.edu	37	1	205272802	205272802	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205272802C>A	uc001hce.2	-	7	1790	c.1663G>T	c.(1663-1665)GAC>TAC	p.D555Y		NM_030952	NP_112214	Q9H093	NUAK2_HUMAN	NUAK family, SNF1-like kinase, 2	555					actin cytoskeleton organization|apoptosis|cellular response to glucose starvation|negative regulation of apoptosis		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|stomach(1)|breast(1)	5	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TCCAGCTGGTCAAAGGACTCA	0.687													6	28	---	---	---	---	PASS
FAM71A	149647	broad.mit.edu	37	1	212798782	212798782	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212798782C>A	uc001hjk.2	+	1	967	c.563C>A	c.(562-564)CCA>CAA	p.P188Q	uc010pth.1_RNA	NM_153606	NP_705834	Q8IYT1	FA71A_HUMAN	hypothetical protein LOC149647	188										skin(3)|ovary(1)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		TGTGGCATTCCAGCTGAAGAC	0.532													12	74	---	---	---	---	PASS
DUSP10	11221	broad.mit.edu	37	1	221879668	221879668	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221879668C>A	uc001hmy.1	-	3	1134	c.952G>T	c.(952-954)GAG>TAG	p.E318*	DUSP10_uc001hmx.1_5'UTR|DUSP10_uc001hmz.1_5'UTR	NM_007207	NP_009138	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10 isoform a	318					inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|negative regulation of stress-activated MAPK cascade	Golgi apparatus|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|lung(1)	2				GBM - Glioblastoma multiforme(131;0.0103)		TCAGCGTTCTCGATGTCAGGG	0.632													6	167	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228471295	228471295	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228471295G>A	uc009xez.1	+	33	8873	c.8829G>A	c.(8827-8829)GCG>GCA	p.A2943A	OBSCN_uc001hsn.2_Silent_p.A2943A|OBSCN_uc001hsp.1_Silent_p.A642A|OBSCN_uc001hsq.1_Silent_p.A199A	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	2943	Ig-like 29.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				AGCACCCCGCGGCCACAGTGA	0.632													3	37	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	247902195	247902195	+	IGR	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247902195G>T								OR6F1 (26138 upstream) : OR1C1 (18571 downstream)																							TCTCCTTCCTGGGGTGTGTGT	0.532													5	88	---	---	---	---	PASS
RHOB	388	broad.mit.edu	37	2	20647450	20647450	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20647450C>T	uc002rdv.2	+	1	616	c.224C>T	c.(223-225)CCG>CTG	p.P75L		NM_004040	NP_004031	P62745	RHOB_HUMAN	ras homolog gene family, member B precursor	75					angiogenesis|axon guidance|cell adhesion|endosome to lysosome transport|negative regulation of cell cycle|platelet activation|positive regulation of angiogenesis|protein transport|regulation of small GTPase mediated signal transduction|Rho protein signal transduction|transformed cell apoptosis	cytosol|late endosome membrane|nucleus|plasma membrane	GTP binding|GTPase activity|protein binding			ovary(1)|lung(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)	all_epithelial(98;4.19e-09)|Lung NSC(108;0.00452)|Ovarian(717;0.0164)		OV - Ovarian serous cystadenocarcinoma(76;1.14e-22)|Epithelial(75;7.84e-19)		CTCTCCTACCCGGACACCGAC	0.647													22	65	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25965729	25965729	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25965729C>G	uc002rgs.2	-	12	3698	c.3477G>C	c.(3475-3477)TTG>TTC	p.L1159F	ASXL2_uc002rgt.1_Missense_Mutation_p.L642F	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	1159					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCCCATTTTCAAGGCTTCAG	0.458													27	60	---	---	---	---	PASS
BIRC6	57448	broad.mit.edu	37	2	32716552	32716552	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32716552C>G	uc010ezu.2	+	44	8401	c.8267C>G	c.(8266-8268)CCA>CGA	p.P2756R		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	2756					anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					GTTTCAGATCCAAACCTAATT	0.388													34	57	---	---	---	---	PASS
FSHR	2492	broad.mit.edu	37	2	49190073	49190073	+	Silent	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:49190073A>G	uc002rww.2	-	10	1961	c.1887T>C	c.(1885-1887)TTT>TTC	p.F629F	FSHR_uc002rwx.2_Silent_p.F567F|FSHR_uc010fbn.2_Silent_p.F603F	NM_000145	NP_000136	P23945	FSHR_HUMAN	follicle stimulating hormone receptor isoform 1	629	Helical; Name=7; (Potential).				female gamete generation|male gonad development|spermatogenesis	integral to membrane|plasma membrane	follicle-stimulating hormone receptor activity|protein binding			ovary(4)|lung(2)|central_nervous_system(1)|skin(1)	8		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Urofollitropin(DB00094)	AGTTTTTGGTAAAGATGGCAT	0.468									Gonadal_Dysgenesis_46_XX				5	37	---	---	---	---	PASS
PSME4	23198	broad.mit.edu	37	2	54093286	54093286	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54093286G>A	uc002rxp.2	-	46	5528	c.5472C>T	c.(5470-5472)TTC>TTT	p.F1824F	PSME4_uc010yop.1_Silent_p.F1714F|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Silent_p.F1199F|PSME4_uc010fbv.1_Silent_p.F968F|PSME4_uc010fbt.1_Silent_p.F259F	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	1824					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GGTCATCAGTGAATTGCTGTT	0.398													23	78	---	---	---	---	PASS
MEIS1	4211	broad.mit.edu	37	2	66775088	66775088	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66775088C>T	uc002sdu.2	+	9	1359	c.902C>T	c.(901-903)TCT>TTT	p.S301F	MEIS1_uc002sdt.2_Missense_Mutation_p.S301F|MEIS1_uc002sdv.2_Missense_Mutation_p.S299F|MEIS1_uc010yqh.1_RNA|MEIS1_uc010yqi.1_Missense_Mutation_p.S236F|MEIS1_uc002sdw.1_Missense_Mutation_p.S157F	NM_002398	NP_002389	O00470	MEIS1_HUMAN	Meis homeobox 1	301	Homeobox; TALE-type.						sequence-specific DNA binding transcription factor activity				0						CCTTACCCTTCTGAAGAACAG	0.383													20	26	---	---	---	---	PASS
ARHGAP25	9938	broad.mit.edu	37	2	69015022	69015022	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69015022A>T	uc002seu.2	+	4	764	c.400A>T	c.(400-402)AGC>TGC	p.S134C	ARHGAP25_uc010yqk.1_Missense_Mutation_p.S108C|ARHGAP25_uc010fdg.2_Missense_Mutation_p.S134C|ARHGAP25_uc010yql.1_Intron|ARHGAP25_uc002sev.2_Missense_Mutation_p.S127C|ARHGAP25_uc002sew.2_Missense_Mutation_p.S127C|ARHGAP25_uc002sex.2_Missense_Mutation_p.S127C|ARHGAP25_uc010fdh.1_RNA	NM_001007231	NP_001007232	P42331	RHG25_HUMAN	Rho GTPase activating protein 25 isoform a	134	PH.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)|breast(2)	4						CCTCATGGCCAGCTCTCAGGC	0.542													3	72	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	77748798	77748798	+	5'UTR	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77748798C>A	uc002snr.2	-	2					LRRTM4_uc002snq.2_5'UTR|LRRTM4_uc002sns.2_5'UTR|LRRTM4_uc002snt.2_Intron	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		ACTTACCCATCCTTTGTCATC	0.473													16	152	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89159973	89159973	+	Intron	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89159973A>C	uc010ytr.1	-						uc002sti.1_RNA|uc002stj.1_Intron					Parts of antibodies, mostly variable regions.																		GGCAAATCTTAAATGCCCTCA	0.323													7	15	---	---	---	---	PASS
TGFBRAP1	9392	broad.mit.edu	37	2	105883968	105883968	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105883968G>C	uc002tcq.2	-	12	2539	c.2455C>G	c.(2455-2457)CAG>GAG	p.Q819E	TGFBRAP1_uc010fjc.2_Missense_Mutation_p.Q588E|TGFBRAP1_uc002tcr.3_Missense_Mutation_p.Q819E|uc002tcp.2_5'Flank	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor	819					regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2						TGGCATATCTGACAAAGCTTT	0.433													23	116	---	---	---	---	PASS
RGPD3	653489	broad.mit.edu	37	2	107040796	107040796	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107040796C>G	uc010ywi.1	-	20	3684	c.3627G>C	c.(3625-3627)TTG>TTC	p.L1209F		NM_001144013	NP_001137485	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	1209					intracellular transport		binding			ovary(1)	1						GATCATTTGTCAAAAATGTTT	0.408													37	192	---	---	---	---	PASS
MALL	7851	broad.mit.edu	37	2	110849283	110849283	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110849283C>G	uc002tfk.2	-	2	944	c.170G>C	c.(169-171)GGA>GCA	p.G57A	MALL_uc010fju.2_Intron	NM_005434	NP_005425	Q13021	MALL_HUMAN	mal, T-cell differentiation protein-like	57	MARVEL.				cholesterol homeostasis	clathrin-coated vesicle|Golgi membrane|integral to membrane|membrane raft|plasma membrane	protein binding			ovary(1)|skin(1)	2				Epithelial(1;0.0546)|STAD - Stomach adenocarcinoma(1;0.18)		CATCACCCATCCTTGCAGCAA	0.433													4	71	---	---	---	---	PASS
WASH2P	375260	broad.mit.edu	37	2	114355998	114355998	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114355998C>G	uc002tkh.2	+	5	674	c.616C>G	c.(616-618)CAC>GAC	p.H206D	WASH2P_uc002tka.2_RNA|WASH2P_uc002tkb.2_RNA|WASH2P_uc002tkd.2_RNA	NM_182905	NP_878908			WAS protein family homolog 1												0						CCAAGGTGGGCACTTGATGTC	0.612													3	9	---	---	---	---	PASS
SAP130	79595	broad.mit.edu	37	2	128775266	128775266	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128775266C>G	uc002tpp.2	-	3	546	c.414G>C	c.(412-414)GAG>GAC	p.E138D	SAP130_uc002tpo.2_5'Flank|SAP130_uc010fmd.2_Missense_Mutation_p.E138D|SAP130_uc002tpq.1_Missense_Mutation_p.E112D	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b	138	Pro-rich.				histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		TCATAAGTCCCTCCGAAAATG	0.478													20	27	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136567117	136567117	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136567117T>C	uc002tuu.1	-	8	2811	c.2800A>G	c.(2800-2802)AAC>GAC	p.N934D		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	934	3.|Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		TGGGTAAAGTTATCCCAGATG	0.552													4	61	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	139045532	139045532	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139045532T>A	uc010zbk.1	-	1	909	c.766A>T	c.(766-768)ACT>TCT	p.T256S						SubName: Full=cDNA, FLJ79100, highly similar to 14-3-3 protein epsilon (14-3-3E);																		CAATGGGGAGTTTCCAAGGGG	0.428													8	32	---	---	---	---	PASS
ORC4L	5000	broad.mit.edu	37	2	148705641	148705641	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148705641C>T	uc002twi.2	-	9	876	c.741G>A	c.(739-741)GAG>GAA	p.E247E	ORC4L_uc002twj.2_Silent_p.E247E|ORC4L_uc010zbo.1_Silent_p.E173E|ORC4L_uc010zbp.1_Silent_p.E30E|ORC4L_uc010fnr.2_Silent_p.E247E|ORC4L_uc010zbq.1_Silent_p.E163E|ORC4L_uc002twk.2_Silent_p.E247E|ORC4L_uc010zbr.1_Silent_p.E247E	NM_181741	NP_859525	O43929	ORC4_HUMAN	origin recognition complex subunit 4	247					cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|nucleoside-triphosphatase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.0963)|COAD - Colon adenocarcinoma(177;0.203)		CATTCCACTTCTCAGCAAAAA	0.294													6	94	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166229818	166229818	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166229818G>A	uc002udc.2	+	21	4223	c.3933G>A	c.(3931-3933)CTG>CTA	p.L1311L	SCN2A_uc002udd.2_Silent_p.L1311L|SCN2A_uc002ude.2_Silent_p.L1311L	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	1311	III.|Helical; Voltage-sensor; Name=S4 of repeat III; (Potential).				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	TAAGAGCTCTGAGGCCACTGA	0.433													4	85	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168101392	168101392	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168101392A>G	uc002udx.2	+	8	3508	c.3490A>G	c.(3490-3492)ACA>GCA	p.T1164A	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.T989A|XIRP2_uc010fpq.2_Missense_Mutation_p.T942A|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	989	Xin 18.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GGATGTTCGTACAGCATGTTT	0.398													29	40	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168108453	168108453	+	Silent	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168108453A>C	uc002udx.2	+	8	10569	c.10551A>C	c.(10549-10551)ATA>ATC	p.I3517I	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.I3342I|XIRP2_uc010fpq.2_Silent_p.I3295I|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	3342					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CTGCATTTATAAGTGGTAAAT	0.408													4	68	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179431334	179431334	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179431334C>G	uc010zfg.1	-	275	72045	c.71821G>C	c.(71821-71823)GGT>CGT	p.G23941R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G17636R|TTN_uc010zfi.1_Missense_Mutation_p.G17569R|TTN_uc010zfj.1_Missense_Mutation_p.G17444R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24868							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGGGTTTACCCCAGGCAAGT	0.423													24	206	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179547564	179547564	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179547564C>T	uc010zfg.1	-	132	29446	c.29222G>A	c.(29221-29223)CGG>CAG	p.R9741Q	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R6402Q|TTN_uc010fre.1_Missense_Mutation_p.R588Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	10668							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTTCTTCCCGTTGTACTGA	0.353													6	57	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179596956	179596956	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179596956A>C	uc010zfg.1	-	54	13232	c.13008T>G	c.(13006-13008)AAT>AAG	p.N4336K	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.N997K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5263							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTCTATCATTTGCAAACC	0.423													62	85	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	190044277	190044277	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190044277T>A	uc002uqk.2	-	1	329	c.54A>T	c.(52-54)TTA>TTT	p.L18F		NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	18					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CAAATTGCCCTAATAAAACAA	0.413													16	21	---	---	---	---	PASS
STAT1	6772	broad.mit.edu	37	2	191847151	191847151	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191847151G>C	uc002usj.2	-	18	1928	c.1540C>G	c.(1540-1542)CTC>GTC	p.L514V	STAT1_uc010fse.1_Missense_Mutation_p.L514V|STAT1_uc002usk.2_Missense_Mutation_p.L514V|STAT1_uc002usl.2_Missense_Mutation_p.L516V|STAT1_uc010fsf.1_Missense_Mutation_p.L326V	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription	514					activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity			lung(3)|breast(3)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Fludarabine(DB01073)	TCCACATTGAGACCTCTTTTG	0.398													34	100	---	---	---	---	PASS
HECW2	57520	broad.mit.edu	37	2	197092943	197092943	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197092943A>G	uc002utm.1	-	22	3983	c.3800T>C	c.(3799-3801)TTC>TCC	p.F1267S	HECW2_uc002utl.1_Missense_Mutation_p.F911S	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	1267	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						GGATACCAGGAAGAAAAACTC	0.348													12	46	---	---	---	---	PASS
GTF3C3	9330	broad.mit.edu	37	2	197641263	197641263	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197641263A>G	uc002uts.2	-	11	1571	c.1481T>C	c.(1480-1482)ATT>ACT	p.I494T	GTF3C3_uc010zgu.1_Missense_Mutation_p.I465T	NM_012086	NP_036218	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide	494	TPR 9.					transcription factor TFIIIC complex	DNA binding|protein binding			ovary(3)|breast(3)|pancreas(1)	7						AGAAAGTGAAATCCTTGCATC	0.473													4	114	---	---	---	---	PASS
ICA1L	130026	broad.mit.edu	37	2	203693838	203693838	+	Intron	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203693838G>T	uc002uzh.1	-						ICA1L_uc002uzi.1_Intron|ICA1L_uc002uzj.2_5'UTR|ICA1L_uc002uzk.1_Intron	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1												0						ttgggaggctgaggcgagcgg	0.055													3	9	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220337015	220337015	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220337015T>A	uc010fwg.2	+	15	3902	c.3902T>A	c.(3901-3903)CTC>CAC	p.L1301H		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	1301	Fibronectin type-III 1.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		ATGGTCACACTCACATGGAAC	0.647													7	38	---	---	---	---	PASS
CAPN10	11132	broad.mit.edu	37	2	241531491	241531491	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241531491G>A	uc002vzk.1	+	4	796	c.612G>A	c.(610-612)GAG>GAA	p.E204E	CAPN10_uc010zoh.1_Silent_p.E204E|CAPN10_uc002vzl.1_Silent_p.E204E|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Silent_p.E76E|CAPN10_uc002vzo.1_RNA|CAPN10_uc010fzg.1_RNA|CAPN10_uc002vzp.1_RNA|CAPN10_uc002vzq.1_Intron	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10 isoform a	204	Calpain catalytic.				actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		GCCGCTGGGAGCACAGGACTT	0.657													7	8	---	---	---	---	PASS
MTERFD2	130916	broad.mit.edu	37	2	242038846	242038846	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242038846C>T	uc002wan.1	-	1	1065	c.572G>A	c.(571-573)CGC>CAC	p.R191H	MTERFD2_uc010zoj.1_Intron|MTERFD2_uc010zok.1_Missense_Mutation_p.R162H	NM_182501	NP_872307	Q7Z6M4	MTER2_HUMAN	MTERF domain containing 2	162										ovary(1)	1		all_cancers(19;4.67e-31)|all_epithelial(40;8.67e-13)|Breast(86;0.000141)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;2.47e-32)|all cancers(36;1.79e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-14)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;2.81e-06)|Lung(119;0.000509)|LUSC - Lung squamous cell carcinoma(224;0.00442)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0886)		GTAACTGGAGCGCTTCCTCAT	0.338													10	118	---	---	---	---	PASS
ATP2B2	491	broad.mit.edu	37	3	10417161	10417161	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10417161C>G	uc003bvt.2	-	11	1808	c.1369G>C	c.(1369-1371)GAG>CAG	p.E457Q	ATP2B2_uc003bvv.2_Missense_Mutation_p.E412Q|ATP2B2_uc003bvw.2_Missense_Mutation_p.E412Q|ATP2B2_uc010hdo.2_Missense_Mutation_p.E162Q	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	457	Helical; (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						GGGAGCCCCTCGGGCACGGCG	0.622													22	90	---	---	---	---	PASS
ARPP21	10777	broad.mit.edu	37	3	35770879	35770879	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35770879G>T	uc003cgb.2	+	15	1574	c.1310G>T	c.(1309-1311)GGT>GTT	p.G437V	ARPP21_uc003cga.2_Missense_Mutation_p.G383V|ARPP21_uc011axy.1_Missense_Mutation_p.G403V|ARPP21_uc003cgf.2_Missense_Mutation_p.G238V|ARPP21_uc003cgg.2_5'UTR	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD	437						cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3						CTAGTCTCAGGTGTGGCAGCT	0.587													7	49	---	---	---	---	PASS
VILL	50853	broad.mit.edu	37	3	38047993	38047993	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38047993C>A	uc003chj.2	+	19	2545	c.2259C>A	c.(2257-2259)GCC>GCA	p.A753A	VILL_uc003chl.2_Silent_p.A753A	NM_015873	NP_056957	O15195	VILL_HUMAN	villin-like protein	753					actin filament capping|cytoskeleton organization	actin cytoskeleton	actin binding|structural constituent of cytoskeleton				0				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		GGGCAGGTGCCGTGGCCCTGC	0.622													63	69	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38739807	38739807	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38739807T>G	uc003ciq.2	-	27	4904	c.4904A>C	c.(4903-4905)GAG>GCG	p.E1635A		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	1635	IV.				sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	GATGCCAGCCTCCCACCTCAC	0.552													5	171	---	---	---	---	PASS
RTP3	83597	broad.mit.edu	37	3	46542298	46542298	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46542298G>A	uc003cps.1	+	2	676	c.608G>A	c.(607-609)TGC>TAC	p.C203Y		NM_031440	NP_113628	Q9BQQ7	RTP3_HUMAN	transmembrane protein 7	203	Cytoplasmic (Potential).				detection of chemical stimulus involved in sensory perception of bitter taste|protein targeting to membrane	cytoplasm|integral to membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		TCCTACGCATGCCAAAACCAC	0.428													4	72	---	---	---	---	PASS
SMARCC1	6599	broad.mit.edu	37	3	47755937	47755937	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47755937C>T	uc003crq.2	-	8	878	c.760G>A	c.(760-762)GAA>AAA	p.E254K	SMARCC1_uc011bbd.1_Missense_Mutation_p.E145K	NM_003074	NP_003065	Q92922	SMRC1_HUMAN	SWI/SNF-related matrix-associated	254					chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			skin(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		GGTGGATCTTCAATTTCAGCA	0.244													22	49	---	---	---	---	PASS
OR5K2	402135	broad.mit.edu	37	3	98217282	98217282	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98217282G>T	uc011bgx.1	+	1	758	c.758G>T	c.(757-759)GGA>GTA	p.G253V		NM_001004737	NP_001004737	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K,	253	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2						TTATTCTATGGATCTATTTTT	0.328													10	50	---	---	---	---	PASS
RPL24	6152	broad.mit.edu	37	3	101400024	101400024	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101400024C>A	uc003dvh.1	-	6	472	c.429G>T	c.(427-429)GTG>GTT	p.V143V	RPL24_uc003dvi.1_Nonstop_Mutation_p.*122L	NM_000986	NP_000977	P83731	RL24_HUMAN	ribosomal protein L24	143					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0						TCACAGGCTTCACAATCTTTT	0.383													38	106	---	---	---	---	PASS
QTRTD1	79691	broad.mit.edu	37	3	113804793	113804793	+	3'UTR	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113804793A>T	uc003eay.2	+	10					QTRTD1_uc003eaz.2_3'UTR|QTRTD1_uc011biq.1_3'UTR|QTRTD1_uc011bir.1_3'UTR	NM_024638	NP_078914	Q9H974	QTRD1_HUMAN	queuine tRNA-ribosyltransferase domain						queuosine biosynthetic process	mitochondrion	metal ion binding|queuine tRNA-ribosyltransferase activity			central_nervous_system(1)|skin(1)	2						CTGAGCCTGTACCACTGTTGT	0.373													3	23	---	---	---	---	PASS
MYLK	4638	broad.mit.edu	37	3	123419119	123419119	+	Missense_Mutation	SNP	C	T	T	rs72491150		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123419119C>T	uc003ego.2	-	18	3478	c.3196G>A	c.(3196-3198)GAA>AAA	p.E1066K	MYLK_uc011bjw.1_Missense_Mutation_p.E1066K|MYLK_uc003egp.2_Missense_Mutation_p.E997K|MYLK_uc003egq.2_Missense_Mutation_p.E1066K|MYLK_uc003egr.2_Missense_Mutation_p.E997K|MYLK_uc003egs.2_Missense_Mutation_p.E890K|MYLK_uc003egt.2_Missense_Mutation_p.E257K	NM_053025	NP_444253	Q15746	MYLK_HUMAN	myosin light chain kinase isoform 1	1066	Actin-binding (calcium/calmodulin- insensitive) (By similarity).				aorta smooth muscle tissue morphogenesis|muscle contraction	cytosol	actin binding|ATP binding|calmodulin binding|metal ion binding|myosin light chain kinase activity			ovary(6)|skin(2)|stomach(1)	9		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TTCTTGAGTTCTTCTTTGCTA	0.527													141	162	---	---	---	---	PASS
COL29A1	256076	broad.mit.edu	37	3	130159571	130159571	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130159571A>T	uc010htj.1	+	35	6883	c.6389A>T	c.(6388-6390)TAC>TTC	p.Y2130F	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Missense_Mutation_p.Y169F	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2130	VWFA 9.|Nonhelical region.				axon guidance|cell adhesion	collagen					0						TTAGCCAGCTACCCACTTGAT	0.423													3	34	---	---	---	---	PASS
NEK11	79858	broad.mit.edu	37	3	130871348	130871348	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130871348G>A	uc003eny.2	+	8	1090	c.764G>A	c.(763-765)AGA>AAA	p.R255K	NEK11_uc003enx.2_Missense_Mutation_p.R255K|NEK11_uc003eoa.2_Missense_Mutation_p.R255K|NEK11_uc003enz.2_Missense_Mutation_p.R73K|NEK11_uc010htn.2_RNA|NEK11_uc011blk.1_Missense_Mutation_p.R107K|NEK11_uc011bll.1_Intron|NEK11_uc011blm.1_Missense_Mutation_p.R255K|NEK11_uc010hto.1_Missense_Mutation_p.R107K	NM_024800	NP_079076	Q8NG66	NEK11_HUMAN	NIMA-related kinase 11 isoform 1	255	Protein kinase.				cell cycle|intra-S DNA damage checkpoint|intracellular protein kinase cascade	nucleolus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(4)|stomach(1)|central_nervous_system(1)	6						CTCCCTGAGAGATATCCAAAA	0.333													19	84	---	---	---	---	PASS
COPB2	9276	broad.mit.edu	37	3	139108440	139108440	+	5'UTR	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139108440C>G	uc003etf.3	-	1					COPB2_uc011bmv.1_Intron|COPB2_uc010hui.2_5'UTR|COPB2_uc011bmw.1_5'UTR|COPB2_uc003etg.2_5'UTR	NM_004766	NP_004757	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(2)	2						ACCGGCTACTCAGGCCTTGAG	0.607													17	24	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	151102914	151102914	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151102914A>G	uc003eyp.2	+	34	4956	c.4918A>G	c.(4918-4920)ATG>GTG	p.M1640V	MED12L_uc011bnz.1_Missense_Mutation_p.M1500V|P2RY12_uc011boa.1_5'Flank|P2RY12_uc003eyx.1_5'Flank|MED12L_uc003eyy.1_Missense_Mutation_p.M803V	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	1640					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTGTGAACCTATGGGTTCCTT	0.348													109	77	---	---	---	---	PASS
