Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
UBE4B	10277	broad.mit.edu	37	1	10197129	10197129	+	Silent	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10197129C>T	uc001aqs.3	+	17	2942	c.2229C>T	c.(2227-2229)GGC>GGT	p.G743G	UBE4B_uc001aqr.3_Silent_p.G614G|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_Silent_p.G198G|UBE4B_uc001aqt.1_Silent_p.G83G	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	743					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TCCTAGATGGCGATCAGCCTC	0.393													63	74	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24434550	24434550	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24434550C>T	uc001bin.3	-	3	338	c.175G>A	c.(175-177)GAG>AAG	p.E59K	MYOM3_uc001bio.2_Missense_Mutation_p.E59K|MYOM3_uc001bip.1_5'UTR	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	59										skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GCGCTGAACTCATGCTCTTCT	0.632													33	42	---	---	---	---	PASS
RNF19B	127544	broad.mit.edu	37	1	33409700	33409700	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33409700C>T	uc010oho.1	-	6	1325	c.1325G>A	c.(1324-1326)CGT>CAT	p.R442H	RNF19B_uc001bwm.3_Missense_Mutation_p.R441H|RNF19B_uc010ohp.1_Missense_Mutation_p.R441H	NM_153341	NP_699172	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B isoform a	442						integral to membrane	ligase activity|protein binding|zinc ion binding				0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GCCGCCTCCACGACAAAGAGA	0.453													36	39	---	---	---	---	PASS
CYB5RL	606495	broad.mit.edu	37	1	54661136	54661136	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54661136G>T	uc009vzo.2	-	3	474	c.154C>A	c.(154-156)CAA>AAA	p.Q52K	CYB5RL_uc001cww.2_5'UTR|CYB5RL_uc001cwx.3_RNA|CYB5RL_uc001cwy.3_5'UTR	NM_001031672	NP_001026842	Q6IPT4	NB5R5_HUMAN	cytochrome b5 reductase-like	52							cytochrome-b5 reductase activity				0						TTGCTGGCTTGGGCTGCCTCC	0.602													5	27	---	---	---	---	PASS
ZNF644	84146	broad.mit.edu	37	1	91403562	91403562	+	Silent	SNP	A	G	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91403562A>G	uc001dnw.2	-	4	3310	c.3168T>C	c.(3166-3168)CAT>CAC	p.H1056H	ZNF644_uc001dnv.2_Intron|ZNF644_uc001dnx.2_Intron	NM_201269	NP_958357	Q9H582	ZN644_HUMAN	zinc finger protein 644 isoform 1	1056	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GGCCTCTAACATGATTTGATA	0.358													61	89	---	---	---	---	PASS
AMY2B	280	broad.mit.edu	37	1	104122043	104122043	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104122043A>T	uc001duq.2	+	12	2073	c.1457A>T	c.(1456-1458)GAC>GTC	p.D486V	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Missense_Mutation_p.D486V|AMY2B_uc001dus.1_Intron	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	486					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TACGTTTCTGACGATGGCAAA	0.328													242	315	---	---	---	---	PASS
SELE	6401	broad.mit.edu	37	1	169697037	169697037	+	Silent	SNP	C	T	T	rs144324234	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169697037C>T	uc001ggm.3	-	9	1468	c.1311G>A	c.(1309-1311)CCG>CCA	p.P437P	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	437	Extracellular (Potential).|Sushi 5.				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)					CCAAACCCTTCGGGGGCTGGT	0.488													50	96	---	---	---	---	PASS
RABGAP1L	9910	broad.mit.edu	37	1	174274226	174274226	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174274226G>C	uc001gjx.2	+	11	1621	c.1426G>C	c.(1426-1428)GGG>CGG	p.G476R	RABGAP1L_uc009wwq.1_Missense_Mutation_p.G488R|RABGAP1L_uc001gjw.2_Missense_Mutation_p.G439R|RABGAP1L_uc001gjy.2_Missense_Mutation_p.G144R|RABGAP1L_uc001gjz.2_Missense_Mutation_p.G123R	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A	476					regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						TACTAGTGGAGGGGGTCCAAT	0.463													25	29	---	---	---	---	PASS
PPP2R5A	5525	broad.mit.edu	37	1	212529963	212529963	+	Intron	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212529963C>T	uc001hjb.2	+						PPP2R5A_uc010ptd.1_Intron	NM_006243	NP_006234	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B						negative regulation of establishment of protein localization in plasma membrane|negative regulation of lipid kinase activity|positive regulation of protein dephosphorylation|signal transduction	chromosome, centromeric region|cytoplasm|nucleus|protein phosphatase type 2A complex	kinase binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		TTTTCTTTTTCGCAGGTGATC	0.358													37	50	---	---	---	---	PASS
FLVCR1	28982	broad.mit.edu	37	1	213032466	213032466	+	Silent	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213032466C>T	uc001hjt.2	+	1	870	c.672C>T	c.(670-672)ATC>ATT	p.I224I	LQK1_uc001hjr.3_5'Flank|LQK1_uc001hjs.3_5'Flank	NM_014053	NP_054772	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular	224					cell death|cellular iron ion homeostasis|heme export|transmembrane transport	integral to plasma membrane	heme transporter activity|protein binding|receptor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		CCTCCCGCATCGCCTCAGTGT	0.597													45	41	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214549657	214549657	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214549657G>A	uc001hkk.1	-	15	3083	c.2812C>T	c.(2812-2814)CGA>TGA	p.R938*	PTPN14_uc010pty.1_Nonsense_Mutation_p.R839*	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	938	Tyrosine-protein phosphatase.				lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TCACGGATTCGGCTGCGCTCG	0.458													75	83	---	---	---	---	PASS
ABCB10	23456	broad.mit.edu	37	1	229667459	229667459	+	Silent	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229667459C>T	uc001htp.3	-	7	1402	c.1359G>A	c.(1357-1359)TCG>TCA	p.S453S		NM_012089	NP_036221	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B, member 10	453	Mitochondrial intermembrane (Potential).|ABC transmembrane type-1.|Mitochondrial matrix (Potential).					integral to mitochondrial membrane|mitochondrial inner membrane	ATP binding|oligopeptide-transporting ATPase activity			breast(2)	2	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				TCATCAGCTCCGAGTAGAAAG	0.547													46	68	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243327912	243327912	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243327912G>A	uc001hzs.2	-	13	3758	c.3350C>T	c.(3349-3351)GCT>GTT	p.A1117V	CEP170_uc001hzt.2_Missense_Mutation_p.A1019V|CEP170_uc001hzu.2_Missense_Mutation_p.A1019V|CEP170_uc001hzv.1_Missense_Mutation_p.A495V	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	1117	Targeting to microtubules.|Targeting to centrosomes.					centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GTCAGCATCAGCAAGTTCACT	0.473													3	81	---	---	---	---	PASS
OR2M7	391196	broad.mit.edu	37	1	248487506	248487506	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487506C>T	uc010pzk.1	-	1	365	c.365G>A	c.(364-366)CGC>CAC	p.R122H		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGCAGTGTAGCGGTCATAAGA	0.448													208	272	---	---	---	---	PASS
REL	5966	broad.mit.edu	37	2	61144086	61144086	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61144086C>G	uc002sam.1	+	5	693	c.469C>G	c.(469-471)CCT>GCT	p.P157A	REL_uc002san.1_Missense_Mutation_p.P157A	NM_002908	NP_002899	Q04864	REL_HUMAN	v-rel reticuloendotheliosis viral oncogene	157	RHD.				positive regulation of I-kappaB kinase/NF-kappaB cascade	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|breast(1)	3	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			AGTTTTTCTCCCTGATGAACA	0.343			A		Hodgkin Lymphoma								69	96	---	---	---	---	PASS
DGUOK	1716	broad.mit.edu	37	2	74177838	74177838	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74177838C>G	uc002sjx.2	+	4	655	c.570C>G	c.(568-570)ATC>ATG	p.I190M	DGUOK_uc002sjy.2_Intron|DGUOK_uc002sjz.2_Intron	NM_080916	NP_550438	Q16854	DGUOK_HUMAN	deoxyguanosine kinase isoform a precursor	190					guanosine metabolic process|purine base metabolic process|purine deoxyribonucleoside metabolic process|purine-containing compound salvage	mitochondrial matrix	ATP binding|deoxyguanosine kinase activity|phosphotransferase activity, alcohol group as acceptor				0						ATGGCTTCATCTACCTCCAGG	0.318													7	369	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141032110	141032110	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141032110C>T	uc002tvj.1	-	85	13997	c.13025G>A	c.(13024-13026)AGT>AAT	p.S4342N		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4342	Extracellular (Potential).|EGF-like 13.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACATTCAACACTTCCATCATC	0.408										TSP Lung(27;0.18)			54	8	---	---	---	---	PASS
