Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
AURKAIP1	54998	broad.mit.edu	37	1	1309502	1309502	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1309502G>C	uc001afb.1	-	2	486	c.376C>G	c.(376-378)CAG>GAG	p.Q126E	AURKAIP1_uc001afc.2_Missense_Mutation_p.Q126E|AURKAIP1_uc001afd.2_Missense_Mutation_p.Q126E|AURKAIP1_uc009vkb.1_Missense_Mutation_p.Q126E	NM_017900	NP_060370	Q9NWT8	AKIP_HUMAN	aurora kinase A interacting protein 1	126					negative regulation of mitosis|positive regulation of proteolysis	mitochondrion|nucleus	protein binding				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;5.82e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TTTTTGCACTGAATTTGAGGC	0.607													11	111	---	---	---	---	PASS
ATAD3A	55210	broad.mit.edu	37	1	1469407	1469407	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1469407G>A	uc001afz.1	+	16	1954	c.1860G>A	c.(1858-1860)CTG>CTA	p.L620L	ATAD3A_uc001aga.1_Silent_p.L572L|ATAD3A_uc001agb.1_Silent_p.L493L|ATAD3A_uc001agc.1_RNA	NM_018188	NP_060658	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	620							ATP binding|nucleoside-triphosphatase activity|protein binding			skin(1)	1	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		TGTGCTGGCTGAAGGCGGAAG	0.677													7	69	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	1855219	1855219	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1855219C>G	uc001aik.2	-	7	1232	c.382G>C	c.(382-384)GAA>CAA	p.E128Q	uc001ail.2_Missense_Mutation_p.E128Q					RecName: Full=Uncharacterized protein C1orf222;																		CGCACCTTTTCAAAGAGCACC	0.632													15	84	---	---	---	---	PASS
ESPN	83715	broad.mit.edu	37	1	6504554	6504554	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6504554G>A	uc001amy.2	+	6	1172	c.1004G>A	c.(1003-1005)CGC>CAC	p.R335H		NM_031475	NP_113663	B1AK53	ESPN_HUMAN	espin	335					sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding				0	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		GTGGAGCACCGCGTGCTTTCC	0.517													6	29	---	---	---	---	PASS
NMNAT1	64802	broad.mit.edu	37	1	10035738	10035738	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10035738C>T	uc001aqp.2	+	3	348	c.204C>T	c.(202-204)ATC>ATT	p.I68I		NM_022787	NP_073624	Q9HAN9	NMNA1_HUMAN	nicotinamide mononucleotide adenylyltransferase	68					water-soluble vitamin metabolic process	nucleoplasm	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity|protein binding				0		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)		ACCGGGTCATCATGGCAGAAC	0.438													11	113	---	---	---	---	PASS
CASZ1	54897	broad.mit.edu	37	1	10714279	10714279	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10714279G>A	uc001aro.2	-						CASZ1_uc001arp.1_Intron|CASZ1_uc009vmx.2_Intron	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GGGGCGCCTGGATGGGACATT	0.602													7	80	---	---	---	---	PASS
PTCHD2	57540	broad.mit.edu	37	1	11561451	11561451	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11561451G>A	uc001ash.3	+	2	540	c.402G>A	c.(400-402)GGG>GGA	p.G134G	PTCHD2_uc001asi.1_Silent_p.G134G	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	134	Extracellular (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GATCCTGGGGGCGGAACCGGC	0.602													6	38	---	---	---	---	PASS
MTHFR	4524	broad.mit.edu	37	1	11861220	11861220	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11861220C>T	uc001atc.1	-	3	657	c.473G>A	c.(472-474)GGA>GAA	p.G158E	MTHFR_uc001atb.1_Missense_Mutation_p.G181E	NM_005957	NP_005948	P42898	MTHR_HUMAN	5,10-methylenetetrahydrofolate reductase	158					blood circulation|folic acid metabolic process	cytosol	methylenetetrahydrofolate reductase (NADPH) activity|protein binding				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|Raltitrexed(DB00293)|Riboflavin(DB00140)|S-Adenosylmethionine(DB00118)|Tetrahydrofolic acid(DB00116)	CTCCACACCTCCCCGCAGCGC	0.582													16	203	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12342893	12342893	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12342893C>T	uc001atv.2	+	21	4875	c.4734C>T	c.(4732-4734)CTC>CTT	p.L1578L	VPS13D_uc001atw.2_Silent_p.L1578L|VPS13D_uc001atx.2_Silent_p.L766L	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	1578					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TGCCTCCCCTCAGTACCTGTG	0.478													7	66	---	---	---	---	PASS
CLCNKA	1187	broad.mit.edu	37	1	16356492	16356492	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16356492C>G	uc001axu.2	+	14	1410	c.1330C>G	c.(1330-1332)CTT>GTT	p.L444V	CLCNKA_uc001axt.2_RNA|CLCNKA_uc001axv.2_Missense_Mutation_p.L444V|CLCNKA_uc010obw.1_Missense_Mutation_p.L401V|CLCNKB_uc001axw.3_Intron|CLCNKA_uc010obx.1_Missense_Mutation_p.L91V|CLCNKA_uc010oby.1_Missense_Mutation_p.L180V	NM_004070	NP_004061	P51800	CLCKA_HUMAN	chloride channel Ka isoform 1	444					excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			ovary(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	GGGAGAGGCTCTTGCCGTCGC	0.662													9	106	---	---	---	---	PASS
ARHGEF19	128272	broad.mit.edu	37	1	16525135	16525135	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16525135C>T	uc001ayc.1	-	16	2493	c.2356G>A	c.(2356-2358)GAG>AAG	p.E786K	ARHGEF19_uc009voo.1_Missense_Mutation_p.E139K|ARHGEF19_uc001ayb.1_Missense_Mutation_p.E263K	NM_153213	NP_694945	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	786					regulation of actin cytoskeleton organization	intracellular	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		CGCTTATTCTCCCGGAGGTTT	0.637													6	89	---	---	---	---	PASS
ATP13A2	23400	broad.mit.edu	37	1	17318248	17318248	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17318248G>A	uc001baa.2	-	20	2422	c.2232C>T	c.(2230-2232)ATC>ATT	p.I744I	ATP13A2_uc001azz.1_5'Flank|ATP13A2_uc001bab.2_Silent_p.I739I|ATP13A2_uc001bac.2_Silent_p.I739I	NM_022089	NP_071372	Q9NQ11	AT132_HUMAN	ATPase type 13A2 isoform 1	744	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		TGACGGCGCGGATGCGGGTCC	0.622													5	98	---	---	---	---	PASS
IGSF21	84966	broad.mit.edu	37	1	18703404	18703404	+	Silent	SNP	C	T	T	rs145075430		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18703404C>T	uc001bau.1	+	8	1595	c.1212C>T	c.(1210-1212)GCC>GCT	p.A404A	IGSF21_uc001bav.1_Silent_p.A225A	NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor	404	Ig-like 2.					extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		GGGTTCCCGCCGAGCTCAATG	0.662													8	25	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19436713	19436713	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19436713G>A	uc001bbi.2	-	81	11986	c.11982C>T	c.(11980-11982)CTC>CTT	p.L3994L		NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	3994					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GGAAAAGGCTGAGAGCTAGGG	0.512													4	72	---	---	---	---	PASS
KIAA0090	23065	broad.mit.edu	37	1	19549948	19549948	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19549948G>C	uc001bbo.2	-	19	2361	c.2318C>G	c.(2317-2319)TCT>TGT	p.S773C	KIAA0090_uc001bbn.2_5'Flank|KIAA0090_uc001bbp.2_Missense_Mutation_p.S772C|KIAA0090_uc001bbq.2_Missense_Mutation_p.S772C|KIAA0090_uc001bbr.2_Missense_Mutation_p.S751C	NM_015047	NP_055862	Q8N766	K0090_HUMAN	hypothetical protein LOC23065 precursor	773	DUF1620.|Extracellular (Potential).					integral to membrane	protein binding			ovary(1)	1		Colorectal(325;0.000147)|Renal(390;0.000469)|Breast(348;0.00366)|all_lung(284;0.00519)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;3.84e-05)|Kidney(64;0.000191)|KIRC - Kidney renal clear cell carcinoma(64;0.00274)|GBM - Glioblastoma multiforme(114;0.005)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0656)		CTTCTGCACAGAGGAGTGAAT	0.557													20	199	---	---	---	---	PASS
HSPG2	3339	broad.mit.edu	37	1	22168565	22168565	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22168565G>A	uc001bfj.2	-	69	9163	c.9123C>T	c.(9121-9123)TTC>TTT	p.F3041F	HSPG2_uc009vqd.2_Silent_p.F3042F	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	3041	Ig-like C2-type 16.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	TGAGGCACTTGAAGCTGGCAT	0.677													9	28	---	---	---	---	PASS
ZBTB40	9923	broad.mit.edu	37	1	22835108	22835108	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22835108C>T	uc001bft.2	+	9	2094	c.1583C>T	c.(1582-1584)TCT>TTT	p.S528F	ZBTB40_uc001bfu.2_Missense_Mutation_p.S528F|ZBTB40_uc009vqi.1_Missense_Mutation_p.S416F|ZBTB40_uc001bfv.1_Missense_Mutation_p.S157F	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	528					bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		CAGACTCTCTCTGCCACAGCC	0.488													8	111	---	---	---	---	PASS
ZNF436	80818	broad.mit.edu	37	1	23688744	23688744	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23688744G>A	uc001bgt.2	-	3	1512	c.1131C>T	c.(1129-1131)CTC>CTT	p.L377L	ZNF436_uc001bgu.2_Silent_p.L377L	NM_030634	NP_085137	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	377	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		GGTGTGTGATGAGATGAGAGC	0.458													6	87	---	---	---	---	PASS
MYOM3	127294	broad.mit.edu	37	1	24388456	24388456	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24388456G>C	uc001bin.3	-	33	4077	c.3914C>G	c.(3913-3915)TCA>TGA	p.S1305*	MYOM3_uc001bil.3_Nonsense_Mutation_p.S198*|MYOM3_uc001bim.3_Nonsense_Mutation_p.S962*	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	1305										skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GAGATCTGTTGAGAGCTGCCG	0.458													5	137	---	---	---	---	PASS
NIPAL3	57185	broad.mit.edu	37	1	24782617	24782617	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24782617C>G	uc001bjh.2	+						NIPAL3_uc001bjg.2_Intron|NIPAL3_uc009vrc.2_Intron|NIPAL3_uc001bji.2_5'Flank	NM_020448	NP_065181	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3							integral to membrane					0						GCCCTTGTCTCCCATCTGCAG	0.557													42	321	---	---	---	---	PASS
RCAN3	11123	broad.mit.edu	37	1	24857861	24857861	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24857861C>G	uc001bjj.2	+	3	662	c.349C>G	c.(349-351)CTA>GTA	p.L117V	RCAN3_uc009vrd.2_Missense_Mutation_p.L117V|RCAN3_uc009vre.2_Intron|RCAN3_uc009vrf.2_Missense_Mutation_p.L117V|RCAN3_uc009vrg.2_Intron	NM_013441	NP_038469	Q9UKA8	RCAN3_HUMAN	Down syndrome critical region gene 1-like 2	117					anatomical structure morphogenesis|calcium-mediated signaling		nucleotide binding|RNA binding|troponin I binding				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		TGGGCAGAAGCTAAAGCTATA	0.383													9	28	---	---	---	---	PASS
GPATCH3	63906	broad.mit.edu	37	1	27226681	27226681	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27226681C>T	uc001bne.2	-	1	282	c.253G>A	c.(253-255)GAT>AAT	p.D85N	GPATCH3_uc009vsp.1_5'UTR	NM_022078	NP_071361	Q96I76	GPTC3_HUMAN	G patch domain containing 3	85						intracellular	nucleic acid binding				0		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		GGCCGGACATCGGTGGCCGAA	0.627													6	75	---	---	---	---	PASS
FAM46B	115572	broad.mit.edu	37	1	27332842	27332842	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27332842G>A	uc010ofj.1	-	2	1043	c.871C>T	c.(871-873)CGG>TGG	p.R291W		NM_052943	NP_443175	Q96A09	FA46B_HUMAN	hypothetical protein LOC115572	291										central_nervous_system(1)	1		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		GGCCGGGGCCGGAAGCCCCGC	0.677													8	24	---	---	---	---	PASS
RPA2	6118	broad.mit.edu	37	1	28233564	28233564	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28233564G>A	uc001bpe.1	-						RPA2_uc001bpd.1_Intron|RPA2_uc010ofp.1_Intron	NM_002946	NP_002937	P15927	RFA2_HUMAN	replication protein A2, 32kDa						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|regulation of double-strand break repair via homologous recombination|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor A complex|PML body	protein phosphatase binding|single-stranded DNA binding			skin(1)	1		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		TAGGTTAGAAGAAACAAAGAA	0.363								Direct_reversal_of_damage|NER					7	37	---	---	---	---	PASS
SMPDL3B	27293	broad.mit.edu	37	1	28285127	28285127	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28285127C>T	uc001bpg.2	+	8	1337	c.1146C>T	c.(1144-1146)ATC>ATT	p.I382I	SMPDL3B_uc010ofq.1_Silent_p.I176I|SMPDL3B_uc010ofr.1_Silent_p.I334I|XKR8_uc001bph.1_5'Flank	NM_014474	NP_055289	Q92485	ASM3B_HUMAN	acid sphingomyelinase-like phosphodiesterase 3B	382					sphingomyelin catabolic process	extracellular space	hydrolase activity, acting on glycosyl bonds|sphingomyelin phosphodiesterase activity			ovary(3)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;5.68e-24)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00587)|READ - Rectum adenocarcinoma(331;0.055)		TGGACCGCATCGCTGGCGACC	0.647													4	53	---	---	---	---	PASS
MED18	54797	broad.mit.edu	37	1	28661064	28661064	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28661064C>T	uc001bpt.3	+	3	455	c.210C>T	c.(208-210)CTC>CTT	p.L70L	MED18_uc009vtg.2_Silent_p.L70L	NM_017638	NP_060108	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	70					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex	identical protein binding				0		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		CATTTGTTCTCAGGGCCCGAC	0.572													34	294	---	---	---	---	PASS
MED18	54797	broad.mit.edu	37	1	28661335	28661335	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28661335G>A	uc001bpt.3	+	3	726	c.481G>A	c.(481-483)GAG>AAG	p.E161K	MED18_uc009vtg.2_Missense_Mutation_p.E161K	NM_017638	NP_060108	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	161					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex	identical protein binding				0		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		AGACAGCACTGAGGCCTTGTC	0.483													10	74	---	---	---	---	PASS
PUM1	9698	broad.mit.edu	37	1	31409541	31409541	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31409541C>G	uc001bsi.1	-	21	3491	c.3378G>C	c.(3376-3378)CAG>CAC	p.Q1126H	PUM1_uc001bsf.1_Missense_Mutation_p.Q794H|PUM1_uc001bsg.1_Missense_Mutation_p.Q860H|PUM1_uc001bsh.1_Missense_Mutation_p.Q1128H|PUM1_uc001bsj.1_Missense_Mutation_p.Q1102H|PUM1_uc010oga.1_Missense_Mutation_p.Q984H|PUM1_uc001bsk.1_Missense_Mutation_p.Q1164H|PUM1_uc010ogb.1_Missense_Mutation_p.Q1067H|SNORD103A_uc009vts.1_Intron	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	1126	PUM-HD.|Pumilio 8.				cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		CAATCATCTTCTGGACCACGT	0.572													5	39	---	---	---	---	PASS
C1orf212	113444	broad.mit.edu	37	1	35321026	35321026	+	Missense_Mutation	SNP	C	G	G	rs142214795		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35321026C>G	uc001byb.2	-	2	673	c.256G>C	c.(256-258)GAG>CAG	p.E86Q		NM_138428	NP_612437			hypothetical protein LOC113444												0		Myeloproliferative disorder(586;0.0393)				ATGTTCATCTCATAACTCTCC	0.557													3	48	---	---	---	---	PASS
STK40	83931	broad.mit.edu	37	1	36820970	36820970	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36820970C>T	uc001cak.1	-	6	814	c.407G>A	c.(406-408)CGC>CAC	p.R136H	STK40_uc001cal.1_Missense_Mutation_p.R141H|STK40_uc001cam.1_Missense_Mutation_p.R136H|STK40_uc009vva.1_Missense_Mutation_p.R136H|STK40_uc001can.1_Missense_Mutation_p.R136H	NM_032017	NP_114406	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	136	Protein kinase.					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)				GAGGCAGATGCGCTTCTTCAT	0.557													15	289	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37346292	37346292	+	Missense_Mutation	SNP	C	G	G	rs148168675		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37346292C>G	uc001caz.2	-	3	628	c.493G>C	c.(493-495)GAC>CAC	p.D165H	GRIK3_uc001cba.1_Missense_Mutation_p.D165H	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	165	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	TGGACCAGGTCGAGGATGGCA	0.622													7	204	---	---	---	---	PASS
C1orf122	127687	broad.mit.edu	37	1	38274699	38274699	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38274699G>C	uc001ccd.2	+	3	891	c.287G>C	c.(286-288)AGA>ACA	p.R96T	YRDC_uc001cca.1_5'Flank|C1orf122_uc001ccb.1_Missense_Mutation_p.E125Q|C1orf122_uc010oii.1_Missense_Mutation_p.R33T	NM_198446	NP_940848	Q6ZSJ8	CA122_HUMAN	hypothetical protein LOC127687 isoform 1	96											0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0393)				GTCTCCGCCAGAGGCGGCTTT	0.622													10	146	---	---	---	---	PASS
KIAA0754	643314	broad.mit.edu	37	1	39879250	39879250	+	Missense_Mutation	SNP	A	G	G	rs783822	by1000genomes	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39879250A>G	uc009vvt.1	+	1	4075	c.3313A>G	c.(3313-3315)ACC>GCC	p.T1105A	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc010oiu.1_Intron	NM_015038	NP_055853	O94854	K0754_HUMAN	hypothetical protein LOC643314	969	Ala-rich.|8.										0	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGAGGAGCCCACCTCCCCAGC	0.726													3	5	---	---	---	---	PASS
PABPC4	8761	broad.mit.edu	37	1	40033119	40033119	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40033119C>G	uc010oiv.1	-						PABPC4_uc001cdl.2_Intron|PABPC4_uc001cdm.2_Intron|SNORA55_uc001cdo.1_RNA	NM_003819	NP_003810	Q13310	PABP4_HUMAN	poly A binding protein, cytoplasmic 4 isoform 2						blood coagulation|RNA catabolic process|RNA processing|translation	cytoplasm|ribonucleoprotein complex	nucleotide binding|poly(A) RNA binding|poly(U) RNA binding|protein binding				0	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TCTGCTCATTCTGTAGCACCA	0.502													3	33	---	---	---	---	PASS
ZNF642	339559	broad.mit.edu	37	1	40961552	40961552	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40961552G>A	uc001cfo.2	+	6	1696	c.1402G>A	c.(1402-1404)GAA>AAA	p.E468K	ZNF642_uc009vwb.2_Missense_Mutation_p.E468K|ZNF642_uc010ojk.1_Missense_Mutation_p.E469K	NM_198494	NP_940896	Q49AA0	ZN642_HUMAN	zinc finger protein 642	468	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.81e-19)			GAAAGCATATGAATGCAACCG	0.408													8	74	---	---	---	---	PASS
CTPS	1503	broad.mit.edu	37	1	41475253	41475253	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41475253C>G	uc001cgk.3	+	17	2191	c.1683C>G	c.(1681-1683)CTC>CTG	p.L561L	CTPS_uc010ojo.1_Silent_p.L330L|CTPS_uc001cgl.3_Silent_p.L561L|CTPS_uc010ojq.1_Silent_p.L405L|CTPS_uc009vwe.2_Silent_p.L230L	NM_001905	NP_001896	P17812	PYRG1_HUMAN	CTP synthase	561					CTP biosynthetic process|glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|response to drug	cytosol	ATP binding|CTP synthase activity|protein binding				0	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)			L-Glutamine(DB00130)	GCTGCAGGCTCTCACCCAGGT	0.537													7	112	---	---	---	---	PASS
SLC2A1	6513	broad.mit.edu	37	1	43395575	43395575	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43395575G>C	uc001cik.2	-	5	1173	c.648C>G	c.(646-648)ATC>ATG	p.I216M		NM_006516	NP_006507	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose	216	Cytoplasmic (Potential).				carbohydrate metabolic process|energy reserve metabolic process|regulation of insulin secretion|water-soluble vitamin metabolic process	integral to membrane|melanosome|membrane fraction|midbody	D-glucose transmembrane transporter activity|dehydroascorbic acid transporter activity			central_nervous_system(2)|pancreas(2)|ovary(1)	5	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	CGTTGCGGTTGATGAGCAGGA	0.652													8	97	---	---	---	---	PASS
PLK3	1263	broad.mit.edu	37	1	45271329	45271329	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45271329C>T	uc001cmn.2	+	15	2020	c.1920C>T	c.(1918-1920)CTC>CTT	p.L640L	PLK3_uc001cmo.2_RNA|BTBD19_uc010old.1_5'Flank|BTBD19_uc010ole.1_5'Flank	NM_004073	NP_004064	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	640						membrane	ATP binding|protein binding|protein serine/threonine kinase activity				0	Acute lymphoblastic leukemia(166;0.155)					TGCGCCTGCTCCGGGACCGCA	0.647													5	57	---	---	---	---	PASS
TESK2	10420	broad.mit.edu	37	1	45923264	45923264	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45923264C>T	uc001cns.1	-	2	597	c.194G>A	c.(193-195)GGG>GAG	p.G65E	TESK2_uc009vxr.1_Missense_Mutation_p.G65E|TESK2_uc010olo.1_Intron|TESK2_uc009vxs.1_5'UTR|TESK2_uc010olp.1_Missense_Mutation_p.G65E	NM_007170	NP_009101	Q96S53	TESK2_HUMAN	testis-specific protein kinase 2	65	ATP (By similarity).|Protein kinase.				actin cytoskeleton organization|focal adhesion assembly|spermatogenesis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(2)|pancreas(1)	5	Acute lymphoblastic leukemia(166;0.155)					GAAGCCAGACCCTATTTTTTC	0.438													4	72	---	---	---	---	PASS
C1orf190	541468	broad.mit.edu	37	1	46669217	46669217	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46669217C>T	uc010oma.1	+	1	212	c.119C>T	c.(118-120)TCT>TTT	p.S40F	POMGNT1_uc001cpg.2_Intron|POMGNT1_uc001cpf.2_Intron	NM_001013615	NP_001013633	Q96LR2	CA190_HUMAN	hypothetical protein LOC541468	40					positive regulation of cytokine production|positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm				ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(166;0.155)					CTGGGAACCTCTGGCGCCCTG	0.657													3	38	---	---	---	---	PASS