GPR149	344758	broad.mit.edu	37	3	154055940	154055940	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154055940T>C	uc003faa.2	-	4	1844	c.1744A>G	c.(1744-1746)ATA>GTA	p.I582V		NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	582	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GCTGGAGTTATTTTTTGCCCT	0.453													6	272	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155212182	155212182	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155212182G>T	uc011bok.1	-	15	2260	c.1983C>A	c.(1981-1983)CGC>CGA	p.R661R	PLCH1_uc011boj.1_Silent_p.R661R|PLCH1_uc011bol.1_Silent_p.R643R	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	661	PI-PLC Y-box.				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TGGAATCAATGCGGTAGGCAG	0.453													5	80	---	---	---	---	PASS
VEPH1	79674	broad.mit.edu	37	3	156983384	156983384	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156983384G>A	uc003fbj.1	-	13	2513	c.2196C>T	c.(2194-2196)TTC>TTT	p.F732F	VEPH1_uc003fbk.1_Silent_p.F732F|VEPH1_uc010hvu.1_Silent_p.F687F	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1	732	PH.					plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			ACCTTTTGATGAACTTCCATC	0.383													55	60	---	---	---	---	PASS
MECOM	2122	broad.mit.edu	37	3	168845829	168845829	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168845829G>T	uc003ffi.3	-	4	338	c.69C>A	c.(67-69)TGC>TGA	p.C23*	MECOM_uc010hwk.1_Nonsense_Mutation_p.C46*|MECOM_uc003ffj.3_Nonsense_Mutation_p.C87*|MECOM_uc011bpi.1_Nonsense_Mutation_p.C23*|MECOM_uc003ffn.3_Nonsense_Mutation_p.C23*|MECOM_uc003ffk.2_Nonsense_Mutation_p.C23*|MECOM_uc003ffl.2_Nonsense_Mutation_p.C183*|MECOM_uc011bpj.1_Nonsense_Mutation_p.C211*|MECOM_uc011bpk.1_Nonsense_Mutation_p.C13*|MECOM_uc010hwn.2_Nonsense_Mutation_p.C211*|MECOM_uc003ffm.1_Nonsense_Mutation_p.C87*	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	23	C2H2-type 1.|Interaction with MAPK9, SMAD3 and probably SUV39H1.				apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						CACAGTCTTCGCAGCGATATT	0.433													12	120	---	---	---	---	PASS
ARPM1	84517	broad.mit.edu	37	3	169485742	169485742	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169485742C>G	uc003ffs.1	-	2	972	c.597G>C	c.(595-597)TTG>TTC	p.L199F	TERC_uc003ffr.1_5'Flank	NM_032487	NP_115876	Q9BYD9	ARPM1_HUMAN	actin related protein M1	199						cytoplasm|cytoskeleton					0	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;5.01e-59)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			AAGCACTGAGCAACATGATAC	0.468													7	118	---	---	---	---	PASS
MFN1	55669	broad.mit.edu	37	3	179082125	179082125	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179082125G>C	uc003fjs.2	+	6	703	c.577G>C	c.(577-579)GAT>CAT	p.D193H	MFN1_uc010hxb.2_RNA|MFN1_uc003fjt.2_Missense_Mutation_p.D221H|MFN1_uc010hxc.2_Missense_Mutation_p.D46H	NM_033540	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	193	Cytoplasmic (Potential).				mitochondrial fusion	integral to membrane|mitochondrial outer membrane	GTP binding|GTPase activity			ovary(2)|large_intestine(1)	3	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			TAGCTGGATTGATAAGTTTTG	0.338													5	57	---	---	---	---	PASS
KNG1	3827	broad.mit.edu	37	3	186459867	186459867	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186459867C>T	uc011bsa.1	+	10	1894	c.1682C>T	c.(1681-1683)TCT>TTT	p.S561F	KNG1_uc003fqr.2_Intron	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	561					blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	GTTACCTTTTCTGACTTTCAG	0.473													8	103	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	187003830	187003830	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187003830T>C	uc003frh.1	-	2	352	c.20A>G	c.(19-21)TAT>TGT	p.Y7C	MASP1_uc003fri.2_Missense_Mutation_p.Y7C|MASP1_uc003frj.2_Intron|MASP1_uc003frk.1_Missense_Mutation_p.Y7C|MASP1_uc011bse.1_5'UTR	NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	7					complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CAGAGCATAATAGAGAAGCAG	0.468													7	48	---	---	---	---	PASS
MFSD7	84179	broad.mit.edu	37	4	677066	677066	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:677066C>G	uc003gay.2	-	8	1144	c.1087G>C	c.(1087-1089)GAG>CAG	p.E363Q	MFSD7_uc003gaw.2_Missense_Mutation_p.E105Q|MFSD7_uc003gax.2_Missense_Mutation_p.E362Q|MFSD7_uc003gaz.2_Missense_Mutation_p.E244Q|MFSD7_uc003gba.2_Missense_Mutation_p.E266Q|MFSD7_uc003gbb.1_Missense_Mutation_p.E298Q	NM_032219	NP_115595	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing	363					transmembrane transport	integral to membrane					0						ACCGCCAACTCCATGGCCACG	0.667													6	70	---	---	---	---	PASS
PPP2R2C	5522	broad.mit.edu	37	4	6325278	6325278	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6325278G>T	uc003gjc.2	-	9	1465	c.1095C>A	c.(1093-1095)TTC>TTA	p.F365L	PPP2R2C_uc003gjb.2_Missense_Mutation_p.F348L|PPP2R2C_uc011bwd.1_Missense_Mutation_p.F358L|PPP2R2C_uc011bwe.1_Missense_Mutation_p.F358L|PPP2R2C_uc003gja.2_Missense_Mutation_p.F365L	NM_020416	NP_065149	Q9Y2T4	2ABG_HUMAN	gamma isoform of regulatory subunit B55, protein	365	WD 6.				signal transduction	protein phosphatase type 2A complex	protein phosphatase type 2A regulator activity			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4						TGTTCCGATCGAACATGCGGA	0.622													6	21	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13602053	13602053	+	Silent	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13602053G>C	uc003gmz.1	-	10	6588	c.6471C>G	c.(6469-6471)TCC>TCG	p.S2157S	BOD1L_uc010idr.1_Silent_p.S1494S	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	2157							DNA binding			ovary(5)|breast(1)	6						TTGTTGCACTGGAGATAGGCA	0.498													21	47	---	---	---	---	PASS
AFP	174	broad.mit.edu	37	4	74320990	74320990	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74320990G>T	uc003hgz.1	+	14	1870	c.1823G>T	c.(1822-1824)GGA>GTA	p.G608V	AFP_uc003hha.1_Intron|AFP_uc011cbg.1_Missense_Mutation_p.G382V	NM_001134	NP_001125	P02771	FETA_HUMAN	alpha-fetoprotein precursor	608					transport		metal ion binding			ovary(1)	1	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GCTGCTTTGGGAGTTTAAATT	0.313									Alpha-Fetoprotein_Hereditary_Persistence_of				27	57	---	---	---	---	PASS
COPS4	51138	broad.mit.edu	37	4	83989596	83989596	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83989596A>T	uc003hoa.2	+	9	1147	c.1008A>T	c.(1006-1008)GAA>GAT	p.E336D	COPS4_uc003hob.2_Missense_Mutation_p.E336D|COPS4_uc010ijw.2_Missense_Mutation_p.E368D|COPS4_uc010ijx.2_Intron	NM_016129	NP_057213	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	336	PCI.				cullin deneddylation	cytoplasm|signalosome	protein binding			kidney(1)	1		Hepatocellular(203;0.114)				AATAGGCGGAAAAGATAGCAT	0.328													13	52	---	---	---	---	PASS
AFF1	4299	broad.mit.edu	37	4	88036209	88036209	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88036209C>G	uc003hqj.3	+	11	2610	c.2203C>G	c.(2203-2205)CGC>GGC	p.R735G	AFF1_uc011ccz.1_Missense_Mutation_p.R742G|AFF1_uc003hqk.3_Missense_Mutation_p.R735G|AFF1_uc011cda.1_Missense_Mutation_p.R373G	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	735						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		GGAGGACAGCCGCAAAGACAG	0.607													10	22	---	---	---	---	PASS
ADH6	130	broad.mit.edu	37	4	100126055	100126055	+	3'UTR	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100126055G>C	uc003hup.3	-	8					uc003hum.1_Intron|ADH6_uc003huo.2_Intron|ADH6_uc011cef.1_Intron|ADH6_uc010ile.2_3'UTR	NM_000672	NP_000663	P28332	ADH6_HUMAN	class V alcohol dehydrogenase isoform 2						ethanol oxidation|response to ethanol|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|electron carrier activity|zinc ion binding			ovary(1)|kidney(1)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)|NADH(DB00157)	CAAACACACAGACATAAAATT	0.383													15	32	---	---	---	---	PASS
TACR3	6870	broad.mit.edu	37	4	104510983	104510983	+	Silent	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104510983T>C	uc003hxe.1	-	5	1397	c.1254A>G	c.(1252-1254)GCA>GCG	p.A418A		NM_001059	NP_001050	P29371	NK3R_HUMAN	tachykinin receptor 3	418	Cytoplasmic (Potential).					integral to plasma membrane	tachykinin receptor activity			ovary(3)|lung(2)|breast(1)|skin(1)	7		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		TGGTGGTGTCTGCATCGTTGG	0.517													13	168	---	---	---	---	PASS
COL25A1	84570	broad.mit.edu	37	4	109740467	109740467	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109740467C>T	uc003hze.1	-	35	2395	c.1864G>A	c.(1864-1866)GGG>AGG	p.G622R	COL25A1_uc003hzd.2_Intron	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1 isoform 1	622	Extracellular (Potential).|Collagen-like 7.					collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		CCTTTTTCCCCCTTAACGCCA	0.463													3	26	---	---	---	---	PASS
KIAA0922	23240	broad.mit.edu	37	4	154502664	154502664	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154502664G>A	uc003inm.3	+	9	896	c.844G>A	c.(844-846)GAT>AAT	p.D282N	KIAA0922_uc010ipp.2_Missense_Mutation_p.D282N|KIAA0922_uc010ipq.2_Missense_Mutation_p.D134N	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2	282	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				ACATTTGTTAGATCATCTCTC	0.318													20	28	---	---	---	---	PASS
FGA	2243	broad.mit.edu	37	4	155505643	155505643	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155505643C>A	uc003iod.1	-	6	2292	c.2234G>T	c.(2233-2235)GGC>GTC	p.G745V		NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	745	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	AGCCTCAGAGCCTACCCGGAA	0.527													14	44	---	---	---	---	PASS
FGA	2243	broad.mit.edu	37	4	155505644	155505644	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155505644C>A	uc003iod.1	-	6	2291	c.2233G>T	c.(2233-2235)GGC>TGC	p.G745C		NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	745	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	GCCTCAGAGCCTACCCGGAAG	0.522													15	44	---	---	---	---	PASS
WWC2	80014	broad.mit.edu	37	4	184129307	184129307	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184129307G>C	uc010irx.2	+	3	625	c.443G>C	c.(442-444)AGC>ACC	p.S148T	WWC2_uc003ivk.3_5'UTR|WWC2_uc003ivl.3_RNA|WWC2_uc010iry.2_5'Flank	NM_024949	NP_079225	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	148	Potential.									ovary(2)|lung(1)	3		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		TCTCACACAAGCTGTAAGTAC	0.423													4	13	---	---	---	---	PASS
FRG1	2483	broad.mit.edu	37	4	190862215	190862215	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190862215C>A	uc003izs.2	+	1	242	c.51C>A	c.(49-51)ACC>ACA	p.T17T	uc003izq.2_5'Flank	NM_004477	NP_004468	Q14331	FRG1_HUMAN	FSHD region gene 1	17	Lys-rich.				rRNA processing	Cajal body|catalytic step 2 spliceosome|nuclear speck|nucleolus					0		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TCAAGGGAACCAAGACGAAGA	0.632											OREG0016457	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	15	---	---	---	---	PASS
ZNF622	90441	broad.mit.edu	37	5	16465637	16465637	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16465637G>T	uc003jfq.2	-	1	258	c.138C>A	c.(136-138)GGC>GGA	p.G46G		NM_033414	NP_219482	Q969S3	ZN622_HUMAN	zinc finger protein 622	46						cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						GCTCCTGGAAGCCCTCGGCGG	0.662													5	169	---	---	---	---	PASS
RAI14	26064	broad.mit.edu	37	5	34823943	34823943	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34823943A>C	uc003jir.2	+	15	2192	c.1996A>C	c.(1996-1998)AAA>CAA	p.K666Q	RAI14_uc010iur.2_Missense_Mutation_p.K637Q|RAI14_uc011coj.1_Missense_Mutation_p.K666Q|RAI14_uc003jis.2_Missense_Mutation_p.K669Q|RAI14_uc003jit.2_Missense_Mutation_p.K666Q|RAI14_uc011cok.1_Missense_Mutation_p.K658Q	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a	666	Potential.					cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					CAGGAAGAGGAAATCTCTAGA	0.448													8	80	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45303809	45303809	+	Nonsense_Mutation	SNP	G	A	A	rs35229491		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45303809G>A	uc003jok.2	-	6	1535	c.1510C>T	c.(1510-1512)CGA>TGA	p.R504*		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	504	cAMP.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GCTCCTTCTCGTATGATATAA	0.403													50	152	---	---	---	---	PASS
ADAMTS6	11174	broad.mit.edu	37	5	64748566	64748566	+	Missense_Mutation	SNP	T	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64748566T>G	uc003jtp.2	-	5	1625	c.811A>C	c.(811-813)ATT>CTT	p.I271L	ADAMTS6_uc003jto.2_RNA|ADAMTS6_uc003jtq.2_RNA|ADAMTS6_uc003jtr.1_5'UTR	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1	271	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		TAATGTTCAATGTCTTTGCGG	0.368													33	28	---	---	---	---	PASS
MCCC2	64087	broad.mit.edu	37	5	70930791	70930791	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70930791C>A	uc003kbs.3	+	9	963	c.825C>A	c.(823-825)CAC>CAA	p.H275Q	MCCC2_uc010iyv.1_Missense_Mutation_p.H275Q|MCCC2_uc003kbt.3_RNA|MCCC2_uc003kbu.1_Missense_Mutation_p.H144Q	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)	275	Carboxyltransferase.				leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	TAAGTGACCACTGGGCTTTGG	0.368													36	28	---	---	---	---	PASS
ARRDC3	57561	broad.mit.edu	37	5	90669643	90669643	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90669643T>C	uc003kjz.2	-	7	1286	c.1046A>G	c.(1045-1047)TAT>TGT	p.Y349C		NM_020801	NP_065852	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	349					signal transduction	cytoplasm	protein binding			ovary(1)|breast(1)	2		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		CACTTCTGCATAGCTGGGTGG	0.428													38	26	---	---	---	---	PASS
SLC12A2	6558	broad.mit.edu	37	5	127471428	127471428	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127471428A>T	uc003kus.2	+	7	1500	c.1336A>T	c.(1336-1338)ATT>TTT	p.I446F	SLC12A2_uc010jdf.2_RNA|SLC12A2_uc010jdg.2_Missense_Mutation_p.I446F	NM_001046	NP_001037	P55011	S12A2_HUMAN	solute carrier family 12	446	Helical; (Potential).				potassium ion transport|sodium ion transport|transepithelial ammonium transport|transepithelial chloride transport	integral to plasma membrane|membrane fraction	ammonia transmembrane transporter activity|sodium:potassium:chloride symporter activity			ovary(3)	3		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	ACTTCTTGCTATTGGTGATTT	0.264													3	55	---	---	---	---	PASS
C5orf24	134553	broad.mit.edu	37	5	134191220	134191220	+	3'UTR	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134191220G>C	uc003kzx.2	+	2					C5orf24_uc003kzy.3_Intron|C5orf24_uc003kzz.2_3'UTR	NM_152409	NP_689622	Q7Z6I8	CE024_HUMAN	hypothetical protein LOC134553												0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AAGCTTCTTGGTTTTATTTTG	0.388													13	6	---	---	---	---	PASS
ETF1	2107	broad.mit.edu	37	5	137849377	137849377	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137849377A>C	uc003ldc.3	-	5	586	c.421T>G	c.(421-423)TCA>GCA	p.S141A	ETF1_uc011cyv.1_Missense_Mutation_p.S127A|ETF1_uc010jex.2_RNA|ETF1_uc003ldd.3_Missense_Mutation_p.S108A|ETF1_uc010jey.1_5'UTR	NM_004730	NP_004721	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	141					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|protein methylation|regulation of translational termination	cytoplasm	protein binding|ribosome binding|translation release factor activity, codon specific			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			CTATCATCTGAAAGTAGTGCT	0.403													22	19	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140517289	140517289	+	Nonsense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140517289C>G	uc003liq.2	+	1	2490	c.2273C>G	c.(2272-2274)TCA>TGA	p.S758*		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	758	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACCGGAGACTCAGGGGCCGGC	0.592													24	108	---	---	---	---	PASS
PCDHGB3	56102	broad.mit.edu	37	5	140751625	140751625	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140751625G>A	uc003ljw.1	+	1	1664	c.1664G>A	c.(1663-1665)CGC>CAC	p.R555H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGA6_uc003ljy.1_5'Flank|PCDHGB3_uc011dat.1_Missense_Mutation_p.R555H|PCDHGA6_uc011dau.1_5'Flank	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	555	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGACGACCGCAACGACAAT	0.667													3	30	---	---	---	---	PASS
GABRG2	2566	broad.mit.edu	37	5	161494966	161494966	+	5'UTR	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161494966C>A	uc003lyz.3	+	1					GABRG2_uc010jjc.2_5'UTR|GABRG2_uc003lyy.3_5'UTR|GABRG2_uc011dej.1_5'UTR	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		TCTTCTGCAACCAAGAGGCAA	0.468													7	8	---	---	---	---	PASS
FBXW11	23291	broad.mit.edu	37	5	171318553	171318553	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171318553C>T	uc003mbm.1	-	6	1078	c.707G>A	c.(706-708)CGC>CAC	p.R236H	FBXW11_uc011dey.1_Missense_Mutation_p.R204H|FBXW11_uc003mbl.1_Missense_Mutation_p.R223H|FBXW11_uc003mbn.1_Missense_Mutation_p.R202H	NM_012300	NP_036432	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11 isoform	236					cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of circadian rhythm|positive regulation of proteolysis|positive regulation of transcription, DNA-dependent|protein dephosphorylation|protein destabilization|protein polyubiquitination|rhythmic process|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	centrosome|cytosol|nucleus|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity	p.N260_I262(1)|p.R236C(1)		ovary(1)|breast(1)	2	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ATTTTCAGAGCGGCACTGAAT	0.378													5	44	---	---	---	---	PASS
FGFR4	2264	broad.mit.edu	37	5	176518005	176518005	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176518005T>A	uc003mfl.2	+	5	670	c.503T>A	c.(502-504)GTC>GAC	p.V168D	FGFR4_uc003mfm.2_Missense_Mutation_p.V168D|FGFR4_uc011dfu.1_Missense_Mutation_p.V168D|FGFR4_uc011dfv.1_RNA|FGFR4_uc003mfn.1_3'UTR|FGFR4_uc011dfw.1_Missense_Mutation_p.V168D|FGFR4_uc003mfo.2_Missense_Mutation_p.V168D	NM_002011	NP_002002	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4 isoform 1	168	Extracellular (Potential).|Ig-like C2-type 2.				insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity			lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)	GGGAACACCGTCAAGTTCCGC	0.612										TSP Lung(9;0.080)			14	11	---	---	---	---	PASS
ZNF354C	30832	broad.mit.edu	37	5	178503483	178503483	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178503483G>A	uc003mju.2	+	3	180	c.65G>A	c.(64-66)AGC>AAC	p.S22N		NM_014594	NP_055409	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	22	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		GTGTTCTTCAGCCAGGACGAG	0.542													13	42	---	---	---	---	PASS
FAM50B	26240	broad.mit.edu	37	6	3850672	3850672	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3850672G>A	uc003mvu.2	+	2	739	c.627G>A	c.(625-627)GTG>GTA	p.V209V		NM_012135	NP_036267	Q9Y247	FA50B_HUMAN	family with sequence similarity 50, member B	209						nucleus				pancreas(1)	1	Ovarian(93;0.0925)	all_hematologic(90;0.108)				GCAACACGGTGCAGCAGTTCC	0.647													35	53	---	---	---	---	PASS
NKAPL	222698	broad.mit.edu	37	6	28228103	28228103	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28228103C>A	uc003nkt.2	+	1	1006	c.954C>A	c.(952-954)ATC>ATA	p.I318I	ZKSCAN4_uc011dlb.1_5'Flank	NM_001007531	NP_001007532	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	318										upper_aerodigestive_tract(1)|ovary(1)	2						GAAAGCGAATCCCACGAAGAG	0.463													6	105	---	---	---	---	PASS
ZFP57	346171	broad.mit.edu	37	6	29640795	29640795	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29640795G>C	uc011dlw.1	-	4	1244	c.1093C>G	c.(1093-1095)CTC>GTC	p.L365V	ZFP57_uc003nnl.3_Missense_Mutation_p.L345V	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog	281					DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5						TCCTGACAGAGGGTTCCAGTG	0.493													124	88	---	---	---	---	PASS
ZFP57	346171	broad.mit.edu	37	6	29640796	29640796	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29640796G>T	uc011dlw.1	-	4	1243	c.1092C>A	c.(1090-1092)ACC>ACA	p.T364T	ZFP57_uc003nnl.3_Silent_p.T344T	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog	280					DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5						CCTGACAGAGGGTTCCAGTGA	0.493													124	88	---	---	---	---	PASS
TRIM10	10107	broad.mit.edu	37	6	30128418	30128418	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30128418C>T	uc003npo.3	-	1	294	c.218G>A	c.(217-219)TGG>TAG	p.W73*	TRIM10_uc003npn.2_Nonsense_Mutation_p.W73*|TRIM15_uc010jrx.2_5'Flank	NM_006778	NP_006769	Q9UDY6	TRI10_HUMAN	tripartite motif-containing 10 isoform 1	73						cytoplasm	zinc ion binding				0						AGCCAGCTGCCAGTTGGGCCG	0.592													102	60	---	---	---	---	PASS
POU5F1	5460	broad.mit.edu	37	6	31133762	31133762	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31133762C>G	uc003nsv.2	-	2	522	c.468G>C	c.(466-468)AAG>AAC	p.K156N	POU5F1_uc003nsu.2_Missense_Mutation_p.K61N|uc011dnf.1_RNA	NM_002701	NP_002692	Q01860	PO5F1_HUMAN	POU domain, class 5, transcription factor 1	156	POU-specific.				anatomical structure morphogenesis|blastocyst development|BMP signaling pathway involved in heart induction|cardiac cell fate determination|cell fate commitment involved in formation of primary germ layers|mRNA transcription from RNA polymerase II promoter|negative regulation of gene silencing by miRNA|positive regulation of catenin import into nucleus|positive regulation of SMAD protein import into nucleus|positive regulation of transcription from RNA polymerase II promoter|regulation of asymmetric cell division|regulation of heart induction by regulation of canonical Wnt receptor signaling pathway|regulation of methylation-dependent chromatin silencing|response to wounding|somatic stem cell maintenance|somatic stem cell maintenance	cytosol|nucleoplasm|transcription factor complex	miRNA binding|sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding		EWSR1/POU5F1(10)	skin(7)|salivary_gland(2)|bone(2)|lung(1)|ovary(1)	13						GGGTGATCCTCTTCTGCTTCA	0.498			T	EWSR1	sarcoma								21	13	---	---	---	---	PASS
C6orf222	389384	broad.mit.edu	37	6	36291124	36291124	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36291124T>C	uc003oly.2	-	8	1595	c.1417A>G	c.(1417-1419)AGC>GGC	p.S473G		NM_001010903	NP_001010903	P0C671	CF222_HUMAN	hypothetical protein LOC389384	473										skin(2)|ovary(1)|breast(1)	4						GGCAGAAAGCTGGGCCTCTTG	0.622													21	64	---	---	---	---	PASS
C6orf222	389384	broad.mit.edu	37	6	36291125	36291125	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36291125G>T	uc003oly.2	-	8	1594	c.1416C>A	c.(1414-1416)CCC>CCA	p.P472P		NM_001010903	NP_001010903	P0C671	CF222_HUMAN	hypothetical protein LOC389384	472										skin(2)|ovary(1)|breast(1)	4						GCAGAAAGCTGGGCCTCTTGG	0.617													20	62	---	---	---	---	PASS
C6orf222	389384	broad.mit.edu	37	6	36291126	36291126	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36291126G>T	uc003oly.2	-	8	1593	c.1415C>A	c.(1414-1416)CCC>CAC	p.P472H		NM_001010903	NP_001010903	P0C671	CF222_HUMAN	hypothetical protein LOC389384	472										skin(2)|ovary(1)|breast(1)	4						CAGAAAGCTGGGCCTCTTGGG	0.612													25	62	---	---	---	---	PASS
KIF6	221458	broad.mit.edu	37	6	39693107	39693107	+	5'UTR	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39693107G>A	uc003oot.2	-	1					KIF6_uc011dua.1_5'UTR|KIF6_uc010jxb.1_5'UTR	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						GCTCTGCAATGACCCTTGACC	0.592													116	70	---	---	---	---	PASS
TRERF1	55809	broad.mit.edu	37	6	42236926	42236926	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42236926G>T	uc003osd.2	-	5	966	c.403C>A	c.(403-405)CTT>ATT	p.L135I	TRERF1_uc011duq.1_Missense_Mutation_p.L135I|TRERF1_uc003osb.2_5'UTR|TRERF1_uc003osc.2_5'UTR|TRERF1_uc003ose.2_Missense_Mutation_p.L135I	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	135					cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CCGCTGGTAAGCTTCTGGGTC	0.562													58	170	---	---	---	---	PASS
KHDRBS2	202559	broad.mit.edu	37	6	62887182	62887182	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:62887182C>A	uc003peg.2	-	2	374	c.127G>T	c.(127-129)GAA>TAA	p.E43*		NM_152688	NP_689901	Q5VWX1	KHDR2_HUMAN	KH domain-containing, RNA-binding, signal	43					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	SH3 domain binding			skin(7)|ovary(3)|liver(1)	11				BRCA - Breast invasive adenocarcinoma(397;0.149)		TCTTCGTCTTCCTTTTTTCCA	0.343													7	8	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79650578	79650578	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79650578C>G	uc003pir.2	-	40	5524	c.5298G>C	c.(5296-5298)ATG>ATC	p.M1766I	PHIP_uc003piq.2_Missense_Mutation_p.M790I|PHIP_uc011dyp.1_Missense_Mutation_p.M1765I|IRAK1BP1_uc010kbg.1_Intron|PHIP_uc003pio.3_Missense_Mutation_p.M652I	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1766					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TTCTAGTTCTCATGTGGGGTT	0.408													96	661	---	---	---	---	PASS