OBSL1	23363	broad.mit.edu	37	2	220432984	220432984	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220432984C>T	uc010fwk.2	-	2	1132	c.1075G>A	c.(1075-1077)GTG>ATG	p.V359M	OBSL1_uc010fwl.1_5'Flank|OBSL1_uc002vmi.2_Missense_Mutation_p.V359M|OBSL1_uc002vmj.2_Translation_Start_Site	NM_015311	NP_056126	O75147	OBSL1_HUMAN	obscurin-like 1	359	Ig-like 4.				cardiac myofibril assembly	intercalated disc|M band|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity				0		Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CATTCCAGCACGGCAATCCCG	0.652											OREG0003988	type=REGULATORY REGION|Gene=OBSL1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	11	2	---	---	---	---	PASS
PARL	55486	broad.mit.edu	37	3	183551375	183551375	+	Silent	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183551375G>A	uc003fmd.2	-	9	992	c.933C>T	c.(931-933)GCC>GCT	p.A311A	PARL_uc003fme.2_Silent_p.A261A	NM_018622	NP_061092	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like isoform 1	311	Helical; (Potential).				proteolysis	integral to membrane|mitochondrial inner membrane|nucleus	serine-type endopeptidase activity				0	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TGGCTTTCAGGGCCTGAAAGG	0.458													48	88	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195516229	195516229	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195516229G>A	uc011bto.1	-	2	2682	c.2222C>T	c.(2221-2223)GCC>GTC	p.A741V	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.A623V	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	746					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACAGAGTTGGCCAGAGTAAG	0.612													17	240	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87693987	87693987	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87693987C>T	uc003hpz.2	+	32	5705	c.5225C>T	c.(5224-5226)TCA>TTA	p.S1742L	PTPN13_uc003hpy.2_Missense_Mutation_p.S1747L|PTPN13_uc003hqa.2_Missense_Mutation_p.S1723L|PTPN13_uc003hqb.2_Missense_Mutation_p.S1551L|PTPN13_uc003hqc.1_Missense_Mutation_p.S108L	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	1742	Poly-Ser.					cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CAACCCCAATCAGAATCTGCT	0.383													85	114	---	---	---	---	PASS
USP53	54532	broad.mit.edu	37	4	120190892	120190892	+	Silent	SNP	C	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120190892C>A	uc003ics.3	+	14	2401	c.1335C>A	c.(1333-1335)TCC>TCA	p.S445S	USP53_uc003icr.3_Silent_p.S445S|USP53_uc003icu.3_Silent_p.S68S|USP53_uc003ict.2_Silent_p.S68S	NM_019050	NP_061923	Q70EK8	UBP53_HUMAN	ubiquitin specific protease 53	445					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			ovary(1)|breast(1)|kidney(1)|skin(1)	4						AAGACATTTCCAGAGAATGTG	0.323													5	206	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123258115	123258115	+	Silent	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123258115G>A	uc003ieh.2	+	69	12135	c.12090G>A	c.(12088-12090)TCG>TCA	p.S4030S	KIAA1109_uc003iem.2_Silent_p.S386S|KIAA1109_uc003ien.2_5'Flank	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	4030					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						CACTAGTGTCGTCTTCAACAT	0.353													57	114	---	---	---	---	PASS
SPEF2	79925	broad.mit.edu	37	5	35695837	35695837	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35695837G>T	uc003jjo.2	+	14	2087	c.1976G>T	c.(1975-1977)AGT>ATT	p.S659I	SPEF2_uc003jjq.3_Missense_Mutation_p.G654V|SPEF2_uc003jjp.1_Missense_Mutation_p.G145V	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	659					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTATTGCTAGGTGCTAATGCT	0.318													13	15	---	---	---	---	PASS
GABRA1	2554	broad.mit.edu	37	5	161281255	161281255	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161281255C>T	uc010jiw.2	+	4	634	c.166C>T	c.(166-168)CGC>TGC	p.R56C	GABRA1_uc010jix.2_Missense_Mutation_p.R56C|GABRA1_uc010jiy.2_Missense_Mutation_p.R56C|GABRA1_uc003lyx.3_Missense_Mutation_p.R56C|GABRA1_uc010jiz.2_Missense_Mutation_p.R56C|GABRA1_uc010jja.2_Missense_Mutation_p.R56C|GABRA1_uc010jjb.2_Missense_Mutation_p.R56C	NM_000806	NP_000797	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha	56	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|pancreas(1)	3	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Alprazolam(DB00404)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flurazepam(DB00690)|Halazepam(DB00801)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Metharbital(DB00463)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Picrotoxin(DB00466)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Zaleplon(DB00962)|Zolpidem(DB00425)	TTATGACAATCGCCTGAGACC	0.373													39	51	---	---	---	---	PASS
C6orf27	80737	broad.mit.edu	37	6	31733527	31733527	+	Silent	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31733527G>A	uc011dog.1	-	17	2758	c.2520C>T	c.(2518-2520)ACC>ACT	p.T840T		NM_025258	NP_079534	Q9Y334	G7C_HUMAN	G7c protein precursor	840						extracellular region				ovary(3)	3						CAGATGAGCCGGTAGGGGTGG	0.617													15	4	---	---	---	---	PASS
PSMB8	5696	broad.mit.edu	37	6	32810842	32810842	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32810842C>T	uc003oce.2	-	2	215	c.172G>A	c.(172-174)GGT>AGT	p.G58S	PSMB8_uc003ocf.2_Missense_Mutation_p.G54S|PSMB8_uc011dqh.1_Missense_Mutation_p.G58S	NM_148919	NP_683720	P28062	PSB8_HUMAN	proteasome beta 8 subunit isoform E2 proprotein	58					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|type I interferon-mediated signaling pathway|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity			skin(1)	1						CCGTCCCCACCCAGGGACTGG	0.498													34	8	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	77885494	77885494	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77885494T>C	uc003ugx.2	-	10	2067	c.1813A>G	c.(1813-1815)ACC>GCC	p.T605A	MAGI2_uc003ugy.2_Missense_Mutation_p.T605A|MAGI2_uc010ldx.1_Missense_Mutation_p.T214A|MAGI2_uc010ldy.1_Missense_Mutation_p.T214A|MAGI2_uc011kgr.1_Missense_Mutation_p.T437A|MAGI2_uc011kgs.1_Missense_Mutation_p.T442A	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	605	PDZ 3.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				ATGGTTAAGGTCATAAGTTCA	0.527													4	45	---	---	---	---	PASS
SMURF1	57154	broad.mit.edu	37	7	98645296	98645296	+	Intron	SNP	G	C	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98645296G>C	uc003upu.1	-						SMURF1_uc003upv.1_Intron|SMURF1_uc003upt.2_Intron	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	Smad ubiquitination regulatory factor 1 isoform						BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			CAGTGGCCCTGAACTCTCTAC	0.468													6	134	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100349807	100349807	+	Silent	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100349807G>A	uc003uwj.2	+	14	2244	c.2079G>A	c.(2077-2079)ACG>ACA	p.T693T	ZAN_uc003uwk.2_Silent_p.T693T|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	693	66 X heptapeptide repeats (approximate) (mucin-like domain).|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCATCCCCACGGAAAAACCCA	0.532													17	25	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100683521	100683521	+	Missense_Mutation	SNP	G	A	A	rs150470478		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100683521G>A	uc003uxp.1	+	3	8877	c.8824G>A	c.(8824-8826)GGT>AGT	p.G2942S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2942	Extracellular (Potential).|47.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GCCAGTGGCCGGTTCTGAGGC	0.488													193	223	---	---	---	---	PASS
FBXO25	26260	broad.mit.edu	37	8	382894	382894	+	Missense_Mutation	SNP	C	T	T	rs142717048	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:382894C>T	uc003wox.2	+	4	513	c.247C>T	c.(247-249)CGT>TGT	p.R83C	FBXO25_uc003woy.2_Missense_Mutation_p.R83C|FBXO25_uc003woz.2_Intron|FBXO25_uc003wpa.2_5'Flank	NM_183421	NP_904357	Q8TCJ0	FBX25_HUMAN	F-box only protein 25 isoform 1	83	Interaction with beta-actin.					nucleus|SCF ubiquitin ligase complex	actin binding|ubiquitin-protein ligase activity			lung(1)	1		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)		AGGTTTTTATCGTGAAAAATG	0.259													26	5	---	---	---	---	PASS
EIF3E	3646	broad.mit.edu	37	8	109260902	109260902	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109260902G>C	uc003ymu.2	-	1	58	c.30C>G	c.(28-30)ATC>ATG	p.I10M	EIF3E_uc003ymv.2_Translation_Start_Site|EIF3E_uc010mci.1_Missense_Mutation_p.I10M|EIF3E_uc010mcj.1_Missense_Mutation_p.I10M	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	10	Sufficient for interaction with TRIM27.|Sufficient for interaction with EPAS1.				negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			AAAAGTGCGCGATGCGAGTAG	0.512													33	39	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139749795	139749795	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139749795G>T	uc003yvd.2	-	23	2558	c.2111C>A	c.(2110-2112)CCT>CAT	p.P704H	COL22A1_uc011ljo.1_Missense_Mutation_p.P4H	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	704	Pro-rich.|Gly-rich.|Collagen-like 4.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AGGGATTCCAGGTGGTCCCAT	0.453										HNSCC(7;0.00092)			43	50	---	---	---	---	PASS