CC2D1B	200014	broad.mit.edu	37	1	52825770	52825770	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52825770G>C	uc001ctq.1	-	7	877	c.739C>G	c.(739-741)CCA>GCA	p.P247A	CC2D1B_uc001ctr.2_5'Flank|CC2D1B_uc001cts.2_5'UTR	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	247	Pro-rich.									ovary(2)	2						GGGGGAGCTGGAGGGTCTGTC	0.602													3	25	---	---	---	---	PASS
ZCCHC11	23318	broad.mit.edu	37	1	52981652	52981652	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52981652C>G	uc001ctx.2	-	3	1027	c.793G>C	c.(793-795)GAT>CAT	p.D265H	ZCCHC11_uc001cty.2_Missense_Mutation_p.D265H|ZCCHC11_uc001ctz.2_Missense_Mutation_p.D265H|ZCCHC11_uc009vze.1_Missense_Mutation_p.D265H|ZCCHC11_uc009vzf.1_Missense_Mutation_p.D24H|ZCCHC11_uc001cub.2_Missense_Mutation_p.D265H|ZCCHC11_uc001cuc.2_RNA|ZCCHC11_uc001cud.2_Missense_Mutation_p.D265H	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform	265					miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						GCAGATTCATCTATCACAGTG	0.363													3	64	---	---	---	---	PASS
TMEM48	55706	broad.mit.edu	37	1	54238061	54238061	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54238061G>A	uc001cvs.2	-	17	2143	c.1902C>T	c.(1900-1902)TTC>TTT	p.F634F	TMEM48_uc010onu.1_Silent_p.F594F|TMEM48_uc001cvt.2_Silent_p.F511F|TMEM48_uc009vzk.2_RNA|TMEM48_uc010onv.1_Silent_p.F299F	NM_018087	NP_060557	Q9BTX1	NDC1_HUMAN	transmembrane protein 48	634	Cytoplasmic (Potential).				mRNA transport|nuclear pore complex assembly|nuclear pore distribution|protein transport|transmembrane transport	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore			ovary(1)|pancreas(1)	2						GTGATGCTCTGAATGCAAATC	0.393													15	142	---	---	---	---	PASS
PPAP2B	8613	broad.mit.edu	37	1	56990047	56990047	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:56990047C>A	uc001cyj.1	-	4	978	c.477G>T	c.(475-477)TTG>TTT	p.L159F		NM_177414	NP_803133	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B	159	Lumenal (Potential).				canonical Wnt receptor signaling pathway involved in positive regulation of cell-cell adhesion|canonical Wnt receptor signaling pathway involved in positive regulation of endothelial cell migration|canonical Wnt receptor signaling pathway involved in positive regulation of wound healing|germ cell migration|homotypic cell-cell adhesion|negative regulation of protein phosphorylation|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|sphingolipid metabolic process	adherens junction|Golgi apparatus|integral to membrane	phosphatidate phosphatase activity|phosphoprotein phosphatase activity|protein binding|sphingosine-1-phosphate phosphatase activity				0						TGCAGACACTCAAGAAGTGAG	0.507													18	122	---	---	---	---	PASS
C1orf168	199920	broad.mit.edu	37	1	57252870	57252870	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57252870C>G	uc001cym.3	-	4	1337	c.931G>C	c.(931-933)GAG>CAG	p.E311Q	C1orf168_uc009vzu.1_RNA	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920	311										ovary(3)|skin(2)	5						AGGGAGCCCTCTTCCACAGTC	0.493													10	82	---	---	---	---	PASS
HOOK1	51361	broad.mit.edu	37	1	60312796	60312796	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60312796G>C	uc009wad.2	+	11	970	c.868G>C	c.(868-870)GAT>CAT	p.D290H	HOOK1_uc001czo.2_Missense_Mutation_p.D290H|HOOK1_uc001czp.2_RNA|HOOK1_uc010oor.1_Missense_Mutation_p.D248H	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1	290	Potential.|Sufficient for interaction with microtubules.				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)					GCATAGGAATGATGAATTGAC	0.348													4	59	---	---	---	---	PASS
DNAJC6	9829	broad.mit.edu	37	1	65854988	65854988	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65854988C>T	uc001dcd.1	+	10	1236	c.1072C>T	c.(1072-1074)CAG>TAG	p.Q358*	DNAJC6_uc001dcc.1_Nonsense_Mutation_p.Q389*|DNAJC6_uc010opc.1_Nonsense_Mutation_p.Q345*|DNAJC6_uc001dce.1_Nonsense_Mutation_p.Q415*	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	358	C2 tensin-type.				cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3						TCAGCTATTTCAGGTGACACT	0.388													9	83	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67147793	67147793	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67147793C>G	uc001dcr.2	+	15	1273	c.1056C>G	c.(1054-1056)CTC>CTG	p.L352L	SGIP1_uc010opd.1_Intron|SGIP1_uc001dcs.2_Intron|SGIP1_uc001dct.2_Intron|SGIP1_uc009wat.2_Silent_p.L119L	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	352	Pro-rich.				positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						CAGGCCCTCTCGGCCCCCCAG	0.607													6	225	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82431798	82431798	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82431798C>T	uc001dit.3	+	11	2204	c.2023C>T	c.(2023-2025)CTG>TTG	p.L675L	LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Silent_p.L675L|LPHN2_uc001div.2_Silent_p.L675L|LPHN2_uc009wcd.2_Silent_p.L675L|LPHN2_uc001diw.2_Silent_p.L259L	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	688	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TAAATTTCCTCTGGGCATCAA	0.443													4	83	---	---	---	---	PASS
SYDE2	84144	broad.mit.edu	37	1	85624862	85624862	+	Silent	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85624862C>A	uc009wcm.2	-	7	3205	c.3156G>T	c.(3154-3156)CTG>CTT	p.L1052L		NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2	1052					activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)		TCTTCTGCCTCAGATAATTCA	0.378													9	102	---	---	---	---	PASS
GBP6	163351	broad.mit.edu	37	1	89844114	89844114	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89844114G>C	uc001dnf.2	+	5	841	c.567G>C	c.(565-567)TTG>TTC	p.L189F	GBP6_uc010ost.1_Missense_Mutation_p.L59F	NM_198460	NP_940862	Q6ZN66	GBP6_HUMAN	guanylate binding protein family, member 6	189							GTP binding|GTPase activity			ovary(2)	2		Lung NSC(277;0.0908)		all cancers(265;0.0108)|Epithelial(280;0.0398)		AGCTGAAGTTGAACGGTCACC	0.498													6	92	---	---	---	---	PASS
EPHX4	253152	broad.mit.edu	37	1	92508477	92508477	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92508477C>T	uc001don.2	+	3	519	c.415C>T	c.(415-417)CGA>TGA	p.R139*		NM_173567	NP_775838	Q8IUS5	EPHX4_HUMAN	abhydrolase domain containing 7	139						integral to membrane	hydrolase activity			central_nervous_system(1)	1						TCCCATTCATCGACAGAATTA	0.338													5	58	---	---	---	---	PASS
CCDC18	343099	broad.mit.edu	37	1	93683346	93683346	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93683346G>A	uc001dpq.2	+	14	2404	c.2236G>A	c.(2236-2238)GAG>AAG	p.E746K	CCDC18_uc009wdl.1_Intron	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41	627	Potential.									ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TACAGAGCATGAGAAAATTTG	0.269													4	49	---	---	---	---	PASS
SLC44A3	126969	broad.mit.edu	37	1	95290200	95290200	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95290200C>G	uc001dqv.3	+						SLC44A3_uc001dqx.3_Intron|SLC44A3_uc010otq.1_Intron|SLC44A3_uc010otr.1_Intron|SLC44A3_uc001dqw.3_Intron|SLC44A3_uc010ots.1_Intron|SLC44A3_uc009wds.2_Intron|SLC44A3_uc010ott.1_Intron|SLC44A3_uc010otu.1_5'Flank	NM_001114106	NP_001107578	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3 isoform 1							integral to membrane|plasma membrane	choline transmembrane transporter activity			kidney(1)	1		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	AAGTAAGTATCTAAATAAGTC	0.443													7	74	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109795141	109795141	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109795141C>T	uc001dxa.3	+	1	2501	c.2440C>T	c.(2440-2442)CAG>TAG	p.Q814*		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	814	Cadherin 6.|Extracellular (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CAATGCCCCTCAGTTCCTGCG	0.542													4	68	---	---	---	---	PASS
AMIGO1	57463	broad.mit.edu	37	1	110050944	110050944	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110050944C>T	uc001dxx.3	-	2	973	c.591G>A	c.(589-591)CTG>CTA	p.L197L		NM_020703	NP_065754	Q86WK6	AMGO1_HUMAN	AMIGO protein precursor	197	LRR 6.|Extracellular (Potential).				axonal fasciculation|heterophilic cell-cell adhesion|homophilic cell adhesion|myelination|positive regulation of axonogenesis	axon|integral to membrane				ovary(1)|breast(1)	2		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Colorectal(144;0.0129)|Lung(183;0.0182)|Epithelial(280;0.046)|all cancers(265;0.0492)|READ - Rectum adenocarcinoma(129;0.0689)|LUSC - Lung squamous cell carcinoma(189;0.227)		GCAAGTTCTTCAGCTTGTTAG	0.527													9	141	---	---	---	---	PASS
KCND3	3752	broad.mit.edu	37	1	112329586	112329586	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112329586C>G	uc001ebu.1	-	3	1729	c.1249G>C	c.(1249-1251)GAT>CAT	p.D417H	KCND3_uc001ebv.1_Missense_Mutation_p.D417H	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related	417	Cytoplasmic (Potential).					sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)		CTGCGTTTATCAGCTCTCTGA	0.572													6	51	---	---	---	---	PASS
KCND3	3752	broad.mit.edu	37	1	112525146	112525146	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112525146C>T	uc001ebu.1	-	2	683	c.203G>A	c.(202-204)AGC>AAC	p.S68N	KCND3_uc001ebv.1_Missense_Mutation_p.S68N	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related	68	Cytoplasmic (Potential).					sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)		CTTCTCCGTGCTGCCCAGCAG	0.612													4	61	---	---	---	---	PASS
MOV10	4343	broad.mit.edu	37	1	113236732	113236732	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113236732C>T	uc001eck.2	+	8	1503	c.1233C>T	c.(1231-1233)ATC>ATT	p.I411I	MOV10_uc001ecl.2_Silent_p.I411I|MOV10_uc001ecn.2_Silent_p.I411I|MOV10_uc001ecm.2_Silent_p.I351I|MOV10_uc009wgj.1_Silent_p.I351I	NM_001130079	NP_001123551	Q9HCE1	MOV10_HUMAN	Mov10, Moloney leukemia virus 10, homolog	411					mRNA cleavage involved in gene silencing by miRNA|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body	ATP binding|helicase activity|protein binding|RNA binding			ovary(4)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		AGGACCCCATCACATATAAGG	0.577													7	72	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113633937	113633937	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113633937C>G	uc001edf.1	+						LRIG2_uc009wgn.1_Intron	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like							cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TGTCCTCTTTCAGGGATTTCA	0.284													6	67	---	---	---	---	PASS
TRIM45	80263	broad.mit.edu	37	1	117663630	117663630	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117663630C>G	uc001egz.2	-	1	782	c.194G>C	c.(193-195)CGA>CCA	p.R65P	TRIM45_uc009whe.2_Missense_Mutation_p.R65P|TRIM45_uc001eha.2_Intron	NM_025188	NP_079464	Q9H8W5	TRI45_HUMAN	tripartite motif-containing 45 isoform 1	65	RING-type.					cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)	1	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		GTCTCCCCCTCGGATGTCCAC	0.537													4	75	---	---	---	---	PASS
MAN1A2	10905	broad.mit.edu	37	1	117911031	117911031	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117911031C>T	uc001ehd.1	+	1	947	c.226C>T	c.(226-228)CCA>TCA	p.P76S	MAN1A2_uc009whg.1_5'UTR	NM_006699	NP_006690	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	76	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity				0	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		TGTGTTAATTCCACATGTAGA	0.428													45	90	---	---	---	---	PASS
GDAP2	54834	broad.mit.edu	37	1	118429283	118429283	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118429283C>T	uc001ehf.2	-						GDAP2_uc001ehg.2_Intron	NM_017686	NP_060156	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated											ovary(2)	2		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		CACCTATAAACAGGAAATGTC	0.343													4	59	---	---	---	---	PASS
BCL9	607	broad.mit.edu	37	1	147090735	147090735	+	Silent	SNP	A	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147090735A>C	uc001epq.2	+	8	1514	c.774A>C	c.(772-774)CCA>CCC	p.P258P	BCL9_uc010ozr.1_Silent_p.P184P	NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	258	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)					AGCCAACTCCACCCATTCCGG	0.592			T	IGH@|IGL@	B-ALL								8	61	---	---	---	---	PASS
ANP32E	81611	broad.mit.edu	37	1	150203003	150203003	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150203003G>A	uc001etw.2	-	3	600	c.230C>T	c.(229-231)TCT>TTT	p.S77F	ANP32E_uc010pbu.1_Missense_Mutation_p.S29F|ANP32E_uc010pbv.1_Intron|ANP32E_uc001etv.3_Missense_Mutation_p.S77F|ANP32E_uc010pbw.1_Missense_Mutation_p.S77F	NM_030920	NP_112182	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32	77	LRR 3.					cytoplasmic membrane-bounded vesicle|nucleus	phosphatase inhibitor activity				0	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAAGCCTCCAGAAATTATATT	0.318													19	61	---	---	---	---	PASS
SNX27	81609	broad.mit.edu	37	1	151664974	151664974	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151664974G>C	uc001eyn.1	+	9	1319	c.1303G>C	c.(1303-1305)GAC>CAC	p.D435H	SNX27_uc001eyo.2_Missense_Mutation_p.D342H|SNX27_uc001eyp.2_Missense_Mutation_p.D249H	NM_030918	NP_112180	Q96L92	SNX27_HUMAN	sorting nexin family member 27	435					cell communication|protein transport|signal transduction	cytosol|early endosome	phosphatidylinositol binding|protein binding			ovary(2)|central_nervous_system(1)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTGTGCCTGTGACTCCAGGAG	0.438													7	62	---	---	---	---	PASS
RORC	6097	broad.mit.edu	37	1	151783893	151783893	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151783893C>G	uc001ezh.2	-	10	1411	c.1303G>C	c.(1303-1305)GAG>CAG	p.E435Q	RORC_uc001ezg.2_Missense_Mutation_p.E414Q|RORC_uc010pdo.1_Missense_Mutation_p.E489Q|RORC_uc010pdp.1_Missense_Mutation_p.E423Q	NM_005060	NP_005051	P51449	RORG_HUMAN	RAR-related orphan receptor C isoform a	435	Ligand-binding.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTCCTTTTCTCTTGGAGCCCT	0.493													5	22	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152281453	152281453	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152281453G>C	uc001ezu.1	-	3	5945	c.5909C>G	c.(5908-5910)TCT>TGT	p.S1970C		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1970	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGTCTGCAGAGTGCCCGTG	0.557									Ichthyosis				23	457	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152282510	152282510	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152282510G>T	uc001ezu.1	-	3	4888	c.4852C>A	c.(4852-4854)CAT>AAT	p.H1618N		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1618	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GATCCATAATGGTTTCTGGAA	0.562									Ichthyosis				15	172	---	---	---	---	PASS
S100A13	6284	broad.mit.edu	37	1	153591383	153591383	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153591383G>A	uc001fcf.3	-	3	444	c.285C>T	c.(283-285)ATC>ATT	p.I95I	S100A14_uc001fce.2_5'Flank|S100A13_uc001fcg.2_Silent_p.I95I|S100A13_uc009woh.2_Silent_p.I95I|S100A13_uc001fch.2_Silent_p.I95I|S100A13_uc001fci.2_Silent_p.I95I|S100A13_uc001fcj.2_Silent_p.I95I	NM_001024213	NP_001019384	Q99584	S10AD_HUMAN	S100 calcium binding protein A13	95					interleukin-1 alpha secretion|mast cell degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade	cytosol|extracellular space|nucleus|perinuclear region of cytoplasm	calcium ion binding|copper ion binding|fibroblast growth factor 1 binding|lipid binding|protein homodimerization activity|RAGE receptor binding|zinc ion binding				0	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Amlexanox(DB01025)	ACTTCTTCCTGATCTTCAGGT	0.522													6	159	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154098850	154098850	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154098850C>T	uc001fdw.2	-	10	1347	c.1275G>A	c.(1273-1275)CTG>CTA	p.L425L	NUP210L_uc009woq.2_5'UTR|NUP210L_uc010peh.1_Silent_p.L425L	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	425						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CACCATCTTTCAGGGCTTTTA	0.388													13	120	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154112352	154112352	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154112352C>G	uc001fdw.2	-	5	715	c.643G>C	c.(643-645)GAT>CAT	p.D215H	NUP210L_uc010peh.1_Missense_Mutation_p.D215H	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	215						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			AAAATCACATCTCCTTGTTTC	0.338													18	367	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	156916585	156916585	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156916585G>A	uc001fqo.2	-						ARHGEF11_uc010phu.1_Intron|ARHGEF11_uc001fqn.2_Intron	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11						actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCAAACTGAAGAGGCAGAATG	0.562													12	158	---	---	---	---	PASS
OR6K6	128371	broad.mit.edu	37	1	158724677	158724677	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158724677G>A	uc001fsw.1	+	1	72	c.72G>A	c.(70-72)CAG>CAA	p.Q24Q		NM_001005184	NP_001005184	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_hematologic(112;0.0378)					TGTGTTCACAGATGACACAGT	0.428													15	97	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158912082	158912082	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158912082G>C	uc001ftb.2	+	5	1140	c.895G>C	c.(895-897)GAG>CAG	p.E299Q	PYHIN1_uc001ftc.2_Missense_Mutation_p.E290Q|PYHIN1_uc001ftd.2_Missense_Mutation_p.E299Q|PYHIN1_uc001fte.2_Missense_Mutation_p.E290Q	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	299	HIN-200.				cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					CCAAACGTTTGAGGTTCCAAA	0.348													3	35	---	---	---	---	PASS
DARC	2532	broad.mit.edu	37	1	159175724	159175724	+	Silent	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159175724C>A	uc001fto.2	+	2	735	c.495C>A	c.(493-495)CTC>CTA	p.L165L	DARC_uc001ftp.3_Silent_p.L167L	NM_002036	NP_002027	Q16570	DUFFY_HUMAN	Duffy blood group antigen isoform b	165	Cytoplasmic (Potential).				defense response	integral to membrane|plasma membrane	C-C chemokine binding|chemokine receptor activity			ovary(1)|lung(1)	2	all_hematologic(112;0.0429)					TCCCAGGCCTCACCCTGGGGC	0.622													4	32	---	---	---	---	PASS
CRP	1401	broad.mit.edu	37	1	159683846	159683846	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159683846G>A	uc001ftw.2	-	2	248	c.144C>T	c.(142-144)CTC>CTT	p.L48L	CRP_uc001ftx.1_Silent_p.L48L|CRP_uc001fty.1_5'Flank	NM_000567	NP_000558	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related precursor	48	Pentaxin.				acute-phase response|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|opsonization		choline binding|Gram-positive bacterial cell surface binding|low-density lipoprotein particle binding|metal ion binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)				Atorvastatin(DB01076)|Bezafibrate(DB01393)	TGAAGGCTTTGAGAGGCTTCG	0.478													6	92	---	---	---	---	PASS
NCSTN	23385	broad.mit.edu	37	1	160319428	160319428	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160319428C>T	uc001fvx.2	+	4	528	c.404C>T	c.(403-405)TCT>TTT	p.S135F	NCSTN_uc009wtk.1_RNA|NCSTN_uc001fvy.2_Missense_Mutation_p.S115F|NCSTN_uc010pjf.1_Missense_Mutation_p.S135F|NCSTN_uc001fvz.2_5'Flank|NCSTN_uc010pjg.1_5'Flank	NM_015331	NP_056146	Q92542	NICA_HUMAN	nicastrin precursor	135	Extracellular (Potential).				amyloid precursor protein catabolic process|apoptosis|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity|protein processing	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane|melanosome	protein binding			ovary(1)|lung(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TCAGGCTTCTCTCCTAGTGTA	0.512													3	42	---	---	---	---	PASS
C1orf110	339512	broad.mit.edu	37	1	162824639	162824639	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162824639C>G	uc001gck.2	-	4	1000	c.825G>C	c.(823-825)GAG>GAC	p.E275D	C1orf110_uc009wuw.1_Intron|C1orf110_uc009wux.1_Missense_Mutation_p.E274D	NM_178550	NP_848645	Q86UF4	CA110_HUMAN	hypothetical protein LOC339512	275											0						GCCCAAATATCTCTCCAATGC	0.488													10	85	---	---	---	---	PASS
ILDR2	387597	broad.mit.edu	37	1	166891971	166891971	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166891971C>T	uc001gdx.1	-	8	1126	c.1070G>A	c.(1069-1071)AGA>AAA	p.R357K		NM_199351	NP_955383	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor	357	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1						CTGCTTGCTTCTCATCTGATG	0.542													28	113	---	---	---	---	PASS
C1orf9	51430	broad.mit.edu	37	1	172557994	172557994	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172557994G>T	uc001giq.3	+	18	2069	c.1753G>T	c.(1753-1755)GAA>TAA	p.E585*	C1orf9_uc010pmm.1_Nonsense_Mutation_p.E585*|C1orf9_uc009wwd.2_Nonsense_Mutation_p.E541*|C1orf9_uc010pmn.1_Nonsense_Mutation_p.E548*|C1orf9_uc010pmo.1_RNA	NM_014283	NP_055098	Q9UBS9	OSPT_HUMAN	chromosome 1 open reading frame 9 protein	585					multicellular organismal development|ossification	integral to membrane|rough endoplasmic reticulum membrane				ovary(2)	2		Breast(1374;0.212)		Colorectal(1306;3.98e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00544)		TCAAGAGGAGGAAGAGGAGGC	0.463													7	18	---	---	---	---	PASS