ORC3L	23595	broad.mit.edu	37	6	88331710	88331710	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88331710G>C	uc003pmh.2	+	11	1208	c.1164G>C	c.(1162-1164)TTG>TTC	p.L388F	ORC3L_uc011dzl.1_Missense_Mutation_p.L388F|ORC3L_uc011dzm.1_Missense_Mutation_p.L388F|ORC3L_uc011dzn.1_RNA|ORC3L_uc003pmg.2_Missense_Mutation_p.L388F|ORC3L_uc003pmi.2_Missense_Mutation_p.L350F|ORC3L_uc011dzo.1_Missense_Mutation_p.L245F|ORC3L_uc011dzp.1_Missense_Mutation_p.L245F	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2	388					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		TTGCGCTCTTGACCAATGAGA	0.313													10	57	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90354787	90354787	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90354787G>A	uc003pnn.1	-	101	16665	c.16549C>T	c.(16549-16551)CGG>TGG	p.R5517W		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	5517	VWFA.				protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TTTGCATTCCGGGCAGCCTGA	0.483													6	48	---	---	---	---	PASS
HSF2	3298	broad.mit.edu	37	6	122733619	122733619	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122733619G>A	uc003pyu.2	+	2	382	c.195G>A	c.(193-195)CTG>CTA	p.L65L	HSF2_uc003pyt.3_Silent_p.L65L|HSF2_uc003pyv.2_Silent_p.L65L	NM_004506	NP_004497	Q03933	HSF2_HUMAN	heat shock transcription factor 2 isoform a	65	By similarity.				response to stress|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		TGAGGCAACTGAATATGTGTG	0.373													47	39	---	---	---	---	PASS
TRMT11	60487	broad.mit.edu	37	6	126360069	126360069	+	3'UTR	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126360069T>C	uc003qam.2	+	13					TRMT11_uc003qan.2_RNA|TRMT11_uc010kev.2_3'UTR	NM_001031712	NP_001026882	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11						tRNA processing		methyltransferase activity|nucleic acid binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0356)		ATCCAGAAAATAGGTACGGTT	0.264													5	3	---	---	---	---	PASS
C6orf174	387104	broad.mit.edu	37	6	127796469	127796469	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127796469C>A	uc003qbd.2	-	6	3567	c.2702G>T	c.(2701-2703)CGC>CTC	p.R901L	C6orf174_uc003qbc.2_5'UTR	NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor	901						integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		CTCGGCGCCGCGGTCGTCCGC	0.667													4	68	---	---	---	---	PASS
NUDT1	4521	broad.mit.edu	37	7	2284269	2284269	+	Silent	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2284269G>C	uc003slp.1	+	3	231	c.129G>C	c.(127-129)CTG>CTC	p.L43L	FTSJ2_uc003slk.2_5'Flank|FTSJ2_uc003sll.2_5'Flank|FTSJ2_uc003slm.2_5'Flank|FTSJ2_uc003sln.2_5'Flank|FTSJ2_uc003slo.2_5'Flank|NUDT1_uc003slq.1_Silent_p.L20L|NUDT1_uc003slr.1_Silent_p.L20L|NUDT1_uc003sls.1_Silent_p.L43L|NUDT1_uc003slt.1_Silent_p.L20L|NUDT1_uc003slu.1_Silent_p.L43L|NUDT1_uc003slv.1_Silent_p.L20L	NM_198949	NP_945187	P36639	8ODP_HUMAN	nudix-type motif 1 isoform p22	61	Nudix hydrolase.				DNA protection|DNA repair|response to oxidative stress	cytoplasm	8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity|8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity|GTPase activity|metal ion binding|protein binding				0		Ovarian(82;0.0253)|Melanoma(862;0.155)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.8e-14)|BRCA - Breast invasive adenocarcinoma(126;0.15)		GAGTTCTCCTGGGCATGAAAA	0.602								Direct_reversal_of_damage|Modulation_of_nucleotide_pools					35	35	---	---	---	---	PASS
AOAH	313	broad.mit.edu	37	7	36633960	36633960	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36633960A>C	uc003tfh.3	-	12	1324	c.923T>G	c.(922-924)CTG>CGG	p.L308R	AOAH_uc010kxf.2_Missense_Mutation_p.L308R|AOAH_uc011kba.1_Missense_Mutation_p.L276R	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	308					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						AGTGGAGTCCAGAAATCCTGT	0.448													4	86	---	---	---	---	PASS
GPR141	353345	broad.mit.edu	37	7	37780823	37780823	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37780823C>G	uc003tfm.1	+	1	828	c.828C>G	c.(826-828)AGC>AGG	p.S276R	uc003tfl.2_Intron	NM_181791	NP_861456	Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	276	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3						CAGCAATTAGCTGCTATGATT	0.378													10	152	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38388826	38388826	+	Intron	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38388826T>A	uc003tgp.1	+						uc003tgq.1_Missense_Mutation_p.S162C					Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		GGAGTTAAGCTGTCTTTCTCT	0.517													4	1	---	---	---	---	PASS
PSMA2	5683	broad.mit.edu	37	7	42959130	42959130	+	Intron	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42959130A>C	uc003thy.2	-						C7orf25_uc010kxr.2_Intron|PSMA2_uc010kxt.2_Intron|PSMA2_uc003thz.1_3'UTR	NM_002787	NP_002778	P25787	PSA2_HUMAN	proteasome subunit alpha type 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|response to virus|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	protein binding|threonine-type endopeptidase activity			large_intestine(2)|ovary(1)	3						TCTTCTGATGACAAAACTGTT	0.363													3	58	---	---	---	---	PASS
H2AFV	94239	broad.mit.edu	37	7	44880564	44880564	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44880564G>A	uc003tma.2	-	3	284	c.129C>T	c.(127-129)AGC>AGT	p.S43S	H2AFV_uc003tlz.2_Silent_p.S43S|H2AFV_uc003tmb.2_Intron|H2AFV_uc003tmc.2_Silent_p.S43S|H2AFV_uc003tmd.2_Silent_p.S17S	NM_012412	NP_036544	Q71UI9	H2AV_HUMAN	H2A histone family, member V isoform 1	43					nucleosome assembly	nucleosome|nucleus	DNA binding				0						CCCTTCCATGGCTTGTGGTGC	0.512													5	58	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48280473	48280473	+	Nonsense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48280473C>T	uc003toq.2	+	10	1097	c.1072C>T	c.(1072-1074)CAG>TAG	p.Q358*	ABCA13_uc010kyr.2_5'UTR	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	358					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						GGTGTTTGTTCAGTGGCAACA	0.408													23	51	---	---	---	---	PASS
TYW1	55253	broad.mit.edu	37	7	66703537	66703537	+	3'UTR	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66703537C>A	uc003tvn.2	+	16					TYW1_uc010lai.2_RNA|TYW1_uc011kef.1_3'UTR|PMS2L4_uc003tvo.2_Intron	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin						tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				TTTCAAGGTACTGAAGGACAA	0.398													12	23	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72412672	72412672	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72412672T>C	uc003twk.2	+	11	2140	c.2140T>C	c.(2140-2142)TCC>CCC	p.S714P	POM121_uc003twj.2_Missense_Mutation_p.S449P|POM121_uc010lam.1_Missense_Mutation_p.S449P	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	714	Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				CACCTCACCTTCCAGCCCTGC	0.607													6	76	---	---	---	---	PASS
PILRA	29992	broad.mit.edu	37	7	99987517	99987517	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99987517C>T	uc003uuo.1	+	3	673	c.461C>T	c.(460-462)ACG>ATG	p.T154M	PILRA_uc011kjo.1_Intron|PILRA_uc003uup.1_Intron|PILRA_uc003uuq.1_Intron	NM_013439	NP_038467	Q9UKJ1	PILRA_HUMAN	paired immunoglobulin-like type 2 receptor alpha	154	Extracellular (Potential).				interspecies interaction between organisms	extracellular region|integral to membrane|plasma membrane	protein binding|receptor activity			skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCAGCTGTCACGACCACCACC	0.612													7	62	---	---	---	---	PASS
LMOD2	442721	broad.mit.edu	37	7	123296034	123296034	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123296034A>G	uc003vky.2	+	1	174	c.17A>G	c.(16-18)TAC>TGC	p.Y6C		NM_207163	NP_997046	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	6	Tropomyosin-binding (By similarity).					cytoskeleton	actin binding|tropomyosin binding				0						ACCTTTGGCTACCGAAGAGGA	0.557													3	6	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10469112	10469112	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10469112C>A	uc003wtc.2	-	4	2725	c.2496G>T	c.(2494-2496)CAG>CAT	p.Q832H		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	832					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CTTGGGCCGGCTGCGTCCCAG	0.726													9	21	---	---	---	---	PASS
MIR320A	407037	broad.mit.edu	37	8	22102534	22102534	+	RNA	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22102534G>A	hsa-mir-320a|MI0000542	-			c.23G>A			uc011kzd.1_RNA|POLR3D_uc003xbl.2_5'Flank|POLR3D_uc003xbm.2_5'Flank|POLR3D_uc011kze.1_5'Flank																	0						GAACCGGGAAGAGAAGGCGGA	0.652													32	67	---	---	---	---	PASS
BNIP3L	665	broad.mit.edu	37	8	26238261	26238261	+	5'Flank	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26238261G>T	uc003xex.1	+						uc003xew.2_RNA|BNIP3L_uc010luh.1_5'Flank|BNIP3L_uc010lui.1_5'Flank	NM_004331	NP_004322	O60238	BNI3L_HUMAN	BCL2/adenovirus E1B 19kD-interacting protein						apoptosis|defense response to virus|induction of apoptosis|interspecies interaction between organisms|mitochondrial protein catabolic process|negative regulation of survival gene product expression	endoplasmic reticulum|integral to membrane|mitochondrial outer membrane|nuclear envelope	lamin binding|protein heterodimerization activity|protein homodimerization activity				0		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0019)|Epithelial(17;1.59e-12)|all cancers(2;3.75e-11)|OV - Ovarian serous cystadenocarcinoma(2;2.57e-08)|Colorectal(74;0.135)		CCTCAGATTCGGAGTCACTGG	0.413													3	52	---	---	---	---	PASS
ADRA1A	148	broad.mit.edu	37	8	26722541	26722541	+	5'UTR	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26722541G>C	uc003xfh.1	-	1					ADRA1A_uc003xfc.1_5'UTR|ADRA1A_uc010lul.1_5'UTR|ADRA1A_uc003xfd.1_RNA|ADRA1A_uc003xfe.1_5'UTR|ADRA1A_uc010lum.1_5'UTR|ADRA1A_uc003xff.1_RNA|ADRA1A_uc003xfg.1_5'UTR	NM_000680	NP_000671	P35348	ADA1A_HUMAN	alpha-1A-adrenergic receptor isoform 1						activation of phospholipase C activity|aging|apoptosis|calcium ion transport into cytosol|cell-cell signaling|intracellular protein kinase cascade|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of synaptic transmission, GABAergic|positive regulation of action potential|positive regulation of cardiac muscle contraction|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase C signaling cascade|positive regulation of vasoconstriction|response to drug|response to hormone stimulus|response to stress|smooth muscle contraction	integral to plasma membrane	alpha1-adrenergic receptor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amphetamine(DB00182)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Carvedilol(DB01136)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergotamine(DB00696)|Flupenthixol(DB00875)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Maprotiline(DB00934)|Mephentermine(DB01365)|Metaraminol(DB00610)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Midodrine(DB00211)|Nefazodone(DB01149)|Nicergoline(DB00699)|Nilutamide(DB00665)|Norepinephrine(DB00368)|Norgestrel(DB00506)|Oxymetazoline(DB00935)|Perphenazine(DB00850)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Prazosin(DB00457)|Promazine(DB00420)|Promethazine(DB01069)|Propericiazine(DB01608)|Propiomazine(DB00777)|Pseudoephedrine(DB00852)|Risperidone(DB00734)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioridazine(DB00679)|Tolazoline(DB00797)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Ziprasidone(DB00246)	TCCCGGGCTGGCGCGGAGGCG	0.716													24	41	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30704189	30704189	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30704189C>T	uc003xil.2	-	1	2345	c.2345G>A	c.(2344-2346)AGG>AAG	p.R782K		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	782										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GAATCCTGGCCTAAATATATT	0.353													8	85	---	---	---	---	PASS
ADAM9	8754	broad.mit.edu	37	8	38948794	38948794	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38948794C>G	uc003xmr.2	+	20	2305	c.2227C>G	c.(2227-2229)CAA>GAA	p.Q743E	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA|ADAM9_uc003xms.2_RNA	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	743	Cytoplasmic (Potential).			Missing (in Ref. 2; no nucleotide entry).	activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			TGGCAAAAATCAAGCAAACCC	0.338													14	149	---	---	---	---	PASS
MOS	4342	broad.mit.edu	37	8	57025924	57025924	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:57025924G>T	uc011leb.1	-	1	618	c.618C>A	c.(616-618)AAC>AAA	p.N206K		NM_005372	NP_005363	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene	206	Protein kinase.						ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|ovary(1)|central_nervous_system(1)	4			Epithelial(17;0.00117)|all cancers(17;0.00879)			TGATCAAGATGTTCGCGGGCT	0.483													18	32	---	---	---	---	PASS
NSMAF	8439	broad.mit.edu	37	8	59503463	59503463	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59503463G>A	uc003xtt.2	-	24	2196	c.1982C>T	c.(1981-1983)TCA>TTA	p.S661L	NSMAF_uc011lee.1_Missense_Mutation_p.S692L	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation	661					ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				TAGCATTTTTGATTCTTTAGA	0.289													11	22	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62491553	62491553	+	Intron	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62491553A>G	uc011leg.1	-						ASPH_uc003xuj.2_Intron|ASPH_uc003xuo.2_Intron|uc003xuk.2_Missense_Mutation_p.I200V	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a						muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	CATGGACAGCATCATTGCTGA	0.547													3	52	---	---	---	---	PASS
CSPP1	79848	broad.mit.edu	37	8	68049786	68049786	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68049786G>T	uc003xxi.2	+	17	2044	c.2013G>T	c.(2011-2013)TGG>TGT	p.W671C	CSPP1_uc003xxg.1_Missense_Mutation_p.W663C|CSPP1_uc003xxh.1_RNA|CSPP1_uc003xxj.2_Missense_Mutation_p.W636C|CSPP1_uc003xxk.2_Missense_Mutation_p.W342C	NM_001077204	NP_001070672	Q1MSJ5	CSPP1_HUMAN	centrosome spindle pole associated protein 1	671						centrosome|microtubule|spindle				ovary(3)|breast(2)	5	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			ATAATCCCTGGGGAAAAGGTG	0.348													11	21	---	---	---	---	PASS
RAD54B	25788	broad.mit.edu	37	8	95392549	95392549	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95392549C>T	uc003ygk.2	-	12	2169	c.2071G>A	c.(2071-2073)GAT>AAT	p.D691N	RAD54B_uc010may.1_Missense_Mutation_p.D498N	NM_012415	NP_036547	O95073	FSBP_HUMAN	RAD54 homolog B	Error:Variant_position_missing_in_O95073_after_alignment					double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GTTTGTCCATCAAGTCTTGTA	0.363								Direct_reversal_of_damage|Homologous_recombination					23	39	---	---	---	---	PASS
MATN2	4147	broad.mit.edu	37	8	98973758	98973758	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98973758G>T	uc003yic.2	+	5	1189	c.958G>T	c.(958-960)GCT>TCT	p.A320S	MATN2_uc003yib.1_Missense_Mutation_p.A320S|MATN2_uc010mbh.1_Missense_Mutation_p.A320S|MATN2_uc003yid.2_Missense_Mutation_p.A320S|MATN2_uc003yie.1_Missense_Mutation_p.A320S|MATN2_uc010mbi.1_Intron	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor	320	EGF-like 3.					proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			GAGGTGTGTGGGTGAGTATCC	0.567													6	48	---	---	---	---	PASS
HRSP12	10247	broad.mit.edu	37	8	99118512	99118512	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99118512C>T	uc003yii.1	-	3	308	c.214G>A	c.(214-216)GAC>AAC	p.D72N		NM_005836	NP_005827	P52758	UK114_HUMAN	heat-responsive protein 12	72					regulation of translational termination	nucleus	endonuclease activity			ovary(1)	1	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			TTAGTGAAGTCACAGCCTGCA	0.363													11	89	---	---	---	---	PASS
OXR1	55074	broad.mit.edu	37	8	107718630	107718630	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107718630G>T	uc011lht.1	+	8	983	c.884G>T	c.(883-885)GGA>GTA	p.G295V	OXR1_uc003ymf.2_Missense_Mutation_p.G294V|OXR1_uc011lhu.1_Missense_Mutation_p.G287V|OXR1_uc010mcg.2_Intron|OXR1_uc010mch.2_5'UTR|OXR1_uc003ymg.1_Missense_Mutation_p.G227V|OXR1_uc003ymi.1_Missense_Mutation_p.G206V	NM_018002	NP_060472	Q8N573	OXR1_HUMAN	oxidation resistance 1 isoform 1	295					cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			CAGCTATCAGGAAGGGACTTC	0.353													9	62	---	---	---	---	PASS
OXR1	55074	broad.mit.edu	37	8	107718631	107718631	+	Silent	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107718631A>G	uc011lht.1	+	8	984	c.885A>G	c.(883-885)GGA>GGG	p.G295G	OXR1_uc003ymf.2_Silent_p.G294G|OXR1_uc011lhu.1_Silent_p.G287G|OXR1_uc010mcg.2_Intron|OXR1_uc010mch.2_5'UTR|OXR1_uc003ymg.1_Silent_p.G227G|OXR1_uc003ymi.1_Silent_p.G206G	NM_018002	NP_060472	Q8N573	OXR1_HUMAN	oxidation resistance 1 isoform 1	295					cell wall macromolecule catabolic process|response to oxidative stress	mitochondrion					0			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			AGCTATCAGGAAGGGACTTCT	0.348													9	62	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	133941430	133941430	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133941430C>T	uc003ytw.2	+	23	4850	c.4809C>T	c.(4807-4809)TGC>TGT	p.C1603C	TG_uc010mdw.2_Silent_p.C362C|TG_uc011ljb.1_Silent_p.C36C|TG_uc003ytx.1_RNA	NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor	1603	Type IIIA.				hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TGATGCAGTGCTTGACAGGTG	0.468													3	87	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139833571	139833571	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139833571G>A	uc003yvd.2	-	7	1500	c.1053C>T	c.(1051-1053)TTC>TTT	p.F351F		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	351	TSP N-terminal.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GAGAACCTCGGAAGACCACCC	0.582										HNSCC(7;0.00092)			7	86	---	---	---	---	PASS
DNAI1	27019	broad.mit.edu	37	9	34514409	34514409	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34514409C>T	uc003zum.2	+	17	1780	c.1587C>T	c.(1585-1587)TCC>TCT	p.S529S		NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	529					cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		AATCCTACTCCAGCCAATTCC	0.567									Kartagener_syndrome				82	63	---	---	---	---	PASS
GNE	10020	broad.mit.edu	37	9	36276944	36276944	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36276944C>T	uc010mlj.2	-	1	98	c.96G>A	c.(94-96)TCG>TCA	p.S32S	CLTA_uc003zzf.1_Intron|GNE_uc010mli.2_5'UTR	NM_005476	NP_005467	Q9Y223	GLCNE_HUMAN	UDP-N-acetylglucosamine-2-epimerase/N-	Error:Variant_position_missing_in_Q9Y223_after_alignment					cell adhesion|lipopolysaccharide biosynthetic process|N-acetylneuraminate metabolic process|UDP-N-acetylglucosamine metabolic process		ATP binding|N-acylmannosamine kinase activity|UDP-N-acetylglucosamine 2-epimerase activity				0			STAD - Stomach adenocarcinoma(86;0.228)			GTTTCCATCCCGAAGCACGAG	0.433													46	68	---	---	---	---	PASS
RORB	6096	broad.mit.edu	37	9	77257389	77257389	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77257389A>G	uc004aji.2	+	4	377	c.328A>G	c.(328-330)AAG>GAG	p.K110E	RORB_uc004ajh.2_Missense_Mutation_p.K99E	NM_006914	NP_008845	Q92753	RORB_HUMAN	RAR-related orphan receptor B	110	Hinge (Potential).				eye photoreceptor cell development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|visual perception	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(2)|lung(1)|skin(1)	4						TGAGGTgcagaagcaccagca	0.413													7	37	---	---	---	---	PASS
NAA35	60560	broad.mit.edu	37	9	88635862	88635862	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88635862G>T	uc004aoi.3	+	22	2233	c.2096G>T	c.(2095-2097)GGA>GTA	p.G699V	NAA35_uc004aoj.3_Missense_Mutation_p.G699V	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN	corneal wound healing-related protein	699					smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3						TTATTGGCAGGAGGACACAAA	0.313													3	27	---	---	---	---	PASS
ECM2	1842	broad.mit.edu	37	9	95285103	95285103	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95285103G>C	uc004ash.2	-	2	111	c.46C>G	c.(46-48)CAA>GAA	p.Q16E	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ECM2_uc004asf.3_Missense_Mutation_p.Q16E|ECM2_uc011lty.1_Missense_Mutation_p.Q16E|ECM2_uc004asg.2_Missense_Mutation_p.Q16E|ECM2_uc011ltz.1_Missense_Mutation_p.Q16E|ECM2_uc004asi.2_Missense_Mutation_p.Q16E	NM_001393	NP_001384	O94769	ECM2_HUMAN	extracellular matrix protein 2 precursor	16					cell-matrix adhesion		integrin binding			ovary(1)|skin(1)	2						AAGTCAGTTTGAAAAATGATA	0.338													21	18	---	---	---	---	PASS
TNFSF8	944	broad.mit.edu	37	9	117692469	117692469	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117692469A>C	uc004bji.1	-	1	302	c.115T>G	c.(115-117)TTC>GTC	p.F39V		NM_001244	NP_001235	P32971	TNFL8_HUMAN	tumor necrosis factor (ligand) superfamily,	39	Helical; Signal-anchor for type II membrane protein; (Potential).				cell proliferation|cell-cell signaling|immune response|induction of apoptosis|signal transduction	extracellular space|integral to plasma membrane	cytokine activity|tumor necrosis factor receptor binding			lung(3)|skin(2)|ovary(1)	6						GTCAAATAGAAATAGCTGCGG	0.592													6	65	---	---	---	---	PASS
GPR21	2844	broad.mit.edu	37	9	125796872	125796872	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125796872G>T	uc011lzk.1	+	1	27	c.27G>T	c.(25-27)CAG>CAT	p.Q9H	RABGAP1_uc004bnl.3_Intron|RABGAP1_uc011lzh.1_Intron|RABGAP1_uc011lzj.1_Intron|GPR21_uc011lzi.1_RNA	NM_005294	NP_005285	Q99679	GPR21_HUMAN	G protein-coupled receptor 21	9	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity			ovary(1)	1						ATGGTAATCAGAGCAGCCACC	0.438													4	108	---	---	---	---	PASS
GARNL3	84253	broad.mit.edu	37	9	130119519	130119519	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130119519C>A	uc011mae.1	+	21	2358	c.1957C>A	c.(1957-1959)CCC>ACC	p.P653T	GARNL3_uc011mad.1_Missense_Mutation_p.P631T|GARNL3_uc010mxi.2_5'UTR	NM_032293	NP_115669	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	653	CNH.				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity|small GTPase regulator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						GTCTGACTCTCCCATGGTGAT	0.527													15	28	---	---	---	---	PASS
KIAA0649	9858	broad.mit.edu	37	9	138379116	138379116	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138379116C>T	uc004cfr.1	+	4	3309	c.2760C>T	c.(2758-2760)TTC>TTT	p.F920F		NM_014811	NP_055626	Q5T8A7	K0649_HUMAN	1A6/DRIM (down-regulated in metastasis)	920						nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;6.91e-08)|Epithelial(140;4.69e-07)|all cancers(34;9.33e-06)		CTGGTCTGTTCAGCCAGGGCG	0.701													27	68	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7608067	7608067	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7608067G>T	uc001ijq.2	-	13	2532	c.2453C>A	c.(2452-2454)CCC>CAC	p.P818H	ITIH5_uc001ijp.2_Missense_Mutation_p.P604H	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	818					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						TCGCTGGAAGGGCGCCGGCTT	0.597													31	65	---	---	---	---	PASS
ITIH5	80760	broad.mit.edu	37	10	7608068	7608068	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7608068G>T	uc001ijq.2	-	13	2531	c.2452C>A	c.(2452-2454)CCC>ACC	p.P818T	ITIH5_uc001ijp.2_Missense_Mutation_p.P604T	NM_030569	NP_085046	Q86UX2	ITIH5_HUMAN	inter-alpha trypsin inhibitor heavy chain	818					hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)	4						CGCTGGAAGGGCGCCGGCTTT	0.602													31	66	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24908838	24908838	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24908838A>C	uc001isb.2	-	9	2473	c.1986T>G	c.(1984-1986)AAT>AAG	p.N662K	ARHGAP21_uc010qdb.1_RNA|ARHGAP21_uc009xkl.1_Missense_Mutation_p.N662K|ARHGAP21_uc010qdc.1_Missense_Mutation_p.N497K|ARHGAP21_uc001isc.1_Missense_Mutation_p.N652K	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	661					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						ATGTCTGCTGATTCAACAGAC	0.478													3	92	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26455034	26455034	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26455034G>A	uc001isn.2	+	27	3398	c.3038G>A	c.(3037-3039)CGC>CAC	p.R1013H	MYO3A_uc009xko.1_Missense_Mutation_p.R1013H|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1013	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						GAGGAGCCCCGCATGAGCCCT	0.448													12	295	---	---	---	---	PASS
WAC	51322	broad.mit.edu	37	10	28824669	28824669	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28824669T>C	uc001iuf.2	+	3	342	c.257T>C	c.(256-258)GTT>GCT	p.V86A	WAC_uc001iud.2_Missense_Mutation_p.V41A|WAC_uc001iue.2_Splice_Site_p.R40_splice|WAC_uc009xlb.2_Missense_Mutation_p.V41A|WAC_uc001iug.2_Missense_Mutation_p.V86A|WAC_uc001iuh.2_Missense_Mutation_p.V41A	NM_016628	NP_057712	Q9BTA9	WAC_HUMAN	WW domain-containing adapter with a coiled-coil	86					cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding			large_intestine(1)|ovary(1)	2						ACTCACAGAGTTAGAGAGAGG	0.393													22	42	---	---	---	---	PASS