ARHGAP21	57584	broad.mit.edu	37	10	24908766	24908766	+	Silent	SNP	A	C	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24908766A>C	uc001isb.2	-	9	2545	c.2058T>G	c.(2056-2058)TCT>TCG	p.S686S	ARHGAP21_uc010qdb.1_RNA|ARHGAP21_uc009xkl.1_Silent_p.S686S|ARHGAP21_uc010qdc.1_Silent_p.S521S|ARHGAP21_uc001isc.1_Silent_p.S676S	NM_020824	NP_065875	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	685					signal transduction	cell junction|cytoplasmic vesicle membrane|cytoskeleton|Golgi membrane	GTPase activator activity|protein binding			ovary(7)|pancreas(1)	8						CAGAGGCTCCAGATAAAGAGG	0.478													6	87	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50732789	50732789	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50732789C>T	uc001jhs.3	-	5	841	c.687G>A	c.(685-687)ATG>ATA	p.M229I	PGBD3_uc001jht.2_5'Flank|PGBD3_uc009xoe.2_Missense_Mutation_p.M229I|PGBD3_uc001jhu.2_Missense_Mutation_p.M229I	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	229					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						CCTGGACAGGCATGAGCATGC	0.507								Direct_reversal_of_damage|NER					66	73	---	---	---	---	PASS
DNMBP	23268	broad.mit.edu	37	10	101715391	101715391	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101715391G>A	uc001kqj.2	-	4	1932	c.1840C>T	c.(1840-1842)CGT>TGT	p.R614C	NCRNA00093_uc001kqk.1_Intron	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	614	Pro-rich.				intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		GTACAGGGACGAGGTGGCGGT	0.562													6	23	---	---	---	---	PASS
CNNM2	54805	broad.mit.edu	37	10	104679252	104679252	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104679252G>A	uc001kwm.2	+	1	1139	c.1015G>A	c.(1015-1017)GGC>AGC	p.G339S	CNNM2_uc001kwn.2_Missense_Mutation_p.G339S|CNNM2_uc001kwl.2_Missense_Mutation_p.G339S	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	339	DUF21.|Helical; (Potential).				ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CGACATCGCCGGCTCGGGCCT	0.657													32	3	---	---	---	---	PASS
BBOX1	8424	broad.mit.edu	37	11	27136998	27136998	+	Splice_Site	SNP	G	C	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27136998G>C	uc001mre.1	+	6	902	c.534_splice	c.e6-1	p.G178_splice	BBOX1_uc009yih.1_Splice_Site_p.G178_splice|BBOX1_uc001mrg.1_Splice_Site_p.G178_splice	NM_003986	NP_003977	O75936	BODG_HUMAN	gamma-butyrobetaine dioxygenase						carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1					Succinic acid(DB00139)|Vitamin C(DB00126)	GCATTTTACAGACATACTTGG	0.393													27	3	---	---	---	---	PASS
BBOX1	8424	broad.mit.edu	37	11	27137027	27137027	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27137027G>C	uc001mre.1	+	6	930	c.562G>C	c.(562-564)GAT>CAT	p.D188H	BBOX1_uc009yih.1_Missense_Mutation_p.D188H|BBOX1_uc001mrg.1_Missense_Mutation_p.D188H	NM_003986	NP_003977	O75936	BODG_HUMAN	gamma-butyrobetaine dioxygenase	188					carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1					Succinic acid(DB00139)|Vitamin C(DB00126)	AGACAAAATCGATGCAAACAA	0.403													27	7	---	---	---	---	PASS
BBOX1	8424	broad.mit.edu	37	11	27137075	27137075	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27137075G>A	uc001mre.1	+	6	978	c.610G>A	c.(610-612)GAT>AAT	p.D204N	BBOX1_uc009yih.1_Missense_Mutation_p.D204N|BBOX1_uc001mrg.1_Missense_Mutation_p.D204N	NM_003986	NP_003977	O75936	BODG_HUMAN	gamma-butyrobetaine dioxygenase	204		Iron; catalytic (Probable).			carnitine biosynthetic process	actin cytoskeleton|cytosol|intracellular membrane-bounded organelle	gamma-butyrobetaine dioxygenase activity|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1					Succinic acid(DB00139)|Vitamin C(DB00126)	CTTTCACACTGATTATCCAGC	0.408													25	7	---	---	---	---	PASS
GIF	2694	broad.mit.edu	37	11	59610543	59610543	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59610543C>A	uc001noi.2	-	3	376	c.328G>T	c.(328-330)GTA>TTA	p.V110L	GIF_uc010rkz.1_Missense_Mutation_p.V110L	NM_005142	NP_005133	P27352	IF_HUMAN	gastric intrinsic factor (vitamin B synthesis)	110					cobalamin metabolic process|cobalamin transport|cobalt ion transport	apical plasma membrane|endosome|extracellular space|microvillus	cobalamin binding			ovary(1)|liver(1)	2						AGAATGGATACTTTATCCCCA	0.488													5	31	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117351190	117351190	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117351190G>A	uc001prh.1	-	14	2935	c.2933C>T	c.(2932-2934)ACG>ATG	p.T978M		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	918	Extracellular (Potential).|Fibronectin type-III 1.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GTCGAAGCCCGTGATGATGCT	0.627													6	1	---	---	---	---	PASS
GUCY2C	2984	broad.mit.edu	37	12	14772204	14772204	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14772204C>A	uc001rcd.2	-	24	2953	c.2816G>T	c.(2815-2817)CGT>CTT	p.R939L		NM_004963	NP_004954	P25092	GUC2C_HUMAN	guanylate cyclase 2C precursor	939	Cytoplasmic (Potential).|Guanylate cyclase.				intracellular signal transduction|receptor guanylyl cyclase signaling pathway	integral to membrane	ATP binding|GTP binding|guanylate cyclase activity|protein binding|protein kinase activity|receptor activity			ovary(4)|skin(2)	6						TAGACAATAACGAGGCATCTT	0.473													4	54	---	---	---	---	PASS
GXYLT1	283464	broad.mit.edu	37	12	42499642	42499642	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42499642C>T	uc001rms.3	-	5	1067	c.842G>A	c.(841-843)CGA>CAA	p.R281Q	GXYLT1_uc001rmt.3_Missense_Mutation_p.R250Q	NM_173601	NP_775872	Q4G148	GXLT1_HUMAN	glycosyltransferase 8 domain containing 3	281	Lumenal (Potential).				O-glycan processing	integral to membrane	UDP-xylosyltransferase activity				0						CCTTCTCATTCGAGTCATGTT	0.318													44	54	---	---	---	---	PASS
PPTC7	160760	broad.mit.edu	37	12	110983707	110983707	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110983707C>T	uc001trh.1	-	3	808	c.580G>A	c.(580-582)GAG>AAG	p.E194K		NM_139283	NP_644812	Q8NI37	PPTC7_HUMAN	T-cell activation protein phosphatase 2C	194	PP2C-like.						metal ion binding|phosphoprotein phosphatase activity				0						ACGACTCCCTCGGCTTCAGGG	0.557													52	61	---	---	---	---	PASS
COG3	83548	broad.mit.edu	37	13	46070407	46070407	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46070407C>T	uc001vak.2	+	13	1549	c.1448C>T	c.(1447-1449)CCT>CTT	p.P483L	COG3_uc001vaj.1_Missense_Mutation_p.P483L|COG3_uc010tfv.1_Missense_Mutation_p.P320L|COG3_uc010aci.2_Missense_Mutation_p.P259L	NM_031431	NP_113619	Q96JB2	COG3_HUMAN	component of golgi transport complex 3	483					ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity			breast(1)|skin(1)	2		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		AAACCAGCTCCTGGAGATCTG	0.478													31	38	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77834572	77834572	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77834572C>T	uc001vkf.2	-	14	1985	c.1894G>A	c.(1894-1896)GAT>AAT	p.D632N	MYCBP2_uc010aev.2_Missense_Mutation_p.D36N	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	632					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CTTGAACTATCAGAGTAAATG	0.303													51	66	---	---	---	---	PASS
RASA3	22821	broad.mit.edu	37	13	114806481	114806481	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114806481C>T	uc001vui.2	-	4	498	c.367G>A	c.(367-369)GTG>ATG	p.V123M	RASA3_uc010tkk.1_Missense_Mutation_p.V91M|RASA3_uc001vuj.2_Translation_Start_Site|RASA3_uc010tkl.1_Intron	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	123					intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			CTCACCTGCACTTCCGAGTCA	0.612													53	73	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21884050	21884050	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21884050C>T	uc001was.1	-	6	990	c.896G>A	c.(895-897)CGC>CAC	p.R299H	CHD8_uc001war.1_Missense_Mutation_p.R195H	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	578					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CTTAACTTGGCGGTTTGAGCG	0.378													89	163	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22315128	22315128	+	Intron	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22315128G>A	uc010tmf.1	+						uc001wbw.2_Intron|uc010tmg.1_Intron|uc001wby.2_Intron|uc010ait.1_Intron|uc001wbz.1_Silent_p.S22S					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		GAGCCCAGTCGGTGACCCAGC	0.507											OREG0022570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	52	62	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22392654	22392654	+	Intron	SNP	G	T	T	rs35290879		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22392654G>T	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_RNA|uc010aiz.2_Missense_Mutation_p.Q59H					SubName: Full=Alpha-chain C region; Flags: Fragment;																		GGTACAAGCAGCCCAGCAGTG	0.443													90	107	---	---	---	---	PASS