ZBTB37	84614	broad.mit.edu	37	1	173842618	173842618	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173842618G>A	uc009wwp.1	+	4	1213	c.937G>A	c.(937-939)GGC>AGC	p.G313S	ZBTB37_uc001gjp.1_Intron|ZBTB37_uc001gjq.3_Missense_Mutation_p.G313S|ZBTB37_uc001gjr.2_Missense_Mutation_p.G313S	NM_001122770	NP_001116242	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37 isoform	313					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TAGCCCCTCCGGCAGTGTTGT	0.483													6	42	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181708285	181708285	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181708285G>T	uc001gow.2	+	25	3780	c.3615G>T	c.(3613-3615)ATG>ATT	p.M1205I	CACNA1E_uc009wxs.2_Missense_Mutation_p.M1093I|CACNA1E_uc001gox.1_Missense_Mutation_p.M431I|CACNA1E_uc009wxt.2_Missense_Mutation_p.M431I	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	1205	III.|Helical; Name=S2 of repeat III.				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						TTCTGCAGATGATAGACCAAG	0.537													15	96	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181767715	181767715	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181767715C>T	uc001gow.2	+	47	6723	c.6558C>T	c.(6556-6558)TCC>TCT	p.S2186S	CACNA1E_uc009wxs.2_Silent_p.S2074S|CACNA1E_uc009wxt.2_Silent_p.S1455S	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	2229	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						GCTACATCTCCGAGCCCTACT	0.612													4	27	---	---	---	---	PASS
RGS13	6003	broad.mit.edu	37	1	192628603	192628603	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192628603G>C	uc001gsj.2	+	7	711	c.430G>C	c.(430-432)GAA>CAA	p.E144Q	RGS13_uc001gsk.2_Missense_Mutation_p.E144Q	NM_002927	NP_002918	O14921	RGS13_HUMAN	regulator of G-protein signalling 13	144	RGS.					plasma membrane	GTPase activator activity|signal transducer activity				0						TCTAAAGTCAGAAATGTACCA	0.353													4	41	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198668784	198668784	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198668784C>T	uc001gur.1	+	5	564	c.384C>T	c.(382-384)TCC>TCT	p.S128S	PTPRC_uc001gus.1_Silent_p.S128S|PTPRC_uc001gut.1_Intron|PTPRC_uc009wze.1_Silent_p.S64S|PTPRC_uc009wzf.1_Silent_p.S64S|PTPRC_uc010ppg.1_Silent_p.S64S|PTPRC_uc001guu.1_Silent_p.S171S|PTPRC_uc001guv.1_RNA|PTPRC_uc001guw.1_RNA	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	128	Extracellular (Potential).				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						TCAGCGGCTCCGCCGCCAATG	0.532											OREG0014061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	106	---	---	---	---	PASS
ELF3	1999	broad.mit.edu	37	1	201981202	201981202	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201981202G>A	uc001gxg.3	+	2	3473	c.281G>A	c.(280-282)CGA>CAA	p.R94Q	ELF3_uc001gxi.3_Missense_Mutation_p.R94Q|ELF3_uc001gxh.3_Missense_Mutation_p.R94Q	NM_004433	NP_004424	P78545	ELF3_HUMAN	E74-like factor 3 (ets domain transcription	94	PNT.				epidermis development|epithelial cell differentiation|inflammatory response|mammary gland involution|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0						GACTTCTCACGATGTGACATG	0.582													10	99	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	211263953	211263953	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211263953G>T	uc001hib.2	-	4	560	c.390C>A	c.(388-390)TTC>TTA	p.F130L	KCNH1_uc001hic.2_Missense_Mutation_p.F130L	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	130	PAC.|Cytoplasmic (Potential).				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TTATGTCACTGAAAGTGCAAA	0.343													4	63	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	211280693	211280693	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211280693G>A	uc001hib.2	-	2	276	c.106C>T	c.(106-108)CAG>TAG	p.Q36*	KCNH1_uc001hic.2_Nonsense_Mutation_p.Q36*	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	36	Cytoplasmic (Potential).|PAS.				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TCCACTATCTGAGCATTCCCC	0.403													7	72	---	---	---	---	PASS
PPP2R5A	5525	broad.mit.edu	37	1	212515594	212515594	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212515594G>A	uc001hjb.2	+	4	1119	c.545G>A	c.(544-546)CGA>CAA	p.R182Q	PPP2R5A_uc010ptd.1_Missense_Mutation_p.R123Q	NM_006243	NP_006234	Q15172	2A5A_HUMAN	protein phosphatase 2, regulatory subunit B	182					negative regulation of establishment of protein localization in plasma membrane|negative regulation of lipid kinase activity|positive regulation of protein dephosphorylation|signal transduction	chromosome, centromeric region|cytoplasm|nucleus|protein phosphatase type 2A complex	kinase binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0125)|all cancers(67;0.029)|Epithelial(68;0.154)|GBM - Glioblastoma multiforme(131;0.155)		ATTGCAAAACGATACATTGAT	0.318													7	67	---	---	---	---	PASS
CENPF	1063	broad.mit.edu	37	1	214816097	214816097	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214816097C>T	uc001hkm.2	+	12	4590	c.4416C>T	c.(4414-4416)CTC>CTT	p.L1472L		NM_016343	NP_057427	P49454	CENPF_HUMAN	centromere protein F	1568	1-2.|2 X 96 AA approximate tandem repeats.		Missing.		cell differentiation|cell division|cell proliferation|DNA replication|G2 phase of mitotic cell cycle|kinetochore assembly|metaphase plate congression|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|muscle organ development|negative regulation of transcription, DNA-dependent|protein transport|regulation of G2/M transition of mitotic cell cycle|regulation of striated muscle tissue development|response to drug	condensed chromosome outer kinetochore|cytosol|midbody|nuclear envelope|nuclear matrix|perinuclear region of cytoplasm|spindle pole	chromatin binding|dynein binding|protein C-terminus binding|protein homodimerization activity|transcription factor binding			ovary(6)|central_nervous_system(4)|large_intestine(2)|skin(1)	13				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGGAGGGGCTCGTTCCATCCC	0.473													12	28	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215807890	215807890	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215807890C>G	uc001hku.1	-	70	15595	c.15208G>C	c.(15208-15210)GAG>CAG	p.E5070Q		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	5070	Cytoplasmic (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATATATGGCTCTTTGTGGATT	0.438										HNSCC(13;0.011)			3	56	---	---	---	---	PASS
SPATA17	128153	broad.mit.edu	37	1	217842410	217842410	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217842410T>A	uc001hlh.1	+	4	302	c.276T>A	c.(274-276)AAT>AAA	p.N92K	SPATA17_uc009xdr.1_RNA|SPATA17_uc001hli.2_Missense_Mutation_p.N92K	NM_138796	NP_620151	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	92	IQ 3.					cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		ATCTCTACAATGCAATGGCTG	0.328													5	112	---	---	---	---	PASS
RAB3GAP2	25782	broad.mit.edu	37	1	220369645	220369645	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220369645G>C	uc010puk.1	-	10	1071	c.907C>G	c.(907-909)CAG>GAG	p.Q303E	RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_5'UTR	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic	303					intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		GTGATATACTGAGACATGGCA	0.383													24	70	---	---	---	---	PASS
RAB3GAP2	25782	broad.mit.edu	37	1	220384325	220384325	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220384325G>C	uc010puk.1	-	5	570	c.406C>G	c.(406-408)CTA>GTA	p.L136V	RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_5'UTR|RAB3GAP2_uc010pum.1_Missense_Mutation_p.L136V	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic	136					intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		GGGATACATAGAGCACTGGTT	0.308													4	35	---	---	---	---	PASS
MARK1	4139	broad.mit.edu	37	1	220835472	220835472	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220835472C>G	uc001hmn.3	+	18	2949	c.2352C>G	c.(2350-2352)AAC>AAG	p.N784K	MARK1_uc009xdw.2_Missense_Mutation_p.N785K|MARK1_uc010pun.1_Missense_Mutation_p.N769K|MARK1_uc001hmm.3_Missense_Mutation_p.N747K	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1	784	KA1.				intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)		CCTTTAAGAACATTGCATCAA	0.408													3	43	---	---	---	---	PASS
FBXO28	23219	broad.mit.edu	37	1	224345361	224345361	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224345361G>A	uc001hoh.2	+	5	1061	c.1020G>A	c.(1018-1020)CAG>CAA	p.Q340Q	FBXO28_uc009xef.2_3'UTR|FBXO28_uc010pvc.1_Silent_p.Q135Q	NM_015176	NP_055991	Q9NVF7	FBX28_HUMAN	F-box protein 28 isoform a	340										ovary(2)|kidney(2)|lung(1)	5	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)		GGTCCGGGCAGAATGAGGAGT	0.458													5	84	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228487765	228487765	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228487765C>G	uc009xez.1	+						OBSCN_uc001hsn.2_Intron|OBSCN_uc001hsq.1_Missense_Mutation_p.R1380G	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and						apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GCTGCAGATTCGTGGCCTGGT	0.577													15	49	---	---	---	---	PASS
KIAA1383	54627	broad.mit.edu	37	1	232943152	232943152	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232943152G>A	uc001hvh.2	+	1	2515	c.2383G>A	c.(2383-2385)GAT>AAT	p.D795N		NM_019090	NP_061963	Q9P2G4	K1383_HUMAN	hypothetical protein LOC54627	653										ovary(1)	1		all_cancers(173;0.00528)|Prostate(94;0.122)|all_epithelial(177;0.169)				TTTCCAACAGGATGCTGTTGT	0.373													7	78	---	---	---	---	PASS
PCNXL2	80003	broad.mit.edu	37	1	233394328	233394328	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233394328G>C	uc001hvl.2	-	5	1515	c.1280C>G	c.(1279-1281)TCA>TGA	p.S427*	PCNXL2_uc009xfu.2_RNA|PCNXL2_uc009xfv.1_RNA	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	427						integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				TACAGGAATTGAGATCTGCTC	0.577													9	116	---	---	---	---	PASS
TARBP1	6894	broad.mit.edu	37	1	234596009	234596009	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234596009G>A	uc001hwd.2	-	7	1533	c.1533C>T	c.(1531-1533)CTC>CTT	p.L511L		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	511					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TAAATTACCTGAGAGCAAGAA	0.378													5	59	---	---	---	---	PASS
LYST	1130	broad.mit.edu	37	1	235944340	235944340	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235944340G>C	uc001hxj.2	-	16	5214	c.5039C>G	c.(5038-5040)TCA>TGA	p.S1680*	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	1680					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GGCCTCTTGTGAACCAACCTT	0.343									Chediak-Higashi_syndrome				4	23	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236715311	236715311	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236715311C>G	uc001hyd.1	-	44	6459	c.6334G>C	c.(6334-6336)GAG>CAG	p.E2112Q	HEATR1_uc009xgh.1_Missense_Mutation_p.E1274Q	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	2112	HEAT.				rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TCCATCAACTCTGCTAAGAAA	0.353													5	128	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237796929	237796929	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237796929T>G	uc001hyl.1	+	43	6727	c.6607T>G	c.(6607-6609)TTC>GTC	p.F2203V		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2203	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCTCTGTTACTTCTGTCGTAT	0.378													5	133	---	---	---	---	PASS
WDR64	128025	broad.mit.edu	37	1	241886681	241886681	+	Silent	SNP	C	A	A	rs138786182		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241886681C>A	uc001hze.1	+	9	1314	c.1107C>A	c.(1105-1107)ATC>ATA	p.I369I	WDR64_uc001hzf.1_Silent_p.I89I			B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;	369	WD 4.									skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TGTTCAGTATCGCCGAGATCG	0.433													3	29	---	---	---	---	PASS
PLD5	200150	broad.mit.edu	37	1	242253408	242253408	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242253408A>C	uc001hzn.1	-	10	1486	c.1359T>G	c.(1357-1359)AAT>AAG	p.N453K	PLD5_uc001hzl.3_Missense_Mutation_p.N391K|PLD5_uc001hzm.3_Missense_Mutation_p.N243K|PLD5_uc001hzo.1_Missense_Mutation_p.N361K			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	453	PLD phosphodiesterase 2.					integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CCCAATCAAAATTTCCTGCAA	0.383													5	79	---	---	---	---	PASS
PLD5	200150	broad.mit.edu	37	1	242287829	242287829	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242287829C>G	uc001hzn.1	-	6	1001	c.874G>C	c.(874-876)GAC>CAC	p.D292H	PLD5_uc001hzl.3_Missense_Mutation_p.D230H|PLD5_uc001hzm.3_Missense_Mutation_p.D82H|PLD5_uc001hzo.1_Missense_Mutation_p.D200H			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	292						integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TTTTCATTGTCATAGACTCCA	0.383													4	61	---	---	---	---	PASS
SDCCAG8	10806	broad.mit.edu	37	1	243579062	243579062	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243579062C>T	uc001hzw.2	+	14	1831	c.1675C>T	c.(1675-1677)CAG>TAG	p.Q559*	SDCCAG8_uc010pyk.1_Nonsense_Mutation_p.Q414*|SDCCAG8_uc010pyl.1_Nonsense_Mutation_p.Q371*|SDCCAG8_uc001hzx.2_Intron	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	559	Mediates interaction with OFD1.|Gln-rich.|Potential.|Sufficient for homodimerization (By similarity).				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		CCAAGCCCTTCAGGCCCAGCA	0.483													9	28	---	---	---	---	PASS
OR2L2	26246	broad.mit.edu	37	1	248202316	248202316	+	Silent	SNP	C	T	T	rs12134979	by1000genomes	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248202316C>T	uc001idw.2	+	1	843	c.747C>T	c.(745-747)TTC>TTT	p.F249F	OR2L13_uc001ids.2_Intron	NM_001004686	NP_001004686	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L,	249	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TAGTGTCCTTCTACTATGCAC	0.512													19	67	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8919253	8919253	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8919253G>A	uc002qzc.2	-	19	2569	c.2387C>T	c.(2386-2388)TCA>TTA	p.S796L	KIDINS220_uc010yiv.1_Missense_Mutation_p.S562L|KIDINS220_uc002qzd.2_Missense_Mutation_p.S754L|KIDINS220_uc010yiw.1_Missense_Mutation_p.S797L	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	796	KAP NTPase.|Cytoplasmic (Potential).				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CGGGCCTTTTGAAAACAGAAC	0.363													6	94	---	---	---	---	PASS
ODC1	4953	broad.mit.edu	37	2	10583644	10583644	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10583644G>C	uc010exg.1	-	7	1072	c.638C>G	c.(637-639)TCT>TGT	p.S213C	ODC1_uc002ran.1_5'Flank|ODC1_uc002rao.1_Missense_Mutation_p.S213C|ODC1_uc010yjd.1_Missense_Mutation_p.S83C	NM_002539	NP_002530	P11926	DCOR_HUMAN	ornithine decarboxylase 1	213					polyamine biosynthetic process|regulation of cellular amino acid metabolic process|response to virus	cytosol	ornithine decarboxylase activity|protein binding			ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Pyridoxal Phosphate(DB00114)|Spermine(DB00127)	GCGGGCATCAGAGATTGCCTG	0.463													9	103	---	---	---	---	PASS
ASXL2	55252	broad.mit.edu	37	2	25966752	25966752	+	Silent	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25966752G>C	uc002rgs.2	-	12	2675	c.2454C>G	c.(2452-2454)GTC>GTG	p.V818V	ASXL2_uc002rgt.1_Silent_p.V558V	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	818					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTGGATGGCTGACAGAGGCCA	0.522													11	200	---	---	---	---	PASS
CIB4	130106	broad.mit.edu	37	2	26863411	26863411	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26863411C>T	uc002rhm.2	-	2	108	c.79G>A	c.(79-81)GAA>AAA	p.E27K		NM_001029881	NP_001025052	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4	27							calcium ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACAGAATTTCATTTCTGGTC	0.562													8	136	---	---	---	---	PASS
EIF2B4	8890	broad.mit.edu	37	2	27590321	27590321	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27590321C>T	uc002rkb.2	-						EIF2B4_uc002rjz.2_Intron|EIF2B4_uc002rka.2_Intron|EIF2B4_uc002rkc.2_Intron|EIF2B4_uc002rkd.2_Intron|EIF2B4_uc002rke.2_Intron|EIF2B4_uc002rkf.1_3'UTR	NM_001034116	NP_001029288	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B,						myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	translation initiation factor activity|translation initiation factor binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCATACTCATCACCTCCTCTT	0.483													5	56	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27804955	27804955	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27804955G>A	uc002rkz.3	+	1	5567	c.5516G>A	c.(5515-5517)CGT>CAT	p.R1839H	ZNF512_uc010ylv.1_5'Flank|ZNF512_uc010ylw.1_5'Flank|ZNF512_uc002rlb.2_5'Flank|ZNF512_uc010ylx.1_5'Flank|ZNF512_uc002rlc.2_5'Flank|ZNF512_uc002rla.2_5'Flank|ZNF512_uc010yly.1_5'Flank|ZNF512_uc010ylz.1_5'Flank	NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	1839	27 X 8 AA approximative tandem repeat of P-S-E-R-S-H-H-S.|Arg-rich.									large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					AGGAGCCATCGTAGGATTTCT	0.557													10	64	---	---	---	---	PASS
PPP1CB	5500	broad.mit.edu	37	2	29004594	29004594	+	Intron	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29004594C>A	uc002rmg.2	+						PPP1CB_uc010ymj.1_Intron|PPP1CB_uc010ymk.1_Intron|PPP1CB_uc010yml.1_Intron|PPP1CB_uc002rmh.2_Intron|SPDYA_uc002rmi.2_5'Flank	NM_206876	NP_996759	P62140	PP1B_HUMAN	protein phosphatase 1, catalytic subunit, beta						cell cycle|cell division|glycogen metabolic process|triglyceride catabolic process	MLL5-L complex|nucleolus|PTW/PP1 phosphatase complex	metal ion binding|myosin phosphatase activity|myosin-light-chain-phosphatase activity|protein binding			skin(1)	1	Acute lymphoblastic leukemia(172;0.155)					TCTATCTGTTCTTTTTACAGG	0.313													11	45	---	---	---	---	PASS
FAM179A	165186	broad.mit.edu	37	2	29245120	29245120	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29245120C>G	uc010ezl.2	+	11	1808	c.1457C>G	c.(1456-1458)TCG>TGG	p.S486W	FAM179A_uc010ymm.1_Missense_Mutation_p.S431W|FAM179A_uc002rmr.3_Missense_Mutation_p.S13W	NM_199280	NP_954974	Q6ZUX3	F179A_HUMAN	hypothetical protein LOC165186	486							binding			ovary(3)|skin(1)	4						AGGCCTTTCTCGAACCCGGAG	0.572													8	48	---	---	---	---	PASS
C2orf71	388939	broad.mit.edu	37	2	29295854	29295854	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29295854C>T	uc002rmt.1	-	1	1274	c.1274G>A	c.(1273-1275)CGA>CAA	p.R425Q		NM_001029883	NP_001025054	A6NGG8	CB071_HUMAN	hypothetical protein LOC388939	425					response to stimulus|visual perception	photoreceptor outer segment				skin(1)	1						GTCCTGTGCTCGTGGCTGAAC	0.572													5	63	---	---	---	---	PASS
ALK	238	broad.mit.edu	37	2	29419650	29419650	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29419650C>T	uc002rmy.2	-	28	5057	c.4150G>A	c.(4150-4152)GAA>AAA	p.E1384K	ALK_uc010ymo.1_Missense_Mutation_p.E316K	NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	1384	Protein kinase.|Cytoplasmic (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	GTGCAGTATTCAATCCTCTCC	0.383			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome		OREG0014526	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	68	---	---	---	---	PASS
CRIM1	51232	broad.mit.edu	37	2	36704113	36704113	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36704113G>A	uc002rpd.2	+	6	1112	c.1073G>A	c.(1072-1074)CGA>CAA	p.R358Q		NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN	cysteine-rich motor neuron 1 precursor	358	VWFC 1.|Extracellular (Potential).				nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				CGGTTCTGTCGATGCCAAGGG	0.483													8	112	---	---	---	---	PASS
CHAC2	494143	broad.mit.edu	37	2	54001579	54001579	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54001579G>A	uc002rxk.1	+	3	567	c.472G>A	c.(472-474)GAA>AAA	p.E158K	ASB3_uc002rxg.1_Intron|ASB3_uc002rxh.1_Intron|ASB3_uc002rxi.3_Intron|ASB3_uc010yoo.1_Intron	NM_001008708	NP_001008708	Q8WUX2	CHAC2_HUMAN	ChaC, cation transport regulator-like 2	158											0			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CCTTGTGCCAGAAGAAGCAGA	0.353													4	71	---	---	---	---	PASS
RTN4	57142	broad.mit.edu	37	2	55253920	55253920	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55253920C>G	uc002rye.2	-	3	1613	c.1315G>C	c.(1315-1317)GAG>CAG	p.E439Q	RTN4_uc002ryd.2_Missense_Mutation_p.E233Q|RTN4_uc002ryf.2_Intron|RTN4_uc002ryg.2_Intron	NM_020532	NP_065393	Q9NQC3	RTN4_HUMAN	reticulon 4 isoform A	439	Cytoplasmic (Potential).				apoptosis|axonal fasciculation|cerebral cortex radial glia guided migration|endoplasmic reticulum tubular network organization|negative regulation of anti-apoptosis|negative regulation of axon extension|nerve growth factor receptor signaling pathway|regulation of apoptosis|regulation of branching morphogenesis of a nerve|regulation of cell migration	integral to endoplasmic reticulum membrane|nuclear envelope|plasma membrane	protein binding			ovary(2)|large_intestine(1)	3						TTACTACTCTCACTATCTTTT	0.413													9	166	---	---	---	---	PASS