DLG5	9231	broad.mit.edu	37	10	79576344	79576344	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79576344G>T	uc001jzk.2	-	20	4060	c.3990C>A	c.(3988-3990)GTC>GTA	p.V1330V	DLG5_uc001jzi.2_Silent_p.V85V|DLG5_uc001jzj.2_Silent_p.V745V|DLG5_uc009xru.1_RNA|DLG5_uc001jzl.3_Silent_p.V934V	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5	1330					cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			ACGCGGGGTTGACAGCGATTC	0.617													5	71	---	---	---	---	PASS
LOC650623	650623	broad.mit.edu	37	10	81442880	81442880	+	RNA	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81442880C>G	uc010qlu.1	+	1		c.150C>G				NR_027512				Homo sapiens BEN domain containing 3 pseudogene (LOC650623), non-coding RNA.												0						CAATGGCCAGCCAGACTCCAT	0.597													8	8	---	---	---	---	PASS
MAT1A	4143	broad.mit.edu	37	10	82043718	82043718	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82043718C>T	uc001kbw.2	-	3	501	c.246G>A	c.(244-246)GTG>GTA	p.V82V		NM_000429	NP_000420	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	82					methylation|S-adenosylmethionine biosynthetic process|xenobiotic metabolic process	cytosol	ATP binding|metal ion binding|methionine adenosyltransferase activity				0			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	TGTCCCTCACCACCCGCTGGT	0.592													7	29	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97200912	97200912	+	5'UTR	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97200912G>C	uc001kkp.2	-	1					SORBS1_uc001kko.2_5'UTR|SORBS1_uc001kkq.2_5'UTR|SORBS1_uc001kkr.2_5'UTR|SORBS1_uc001kks.2_5'UTR|SORBS1_uc001kkt.2_RNA|SORBS1_uc001kku.2_5'UTR|SORBS1_uc001kkv.2_5'UTR|SORBS1_uc001kkw.2_5'UTR|SORBS1_uc010qoe.1_5'UTR|SORBS1_uc010qof.1_5'UTR|SORBS1_uc001kkx.1_5'UTR	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3						focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AGGACAAGTCGTCTGCAACTG	0.443													8	100	---	---	---	---	PASS
CRTAC1	55118	broad.mit.edu	37	10	99696115	99696115	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99696115C>G	uc001kou.1	-	3	589	c.233G>C	c.(232-234)GGA>GCA	p.G78A	CRTAC1_uc001kov.2_Missense_Mutation_p.G67A|CRTAC1_uc001kot.1_5'UTR	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1 precursor	78	FG-GAP 1; atypical.					proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		CAGGTTGGGTCCATTGTACCT	0.657													6	19	---	---	---	---	PASS
C10orf46	143384	broad.mit.edu	37	10	120445554	120445554	+	3'UTR	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120445554G>T	uc001lds.1	-	9					C10orf46_uc010qst.1_RNA	NM_153810	NP_722517	Q86Y37	CJ046_HUMAN	chromosome 10 open reading frame 46						ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding				0		Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0131)		TCCTGAGTGTGTGCAGCCCCC	0.408													6	29	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	127737960	127737960	+	Silent	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127737960G>C	uc001ljk.2	-	16	2201	c.1788C>G	c.(1786-1788)ACC>ACG	p.T596T	ADAM12_uc010qul.1_Silent_p.T547T|ADAM12_uc001ljm.2_Silent_p.T596T|ADAM12_uc001ljn.2_Silent_p.T593T|ADAM12_uc001ljl.3_Silent_p.T593T	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	596	Extracellular (Potential).|Cys-rich.				cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		AAACGGCATTGGTACCAATGA	0.532													14	82	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	128018989	128018989	+	Missense_Mutation	SNP	C	T	T	rs150357794		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128018989C>T	uc001ljk.2	-	2	591	c.178G>A	c.(178-180)GAC>AAC	p.D60N	ADAM12_uc010qul.1_Missense_Mutation_p.D60N|ADAM12_uc001ljm.2_Missense_Mutation_p.D60N|ADAM12_uc001ljn.2_Missense_Mutation_p.D60N|ADAM12_uc001ljl.3_Missense_Mutation_p.D60N	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	60					cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		ACCTTGGAGTCGAAGCTCTTC	0.473													6	89	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	134647018	134647018	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134647018G>C	uc010qux.1	-	42	6139	c.6139C>G	c.(6139-6141)CCT>GCT	p.P2047A		NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		GCAACCTCAGGCTGGACTGTG	0.582													15	30	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	134647019	134647019	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134647019C>A	uc010qux.1	-	42	6138	c.6138G>T	c.(6136-6138)CAG>CAT	p.Q2046H		NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		CAACCTCAGGCTGGACTGTGC	0.587													15	29	---	---	---	---	PASS
SIGIRR	59307	broad.mit.edu	37	11	408113	408113	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:408113G>C	uc001lpd.2	-	4	630	c.300C>G	c.(298-300)ATC>ATG	p.I100M	SIGIRR_uc001lpf.2_Missense_Mutation_p.I100M|SIGIRR_uc001lpe.1_Missense_Mutation_p.I100M|SIGIRR_uc001lpg.2_Missense_Mutation_p.I100M	NM_001135054	NP_001128526	Q6IA17	SIGIR_HUMAN	single Ig IL-1R-related molecule	100	Ig-like C2-type.|Extracellular (Potential).				acute-phase response|innate immune response|negative regulation of chemokine biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of lipopolysaccharide-mediated signaling pathway|negative regulation of sequence-specific DNA binding transcription factor activity	integral to membrane	protein binding|transmembrane receptor activity				0		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGATGTTCTGGATGGAGCAGG	0.587													24	42	---	---	---	---	PASS
OR56A4	120793	broad.mit.edu	37	11	6023399	6023399	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6023399A>C	uc010qzv.1	-	1	980	c.980T>G	c.(979-981)GTC>GGC	p.V327G		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	275	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGGATGGGGACATCTGGAGG	0.517													5	14	---	---	---	---	PASS
OR56B4	196335	broad.mit.edu	37	11	6129720	6129720	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6129720G>T	uc010qzx.1	+	1	712	c.712G>T	c.(712-714)GAA>TAA	p.E238*		NM_001005181	NP_001005181	Q8NH76	O56B4_HUMAN	olfactory receptor, family 56, subfamily B,	238	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.31e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAACTCAGCAGAAGCAATGTC	0.493													23	24	---	---	---	---	PASS
FAM160A2	84067	broad.mit.edu	37	11	6244846	6244846	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6244846G>A	uc001mcl.3	-	3	1130	c.771C>T	c.(769-771)TTC>TTT	p.F257F	FAM160A2_uc001mck.3_Silent_p.F257F|FAM160A2_uc001mcm.2_Silent_p.F257F	NM_001098794	NP_001092264	Q8N612	F16A2_HUMAN	hypothetical protein LOC84067 isoform 2	257					early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|protein transport	FHF complex	protein binding			skin(2)	2						TAACCGGGCAGAAGTAAGAGT	0.597													18	86	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6649910	6649910	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6649910C>T	uc001mem.1	-	13	5723	c.5313G>A	c.(5311-5313)ATG>ATA	p.M1771I		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	1771	Cadherin 17.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGCCCGAAGCATGGTAAGGG	0.577													13	20	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	19970352	19970352	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19970352C>T	uc010rdm.1	+	11	2801	c.2440C>T	c.(2440-2442)CGG>TGG	p.R814W	NAV2_uc001mpp.2_Missense_Mutation_p.R727W|NAV2_uc001mpr.3_Missense_Mutation_p.R791W	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	814						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						GTCCAGCCCTCGGCTCCAAGC	0.592													4	17	---	---	---	---	PASS
CSTF3	1479	broad.mit.edu	37	11	33106597	33106597	+	3'UTR	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33106597C>T	uc001muh.2	-	21					TCP11L1_uc001muf.1_RNA	NM_001326	NP_001317	Q12996	CSTF3_HUMAN	cleavage stimulation factor subunit 3 isoform 1						mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding				0						CAAAAGGAATCCTGGACAGGA	0.463													3	35	---	---	---	---	PASS
API5	8539	broad.mit.edu	37	11	43333648	43333648	+	5'UTR	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43333648C>T	uc010rfh.1	+	1					API5_uc010rfg.1_5'UTR|API5_uc001mxf.2_5'UTR|API5_uc010rfi.1_5'UTR	NM_001142930	NP_001136402	Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5 isoform a						anti-apoptosis|apoptosis	cytoplasm|spliceosomal complex	fibroblast growth factor binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						ACAAGGATAGCGGAACCGGGC	0.632											OREG0020900	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	6	---	---	---	---	PASS
ALKBH3	221120	broad.mit.edu	37	11	43920117	43920117	+	Intron	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43920117G>C	uc001mxs.2	+						ALKBH3_uc009ykp.2_Intron|ALKBH3_uc001mxt.2_Intron|ALKBH3_uc009ykq.2_Intron|LOC729799_uc010rfk.1_RNA	NM_139178	NP_631917	Q96Q83	ALKB3_HUMAN	AlkB homolog 3						DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation	mitochondrion|nucleoplasm	damaged DNA binding|DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0					Vitamin C(DB00126)	GCGATGTGAAGAGAATACAAA	0.517								Direct_reversal_of_damage					5	10	---	---	---	---	PASS
PACSIN3	29763	broad.mit.edu	37	11	47199401	47199401	+	3'UTR	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47199401G>T	uc001ndw.2	-	11					ARFGAP2_uc001ndt.2_5'Flank|ARFGAP2_uc010rhb.1_5'Flank|ARFGAP2_uc001ndu.2_5'Flank|ARFGAP2_uc010rhc.1_5'Flank|ARFGAP2_uc010rhd.1_5'Flank|ARFGAP2_uc001ndv.1_5'Flank|PACSIN3_uc001ndx.2_3'UTR|PACSIN3_uc001ndy.2_3'UTR|PACSIN3_uc001ndz.2_RNA|PACSIN3_uc001nea.2_RNA	NM_016223	NP_057307	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in						endocytosis|negative regulation of endocytosis|positive regulation of membrane protein ectodomain proteolysis	cytoplasm|plasma membrane	cytoskeletal protein binding				0						GACGGTTCAGGGCCCTGAGGG	0.637											OREG0020951	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	1	---	---	---	---	PASS
CD5	921	broad.mit.edu	37	11	60885820	60885820	+	Silent	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60885820T>C	uc009ynk.2	+	3	371	c.268T>C	c.(268-270)TTA>CTA	p.L90L		NM_014207	NP_055022	P06127	CD5_HUMAN	CD5 molecule precursor	90	Extracellular (Potential).|SRCR 1.				cell proliferation|cell recognition	integral to plasma membrane	scavenger receptor activity			ovary(1)	1		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		TGGGGTGCCCTTAAGCCTTGG	0.582													5	175	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62285078	62285078	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62285078G>C	uc001ntl.2	-	5	17111	c.16811C>G	c.(16810-16812)TCT>TGT	p.S5604C	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	5604	Gly-rich.				nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				GTTGAGAGCAGAGGAGACTTG	0.537													54	132	---	---	---	---	PASS
CCDC88B	283234	broad.mit.edu	37	11	64124602	64124602	+	3'UTR	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64124602C>G	uc001nzy.2	+	27					CCDC88B_uc001oaa.2_Missense_Mutation_p.S594C|CCDC88B_uc001oab.1_3'UTR|CCDC88B_uc001oac.2_Missense_Mutation_p.S105C|RPS6KA4_uc001oad.2_5'Flank|RPS6KA4_uc001oae.2_5'Flank|RPS6KA4_uc010rnl.1_5'Flank|RPS6KA4_uc001oaf.2_5'Flank|RPS6KA4_uc009ypp.2_5'Flank	NM_032251	NP_115627	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88						microtubule cytoskeleton organization	cytoplasm	microtubule binding			ovary(3)|skin(1)	4						GTGCAGCCTTCTCGGCACTGG	0.652													29	30	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65265440	65265440	+	RNA	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65265440C>G	uc010roh.1	+	1		c.208C>G				NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						GCTGGCCATTCCAGGTGGTGG	0.522													48	85	---	---	---	---	PASS
SAPS3	55291	broad.mit.edu	37	11	68370851	68370851	+	Nonsense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68370851G>T	uc001onw.2	+	22	2608	c.2341G>T	c.(2341-2343)GAG>TAG	p.E781*	SAPS3_uc001onv.2_Nonsense_Mutation_p.E781*|SAPS3_uc001ony.3_Nonsense_Mutation_p.E752*|SAPS3_uc001onx.2_Nonsense_Mutation_p.E775*|SAPS3_uc009ysh.2_Nonsense_Mutation_p.E701*|SAPS3_uc001onu.2_Nonsense_Mutation_p.E701*|SAPS3_uc010rqc.1_Nonsense_Mutation_p.E549*|SAPS3_uc010rqd.1_Nonsense_Mutation_p.E464*|SAPS3_uc001onz.2_Nonsense_Mutation_p.E109*|SAPS3_uc001ooa.2_Nonsense_Mutation_p.E231*	NM_001164161	NP_001157633	Q5H9R7	PP6R3_HUMAN	SAPS domain family, member 3 isoform 6	781					regulation of phosphoprotein phosphatase activity	cytoplasm|nucleus	protein phosphatase binding				0			LUAD - Lung adenocarcinoma(13;0.102)			TGACGGAGAGGAGGATGCAGA	0.542													24	35	---	---	---	---	PASS
PAAF1	80227	broad.mit.edu	37	11	73620513	73620513	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73620513G>A	uc001ouk.1	+	7	636	c.602G>A	c.(601-603)CGA>CAA	p.R201Q	PAAF1_uc001oul.1_Missense_Mutation_p.R184Q|PAAF1_uc009ytx.1_RNA|PAAF1_uc001oum.1_Missense_Mutation_p.R184Q	NM_025155	NP_079431	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1	201	WD 3.				interspecies interaction between organisms	proteasome complex	protein binding			ovary(1)|skin(1)	2	Breast(11;7.42e-05)					GGGACAGCACGACTTTGGGAT	0.517													10	65	---	---	---	---	PASS
AMOTL1	154810	broad.mit.edu	37	11	94602363	94602363	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94602363G>T	uc001pfb.2	+	12	2659	c.2489G>T	c.(2488-2490)GGA>GTA	p.G830V	AMOTL1_uc001pfc.2_Missense_Mutation_p.G780V	NM_130847	NP_570899	Q8IY63	AMOL1_HUMAN	angiomotin like 1	830						cytoplasm|tight junction	identical protein binding			ovary(1)|breast(1)	2		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				CTGCCCTCAGGATTGCTGCTG	0.483													3	19	---	---	---	---	PASS
KIAA1826	84437	broad.mit.edu	37	11	105880645	105880645	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105880645G>C	uc001piy.2	-	3	828	c.655C>G	c.(655-657)CTG>GTG	p.L219V	KIAA1826_uc001piz.2_Missense_Mutation_p.L219V	NM_032424	NP_115800	Q8NCY6	K1826_HUMAN	hypothetical protein LOC84437	219	Potential.					nucleus				breast(1)	1		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.56e-05)|Epithelial(105;0.00432)|all cancers(92;0.0309)		TCGATATCCAGTCGTCGTTTT	0.443													4	101	---	---	---	---	PASS
HSPB2	3316	broad.mit.edu	37	11	111784284	111784284	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111784284G>T	uc001pmg.2	+	2	308	c.214G>T	c.(214-216)GGC>TGC	p.G72C	CRYAB_uc001pmf.1_5'Flank|CRYAB_uc010rwp.1_5'Flank|HSPB2_uc009yyj.2_RNA|C11orf52_uc001pmh.2_Intron	NM_001541	NP_001532	Q16082	HSPB2_HUMAN	heat shock 27kDa protein 2	72					response to heat|response to unfolded protein	cytosol|nucleus	enzyme activator activity|protein binding			ovary(2)|skin(1)	3		all_cancers(61;3.75e-11)|all_epithelial(67;2.33e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;3.57e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.57e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.051)		GCTCAGTGAGGGCAAGTTCCA	0.637													15	76	---	---	---	---	PASS
FAM55D	54827	broad.mit.edu	37	11	114441787	114441787	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114441787A>G	uc001ppc.2	-	6	1689	c.1508T>C	c.(1507-1509)TTC>TCC	p.F503S	FAM55D_uc001ppd.2_Missense_Mutation_p.F219S	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1	503						extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)		GAGATCCTGGAAAATGTCCTT	0.363													3	64	---	---	---	---	PASS
TAGLN	6876	broad.mit.edu	37	11	117073833	117073833	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117073833T>C	uc001pqm.2	+	2	225	c.104T>C	c.(103-105)ATA>ACA	p.I35T	uc001pqk.1_5'Flank|TAGLN_uc001pql.1_Intron|TAGLN_uc001pqn.2_Missense_Mutation_p.I35T|TAGLN_uc001pqo.2_Missense_Mutation_p.I35T|TAGLN_uc001pqp.2_Missense_Mutation_p.I35T|uc001pqq.1_5'Flank	NM_003186	NP_003177	Q01995	TAGL_HUMAN	transgelin	35	CH.				muscle organ development	cytoplasm	actin binding				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|Epithelial(105;5.49e-05)|all cancers(92;0.000435)		GAGTGGATCATAGTGCAGTGT	0.612													13	10	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118374909	118374909	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118374909G>C	uc001pta.2	+	27	8316	c.8293G>C	c.(8293-8295)GAA>CAA	p.E2765Q	MLL_uc001ptb.2_Missense_Mutation_p.E2768Q	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	2765					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		TGGGGAGAAAGAACATGTCAC	0.403			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								5	64	---	---	---	---	PASS
HINFP	25988	broad.mit.edu	37	11	119003661	119003661	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119003661C>T	uc001pvp.2	+	9	1152	c.963C>T	c.(961-963)TTC>TTT	p.F321F	HINFP_uc001pvq.2_Silent_p.F321F|HINFP_uc001pvr.2_Silent_p.F74F	NM_015517	NP_056332	Q9BQA5	HINFP_HUMAN	MBD2 (methyl-CpG-binding protein)-interacting	321	C2H2-type 8.				DNA damage checkpoint|DNA repair|establishment of protein localization|in utero embryonic development|myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	enzyme binding|histone binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription regulatory region DNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						ACTGCACCTTCAGTGCCCGAT	0.522													57	38	---	---	---	---	PASS
OR8B12	219858	broad.mit.edu	37	11	124413346	124413346	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124413346C>G	uc010sam.1	-	1	205	c.205G>C	c.(205-207)GAT>CAT	p.D69H		NM_001005195	NP_001005195	Q8NGG6	OR8BC_HUMAN	olfactory receptor, family 8, subfamily B,	69	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0213)		AAACAGAAATCTATTAAAGAG	0.453													20	15	---	---	---	---	PASS
PKNOX2	63876	broad.mit.edu	37	11	125298937	125298937	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125298937G>T	uc001qbu.2	+	11	1280	c.966G>T	c.(964-966)AGG>AGT	p.R322S	PKNOX2_uc010saz.1_Missense_Mutation_p.R293S|PKNOX2_uc010sba.1_Missense_Mutation_p.R293S|PKNOX2_uc010sbb.1_Missense_Mutation_p.R258S|PKNOX2_uc001qbv.2_Missense_Mutation_p.R87S	NM_022062	NP_071345	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	322	Homeobox.					nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		ATGAGAAGAGGCAGATCGCAG	0.597											OREG0021475	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	17	---	---	---	---	PASS
ARHGAP32	9743	broad.mit.edu	37	11	128844494	128844494	+	Silent	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128844494A>C	uc009zcp.2	-	20	2556	c.2556T>G	c.(2554-2556)TCT>TCG	p.S852S	ARHGAP32_uc009zcq.1_Silent_p.S812S|ARHGAP32_uc009zco.2_5'UTR|ARHGAP32_uc001qez.2_Silent_p.S503S	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	852					cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						AGACAGGTTCAGAGCTTGCTG	0.443													55	59	---	---	---	---	PASS
OPCML	4978	broad.mit.edu	37	11	132290160	132290160	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132290160T>A	uc001qgs.2	-	7	1015	c.965A>T	c.(964-966)AAC>ATC	p.N322I	OPCML_uc001qgu.2_Missense_Mutation_p.N315I|OPCML_uc010sck.1_Missense_Mutation_p.N331I|OPCML_uc001qgt.2_Missense_Mutation_p.N321I|OPCML_uc010scl.1_Missense_Mutation_p.N281I	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion	322					cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GGAGGCCGAGTTTACACCATC	0.502													7	46	---	---	---	---	PASS
ACAD8	27034	broad.mit.edu	37	11	134129044	134129044	+	Intron	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134129044G>A	uc001qhk.2	+						ACAD8_uc009zdc.2_Nonsense_Mutation_p.W113*|ACAD8_uc010sco.1_Intron|ACAD8_uc010scp.1_Intron|ACAD8_uc010scq.1_Intron|ACAD8_uc001qhl.2_Intron|ACAD8_uc010scr.1_Intron|ACAD8_uc009zde.1_Intron	NM_014384	NP_055199	Q9UKU7	ACAD8_HUMAN	acyl-Coenzyme A dehydrogenase family, member 8						branched chain family amino acid catabolic process|lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding				0	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)		ACATCCTCTGGTTCCTTCACA	0.463													10	18	---	---	---	---	PASS
KDM5A	5927	broad.mit.edu	37	12	416853	416853	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:416853G>A	uc001qif.1	-	23	4060	c.3697C>T	c.(3697-3699)CTT>TTT	p.L1233F	KDM5A_uc001qie.1_Missense_Mutation_p.L1233F	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	1233					chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						AACTTCTGAAGGGATACCAGG	0.527			T 	NUP98	AML								20	48	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	936296	936296	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:936296C>G	uc001qio.3	+	3	1528	c.1021C>G	c.(1021-1023)CGA>GGA	p.R341G	WNK1_uc001qin.2_Missense_Mutation_p.R341G|WNK1_uc001qip.3_Missense_Mutation_p.R341G	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	341	Protein kinase.				intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TCTTCATACTCGAACTCCACC	0.438													18	228	---	---	---	---	PASS
LRTM2	654429	broad.mit.edu	37	12	1943830	1943830	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1943830G>A	uc001qjt.2	+	5	1862	c.1056G>A	c.(1054-1056)CTG>CTA	p.L352L	CACNA2D4_uc001qjp.2_Intron|CACNA2D4_uc009zds.1_Intron|CACNA2D4_uc009zdt.1_Intron|CACNA2D4_uc009zdr.1_Intron|LRTM2_uc001qju.2_Silent_p.L352L|LRTM2_uc010sdx.1_Silent_p.L352L|LRTM2_uc001qjv.2_Silent_p.L114L	NM_001039029	NP_001034118	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2	352	Cytoplasmic (Potential).					integral to membrane				large_intestine(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			GCCAGCCCCTGATGGGGGACC	0.652													8	82	---	---	---	---	PASS
NECAP1	25977	broad.mit.edu	37	12	8234864	8234864	+	5'UTR	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8234864A>T	uc001qtx.2	+	1					uc001qtw.1_5'Flank|NECAP1_uc001qty.2_5'UTR	NM_015509	NP_056324	Q8NC96	NECP1_HUMAN	NECAP endocytosis associated 1						endocytosis|protein transport	clathrin coated vesicle membrane|plasma membrane				ovary(1)	1				Kidney(36;0.0915)		CGCCCCCGGCAGCGCCGACAG	0.627													8	21	---	---	---	---	PASS
C12orf60	144608	broad.mit.edu	37	12	14976352	14976352	+	Silent	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14976352C>G	uc001rcj.3	+	2	687	c.483C>G	c.(481-483)ACC>ACG	p.T161T		NM_175874	NP_787070	Q5U649	CL060_HUMAN	hypothetical protein LOC144608	161										ovary(1)|central_nervous_system(1)	2						CAGAAGACACCAAAGAGCAAT	0.413													25	48	---	---	---	---	PASS
FGD4	121512	broad.mit.edu	37	12	32760881	32760881	+	Intron	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32760881C>G	uc001rkz.2	+						FGD4_uc001rlc.2_Intron|FGD4_uc001rky.2_Intron|FGD4_uc001rla.2_5'UTR|FGD4_uc010ske.1_Intron|FGD4_uc001rlb.1_Intron	NM_139241	NP_640334	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4						actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					GAAAACCTTTCTCATTACAGA	0.383													27	95	---	---	---	---	PASS
FGD4	121512	broad.mit.edu	37	12	32760950	32760950	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32760950G>T	uc001rkz.2	+	8	1530	c.1053G>T	c.(1051-1053)CGG>CGT	p.R351R	FGD4_uc001rlc.2_Silent_p.R436R|FGD4_uc001rky.2_Silent_p.R103R|FGD4_uc001rla.2_Silent_p.R7R|FGD4_uc010ske.1_Silent_p.R463R|FGD4_uc001rlb.1_RNA	NM_139241	NP_640334	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	351	DH.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					CTGTTCAGCGGATTCCCCGGT	0.378													49	131	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49444319	49444319	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49444319C>A	uc001rta.3	-	11	3052	c.3052G>T	c.(3052-3054)GAG>TAG	p.E1018*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1018	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GGAAGGGGCTCCATCAGGATG	0.612			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			21	32	---	---	---	---	PASS
LMBR1L	55716	broad.mit.edu	37	12	49491848	49491848	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49491848G>A	uc001rth.3	-	16	1623	c.1281C>T	c.(1279-1281)TTC>TTT	p.F427F	LMBR1L_uc001rtg.3_Silent_p.F422F|LMBR1L_uc001rti.3_Silent_p.F407F	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor	427	Extracellular (Potential).				endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						CCAGCCAGTTGAAGCGTCCAA	0.572											OREG0021783	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	29	106	---	---	---	---	PASS
DIP2B	57609	broad.mit.edu	37	12	51138369	51138369	+	Splice_Site	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51138369G>T	uc001rwv.2	+	38	4635	c.4479_splice	c.e38-1	p.C1493_splice	DIP2B_uc009zlt.2_Splice_Site_p.C923_splice	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B							nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						TGAAATTTCAGTGCCGTGTTC	0.468													42	42	---	---	---	---	PASS
CSRNP2	81566	broad.mit.edu	37	12	51461550	51461550	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51461550G>C	uc001rxu.1	-	4	912	c.614C>G	c.(613-615)GCC>GGC	p.A205G		NM_030809	NP_110436	Q9H175	CSRN2_HUMAN	TGF-beta induced apoptosis protein 12	205					apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						CAGGCGGATGGCTCGAAGTTC	0.572													5	61	---	---	---	---	PASS