C14orf166B	145497	broad.mit.edu	37	14	77319573	77319573	+	Silent	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77319573G>A	uc001xsx.2	+	9	942	c.828G>A	c.(826-828)CTG>CTA	p.L276L	C14orf166B_uc010asn.1_Silent_p.L36L|C14orf166B_uc001xsw.2_Intron|C14orf166B_uc010tvg.1_RNA|C14orf166B_uc010tvh.1_RNA	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497	276	LRR 6.										0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		ATGTGACCCTGACAAAGCTGG	0.552													76	66	---	---	---	---	PASS
C14orf148	122945	broad.mit.edu	37	14	77873996	77873996	+	Intron	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77873996G>A	uc001xtr.2	-						C14orf148_uc010tvi.1_Intron	NM_001113475	NP_001106946	Q6NXP6	CN148_HUMAN	hypothetical protein LOC122945 isoform 1						proline biosynthetic process		binding|pyrroline-5-carboxylate reductase activity				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0277)		CACCTGGGAGGGATAAAGGAA	0.463													3	37	---	---	---	---	PASS
MIR543	100126335	broad.mit.edu	37	14	101498368	101498368	+	RNA	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101498368C>T	hsa-mir-543|MI0005565	+			c.45C>T			MIR495_hsa-mir-495|MI0003135_5'Flank																	0						TTATTTGTGACGAAACATTCG	0.502													4	85	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106236207	106236207	+	RNA	SNP	C	G	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106236207C>G	uc010tyt.1	-	3616		c.57737G>C			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0						ACCTCGGGGTCTTCGTGGCTC	0.587													60	58	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25972339	25972339	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25972339G>A	uc010ayu.2	-	4	921	c.815C>T	c.(814-816)ACG>ATG	p.T272M		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	272	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GACTGCGTCCGTGTTCCTAAG	0.582													37	36	---	---	---	---	PASS
IGDCC3	9543	broad.mit.edu	37	15	65628166	65628166	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65628166C>G	uc002aos.2	-	3	790	c.538G>C	c.(538-540)GAC>CAC	p.D180H		NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	180	Extracellular (Potential).|Ig-like C2-type 2.									ovary(3)	3						TTGTCCGTGTCAATTGGGACT	0.597													80	82	---	---	---	---	PASS
SGK269	79834	broad.mit.edu	37	15	77472802	77472802	+	Silent	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77472802G>A	uc002bcm.2	-	3	1775	c.1467C>T	c.(1465-1467)CTC>CTT	p.L489L	SGK269_uc002bcn.2_Silent_p.L489L	NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member	489					cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		CAGGGCCCTCGAGGTGCTCAC	0.488													213	99	---	---	---	---	PASS
BFAR	51283	broad.mit.edu	37	16	14749014	14749014	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14749014G>C	uc002dco.2	+	5	1011	c.730G>C	c.(730-732)GAA>CAA	p.E244Q	BFAR_uc002dcp.2_Missense_Mutation_p.E119Q|BFAR_uc010uzh.1_Missense_Mutation_p.E116Q	NM_016561	NP_057645	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	244	Lumenal (Potential).|SAM.				anti-apoptosis|apoptosis	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	structural molecule activity|zinc ion binding			ovary(1)|skin(1)	2						CATGGAGCTAGAACGTGTCAA	0.383													64	93	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20559515	20559515	+	Intron	SNP	A	G	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20559515A>G	uc002dhj.3	-						ACSM2B_uc002dhk.3_Intron|ACSM2B_uc010bwf.1_Intron	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						TAACTGAAGAAGAGAAATAAA	0.522													98	111	---	---	---	---	PASS
SIAH1	6477	broad.mit.edu	37	16	48396114	48396114	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48396114G>A	uc002efo.1	-	2	343	c.226C>T	c.(226-228)CGG>TGG	p.R76W	uc002efk.1_RNA|SIAH1_uc002efl.2_RNA|SIAH1_uc002efn.1_Missense_Mutation_p.R107W	NM_003031	NP_003022	Q8IUQ4	SIAH1_HUMAN	seven in absentia homolog 1 isoform a	76	RING-type.			R->E: Decreased activity.	axon guidance|cell cycle|neuron apoptosis|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	beta-catenin destruction complex|cytosol|nucleus	protein C-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				AAAGGGCCCCGGCAAGTTGGA	0.463													3	75	---	---	---	---	PASS
ZNF232	7775	broad.mit.edu	37	17	5009279	5009279	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5009279C>A	uc002gas.2	-	5	1848	c.1094G>T	c.(1093-1095)TGT>TTT	p.C365F	ZNF232_uc002gar.1_Missense_Mutation_p.C383F|ZNF232_uc002gat.2_Missense_Mutation_p.C392F	NM_014519	NP_055334	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	365	C2H2-type 4.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						GGCCTTCCCACACTCATTACA	0.433													56	74	---	---	---	---	PASS
POLR2A	5430	broad.mit.edu	37	17	7406712	7406712	+	Silent	SNP	C	G	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7406712C>G	uc002ghf.3	+	18	3171	c.2937C>G	c.(2935-2937)CTC>CTG	p.L979L		NM_000937	NP_000928	P24928	RPB1_HUMAN	DNA-directed RNA polymerase II A	979					mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|RNA-directed RNA polymerase activity|ubiquitin protein ligase binding			pancreas(1)	1		Prostate(122;0.173)				AGGTCGTCCTCCCCTGTAACC	0.582													4	34	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10304411	10304411	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10304411G>T	uc002gmm.2	-	25	3301	c.3206C>A	c.(3205-3207)ACA>AAA	p.T1069K	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	1069	Potential.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						CATATCCATTGTGGATTCTTG	0.388									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				75	104	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11511460	11511460	+	Silent	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11511460C>T	uc002gne.2	+	2	500	c.432C>T	c.(430-432)GTC>GTT	p.V144V	DNAH9_uc002gnd.1_Silent_p.V144V	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	144	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTCTACCCGTCCTGGCCAATG	0.483													85	156	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18065909	18065909	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18065909G>T	uc010vxh.1	+	57	9866	c.9528G>T	c.(9526-9528)AAG>AAT	p.K3176N	MYO15A_uc010vxi.1_Missense_Mutation_p.K440N|MYO15A_uc010vxk.1_Translation_Start_Site|MYO15A_uc010vxl.1_Missense_Mutation_p.K165N|MYO15A_uc002gsl.2_Missense_Mutation_p.K183N|MYO15A_uc010vxm.1_Missense_Mutation_p.K98N|MYO15A_uc002gsm.1_Missense_Mutation_p.K98N|MYO15A_uc010cpv.2_RNA	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	3176	Tail.|MyTH4 2.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					GGATCGCCAAGGCCTGCGAGC	0.572													3	45	---	---	---	---	PASS
CCDC45	90799	broad.mit.edu	37	17	62529078	62529078	+	Silent	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62529078G>A	uc002jem.2	+	15	1852	c.1794G>A	c.(1792-1794)AAG>AAA	p.K598K	CCDC45_uc002jen.2_RNA|CCDC45_uc010wqb.1_Silent_p.K434K|CCDC45_uc002jeo.1_Silent_p.K30K	NM_138363	NP_612372	Q96GE4	CEP95_HUMAN	coiled-coil domain containing 45	598	Potential.					centrosome|spindle pole	protein binding				0	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			AACAGCTTAAGAAAGAAGCAT	0.393													31	37	---	---	---	---	PASS
AXIN2	8313	broad.mit.edu	37	17	63554353	63554353	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63554353C>T	uc002jfi.2	-	2	675	c.386G>A	c.(385-387)CGA>CAA	p.R129Q	AXIN2_uc010den.1_Missense_Mutation_p.R129Q|AXIN2_uc002jfh.2_Missense_Mutation_p.R129Q|AXIN2_uc002jfj.1_Missense_Mutation_p.R129Q	NM_004655	NP_004646	Q9Y2T1	AXIN2_HUMAN	axin 2	129	RGS.				cellular protein localization|cellular response to organic cyclic compound|dorsal/ventral axis specification|intramembranous ossification|maintenance of DNA repeat elements|mRNA stabilization|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of osteoblast differentiation|odontogenesis|positive regulation of cell death|positive regulation of epithelial to mesenchymal transition|positive regulation of protein phosphorylation|regulation of centromeric sister chromatid cohesion|regulation of mismatch repair|Wnt receptor signaling pathway involved in somitogenesis	Axin-APC-beta-catenin-GSK3B complex|cell cortex|centrosome|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|nucleus|plasma membrane|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			central_nervous_system(1)|skin(1)	2						TTTGGCTACTCGTAAAGTTTT	0.463									Oligodontia_Ectodermal_Dysplasia_and_Colorectal_Polyp_syndrome				76	126	---	---	---	---	PASS