MTIF2	4528	broad.mit.edu	37	2	55481852	55481852	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55481852C>T	uc002ryn.2	-	7	1178	c.441G>A	c.(439-441)ATG>ATA	p.M147I	MTIF2_uc010yox.1_5'UTR|MTIF2_uc002ryo.2_Missense_Mutation_p.M147I	NM_001005369	NP_001005369	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	147					regulation of translational initiation	mitochondrion	GTP binding|GTPase activity|ribosomal small subunit binding|translation initiation factor activity			ovary(1)	1						ACTTTAACTTCATCCCTGCCT	0.363													6	71	---	---	---	---	PASS
PCYOX1	51449	broad.mit.edu	37	2	70504273	70504273	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70504273C>G	uc002sgn.3	+	6	1333	c.1267C>G	c.(1267-1269)CTG>GTG	p.L423V	PCYOX1_uc010fdo.2_Missense_Mutation_p.L346V|PCYOX1_uc010yqu.1_Missense_Mutation_p.L405V	NM_016297	NP_057381	Q9UHG3	PCYOX_HUMAN	prenylcysteine oxidase 1 precursor	423					prenylated protein catabolic process	lysosome|very-low-density lipoprotein particle	prenylcysteine oxidase activity			central_nervous_system(1)	1						AAAGCTCTTTCTGTCCTATGA	0.403													11	57	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73717868	73717868	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73717868G>C	uc002sje.1	+	12	8896	c.8785G>C	c.(8785-8787)GAA>CAA	p.E2929Q	ALMS1_uc002sjf.1_Missense_Mutation_p.E2885Q|ALMS1_uc002sjg.2_Missense_Mutation_p.E2315Q|ALMS1_uc002sjh.1_Missense_Mutation_p.E2315Q	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2927					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						TGAACAACGAGAACTCTTTGA	0.443													6	212	---	---	---	---	PASS
TET3	200424	broad.mit.edu	37	2	74273447	74273447	+	5'Flank	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74273447C>A	uc002skb.3	+						TET3_uc010fez.1_5'Flank	NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3								metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						TGTTCCAGGTCAGATGGACTC	0.542													4	57	---	---	---	---	PASS
REG3A	5068	broad.mit.edu	37	2	79386522	79386522	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79386522G>A	uc002sod.1	-	1	265	c.10C>T	c.(10-12)CCC>TCC	p.P4S	REG3A_uc002soe.1_Missense_Mutation_p.P4S|REG3A_uc002sof.1_Missense_Mutation_p.P4S	NM_138938	NP_620355	Q06141	REG3A_HUMAN	pancreatitis-associated protein precursor	4					acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding			skin(1)	1						AGGGCCATGGGAGGCAGCATA	0.532													4	37	---	---	---	---	PASS
POLR1A	25885	broad.mit.edu	37	2	86270138	86270138	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86270138C>G	uc002sqs.2	-	23	3695	c.3316G>C	c.(3316-3318)GAG>CAG	p.E1106Q	POLR1A_uc010ytb.1_Missense_Mutation_p.E472Q|POLR1A_uc002sqt.1_Missense_Mutation_p.E129Q	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	1106					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						TTTTCACTCTCAAGTTTCAGG	0.527													5	92	---	---	---	---	PASS
KDM3A	55818	broad.mit.edu	37	2	86716633	86716633	+	Intron	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86716633C>A	uc002sri.3	+						KDM3A_uc010ytj.1_Intron|KDM3A_uc010ytk.1_Intron	NM_018433	NP_060903	Q9Y4C1	KDM3A_HUMAN	jumonji domain containing 1A						androgen receptor signaling pathway|cell differentiation|formaldehyde biosynthetic process|histone H3-K9 demethylation|hormone-mediated signaling pathway|positive regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	cytoplasm|nucleus	androgen receptor binding|iron ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5						GCTTTCTCTTCTTGCTCTAGA	0.463													4	37	---	---	---	---	PASS
ASTL	431705	broad.mit.edu	37	2	96803339	96803339	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96803339G>C	uc010yui.1	-	2	156	c.156C>G	c.(154-156)GAC>GAG	p.D52E		NM_001002036	NP_001002036	Q6HA08	ASTL_HUMAN	astacin-like metalloendopeptidase precursor	52					proteolysis		metalloendopeptidase activity|zinc ion binding				0						GAATGTCCTTGTCCCCGGAGG	0.597													20	101	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96948946	96948946	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96948946G>A	uc002svu.2	-	34	4994	c.4908C>T	c.(4906-4908)TTC>TTT	p.F1636F	SNRNP200_uc002svt.2_Silent_p.F246F|SNRNP200_uc010yuj.1_RNA|SNRNP200_uc002svv.1_Silent_p.F163F	NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	1636	Helicase C-terminal 2.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						TACCTGAGCTGAAGAGCTGCT	0.572													7	76	---	---	---	---	PASS
LONRF2	164832	broad.mit.edu	37	2	100915696	100915696	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100915696G>A	uc002tal.3	-	6	1993	c.1353C>T	c.(1351-1353)CTC>CTT	p.L451L	LONRF2_uc010yvs.1_Intron	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	451	RING-type.|TPR 6.				proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2						ACCTCATGCAGAGGGCACACT	0.428													4	25	---	---	---	---	PASS
RNF149	284996	broad.mit.edu	37	2	101905511	101905511	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101905511C>T	uc002taz.1	-	4	889	c.787G>A	c.(787-789)GAT>AAT	p.D263N	RNF149_uc002tax.1_RNA	NM_173647	NP_775918	Q8NC42	RN149_HUMAN	ring finger protein 149 precursor	263						integral to membrane	ligase activity|zinc ion binding			ovary(1)|breast(1)	2						GCATCAACATCAATTCCCTGT	0.328													3	32	---	---	---	---	PASS
MERTK	10461	broad.mit.edu	37	2	112776983	112776983	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112776983C>T	uc002thk.1	+						MERTK_uc002thl.1_Intron	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor						cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						TTTCCTCTATCATCTAGCATA	0.398													13	172	---	---	---	---	PASS
PTPN4	5775	broad.mit.edu	37	2	120658344	120658344	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120658344G>A	uc002tmf.1	+	10	1497	c.726G>A	c.(724-726)CTG>CTA	p.L242L	PTPN4_uc010flj.1_5'UTR	NM_002830	NP_002821	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type	242	FERM.					cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity			ovary(2)	2					Alendronate(DB00630)	GAGGAATTCTGATTTATAAGA	0.274													14	64	---	---	---	---	PASS
CLASP1	23332	broad.mit.edu	37	2	122273342	122273342	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122273342G>C	uc002tnc.2	-						CLASP1_uc010yyy.1_Intron|CLASP1_uc010yyz.1_Intron|CLASP1_uc010yza.1_Intron|CLASP1_uc010yzb.1_Intron|CLASP1_uc010yzc.1_Intron|CLASP1_uc002tng.1_Intron	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1						axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					CTCGAACCTAGATATAAAAGA	0.448													4	22	---	---	---	---	PASS
IWS1	55677	broad.mit.edu	37	2	128262290	128262290	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128262290G>A	uc002ton.2	-	3	1492	c.1189C>T	c.(1189-1191)CTT>TTT	p.L397F	IWS1_uc010yzl.1_RNA|uc002too.1_5'Flank|IWS1_uc010fma.2_RNA	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog	397	Glu-rich.				transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CTATCAGAAAGCACAGCAGCT	0.398													29	174	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128394377	128394377	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128394377C>G	uc002top.2	+	46	6191	c.6138C>G	c.(6136-6138)CTC>CTG	p.L2046L	MYO7B_uc002tos.1_Silent_p.L156L|MYO7B_uc002tot.2_Silent_p.L156L	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	2046	FERM 2.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AGGACCTGCTCACCACCTATC	0.667													6	57	---	---	---	---	PASS
YSK4	80122	broad.mit.edu	37	2	135756556	135756556	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135756556G>A	uc002tue.1	-	5	357	c.326C>T	c.(325-327)TCA>TTA	p.S109L	YSK4_uc010fne.1_Missense_Mutation_p.S81L|YSK4_uc002tuf.1_Missense_Mutation_p.S109L|YSK4_uc010fnc.1_Missense_Mutation_p.S109L|YSK4_uc010fnd.1_Intron|YSK4_uc010zbg.1_Missense_Mutation_p.S109L|YSK4_uc002tui.3_Missense_Mutation_p.S126L	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	109							ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		TTGAAGCGATGAGTTTATCAG	0.443													16	54	---	---	---	---	PASS
SPOPL	339745	broad.mit.edu	37	2	139326585	139326585	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139326585C>T	uc002tvh.2	+	11	1514	c.1114C>T	c.(1114-1116)CGA>TGA	p.R372*		NM_001001664	NP_001001664	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	372						nucleus				skin(2)|breast(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0296)		AGAAGCCTTTCGAGCACTAGC	0.423													39	223	---	---	---	---	PASS
STAM2	10254	broad.mit.edu	37	2	152982735	152982735	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152982735C>T	uc002tyc.3	-						STAM2_uc010foa.1_Missense_Mutation_p.S395N	NM_005843	NP_005834	O75886	STAM2_HUMAN	signal transducing adaptor molecule 2						cellular membrane organization|endosome transport|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway	cytosol|early endosome membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.22)		AAAAAACATGCTCACCTGCAT	0.343													3	15	---	---	---	---	PASS
CCDC148	130940	broad.mit.edu	37	2	159166127	159166127	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159166127G>A	uc002tzq.2	-	9	1191	c.928C>T	c.(928-930)CAA>TAA	p.Q310*	CCDC148_uc002tzr.2_Nonsense_Mutation_p.Q158*|CCDC148_uc010foh.2_Nonsense_Mutation_p.Q23*|CCDC148_uc010foi.1_Nonsense_Mutation_p.Q257*|CCDC148_uc010foj.1_Nonsense_Mutation_p.Q158*|CCDC148_uc010fok.1_Nonsense_Mutation_p.Q224*	NM_138803	NP_620158	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	310										ovary(2)	2						AAGCGATATTGGTCACAATAT	0.338													8	39	---	---	---	---	PASS
RBMS1	5937	broad.mit.edu	37	2	161143486	161143486	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161143486C>G	uc002ubo.2	-	7	1194	c.750G>C	c.(748-750)GTG>GTC	p.V250V	RBMS1_uc002ubj.2_Intron|RBMS1_uc002ubk.2_Intron|RBMS1_uc002ubl.2_Intron|RBMS1_uc002ubn.2_Intron|RBMS1_uc002ubi.3_Intron|RBMS1_uc002ubm.2_Silent_p.V217V|RBMS1_uc002ubp.2_Silent_p.V250V|RBMS1_uc010fox.2_Silent_p.V250V	NM_016836	NP_058520	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting	250					DNA replication|RNA processing	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding|single-stranded DNA binding				0						TTACAAGTCTCACCTCTCCTT	0.443													10	134	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166245843	166245843	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166245843G>A	uc002udc.2	+	27	5817	c.5527G>A	c.(5527-5529)GAT>AAT	p.D1843N	SCN2A_uc002udd.2_Missense_Mutation_p.D1843N|SCN2A_uc002ude.2_Missense_Mutation_p.D1843N	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	1843					myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	CATTGCCATGGATCTGCCCAT	0.473													7	69	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178534241	178534241	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178534241C>G	uc002ulq.2	-	18	2860	c.2542G>C	c.(2542-2544)GAG>CAG	p.E848Q	PDE11A_uc010zfd.1_Missense_Mutation_p.E39Q|PDE11A_uc002ulp.2_Missense_Mutation_p.E404Q|PDE11A_uc002ulr.2_Missense_Mutation_p.E598Q|PDE11A_uc002uls.1_Missense_Mutation_p.E490Q|PDE11A_uc002ult.1_Missense_Mutation_p.E598Q|PDE11A_uc002ulu.1_Missense_Mutation_p.E490Q	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	848	Catalytic (By similarity).				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			AGTTTGAGCTCTAATCTCTCC	0.338									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				4	77	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179425302	179425302	+	Silent	SNP	A	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179425302A>G	uc010zfg.1	-	275	78077	c.77853T>C	c.(77851-77853)AAT>AAC	p.N25951N	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.N19646N|TTN_uc010zfi.1_Silent_p.N19579N|TTN_uc010zfj.1_Silent_p.N19454N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26878							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATATATATTCATTGCCTTTGA	0.383													8	27	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179465713	179465713	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179465713C>A	uc010zfg.1	-	237	48438	c.48214G>T	c.(48214-48216)GAA>TAA	p.E16072*	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.E9767*|TTN_uc010zfi.1_Nonsense_Mutation_p.E9700*|TTN_uc010zfj.1_Nonsense_Mutation_p.E9575*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16999							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCAGTTCTTCCACATCACGC	0.502													5	95	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179466088	179466088	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179466088C>T	uc010zfg.1	-	236	48156	c.47932G>A	c.(47932-47934)GAA>AAA	p.E15978K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E9673K|TTN_uc010zfi.1_Missense_Mutation_p.E9606K|TTN_uc010zfj.1_Missense_Mutation_p.E9481K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16905							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATTGCTGTTCAGAGAGGAGA	0.463													4	32	---	---	---	---	PASS
NCKAP1	10787	broad.mit.edu	37	2	183866922	183866922	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183866922G>A	uc002upc.2	-	5	847	c.445C>T	c.(445-447)CGA>TGA	p.R149*	NCKAP1_uc002upb.2_Nonsense_Mutation_p.R155*	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1	149					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TCTTCAATTCGAGACAGCAGT	0.308													4	78	---	---	---	---	PASS
MSTN	2660	broad.mit.edu	37	2	190924810	190924810	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190924810G>A	uc002urp.2	-	2	858	c.725C>T	c.(724-726)CCA>CTA	p.P242L		NM_005259	NP_005250	O14793	GDF8_HUMAN	myostatin precursor	242					muscle organ development|positive regulation of transcription, DNA-dependent	extracellular space	cytokine activity|growth factor activity			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			TCCTGGTCCTGGGAAGGTTAC	0.343													6	62	---	---	---	---	PASS
STAT4	6775	broad.mit.edu	37	2	191931242	191931242	+	Splice_Site	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191931242C>T	uc002usm.1	-	7	799	c.545_splice	c.e7-1	p.D182_splice	STAT4_uc002usn.1_Splice_Site_p.D182_splice|STAT4_uc010zgk.1_Splice_Site_p.D27_splice|STAT4_uc002uso.2_Splice_Site_p.D182_splice	NM_003151	NP_003142	Q14765	STAT4_HUMAN	signal transducer and activator of transcription						JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			TCACTCTGATCTGCAAAGGTA	0.423													4	25	---	---	---	---	PASS
CYP20A1	57404	broad.mit.edu	37	2	204161618	204161618	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204161618C>G	uc002uzv.3	+	13	1998	c.1376C>G	c.(1375-1377)TCA>TGA	p.S459*	CYP20A1_uc002uzx.3_Nonsense_Mutation_p.S357*|CYP20A1_uc010zif.1_Nonsense_Mutation_p.S467*|CYP20A1_uc002uzy.3_Nonsense_Mutation_p.S357*|CYP20A1_uc002uzw.3_RNA|CYP20A1_uc010ftw.2_Nonsense_Mutation_p.S189*	NM_177538	NP_803882	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A,	459						integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0						ATCACTGTCTCAAAGAGATAT	0.318													6	40	---	---	---	---	PASS
FAM119A	151194	broad.mit.edu	37	2	208477992	208477992	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208477992G>C	uc002vcf.2	-	4	595	c.435C>G	c.(433-435)ATC>ATG	p.I145M	FAM119A_uc002vce.2_Intron|FAM119A_uc010fuk.1_Missense_Mutation_p.I145M|FAM119A_uc002vcg.3_Missense_Mutation_p.I145M	NM_145280	NP_660323	Q8WXB1	MT21A_HUMAN	hypothetical protein LOC151194	145						integral to membrane	methyltransferase activity				0				LUSC - Lung squamous cell carcinoma(261;0.0705)|Epithelial(149;0.131)|Lung(261;0.135)		CTAAATATATGATATCAGCAC	0.388													7	71	---	---	---	---	PASS
IKZF2	22807	broad.mit.edu	37	2	213872482	213872482	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213872482C>A	uc002vem.2	-	8	1352	c.1183G>T	c.(1183-1185)GAA>TAA	p.E395*	IKZF2_uc010fuu.2_Nonsense_Mutation_p.E250*|IKZF2_uc002vej.2_Nonsense_Mutation_p.E342*|IKZF2_uc002vek.2_RNA|IKZF2_uc010fuv.2_Nonsense_Mutation_p.E321*|IKZF2_uc002vel.2_Nonsense_Mutation_p.E316*|IKZF2_uc010fuw.2_Nonsense_Mutation_p.E169*|IKZF2_uc010fux.2_Nonsense_Mutation_p.E169*|IKZF2_uc010fuy.2_Nonsense_Mutation_p.E323*|IKZF2_uc002ven.2_Nonsense_Mutation_p.E369*|IKZF2_uc002vei.2_Nonsense_Mutation_p.E173*	NM_016260	NP_057344	Q9UKS7	IKZF2_HUMAN	helios isoform 1	395					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		GCCTCTCTTTCCTGGGGTCGA	0.498													11	72	---	---	---	---	PASS
USP37	57695	broad.mit.edu	37	2	219362850	219362850	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219362850C>T	uc002vie.2	-	12	1509	c.1056G>A	c.(1054-1056)ATG>ATA	p.M352I	USP37_uc010fvs.1_Missense_Mutation_p.M352I|USP37_uc010zkf.1_Missense_Mutation_p.M352I|USP37_uc002vif.2_Missense_Mutation_p.M352I|USP37_uc002vig.2_Missense_Mutation_p.M280I	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	352					ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		GAATAGCATTCATATAGCAGG	0.343													10	39	---	---	---	---	PASS
CCDC108	255101	broad.mit.edu	37	2	219894307	219894307	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219894307C>G	uc002vjl.1	-	11	1552	c.1468G>C	c.(1468-1470)GAG>CAG	p.E490Q	CCDC108_uc010fwa.1_5'UTR|CCDC108_uc010zkp.1_Missense_Mutation_p.E479Q|CCDC108_uc010zkq.1_Missense_Mutation_p.E425Q	NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1	490						integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GATTGGTTCTCAATCCACAGG	0.597											OREG0015211	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	46	---	---	---	---	PASS
ALPI	248	broad.mit.edu	37	2	233322739	233322739	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233322739G>C	uc002vst.3	+	8	965	c.888G>C	c.(886-888)GAG>GAC	p.E296D	ALPI_uc002vsu.3_Missense_Mutation_p.E207D	NM_001631	NP_001622	P09923	PPBI_HUMAN	intestinal alkaline phosphatase precursor	296					phosphorylation	anchored to membrane|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding|protein binding			central_nervous_system(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CGAAATATGAGATCCACCGAG	0.612													3	38	---	---	---	---	PASS
PRR21	643905	broad.mit.edu	37	2	240981423	240981423	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240981423G>A	uc010zod.1	-	1	977	c.977C>T	c.(976-978)TCA>TTA	p.S326L		NM_001080835	NP_001074304	Q8WXC7	PRR21_HUMAN	proline rich 21	326										ovary(1)|skin(1)	2						AGACGTGGATGAAGAGGCATG	0.587													11	93	---	---	---	---	PASS
GADL1	339896	broad.mit.edu	37	3	30891495	30891495	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30891495G>C	uc003cep.2	-	6	691	c.644C>G	c.(643-645)TCT>TGT	p.S215C	GADL1_uc003ceq.1_Missense_Mutation_p.S215C	NM_207359	NP_997242	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	215					carboxylic acid metabolic process		carboxy-lyase activity|pyridoxal phosphate binding				0					Pyridoxal Phosphate(DB00114)	TACCTCTGCAGATGTGAAAAG	0.333													4	54	---	---	---	---	PASS
MLH1	4292	broad.mit.edu	37	3	37089136	37089136	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37089136G>A	uc003cgl.2	+	16	1918	c.1858G>A	c.(1858-1860)GAG>AAG	p.E620K	MLH1_uc011aye.1_Missense_Mutation_p.E379K|MLH1_uc011ayb.1_Missense_Mutation_p.E379K|MLH1_uc010hge.2_Missense_Mutation_p.E620K|MLH1_uc003cgn.3_Missense_Mutation_p.E379K|MLH1_uc011ayc.1_Missense_Mutation_p.E522K|MLH1_uc011ayd.1_Missense_Mutation_p.E379K|MLH1_uc003cgo.2_Missense_Mutation_p.E379K|MLH1_uc010hgk.2_Intron|MLH1_uc010hgn.2_Intron|MLH1_uc010hgm.2_Intron|MLH1_uc010hgo.2_Intron|MLH1_uc010hgp.2_Missense_Mutation_p.E34K|MLH1_uc010hgq.2_Intron	NM_000249	NP_000240	P40692	MLH1_HUMAN	MutL protein homolog 1	620	Interaction with EXO1.				mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding	p.0?(1)		large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|breast(3)|prostate(3)|skin(2)|NS(1)	77						GAAGAAGGCTGAGATGCTTGC	0.383		1	D|Mis|N|F|S		colorectal|endometrial|ovarian|CNS	colorectal|endometrial|ovarian|CNS		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				13	155	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38991858	38991858	+	5'UTR	SNP	A	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38991858A>C	uc011ays.1	-	1						NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha						response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	ATCCATCTTCACCCTCAGGAC	0.512													10	29	---	---	---	---	PASS
WDR48	57599	broad.mit.edu	37	3	39125682	39125682	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39125682G>A	uc003cit.2	+	12	1220	c.1210G>A	c.(1210-1212)GAA>AAA	p.E404K	WDR48_uc011ayt.1_Missense_Mutation_p.E395K|WDR48_uc011ayu.1_Missense_Mutation_p.E322K|WDR48_uc011ayv.1_Missense_Mutation_p.E129K|WDR48_uc003ciu.2_RNA	NM_020839	NP_065890	Q8TAF3	WDR48_HUMAN	WD repeat domain 48	404					interspecies interaction between organisms|protein deubiquitination	lysosome|nucleus	protein binding			ovary(1)|breast(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		AGTGGATTTTGAAGATGAAAT	0.313													9	45	---	---	---	---	PASS