ANKRD33	341405	broad.mit.edu	37	12	52281949	52281949	+	5'UTR	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52281949G>A	uc001rzf.3	+	1					ANKRD33_uc001rzh.3_5'UTR|ANKRD33_uc001rzd.2_5'UTR|ANKRD33_uc001rze.2_5'UTR|ANKRD33_uc001rzg.3_5'UTR|ANKRD33_uc001rzi.3_5'UTR	NM_001130015	NP_001123487	Q7Z3H0	ANR33_HUMAN	ankyrin repeat domain 33 isoform 1												0				BRCA - Breast invasive adenocarcinoma(357;0.0969)		GCTCAGCCCCGAGGTGTTTGC	0.622													9	70	---	---	---	---	PASS
KRT76	51350	broad.mit.edu	37	12	53170846	53170846	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53170846C>T	uc001sax.2	-	1	284	c.230G>A	c.(229-231)CGG>CAG	p.R77Q		NM_015848	NP_056932	Q01546	K22O_HUMAN	keratin 76	77	Head.				cytoskeleton organization	keratin filament	structural molecule activity			breast(1)|skin(1)	2						GCCTCCAGCCCGGGAGCTGCC	0.428													16	153	---	---	---	---	PASS
KRT79	338785	broad.mit.edu	37	12	53228038	53228038	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53228038A>G	uc001sbb.2	-	1	40	c.7T>C	c.(7-9)TCC>CCC	p.S3P		NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L	3	Head.					keratin filament	structural molecule activity			ovary(2)|skin(2)	4						GAGACGGAGGACCTCATAGCT	0.612													6	28	---	---	---	---	PASS
CSAD	51380	broad.mit.edu	37	12	53567574	53567574	+	Intron	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53567574G>C	uc001sby.2	-						CSAD_uc001sbw.2_5'Flank|CSAD_uc009zmt.2_Translation_Start_Site|CSAD_uc010snx.1_Intron|CSAD_uc001sbz.2_Intron|CSAD_uc009zmu.2_Intron|CSAD_uc001sca.3_Intron|CSAD_uc010sny.1_Intron	NM_015989	NP_057073	Q9Y600	CSAD_HUMAN	cysteine sulfinic acid decarboxylase						carboxylic acid metabolic process		pyridoxal phosphate binding|sulfinoalanine decarboxylase activity			ovary(1)	1					L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	GCAGGACCAAGATGGCAGAGG	0.353									Hereditary_Prostate_Cancer				5	13	---	---	---	---	PASS
MYO1A	4640	broad.mit.edu	37	12	57423361	57423361	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57423361C>T	uc001smw.3	-	26	2978	c.2735G>A	c.(2734-2736)CGG>CAG	p.R912Q	MYO1A_uc010sqz.1_Missense_Mutation_p.R750Q|MYO1A_uc009zpd.2_Missense_Mutation_p.R912Q	NM_005379	NP_005370	Q9UBC5	MYO1A_HUMAN	myosin IA	912					sensory perception of sound|vesicle localization	brush border|cortical actin cytoskeleton|filamentous actin|lateral plasma membrane|microvillus|myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|urinary_tract(1)	7						GAGGAGAATCCGAGAAGAAGT	0.552													6	62	---	---	---	---	PASS
LRIG3	121227	broad.mit.edu	37	12	59274438	59274438	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59274438C>T	uc001sqr.2	-	13	1972	c.1726G>A	c.(1726-1728)GAG>AAG	p.E576K	LRIG3_uc009zqh.2_Missense_Mutation_p.E516K|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	576	Ig-like C2-type 1.					integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)			TATTTCCCCTCACTGGCAAAT	0.468													9	35	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	66502015	66502015	+	IGR	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66502015T>C								HMGA2 (141947 upstream) : LLPH (14835 downstream)																							GCTTCATTCTTTTCTGCCCAC	0.448											OREG0021973	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	44	---	---	---	---	PASS
C12orf26	84190	broad.mit.edu	37	12	82793112	82793112	+	Missense_Mutation	SNP	C	T	T	rs141543492		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82793112C>T	uc001szq.2	+	4	1091	c.1070C>T	c.(1069-1071)TCA>TTA	p.S357L		NM_032230	NP_115606	Q8N6Q8	CL026_HUMAN	hypothetical protein LOC84190	357											0						AATATATATTCACCTTTAACC	0.318													20	24	---	---	---	---	PASS
C12orf50	160419	broad.mit.edu	37	12	88420329	88420329	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88420329G>T	uc001tam.1	-	3	237	c.69C>A	c.(67-69)ATC>ATA	p.I23I	C12orf50_uc001tan.2_Silent_p.I77I	NM_152589	NP_689802	Q8NA57	CL050_HUMAN	hypothetical protein LOC160419	23										skin(2)|ovary(1)	3						AGATACAGCTGATCTTCACAC	0.373													9	46	---	---	---	---	PASS
CCDC38	120935	broad.mit.edu	37	12	96266046	96266046	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96266046C>G	uc001tek.1	-	14	1705	c.1471G>C	c.(1471-1473)GAA>CAA	p.E491Q		NM_182496	NP_872302	Q502W7	CCD38_HUMAN	coiled-coil domain containing 38	491										skin(1)	1						TGCCGCCATTCTTTCTGTTTC	0.403													22	133	---	---	---	---	PASS
ACAD10	80724	broad.mit.edu	37	12	112174762	112174762	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112174762C>T	uc001tsq.2	+	12	1868	c.1668C>T	c.(1666-1668)TTC>TTT	p.F556F	ACAD10_uc001tsp.2_Silent_p.F556F|ACAD10_uc009zvx.2_Silent_p.F587F|ACAD10_uc001tss.1_RNA	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	556							acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						TTTCCTTTTTCCGTGTGGCTG	0.527													33	32	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112605677	112605677	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112605677G>A	uc009zwc.2	-	64	11005	c.10987C>T	c.(10987-10989)CAG>TAG	p.Q3663*		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						GAGGAACTCTGCAGCTCCTTA	0.642													12	51	---	---	---	---	PASS
IQCD	115811	broad.mit.edu	37	12	113633634	113633634	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113633634T>A	uc001tuu.2	-	3	962	c.790A>T	c.(790-792)AGG>TGG	p.R264W		NM_138451	NP_612460	Q96DY2	IQCD_HUMAN	IQ motif containing D	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment										ovary(1)	1						TGCCTCCGCCTGAGCTCCTCC	0.597													4	93	---	---	---	---	PASS
FBXO21	23014	broad.mit.edu	37	12	117627036	117627036	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117627036T>A	uc001twk.2	-	2	410	c.371A>T	c.(370-372)GAG>GTG	p.E124V	FBXO21_uc001twj.2_Missense_Mutation_p.E124V|FBXO21_uc009zwq.2_Missense_Mutation_p.E124V	NM_033624	NP_296373	O94952	FBX21_HUMAN	F-box only protein 21 isoform 1	124					ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		CCTTACGTGCTCTGAAAAGAA	0.478													6	79	---	---	---	---	PASS
FBXO21	23014	broad.mit.edu	37	12	117627039	117627039	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117627039G>A	uc001twk.2	-	2	407	c.368C>T	c.(367-369)TCA>TTA	p.S123L	FBXO21_uc001twj.2_Missense_Mutation_p.S123L|FBXO21_uc009zwq.2_Missense_Mutation_p.S123L	NM_033624	NP_296373	O94952	FBX21_HUMAN	F-box only protein 21 isoform 1	123					ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	ubiquitin-protein ligase activity			kidney(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		TACGTGCTCTGAAAAGAACCT	0.483													7	77	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120568496	120568496	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120568496G>C	uc001txo.2	-	56	7638	c.7625C>G	c.(7624-7626)ACA>AGA	p.T2542R		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	2542					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCCTCCGCCTGTCTCGATGTG	0.602													16	36	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120611536	120611536	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120611536G>C	uc001txo.2	-	14	1300	c.1287C>G	c.(1285-1287)TTC>TTG	p.F429L		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	429					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAGCTTTTTTGAACCATTCAG	0.517													4	39	---	---	---	---	PASS
COQ5	84274	broad.mit.edu	37	12	120942706	120942706	+	Silent	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120942706G>C	uc001tyn.2	-	5	782	c.762C>G	c.(760-762)CTC>CTG	p.L254L	COQ5_uc001tyo.2_Silent_p.L173L|COQ5_uc010szj.1_Silent_p.L180L	NM_032314	NP_115690	Q5HYK3	COQ5_HUMAN	coenzyme Q5 homolog, methyltransferase	254					ubiquinone biosynthetic process	mitochondrion	methyltransferase activity			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACCTGGATATGAGGGGATTGT	0.458													8	35	---	---	---	---	PASS
FZD10	11211	broad.mit.edu	37	12	130648250	130648250	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130648250C>G	uc001uii.2	+	1	1219	c.763C>G	c.(763-765)CGC>GGC	p.R255G	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	255	Cytoplasmic (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		CGACCCGGCCCGCTTCCGCTA	0.647													41	58	---	---	---	---	PASS
ZNF10	7556	broad.mit.edu	37	12	133732756	133732756	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133732756C>T	uc009zzb.2	+	5	1371	c.924C>T	c.(922-924)CTC>CTT	p.L308L	ZNF268_uc010tbv.1_Intron|ZNF10_uc001ulq.2_Silent_p.L308L	NM_015394	NP_056209	P21506	ZNF10_HUMAN	zinc finger protein 10	308	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		GTTCTCACCTCATTGGACATC	0.428													38	60	---	---	---	---	PASS
LOC284232	284232	broad.mit.edu	37	13	19444856	19444856	+	RNA	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19444856C>A	uc010tcj.1	-	1		c.1254G>T				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						GTCCACACGTCTTGAGTAAAG	0.348													10	38	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23930096	23930096	+	Nonsense_Mutation	SNP	G	A	A	rs146784878		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23930096G>A	uc001uon.2	-	8	1244	c.655C>T	c.(655-657)CAA>TAA	p.Q219*	SACS_uc001uoo.2_Nonsense_Mutation_p.Q72*|SACS_uc001uop.1_Nonsense_Mutation_p.Q6*|SACS_uc001uoq.1_Nonsense_Mutation_p.Q72*	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	219					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AAAAGTGTTTGATGAGGATCT	0.378													11	11	---	---	---	---	PASS
KIAA0564	23078	broad.mit.edu	37	13	42259229	42259229	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42259229C>A	uc001uyj.2	-	35	4351	c.4281G>T	c.(4279-4281)AGG>AGT	p.R1427S		NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a	1427						extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		GGGGTAAAATCCTCACTACCT	0.398													34	32	---	---	---	---	PASS
INTS6	26512	broad.mit.edu	37	13	51936253	51936253	+	3'UTR	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51936253C>T	uc001vfk.2	-	18					SERPINE3_uc010tgp.1_Intron|INTS6_uc001vfi.2_3'UTR|INTS6_uc001vfj.2_3'UTR|INTS6_uc001vfl.2_3'UTR	NM_012141	NP_036273	Q9UL03	INT6_HUMAN	integrator complex subunit 6 isoform a						snRNA processing	actin cytoskeleton|integrator complex	protein binding|transmembrane receptor activity			ovary(1)|lung(1)	2		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		ATTCTCTCAGCTCATATATAG	0.308													3	1	---	---	---	---	PASS
FOXG1	2290	broad.mit.edu	37	14	29237689	29237689	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29237689C>T	uc001wqe.2	+	1	1403	c.1204C>T	c.(1204-1206)CTC>TTC	p.L402F		NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1	402	Interaction with KDM5B.				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		GACCTACTCCCTCAACCCCTG	0.672													3	19	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30066873	30066873	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30066873T>C	uc001wqh.2	-	16	2439	c.2258A>G	c.(2257-2259)GAG>GGG	p.E753G		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	753	Protein kinase.				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		CCTTAGGACCTCAGGAGCCAG	0.488													20	63	---	---	---	---	PASS
NPAS3	64067	broad.mit.edu	37	14	34269591	34269591	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34269591C>G	uc001wru.2	+	12	2142	c.2078C>G	c.(2077-2079)TCC>TGC	p.S693C	NPAS3_uc001wrs.2_Missense_Mutation_p.S680C|NPAS3_uc001wrt.2_Missense_Mutation_p.S661C|NPAS3_uc001wrv.2_Missense_Mutation_p.S663C	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3	693					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		CACTTCCCGTCCCCGCAGGGC	0.582													12	26	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51204963	51204963	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51204963T>A	uc001wym.2	-	27	5861	c.5670A>T	c.(5668-5670)AAA>AAT	p.K1890N	NIN_uc001wyi.2_Missense_Mutation_p.K1890N|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.K1177N|NIN_uc010tqp.1_Missense_Mutation_p.K1896N|NIN_uc001wyo.2_Missense_Mutation_p.K1890N|NIN_uc001wyn.2_RNA	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	1890					centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					GGTTTAGATGTTTTTGGTGCT	0.403			T	PDGFRB	MPD								37	84	---	---	---	---	PASS
FRMD6	122786	broad.mit.edu	37	14	52167842	52167842	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52167842G>A	uc001wzd.2	+	4	544	c.259G>A	c.(259-261)GAG>AAG	p.E87K	FRMD6_uc001wzb.2_Missense_Mutation_p.E87K|FRMD6_uc001wzc.2_Missense_Mutation_p.E87K|FRMD6_uc001wze.2_Missense_Mutation_p.E18K	NM_152330	NP_689543	Q96NE9	FRMD6_HUMAN	FERM domain containing 6	87	FERM.					cytoskeleton|mitochondrion|plasma membrane	binding			ovary(1)|breast(1)|central_nervous_system(1)	3	all_epithelial(31;0.0163)|Breast(41;0.089)					ATGGAAGAAAGAGGCCAGCAA	0.294													3	10	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71540497	71540497	+	Silent	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71540497C>G	uc001xmo.2	+	27	5534	c.5088C>G	c.(5086-5088)CTC>CTG	p.L1696L	PCNX_uc010are.1_Silent_p.L1585L|PCNX_uc010arf.1_Silent_p.L484L	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	1696						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GGAAAGTACTCACCACTTACT	0.363													28	84	---	---	---	---	PASS
SNW1	22938	broad.mit.edu	37	14	78184384	78184384	+	3'UTR	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78184384C>T	uc001xuf.2	-	14					SNW1_uc010tvm.1_3'UTR|SNW1_uc010asu.2_3'UTR|SNW1_uc010tvn.1_3'UTR	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein						negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TGACTTGCATCATTAGGGTTA	0.468													10	82	---	---	---	---	PASS
SNW1	22938	broad.mit.edu	37	14	78184840	78184840	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78184840C>T	uc001xuf.2	-	13	1309	c.1282G>A	c.(1282-1284)GAA>AAA	p.E428K	SNW1_uc010tvm.1_Missense_Mutation_p.E353K|SNW1_uc010asu.2_Missense_Mutation_p.E266K|SNW1_uc010tvn.1_Missense_Mutation_p.E428K	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein	428					negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TTATAAATTTCATCTTCTCCA	0.363													7	64	---	---	---	---	PASS
SEL1L	6400	broad.mit.edu	37	14	81946033	81946033	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81946033C>A	uc010tvv.1	-	20	2215	c.2098G>T	c.(2098-2100)GAT>TAT	p.D700Y		NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor	700	Lumenal (Potential).|Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		ACTTGTGCATCTGGGCTGGCT	0.418													6	60	---	---	---	---	PASS
GALC	2581	broad.mit.edu	37	14	88401080	88401080	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88401080C>T	uc001xvt.2	-	17	2453	c.2054G>A	c.(2053-2055)CGC>CAC	p.R685H	GALC_uc010tvw.1_Intron|GALC_uc010tvx.1_Missense_Mutation_p.R659H|GALC_uc010tvy.1_Missense_Mutation_p.R662H|GALC_uc010tvz.1_Intron	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor	685					carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						TAAGTATTAGCGTGTGGCTTC	0.403													6	78	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	93944052	93944052	+	Silent	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93944052A>G	uc001ybv.1	+	1	149	c.66A>G	c.(64-66)ACA>ACG	p.T22T	KIAA1409_uc001ybs.1_Silent_p.T22T|KIAA1409_uc001ybu.1_Silent_p.T22T	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	199						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		ATCTTAGCACATCTTTTCTAC	0.343													47	99	---	---	---	---	PASS
EML1	2009	broad.mit.edu	37	14	100375681	100375681	+	Splice_Site	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100375681G>C	uc001ygs.2	+	11	1174	c.1105_splice	c.e11-1	p.C369_splice	EML1_uc010avt.1_Splice_Site_p.C356_splice|EML1_uc010tww.1_Splice_Site_p.C357_splice|EML1_uc001ygq.2_Splice_Site_p.C388_splice|EML1_uc001ygr.2_Splice_Site_p.C388_splice	NM_004434	NP_004425	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1							cytoplasm|microtubule|microtubule associated complex	calcium ion binding|protein binding			large_intestine(2)|pancreas(1)|ovary(1)|skin(1)	5		Melanoma(154;0.0879)|all_epithelial(191;0.216)				TTTTCCTATAGTGCTCTAATG	0.408													9	124	---	---	---	---	PASS
C14orf68	283600	broad.mit.edu	37	14	100792529	100792529	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100792529C>A	uc001yhc.2	+	3	181	c.108C>A	c.(106-108)ATC>ATA	p.I36I	C14orf68_uc001yhd.2_Translation_Start_Site	NM_207117	NP_997000	Q6Q0C1	S2547_HUMAN	chromosome 14 open reading frame 68	36	Solcar 1.				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0		Melanoma(154;0.152)				ACACAGGCATCTGGCACTGCG	0.667													9	10	---	---	---	---	PASS
SNORD114-12	767590	broad.mit.edu	37	14	101434473	101434473	+	5'Flank	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101434473G>A	uc001yjc.2	+						SNORD114-11_uc001yjb.2_RNA|SNORD114-13_uc001yjd.2_5'Flank	NR_003205				Homo sapiens small nucleolar RNA, C/D box 114-12 (SNORD114-12), non-coding RNA.												0						GACTGGTGGTGTGTGAGTCAT	0.423													4	12	---	---	---	---	PASS
TECPR2	9895	broad.mit.edu	37	14	102904406	102904406	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102904406C>A	uc001ylw.1	+	10	2590	c.2442C>A	c.(2440-2442)CTC>CTA	p.L814L	TECPR2_uc010awl.2_Silent_p.L814L|TECPR2_uc010txx.1_Intron	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	814							protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						ATGGCATCCTCAGCTTGGTGG	0.587											OREG0022547	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	143	---	---	---	---	PASS
LTK	4058	broad.mit.edu	37	15	41795849	41795849	+	3'UTR	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41795849A>C	uc001zoa.3	-	20					LTK_uc001zob.3_3'UTR|LTK_uc010ucx.1_3'UTR|LTK_uc010bcg.2_3'UTR	NM_002344	NP_002335	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase isoform 1						apoptosis|cell proliferation|phosphatidylinositol 3-kinase cascade|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|central_nervous_system(1)	7		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		GGATGAGAAGAGCTTTTTATT	0.587										TSP Lung(18;0.14)			7	8	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	42041126	42041126	+	Splice_Site	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42041126G>T	uc010ucy.1	+	16	5684	c.5503_splice	c.e16+1	p.G1835_splice	MGA_uc010ucz.1_Splice_Site_p.G1626_splice|MGA_uc010uda.1_Splice_Site_p.G451_splice|MGA_uc001zoi.2_Splice_Site_p.G49_splice	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1							MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		CGGAACCCAGGTATAAAGTTC	0.403													36	21	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51773566	51773566	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51773566T>C	uc002abf.2	-	24	5962	c.5737A>G	c.(5737-5739)AAA>GAA	p.K1913E	DMXL2_uc002abd.2_5'UTR|DMXL2_uc010ufy.1_Missense_Mutation_p.K1913E|DMXL2_uc010bfa.2_Missense_Mutation_p.K1277E	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1913						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		GCAGATGTTTTGGTTACTTTT	0.383													98	69	---	---	---	---	PASS
PYGO1	26108	broad.mit.edu	37	15	55839197	55839197	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55839197T>C	uc010bfl.1	-	3	340	c.284A>G	c.(283-285)TAT>TGT	p.Y95C	PYGO1_uc002adf.1_Missense_Mutation_p.Y95C	NM_015617	NP_056432	Q9Y3Y4	PYGO1_HUMAN	pygopus homolog 1	95	Pro-rich.				Wnt receptor signaling pathway	nucleus	zinc ion binding			ovary(1)|skin(1)	2				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		AAAGCCAGGATAACCAGGGCC	0.448													3	98	---	---	---	---	PASS
ZNF609	23060	broad.mit.edu	37	15	64966254	64966254	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64966254A>C	uc002ann.2	+	4	1201	c.1201A>C	c.(1201-1203)ACC>CCC	p.T401P		NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609	401						nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						CAGCAGCAAAACCCGGGCAGG	0.587													4	124	---	---	---	---	PASS
DENND4A	10260	broad.mit.edu	37	15	66048786	66048786	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66048786C>T	uc002aph.2	-	3	381	c.3G>A	c.(1-3)ATG>ATA	p.M1I	DENND4A_uc002api.2_Missense_Mutation_p.M1I|DENND4A_uc002apj.3_Missense_Mutation_p.M1I|DENND4A_uc010ujj.1_Missense_Mutation_p.M1I	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	1					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						TGTCTTCAATCATCTTCCATT	0.358													26	15	---	---	---	---	PASS
SCAMP5	192683	broad.mit.edu	37	15	75305046	75305046	+	Silent	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75305046C>G	uc002azk.1	+	3	198	c.36C>G	c.(34-36)CCC>CCG	p.P12P	SCAMP5_uc002azl.1_Silent_p.P12P|SCAMP5_uc002azm.1_Silent_p.P12P|SCAMP5_uc002azn.1_Silent_p.P12P|SCAMP5_uc010uly.1_5'UTR	NM_138967	NP_620417	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	12	Cytoplasmic (Potential).				exocytosis|negative regulation of endocytosis|positive regulation of calcium ion-dependent exocytosis|positive regulation of cytokine secretion|protein transport|response to endoplasmic reticulum stress	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane|trans-Golgi network membrane	protein binding			ovary(1)	1						CACCATTGCCCAAATTCATCC	0.512													24	10	---	---	---	---	PASS
SCAMP5	192683	broad.mit.edu	37	15	75305073	75305073	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75305073C>T	uc002azk.1	+	3	225	c.63C>T	c.(61-63)TTC>TTT	p.F21F	SCAMP5_uc002azl.1_Silent_p.F21F|SCAMP5_uc002azm.1_Silent_p.F21F|SCAMP5_uc002azn.1_Silent_p.F21F|SCAMP5_uc010uly.1_Silent_p.L3L	NM_138967	NP_620417	Q8TAC9	SCAM5_HUMAN	secretory carrier membrane protein 5	21	Cytoplasmic (Potential).				exocytosis|negative regulation of endocytosis|positive regulation of calcium ion-dependent exocytosis|positive regulation of cytokine secretion|protein transport|response to endoplasmic reticulum stress	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane|trans-Golgi network membrane	protein binding			ovary(1)	1						AGCCATGTTTCTACCAAGACT	0.527													18	15	---	---	---	---	PASS
IREB2	3658	broad.mit.edu	37	15	78758753	78758753	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78758753G>T	uc002bdr.2	+	5	713	c.551G>T	c.(550-552)GGC>GTC	p.G184V	IREB2_uc010unb.1_5'UTR|IREB2_uc002bdq.2_Missense_Mutation_p.G184V	NM_004136	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	184							4 iron, 4 sulfur cluster binding|metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		GGAGAACTAGGCCGAAACTCA	0.458													8	41	---	---	---	---	PASS
MESDC2	23184	broad.mit.edu	37	15	81274291	81274291	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81274291C>G	uc002bfy.1	-	2	519	c.446G>C	c.(445-447)AGG>ACG	p.R149T	MESDC2_uc002bfx.2_RNA|MESDC2_uc010uno.1_Intron	NM_015154	NP_055969	Q14696	MESD_HUMAN	mesoderm development candidate 2	149	Chaperone domain (By similarity).				mesoderm development|protein folding|Wnt receptor signaling pathway	endoplasmic reticulum					0						GCTGCTTTACCTCTGGACGTC	0.403													5	35	---	---	---	---	PASS
ADAMTSL3	57188	broad.mit.edu	37	15	84694106	84694106	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84694106G>C	uc002bjz.3	+	27	4798	c.4574G>C	c.(4573-4575)AGA>ACA	p.R1525T	ADAMTSL3_uc010bmt.1_Missense_Mutation_p.R1525T|ADAMTSL3_uc010bmu.1_Missense_Mutation_p.R1525T	NM_207517	NP_997400	P82987	ATL3_HUMAN	ADAMTS-like 3 precursor	1525	TSP type-1 9.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(6)|central_nervous_system(5)|lung(5)|large_intestine(4)|breast(3)|skin(2)|kidney(1)|pancreas(1)	27			BRCA - Breast invasive adenocarcinoma(143;0.211)			GTGTCTCCAAGAGCATGTGCC	0.527													3	23	---	---	---	---	PASS
RHCG	51458	broad.mit.edu	37	15	90020842	90020842	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90020842T>A	uc002bnz.2	-	7	1042	c.1018A>T	c.(1018-1020)ATT>TTT	p.I340F	RHCG_uc002bny.2_Missense_Mutation_p.I111F|RHCG_uc002boa.2_Intron	NM_016321	NP_057405	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	340	Cytoplasmic (Potential).				amine transport|cellular ion homeostasis|epithelial cell differentiation|transepithelial ammonium transport	apical plasma membrane|basolateral plasma membrane|cytoplasmic vesicle|integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			kidney(1)	1	Lung NSC(78;0.0237)|all_lung(78;0.0478)					AGATTGTTAATGCCACATGTG	0.592													21	12	---	---	---	---	PASS
ITFG3	83986	broad.mit.edu	37	16	310048	310048	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:310048G>C	uc002cgf.2	+	5	661	c.466G>C	c.(466-468)GAC>CAC	p.D156H	ITFG3_uc010bqr.2_RNA|ITFG3_uc002cgg.2_Missense_Mutation_p.D156H|ITFG3_uc010uud.1_RNA|ITFG3_uc002cgh.2_Missense_Mutation_p.D156H	NM_032039	NP_114428	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3	156	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				TGTGGCCCAAGACGTGGCCCT	0.622													34	21	---	---	---	---	PASS
WDR24	84219	broad.mit.edu	37	16	735419	735419	+	Silent	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:735419G>C	uc002ciz.1	-	7	2617	c.1857C>G	c.(1855-1857)GTC>GTG	p.V619V	JMJD8_uc002ciw.1_5'Flank|JMJD8_uc002cix.1_5'Flank|JMJD8_uc002ciy.1_5'Flank	NM_032259	NP_115635	Q96S15	WDR24_HUMAN	WD repeat domain 24	749										ovary(1)|central_nervous_system(1)	2		Hepatocellular(780;0.0218)				GCGCGTGTGAGACAGACAGGA	0.677													5	40	---	---	---	---	PASS