BPTF	2186	broad.mit.edu	37	17	65914901	65914901	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65914901G>A	uc002jgf.2	+	12	5436	c.5375G>A	c.(5374-5376)AGA>AAA	p.R1792K	BPTF_uc002jge.2_Missense_Mutation_p.R1918K	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1918					brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GCAAGTTTGAGATGGGATGAT	0.438													42	76	---	---	---	---	PASS
KIAA0427	9811	broad.mit.edu	37	18	46343613	46343613	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46343613G>A	uc002ldc.2	+	10	1678	c.1393G>A	c.(1393-1395)GAG>AAG	p.E465K	KIAA0427_uc002ldd.2_Missense_Mutation_p.E467K|KIAA0427_uc002lde.3_Missense_Mutation_p.E94K	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1	465	MIF4G.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						GGTGCGCGAGGAGCTGCAGCA	0.667													17	29	---	---	---	---	PASS
C18orf54	162681	broad.mit.edu	37	18	51892104	51892104	+	Silent	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51892104C>T	uc002lfn.3	+	5	872	c.756C>T	c.(754-756)CCC>CCT	p.P252P	C18orf54_uc002lfo.3_Silent_p.P413P	NM_173529	NP_775800	Q8IYD9	CR054_HUMAN	hypothetical protein LOC162681 precursor	252						extracellular region				ovary(1)|skin(1)	2				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		CTCCTGTTCCCGTTAACTCTG	0.333													94	124	---	---	---	---	PASS
ZNF493	284443	broad.mit.edu	37	19	21607218	21607218	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21607218C>G	uc002npx.2	+	2	1653	c.1373C>G	c.(1372-1374)TCA>TGA	p.S458*	ZNF493_uc002npw.2_Nonsense_Mutation_p.S586*|ZNF493_uc002npy.2_Nonsense_Mutation_p.S458*	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN	zinc finger protein 493 isoform 1	458	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AGTGTATTCTCAACCCTTACT	0.353													29	30	---	---	---	---	PASS
DEDD2	162989	broad.mit.edu	37	19	42720852	42720852	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42720852G>A	uc002osu.1	-	2	376	c.308C>T	c.(307-309)GCG>GTG	p.A103V	DEDD2_uc002osv.1_Intron|DEDD2_uc002osw.1_Missense_Mutation_p.A103V|DEDD2_uc002osx.1_Intron|DEDD2_uc002osy.1_Missense_Mutation_p.A103V	NM_133328	NP_579874	Q8WXF8	DEDD2_HUMAN	death effector domain-containing  DNA binding	103	DED.				activation of pro-apoptotic gene products|apoptotic nuclear change|cellular homeostasis|induction of apoptosis via death domain receptors|intracellular signal transduction|negative regulation of transcription, DNA-dependent|RNA processing|rRNA catabolic process|transcription, DNA-dependent	nucleolus	DNA binding|receptor signaling complex scaffold activity				0		Prostate(69;0.0704)				CCGCTTGCGCGCCAGGTGCGG	0.711													2	0	---	---	---	---	PASS
PHLDB3	653583	broad.mit.edu	37	19	43979673	43979673	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43979673G>C	uc002own.3	-	16	2071	c.1812C>G	c.(1810-1812)TTC>TTG	p.F604L	PHLDB3_uc010eit.2_Missense_Mutation_p.F274L	NM_198850	NP_942147	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B,	604	PH.										0		Prostate(69;0.0153)				TTTTGACGCAGAAGGTCAGGC	0.478													8	22	---	---	---	---	PASS
SFRS16	11129	broad.mit.edu	37	19	45572316	45572316	+	Intron	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45572316C>T	uc002pak.2	+						SFRS16_uc002pal.2_Intron|SFRS16_uc010xxh.1_Intron|SFRS16_uc002pam.2_Intron	NM_007056	NP_008987	Q8N2M8	CLASR_HUMAN	splicing factor, arginine/serine-rich 16						mRNA processing|RNA splicing	nucleus					0		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TGTTCTTTCTCTCTACAGTCA	0.408													19	106	---	---	---	---	PASS
GYS1	2997	broad.mit.edu	37	19	49477995	49477995	+	Intron	SNP	A	G	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49477995A>G	uc002plp.2	-						GYS1_uc010xzy.1_Intron|GYS1_uc010emm.2_Intron|GYS1_uc010xzz.1_Intron|GYS1_uc010yaa.1_Intron	NM_002103	NP_002094	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle) isoform 1						glucose metabolic process|glycogen biosynthetic process	cytosol	glycogen (starch) synthase activity|protein binding			ovary(2)	2		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		CTGCCGCTGCAGGAGCCACAA	0.582													6	15	---	---	---	---	PASS
ZNF350	59348	broad.mit.edu	37	19	52468256	52468256	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52468256C>T	uc002pyd.2	-	5	1678	c.1450G>A	c.(1450-1452)GTA>ATA	p.V484I	uc002pyb.2_Intron|uc002pyc.2_Intron	NM_021632	NP_067645	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	484					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix|transcriptional repressor complex	DNA binding|protein binding|zinc ion binding			breast(1)	1		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		ACAAGGACTACGTTCCTGTTT	0.512													26	31	---	---	---	---	PASS
ZNF773	374928	broad.mit.edu	37	19	58018106	58018106	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58018106G>T	uc002qox.2	+	4	783	c.643G>T	c.(643-645)GGG>TGG	p.G215W	ZNF547_uc002qpm.3_Intron|ZNF773_uc002qoy.2_Missense_Mutation_p.G214W|ZNF773_uc002qoz.2_Intron	NM_198542	NP_940944	Q6PK81	ZN773_HUMAN	zinc finger protein 773	215					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		ACTGCACACTGGGGAAAAGCC	0.423													34	147	---	---	---	---	PASS
ZNF773	374928	broad.mit.edu	37	19	58018107	58018107	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58018107G>C	uc002qox.2	+	4	784	c.644G>C	c.(643-645)GGG>GCG	p.G215A	ZNF547_uc002qpm.3_Intron|ZNF773_uc002qoy.2_Missense_Mutation_p.G214A|ZNF773_uc002qoz.2_Intron	NM_198542	NP_940944	Q6PK81	ZN773_HUMAN	zinc finger protein 773	215					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		CTGCACACTGGGGAAAAGCCT	0.423													35	147	---	---	---	---	PASS
ZSCAN1	284312	broad.mit.edu	37	19	58564883	58564883	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58564883G>T	uc002qrc.1	+	6	938	c.691G>T	c.(691-693)GAA>TAA	p.E231*		NM_182572	NP_872378	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	231					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CCTGCGGGCAGAAGGGACTGT	0.642													29	85	---	---	---	---	PASS
XRN2	22803	broad.mit.edu	37	20	21367612	21367612	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21367612C>G	uc002wsf.1	+	29	2850	c.2755C>G	c.(2755-2757)CCA>GCA	p.P919A	XRN2_uc002wsg.1_Missense_Mutation_p.P843A|XRN2_uc010zsk.1_Missense_Mutation_p.P865A|XRN2_uc002wsh.1_Missense_Mutation_p.P57A	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	919					cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1						TGGTGGGTATCCACCCAGACG	0.522													54	66	---	---	---	---	PASS
ATP9A	10079	broad.mit.edu	37	20	50225174	50225174	+	Intron	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50225174G>A	uc002xwg.1	-						ATP9A_uc010gih.1_Intron|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036	O75110	ATP9A_HUMAN	ATPase, class II, type 9A						ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4						ACCTGGGAGAGAAAACCGCCA	0.458													7	18	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60901971	60901971	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60901971G>A	uc002ycq.2	-	39	5231	c.5164C>T	c.(5164-5166)CGG>TGG	p.R1722W		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	1722	Laminin IV type A.|Cell attachment site (Potential).				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	ACATCTCCCCGCTGGGTCTCT	0.627													20	98	---	---	---	---	PASS
PCBP3	54039	broad.mit.edu	37	21	47320525	47320525	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47320525G>T	uc002zhq.1	+	4	335	c.210G>T	c.(208-210)AAG>AAT	p.K70N	PCBP3_uc010gqb.2_Missense_Mutation_p.K70N|PCBP3_uc002zhp.1_Missense_Mutation_p.K70N|PCBP3_uc010gqc.1_Missense_Mutation_p.K70N|PCBP3_uc002zhs.1_Missense_Mutation_p.K70N|PCBP3_uc002zhr.1_Missense_Mutation_p.K70N|PCBP3_uc002zht.1_Missense_Mutation_p.K38N	NM_020528	NP_065389	P57721	PCBP3_HUMAN	poly(rC) binding protein 3 isoform 1	70	KH 1.				mRNA metabolic process	cytosol|mitochondrion|nucleus|ribonucleoprotein complex	DNA binding|RNA binding			skin(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		CTGTGAAGAAGATGCGTGAGG	0.607													25	29	---	---	---	---	PASS