CTNNB1	1499	broad.mit.edu	37	3	41275108	41275108	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41275108C>G	uc010hia.1	+	10	1430	c.1274C>G	c.(1273-1275)TCT>TGT	p.S425C	CTNNB1_uc003ckp.2_Missense_Mutation_p.S425C|CTNNB1_uc003ckq.2_Missense_Mutation_p.S425C|CTNNB1_uc003ckr.2_Missense_Mutation_p.S425C|CTNNB1_uc011azf.1_Missense_Mutation_p.S418C|CTNNB1_uc011azg.1_Missense_Mutation_p.S353C|CTNNB1_uc003cks.2_Missense_Mutation_p.S28C|CTNNB1_uc003ckt.1_5'Flank	NM_001904	NP_001895	P35222	CTNB1_HUMAN	beta-catenin	425	ARM 7.				adherens junction assembly|androgen receptor signaling pathway|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway involved in negative regulation of apoptosis|canonical Wnt receptor signaling pathway involved in positive regulation of epithelial to mesenchymal transition|cell-cell adhesion|cell-matrix adhesion|cellular component disassembly involved in apoptosis|cellular response to growth factor stimulus|cellular response to indole-3-methanol|central nervous system vasculogenesis|cytoskeletal anchoring at plasma membrane|determination of dorsal/ventral asymmetry|dorsal/ventral axis specification|ectoderm development|embryonic axis specification|embryonic foregut morphogenesis|embryonic leg joint morphogenesis|endodermal cell fate commitment|endothelial tube morphogenesis|epithelial to mesenchymal transition|gastrulation with mouth forming second|glial cell fate determination|hair follicle morphogenesis|hair follicle placode formation|hindbrain development|liver development|lung cell differentiation|lung induction|lung-associated mesenchyme development|male genitalia development|mesenchymal cell proliferation involved in lung development|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of osteoclast differentiation|negative regulation of transcription from RNA polymerase II promoter|nephron tubule formation|odontogenesis of dentine-containing tooth|oocyte development|pancreas development|positive regulation of anti-apoptosis|positive regulation of apoptosis|positive regulation of branching involved in lung morphogenesis|positive regulation of epithelial cell proliferation involved in prostate gland development|positive regulation of fibroblast growth factor receptor signaling pathway|positive regulation of heparan sulfate proteoglycan biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of MAPKKK cascade|positive regulation of muscle cell differentiation|positive regulation of osteoblast differentiation|positive regulation of transcription from RNA polymerase II promoter|protein localization at cell surface|proximal/distal pattern formation|regulation of angiogenesis|regulation of calcium ion import|regulation of centriole-centriole cohesion|regulation of centromeric sister chromatid cohesion|regulation of fibroblast proliferation|regulation of nephron tubule epithelial cell differentiation|regulation of protein localization at cell surface|regulation of smooth muscle cell proliferation|regulation of T cell proliferation|renal inner medulla development|renal outer medulla development|renal vesicle formation|response to drug|response to estradiol stimulus|Schwann cell proliferation|smooth muscle cell differentiation|synapse organization|synaptic vesicle transport|T cell differentiation in thymus|thymus development|trachea formation	APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin-TCF7L2 complex|catenin complex|cell cortex|cell-substrate adherens junction|centrosome|dendritic shaft|desmosome|fascia adherens|internal side of plasma membrane|lamellipodium|lateral plasma membrane|microvillus membrane|perinuclear region of cytoplasm|protein-DNA complex|synapse|transcription factor complex|Z disc|zonula adherens	alpha-catenin binding|androgen receptor binding|cadherin binding|estrogen receptor binding|I-SMAD binding|ion channel binding|protein binding|protein C-terminus binding|protein kinase binding|protein phosphatase binding|R-SMAD binding|RPTP-like protein binding|signal transducer activity|specific RNA polymerase II transcription factor activity|structural molecule activity|transcription coactivator activity|transcription regulatory region DNA binding		CTNNB1/PLAG1(60)	liver(806)|soft_tissue(609)|large_intestine(243)|endometrium(222)|kidney(172)|stomach(157)|central_nervous_system(139)|ovary(104)|skin(97)|pancreas(91)|adrenal_gland(85)|pituitary(81)|salivary_gland(62)|haematopoietic_and_lymphoid_tissue(57)|thyroid(55)|biliary_tract(41)|lung(38)|prostate(24)|bone(20)|small_intestine(17)|cervix(9)|parathyroid(9)|urinary_tract(8)|breast(7)|oesophagus(5)|NS(3)|pleura(2)|upper_aerodigestive_tract(2)|eye(1)	3166				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)	Lithium(DB01356)	GGAATTCTTTCTAACCTCACT	0.463		15	H|Mis|T	PLAG1	colorectal|cvarian| hepatoblastoma|others|pleomorphic salivary adenoma				Pilomatrixoma_Familial_Clustering_of				9	137	---	---	---	---	PASS
ALS2CL	259173	broad.mit.edu	37	3	46716160	46716160	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46716160G>A	uc003cqa.1	-	21	2515	c.2325C>T	c.(2323-2325)CTC>CTT	p.L775L	ALS2CL_uc003cpx.1_Silent_p.L122L|ALS2CL_uc003cpy.1_RNA|ALS2CL_uc003cpz.1_Silent_p.L290L|ALS2CL_uc003cqb.1_Silent_p.L775L|ALS2CL_uc003cqc.1_RNA	NM_147129	NP_667340	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like isoform 1	775					endosome organization|regulation of Rho protein signal transduction		GTPase activator activity|identical protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)|central_nervous_system(2)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GCAGCAGGTAGAGCGTGAAGA	0.572													11	46	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48675652	48675652	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48675652C>G	uc003cul.2	-	35	10206	c.9925G>C	c.(9925-9927)GAG>CAG	p.E3309Q	CELSR3_uc003cuf.1_Intron|SLC26A6_uc003cuh.2_5'Flank|SLC26A6_uc010hke.2_5'Flank|SLC26A6_uc003cuk.2_5'Flank|SLC26A6_uc003cui.2_5'Flank|SLC26A6_uc003cuj.2_5'Flank|SLC26A6_uc011bbp.1_5'Flank|CELSR3_uc010hkf.2_Missense_Mutation_p.E599Q|CELSR3_uc010hkg.2_Missense_Mutation_p.E1292Q	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	3309	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GAGTGACCCTCACTTCTGGGA	0.607													4	42	---	---	---	---	PASS
AMT	275	broad.mit.edu	37	3	49459014	49459014	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49459014G>C	uc003cww.2	-						AMT_uc011bcn.1_Intron|AMT_uc003cwx.2_Intron|AMT_uc011bco.1_Intron|AMT_uc003cwy.2_Intron|AMT_uc011bcp.1_Intron|AMT_uc011bcq.1_Intron	NM_000481	NP_000472	P48728	GCST_HUMAN	aminomethyltransferase isoform 1 precursor						glycine catabolic process	mitochondrion	aminomethyltransferase activity|transaminase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	GTCTGGGGAAGAGATTGAAAG	0.522													10	43	---	---	---	---	PASS
RASSF1	11186	broad.mit.edu	37	3	50369054	50369054	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50369054C>G	uc003dad.1	-	4	839	c.708G>C	c.(706-708)AAG>AAC	p.K236N	RASSF1_uc003daa.1_Missense_Mutation_p.K81N|RASSF1_uc003dab.1_Missense_Mutation_p.K162N|RASSF1_uc003dac.2_Missense_Mutation_p.K81N|RASSF1_uc003dae.1_Missense_Mutation_p.K232N|RASSF1_uc010hlk.1_RNA|RASSF1_uc003daf.1_Missense_Mutation_p.K81N	NM_170714	NP_733832	Q9NS23	RASF1_HUMAN	Ras association domain family 1 isoform D	236	Ras-associating.				cell cycle arrest|negative regulation of cell cycle arrest|positive regulation of protein ubiquitination|protein stabilization|Ras protein signal transduction|response to DNA damage stimulus	microtubule|microtubule cytoskeleton|microtubule organizing center|nucleus|spindle pole	identical protein binding|protein binding|protein N-terminus binding|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000278)|OV - Ovarian serous cystadenocarcinoma(275;0.0015)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CCACCAAGAACTTTCGCAGCA	0.602													27	72	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52437766	52437766	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52437766G>C	uc003ddx.2	-	13	1510	c.1395C>G	c.(1393-1395)ATC>ATG	p.I465M	BAP1_uc003ddw.2_RNA|BAP1_uc010hmg.2_RNA|BAP1_uc010hmh.2_Intron	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	465					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TGCTAGTCTTGATGGACAGAG	0.587			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								3	47	---	---	---	---	PASS
SEMA3G	56920	broad.mit.edu	37	3	52475701	52475701	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52475701C>T	uc003dea.1	-	6	556	c.556G>A	c.(556-558)GAG>AAG	p.E186K		NM_020163	NP_064548	Q9NS98	SEM3G_HUMAN	semaphorin sem2 precursor	186	Sema.				multicellular organismal development	extracellular region|membrane	receptor activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		GTGTACAGCTCCCCGTCTGGG	0.657													4	40	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52582226	52582226	+	Silent	SNP	C	T	T	rs138449080	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52582226C>T	uc003des.2	-	30	4935	c.4923G>A	c.(4921-4923)TCG>TCA	p.S1641S	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Silent_p.S1534S|PBRM1_uc003der.2_Silent_p.S1554S|PBRM1_uc003det.2_Silent_p.S1549S|PBRM1_uc003deu.2_Silent_p.S1604S|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Silent_p.S1586S|PBRM1_uc010hmk.1_Silent_p.S1561S|PBRM1_uc003dey.2_Silent_p.S1534S	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1641					chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CCTGTTCTTTCGACAAATGGA	0.488			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								12	84	---	---	---	---	PASS
HESX1	8820	broad.mit.edu	37	3	57232436	57232436	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57232436C>G	uc003din.3	-	3	776	c.442G>C	c.(442-444)GAG>CAG	p.E148Q		NM_003865	NP_003856	Q9UBX0	HESX1_HUMAN	HESX homeobox 1	148	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0109)|Kidney(284;0.0126)		CTGTCTTCCTCTAGATTCAAT	0.269													3	32	---	---	---	---	PASS
GABRR3	200959	broad.mit.edu	37	3	97744425	97744425	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97744425C>G	uc011bgr.1	-	2	224	c.224G>C	c.(223-225)AGA>ACA	p.R75T		NM_001105580	NP_001099050	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 3	75	Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity				0						AAATCCAGGTCTCATTGCGAA	0.383													3	42	---	---	---	---	PASS
TBC1D23	55773	broad.mit.edu	37	3	99979910	99979910	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99979910C>T	uc003dtt.2	+	1	225	c.48C>T	c.(46-48)GAC>GAT	p.D16D	TBC1D23_uc003dts.2_Silent_p.D16D	NM_018309	NP_060779	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	16						intracellular	Rab GTPase activator activity			ovary(1)|liver(1)	2						CGAGCGGCGACGGCTGGTGAG	0.597													6	109	---	---	---	---	PASS
RG9MTD1	54931	broad.mit.edu	37	3	101283864	101283864	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101283864C>T	uc003duz.2	+	2	387	c.239C>T	c.(238-240)TCA>TTA	p.S80L		NM_017819	NP_060289	Q7L0Y3	MRRP1_HUMAN	RNA (guanine-9-) methyltransferase domain	80					tRNA processing	mitochondrion	methyltransferase activity|protein binding			ovary(1)	1						GAATGTGTTTCAACAATCTCA	0.418													17	129	---	---	---	---	PASS
CD47	961	broad.mit.edu	37	3	107769437	107769437	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107769437C>T	uc003dwt.1	-	9	1102	c.922G>A	c.(922-924)GAA>AAA	p.E308K	CD47_uc003dwu.1_Missense_Mutation_p.E308K|CD47_uc003dwv.1_Intron|CD47_uc003dww.1_Intron	NM_001777	NP_001768	Q08722	CD47_HUMAN	CD47 antigen isoform 1 precursor	308	Cytoplasmic (Potential).				blood coagulation|cell adhesion|cell junction assembly|integrin-mediated signaling pathway|leukocyte migration|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to plasma membrane	protein binding|thrombospondin receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			TTAAGGGGTTCCTCTACAGCT	0.279													5	45	---	---	---	---	PASS
SLC9A10	285335	broad.mit.edu	37	3	111886195	111886195	+	Splice_Site	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111886195C>G	uc003dyu.2	-	26	3460	c.3238_splice	c.e26-1	p.I1080_splice	SLC9A10_uc011bhu.1_Splice_Site_p.I343_splice|SLC9A10_uc010hqc.2_Splice_Site_p.I1032_splice	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger						cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						TACTTTGTATCTGAAAGTTGA	0.308													4	22	---	---	---	---	PASS
SIDT1	54847	broad.mit.edu	37	3	113286512	113286512	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113286512C>G	uc003eak.2	+	3	1121	c.470C>G	c.(469-471)GCT>GGT	p.A157G	SIDT1_uc011bif.1_RNA|SIDT1_uc003eaj.1_Missense_Mutation_p.A157G|SIDT1_uc011big.1_5'UTR	NM_017699	NP_060169	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1 precursor	157	Extracellular (Potential).					integral to membrane				ovary(3)|pancreas(1)|skin(1)	5						CCCCTGGGTGCTCAGTACAAA	0.517													13	172	---	---	---	---	PASS
SIDT1	54847	broad.mit.edu	37	3	113345002	113345002	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113345002C>G	uc003eak.2	+	24	3012	c.2361C>G	c.(2359-2361)TTC>TTG	p.F787L	SIDT1_uc011big.1_Missense_Mutation_p.F540L|SIDT1_uc011bii.1_Missense_Mutation_p.F240L	NM_017699	NP_060169	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1 precursor	787	Extracellular (Potential).					integral to membrane				ovary(3)|pancreas(1)|skin(1)	5						TGCTGGATTTCTTCGATGACC	0.488													6	133	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119120821	119120821	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119120821G>A	uc003ecj.3	+	10	1754	c.1222G>A	c.(1222-1224)GAG>AAG	p.E408K		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	408					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						TCCCGGGGCTGAGGGTGGCTT	0.637													8	59	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121409792	121409792	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121409792G>C	uc003eei.3	-	14	8530	c.8404C>G	c.(8404-8406)CAC>GAC	p.H2802D	GOLGB1_uc010hrc.2_Missense_Mutation_p.H2807D|GOLGB1_uc003eej.3_Missense_Mutation_p.H2768D	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2802	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		TTCTCAAGGTGAGACAAGCTA	0.423													4	69	---	---	---	---	PASS
CD86	942	broad.mit.edu	37	3	121822379	121822379	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121822379C>G	uc003eet.2	+	3	201	c.85C>G	c.(85-87)CAA>GAA	p.Q29E	CD86_uc011bjo.1_5'UTR|CD86_uc011bjp.1_Intron|CD86_uc003eeu.2_Missense_Mutation_p.Q23E	NM_175862	NP_787058	P42081	CD86_HUMAN	CD86 antigen isoform 1	29	Extracellular (Potential).				interspecies interaction between organisms|positive regulation of cell proliferation|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of lymphotoxin A biosynthetic process|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation		coreceptor activity|protein binding			pancreas(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)	TCTGAAGATTCAAGCTTATTT	0.418													7	70	---	---	---	---	PASS
KPNA1	3836	broad.mit.edu	37	3	122156070	122156070	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122156070C>T	uc003efd.1	-	11	1105	c.1069G>A	c.(1069-1071)GAA>AAA	p.E357K	KPNA1_uc003efb.1_Missense_Mutation_p.E156K|KPNA1_uc003efc.1_Missense_Mutation_p.E156K|KPNA1_uc011bjr.1_Missense_Mutation_p.E156K|KPNA1_uc010hrh.2_Missense_Mutation_p.E156K|KPNA1_uc003efe.2_Missense_Mutation_p.E357K	NM_002264	NP_002255	P52294	IMA1_HUMAN	karyopherin alpha 1	357	Binding to RAG1.|NLS binding site (minor) (By similarity).|ARM 7.				DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|regulation of DNA recombination|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein binding|protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.0898)		CAACATGCTTCCTTTTTGATA	0.353													6	107	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124374457	124374457	+	Silent	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124374457G>C	uc003ehg.2	+	39	5929	c.5802G>C	c.(5800-5802)CTG>CTC	p.L1934L	KALRN_uc003ehi.2_Silent_p.L275L|KALRN_uc003ehk.2_Silent_p.L237L|KALRN_uc011bjz.1_Silent_p.L26L	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	1933	DH 2.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						GGTTTGTCCTGAATGAGCTGG	0.458													7	107	---	---	---	---	PASS
ROPN1B	152015	broad.mit.edu	37	3	125690976	125690976	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125690976C>T	uc003eih.2	+	2	307	c.79C>T	c.(79-81)CGG>TGG	p.R27W	ROPN1B_uc010hsb.2_Missense_Mutation_p.R27W|ROPN1B_uc011bkg.1_Missense_Mutation_p.R27W	NM_001012337	NP_001012337	Q9BZX4	ROP1B_HUMAN	ropporin, rhophilin associated protein 1B	27	RIIa.				acrosome reaction|cell-cell adhesion|cytokinesis|fusion of sperm to egg plasma membrane|Rho protein signal transduction|sperm motility|spermatogenesis	cytoplasm|flagellum	cAMP-dependent protein kinase regulator activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling complex scaffold activity				0				GBM - Glioblastoma multiforme(114;0.151)		AGCCGCCATTCGGGCGCAGCC	0.577													4	63	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130284200	130284200	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130284200C>T	uc010htl.2	+	3	1055	c.1024C>T	c.(1024-1026)CGA>TGA	p.R342*		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	342	Nonhelical region.|VWFA 2.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						GGTGACCCACCGAGATTCAGA	0.557													45	153	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134920383	134920383	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134920383A>C	uc003eqt.2	+	12	2418	c.2198A>C	c.(2197-2199)AAG>ACG	p.K733T	EPHB1_uc003equ.2_Missense_Mutation_p.K294T	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	733	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						GCTGGCATGAAGTACCTGGCT	0.522													6	231	---	---	---	---	PASS
PPP2R3A	5523	broad.mit.edu	37	3	135801160	135801160	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135801160C>G	uc003eqv.1	+	8	3250	c.2685C>G	c.(2683-2685)TTC>TTG	p.F895L	PPP2R3A_uc011blz.1_Missense_Mutation_p.F159L|PPP2R3A_uc003eqw.1_Missense_Mutation_p.F274L|PPP2R3A_uc011bma.1_RNA	NM_002718	NP_002709	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'',	895					protein dephosphorylation	protein phosphatase type 2A complex	calcium ion binding|protein binding|protein phosphatase type 2A regulator activity			ovary(3)|pancreas(1)|lung(1)|breast(1)|skin(1)	7						CAGATTACTTCTCCTATGAAC	0.348													3	74	---	---	---	---	PASS
STAG1	10274	broad.mit.edu	37	3	136141645	136141645	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136141645C>G	uc003era.1	-	18	2090	c.1798G>C	c.(1798-1800)GAT>CAT	p.D600H	STAG1_uc003erb.1_Missense_Mutation_p.D600H|STAG1_uc003erc.1_Missense_Mutation_p.D374H|STAG1_uc010hua.1_Missense_Mutation_p.D463H	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1	600					cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2						ATTTCTAAATCAAAATACTGT	0.313													4	47	---	---	---	---	PASS
MRPS22	56945	broad.mit.edu	37	3	139065764	139065764	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139065764G>A	uc003etb.2	+	2	225	c.217G>A	c.(217-219)GAG>AAG	p.E73K	MRPS22_uc003etc.2_RNA|MRPS22_uc003etd.2_Missense_Mutation_p.E72K|MRPS22_uc003ete.2_Missense_Mutation_p.E32K	NM_020191	NP_064576	P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	73						mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(2)|skin(1)	3						ATTTATGGATGAGGAAGTTCA	0.388													11	80	---	---	---	---	PASS
ZBTB38	253461	broad.mit.edu	37	3	141162891	141162891	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141162891G>A	uc003etw.2	+	8	2643	c.1661G>A	c.(1660-1662)GGA>GAA	p.G554E	ZBTB38_uc010hun.2_Missense_Mutation_p.G551E|ZBTB38_uc010huo.2_Missense_Mutation_p.G554E|ZBTB38_uc003ety.2_Missense_Mutation_p.G554E|ZBTB38_uc010hup.2_Missense_Mutation_p.G555E	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	554					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						ACAGCAAATGGAGGCTTGAAG	0.378													17	63	---	---	---	---	PASS
CPA3	1359	broad.mit.edu	37	3	148596449	148596449	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148596449G>C	uc003ewm.2	+	5	440	c.388G>C	c.(388-390)GAA>CAA	p.E130Q		NM_001870	NP_001861	P15088	CBPA3_HUMAN	carboxypeptidase A3 precursor	130					proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding			breast(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			GGCTTGGACTGAAAAGATGAT	0.284													7	88	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	149700572	149700572	+	IGR	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149700572C>T								PFN2 (11831 upstream) : TSC22D2 (426216 downstream)																							GTAGTGCCTTCGGTACAACCT	0.522													5	127	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151164846	151164846	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151164846G>C	uc011bod.1	-	4	2923	c.2923C>G	c.(2923-2925)CAA>GAA	p.Q975E		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	975					cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTAAGTATTTGAGTAGTGTGA	0.418													4	134	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151166292	151166292	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151166292C>T	uc011bod.1	-	4	1477	c.1477G>A	c.(1477-1479)GTT>ATT	p.V493I		NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	493	Ig-like C2-type 1.				cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTCAGGCCAACGGTTCCACCT	0.493													8	192	---	---	---	---	PASS