NDUFB10	4716	broad.mit.edu	37	16	2011251	2011251	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2011251C>T	uc002cni.2	+	2	337	c.228C>T	c.(226-228)ATC>ATT	p.I76I	NDUFB10_uc002cnj.2_Silent_p.I76I	NM_004548	NP_004539	O96000	NDUBA_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	76					mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding				0					NADH(DB00157)	AGGAGGACATCATGTGCATGT	0.537													39	27	---	---	---	---	PASS
PAQR4	124222	broad.mit.edu	37	16	3019837	3019837	+	Silent	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3019837G>C	uc002csj.3	+	1	496	c.162G>C	c.(160-162)ACG>ACC	p.T54T	PAQR4_uc002csk.3_Silent_p.T54T|PAQR4_uc002csl.3_Silent_p.T54T|PAQR4_uc010uwm.1_5'Flank	NM_152341	NP_689554	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	54	Helical; (Potential).			T -> A (in Ref. 2; BAC03821).		integral to membrane	receptor activity				0						ACATCTACACGCACGGTGAGC	0.697													14	14	---	---	---	---	PASS
TNP2	7142	broad.mit.edu	37	16	11362858	11362858	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11362858A>T	uc002das.2	-	1	303	c.262T>A	c.(262-264)TCC>ACC	p.S88T	C16orf75_uc002daq.1_Intron	NM_005425	NP_005416	Q05952	STP2_HUMAN	transition protein 2 (during histone to	88					cell differentiation|multicellular organismal development|spermatogenesis	nucleosome|nucleus	DNA binding				0						GAGTGGTGGGAGTTCATAGTC	0.557													39	22	---	---	---	---	PASS
TMC7	79905	broad.mit.edu	37	16	19020681	19020681	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19020681C>A	uc002dfq.2	+	2	385	c.255C>A	c.(253-255)CTC>CTA	p.L85L	TMC7_uc010vao.1_Silent_p.L85L|TMC7_uc002dfp.2_Silent_p.L85L|TMC7_uc010vap.1_5'UTR	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a	85	Extracellular (Potential).					integral to membrane				skin(2)|ovary(1)	3						CTGAAAACCTCAGCAGCCATT	0.493													46	20	---	---	---	---	PASS
THUMPD1	55623	broad.mit.edu	37	16	20748467	20748467	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20748467T>C	uc002dho.2	-	4	935	c.797A>G	c.(796-798)GAG>GGG	p.E266G	THUMPD1_uc010vaz.1_Missense_Mutation_p.E119G|THUMPD1_uc002dhp.2_Missense_Mutation_p.E266G	NM_017736	NP_060206	Q9NXG2	THUM1_HUMAN	THUMP domain containing 1	266											0						CTTCACCACCTCCTGGAGATT	0.428													23	86	---	---	---	---	PASS
SEPT1	1731	broad.mit.edu	37	16	30392786	30392786	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30392786G>A	uc002dxy.2	-	6	501	c.314C>T	c.(313-315)CCG>CTG	p.P105L	SEPT1_uc002dxw.2_5'Flank|SEPT1_uc002dxx.2_5'UTR|SEPT1_uc010veq.1_Missense_Mutation_p.P152L	NM_052838	NP_443070	Q8WYJ6	SEPT1_HUMAN	septin 1	105					cell cycle|cell division	microtubule organizing center|septin complex	GTP binding|protein binding			ovary(1)	1			Colorectal(24;0.193)			TTTCACCACCGGAAGCCAGCT	0.562													4	114	---	---	---	---	PASS
PHKG2	5261	broad.mit.edu	37	16	30768579	30768579	+	3'UTR	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30768579C>G	uc002dzk.1	+	11						NM_000294	NP_000285	P15735	PHKG2_HUMAN	phosphorylase kinase, gamma 2 (testis)						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	ATP binding|calmodulin binding|phosphorylase kinase activity			ovary(1)	1			Colorectal(24;0.198)			GGCCAGGACTCTGAGATCAGA	0.592													8	11	---	---	---	---	PASS
ITGAD	3681	broad.mit.edu	37	16	31429662	31429662	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31429662C>T	uc002ebv.1	+	22	2706	c.2657C>T	c.(2656-2658)ACC>ATC	p.T886I	ITGAD_uc010cap.1_Missense_Mutation_p.T887I	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	886	Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						TACAAGGCCACCCTGGGAGAC	0.577													7	96	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	16	33784804	33784804	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33784804G>T	uc010vgb.1	+	2	213	c.193G>T	c.(193-195)GCC>TCC	p.A65S						RecName: Full=Transporter;																		CCTCCTCAGGGCCAAGGGCAC	0.652													3	22	---	---	---	---	PASS
SLC12A4	6560	broad.mit.edu	37	16	67985834	67985834	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67985834A>G	uc002euz.2	-	8	1165	c.1024T>C	c.(1024-1026)TTC>CTC	p.F342L	SLC12A4_uc010ceu.2_Missense_Mutation_p.F336L|SLC12A4_uc010vkh.1_Missense_Mutation_p.F311L|SLC12A4_uc010vki.1_Missense_Mutation_p.F342L|SLC12A4_uc010vkj.1_Missense_Mutation_p.F344L|SLC12A4_uc002eva.2_Missense_Mutation_p.F342L|SLC12A4_uc002evb.2_RNA	NM_005072	NP_005063	Q9UP95	S12A4_HUMAN	solute carrier family 12, member 4 isoform a	342					cell volume homeostasis|potassium ion transport|sodium ion transport	integral to plasma membrane|membrane fraction	potassium:chloride symporter activity			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	CTGTGGCAGAAGAAACTCCAT	0.577													7	57	---	---	---	---	PASS
HAS3	3038	broad.mit.edu	37	16	69147356	69147356	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69147356G>C	uc010cfh.2	+	3	873	c.649G>C	c.(649-651)GAC>CAC	p.D217H	HAS3_uc002ewk.2_Missense_Mutation_p.D217H|HAS3_uc002ewl.2_Missense_Mutation_p.D217H	NM_005329	NP_005320	O00219	HAS3_HUMAN	hyaluronan synthase 3 isoform a	217	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to plasma membrane	hyaluronan synthase activity				0		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		GTGCGACTCTGACACTGTGCT	0.612											OREG0023905	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	29	59	---	---	---	---	PASS
SF3B3	23450	broad.mit.edu	37	16	70563070	70563070	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70563070C>T	uc002ezf.2	+	3	576	c.365C>T	c.(364-366)GCT>GTT	p.A122V	SNORD111B_uc010cfv.1_5'Flank	NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3	122					protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)				CAGTTCTTAGCTGTGGATCCC	0.438													3	51	---	---	---	---	PASS
VAT1L	57687	broad.mit.edu	37	16	77910312	77910312	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77910312G>T	uc002ffg.1	+	5	865	c.768G>T	c.(766-768)GGG>GGT	p.G256G		NM_020927	NP_065978	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport protein 1 homolog (T.	256							oxidoreductase activity|zinc ion binding			central_nervous_system(1)	1						GCCTCTGTGGGGACAACACTG	0.478													10	135	---	---	---	---	PASS
C16orf46	123775	broad.mit.edu	37	16	81095726	81095726	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81095726C>A	uc002fgc.3	-	4	487	c.228G>T	c.(226-228)AGG>AGT	p.R76S	C16orf46_uc010chf.2_Missense_Mutation_p.R76S|C16orf46_uc010vno.1_5'UTR	NM_152337	NP_689550	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46 isoform 2	76											0						CTGGAGAAGTCCTTCCCCACC	0.557													11	106	---	---	---	---	PASS
KIAA0182	23199	broad.mit.edu	37	16	85691124	85691124	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85691124C>T	uc002fix.2	+	8	1628	c.1554C>T	c.(1552-1554)TTC>TTT	p.F518F	KIAA0182_uc002fiw.2_Silent_p.F414F|KIAA0182_uc002fiy.2_Silent_p.F445F	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1	518							protein binding			large_intestine(3)|ovary(1)|skin(1)	5						TGTCCGAGTTCCGGCAGCAGG	0.697													9	12	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577107	7577107	+	Nonsense_Mutation	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577107A>T	uc002gim.2	-	8	1025	c.831T>A	c.(829-831)TGT>TGA	p.C277*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.C277*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.C145*|TP53_uc010cng.1_Nonsense_Mutation_p.C145*|TP53_uc002gii.1_Nonsense_Mutation_p.C145*|TP53_uc010cnh.1_Nonsense_Mutation_p.C277*|TP53_uc010cni.1_Nonsense_Mutation_p.C277*|TP53_uc002gij.2_Nonsense_Mutation_p.C277*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	277	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		C -> W (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> F (in sporadic cancers; somatic mutation).|C -> Y (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.C277F(20)|p.C277Y(15)|p.0?(7)|p.C277*(6)|p.C277G(4)|p.C277C(4)|p.P278fs*28(2)|p.?(2)|p.C277W(2)|p.C277fs*29(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.V274_P278del(1)|p.C277_P278insXXXXXXX(1)|p.L265_K305del41(1)|p.C275_R283delCACPGRDRR(1)|p.S269fs*21(1)|p.F270_D281del12(1)|p.A276_C277delAC(1)|p.C275fs*67(1)|p.C277R(1)|p.C277S(1)|p.V272_K292del21(1)|p.C275fs*20(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CTCTCCCAGGACAGGCACAAA	0.547		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			17	14	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10248889	10248889	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10248889C>A	uc002gmk.1	-	14	1398	c.1308G>T	c.(1306-1308)AAG>AAT	p.K436N	MYH13_uc010vvf.1_Missense_Mutation_p.K111N	NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	436	Myosin head-like.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						ACAGGAACATCTTCTCGTAGA	0.517													44	42	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10309504	10309504	+	Intron	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10309504G>C	uc002gmm.2	-						uc002gml.1_RNA	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,						muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						CCTGGAGAAAGAGAGAGTCAC	0.393									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				18	16	---	---	---	---	PASS
AKAP10	11216	broad.mit.edu	37	17	19845219	19845219	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19845219C>T	uc002gwo.2	-	6	1118	c.981G>A	c.(979-981)AGG>AGA	p.R327R	AKAP10_uc002gwp.1_Silent_p.R327R|AKAP10_uc010cqw.1_Silent_p.R327R	NM_007202	NP_009133	O43572	AKA10_HUMAN	A-kinase anchor protein 10 precursor	327	RGS 1.				blood coagulation|protein localization	cytosol|mitochondrion|plasma membrane	signal transducer activity			skin(1)	1	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					CTCCACAAATCCTTGCTGCAA	0.373													4	25	---	---	---	---	PASS
NOS2	4843	broad.mit.edu	37	17	26106004	26106004	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26106004G>T	uc002gzu.2	-	10	1347	c.1083C>A	c.(1081-1083)GGC>GGA	p.G361G	NOS2_uc010crh.1_Silent_p.G361G|NOS2_uc010wab.1_Silent_p.G361G	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	361					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	GGAACTCCAGGCCGCCCACCT	0.567													30	40	---	---	---	---	PASS
EFCAB5	374786	broad.mit.edu	37	17	28380773	28380773	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28380773G>C	uc002het.2	+	10	1993	c.1801G>C	c.(1801-1803)GAG>CAG	p.E601Q	EFCAB5_uc010wbi.1_Missense_Mutation_p.E344Q|EFCAB5_uc010wbj.1_Missense_Mutation_p.E545Q|EFCAB5_uc010wbk.1_Missense_Mutation_p.E258Q|EFCAB5_uc010csd.2_RNA|EFCAB5_uc010cse.2_Missense_Mutation_p.E480Q|EFCAB5_uc010csf.2_Missense_Mutation_p.E480Q	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a	601							calcium ion binding			ovary(1)|skin(1)	2						ATCAAGCAGAGAGTCAGTTGC	0.478													12	109	---	---	---	---	PASS
GAS2L2	246176	broad.mit.edu	37	17	34071981	34071981	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34071981C>T	uc002hjv.1	-	6	2563	c.2535G>A	c.(2533-2535)GAG>GAA	p.E845E		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	845					cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTGGctctttctcctcctttc	0.512													4	20	---	---	---	---	PASS
STAT3	6774	broad.mit.edu	37	17	40467822	40467822	+	Intron	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40467822G>T	uc002hzl.1	-						STAT3_uc002hzk.1_Intron|STAT3_uc002hzm.1_Intron|STAT3_uc010wgh.1_Intron|STAT3_uc002hzn.1_Intron|STAT3_uc010cyf.1_3'UTR	NM_139276	NP_644805	P40763	STAT3_HUMAN	signal transducer and activator of transcription						cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		AGGGACTCTGGAGGGACAGAC	0.587									Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome				10	41	---	---	---	---	PASS
ABCC3	8714	broad.mit.edu	37	17	48761083	48761083	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48761083G>C	uc002isl.2	+	27	4000	c.3920G>C	c.(3919-3921)AGA>ACA	p.R1307T	ABCC3_uc002isn.2_Missense_Mutation_p.R61T	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	1307	Cytoplasmic (By similarity).|ABC transporter 2.				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	CTGGTGCTGAGAGACCTGAGT	0.647													30	81	---	---	---	---	PASS
UTP18	51096	broad.mit.edu	37	17	49357465	49357465	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49357465A>C	uc002its.2	+	8	1161	c.1112A>C	c.(1111-1113)AAG>ACG	p.K371T		NM_016001	NP_057085	Q9Y5J1	UTP18_HUMAN	UTP18, small subunit processome component	371	WD 3.				rRNA processing	nucleolus					0			BRCA - Breast invasive adenocarcinoma(22;2.09e-07)			CTAGCAATGAAGGTAAAGCAT	0.418													16	24	---	---	---	---	PASS
TBX4	9496	broad.mit.edu	37	17	59560585	59560585	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59560585C>A	uc002izi.2	+	8	1391	c.1346C>A	c.(1345-1347)ACC>AAC	p.T449N	TBX4_uc010ddo.2_Missense_Mutation_p.T450N|TBX4_uc010woy.1_Missense_Mutation_p.T450N	NM_018488	NP_060958	P57082	TBX4_HUMAN	T-box 4	449					leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						TTCACCGCCACCACCATGATG	0.592													4	67	---	---	---	---	PASS
ACE	1636	broad.mit.edu	37	17	61566424	61566424	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61566424C>T	uc002jau.1	+	17	2594	c.2572C>T	c.(2572-2574)CGG>TGG	p.R858W	ACE_uc002jav.1_Missense_Mutation_p.R284W|ACE_uc010ddv.1_Missense_Mutation_p.R85W|ACE_uc010wpj.1_Missense_Mutation_p.R284W|ACE_uc002jaw.1_RNA|ACE_uc010wpk.1_Intron	NM_000789	NP_000780	P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 1	858	Extracellular (Potential).|Peptidase M2 2.				arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	CTACGTGCGCCGGGCCCTGCA	0.632													3	39	---	---	---	---	PASS
KCNJ16	3773	broad.mit.edu	37	17	68128659	68128659	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68128659C>A	uc002jin.2	+	5	917	c.431C>A	c.(430-432)TCT>TAT	p.S144Y	KCNJ16_uc002jio.2_Missense_Mutation_p.S144Y|KCNJ16_uc002jip.2_Missense_Mutation_p.S144Y|KCNJ16_uc002jiq.2_Missense_Mutation_p.S176Y	NM_018658	NP_061128	Q9NPI9	IRK16_HUMAN	potassium inwardly-rectifying channel J16	144	Extracellular (By similarity).				synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(1)|central_nervous_system(1)|skin(1)	3	Breast(10;2.96e-09)					GAAGAATGTTCTGTGGCCGTG	0.458													23	41	---	---	---	---	PASS
CD300A	11314	broad.mit.edu	37	17	72480186	72480186	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72480186C>T	uc002jkv.2	+	7	1142	c.821C>T	c.(820-822)TCT>TTT	p.S274F	CD300A_uc002jkw.2_Missense_Mutation_p.S161F|CD300A_uc010dfr.2_Missense_Mutation_p.S125F|CD300A_uc010dfs.2_Missense_Mutation_p.S78F	NM_007261	NP_009192	Q9UGN4	CLM8_HUMAN	leukocyte membrane antigen	274	Cytoplasmic (Potential).				cell adhesion	integral to membrane|plasma membrane	receptor activity			ovary(1)|skin(1)	2						GTGTTTGATTCTAACACCAAC	0.507													26	60	---	---	---	---	PASS
KIAA0195	9772	broad.mit.edu	37	17	73489627	73489627	+	Silent	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73489627A>G	uc002jnz.3	+	17	2417	c.2142A>G	c.(2140-2142)ACA>ACG	p.T714T	KIAA0195_uc010wsa.1_Silent_p.T724T|KIAA0195_uc010wsb.1_Silent_p.T354T|KIAA0195_uc002job.3_5'Flank	NM_014738	NP_055553	Q12767	K0195_HUMAN	hypothetical protein LOC9772	714					ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGGCCTGCACAGACTTCTGGG	0.612													16	31	---	---	---	---	PASS
ASPSCR1	79058	broad.mit.edu	37	17	79975246	79975246	+	3'UTR	SNP	C	T	T	rs111891945		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79975246C>T	uc002kcx.2	+	16					ASPSCR1_uc002kcy.2_3'UTR|ASPSCR1_uc002kcz.2_3'UTR|ASPSCR1_uc002kda.2_3'UTR	NM_024083	NP_076988	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region,								protein binding		ASPSCR1/TFE3(161)	soft_tissue(118)|kidney(43)|breast(1)	162	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			GGACCACCTCCTCTGCCAGCA	0.622			T	TFE3	alveolar soft part sarcoma								4	14	---	---	---	---	PASS
NARF	26502	broad.mit.edu	37	17	80426772	80426772	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80426772G>C	uc002kfg.3	+	4	525	c.385G>C	c.(385-387)GGG>CGG	p.G129R	NARF_uc002kff.3_Missense_Mutation_p.G70R|NARF_uc010wvo.1_Missense_Mutation_p.G129R|NARF_uc010wvp.1_Missense_Mutation_p.L13F|NARF_uc010dit.2_Missense_Mutation_p.G129R|NARF_uc002kfj.3_Missense_Mutation_p.G81R|NARF_uc002kfi.3_RNA|NARF_uc002kfh.3_Missense_Mutation_p.G129R|NARF_uc002kfk.2_RNA	NM_012336	NP_036468	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor isoform a	129						lamin filament	lamin binding			skin(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			CAAAAGTCTTGGTGAGTCATC	0.388													5	78	---	---	---	---	PASS
NDC80	10403	broad.mit.edu	37	18	2595619	2595619	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2595619C>T	uc002kli.2	+	11	1402	c.1220C>T	c.(1219-1221)GCG>GTG	p.A407V		NM_006101	NP_006092	O14777	NDC80_HUMAN	kinetochore associated 2	407	Interaction with the N-terminus of CDCA1.|Interaction with PSMC2 and SMC1A.|Interaction with NEK2 and ZWINT.|Interaction with SMC1A.				attachment of spindle microtubules to kinetochore|cell division|establishment of mitotic spindle orientation|mitotic prometaphase|mitotic sister chromatid segregation|mitotic spindle organization|phosphatidylinositol-mediated signaling	condensed nuclear chromosome outer kinetochore|cytosol|Ndc80 complex	protein binding			ovary(1)	1						GGCAAAGAAGCGGTATGTCAT	0.408													16	41	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21474922	21474922	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21474922A>T	uc002kuq.2	+	44	5599	c.5513A>T	c.(5512-5514)GAG>GTG	p.E1838V	LAMA3_uc002kur.2_Missense_Mutation_p.E1838V|LAMA3_uc002kus.3_Missense_Mutation_p.E229V|LAMA3_uc002kut.3_Missense_Mutation_p.E229V	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	1838	Domain II and I.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ACCATGGGCGAGCAGCTCCGC	0.627													3	25	---	---	---	---	PASS
ZNF555	148254	broad.mit.edu	37	19	2851495	2851495	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2851495T>A	uc002lwo.2	+	3	249	c.160T>A	c.(160-162)TCA>ACA	p.S54T	ZNF555_uc002lwn.3_Missense_Mutation_p.S54T	NM_152791	NP_690004	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	54	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCAGTGGGTCAGTTTCTCA	0.388													3	45	---	---	---	---	PASS
C19orf29	58509	broad.mit.edu	37	19	3612107	3612107	+	Missense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3612107C>A	uc002lyh.2	-	10	2144	c.2091G>T	c.(2089-2091)GAG>GAT	p.E697D	C19orf29_uc010xho.1_Missense_Mutation_p.E156D|C19orf29_uc010dtn.2_Missense_Mutation_p.E545D|C19orf29_uc002lyi.3_Missense_Mutation_p.E697D|C19orf29_uc010dto.2_RNA	NM_001080543	NP_001074012	Q8WUQ7	CS029_HUMAN	chromosome 19 open reading frame 29	697						catalytic step 2 spliceosome	protein binding				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCGCAGGCCTCCAGGAAGT	0.582													17	181	---	---	---	---	PASS
ECSIT	51295	broad.mit.edu	37	19	11624758	11624758	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11624758G>C	uc002msb.2	-	3	509	c.375C>G	c.(373-375)GAC>GAG	p.D125E	ECSIT_uc002msa.1_5'Flank|ECSIT_uc010dyc.1_Missense_Mutation_p.D125E|ECSIT_uc010dyd.2_Missense_Mutation_p.D125E|ECSIT_uc010xma.1_Intron	NM_016581	NP_057665	Q9BQ95	ECSIT_HUMAN	evolutionarily conserved signaling intermediate	125					innate immune response|regulation of oxidoreductase activity	mitochondrion	oxidoreductase activity, acting on NADH or NADPH|protein binding			ovary(1)	1						ACACAGCCAGGTCCCGCTCGA	0.597													6	56	---	---	---	---	PASS
ZNF563	147837	broad.mit.edu	37	19	12430206	12430206	+	Silent	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12430206T>C	uc002mtp.2	-	4	871	c.633A>G	c.(631-633)TTA>TTG	p.L211L	ZNF563_uc002mtq.2_Intron	NM_145276	NP_660319	Q8TA94	ZN563_HUMAN	zinc finger protein 563	211	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCATACGTAATAAACTGGGCC	0.393													17	142	---	---	---	---	PASS
CC2D1A	54862	broad.mit.edu	37	19	14038090	14038090	+	Intron	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14038090A>G	uc002mxo.2	+						CC2D1A_uc002mxp.2_Intron|CC2D1A_uc010dzh.2_Intron|CC2D1A_uc002mxq.1_3'UTR	NM_017721	NP_060191	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A						positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			TGAGAGGTGGACATTCATCCG	0.557													3	55	---	---	---	---	PASS
OR7A5	26659	broad.mit.edu	37	19	14938677	14938677	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14938677A>G	uc002mzw.2	-	1	600	c.377T>C	c.(376-378)ATC>ACC	p.I126T	OR7A5_uc010xoa.1_Missense_Mutation_p.I126T	NM_017506	NP_059976	Q15622	OR7A5_HUMAN	olfactory receptor, family 7, subfamily A,	126	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(2)	2						GGGGTGACAGATGGCCACAAA	0.483													22	38	---	---	---	---	PASS
OR10H4	126541	broad.mit.edu	37	19	16060285	16060285	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16060285G>A	uc010xov.1	+	1	468	c.468G>A	c.(466-468)ATG>ATA	p.M156I		NM_001004465	NP_001004465	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2						GCTCAGTCATGGGGATGATGG	0.522													21	113	---	---	---	---	PASS
LSR	51599	broad.mit.edu	37	19	35757739	35757739	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35757739A>G	uc002nyl.2	+	8	1380	c.1157A>G	c.(1156-1158)GAA>GGA	p.E386G	LSR_uc002nym.2_Missense_Mutation_p.E367G|LSR_uc002nyn.2_Missense_Mutation_p.E318G|LSR_uc002nyo.2_Intron|LSR_uc010xsr.1_Missense_Mutation_p.E278G|LSR_uc002nyp.2_Intron|USF2_uc010xss.1_5'Flank|USF2_uc002nyq.1_5'Flank|USF2_uc002nyr.1_5'Flank|USF2_uc002nys.1_5'Flank|USF2_uc002nyt.1_5'Flank|USF2_uc002nyu.1_5'Flank|USF2_uc002nyv.1_5'Flank	NM_205834	NP_991403	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	386	Cytoplasmic (Potential).				embryo development|liver development	chylomicron|integral to membrane|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle	receptor activity				0	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CTGTCCCTAGAAGTCCGCAGT	0.597													6	6	---	---	---	---	PASS
ZBTB32	27033	broad.mit.edu	37	19	36207735	36207735	+	3'UTR	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36207735T>C	uc002oay.2	+	6					ZBTB32_uc002oaz.2_RNA|MLL4_uc010eei.2_5'Flank	NM_014383	NP_055198	Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32						DNA repair|negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleoplasm	DNA binding|protein binding|transcription corepressor activity|zinc ion binding			ovary(1)|skin(1)	2	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTGGCACCGCTGCTACGGCGG	0.642											OREG0025433	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	29	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41383813	41383813	+	Missense_Mutation	SNP	A	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41383813A>C	uc002opm.2	-	6	1459	c.917T>G	c.(916-918)GTC>GGC	p.V306G	CYP2A7_uc002opo.2_Missense_Mutation_p.V306G|CYP2A7_uc002opn.2_Missense_Mutation_p.V255G	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,	306						endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GGTGGTGCTGACCGTCTCGGT	0.587													11	56	---	---	---	---	PASS
FUT1	2523	broad.mit.edu	37	19	49253764	49253764	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49253764C>G	uc002pkk.2	-	4	1750	c.775G>C	c.(775-777)GTG>CTG	p.V259L		NM_000148	NP_000139	P19526	FUT1_HUMAN	fucosyltransferase 1	259	Lumenal (Potential).		V -> E (in Bombay H-).		L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to plasma membrane|membrane fraction	galactoside 2-alpha-L-fucosyltransferase activity			ovary(1)	1		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		CTGGTGACCACGAAAACGGGG	0.617													5	122	---	---	---	---	PASS
PLEKHA4	57664	broad.mit.edu	37	19	49348658	49348658	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49348658C>T	uc002pkx.2	-	16	2263	c.1712G>A	c.(1711-1713)CGC>CAC	p.R571H	PLEKHA4_uc002pkw.1_Missense_Mutation_p.R86H|PLEKHA4_uc010eml.2_Missense_Mutation_p.R546H	NM_020904	NP_065955	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing family A	571						cytoplasm|membrane	1-phosphatidylinositol binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		AGGGAGGTGGCGACCCTCAGG	0.582													55	14	---	---	---	---	PASS
NOSIP	51070	broad.mit.edu	37	19	50060221	50060221	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50060221G>A	uc002pok.2	-	7	600	c.448C>T	c.(448-450)CCT>TCT	p.P150S	NOSIP_uc002pol.2_Missense_Mutation_p.P150S|NOSIP_uc010yay.1_RNA	NM_015953	NP_057037	Q9Y314	NOSIP_HUMAN	nitric oxide synthase interacting protein	150					negative regulation of nitric-oxide synthase activity|nitric oxide metabolic process	cytosol|nucleus	protein binding			skin(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00321)|GBM - Glioblastoma multiforme(134;0.0133)		TTACTTGGAGGACCCACACTG	0.478													5	9	---	---	---	---	PASS
GPR32	2854	broad.mit.edu	37	19	51274695	51274695	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51274695C>T	uc010ycf.1	+	1	838	c.838C>T	c.(838-840)CTG>TTG	p.L280L		NM_001506	NP_001497	O75388	GPR32_HUMAN	G protein-coupled receptor 32	280	Helical; Name=6; (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		GTTGGTCCATCTGTGGCGACG	0.592													81	25	---	---	---	---	PASS