CECR2	27443	broad.mit.edu	37	22	18022027	18022027	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18022027G>T	uc010gqw.1	+	15	2255	c.2129G>T	c.(2128-2130)GGA>GTA	p.G710V	CECR2_uc010gqv.1_Missense_Mutation_p.G569V|CECR2_uc002zml.2_Missense_Mutation_p.G569V	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	752					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)		TTCCAGCCAGGATTCATTCCT	0.552													10	24	---	---	---	---	PASS
TXN2	25828	broad.mit.edu	37	22	36872906	36872906	+	Intron	SNP	C	G	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36872906C>G	uc003apk.1	-						TXN2_uc003apl.1_Intron	NM_012473	NP_036605	Q99757	THIOM_HUMAN	thioredoxin 2 precursor						cell redox homeostasis|electron transport chain|glycerol ether metabolic process|transport	mitochondrion|nucleolus	electron carrier activity				0						CACACCACCTCAAAAGGCGAG	0.537													49	49	---	---	---	---	PASS
KCNJ4	3761	broad.mit.edu	37	22	38823423	38823423	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38823423G>T	uc003avs.1	-	2	812	c.715C>A	c.(715-717)CAG>AAG	p.Q239K	KCNJ4_uc003avt.1_Missense_Mutation_p.Q239K	NM_004981	NP_004972	P48050	IRK4_HUMAN	potassium inwardly-rectifying channel J4	239	Cytoplasmic (By similarity).				synaptic transmission	basolateral plasma membrane|voltage-gated potassium channel complex	inward rectifier potassium channel activity|PDZ domain binding				0	Melanoma(58;0.0286)					AGGTCCCGCTGGTCCAGGGGC	0.627													3	48	---	---	---	---	PASS
MIOX	55586	broad.mit.edu	37	22	50928004	50928004	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50928004C>T	uc003bll.1	+	9	794	c.680C>T	c.(679-681)ACG>ATG	p.T227M	MIOX_uc003blm.1_Missense_Mutation_p.T227M|MIOX_uc003bln.1_Intron	NM_017584	NP_060054	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	227					inositol catabolic process	cytoplasm|inclusion body	aldo-keto reductase (NADP) activity|ferric iron binding|inositol oxygenase activity				0		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCTGGCACACGGGCCGCGAC	0.672													14	12	---	---	---	---	PASS
MAP3K15	389840	broad.mit.edu	37	X	19478185	19478185	+	5'UTR	SNP	C	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19478185C>A	uc004czk.1	-	4					MAP3K15_uc004czj.1_5'UTR	NM_001001671	NP_001001671	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase								ATP binding|MAP kinase kinase kinase activity|metal ion binding			ovary(3)|lung(2)|stomach(1)|skin(1)	7	Hepatocellular(33;0.183)					GAGCTTGATCCGAGCTAGCTC	0.428													3	48	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37026576	37026576	+	Silent	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37026576G>A	uc004ddl.1	+	1	107	c.93G>A	c.(91-93)GCG>GCA	p.A31A		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	31										ovary(3)	3						AGTACTTCGCGAAGCGCAAGC	0.642													19	5	---	---	---	---	PASS
SPANXN5	494197	broad.mit.edu	37	X	52826382	52826382	+	Nonsense_Mutation	SNP	T	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52826382T>A	uc004drc.1	-	1	7	c.7A>T	c.(7-9)AAG>TAG	p.K3*		NM_001009616	NP_001009616	Q5MJ07	SPXN5_HUMAN	SPANX family, member N5	3											0	Ovarian(276;0.236)					GAAGTGGGCTTTTCCATGATT	0.418													119	12	---	---	---	---	PASS
PHKA1	5255	broad.mit.edu	37	X	71932674	71932674	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71932674G>A	uc004eax.3	-	2	485	c.184C>T	c.(184-186)CGG>TGG	p.R62W	PHKA1_uc004eay.3_Missense_Mutation_p.R62W|PHKA1_uc011mqi.1_Missense_Mutation_p.R62W	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform	62					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)					GCATTCTTCCGATAGGCCAGG	0.478													29	1	---	---	---	---	PASS
OSCP1	127700	broad.mit.edu	37	1	36915751	36915752	+	Intron	DEL	AA	-	-	rs3079364		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36915751_36915752delAA	uc001cap.2	-						OSCP1_uc001caq.2_Intron|OSCP1_uc001car.2_Intron	NM_145047	NP_659484	Q8WVF1	OSCP1_HUMAN	oxidored-nitro domain-containing protein isoform						transport	basal plasma membrane				ovary(2)|central_nervous_system(1)|pancreas(1)	4						CCCTGGTTATAAGAGTGAAGTG	0.584											OREG0013369	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	6	---	---	---	---	
CAPZA1	829	broad.mit.edu	37	1	113202197	113202198	+	Intron	DEL	TC	-	-	rs113906793		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113202197_113202198delTC	uc001ecj.1	+							NM_006135	NP_006126	P52907	CAZA1_HUMAN	F-actin capping protein alpha-1 subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement|innate immune response|protein complex assembly	cytosol|extracellular region|F-actin capping protein complex|WASH complex	actin binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATGACAGTTTCTCTCTCTCTC	0.396													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	151742420	151742420	+	IGR	DEL	C	-	-	rs35221320		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151742420delC								OAZ3 (-1385 upstream) : OAZ3 (-6975 downstream)																							tggcggcacgcgcctgcaatc	0.000													7	6	---	---	---	---	
ALLC	55821	broad.mit.edu	37	2	3745208	3745215	+	Intron	DEL	TCTGTCTA	-	-	rs112134730	by1000genomes	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3745208_3745215delTCTGTCTA	uc010ewt.2	+						ALLC_uc002qyf.2_Intron	NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a								allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		ACtctgtctgtctgtctatctatctatc	0.202										HNSCC(21;0.051)			4	4	---	---	---	---	
PLEKHH2	130271	broad.mit.edu	37	2	43984561	43984562	+	Intron	INS	-	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43984561_43984562insT	uc010yny.1	+							NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H							cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ttttttctttcttttttttttt	0.129													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	73417989	73417989	+	IGR	DEL	A	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73417989delA								RAB11FIP5 (77843 upstream) : NOTO (11397 downstream)																							ggaaggaaggaaaaaaaagaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106984908	106984908	+	IGR	DEL	T	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106984908delT								UXS1 (174113 upstream) : PLGLA (17861 downstream)																							AATTAAtttcttttttttttt	0.224													4	3	---	---	---	---	
DES	1674	broad.mit.edu	37	2	220286391	220286392	+	Intron	INS	-	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220286391_220286392insT	uc002vll.2	+							NM_001927	NP_001918	P17661	DESM_HUMAN	desmin						cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton			central_nervous_system(2)	2		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		CCTGGAAACAAttttttttttt	0.292													6	4	---	---	---	---	
CNOT10	25904	broad.mit.edu	37	3	32769472	32769483	+	Intron	DEL	TTTATTTATTTA	-	-	rs71695725		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32769472_32769483delTTTATTTATTTA	uc003cfc.1	+						CNOT10_uc011axi.1_Intron|CNOT10_uc003cfd.1_Intron|CNOT10_uc003cfe.1_Intron|CNOT10_uc010hfv.1_Intron|CNOT10_uc011axj.1_Intron|CNOT10_uc010hfw.1_Intron	NM_015442	NP_056257	Q9H9A5	CNOTA_HUMAN	CCR4-NOT transcription complex, subunit 10						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding			central_nervous_system(1)|skin(1)	2						CATTTCTCTTtttatttatttatttatttatt	0.151													4	2	---	---	---	---	
ACY1	95	broad.mit.edu	37	3	52018136	52018149	+	Frame_Shift_Del	DEL	ACCTGCGTATCCGC	-	-	rs34017492	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52018136_52018149delACCTGCGTATCCGC	uc003dcp.2	+	2	117_130	c.56_69delACCTGCGTATCCGC	c.(55-69)TACCTGCGTATCCGCfs	p.Y19fs	ABHD14B_uc003dcn.2_5'Flank|ACY1_uc011bea.1_Frame_Shift_Del_p.Y109fs|ACY1_uc011beb.1_Frame_Shift_Del_p.Y19fs|ACY1_uc003dcq.2_Frame_Shift_Del_p.Y19fs	NM_000666	NP_000657	Q03154	ACY1_HUMAN	aminoacylase 1	19_23					cellular amino acid metabolic process|proteolysis	cytosol	aminoacylase activity|metal ion binding|metallopeptidase activity			breast(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	L-Aspartic Acid(DB00128)	TTCCGCCAGTACCTGCGTATCCGCACTGTCCAGC	0.617													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49512654	49512654	+	IGR	DEL	T	-	-	rs113012804		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49512654delT								CWH43 (448561 upstream) : None (None downstream)																							ACATTCTGCGTTTTTTTGGGG	0.368													3	3	---	---	---	---	
MARCH6	10299	broad.mit.edu	37	5	10424069	10424069	+	Intron	DEL	T	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10424069delT	uc003jet.1	+						MARCH6_uc011cmu.1_Intron|MARCH6_uc003jeu.1_Intron|MARCH6_uc011cmv.1_Intron	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6						protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						ATATATAACCTTTTTTTTTTT	0.214													9	4	---	---	---	---	