AADACL2	344752	broad.mit.edu	37	3	151458487	151458487	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151458487G>A	uc003ezc.2	+	2	312	c.192G>A	c.(190-192)ATG>ATA	p.M64I	AADACL2_uc010hvn.2_Intron	NM_207365	NP_997248	Q6P093	ADCL2_HUMAN	arylacetamide deacetylase-like 2 precursor	64						extracellular region|integral to membrane	carboxylesterase activity				0			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TTATATCCATGATATTCAGGC	0.294													9	54	---	---	---	---	PASS
LRRC34	151827	broad.mit.edu	37	3	169511578	169511578	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169511578C>T	uc003ffx.2	-	10	1120	c.1105G>A	c.(1105-1107)GAT>AAT	p.D369N	LRRC34_uc003ffy.2_Missense_Mutation_p.D401N|LRRC34_uc011bpn.1_3'UTR|LRRC34_uc003ffz.2_Missense_Mutation_p.D353N|LRRC34_uc003fga.3_3'UTR	NM_153353	NP_699184	Q8IZ02	LRC34_HUMAN	leucine rich repeat containing 34	369											0	all_cancers(22;4.12e-22)|all_epithelial(15;7.54e-27)|all_lung(20;1.63e-16)|Lung NSC(18;6.92e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			GGCTCCACATCTGTATTGTCT	0.323													6	43	---	---	---	---	PASS
FNDC3B	64778	broad.mit.edu	37	3	171969135	171969135	+	Silent	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171969135C>A	uc003fhy.2	+	6	766	c.594C>A	c.(592-594)CGC>CGA	p.R198R	FNDC3B_uc003fhz.3_Silent_p.R198R|FNDC3B_uc003fia.2_Silent_p.R129R	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	198						endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TGAAAGACCGCCAGATCGATC	0.458													13	34	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			12	45	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178938934	178938934	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178938934G>A	uc003fjk.2	+	14	2333	c.2176G>A	c.(2176-2178)GAA>AAA	p.E726K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	726					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E726K(2)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GAAGAAGGATGAAACACAAAA	0.363		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			6	46	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	183027494	183027494	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183027494G>A	uc003fli.1	-						MCF2L2_uc003flj.1_Intron|MCF2L2_uc003flp.1_Intron	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor						regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			AAAAATGTCAGAAAGCAAACC	0.463													6	111	---	---	---	---	PASS
CAMK2N2	94032	broad.mit.edu	37	3	183977945	183977945	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183977945C>T	uc003fnj.1	-	2	418	c.240G>A	c.(238-240)TAG>TAA	p.*80*	ECE2_uc003fni.3_Intron	NM_033259	NP_150284	Q96S95	CK2N2_HUMAN	CaM-KII inhibitory protein	80						cytosol|nucleus	protein kinase inhibitor activity				0	all_cancers(143;1.09e-10)|Ovarian(172;0.0339)		Epithelial(37;2.51e-33)|OV - Ovarian serous cystadenocarcinoma(80;5.69e-22)			gccggcgcgTCTACACTCCGG	0.328													7	17	---	---	---	---	PASS
ECE2	9718	broad.mit.edu	37	3	183996310	183996310	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183996310C>T	uc003fni.3	+	7	1173	c.1135C>T	c.(1135-1137)CGG>TGG	p.R379W	ECE2_uc011brg.1_Missense_Mutation_p.R307W|ECE2_uc011brh.1_Missense_Mutation_p.R232W|ECE2_uc003fnl.3_Missense_Mutation_p.R307W|ECE2_uc003fnm.3_Missense_Mutation_p.R261W|ECE2_uc003fnk.3_Missense_Mutation_p.R232W|ECE2_uc011bri.1_Missense_Mutation_p.R294W|ECE2_uc010hxv.2_Intron	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	379	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCTGCCCTCTCGGGATTACTA	0.552													14	95	---	---	---	---	PASS
EIF4G1	1981	broad.mit.edu	37	3	184049281	184049281	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184049281G>A	uc003fnp.2	+	30	4480	c.4282G>A	c.(4282-4284)GAG>AAG	p.E1428K	EIF4G1_uc003fnt.2_Missense_Mutation_p.E1139K|EIF4G1_uc003fnq.2_Missense_Mutation_p.E1341K|EIF4G1_uc003fnr.2_Missense_Mutation_p.E1264K|EIF4G1_uc010hxx.2_Missense_Mutation_p.E1435K|EIF4G1_uc003fns.2_Missense_Mutation_p.E1388K|EIF4G1_uc010hxy.2_Missense_Mutation_p.E1435K|EIF4G1_uc003fnv.3_Missense_Mutation_p.E1429K|EIF4G1_uc003fnu.3_Missense_Mutation_p.E1428K|EIF4G1_uc003fnw.2_Missense_Mutation_p.E1435K|EIF4G1_uc003fnx.2_Missense_Mutation_p.E1233K|EIF4G1_uc003fny.3_Missense_Mutation_p.E1232K|EIF4G1_uc003foa.2_Missense_Mutation_p.E100K	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	1428					insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TACCCTGGGAGAGGAGTCGGA	0.577													16	221	---	---	---	---	PASS
THPO	7066	broad.mit.edu	37	3	184090793	184090793	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184090793G>A	uc003fol.1	-	6	785	c.570C>T	c.(568-570)CTC>CTT	p.L190L	THPO_uc003fom.1_Silent_p.L186L|THPO_uc003fon.2_Intron|THPO_uc011bro.1_Intron|THPO_uc003fop.2_Intron|THPO_uc011brp.1_Intron|THPO_uc011brq.1_Intron|THPO_uc003for.1_Intron|THPO_uc003fos.1_Intron	NM_000460	NP_000451	P40225	TPO_HUMAN	thrombopoietin precursor	190					cell proliferation|platelet activation	extracellular space	cytokine activity|growth factor activity|hormone activity			ovary(1)	1	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CGTTCAGTGTGAGGACTAGAG	0.577													9	67	---	---	---	---	PASS
MAGEF1	64110	broad.mit.edu	37	3	184429339	184429339	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184429339C>G	uc003fpa.2	-	1	498	c.271G>C	c.(271-273)GAC>CAC	p.D91H		NM_022149	NP_071432	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1	91	MAGE.									ovary(1)	1	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			TTCTTCTTGTCTTTCACCAGG	0.587													12	146	---	---	---	---	PASS
DNAJB11	51726	broad.mit.edu	37	3	186303135	186303135	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186303135A>G	uc003fqi.2	+	10	1235	c.1015A>G	c.(1015-1017)ATC>GTC	p.I339V		NM_016306	NP_057390	Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	339					protein folding	endoplasmic reticulum lumen	heat shock protein binding			ovary(1)|lung(1)	2	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		TTCTTCAGGTATCAAACAGCT	0.328													8	59	---	---	---	---	PASS
TP63	8626	broad.mit.edu	37	3	189586422	189586422	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189586422G>C	uc003fry.2	+	8	1135	c.1046G>C	c.(1045-1047)GGA>GCA	p.G349A	TP63_uc003frx.2_Missense_Mutation_p.G349A|TP63_uc003frz.2_Missense_Mutation_p.G349A|TP63_uc010hzc.1_Missense_Mutation_p.G349A|TP63_uc003fsa.2_Missense_Mutation_p.G255A|TP63_uc003fsb.2_Missense_Mutation_p.G255A|TP63_uc003fsc.2_Missense_Mutation_p.G255A|TP63_uc003fsd.2_Missense_Mutation_p.G255A|TP63_uc010hzd.1_Missense_Mutation_p.G170A|TP63_uc003fse.1_Missense_Mutation_p.G230A	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1	349					anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		GCTTGCCCAGGAAGAGACAGG	0.488									Hay-Wells_syndrome	HNSCC(45;0.13)			7	65	---	---	---	---	PASS
C3orf43	255798	broad.mit.edu	37	3	196236422	196236422	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196236422C>T	uc003fws.2	-	2	326	c.169G>A	c.(169-171)GAT>AAT	p.D57N	C3orf43_uc003fwr.2_Missense_Mutation_p.D49N	NM_001077657	NP_001071125	Q147U7	CC043_HUMAN	hypothetical protein LOC255798	57						integral to membrane				ovary(1)	1	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;2.13e-23)|all cancers(36;2e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00298)		CACATCTCATCTTGGGCTGCT	0.448													4	50	---	---	---	---	PASS
DLG1	1739	broad.mit.edu	37	3	196863488	196863488	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196863488G>C	uc003fxo.3	-	11	1234	c.1044C>G	c.(1042-1044)ATC>ATG	p.I348M	DLG1_uc011bub.1_Missense_Mutation_p.I232M|DLG1_uc011buc.1_Missense_Mutation_p.I232M|DLG1_uc011bud.1_Missense_Mutation_p.I31M|DLG1_uc003fxn.3_Missense_Mutation_p.I348M|DLG1_uc011bue.1_Missense_Mutation_p.I315M|DLG1_uc010ial.2_Missense_Mutation_p.I348M|DLG1_uc011buf.1_RNA|DLG1_uc003fxp.2_RNA|DLG1_uc010iam.1_Missense_Mutation_p.I315M|DLG1_uc010ian.2_Missense_Mutation_p.I215M	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1	348	PDZ 2.				actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TGGTTACATAGATGCTATTAT	0.363													7	148	---	---	---	---	PASS
DLG1	1739	broad.mit.edu	37	3	196863557	196863557	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196863557G>A	uc003fxo.3	-						DLG1_uc011bub.1_Intron|DLG1_uc011buc.1_Intron|DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron|DLG1_uc011buf.1_Intron|DLG1_uc003fxp.2_Intron|DLG1_uc010iam.1_Intron|DLG1_uc010ian.2_Intron	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		GACCTGTTTGGAAAACAGTTC	0.358													7	90	---	---	---	---	PASS
KIAA0232	9778	broad.mit.edu	37	4	6873338	6873338	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6873338G>C	uc003gjr.3	+	8	4302	c.3839G>C	c.(3838-3840)AGA>ACA	p.R1280T	KIAA0232_uc003gjq.3_Missense_Mutation_p.R1280T	NM_014743	NP_055558	Q92628	K0232_HUMAN	hypothetical protein LOC9778	1280							ATP binding			ovary(2)	2						GGAATGAATAGAAGTCAAGAA	0.348													4	72	---	---	---	---	PASS
TBC1D14	57533	broad.mit.edu	37	4	6995933	6995933	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6995933G>A	uc011bwg.1	+	4	945	c.866G>A	c.(865-867)AGA>AAA	p.R289K	TBC1D14_uc003gjs.3_Missense_Mutation_p.R289K|TBC1D14_uc010idh.2_Missense_Mutation_p.R9K	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a	289						intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						aaggctggaagacctagCAAG	0.308													10	52	---	---	---	---	PASS
ZNF518B	85460	broad.mit.edu	37	4	10445489	10445489	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10445489C>G	uc003gmn.2	-	3	2951	c.2464G>C	c.(2464-2466)GAC>CAC	p.D822H		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	822					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4						GGCTGTAAGTCTGAGTCCGCC	0.463													4	86	---	---	---	---	PASS
ZNF518B	85460	broad.mit.edu	37	4	10445539	10445539	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10445539C>G	uc003gmn.2	-	3	2901	c.2414G>C	c.(2413-2415)AGA>ACA	p.R805T		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	805					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4						TATTAACTGTCTTTCACTGCA	0.463													5	74	---	---	---	---	PASS
LDB2	9079	broad.mit.edu	37	4	16504353	16504353	+	Silent	SNP	C	T	T	rs150164147		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16504353C>T	uc003goz.2	-	8	1351	c.1035G>A	c.(1033-1035)GCG>GCA	p.A345A	LDB2_uc003gpa.2_3'UTR|LDB2_uc003gpb.2_Silent_p.A343A|LDB2_uc011bxh.1_Silent_p.A317A|LDB2_uc010iee.2_3'UTR|LDB2_uc003goy.2_Silent_p.A220A|LDB2_uc011bxi.1_3'UTR	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a	345							LIM domain binding|transcription cofactor activity				0						TGTTCCCCAGCGCGGGTGAAT	0.537													9	163	---	---	---	---	PASS
RBPJ	3516	broad.mit.edu	37	4	26407808	26407808	+	Missense_Mutation	SNP	G	A	A	rs141690523		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26407808G>A	uc003grx.1	+	4	346	c.110G>A	c.(109-111)CGA>CAA	p.R37Q	RBPJ_uc003gry.1_Missense_Mutation_p.R22Q|RBPJ_uc003grz.1_Missense_Mutation_p.R37Q|RBPJ_uc011bxt.1_Missense_Mutation_p.R37Q|RBPJ_uc003gsa.1_Missense_Mutation_p.R23Q|RBPJ_uc003gsb.1_Missense_Mutation_p.R24Q|RBPJ_uc003gsc.1_Missense_Mutation_p.R23Q	NM_005349	NP_005340	Q06330	SUH_HUMAN	recombining binding protein suppressor of	37					DNA recombination|negative regulation of transcription, DNA-dependent|positive regulation of transcription of Notch receptor target	cytoplasm|nucleolus|nucleoplasm	DNA binding|protein binding|recombinase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)	3		Breast(46;0.0503)				GAAGCTATGCGAAATTATTTA	0.323													4	65	---	---	---	---	PASS
TLR1	7096	broad.mit.edu	37	4	38800105	38800105	+	Silent	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38800105G>C	uc003gtl.2	-	4	622	c.348C>G	c.(346-348)CTC>CTG	p.L116L		NM_003263	NP_003254	Q15399	TLR1_HUMAN	toll-like receptor 1 precursor	116	Extracellular (Potential).|LRR 4.				cellular response to triacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|inflammatory response|innate immune response|macrophage activation|positive regulation of interleukin-6 biosynthetic process|positive regulation of tumor necrosis factor biosynthetic process	integral to plasma membrane|phagocytic vesicle membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	protein heterodimerization activity|transmembrane receptor activity			lung(2)|skin(2)|prostate(1)	5						CCAAGTGCTTGAGGTTCACAG	0.408													5	138	---	---	---	---	PASS
DCAF4L1	285429	broad.mit.edu	37	4	41984426	41984426	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41984426A>G	uc003gwk.2	+	1	714	c.617A>G	c.(616-618)CAG>CGG	p.Q206R		NM_001029955	NP_001025126	Q3SXM0	DC4L1_HUMAN	WD repeat domain 21B	206										skin(1)	1						GGCTTGTCTCAGCAGGTCCTG	0.577													6	110	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48636431	48636431	+	5'UTR	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48636431G>A	uc003gyh.1	-	4					FRYL_uc003gyk.2_5'UTR|FRYL_uc003gyl.1_Silent_p.I50I|FRYL_uc003gym.1_5'UTR	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						TTGACATGATGATATTTTTTT	0.358													5	67	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	55152005	55152005	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55152005C>T	uc003han.3	+						PDGFRA_uc003haa.2_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	CTTTTCCATGCAGTGTGTCCA	0.512			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			10	74	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	69327602	69327602	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69327602C>G	uc003hdz.3	+	2	139	c.75C>G	c.(73-75)ATC>ATG	p.I25M		NM_014058	NP_054777			transmembrane protease, serine 11E																		GCCTCGTCATCTTCATATCCC	0.433													18	294	---	---	---	---	PASS
SLC4A4	8671	broad.mit.edu	37	4	72306422	72306422	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72306422C>T	uc003hfy.2	+	8	1014	c.897C>T	c.(895-897)TTC>TTT	p.F299F	SLC4A4_uc010iic.2_Silent_p.F299F|SLC4A4_uc010iib.2_Silent_p.F299F|SLC4A4_uc003hfz.2_Silent_p.F299F|SLC4A4_uc003hgc.3_Silent_p.F255F|SLC4A4_uc003hga.2_Silent_p.F177F|SLC4A4_uc003hgb.3_Silent_p.F255F	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate	299	Cytoplasmic (Potential).					basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			ATACTCCTTTCATTGCCTTTG	0.483													6	68	---	---	---	---	PASS
IL8	3576	broad.mit.edu	37	4	74607697	74607697	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74607697C>A	uc003hhe.2	+	3	333	c.232C>A	c.(232-234)CTG>ATG	p.L78M	IL8_uc011cbh.1_Missense_Mutation_p.L78M	NM_000584	NP_000575	P10145	IL8_HUMAN	interleukin 8 precursor	78					angiogenesis|calcium-mediated signaling|cell cycle arrest|cellular response to lipopolysaccharide|embryonic digestive tract development|G-protein coupled receptor protein signaling pathway|immune response|induction of positive chemotaxis|inflammatory response|negative regulation of cell proliferation|neutrophil activation|neutrophil chemotaxis|positive regulation of neutrophil chemotaxis|regulation of cell adhesion|regulation of retroviral genome replication	extracellular space|intracellular	chemokine activity|interleukin-8 receptor binding			ovary(2)	2	Breast(15;0.00102)		all cancers(17;0.00169)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)	LUSC - Lung squamous cell carcinoma(721;0.008)	Ketoprofen(DB01009)|Salbutamol(DB01001)|Simvastatin(DB00641)|Zileuton(DB00744)	AGAGCTCTGTCTGGACCCCAA	0.328													5	54	---	---	---	---	PASS
CCDC158	339965	broad.mit.edu	37	4	77288597	77288597	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77288597C>G	uc003hkb.3	-	11	1833	c.1680G>C	c.(1678-1680)AAG>AAC	p.K560N		NM_001042784	NP_001036249	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	560	Potential.									skin(3)|ovary(2)|pancreas(1)	6						TCACCTTGTCCTTCTCTGTCA	0.478													5	60	---	---	---	---	PASS
FRAS1	80144	broad.mit.edu	37	4	79420968	79420968	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79420968G>C	uc003hlb.2	+	61	9649	c.9209G>C	c.(9208-9210)AGA>ACA	p.R3070T	FRAS1_uc003hlc.1_Missense_Mutation_p.R72T	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	3065	Calx-beta 5.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						GTGATCCGCAGAGGGGATCAG	0.552													22	78	---	---	---	---	PASS
PTPN13	5783	broad.mit.edu	37	4	87643575	87643575	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87643575A>C	uc003hpz.2	+	10	2076	c.1596A>C	c.(1594-1596)CAA>CAC	p.Q532H	PTPN13_uc003hpy.2_Missense_Mutation_p.Q532H|PTPN13_uc003hqa.2_Missense_Mutation_p.Q532H|PTPN13_uc003hqb.2_Missense_Mutation_p.Q532H	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	532						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CCATGACTCAAAGAAAACTGA	0.433													5	73	---	---	---	---	PASS
GPRIN3	285513	broad.mit.edu	37	4	90169273	90169273	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90169273C>G	uc003hsm.1	-	2	2508	c.1989G>C	c.(1987-1989)AAG>AAC	p.K663N		NM_198281	NP_938022	Q6ZVF9	GRIN3_HUMAN	G protein-regulated inducer of neurite outgrowth	663										ovary(3)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		GCTGCTTTTTCTTATCTCCTG	0.562													3	46	---	---	---	---	PASS
ADH7	131	broad.mit.edu	37	4	100336624	100336624	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100336624G>C	uc003huv.1	-							NM_000673	NP_000664	P40394	ADH7_HUMAN	class IV alcohol dehydrogenase, mu or sigma						ethanol oxidation|fatty acid omega-oxidation|response to bacterium|response to ethanol|xenobiotic metabolic process	cytosol|soluble fraction	alcohol dehydrogenase activity, zinc-dependent|aldehyde oxidase activity|ethanol binding|receptor antagonist activity|retinol binding|retinol dehydrogenase activity			lung(2)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)	NADH(DB00157)	ATCATCATAAGAAACAGTTAC	0.303													5	55	---	---	---	---	PASS
UBE2D3	7323	broad.mit.edu	37	4	103731003	103731003	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103731003C>T	uc003hwk.2	-	3	495	c.34G>A	c.(34-36)GAT>AAT	p.D12N	UBE2D3_uc003hwi.2_Missense_Mutation_p.D12N|UBE2D3_uc003hwj.2_RNA|UBE2D3_uc003hwl.2_Missense_Mutation_p.D12N|UBE2D3_uc011cet.1_Missense_Mutation_p.D12N|UBE2D3_uc011ceu.1_Missense_Mutation_p.D12N|UBE2D3_uc003hwo.2_Missense_Mutation_p.D12N|UBE2D3_uc003hwp.2_Missense_Mutation_p.D12N|UBE2D3_uc003hwq.2_Missense_Mutation_p.D14N|UBE2D3_uc003hwr.2_Missense_Mutation_p.D12N	NM_181887	NP_871616	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3 isoform 1	12					apoptosis|BMP signaling pathway|DNA repair|negative regulation of type I interferon production|proteasomal ubiquitin-dependent protein catabolic process|protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein monoubiquitination|transforming growth factor beta receptor signaling pathway	endosome membrane|plasma membrane	ATP binding|protein binding|ubiquitin-protein ligase activity				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		CGGGCCAAATCACTAAGTTCC	0.393													4	70	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114279312	114279312	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114279312G>C	uc003ibe.3	+	38	9638	c.9538G>C	c.(9538-9540)GAC>CAC	p.D3180H	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.D482H|ANK2_uc011cgb.1_Missense_Mutation_p.D3195H	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	3147					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TGATGAGGCAGACTTACTTCC	0.483													3	40	---	---	---	---	PASS
ARSJ	79642	broad.mit.edu	37	4	114824078	114824078	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114824078G>A	uc003ibq.1	-	2	2040	c.1152C>T	c.(1150-1152)CTC>CTT	p.L384L	ARSJ_uc010imu.1_Silent_p.L384L|ARSJ_uc010imv.1_Silent_p.L212L	NM_024590	NP_078866	Q5FYB0	ARSJ_HUMAN	arylsulfatase J precursor	384						extracellular region	arylsulfatase activity|metal ion binding	p.L384L(1)		ovary(1)	1		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		CCAGTGAAATGAGAGTGGGGT	0.488													10	105	---	---	---	---	PASS
LARP1B	55132	broad.mit.edu	37	4	129100652	129100652	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129100652G>C	uc003iga.2	+	15	2119	c.1988G>C	c.(1987-1989)GGA>GCA	p.G663A	LARP1B_uc003igc.2_Missense_Mutation_p.G82A|LARP1B_uc010ioa.1_RNA|LARP1B_uc003ige.2_RNA|LARP1B_uc003igd.2_RNA	NM_018078	NP_060548	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family member 2	663							RNA binding				0						CGTGGGCCAGGAACATCCTCT	0.363													10	67	---	---	---	---	PASS