ZNF320	162967	broad.mit.edu	37	19	53383746	53383746	+	3'UTR	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53383746G>A	uc002qag.2	-	4					ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_3'UTR|ZNF320_uc002qai.2_3'UTR	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		gagacaccacgcctggccCAA	0.189													3	4	---	---	---	---	PASS
VSTM1	284415	broad.mit.edu	37	19	54561828	54561828	+	Silent	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54561828G>A	uc002qcw.3	-	3	263	c.87C>T	c.(85-87)CCC>CCT	p.P29P	VSTM1_uc010erb.2_RNA|VSTM1_uc002qcx.3_Silent_p.P29P	NM_198481	NP_940883	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	29	Ig-like V-type.					integral to membrane					0	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		CGTGGAGGGAGGGCTTGGGCG	0.498													10	70	---	---	---	---	PASS
NLRP7	199713	broad.mit.edu	37	19	55450590	55450590	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55450590C>G	uc002qih.3	-	4	1673	c.1597G>C	c.(1597-1599)GAG>CAG	p.E533Q	NLRP7_uc002qig.3_Missense_Mutation_p.E533Q|NLRP7_uc002qii.3_Missense_Mutation_p.E533Q|NLRP7_uc010esk.2_Missense_Mutation_p.E533Q|NLRP7_uc010esl.2_Missense_Mutation_p.E561Q	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	533							ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		GCCTCCAACTCCTTGGCTCTC	0.498													3	66	---	---	---	---	PASS
U2AF2	11338	broad.mit.edu	37	19	56181003	56181003	+	Missense_Mutation	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56181003A>G	uc002qlu.2	+	11	2293	c.1238A>G	c.(1237-1239)AAG>AGG	p.K413R	U2AF2_uc002qlt.2_Missense_Mutation_p.K409R	NM_007279	NP_009210	P26368	U2AF2_HUMAN	U2 (RNU2) small nuclear RNA auxiliary factor 2	413	RRM 3.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding			ovary(1)	1		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GGGCTTGTCAAGTCCATCGAG	0.567													23	12	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56369479	56369479	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56369479G>C	uc002qmd.3	+	3	1142	c.720G>C	c.(718-720)TTG>TTC	p.L240F	NLRP4_uc002qmf.2_Missense_Mutation_p.L165F|NLRP4_uc010etf.2_Missense_Mutation_p.L71F	NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	240	NACHT.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		AGGGCGGCTTGAACGAACCCG	0.567													26	61	---	---	---	---	PASS
ZIM2	23619	broad.mit.edu	37	19	57286539	57286539	+	Silent	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57286539G>C	uc002qnr.2	-	11	1483	c.1101C>G	c.(1099-1101)CTC>CTG	p.L367L	uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_Silent_p.L163L|ZIM2_uc010ygr.1_Silent_p.L163L|ZIM2_uc002qnq.2_Silent_p.L367L|ZIM2_uc010etp.2_Silent_p.L367L|ZIM2_uc010ygs.1_Silent_p.L367L	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	367	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		GGTGTGGCATGAGATAGAAGG	0.478													6	96	---	---	---	---	PASS
ZNF814	730051	broad.mit.edu	37	19	58385546	58385546	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58385546G>T	uc002qqo.2	-	3	1484	c.1212C>A	c.(1210-1212)GAC>GAA	p.D404E	ZNF814_uc002qqk.2_Intron|ZNF814_uc010yhl.1_Intron	NM_001144989	NP_001138461	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	404					regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0						AATGTTTTTTGTCAGTGTGAA	0.393													3	8	---	---	---	---	PASS
ZNF418	147686	broad.mit.edu	37	19	58438177	58438177	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58438177C>G	uc002qqs.1	-	4	1664	c.1372G>C	c.(1372-1374)GAG>CAG	p.E458Q	ZNF418_uc010yhn.1_RNA|ZNF418_uc010yho.1_Missense_Mutation_p.E373Q	NM_133460	NP_597717	Q8TF45	ZN418_HUMAN	zinc finger protein 418	458	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		TTCCTACACTCTCTACACTCA	0.443													96	44	---	---	---	---	PASS
FASTKD5	60493	broad.mit.edu	37	20	3127517	3127517	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3127517C>G	uc002whz.2	-	2	2511	c.2200G>C	c.(2200-2202)GAG>CAG	p.E734Q	uc002whv.1_Intron|UBOX5_uc002whw.2_Intron|UBOX5_uc002whx.2_Intron|UBOX5_uc002why.1_Intron	NM_021826	NP_068598	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	734	RAP.				apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity				0						TAGGATAACTCTACCACACGG	0.502													48	55	---	---	---	---	PASS
ANKRD5	63926	broad.mit.edu	37	20	10030758	10030758	+	Nonsense_Mutation	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10030758C>A	uc002wno.2	+	7	1934	c.1541C>A	c.(1540-1542)TCA>TAA	p.S514*	uc002wnn.1_Intron|ANKRD5_uc002wnp.2_Nonsense_Mutation_p.S514*|ANKRD5_uc010gbz.2_Nonsense_Mutation_p.S325*	NM_022096	NP_071379	Q9NU02	ANKR5_HUMAN	ankyrin repeat domain protein 5	514							calcium ion binding			ovary(1)|breast(1)	2						GCCTTTGAATCAGGAATACCT	0.378													8	46	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29625941	29625941	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29625941A>T	uc010ztl.1	+	2	127	c.95A>T	c.(94-96)GAT>GTT	p.D32V	FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010gdr.1_RNA|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						GGGCATTCAGATGCAATTGGA	0.333													6	48	---	---	---	---	PASS
FRG1B	284802	broad.mit.edu	37	20	29632710	29632710	+	Intron	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29632710G>C	uc010ztl.1	+						FRG1B_uc002wvm.1_RNA|FRG1B_uc010ztj.1_RNA|FRG1B_uc010ztk.1_Silent_p.T97T					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TGCATGAGACGCTTCTGGACA	0.308													15	341	---	---	---	---	PASS
BCL2L1	598	broad.mit.edu	37	20	30309576	30309576	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30309576G>T	uc002wwl.2	-	2	812	c.446C>A	c.(445-447)GCA>GAA	p.A149E	BCL2L1_uc002wwk.2_RNA|BCL2L1_uc002wwm.2_Intron|BCL2L1_uc002wwn.2_Missense_Mutation_p.A149E|BCL2L1_uc002wwo.1_Missense_Mutation_p.A149E	NM_138578	NP_612815	Q07817	B2CL1_HUMAN	BCL2-like 1 isoform 1	149					induction of apoptosis by intracellular signals|negative regulation of establishment of protein localization in plasma membrane|negative regulation of survival gene product expression|regulation of mitochondrial membrane permeability|regulation of mitochondrial membrane potential|release of cytochrome c from mitochondria|response to cytokine stimulus	integral to membrane|mitochondrial outer membrane|nuclear membrane	BH3 domain binding|identical protein binding			lung(1)|central_nervous_system(1)	2	all_cancers(5;3.47e-06)|all_epithelial(3;1.83e-06)|Lung NSC(7;2.08e-06)|all_lung(7;3.63e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;2.97e-06)|all cancers(5;3.21e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00052)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			CACGCACAGTGCCCCGCCGAA	0.537													9	175	---	---	---	---	PASS
TM9SF4	9777	broad.mit.edu	37	20	30723942	30723942	+	Missense_Mutation	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30723942G>C	uc002wxj.2	+	3	430	c.195G>C	c.(193-195)CAG>CAC	p.Q65H	TM9SF4_uc010ztr.1_5'UTR|TM9SF4_uc010zts.1_5'UTR|TM9SF4_uc002wxk.2_Missense_Mutation_p.Q48H	NM_014742	NP_055557	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	65						integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCTTCTGCCAGCCCAGCAAGA	0.483													5	44	---	---	---	---	PASS
SNTA1	6640	broad.mit.edu	37	20	32026723	32026723	+	Silent	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32026723C>G	uc002wzd.1	-	2	692	c.420G>C	c.(418-420)GGG>GGC	p.G140G	SNTA1_uc010zuf.1_Silent_p.G140G	NM_003098	NP_003089	Q13424	SNTA1_HUMAN	acidic alpha 1 syntrophin	140	PH 1.|PDZ.				muscle contraction	cell junction|cytoplasm|cytoskeleton|sarcolemma	actin binding|calmodulin binding			skin(1)	1						ACAAGTCTTCCCCATTCACAG	0.532													11	141	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	41400092	41400092	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41400092C>T	uc002xkg.2	-	5	851	c.667G>A	c.(667-669)GAC>AAC	p.D223N	PTPRT_uc010ggj.2_Missense_Mutation_p.D223N	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	223	Extracellular (Potential).|Ig-like C2-type.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CAAAGCTTGTCATGCTGAGAC	0.418													4	163	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	41408892	41408892	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41408892G>T	uc002xkg.2	-	4	718	c.534C>A	c.(532-534)GCC>GCA	p.A178A	PTPRT_uc010ggj.2_Silent_p.A178A	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	178	Extracellular (Potential).|MAM.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CCTCGTCCACGGCGATGTAGC	0.522													3	60	---	---	---	---	PASS
KCNB1	3745	broad.mit.edu	37	20	48098449	48098449	+	Intron	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48098449A>G	uc002xur.1	-						KCNB1_uc002xus.1_Splice_Site_p.K189_splice	NM_004975	NP_004966	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related						energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	protein binding|voltage-gated potassium channel activity			pancreas(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TCCCAGACTCACCTTGGCAGC	0.567													4	73	---	---	---	---	PASS
CSTF1	1477	broad.mit.edu	37	20	54978796	54978796	+	3'UTR	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54978796G>T	uc002xxl.1	+	6					CSTF1_uc002xxm.1_3'UTR|CSTF1_uc002xxn.1_3'UTR|CSTF1_uc002xxo.1_3'UTR	NM_001033521	NP_001028693	Q05048	CSTF1_HUMAN	cleavage stimulation factor subunit 1						mRNA cleavage|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nucleoplasm	protein binding|RNA binding			central_nervous_system(1)	1			Colorectal(105;0.202)			CACCCTCTCCGTAGGGTTCTT	0.592													10	62	---	---	---	---	PASS
TFAP2C	7022	broad.mit.edu	37	20	55212966	55212966	+	Missense_Mutation	SNP	A	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55212966A>T	uc002xya.2	+	7	1493	c.1250A>T	c.(1249-1251)AAA>ATA	p.K417I	TFAP2C_uc010zzi.1_Missense_Mutation_p.K248I	NM_003222	NP_003213	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma	417	H-S-H (helix-span-helix), dimerization.				cell-cell signaling|male gonad development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Colorectal(105;0.229)			AACTACATCAAAGAAGCCCTG	0.488													5	71	---	---	---	---	PASS
KRTAP22-1	337979	broad.mit.edu	37	21	31973474	31973474	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31973474G>T	uc011add.1	+	1	35	c.35G>T	c.(34-36)GGC>GTC	p.G12V	KRTAP6-2_uc011adc.1_5'Flank	NM_181620	NP_853651	Q3MIV0	KR221_HUMAN	keratin associated protein 22-1	12						intermediate filament					0						GGTGGCCAGGGCTATGCCAAA	0.443													34	96	---	---	---	---	PASS
KCNJ6	3763	broad.mit.edu	37	21	39087121	39087121	+	Missense_Mutation	SNP	C	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39087121C>G	uc011aej.1	-	3	392	c.339G>C	c.(337-339)TTG>TTC	p.L113F	KCNJ6_uc002ywo.2_Missense_Mutation_p.L113F	NM_002240	NP_002231	P48051	IRK6_HUMAN	potassium inwardly-rectifying channel J6	113	Helical; Name=M1; (By similarity).				synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1					Halothane(DB01159)	TGTATGCGATCAACCACCAGA	0.453													60	128	---	---	---	---	PASS
LCA5L	150082	broad.mit.edu	37	21	40794949	40794949	+	Silent	SNP	A	G	G			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40794949A>G	uc002yxu.2	-	5	1103	c.790T>C	c.(790-792)TTA>CTA	p.L264L	LCA5L_uc002yxv.2_Silent_p.L264L|LCA5L_uc002yxw.1_Silent_p.L264L|LCA5L_uc002yxx.1_Silent_p.L126L|LCA5L_uc002yxy.2_RNA	NM_152505	NP_689718	O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	264											0		Prostate(19;1.2e-06)				ATAATAGATAATTTATGAGTG	0.373													3	159	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	42080497	42080497	+	Nonsense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42080497G>A	uc002yyq.1	-	2	696	c.244C>T	c.(244-246)CAA>TAA	p.Q82*	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	82	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GGGAAAATTTGGAGAGTGCCG	0.502													14	144	---	---	---	---	PASS
RIPK4	54101	broad.mit.edu	37	21	43161781	43161781	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43161781C>T	uc002yzn.1	-	8	1620	c.1572G>A	c.(1570-1572)TTG>TTA	p.L524L		NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3	524						cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						CGTTCTTCTCCAACAGCAGCC	0.622													23	80	---	---	---	---	PASS
PRDM15	63977	broad.mit.edu	37	21	43221851	43221851	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43221851G>T	uc002yzq.1	-	31	4184	c.4073C>A	c.(4072-4074)ACC>AAC	p.T1358N	PRDM15_uc002yzo.2_Missense_Mutation_p.T1029N|PRDM15_uc002yzp.2_Missense_Mutation_p.T1049N|PRDM15_uc002yzr.1_Missense_Mutation_p.T1049N	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	1358					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CGATGGTGTGGTCACATTTGG	0.557													4	77	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47655203	47655203	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47655203C>A	uc002zir.1	-	28	5958	c.5922G>T	c.(5920-5922)CTG>CTT	p.L1974L	MCM3APAS_uc002zim.2_Intron|MCM3APAS_uc002zin.2_Intron|MCM3AP_uc002zio.1_Silent_p.L469L|MCM3AP_uc002zip.1_Silent_p.L715L|MCM3AP_uc002ziq.1_Silent_p.L901L|MCM3APAS_uc002zis.1_5'Flank	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	1974					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					CCATGTCTAGCAGCGCAGAGA	0.507													4	68	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22664690	22664690	+	RNA	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22664690C>T	uc011aim.1	+	31		c.2205C>T			LOC96610_uc011aiq.1_RNA					Parts of antibodies, mostly variable regions.												0						GACACCTGGTCAGGAACGCGG	0.488													10	16	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23006960	23006960	+	RNA	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23006960C>A	uc011aim.1	+	119		c.7563C>A								Parts of antibodies, mostly variable regions.												0						GGGCTCTGCTCCTCCTCACCC	0.627													3	4	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23006961	23006961	+	RNA	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23006961C>T	uc011aim.1	+	119		c.7564C>T								Parts of antibodies, mostly variable regions.												0						GGCTCTGCTCCTCCTCACCCT	0.627													3	4	---	---	---	---	PASS
POLR2F	5435	broad.mit.edu	37	22	38355472	38355472	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38355472G>T	uc003aul.2	+	3	331	c.210G>T	c.(208-210)GCG>GCT	p.A70A	POLR2F_uc010gxi.2_Missense_Mutation_p.A64S|POLR2F_uc003aum.2_RNA	NM_021974	NP_068809	P61218	RPAB2_HUMAN	DNA directed RNA polymerase II polypeptide F	70					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex|nucleolus	DNA binding|DNA-directed RNA polymerase activity			breast(1)	1	Melanoma(58;0.045)					GCACCCGAGCGCTCCAGATTG	0.587													26	121	---	---	---	---	PASS
TAB1	10454	broad.mit.edu	37	22	39817833	39817833	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39817833G>A	uc003axt.2	+	8	827	c.778G>A	c.(778-780)GCT>ACT	p.A260T	TAB1_uc003axr.2_Missense_Mutation_p.A336T|TAB1_uc011aok.1_Missense_Mutation_p.A94T|TAB1_uc003axu.1_Missense_Mutation_p.A260T	NM_006116	NP_006107	Q15750	TAB1_HUMAN	mitogen-activated protein kinase kinase kinase 7	260	PP2C-like.				activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding			breast(1)	1						TCCCCATAGCGCTGCCAAGTC	0.547													8	34	---	---	---	---	PASS
FAM83F	113828	broad.mit.edu	37	22	40415273	40415273	+	Silent	SNP	C	T	T	rs141929176		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40415273C>T	uc003ayk.1	+	2	685	c.591C>T	c.(589-591)GAC>GAT	p.D197D		NM_138435	NP_612444	Q8NEG4	FA83F_HUMAN	hypothetical protein LOC113828	197										breast(1)	1						TCATCCTGGACGAGGCAGGAG	0.527													12	59	---	---	---	---	PASS
ZC3H7B	23264	broad.mit.edu	37	22	41752423	41752423	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41752423C>T	uc003azw.2	+	21	2676	c.2460C>T	c.(2458-2460)ATC>ATT	p.I820I	ZC3H7B_uc010gyl.1_Intron	NM_017590	NP_060060	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	836					interspecies interaction between organisms	nucleus	nucleic acid binding|protein binding|zinc ion binding			central_nervous_system(1)	1						GGACCCCCATCAGTTCTCGGG	0.617													22	139	---	---	---	---	PASS
ZC3H7B	23264	broad.mit.edu	37	22	41753225	41753225	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41753225G>A	uc003azw.2	+	23	2942	c.2726G>A	c.(2725-2727)TGC>TAC	p.C909Y	ZC3H7B_uc010gyl.1_Intron	NM_017590	NP_060060	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	925	C3H1-type 4.|Potential.				interspecies interaction between organisms	nucleus	nucleic acid binding|protein binding|zinc ion binding			central_nervous_system(1)	1						AAGTGCCGCTGCGCCCATGGA	0.662													6	38	---	---	---	---	PASS
ACO2	50	broad.mit.edu	37	22	41923345	41923345	+	Silent	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41923345G>C	uc003bac.2	+	16	2029	c.2007G>C	c.(2005-2007)TCG>TCC	p.S669S	ACO2_uc003bad.2_Silent_p.S694S|POLR3H_uc003bae.2_RNA|POLR3H_uc003baf.2_3'UTR|POLR3H_uc003bag.2_3'UTR|POLR3H_uc003bai.2_3'UTR	NM_001098	NP_001089	Q99798	ACON_HUMAN	aconitase 2, mitochondrial precursor	669					citrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	4 iron, 4 sulfur cluster binding|aconitate hydratase activity|citrate hydro-lyase (cis-aconitate-forming) activity|iron ion binding|isocitrate hydro-lyase (cis-aconitate-forming) activity			breast(2)|ovary(1)|lung(1)	4						GCGAGGGCTCGAGCCGGGAGC	0.617											OREG0026589	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	19	17	---	---	---	---	PASS
CENPM	79019	broad.mit.edu	37	22	42335022	42335022	+	3'UTR	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42335022G>C	uc003bbn.2	-	6					WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|CENPM_uc003bbm.2_3'UTR|CENPM_uc003bbo.2_3'UTR|CENPM_uc010gyq.2_3'UTR	NM_024053	NP_076958	Q9NSP4	CENPM_HUMAN	centromere protein M isoform a						mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleus					0						GAGTCAGCACGAAGCCATGAG	0.627													4	30	---	---	---	---	PASS
CYP2D7P1	1564	broad.mit.edu	37	22	42538870	42538870	+	Missense_Mutation	SNP	A	C	C	rs2982057	by1000genomes	TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42538870A>C	uc003bci.2	-	3	475	c.94T>G	c.(94-96)TCG>GCG	p.S32A	CYP2D7P1_uc003bcg.2_5'Flank|CYP2D7P1_uc003bch.2_5'Flank|CYP2D7P1_uc010gyv.2_Intron|CYP2D7P1_uc010gyw.2_RNA|CYP2D7P1_uc010gyx.1_Missense_Mutation_p.S32A	NR_002570				SubName: Full=Cytochrome P450 2D6;          EC=1.14.14.1;												0						CCATAGCGCGACAGGAACACC	0.687													3	18	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42606218	42606218	+	Silent	SNP	C	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42606218C>A	uc003bcj.1	-	1	5228	c.5094G>T	c.(5092-5094)TCG>TCT	p.S1698S	TCF20_uc003bck.1_Silent_p.S1698S|TCF20_uc003bnt.2_Silent_p.S1698S	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1698					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						GCCCCATAACCGAAGACTCTG	0.557													17	64	---	---	---	---	PASS
SELO	83642	broad.mit.edu	37	22	50649091	50649091	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50649091G>A	uc011arr.1	+	5	1160	c.1102G>A	c.(1102-1104)GAC>AAC	p.D368N	SELO_uc010hap.2_Missense_Mutation_p.D179N|SELO_uc003bjy.2_Missense_Mutation_p.D48N|SELO_uc003bjz.2_Missense_Mutation_p.D48N	NM_031454	NP_113642	Q9BVL4	SELO_HUMAN	selenoprotein O	368											0		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		CAATGCCTCCGACAACACCGG	0.672											OREG0026676	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	24	35	---	---	---	---	PASS
MIOX	55586	broad.mit.edu	37	22	50927504	50927504	+	Silent	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50927504C>T	uc003bll.1	+	6	558	c.444C>T	c.(442-444)TGC>TGT	p.C148C	MIOX_uc003blm.1_Silent_p.C148C|MIOX_uc003bln.1_Missense_Mutation_p.A159V	NM_017584	NP_060054	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	148					inositol catabolic process	cytoplasm|inclusion body	aldo-keto reductase (NADP) activity|ferric iron binding|inositol oxygenase activity				0		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCGTCGGATGCCGTCCGCAGG	0.667													3	7	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50094645	50094645	+	Missense_Mutation	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50094645G>T	uc004dox.3	+	13	4429	c.4131G>T	c.(4129-4131)ATG>ATT	p.M1377I	CCNB3_uc004doy.2_Missense_Mutation_p.M1377I|CCNB3_uc004doz.2_Missense_Mutation_p.M273I|CCNB3_uc010njq.2_Missense_Mutation_p.M269I|CCNB3_uc004dpa.2_Missense_Mutation_p.M216I	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	1377					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					CCTTGGATATGTTGAAGCTGG	0.473													7	12	---	---	---	---	PASS
TGIF2LX	90316	broad.mit.edu	37	X	89177393	89177393	+	Missense_Mutation	SNP	T	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89177393T>A	uc004efe.2	+	2	358	c.309T>A	c.(307-309)AAT>AAA	p.N103K		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	103	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						GGTTTATCAATGCTCGCAGAC	0.473													23	88	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107413848	107413848	+	Missense_Mutation	SNP	C	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107413848C>T	uc004enw.3	-	35	3590	c.3487G>A	c.(3487-3489)GGA>AGA	p.G1163R	COL4A6_uc004env.3_Missense_Mutation_p.G1162R|COL4A6_uc011msn.1_Missense_Mutation_p.G1162R|COL4A6_uc010npk.2_Missense_Mutation_p.G1162R	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	1163	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						CCTTTGGGTCCTATTAATCCG	0.498									Alport_syndrome_with_Diffuse_Leiomyomatosis				36	56	---	---	---	---	PASS
COL4A5	1287	broad.mit.edu	37	X	107850090	107850090	+	Missense_Mutation	SNP	G	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107850090G>A	uc004enz.1	+	29	2565	c.2363G>A	c.(2362-2364)CGC>CAC	p.R788H	COL4A5_uc011mso.1_Missense_Mutation_p.R788H|COL4A5_uc004eob.1_Missense_Mutation_p.R396H	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	788	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						CCTCCAGGACGCACTGGCTTA	0.517									Alport_syndrome_with_Diffuse_Leiomyomatosis				19	17	---	---	---	---	PASS
MOSPD1	56180	broad.mit.edu	37	X	134033531	134033531	+	Translation_Start_Site	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134033531G>C	uc004eyb.2	-	2	120	c.-67C>G	c.(-69--65)ATCTA>ATGTA		MOSPD1_uc004eya.2_Translation_Start_Site|MOSPD1_uc010nrv.2_RNA|MOSPD1_uc011mvr.1_Translation_Start_Site	NM_019556	NP_062456	Q9UJG1	MSPD1_HUMAN	motile sperm domain containing 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter	integral to membrane|nucleus|perinuclear region of cytoplasm	structural molecule activity			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(192;0.000127)					ACTTTTCTTAGATTCAGTTAA	0.363													12	10	---	---	---	---	PASS
SPANXE	171489	broad.mit.edu	37	X	140785779	140785779	+	Missense_Mutation	SNP	T	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140785779T>C	uc004fbq.2	-	2	230	c.137A>G	c.(136-138)GAG>GGG	p.E46G		NM_145665	NP_663698	Q8TAD1	SPNXE_HUMAN	SPANX family, member E	46						cytoplasm|nucleus					0	Acute lymphoblastic leukemia(192;7.65e-05)					GGTCGAGGACTCAGATGTTTT	0.493													7	88	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140969237	140969237	+	Silent	SNP	G	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140969237G>T	uc011mwp.1	+	4	564	c.564G>T	c.(562-564)GTG>GTT	p.V188V		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	188	MAGE 1.									skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ATGAAAAGGTGGACAAGTTGG	0.453													43	26	---	---	---	---	PASS
FUNDC2	65991	broad.mit.edu	37	X	154282952	154282952	+	3'UTR	SNP	G	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154282952G>C	uc004fmw.2	+	5						NM_023934	NP_076423	Q9BWH2	FUND2_HUMAN	FUN14 domain containing 2							mitochondrion					0	all_cancers(53;3.51e-17)|all_epithelial(53;5.13e-11)|all_lung(58;3.84e-07)|Lung NSC(58;1.2e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TCCTAAGGAAGATGACCTCAT	0.468													10	66	---	---	---	---	PASS
DCAF8	50717	broad.mit.edu	37	1	160187254	160187278	+	3'UTR	DEL	GTCTTTCTTTTATCTAAAGCAAAAA	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160187254_160187278delGTCTTTCTTTTATCTAAAGCAAAAA	uc001fvo.2	-	14					DCAF8_uc001fvn.2_3'UTR|DCAF8_uc009wth.2_3'UTR|DCAF8_uc010pjb.1_3'UTR|DCAF8_uc010pjc.1_3'UTR	NM_015726	NP_056541	Q5TAQ9	DCAF8_HUMAN	DDB1 and CUL4 associated factor 8							CUL4 RING ubiquitin ligase complex	protein binding			skin(2)	2						CTCCTGGGATGTCTTTCTTTTATCTAAAGCAAAAAGTCCAAAGTG	0.524													8	4	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	186023082	186023082	+	Frame_Shift_Del	DEL	G	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186023082delG	uc001grq.1	+	44	7055	c.6826delG	c.(6826-6828)GGGfs	p.G2276fs		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2276	Ig-like C2-type 20.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GAATGTTGCTGGGACTGCAAA	0.398													93	11	---	---	---	---	
USP34	9736	broad.mit.edu	37	2	61483709	61483709	+	Intron	DEL	A	-	-	rs34025877		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61483709delA	uc002sbe.2	-						USP34_uc002sbf.2_Intron	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34						positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			AATGCTCAGCaaaaaaatttt	0.244													8	4	---	---	---	---	