GPR98	84059	broad.mit.edu	37	5	90086591	90086591	+	Intron	DEL	T	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90086591delT	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjw.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CACAATTATATTTTTTTTTTG	0.274													2	13	---	---	---	---	
RAPGEF6	51735	broad.mit.edu	37	5	130800138	130800138	+	Intron	DEL	T	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:130800138delT	uc003kvn.1	-						RAPGEF6_uc003kvp.1_Intron|RAPGEF6_uc003kvo.1_Intron|RAPGEF6_uc010jdi.1_Intron|RAPGEF6_uc010jdj.1_Intron|RAPGEF6_uc003kvq.2_Intron|RAPGEF6_uc003kvr.2_Intron|RAPGEF6_uc011cxe.1_Intron|RAPGEF6_uc010jdk.2_Intron	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		AAATATATCCTTTTTTTTTTT	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32441391	32441392	+	IGR	INS	-	T	T	rs28986194		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32441391_32441392insT								HLA-DRA (28570 upstream) : HLA-DRB1 (43771 downstream)																							AAATTATGGGGAGGAGGTTACT	0.505													3	3	---	---	---	---	
COG5	10466	broad.mit.edu	37	7	106870787	106870787	+	Intron	DEL	A	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106870787delA	uc003ved.2	-						COG5_uc003vec.2_Intron|COG5_uc003vee.2_Intron	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4						AGCTAAAAATAAAAAAAAAAA	0.259													4	2	---	---	---	---	
RBM33	155435	broad.mit.edu	37	7	155473256	155473256	+	Intron	DEL	T	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155473256delT	uc010lqk.1	+						RBM33_uc003wme.2_Intron	NM_053043	NP_444271	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33								nucleotide binding|RNA binding			ovary(1)	1	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		CATTGGGTGCTTTTTTTTTTT	0.338													13	6	---	---	---	---	
UBR5	51366	broad.mit.edu	37	8	103358988	103358988	+	Intron	DEL	A	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103358988delA	uc003ykr.1	-						UBR5_uc003yks.1_Intron	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin						cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			ctctcaaaggaaaaaaaaaaa	0.164													6	4	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131199667	131199667	+	Intron	DEL	T	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131199667delT	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						CGTTACACCAttttttttttt	0.159													4	2	---	---	---	---	
C9orf11	54586	broad.mit.edu	37	9	27291192	27291193	+	Intron	INS	-	T	T	rs138227130	by1000genomes	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27291192_27291193insT	uc003zql.2	-						C9orf11_uc011lnq.1_Intron	NM_020641	NP_065692	Q9NQ60	AFAF_HUMAN	Acr formation associated factor isoform 1							acrosomal membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(39;7.39e-08)|Lung(218;1.26e-05)|LUSC - Lung squamous cell carcinoma(38;0.000106)		tgtgtcagacctgtggttggca	0.054													0	6	---	---	---	---	
RASEF	158158	broad.mit.edu	37	9	85620174	85620174	+	Intron	DEL	G	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85620174delG	uc004amo.1	-							NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing						protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						TTTTTAATTTGGAAAAATGCT	0.303													4	5	---	---	---	---	
C9orf43	257169	broad.mit.edu	37	9	116186800	116186801	+	Intron	INS	-	T	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116186800_116186801insT	uc004bho.3	+						C9orf43_uc004bhp.2_Intron	NM_152786	NP_689999	Q8TAL5	CI043_HUMAN	hypothetical protein LOC257169												0						CTATttctttcttttttttttt	0.228													4	2	---	---	---	---	
WAC	51322	broad.mit.edu	37	10	28824816	28824817	+	Intron	INS	-	T	T	rs144095892	by1000genomes	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28824816_28824817insT	uc001iuf.2	+						WAC_uc001iud.2_Intron|WAC_uc001iue.2_Intron|WAC_uc009xlb.2_Intron|WAC_uc001iug.2_Intron|WAC_uc001iuh.2_Intron	NM_016628	NP_057712	Q9BTA9	WAC_HUMAN	WW domain-containing adapter with a coiled-coil						cell cycle checkpoint|histone H2B conserved C-terminal lysine ubiquitination|histone monoubiquitination|positive regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nuclear speck	chromatin binding|RNA polymerase II core binding			large_intestine(1)|ovary(1)	2						TAATCCTATCATTTTTTTTTTA	0.257													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	82009414	82009415	+	IGR	INS	-	C	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:82009414_82009415insC								ANXA11 (43981 upstream) : MAT1A (22162 downstream)																							TGCAAGAAAGGCCTCAACAACT	0.460													6	3	---	---	---	---	
NXF1	10482	broad.mit.edu	37	11	62564556	62564556	+	Intron	DEL	C	-	-	rs111331941		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62564556delC	uc001nvf.1	-						NXF1_uc001nvg.1_Intron|NXF1_uc009yog.1_Intron	NM_006362	NP_006353	Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1 isoform 1						gene expression|interspecies interaction between organisms	cytosol|nuclear speck	nucleotide binding|protein binding			skin(3)	3						aaaaaaaaaacaaaacaaaaa	0.244													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110072813	110072815	+	IGR	DEL	CAT	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110072813_110072815delCAT								MVK (37743 upstream) : C12orf34 (79375 downstream)																							ccaccatcaccatcaccaccacc	0.000													4	3	---	---	---	---	
P2RX4	5025	broad.mit.edu	37	12	121660167	121660168	+	Intron	INS	-	T	T	rs74419719		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121660167_121660168insT	uc001tzr.2	+						P2RX4_uc010szr.1_Intron|P2RX4_uc010szs.1_Intron|P2RX4_uc009zxc.2_Intron|P2RX4_uc001tzs.2_Intron|P2RX4_uc009zxb.2_Intron|P2RX4_uc010szt.1_Intron	NM_002560	NP_002551	Q99571	P2RX4_HUMAN	purinergic receptor P2X4						endothelial cell activation|negative regulation of cardiac muscle hypertrophy|positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin secretion|regulation of apoptosis|regulation of blood pressure|regulation of sodium ion transport|relaxation of cardiac muscle|response to ATP|response to fluid shear stress|sensory perception of pain|tissue homeostasis	cell junction|perinuclear region of cytoplasm	cadherin binding|copper ion binding|extracellular ATP-gated cation channel activity|protein homodimerization activity|purinergic nucleotide receptor activity|receptor binding|zinc ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTGCCCTACtgttttttttttt	0.312													3	3	---	---	---	---	
CCDC92	80212	broad.mit.edu	37	12	124427761	124427762	+	Intron	INS	-	A	A	rs148378755	by1000genomes	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124427761_124427762insA	uc001ufw.1	-						CCDC92_uc001ufv.1_Intron|CCDC92_uc001ufx.1_Intron|CCDC92_uc001ufy.1_Intron	NM_025140	NP_079416	Q53HC0	CCD92_HUMAN	coiled-coil domain containing 92												0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.0002)|OV - Ovarian serous cystadenocarcinoma(86;0.000222)|all cancers(50;0.00129)|BRCA - Breast invasive adenocarcinoma(302;0.242)		ATGAGGATGATATAAGGCATTC	0.490													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19933246	19933246	+	IGR	DEL	A	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19933246delA								LOC100101938 (14133 upstream) : TPTE2 (63775 downstream)																							actccatctcaaaaaaaaaaa	0.194													7	5	---	---	---	---	
KPNA3	3839	broad.mit.edu	37	13	50284028	50284029	+	Intron	INS	-	A	A	rs146505714		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50284028_50284029insA	uc001vdj.2	-							NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3						interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		GAAACTTTATGAAAAAAAAAAA	0.252													4	2	---	---	---	---	