PHF17	79960	broad.mit.edu	37	4	129792793	129792793	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129792793G>C	uc003igk.2	+	11	2185	c.1905G>C	c.(1903-1905)AAG>AAC	p.K635N	PHF17_uc003igl.2_Missense_Mutation_p.K623N|PHF17_uc011cgy.1_Missense_Mutation_p.K635N	NM_199320	NP_955352	Q6IE81	JADE1_HUMAN	PHD finger protein 17 long isoform	635					apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding				0						GTTTAGAAAAGACCTTTGCAG	0.478													4	40	---	---	---	---	PASS
MAML3	55534	broad.mit.edu	37	4	140811803	140811803	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140811803C>G	uc003ihz.1	-	2	1539	c.787G>C	c.(787-789)GAG>CAG	p.E263Q	MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3	263					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					AAGCTATCCTCCAGGTCACTG	0.453													5	108	---	---	---	---	PASS
CLGN	1047	broad.mit.edu	37	4	141311857	141311857	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141311857C>G	uc011chi.1	-	15	1895	c.1677G>C	c.(1675-1677)AAG>AAC	p.K559N	CLGN_uc003iii.2_Missense_Mutation_p.K559N	NM_001130675	NP_001124147	O14967	CLGN_HUMAN	calmegin precursor	559	Cytoplasmic (Potential).				protein folding	endoplasmic reticulum membrane|integral to membrane	calcium ion binding|unfolded protein binding			ovary(2)|skin(1)	3	all_hematologic(180;0.162)					CTTCTTCACTCTTTTCCTCAG	0.313													5	44	---	---	---	---	PASS
OTUD4	54726	broad.mit.edu	37	4	146083806	146083806	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146083806G>A	uc003ika.3	-	6	425	c.287C>T	c.(286-288)TCT>TTT	p.S96F	OTUD4_uc003ijz.3_Missense_Mutation_p.S96F|OTUD4_uc003ikb.3_Missense_Mutation_p.S96F	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	161							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)					ACACATAGCAGAGCTTTCTTT	0.264													3	17	---	---	---	---	PASS
DCLK2	166614	broad.mit.edu	37	4	151177279	151177279	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151177279G>T	uc003ilm.3	+	16	2281	c.2181G>T	c.(2179-2181)GAG>GAT	p.E727D	DCLK2_uc003iln.3_Missense_Mutation_p.E726D|DCLK2_uc003ilo.3_Missense_Mutation_p.E744D|DCLK2_uc003ilp.3_RNA	NM_001040260	NP_001035350	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2 isoform a	727	Pro-rich.				intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)					CAGTGGAGGAGATCCCTGTGC	0.652													3	13	---	---	---	---	PASS
KIAA0922	23240	broad.mit.edu	37	4	154513680	154513680	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154513680C>G	uc003inm.3	+	18	1915	c.1863C>G	c.(1861-1863)CTC>CTG	p.L621L	KIAA0922_uc010ipp.2_Silent_p.L622L|KIAA0922_uc010ipq.2_Intron	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2	621	Extracellular (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				CCTTGCAGCTCCTGCCTCTCT	0.453													8	54	---	---	---	---	PASS
SH3RF1	57630	broad.mit.edu	37	4	170038681	170038681	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170038681C>T	uc003isa.1	-	9	2105	c.1770G>A	c.(1768-1770)GTG>GTA	p.V590V	SH3RF1_uc010irc.1_Silent_p.V290V	NM_020870	NP_065921	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	590						Golgi apparatus|lamellipodium|perinuclear region of cytoplasm	ligase activity|zinc ion binding			breast(2)|lung(1)	3		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		TACCTGTCCTCACAGCATTGC	0.483													6	61	---	---	---	---	PASS
C4orf41	60684	broad.mit.edu	37	4	184612514	184612514	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184612514G>A	uc003ivx.2	+	19	2115	c.1939G>A	c.(1939-1941)GAA>AAA	p.E647K	C4orf41_uc003ivw.2_Missense_Mutation_p.E647K|C4orf41_uc010isc.2_5'UTR|C4orf41_uc003ivy.2_Missense_Mutation_p.E253K	NM_021942	NP_068761	Q7Z392	CD041_HUMAN	hypothetical protein LOC60684 isoform a	647											0		all_lung(41;4.4e-14)|Lung NSC(41;1.03e-13)|Colorectal(36;0.00139)|all_hematologic(60;0.00756)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.39e-26)|Epithelial(43;2.42e-22)|OV - Ovarian serous cystadenocarcinoma(60;6.85e-10)|GBM - Glioblastoma multiforme(59;6.71e-06)|Colorectal(24;9.67e-06)|STAD - Stomach adenocarcinoma(60;2.36e-05)|COAD - Colon adenocarcinoma(29;7.07e-05)|LUSC - Lung squamous cell carcinoma(40;0.00984)|READ - Rectum adenocarcinoma(43;0.171)		CAAAGCAAATGAAGTTTTAGA	0.373													5	64	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13885102	13885102	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13885102G>A	uc003jfd.2	-	19	3021	c.2979C>T	c.(2977-2979)TTC>TTT	p.F993F		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	993	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TATTACCCCGGAAGTTAATTG	0.363									Kartagener_syndrome				7	91	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13891184	13891184	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13891184G>A	uc003jfd.2	-	17	2520	c.2478C>T	c.(2476-2478)TTC>TTT	p.F826F		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	826	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					CATCAATGCGGAACTCAATCA	0.413									Kartagener_syndrome				6	101	---	---	---	---	PASS
TTC23L	153657	broad.mit.edu	37	5	34845686	34845686	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34845686G>C	uc003jiu.2	+	3	266	c.163G>C	c.(163-165)GAG>CAG	p.E55Q		NM_144725	NP_653326	Q6PF05	TT23L_HUMAN	tetratricopeptide repeat domain 23-like	55							binding			central_nervous_system(1)	1						TAAAGCTAAAGAGAAGGAGAA	0.448													7	30	---	---	---	---	PASS
PRLR	5618	broad.mit.edu	37	5	35084645	35084645	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35084645G>A	uc003jjm.2	-	5	830	c.300C>T	c.(298-300)ATC>ATT	p.I100I	PRLR_uc003jjg.1_Silent_p.I100I|PRLR_uc003jjh.1_Silent_p.I100I|PRLR_uc003jji.1_Silent_p.I29I|PRLR_uc003jjj.1_Silent_p.I100I|PRLR_uc003jjk.1_Silent_p.I29I|PRLR_uc003jjl.3_Intron|PRLR_uc010iuw.1_Silent_p.I29I	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor	100	Fibronectin type-III 1.|Extracellular (Potential).				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TGACCATCATGATGTATGTCC	0.493													10	133	---	---	---	---	PASS
GPX8	493869	broad.mit.edu	37	5	54460035	54460035	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54460035G>C	uc003jpq.2	+	3	656	c.619G>C	c.(619-621)GAG>CAG	p.E207Q	CDC20B_uc003jpn.1_Intron|CDC20B_uc010ivu.1_Intron|CDC20B_uc003jpo.1_Intron|CDC20B_uc010ivv.1_Intron|CDC20B_uc003jpp.2_Intron|GPX8_uc003jpr.2_3'UTR|GPX8_uc003jps.2_RNA|GPX8_uc003jpt.2_Missense_Mutation_p.E156Q	NM_001008397	NP_001008398	Q8TED1	GPX8_HUMAN	glutathione peroxidase 8	207					response to oxidative stress	integral to membrane	glutathione peroxidase activity				0					Glutathione(DB00143)	AAAAAAGAAAGAGGATCTATG	0.373													3	53	---	---	---	---	PASS
MIER3	166968	broad.mit.edu	37	5	56219369	56219369	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56219369C>T	uc003jrd.1	-	13	1264	c.1239G>A	c.(1237-1239)GTG>GTA	p.V413V	MIER3_uc003jqz.1_Silent_p.V350V|MIER3_uc003jra.1_Silent_p.V412V|MIER3_uc003jrb.1_Silent_p.V237V|MIER3_uc003jrc.1_Silent_p.V418V	NM_152622	NP_689835	Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family	413					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		CCAAACAATTCACATCTGTGG	0.458													5	35	---	---	---	---	PASS
PPWD1	23398	broad.mit.edu	37	5	64867958	64867958	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64867958G>C	uc003jtv.3	+	5	821	c.814G>C	c.(814-816)GAT>CAT	p.D272H	PPWD1_uc011cqv.1_Missense_Mutation_p.D242H|PPWD1_uc011cqw.1_Missense_Mutation_p.D116H	NM_015342	NP_056157	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat	272					protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		AACTGACACTGATTTATATGA	0.373													4	75	---	---	---	---	PASS
NLN	57486	broad.mit.edu	37	5	65077185	65077185	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65077185G>A	uc003juf.2	+	6	875	c.759G>A	c.(757-759)AAG>AAA	p.K253K	NLN_uc003jue.2_Silent_p.K253K|NLN_uc003jug.2_Silent_p.K82K	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor	253					proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		CTGTCATGAAGAAATGTTGTA	0.333													9	87	---	---	---	---	PASS
NLN	57486	broad.mit.edu	37	5	65105892	65105892	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65105892G>C	uc003juf.2	+	11	1859	c.1743G>C	c.(1741-1743)TTG>TTC	p.L581F	NLN_uc003jug.2_Missense_Mutation_p.L410F|NLN_uc010iww.2_Missense_Mutation_p.L258F	NM_020726	NP_065777	Q9BYT8	NEUL_HUMAN	neurolysin precursor	581					proteolysis	mitochondrial intermembrane space	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		AGATTGTTTTGAGCAAAGTTG	0.398													9	126	---	---	---	---	PASS
ERBB2IP	55914	broad.mit.edu	37	5	65370983	65370983	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65370983G>A	uc003juk.1	+	23	4196	c.3888G>A	c.(3886-3888)CTG>CTA	p.L1296L	ERBB2IP_uc003jui.1_Silent_p.L1255L|ERBB2IP_uc003juj.1_Intron|ERBB2IP_uc011cqx.1_Silent_p.L1303L|ERBB2IP_uc011cqy.1_Silent_p.L1255L|ERBB2IP_uc011cqz.1_Silent_p.L494L|ERBB2IP_uc010iwx.1_Silent_p.L1299L|ERBB2IP_uc003jul.1_Silent_p.L1251L	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	1296					basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		ACTTGATGCTGAAAGTGGCCC	0.453													5	84	---	---	---	---	PASS
BDP1	55814	broad.mit.edu	37	5	70800496	70800496	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70800496G>T	uc003kbp.1	+	16	2553	c.2290G>T	c.(2290-2292)GAT>TAT	p.D764Y	BDP1_uc003kbn.1_Missense_Mutation_p.D764Y|BDP1_uc003kbo.2_Missense_Mutation_p.D764Y	NM_018429	NP_060899	A6H8Y1	BDP1_HUMAN	transcription factor-like nuclear regulator	764					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding			skin(2)	2		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TGAAGAGGAAGATGTCATATT	0.343													9	47	---	---	---	---	PASS
S100Z	170591	broad.mit.edu	37	5	76173601	76173601	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76173601C>G	uc003kep.1	+	4	574	c.244C>G	c.(244-246)CTG>GTG	p.L82V	S100Z_uc003keq.3_Missense_Mutation_p.L82V	NM_130772	NP_570128	Q8WXG8	S100Z_HUMAN	S100 calcium binding protein Z	82	EF-hand 2.						calcium ion binding			ovary(1)	1		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;8.91e-51)|Epithelial(54;5.43e-45)|all cancers(79;1.82e-40)		GGTGGCAGCTCTGACAGTTGC	0.378													6	47	---	---	---	---	PASS
ATP6AP1L	92270	broad.mit.edu	37	5	81605965	81605965	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81605965C>T	uc003khv.2	+						ATP6AP1L_uc003khw.2_Intron	NM_001017971	NP_001017971	Q52LC2	VAS1L_HUMAN	ATPase, H+ transporting, lysosomal accessory						ATP hydrolysis coupled proton transport	integral to membrane|proton-transporting V-type ATPase, V1 domain	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0						TGCGTTGTTTCCTTTTCTTAG	0.318													7	44	---	---	---	---	PASS
ATP6AP1L	92270	broad.mit.edu	37	5	81608442	81608442	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81608442C>G	uc003khv.2	+	9	1469	c.144C>G	c.(142-144)ACC>ACG	p.T48T	ATP6AP1L_uc003khw.2_Silent_p.T48T	NM_001017971	NP_001017971	Q52LC2	VAS1L_HUMAN	ATPase, H+ transporting, lysosomal accessory	48					ATP hydrolysis coupled proton transport	integral to membrane|proton-transporting V-type ATPase, V1 domain	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0						TCATCCTTACCAATTACAACA	0.403											OREG0016689	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	104	---	---	---	---	PASS
MEF2C	4208	broad.mit.edu	37	5	88119605	88119605	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:88119605T>C	uc003kjj.2	-	2	674	c.1A>G	c.(1-3)ATG>GTG	p.M1V	MEF2C_uc003kji.2_Missense_Mutation_p.M1V|MEF2C_uc003kjk.2_Missense_Mutation_p.M1V|MEF2C_uc003kjm.2_Missense_Mutation_p.M1V|MEF2C_uc003kjl.2_Missense_Mutation_p.M1V	NM_002397	NP_002388	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C isoform 1	1					apoptosis|B cell proliferation|innate immune response|learning or memory|muscle cell differentiation|muscle organ development|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|neuron development|positive regulation of muscle cell differentiation|positive regulation of survival gene product expression|positive regulation of transcription from RNA polymerase II promoter|regulation of germinal center formation|regulation of megakaryocyte differentiation|regulation of synaptic activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nuclear speck	activating transcription factor binding|protein heterodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			lung(3)|breast(2)|ovary(1)|large_intestine(1)	7		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		TTTCTCCCCATAGTCCCCGTT	0.343										HNSCC(66;0.2)			5	172	---	---	---	---	PASS
EPB41L4A	64097	broad.mit.edu	37	5	111541149	111541149	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:111541149G>A	uc003kpv.1	-	14	1505	c.1231C>T	c.(1231-1233)CAT>TAT	p.H411Y	EPB41L4A_uc003kpp.1_Missense_Mutation_p.H38Y	NM_022140	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte protein band 4.1-like 4	411				HAP -> LMHS (in Ref. 3; BAB17229).		cytoplasm|cytoskeleton|extrinsic to membrane	cytoskeletal protein binding			ovary(1)	1		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		CACGGTGCATGAGATTTGCTT	0.333													40	470	---	---	---	---	PASS
FTMT	94033	broad.mit.edu	37	5	121187814	121187814	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121187814C>T	uc003kss.2	+	1	165	c.156C>T	c.(154-156)GCC>GCT	p.A52A		NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial precursor	52					cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity			ovary(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		TGGCCGCAGCCGCCTCCTCCC	0.771													5	7	---	---	---	---	PASS
TRPC7	57113	broad.mit.edu	37	5	135583167	135583167	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135583167C>T	uc003lbn.1	-	6	1836	c.1833G>A	c.(1831-1833)GCG>GCA	p.A611A	TRPC7_uc010jef.1_Silent_p.A548A|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Silent_p.A542A|TRPC7_uc010jei.1_Silent_p.A487A|TRPC7_uc010jej.1_Silent_p.A163A	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	612	Extracellular (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ACGTTGTAAACGCTGGGTTGT	0.483													3	25	---	---	---	---	PASS
PCDHA11	56138	broad.mit.edu	37	5	140250050	140250050	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140250050C>T	uc003lia.2	+	1	2220	c.1362C>T	c.(1360-1362)TTC>TTT	p.F454F	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc011dae.1_Silent_p.F454F	NM_018902	NP_061725	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11 isoform 1 precursor	454	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCTGCGTTCGCACAGCCCG	0.652													10	121	---	---	---	---	PASS
PCDHGA8	9708	broad.mit.edu	37	5	140774125	140774125	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140774125C>A	uc003lkd.1	+	1	2643	c.1745C>A	c.(1744-1746)GCA>GAA	p.A582E	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.A582E	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	582	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCCGCTCCGCAGAGCGTGGC	0.677													16	75	---	---	---	---	PASS
PCDHGA10	56106	broad.mit.edu	37	5	140794696	140794696	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140794696G>A	uc003lkl.1	+	1	1954	c.1954G>A	c.(1954-1956)GAC>AAC	p.D652N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc011day.1_Missense_Mutation_p.D652N|PCDHGB7_uc003lkm.2_5'Flank|PCDHGB7_uc003lkn.1_5'Flank	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1	652	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCGTCCAGGACCACGGCCA	0.701													8	76	---	---	---	---	PASS
PCDHGA12	26025	broad.mit.edu	37	5	140811189	140811189	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140811189C>T	uc003lkt.1	+	1	1032	c.863C>T	c.(862-864)GCG>GTG	p.A288V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Missense_Mutation_p.A288V	NM_003735	NP_003726	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12 isoform 1	288	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGACAAGGCGGCCCAAGTT	0.512													14	81	---	---	---	---	PASS
MED7	9443	broad.mit.edu	37	5	156565967	156565967	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156565967C>A	uc010jik.2	-	2	868	c.476G>T	c.(475-477)CGA>CTA	p.R159L	MED7_uc003lwm.3_Missense_Mutation_p.R159L	NM_001100816	NP_001094286	O43513	MED7_HUMAN	mediator complex subunit 7	159					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	protein binding|transcription coactivator activity				0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TTCAATTACTCGTTCCAGGTG	0.443													4	79	---	---	---	---	PASS
ODZ2	57451	broad.mit.edu	37	5	167674361	167674361	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167674361C>T	uc010jjd.2	+	27	6390	c.6390C>T	c.(6388-6390)ATC>ATT	p.I2130I	ODZ2_uc003lzr.3_Silent_p.I1900I|ODZ2_uc003lzt.3_Silent_p.I1503I|ODZ2_uc010jje.2_Silent_p.I1394I	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		ATTATGACATCAACCAGATCA	0.498													9	84	---	---	---	---	PASS
CPEB4	80315	broad.mit.edu	37	5	173317425	173317425	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173317425C>G	uc003mcs.3	+	1	2095	c.689C>G	c.(688-690)TCA>TGA	p.S230*	CPEB4_uc010jju.1_Nonsense_Mutation_p.S230*|CPEB4_uc010jjv.2_Nonsense_Mutation_p.S230*|CPEB4_uc011dfg.1_Nonsense_Mutation_p.S230*|CPEB4_uc003mct.3_5'Flank|CPEB4_uc003mcu.3_5'Flank	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding	230							nucleotide binding|RNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GGGCCTCTCTCACAGCACCAC	0.552													14	73	---	---	---	---	PASS
FAF2	23197	broad.mit.edu	37	5	175906255	175906255	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175906255G>C	uc003mej.3	+	2	183	c.130G>C	c.(130-132)GAG>CAG	p.E44Q		NM_014613	NP_055428	Q96CS3	FAF2_HUMAN	UBX domain containing 8	44	UBA.				response to unfolded protein	endoplasmic reticulum|lipid particle	protein binding			ovary(1)	1						CTGGAACATAGAGGTATAATA	0.378													13	94	---	---	---	---	PASS
MAML1	9794	broad.mit.edu	37	5	179192494	179192494	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179192494C>G	uc003mkm.2	+	2	746	c.483C>G	c.(481-483)CTC>CTG	p.L161L	MAML1_uc003mkn.1_Silent_p.L161L	NM_014757	NP_055572	Q92585	MAML1_HUMAN	mastermind-like 1	161					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	peptide antigen binding|protein kinase binding|transcription coactivator activity			lung(4)|ovary(2)	6	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCTCCCCCCTCGGTCAGTCTG	0.602													4	35	---	---	---	---	PASS
FLT4	2324	broad.mit.edu	37	5	180043493	180043493	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180043493G>A	uc003mma.3	-						FLT4_uc003mlz.3_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	GGATGCACTGGGGTGCGGGGA	0.622									Congenital_Hereditary_Lymphedema				6	41	---	---	---	---	PASS
SERPINB6	5269	broad.mit.edu	37	6	2954917	2954917	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2954917G>C	uc003muk.2	-	3	2334	c.339C>G	c.(337-339)TTC>TTG	p.F113L	SERPINB6_uc003mui.2_5'UTR|SERPINB6_uc003muj.2_RNA|SERPINB6_uc003mul.2_Missense_Mutation_p.F113L|SERPINB6_uc003mum.2_Missense_Mutation_p.F113L|SERPINB6_uc003mun.2_Missense_Mutation_p.F113L|SERPINB6_uc003muo.2_Missense_Mutation_p.F113L	NM_004568	NP_004559	P35237	SPB6_HUMAN	serine (or cysteine) proteinase inhibitor, clade	113					regulation of proteolysis	centrosome|cytosol|protein complex	protease binding|serine-type endopeptidase inhibitor activity				0	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	CTGCTTGGTAGAATTTTTGGC	0.433													6	73	---	---	---	---	PASS
CAP2	10486	broad.mit.edu	37	6	17507543	17507543	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17507543G>A	uc003ncb.2	+	5	687	c.444G>A	c.(442-444)GTG>GTA	p.V148V	CAP2_uc010jpk.1_RNA|CAP2_uc011dja.1_Silent_p.V122V|CAP2_uc011djb.1_Silent_p.V148V|CAP2_uc011djc.1_Intron|CAP2_uc011djd.1_Intron	NM_006366	NP_006357	P40123	CAP2_HUMAN	adenylyl cyclase-associated protein 2	148					activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			GGATAGCTGTGGTGAGTCCAG	0.483													6	57	---	---	---	---	PASS
NUP153	9972	broad.mit.edu	37	6	17640293	17640293	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17640293G>A	uc003ncd.1	-	15	1923	c.1723C>T	c.(1723-1725)CAT>TAT	p.H575Y	NUP153_uc011dje.1_Missense_Mutation_p.H606Y|NUP153_uc010jpl.1_Intron	NM_005124	NP_005115	P49790	NU153_HUMAN	nucleoporin 153kDa	575					carbohydrate metabolic process|glucose transport|interspecies interaction between organisms|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleolus|nucleoplasm	DNA binding|protein binding|transporter activity|zinc ion binding			lung(4)|ovary(2)|breast(2)|skin(1)	9	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			GTGACATGATGAGCTGtaatt	0.323													7	74	---	---	---	---	PASS
LRRC16A	55604	broad.mit.edu	37	6	25551239	25551239	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25551239G>C	uc011djw.1	+	27	2806	c.2430G>C	c.(2428-2430)AAG>AAC	p.K810N	LRRC16A_uc010jpx.2_Missense_Mutation_p.K810N|LRRC16A_uc010jpy.2_Missense_Mutation_p.K810N|LRRC16A_uc003nfa.1_Missense_Mutation_p.K164N	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	810					actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						GCACCGAAAAGATTTCTATTC	0.383													6	100	---	---	---	---	PASS