KIAA1310	55683	broad.mit.edu	37	2	97275285	97275287	+	In_Frame_Del	DEL	TTT	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97275285_97275287delTTT	uc002swn.3	-	12	1478_1480	c.1332_1334delAAA	c.(1330-1335)GCAAAG>GCG	p.K447del	KIAA1310_uc002swh.3_In_Frame_Del_p.K335del|KIAA1310_uc002swi.3_In_Frame_Del_p.K348del|KIAA1310_uc002swj.3_RNA|KIAA1310_uc002swk.3_In_Frame_Del_p.K360del|KIAA1310_uc010fhz.2_In_Frame_Del_p.K241del|KIAA1310_uc002swl.3_In_Frame_Del_p.K348del|KIAA1310_uc002swm.3_RNA|KIAA1310_uc010yur.1_In_Frame_Del_p.K241del|KIAA1310_uc002swp.1_In_Frame_Del_p.K348del|KIAA1310_uc002swq.1_In_Frame_Del_p.K219del|KIAA1310_uc010fhy.1_In_Frame_Del_p.K348del	NM_001115016	NP_001108488	Q9P2N6	K1310_HUMAN	hypothetical protein LOC55683 isoform a	447											0						TGATTTCTTCTTTGCTTTGCTTA	0.384													322	9	---	---	---	---	
RIF1	55183	broad.mit.edu	37	2	152292281	152292282	+	Intron	INS	-	T	T	rs75364982	byFrequency	TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152292281_152292282insT	uc002txm.2	+						RIF1_uc002txl.2_Intron|RIF1_uc010fnv.1_Intron|RIF1_uc002txn.2_Intron|RIF1_uc002txo.2_Intron|RIF1_uc010zby.1_Intron	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1						cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TCTGTTTTTTGTTTTTTTTTTT	0.307													9	4	---	---	---	---	
IRS1	3667	broad.mit.edu	37	2	227660807	227660808	+	In_Frame_Ins	INS	-	GCT	GCT			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227660807_227660808insGCT	uc002voh.3	-	1	2699_2700	c.2647_2648insAGC	c.(2647-2649)CCC>CAGCCC	p.882_883insQ		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	882_883					fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GTGCAGCAAGGgctgctgctgc	0.554													39	13	---	---	---	---	
PFKFB4	5210	broad.mit.edu	37	3	48561279	48561279	+	Intron	DEL	G	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48561279delG	uc003ctv.2	-						PFKFB4_uc003ctw.2_Intron|PFKFB4_uc010hkc.2_Intron|PFKFB4_uc003ctx.2_Intron|PFKFB4_uc010hkb.2_Intron|PFKFB4_uc011bbm.1_Intron	NM_004567	NP_004558	Q16877	F264_HUMAN	6-phosphofructo-2-kinase/fructose-2,						fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0003)|KIRC - Kidney renal clear cell carcinoma(197;0.00596)|Kidney(197;0.00684)		AGGGCAAGCAGAGAGGGGTCC	0.607													53	20	---	---	---	---	
PTPRG	5793	broad.mit.edu	37	3	62267213	62267214	+	Intron	INS	-	TTTT	TTTT	rs60919586		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62267213_62267214insTTTT	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron|PTPRG_uc011bfi.1_Intron|uc010hno.2_Intron|uc003dld.3_Intron|uc010hnp.2_Intron|uc003dle.3_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		ACTGCAGAGGCTTTTTTTTTTT	0.406													4	2	---	---	---	---	
ADCY5	111	broad.mit.edu	37	3	123066917	123066918	+	Intron	DEL	CA	-	-	rs10551109		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123066917_123066918delCA	uc003egh.1	-						ADCY5_uc003egg.1_Intron|ADCY5_uc003egi.1_Intron	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5						activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		tgtgtctgtgcatgtgtgtgta	0.460													7	4	---	---	---	---	
DBR1	51163	broad.mit.edu	37	3	137890343	137890344	+	Intron	DEL	GC	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137890343_137890344delGC	uc003erv.2	-						DBR1_uc003eru.2_Intron	NM_016216	NP_057300	Q9UK59	DBR1_HUMAN	debranching enzyme homolog 1							nucleus	metal ion binding|RNA lariat debranching enzyme activity				0						aaaaaaaaaaGCAAAATACTAA	0.168													4	2	---	---	---	---	
TACC3	10460	broad.mit.edu	37	4	1746465	1746472	+	Frame_Shift_Del	DEL	GGAGCAAG	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1746465_1746472delGGAGCAAG	uc003gdo.2	+	15	2465_2472	c.2357_2364delGGAGCAAG	c.(2356-2364)CGGAGCAAGfs	p.R786fs	TACC3_uc003gdp.2_Frame_Shift_Del_p.R426fs|TACC3_uc010ica.2_Frame_Shift_Del_p.R207fs	NM_006342	NP_006333	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing	786_788	Potential.					centrosome				ovary(1)|central_nervous_system(1)	2		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			GCCCAGGTCCGGAGCAAGGCCCAGGCGG	0.673													28	7	---	---	---	---	
THAP9	79725	broad.mit.edu	37	4	83839377	83839377	+	Frame_Shift_Del	DEL	T	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:83839377delT	uc003hnt.2	+	5	2131	c.2012delT	c.(2011-2013)CTTfs	p.L671fs	THAP9_uc003hns.1_Frame_Shift_Del_p.L527fs|THAP9_uc003hnu.1_RNA|THAP9_uc003hnv.2_Frame_Shift_Del_p.L388fs	NM_024672	NP_078948	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	671							DNA binding|metal ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	5		Hepatocellular(203;0.114)				GACTTGGCGCTTTGGACAGTT	0.393													105	13	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37351260	37351261	+	Intron	INS	-	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37351260_37351261insA	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CATCAAGAGAGAAAAAAAAACG	0.317													117	7	---	---	---	---	
HCN1	348980	broad.mit.edu	37	5	45353214	45353223	+	Frame_Shift_Del	DEL	ATCATTGAGT	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45353214_45353223delATCATTGAGT	uc003jok.2	-	5	1381_1390	c.1356_1365delACTCAATGAT	c.(1354-1365)GAACTCAATGATfs	p.E452fs		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	452_455	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						CTCTCAGAGGATCATTGAGTTCATTGAGAA	0.348													84	7	---	---	---	---	
SH3PXD2B	285590	broad.mit.edu	37	5	171765673	171765674	+	Frame_Shift_Ins	INS	-	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171765673_171765674insA	uc003mbr.2	-	13	2606_2607	c.2435_2436insT	c.(2434-2436)TTGfs	p.L812fs		NM_001017995	NP_001017995	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	812					adipose tissue development|bone development|cell communication|cell differentiation|eye development|heart development|podosome assembly	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-5-phosphate binding|SH2 domain binding			ovary(3)|skin(1)	4	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCTGGCCCCCCAAAGAGTTGGA	0.609													15	17	---	---	---	---	
HIST1H3G	8355	broad.mit.edu	37	6	26271166	26271167	+	3'UTR	INS	-	TTTTTAAG	TTTTTAAG			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26271166_26271167insTTTTTAAG	uc003nhi.2	-	1					uc003nhj.2_5'Flank|HIST1H2BI_uc003nhk.2_5'Flank	NM_003534	NP_003525	P68431	H31_HUMAN	H3 histone family, member H						blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0						TTAAAAGAGCCTTTTTAAGTTG	0.431													34	8	---	---	---	---	
SGK1	6446	broad.mit.edu	37	6	134498867	134498879	+	5'Flank	DEL	GATTACTTCTGGA	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134498867_134498879delGATTACTTCTGGA	uc003qen.3	-						SGK1_uc003qeo.3_Intron|SGK1_uc011ect.1_5'Flank|SGK1_uc011ecu.1_5'Flank|SGK1_uc011ecv.1_5'Flank|SGK1_uc011ecw.1_Frame_Shift_Del_p.S28fs	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform						apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		GCAGGTTGGGGATTACTTCTGGAGGCTGGAGGT	0.484													35	8	---	---	---	---	
OSBPL3	26031	broad.mit.edu	37	7	24849496	24849503	+	Frame_Shift_Del	DEL	CCGATGAA	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24849496_24849503delCCGATGAA	uc003sxf.2	-	20	2645_2652	c.2240_2247delTTCATCGG	c.(2239-2247)GTTCATCGGfs	p.V747fs	OSBPL3_uc003sxd.2_RNA|OSBPL3_uc003sxe.2_RNA|OSBPL3_uc003sxg.2_Frame_Shift_Del_p.V711fs|OSBPL3_uc003sxh.2_Frame_Shift_Del_p.V716fs|OSBPL3_uc003sxi.2_Frame_Shift_Del_p.V680fs	NM_015550	NP_056365	Q9H4L5	OSBL3_HUMAN	oxysterol-binding protein-like protein 3 isoform	747_749					lipid transport		lipid binding|protein binding			skin(1)	1						TCCCAAACAGCCGATGAACCGCTTTTCC	0.500													160	68	---	---	---	---	
DDX56	54606	broad.mit.edu	37	7	44610981	44610988	+	Intron	DEL	ACATCTAG	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44610981_44610988delACATCTAG	uc003tlg.2	-						DDX56_uc003tle.2_Intron|DDX56_uc003tlf.2_Intron|DDX56_uc003tlh.2_Intron|DDX56_uc010kyg.2_Intron|DDX56_uc010kyh.1_Intron	NM_019082	NP_061955	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 56						rRNA processing	nucleolus	ATP binding|ATP-dependent RNA helicase activity|identical protein binding|RNA binding			upper_aerodigestive_tract(1)	1						agtatcagtcacatctagaacctggccc	0.149													18	10	---	---	---	---	
POLR2J	5439	broad.mit.edu	37	7	102116771	102116772	+	Intron	DEL	CT	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102116771_102116772delCT	uc003uzp.1	-							NM_006234	NP_006225	P52435	RPB11_HUMAN	DNA directed RNA polymerase II polypeptide J						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|LRR domain binding|protein dimerization activity			pancreas(1)	1						TCCTCCCACCCTGAGTCTAAAC	0.337													4	2	---	---	---	---	
CTTNBP2	83992	broad.mit.edu	37	7	117357974	117357981	+	Intron	DEL	TAAAAAAA	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117357974_117357981delTAAAAAAA	uc003vjf.2	-							NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2											ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AGCTTTGGTTTAAAAAAATAACTCTGTG	0.327													6	5	---	---	---	---	
C7orf58	79974	broad.mit.edu	37	7	120901811	120901812	+	Intron	INS	-	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120901811_120901812insT	uc003vjq.3	+						C7orf58_uc003vjs.3_3'UTR|C7orf58_uc003vjt.3_3'UTR	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1							endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					cacctggactatttttctgaga	0.020													3	4	---	---	---	---	
RAD54B	25788	broad.mit.edu	37	8	95392597	95392609	+	Frame_Shift_Del	DEL	TGTTCAAGGTTTG	-	-	rs76782918		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95392597_95392609delTGTTCAAGGTTTG	uc003ygk.2	-	12	2109_2121	c.2011_2023delCAAACCTTGAACA	c.(2011-2025)CAAACCTTGAACATTfs	p.Q671fs	RAD54B_uc010may.1_Frame_Shift_Del_p.Q478fs	NM_012415	NP_036547	O95073	FSBP_HUMAN	RAD54 homolog B	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment_28					double-strand break repair via homologous recombination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA translocase activity|protein binding			kidney(2)|lung(1)|skin(1)	4	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			TCTTGTAAAATGTTCAAGGTTTGTGTATAGTTG	0.347								Direct_reversal_of_damage|Homologous_recombination					56	11	---	---	---	---	
RSPO2	340419	broad.mit.edu	37	8	108995324	108995334	+	Intron	DEL	CCGCCGCTTAC	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108995324_108995334delCCGCCGCTTAC	uc003yms.2	-						RSPO2_uc003ymq.2_Intron|RSPO2_uc003ymr.2_Intron	NM_178565	NP_848660	Q6UXX9	RSPO2_HUMAN	R-spondin family, member 2 precursor						Wnt receptor signaling pathway	extracellular region	heparin binding			skin(3)|ovary(2)|pancreas(1)|lung(1)	7			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			CTTCCTAAGGCCGCCGCTTACCCCAGGGTCT	0.578													16	7	---	---	---	---	
SNTB1	6641	broad.mit.edu	37	8	121823372	121823372	+	Intron	DEL	C	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823372delC	uc010mdg.2	-						SNTB1_uc003ype.2_Intron	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CGCCACCCTTCCCCCCCCCCC	0.622													4	2	---	---	---	---	
EEF1D	1936	broad.mit.edu	37	8	144668726	144668727	+	Intron	INS	-	C	C			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144668726_144668727insC	uc011lki.1	-						EEF1D_uc003yyp.1_Intron|EEF1D_uc003yyq.1_Intron|EEF1D_uc011lkj.1_Intron|EEF1D_uc003yyr.2_Intron|EEF1D_uc003yyt.2_Intron|EEF1D_uc011lkk.1_Intron|EEF1D_uc003yys.2_Intron|EEF1D_uc003yyv.2_Intron|EEF1D_uc003yyu.2_Intron|EEF1D_uc011lkl.1_Intron	NM_001130057	NP_001123529	P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta						positive regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|signal transducer activity|translation elongation factor activity			ovary(1)|kidney(1)|skin(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			AGCAGACCCGGCCCGGGGGCCC	0.728													4	2	---	---	---	---	
MPDZ	8777	broad.mit.edu	37	9	13106839	13106855	+	3'UTR	DEL	GTTATTTCCCCCCTACA	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13106839_13106855delGTTATTTCCCCCCTACA	uc010mhy.2	-	45					MPDZ_uc003zkx.3_3'UTR|MPDZ_uc003zky.3_3'UTR|MPDZ_uc010mib.2_3'UTR|MPDZ_uc010mhx.2_3'UTR|MPDZ_uc011lmm.1_3'UTR|MPDZ_uc003zkz.3_3'UTR|MPDZ_uc010mhz.2_3'UTR|MPDZ_uc011lmn.1_3'UTR|MPDZ_uc003zlb.3_3'UTR	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein						interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)		AAACTTAAGTGTTATTTCCCCCCTACAGTTTTGAAGA	0.392													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	74204892	74204892	+	IGR	DEL	A	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74204892delA								TRPM3 (143072 upstream) : TMEM2 (93390 downstream)																							TATGCTCTTGAAAAAAAAAAT	0.393													4	2	---	---	---	---	
TRUB2	26995	broad.mit.edu	37	9	131077746	131077747	+	Intron	INS	-	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131077746_131077747insT	uc004buq.1	-							NM_015679	NP_056494	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase homolog 2						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			ovary(1)	1						TTGCTTATGGCTTGGGTGTTCC	0.406													6	3	---	---	---	---	
CACNB2	783	broad.mit.edu	37	10	18825202	18825203	+	Intron	INS	-	GG	GG	rs150214686	by1000genomes	TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18825202_18825203insGG	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron|CACNB2_uc001ipz.2_Intron|CACNB2_uc001ipy.2_Intron|CACNB2_uc010qco.1_Intron|CACNB2_uc001iqa.2_Intron|NSUN6_uc001iqb.2_Intron	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	tttttttttttgggggacaagg	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42608980	42608981	+	IGR	INS	-	G	G	rs148696932		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42608980_42608981insG								None (None upstream) : LOC441666 (218334 downstream)																							TCTTGATGTTATCTATcagcta	0.223													7	12	---	---	---	---	
DNA2	1763	broad.mit.edu	37	10	70184842	70184845	+	Intron	DEL	TTTC	-	-	rs75564385		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70184842_70184845delTTTC	uc001jof.2	-						DNA2_uc001jog.1_Intron|DNA2_uc001joh.1_Intron	NM_001080449	NP_001073918	P51530	DNA2L_HUMAN	DNA replication helicase 2 homolog						base-excision repair|DNA replication, removal of RNA primer|mitochondrial DNA repair|mitochondrial DNA replication|positive regulation of DNA replication|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	mitochondrial nucleoid|nucleoplasm	5'-flap endonuclease activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|site-specific endodeoxyribonuclease activity, specific for altered base				0						CTCTGGAACAtttctttttttttt	0.176													5	4	---	---	---	---	
CHKA	1119	broad.mit.edu	37	11	67831875	67831875	+	Intron	DEL	A	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67831875delA	uc001onj.2	-						CHKA_uc001onk.2_Intron	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	actctgtctcaaaaaaaaaaa	0.129													4	3	---	---	---	---	
CHRDL2	25884	broad.mit.edu	37	11	74417457	74417457	+	Intron	DEL	C	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74417457delC	uc001ovi.2	-						CHRDL2_uc001ovg.2_Intron|CHRDL2_uc001ovh.2_Intron|CHRDL2_uc001ovj.1_5'Flank|CHRDL2_uc001ovk.1_Intron			Q6WN34	CRDL2_HUMAN	RecName: Full=Chordin-like protein 2; AltName: Full=Chordin-related protein 2; AltName: Full=Breast tumor novel factor 1;          Short=BNF-1; Flags: Precursor;						cartilage development|cell differentiation|ossification	extracellular region|mitochondrion					0	Hepatocellular(1;0.098)					GTATTGCCTGCCCCAGAGTCA	0.562													36	16	---	---	---	---	
NCAM1	4684	broad.mit.edu	37	11	112832392	112832392	+	Intron	DEL	T	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112832392delT	uc009yyq.1	+						NCAM1_uc001pno.2_Intron|uc001pnn.2_Intron	NM_001076682	NP_001070150	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1 isoform 3						axon guidance|interferon-gamma-mediated signaling pathway	anchored to membrane|extracellular region|Golgi membrane|integral to membrane				ovary(1)	1		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		TGCAGGTACATTTTTTTTTTT	0.413													4	2	---	---	---	---	
SLC2A14	144195	broad.mit.edu	37	12	7973994	7973995	+	Intron	INS	-	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7973994_7973995insA	uc001qtk.2	-						SLC2A14_uc001qtl.2_Intron|SLC2A14_uc001qtm.2_Intron|SLC2A14_uc010sgg.1_Intron|SLC2A14_uc001qtn.2_Intron|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Intron	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14						cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)		AAAAAATACTTAAggctgagcg	0.178													20	11	---	---	---	---	
SLCO1A2	6579	broad.mit.edu	37	12	21459936	21459936	+	Intron	DEL	G	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21459936delG	uc001rer.2	-						SLCO1A2_uc001res.2_Intron|SLCO1A2_uc010siq.1_Intron|SLCO1A2_uc010sio.1_Intron|SLCO1A2_uc010sip.1_Intron|SLCO1A2_uc001ret.2_Intron|SLCO1A2_uc001reu.2_Intron	NM_021094	NP_066580	P46721	SO1A2_HUMAN	organic anion transporting polypeptide A						bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						TATAAACACAGGGAAAATGAG	0.353													49	14	---	---	---	---	
XPOT	11260	broad.mit.edu	37	12	64816642	64816646	+	Intron	DEL	CACTG	-	-	rs151118213		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64816642_64816646delCACTG	uc001ssb.2	+							NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin						intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		atgactgcgccactgcactccagcc	0.078													4	2	---	---	---	---	
TAOK3	51347	broad.mit.edu	37	12	118588780	118588780	+	3'UTR	DEL	G	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118588780delG	uc001twx.2	-	21					TAOK3_uc001twv.2_3'UTR|TAOK3_uc001tww.2_3'UTR|TAOK3_uc001twy.3_3'UTR	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ttttttttttGTAAATGGCAA	0.338													40	8	---	---	---	---	
COL4A2	1284	broad.mit.edu	37	13	111164629	111164630	+	3'UTR	DEL	AA	-	-	rs5806862		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111164629_111164630delAA	uc001vqx.2	+	48						NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TTTTTTTCTTAAAAAAAAAAAA	0.485													3	3	---	---	---	---	
NOVA1	4857	broad.mit.edu	37	14	26918178	26918178	+	Intron	DEL	A	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26918178delA	uc001wpy.2	-						NOVA1_uc001wpz.2_Intron|NOVA1_uc001wqa.2_Intron	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1						locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		ACCTGTAATTAAAAAAAATAC	0.328													87	10	---	---	---	---	
HECTD1	25831	broad.mit.edu	37	14	31647112	31647112	+	Intron	DEL	T	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31647112delT	uc001wrc.1	-							NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		tttttagaaattttttttttt	0.318													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	66479722	66479723	+	Frame_Shift_Ins	INS	-	TTTT	TTTT			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66479722_66479723insTTTT	uc001xit.2	-	1	910_911	c.785_786insAAAA	c.(784-786)AATfs	p.N262fs						SubName: Full=Nuclease sensitive element binding protein-1;																		CATCTCCTTGATTTTCTTTATC	0.520													43	11	---	---	---	---	
FAM181A	90050	broad.mit.edu	37	14	94391663	94391664	+	Frame_Shift_Ins	INS	-	A	A			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94391663_94391664insA	uc001ybz.1	+	2	353_354	c.46_47insA	c.(46-48)GCCfs	p.A16fs	C14orf86_uc001yby.2_Intron|FAM181A_uc010aus.1_5'Flank|FAM181A_uc001yca.1_5'Flank	NM_138344	NP_612353	Q8N9Y4	F181A_HUMAN	hypothetical protein LOC90050	16											0						GAATGATGCAGCCCCCACAAAT	0.530													35	12	---	---	---	---	
HERC2P2	400322	broad.mit.edu	37	15	23326487	23326487	+	Intron	DEL	A	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23326487delA	uc001yvr.2	-						HERC2P2_uc010ayf.1_Intron|HERC2P2_uc001yvp.3_Intron					RecName: Full=Putative HERC2-like protein 3;												0						ATTTCTCATCAAATGTTACCT	0.418													35	22	---	---	---	---	
CCPG1	9236	broad.mit.edu	37	15	55652875	55652876	+	Frame_Shift_Ins	INS	-	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55652875_55652876insT	uc002acv.1	-	8	1260_1261	c.1095_1096insA	c.(1093-1098)AAACACfs	p.K365fs	CCPG1_uc002acy.2_Frame_Shift_Ins_p.K365fs|CCPG1_uc002acu.1_Frame_Shift_Ins_p.K221fs|CCPG1_uc002acw.1_Frame_Shift_Ins_p.K90fs|CCPG1_uc002acx.2_Intron|CCPG1_uc010bfk.1_Frame_Shift_Ins_p.K365fs|CCPG1_uc002acz.1_Frame_Shift_Ins_p.K365fs	NM_020739	NP_065790	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1 isoform 2	365_366	Potential.|Lumenal (Potential).				cell cycle	integral to membrane				ovary(1)	1				all cancers(107;0.0354)		AGAAAGCTGTGTTTTTTCTGCT	0.386													100	23	---	---	---	---	
XYLT1	64131	broad.mit.edu	37	16	17451987	17451988	+	Intron	INS	-	T	T			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17451987_17451988insT	uc002dfa.2	-							NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						tctttctttccttttttttttt	0.198													3	3	---	---	---	---	
TMCO7	79613	broad.mit.edu	37	16	69059906	69059906	+	Intron	DEL	T	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69059906delT	uc002ewi.3	+							NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7							integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		AAACtttttcttttttttttt	0.134													5	4	---	---	---	---	
RNFT1	51136	broad.mit.edu	37	17	58030551	58030551	+	Intron	DEL	C	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58030551delC	uc002iya.2	-						RNFT1_uc002iyb.2_Intron|RNFT1_uc002iyc.2_Intron	NM_016125	NP_057209	Q5M7Z0	RNFT1_HUMAN	PTD016 protein							integral to membrane	zinc ion binding				0	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			GAAAGGGAttctttttttttt	0.139													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15198505	15198508	+	IGR	DEL	TTTG	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15198505_15198508delTTTG								ANKRD30B (345768 upstream) : LOC644669 (115047 downstream)																							CACATTCTGATTTGTTTTTTGTAT	0.358													4	2	---	---	---	---	
HMHA1	23526	broad.mit.edu	37	19	1079503	1079503	+	Intron	DEL	A	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1079503delA	uc002lqz.1	+						HMHA1_uc010xgd.1_Intron|HMHA1_uc010xge.1_Intron|HMHA1_uc002lra.1_Intron|HMHA1_uc002lrb.1_Intron|HMHA1_uc002lrc.1_Intron	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actccatctcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
ZNF791	163049	broad.mit.edu	37	19	12734684	12734685	+	Intron	INS	-	GGG	GGG	rs2861401		TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12734684_12734685insGGG	uc002mua.2	+						ZNF791_uc010xml.1_Intron|ZNF791_uc010dyu.1_Intron|ZNF791_uc010xmm.1_Intron	NM_153358	NP_699189	Q3KP31	ZN791_HUMAN	zinc finger protein 791						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						tttttttttttggggggggaca	0.144													11	5	---	---	---	---	
LILRB5	10990	broad.mit.edu	37	19	54759054	54759054	+	Intron	DEL	A	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54759054delA	uc002qex.2	-						LILRA6_uc002qew.1_Intron|LILRB5_uc010yer.1_Intron|LILRB5_uc002qey.2_Intron|LILRB5_uc002qez.2_Intron|LILRB5_uc002qfa.1_Intron|LILRB5_uc010yes.1_Intron	NM_006840	NP_006831	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCTTGGGACCACCCCCCCGCC	0.647													4	2	---	---	---	---	
SLC23A2	9962	broad.mit.edu	37	20	4880386	4880386	+	Intron	DEL	A	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4880386delA	uc002wlg.1	-						SLC23A2_uc010zqr.1_Intron|SLC23A2_uc002wlh.1_Intron|SLC23A2_uc002wli.2_Intron	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase						L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2						GTCAGAGGAGAAACAGTAAAC	0.463													58	14	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62074688	62074690	+	Intron	DEL	CAC	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62074688_62074690delCAC	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	ccatcaccatcaccaccatcacc	0.000													4	7	---	---	---	---	
SLC19A1	6573	broad.mit.edu	37	21	46935342	46935343	+	3'UTR	INS	-	C	C	rs148071918	by1000genomes	TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46935342_46935343insC	uc002zhl.1	-	6					SLC19A1_uc010gpy.1_Intron|SLC19A1_uc011aft.1_3'UTR|SLC19A1_uc002zhm.1_Intron|SLC19A1_uc010gpz.1_3'UTR	NM_194255	NP_919231	P41440	S19A1_HUMAN	solute carrier family 19 member 1						folic acid metabolic process	integral to plasma membrane|membrane fraction	folic acid binding|folic acid transporter activity|methotrexate transporter activity|reduced folate carrier activity				0				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)		TCTTCCAGCAACAAAGCCCGCG	0.668													2	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	97677254	97677254	+	IGR	DEL	T	-	-			TCGA-BT-A20N-01A-11D-A14W-08	TCGA-BT-A20N-11A-11D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:97677254delT								DIAPH2 (821658 upstream) : None (None downstream)																							TTCAGttttcttttttttttt	0.219													2	4	---	---	---	---	