DOCK9	23348	broad.mit.edu	37	13	99537790	99537791	+	Intron	INS	-	A	A	rs35464733		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99537790_99537791insA	uc001vnt.2	-						DOCK9_uc001vnw.2_Intron|DOCK9_uc001vnv.1_Intron|DOCK9_uc010tir.1_Intron|DOCK9_uc010tis.1_Intron|DOCK9_uc010tit.1_Intron|DOCK9_uc010afu.1_Intron	NM_015296	NP_056111	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9 isoform a						blood coagulation	cytosol|endomembrane system|membrane	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			central_nervous_system(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					gctcaaaaattaaaaaaaaaaa	0.139													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	23012893	23012893	+	Intron	DEL	G	-	-	rs67228952		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23012893delG	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wde.1_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wee.3_Intron|uc010tmt.1_Intron|uc010ajv.1_Intron|uc001weg.2_Intron|uc001wei.2_Intron|uc001wej.2_Intron|uc001wek.2_Intron|uc001wel.2_Intron|uc001wem.3_Intron|uc001wen.1_Intron|uc001weo.2_Intron|uc001wep.2_Intron|uc001weq.2_Intron|uc001wer.2_Intron|uc001wet.2_Intron|uc001weu.2_Intron|uc001wev.2_Intron|uc001wew.2_Intron|uc010tmv.1_Intron|uc001wez.2_Intron|uc010ajx.1_Intron|uc001wfb.1_Intron|uc001wfd.1_Intron|uc001wfe.2_Intron|uc001wfg.2_Intron|uc001wfh.1_Intron|uc001wfi.2_Intron|uc001wfk.2_Intron|uc001wfl.2_Intron|uc010ajy.1_Intron|uc001wfn.2_Intron|uc001wfp.2_Intron|uc001wfq.1_Intron|uc001wfr.1_Intron|uc010ajz.1_Intron|uc001wfs.1_Intron|uc001wft.1_Intron|uc001wfu.2_Intron|uc001wfv.1_Intron|uc001wfw.1_Intron|uc001wfx.2_Intron|uc001wfy.1_Intron|uc001wfz.1_Intron|uc001wgc.2_Intron|uc001wgd.2_Intron|uc001wge.3_Intron|uc001wgf.2_Intron|uc010tmw.1_Intron|uc010tmx.1_Intron|uc001wgh.2_Intron|uc001wgi.1_Intron|uc001wgj.1_Intron|uc001wgk.2_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		aaaaaaaaaagaaGGTCTAAC	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98480461	98480462	+	IGR	INS	-	CTTT	CTTT	rs149441117	by1000genomes	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98480461_98480462insCTTT								C14orf64 (36000 upstream) : C14orf177 (697488 downstream)																							ttccttccttcctttctttctc	0.000													4	2	---	---	---	---	
C15orf41	84529	broad.mit.edu	37	15	36983573	36983573	+	Intron	DEL	T	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36983573delT	uc001zje.3	+						C15orf41_uc001zjd.2_Intron|C15orf41_uc010bbb.1_Intron|C15orf41_uc001zjf.2_Intron|C15orf41_uc010uci.1_Intron	NM_001130010	NP_001123482	Q9Y2V0	CO041_HUMAN	hypothetical protein LOC84529 isoform 1								protein binding			pancreas(1)	1		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		TATTTTCTGATTTTTTTTTTT	0.303													4	2	---	---	---	---	
RNF111	54778	broad.mit.edu	37	15	59341945	59341946	+	Intron	DEL	TT	-	-	rs145601625		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59341945_59341946delTT	uc002afv.2	+						RNF111_uc002afs.2_Intron|RNF111_uc002aft.2_Intron|RNF111_uc002afu.2_Intron|RNF111_uc002afw.2_Intron	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111						multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		tctttctttctttttttttttt	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	16696737	16696738	+	IGR	INS	-	CTTC	CTTC			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16696737_16696738insCTTC								LOC339047 (252300 upstream) : XYLT1 (499445 downstream)																							tccctccctttcttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	51074929	51074930	+	IGR	INS	-	GGAG	GGAG	rs145692350	by1000genomes	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51074929_51074930insGGAG								CYLD (239083 upstream) : SALL1 (94956 downstream)																							ggagggagggaggaaggaggga	0.000													4	2	---	---	---	---	
CCDC135	84229	broad.mit.edu	37	16	57764612	57764613	+	Intron	INS	-	CT	CT	rs140947586	by1000genomes	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57764612_57764613insCT	uc002emi.2	+						CCDC135_uc002emj.2_Intron|CCDC135_uc002emk.2_Intron	NM_032269	NP_115645	Q8IY82	CC135_HUMAN	coiled-coil domain containing 135							cytoplasm				central_nervous_system(1)	1						AGTCTTGCCCCGTTCTGATCTC	0.307													1	6	---	---	---	---	
PMFBP1	83449	broad.mit.edu	37	16	72163921	72163921	+	Intron	DEL	T	-	-	rs67023960		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72163921delT	uc002fcc.3	-						PMFBP1_uc002fcd.2_Intron|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Intron|PMFBP1_uc010cgo.1_5'Flank	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1											ovary(2)	2		Ovarian(137;0.179)				aatgtttgtattttttttttt	0.000													4	3	---	---	---	---	
DNAH9	1770	broad.mit.edu	37	17	11607899	11607900	+	Intron	INS	-	T	T	rs11364560		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11607899_11607900insT	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GCTGCTCCTACttttttttttt	0.282													8	4	---	---	---	---	
NXPH3	11248	broad.mit.edu	37	17	47655768	47655768	+	Intron	DEL	T	-	-	rs67095119		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47655768delT	uc002ipa.2	+						NXPH3_uc010wlw.1_Intron	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor						neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					GGGGGGGGGGTGACCCAACTG	0.527													6	4	---	---	---	---	
MYST2	11143	broad.mit.edu	37	17	47876152	47876152	+	Intron	DEL	C	-	-	rs79375515		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47876152delC	uc002ipm.2	+						MYST2_uc002ipl.1_Intron|MYST2_uc010wma.1_Intron|MYST2_uc010wmb.1_Intron|MYST2_uc010wmc.1_Intron|MYST2_uc010wmd.1_Intron|MYST2_uc010wme.1_Intron	NM_007067	NP_008998	O95251	MYST2_HUMAN	MYST histone acetyltransferase 2						DNA replication|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	histone acetyltransferase activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						TTCAGTTTATCCTAGAGCTTT	0.373													3	8	---	---	---	---	
LOC647946	647946	broad.mit.edu	37	18	37248431	37248454	+	Intron	DEL	AGGGAGGAAGGAAGGAAGGAAGGA	-	-	rs11270312	by1000genomes	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37248431_37248454delAGGGAGGAAGGAAGGAAGGAAGGA	uc010xcj.1	-						LOC647946_uc002lal.1_Intron	NR_024391				Homo sapiens cDNA FLJ33284 fis, clone ASTRO2009458.												0						ggagggagggagggaggaaggaaggaaggaaggaaggaaggaag	0.098													4	3	---	---	---	---	
ZCCHC2	54877	broad.mit.edu	37	18	60212014	60212015	+	Intron	DEL	TG	-	-	rs150177822		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60212014_60212015delTG	uc002lip.3	+						ZCCHC2_uc002lio.2_Intron	NM_017742	NP_060212	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2						cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding			lung(1)|prostate(1)	2						CCATATAATATGTGTGTTTTTT	0.332													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7440297	7440297	+	IGR	DEL	A	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7440297delA								INSR (146286 upstream) : ARHGEF18 (7423 downstream)																							aggaaggaagaaaaggaagga	0.100													4	2	---	---	---	---	
IRF3	3661	broad.mit.edu	37	19	50163242	50163243	+	Intron	DEL	AC	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50163242_50163243delAC	uc010end.1	-						IRF3_uc002pos.1_Intron|IRF3_uc002pot.1_Intron|IRF3_uc002pox.1_Intron|IRF3_uc002poy.1_Intron|IRF3_uc002pou.2_Intron|IRF3_uc002pov.2_Intron|IRF3_uc002pow.2_Intron	NM_001571	NP_001562	Q14653	IRF3_HUMAN	interferon regulatory factor 3						interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|endosome membrane|nucleoplasm|plasma membrane	DNA binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		TTGTAGTTTTacacacacacac	0.406													4	2	---	---	---	---	
C20orf117	140710	broad.mit.edu	37	20	35445890	35445891	+	Intron	INS	-	A	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35445890_35445891insA	uc002xgd.1	-						C20orf117_uc002xge.1_5'Flank	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)				GAGatttaattaaaaaaaaaaa	0.510													4	2	---	---	---	---	
ARFGAP1	55738	broad.mit.edu	37	20	61914158	61914158	+	Intron	DEL	T	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61914158delT	uc002yem.2	+						ARFGAP1_uc011aas.1_Intron|ARFGAP1_uc011aat.1_Intron|ARFGAP1_uc002yel.2_Intron|ARFGAP1_uc002yen.2_Intron|ARFGAP1_uc002yeo.1_5'Flank	NM_018209	NP_060679	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating						COPI coating of Golgi vesicle|protein transport|regulation of ARF GTPase activity|retrograde vesicle-mediated transport, Golgi to ER	cytosol|Golgi-associated vesicle membrane	ARF GTPase activator activity|zinc ion binding			pancreas(1)	1	all_cancers(38;1.59e-09)					CTTGTCTTTGTTTTTCATTTT	0.517													55	44	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62076856	62076857	+	Intron	INS	-	CCCCAAAGGG	CCCCAAAGGG	rs138698925	by1000genomes	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62076856_62076857insCCCCAAAGGG	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	GCAAGCTGACCCCCCCACCCCT	0.678													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	30274401	30274401	+	IGR	DEL	C	-	-	rs79176097	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30274401delC								N6AMT1 (16708 upstream) : RNF160 (26065 downstream)																							ttttttttttcctaatgctct	0.164													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	135873660	135873660	+	IGR	DEL	G	-	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135873660delG								ARHGEF6 (10157 upstream) : RBMX (77693 downstream)																							TAATCTACAAGCGTGGTTATG	0.393													4	3	---	---	---	---	