SLC17A4	10050	broad.mit.edu	37	6	25776812	25776812	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25776812C>T	uc003nfe.2	+						SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Intron|SLC17A4_uc003nfg.2_Intron|SLC17A4_uc010jqa.2_Intron	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN	solute carrier family 17 (sodium phosphate),						phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			skin(1)	1						GACCTAGTCTCTGGTCCTCAG	0.493													8	122	---	---	---	---	PASS
HIST1H1B	3009	broad.mit.edu	37	6	27835074	27835074	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27835074C>G	uc003njx.2	-	1	286	c.234G>C	c.(232-234)AAG>AAC	p.K78N		NM_005322	NP_005313	P16401	H15_HUMAN	histone cluster 1, H1b	78	H15.				nucleosome assembly	nucleosome|nucleus	DNA binding			large_intestine(2)|lung(1)	3						GGCTGTTATTCTTCTCCACGT	0.557													5	163	---	---	---	---	PASS
ZNF165	7718	broad.mit.edu	37	6	28053439	28053439	+	Missense_Mutation	SNP	C	G	G	rs143050119		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28053439C>G	uc003nkg.2	+	3	1265	c.181C>G	c.(181-183)CCT>GCT	p.P61A	ZNF165_uc003nkh.2_Missense_Mutation_p.P61A|ZNF165_uc003nki.3_Missense_Mutation_p.P61A	NM_003447	NP_003438	P49910	ZN165_HUMAN	zinc finger protein 165	61					viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CCAGGATTCTCCTGGACCTCG	0.537													6	107	---	---	---	---	PASS
OR2J3	442186	broad.mit.edu	37	6	29079954	29079954	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29079954C>T	uc011dll.1	+	1	287	c.287C>T	c.(286-288)TCT>TTT	p.S96F		NM_001005216	NP_001005216	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J,	96	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AAGACCATCTCTTATGCTGGT	0.483													11	140	---	---	---	---	PASS
DHX16	8449	broad.mit.edu	37	6	30640498	30640498	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30640498C>T	uc003nqz.2	-	1	333	c.121G>A	c.(121-123)GAG>AAG	p.E41K	DHX16_uc011dmo.1_Intron	NM_003587	NP_003578	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	41					mRNA processing|RNA splicing	nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity			ovary(2)|kidney(2)	4						ACGAACTCCTCGGCAGAGGTG	0.647													5	56	---	---	---	---	PASS
BAT2	7916	broad.mit.edu	37	6	31600193	31600193	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31600193C>T	uc003nvb.3	+	16	3992	c.3743C>T	c.(3742-3744)GCT>GTT	p.A1248V	BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Missense_Mutation_p.A1248V	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2	1248	4 X 57 AA type A repeats.					cytoplasm|nucleus	protein binding				0						CATGGGAGGGCTCAGCAGCAG	0.647													9	53	---	---	---	---	PASS
EHMT2	10919	broad.mit.edu	37	6	31848475	31848475	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31848475C>G	uc003nxz.1	-	27	3437	c.3427G>C	c.(3427-3429)GAC>CAC	p.D1143H	EHMT2_uc003nxv.1_Missense_Mutation_p.D182H|EHMT2_uc003nxw.1_Missense_Mutation_p.D182H|EHMT2_uc003nxx.1_Missense_Mutation_p.D341H|EHMT2_uc003nxy.1_Missense_Mutation_p.D941H|EHMT2_uc011don.1_Missense_Mutation_p.D1166H|EHMT2_uc003nya.1_Missense_Mutation_p.D1109H|SLC44A4_uc010jti.2_5'Flank|SLC44A4_uc011dom.1_5'Flank	NM_006709	NP_006700	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	1143	SET.				DNA methylation|peptidyl-lysine dimethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			ovary(1)	1						GTCCGGATGTCTCGGGAACTG	0.592													5	29	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32036830	32036830	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32036830C>T	uc003nzl.2	-	16	5873	c.5671G>A	c.(5671-5673)GAG>AAG	p.E1891K		NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	1973	Fibronectin type-III 12.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						GACGTGGCCTCCTCCACTGTC	0.582													3	37	---	---	---	---	PASS
C6orf10	10665	broad.mit.edu	37	6	32261577	32261577	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32261577C>T	uc011dpy.1	-	12	1046	c.873G>A	c.(871-873)GAG>GAA	p.E291E	C6orf10_uc011dpx.1_Silent_p.E73E	NM_006781	NP_006772	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10	291						integral to membrane				skin(1)	1						CTACCTTGACCTCCATTCCTA	0.398													14	199	---	---	---	---	PASS
BRD2	6046	broad.mit.edu	37	6	32942310	32942310	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32942310G>C	uc003ocn.3	+	3	1802	c.101G>C	c.(100-102)CGA>CCA	p.R34P	BRD2_uc003oco.2_RNA|BRD2_uc003ocq.3_Missense_Mutation_p.R34P|BRD2_uc003ocp.3_5'UTR|BRD2_uc010juh.2_Missense_Mutation_p.R34P	NM_005104	NP_005095	P25440	BRD2_HUMAN	bromodomain containing 2	34					spermatogenesis	nucleus	protein serine/threonine kinase activity			central_nervous_system(3)|stomach(2)	5						AAGAGGATTCGAAAACCCTCT	0.577													9	98	---	---	---	---	PASS
B3GALT4	8705	broad.mit.edu	37	6	33246092	33246092	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33246092G>A	uc003odr.2	+	1	1176	c.896G>A	c.(895-897)CGA>CAA	p.R299Q		NM_003782	NP_003773	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta	299	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	ganglioside galactosyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)|breast(1)	2						GTAAGTGCCCGACGAGGAGGC	0.607													9	73	---	---	---	---	PASS
LEMD2	221496	broad.mit.edu	37	6	33744831	33744831	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33744831C>G	uc011drm.1	-	8	1274	c.1261G>C	c.(1261-1263)GTG>CTG	p.V421L	LEMD2_uc010jvg.2_Missense_Mutation_p.V130L|LEMD2_uc011drl.1_Missense_Mutation_p.V119L|LEMD2_uc003ofe.2_Missense_Mutation_p.V119L	NM_181336	NP_851853	Q8NC56	LEMD2_HUMAN	LEM domain containing 2 isoform 1	421						integral to nuclear inner membrane				central_nervous_system(1)	1						TCCTGGACCACGTCTGCAGGA	0.582													6	99	---	---	---	---	PASS
UHRF1BP1	54887	broad.mit.edu	37	6	34802148	34802148	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34802148C>T	uc003oju.3	+	5	727	c.493C>T	c.(493-495)CGC>TGC	p.R165C	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	165										ovary(3)	3						GAGTGACCTTCGCCTTACCCG	0.507													4	30	---	---	---	---	PASS
TFEB	7942	broad.mit.edu	37	6	41658581	41658581	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41658581C>T	uc003oqs.1	-	4	590	c.288G>A	c.(286-288)CTG>CTA	p.L96L	TFEB_uc003oqt.1_Silent_p.L96L|TFEB_uc003oqu.1_Silent_p.L110L|TFEB_uc003oqv.1_Silent_p.L96L|TFEB_uc010jxo.1_Silent_p.L96L|TFEB_uc003oqx.1_Silent_p.L96L|TFEB_uc003oqr.1_Intron|TFEB_uc003oqw.1_Silent_p.L96L	NM_007162	NP_009093	P19484	TFEB_HUMAN	transcription factor EB	96					embryonic placenta development|humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(1)	1	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;7.61e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			AGGTCTCGGACAGGTACTCCC	0.627			T	ALPHA	renal (childhood epithelioid)								5	42	---	---	---	---	PASS
TMEM63B	55362	broad.mit.edu	37	6	44116376	44116376	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44116376G>C	uc003owr.2	+	14	1312	c.1248G>C	c.(1246-1248)CAG>CAC	p.Q416H	TMEM63B_uc003owq.1_Missense_Mutation_p.Q416H|TMEM63B_uc003ows.2_Missense_Mutation_p.Q319H|TMEM63B_uc010jyz.2_RNA	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	transmembrane protein 63B	416						integral to membrane	nucleotide binding|protein binding			pancreas(2)|central_nervous_system(1)	3	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			CTGACCCTCAGAACATCTACT	0.617													9	38	---	---	---	---	PASS
TDRD6	221400	broad.mit.edu	37	6	46656958	46656958	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46656958G>C	uc003oyj.2	+	1	1093	c.1093G>C	c.(1093-1095)GAA>CAA	p.E365Q	TDRD6_uc010jze.2_Missense_Mutation_p.E359Q	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	365	Tudor 2.				cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			CTTGCTGCCTGAATATTTTCG	0.557													8	59	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56394342	56394342	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56394342C>G	uc003pdf.2	-	60	11170	c.11142G>C	c.(11140-11142)CTG>CTC	p.L3714L	DST_uc003pcz.3_Silent_p.L3536L|DST_uc011dxj.1_Silent_p.L3565L|DST_uc011dxk.1_Silent_p.L3576L|DST_uc003pcy.3_Silent_p.L3210L	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	5622					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCCAGTTCATCAGTTCAACTT	0.458													8	96	---	---	---	---	PASS
MCHR2	84539	broad.mit.edu	37	6	100390912	100390912	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100390912G>A	uc003pqh.1	-	4	815	c.500C>T	c.(499-501)CCT>CTT	p.P167L	MCHR2_uc003pqi.1_Missense_Mutation_p.P167L	NM_001040179	NP_001035269	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	167	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		GACCCAGACAGGCAATGCCAG	0.473													11	89	---	---	---	---	PASS
QRSL1	55278	broad.mit.edu	37	6	107096892	107096892	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107096892G>A	uc003prm.2	+						QRSL1_uc003prl.2_Intron	NM_018292	NP_060762	Q9H0R6	QRSL1_HUMAN	glutaminyl-tRNA synthase						translation		ATP binding|carbon-nitrogen ligase activity, with glutamine as amido-N-donor				0	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;0.00768)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.248)	Epithelial(6;0.000334)|all cancers(7;0.00157)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0152)	BRCA - Breast invasive adenocarcinoma(108;0.118)|all cancers(137;0.167)|Epithelial(106;0.176)		GCTTCACTTCGTCATCAGATC	0.363													8	65	---	---	---	---	PASS
PDSS2	57107	broad.mit.edu	37	6	107595340	107595340	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107595340C>T	uc003prt.2	-	3	813	c.523G>A	c.(523-525)GAT>AAT	p.D175N	PDSS2_uc011eak.1_Missense_Mutation_p.D39N|PDSS2_uc011eal.1_Missense_Mutation_p.D175N|PDSS2_uc003pru.2_Missense_Mutation_p.D175N|PDSS2_uc003prv.2_Missense_Mutation_p.D175N	NM_020381	NP_065114	Q86YH6	DLP1_HUMAN	prenyl diphosphate synthase, subunit 2	175					isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	protein heterodimerization activity			ovary(2)	2	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		AGTGGACCATCAGATGATTGC	0.388													8	108	---	---	---	---	PASS
AMD1	262	broad.mit.edu	37	6	111214021	111214021	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111214021G>C	uc003puk.1	+	7	1021	c.699G>C	c.(697-699)ATG>ATC	p.M233I	AMD1_uc011eay.1_Missense_Mutation_p.M164I|AMD1_uc011eaz.1_Missense_Mutation_p.M204I|AMD1_uc011eba.1_Missense_Mutation_p.M113I|AMD1_uc003pul.1_Missense_Mutation_p.M85I	NM_001634	NP_001625	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1 isoform 1	233					spermidine biosynthetic process|spermine biosynthetic process	cytosol	adenosylmethionine decarboxylase activity			upper_aerodigestive_tract(1)	1		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	TGAATGGAATGAAATCGGATG	0.378													10	91	---	---	---	---	PASS
RPF2	84154	broad.mit.edu	37	6	111345525	111345525	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111345525C>G	uc003pun.2	+	9	755	c.736C>G	c.(736-738)CTC>GTC	p.L246V	RPF2_uc003puo.2_Missense_Mutation_p.L183V|uc003pup.1_5'Flank	NM_032194	NP_115570	Q9H7B2	RPF2_HUMAN	brix domain containing 1	246						nucleolus	protein binding			ovary(2)	2						GCCAAAAGCTCTCAAGGTATA	0.348													3	39	---	---	---	---	PASS
REV3L	5980	broad.mit.edu	37	6	111698934	111698934	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111698934G>A	uc003puy.3	-	12	1890	c.1567C>T	c.(1567-1569)CAG>TAG	p.Q523*	REV3L_uc003pux.3_Nonsense_Mutation_p.Q445*|REV3L_uc003puz.3_Nonsense_Mutation_p.Q445*	NM_002912	NP_002903	O60673	DPOLZ_HUMAN	DNA polymerase zeta	523					DNA-dependent DNA replication|translesion synthesis	nucleus|zeta DNA polymerase complex	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|nucleotide binding			large_intestine(2)|ovary(2)|skin(2)	6		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CCATCTAACTGAGGTATAGAA	0.343								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	59	---	---	---	---	PASS
RFX6	222546	broad.mit.edu	37	6	117244318	117244318	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117244318C>T	uc003pxm.2	+	14	1549	c.1486C>T	c.(1486-1488)CTG>TTG	p.L496L		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	496					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						TCAAGACTTTCTGTTAAAGTG	0.353													7	80	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117609861	117609861	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117609861C>G	uc003pxp.1	-	43	7037	c.6838G>C	c.(6838-6840)GAA>CAA	p.E2280Q	ROS1_uc011ebi.1_RNA	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	2280	Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TGGCCACATTCTGTAGCAAGT	0.433			T	GOPC|ROS1	glioblastoma|NSCLC								3	48	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129762132	129762132	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129762132C>G	uc003qbn.2	+	43	6362	c.6257C>G	c.(6256-6258)CCT>CGT	p.P2086R	LAMA2_uc003qbo.2_Missense_Mutation_p.P2086R	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	2086	Domain II and I.|Potential.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GTTAAAGATCCTTCCAAGAAC	0.418													3	34	---	---	---	---	PASS
L3MBTL3	84456	broad.mit.edu	37	6	130392189	130392189	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130392189C>A	uc003qbt.2	+	13	1331	c.1161C>A	c.(1159-1161)TTC>TTA	p.F387L	L3MBTL3_uc003qbu.2_Missense_Mutation_p.F362L	NM_032438	NP_115814	Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 isoform a	387	MBT 2.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		ATCCCTCATTCATCTGTGTTG	0.408													39	123	---	---	---	---	PASS
TMEM200A	114801	broad.mit.edu	37	6	130761645	130761645	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130761645C>T	uc003qca.2	+	3	949	c.78C>T	c.(76-78)GTC>GTT	p.V26V	TMEM200A_uc010kfh.2_Silent_p.V26V|TMEM200A_uc010kfi.2_Silent_p.V26V|TMEM200A_uc003qcb.2_Silent_p.V26V	NM_052913	NP_443145	Q86VY9	T200A_HUMAN	transmembrane protein 200A	26	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		AGCAGCATGTCAACCTCAGCC	0.547													8	104	---	---	---	---	PASS
VNN1	8876	broad.mit.edu	37	6	133014412	133014412	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133014412C>G	uc003qdo.2	-	4	597	c.577G>C	c.(577-579)GAG>CAG	p.E193Q		NM_004666	NP_004657	O95497	VNN1_HUMAN	vanin 1 precursor	193	CN hydrolase.				acute inflammatory response|anti-apoptosis|cell-cell adhesion|cellular component movement|chronic inflammatory response|innate immune response|pantothenate metabolic process|positive regulation of T cell differentiation in thymus|response to oxidative stress	anchored to membrane|integral to membrane|plasma membrane	GPI anchor binding|pantetheine hydrolase activity			ovary(3)	3	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		ATCTCAGGCTCCTTGGGTACA	0.363													4	60	---	---	---	---	PASS
IFNGR1	3459	broad.mit.edu	37	6	137519199	137519199	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137519199C>G	uc003qho.2	-	7	1542	c.1439G>C	c.(1438-1440)AGA>ACA	p.R480T	IFNGR1_uc011edm.1_Missense_Mutation_p.R452T	NM_000416	NP_000407	P15260	INGR1_HUMAN	interferon gamma receptor 1 precursor	480	Cytoplasmic (Potential).				regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity			upper_aerodigestive_tract(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TTCTGTTGGTCTATAACCAAT	0.388													12	64	---	---	---	---	PASS
OLIG3	167826	broad.mit.edu	37	6	137814879	137814879	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137814879C>G	uc003qhp.1	-	1	653	c.429G>C	c.(427-429)GAG>GAC	p.E143D		NM_175747	NP_786923	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3	143					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		GCCTCTTCATCTCCTCCAGGG	0.657													6	17	---	---	---	---	PASS
ARID1B	57492	broad.mit.edu	37	6	157522462	157522462	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157522462G>A	uc003qqn.2	+	18	4832	c.4680G>A	c.(4678-4680)ATG>ATA	p.M1560I	ARID1B_uc003qqo.2_Missense_Mutation_p.M1520I|ARID1B_uc003qqp.2_Missense_Mutation_p.M1507I	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1565	Pro-rich.				chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TGCCGTCTATGAAGATGCAGA	0.602													7	121	---	---	---	---	PASS
SNX9	51429	broad.mit.edu	37	6	158342600	158342600	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158342600G>A	uc003qqv.1	+	10	1160	c.987G>A	c.(985-987)GAG>GAA	p.E329E		NM_016224	NP_057308	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	329	PX.				cell communication|intracellular protein transport|lipid tube assembly|positive regulation of GTPase activity|positive regulation of protein oligomerization|receptor-mediated endocytosis	clathrin-coated vesicle|cytoplasmic vesicle membrane|extrinsic to internal side of plasma membrane|ruffle|trans-Golgi network	1-phosphatidylinositol binding|protein homodimerization activity|ubiquitin protein ligase binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		TGCGCATGGAGAGACTTCAGG	0.438													4	55	---	---	---	---	PASS
FNDC1	84624	broad.mit.edu	37	6	159654069	159654069	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159654069G>A	uc010kjv.2	+	11	2725	c.2525G>A	c.(2524-2526)CGG>CAG	p.R842Q	FNDC1_uc010kjw.1_Missense_Mutation_p.R727Q	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	842						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CGGGGACCTCGGCTGCAGCCC	0.627													4	10	---	---	---	---	PASS
FNDC1	84624	broad.mit.edu	37	6	159677621	159677621	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159677621C>T	uc010kjv.2	+	18	5332	c.5132C>T	c.(5131-5133)TCA>TTA	p.S1711L		NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1711	Fibronectin type-III 5.					extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CAAGCTTCATCAGTAACTCAC	0.433													10	163	---	---	---	---	PASS
TCP1	6950	broad.mit.edu	37	6	160200193	160200193	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160200193C>G	uc003qsr.2	-	12	1790	c.1555G>C	c.(1555-1557)GAA>CAA	p.E519Q	TCP1_uc003qss.2_Missense_Mutation_p.E364Q|TCP1_uc010kjz.2_3'UTR|TCP1_uc003qst.2_Missense_Mutation_p.E295Q	NM_030752	NP_110379	P17987	TCPA_HUMAN	T-complex protein 1 isoform a	519					'de novo' posttranslational protein folding|tubulin complex assembly	cell junction|Golgi apparatus	ATP binding|unfolded protein binding			breast(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(65;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		ATTGCAGCTTCTGTTGCAAAT	0.363													6	78	---	---	---	---	PASS
MAS1	4142	broad.mit.edu	37	6	160328830	160328830	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160328830C>G	uc003qsz.2	+	1	857	c.843C>G	c.(841-843)TTC>TTG	p.F281L		NM_002377	NP_002368	P04201	MAS_HUMAN	MAS1 oncogene	281	Helical; Name=7; (Potential).				anatomical structure morphogenesis|cell proliferation|protein kinase C signaling cascade	integral to plasma membrane	angiotensin type II receptor activity			ovary(2)|lung(2)	4		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		TCATTTACTTCTTTGTGGGAA	0.453													9	120	---	---	---	---	PASS
SLC22A1	6580	broad.mit.edu	37	6	160557675	160557675	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160557675T>A	uc003qtc.2	+	6	1159	c.1054T>A	c.(1054-1056)TAC>AAC	p.Y352N	SLC22A1_uc003qtd.2_Missense_Mutation_p.Y352N	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a	352	Helical; (Potential).					basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		CATCCTGATGTACCTGTGGTG	0.567													7	63	---	---	---	---	PASS
PLG	5340	broad.mit.edu	37	6	161160096	161160096	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161160096C>T	uc003qtm.3	+							NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen						extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CTCATCTTTTCTAGGTCCCCA	0.507													15	70	---	---	---	---	PASS
FAM120B	84498	broad.mit.edu	37	6	170626894	170626894	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170626894T>C	uc003qxp.2	+	2	524	c.416T>C	c.(415-417)GTG>GCG	p.V139A	FAM120B_uc003qxo.1_Missense_Mutation_p.V139A|FAM120B_uc011ehd.1_Intron	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	139					cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		GGGCTAGCTGTGTTTACACGA	0.453													5	70	---	---	---	---	PASS
MICALL2	79778	broad.mit.edu	37	7	1479625	1479625	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1479625G>A	uc003skj.3	-	9	2049	c.1902C>T	c.(1900-1902)ATC>ATT	p.I634I	MICALL2_uc003skh.3_5'Flank|MICALL2_uc003ski.3_Silent_p.I121I	NM_182924	NP_891554	Q8IY33	MILK2_HUMAN	MICAL-like 2 isoform 1	634						cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGTCAGGGTGATGTGGACAC	0.706													8	17	---	---	---	---	PASS
EIF3B	8662	broad.mit.edu	37	7	2412417	2412417	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2412417G>A	uc003slx.2	+	12	1880	c.1797G>A	c.(1795-1797)AAG>AAA	p.K599K	EIF3B_uc003sly.2_Silent_p.K599K|EIF3B_uc003sma.2_Silent_p.K327K	NM_003751	NP_003742	P55884	EIF3B_HUMAN	eukaryotic translation initiation factor 3,	599	WD 4.				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		ACAACGGGAAGATTGAACTCA	0.502													5	42	---	---	---	---	PASS
ACTB	60	broad.mit.edu	37	7	5567921	5567921	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5567921A>C	uc003sos.3	-	3	829	c.793T>G	c.(793-795)TCC>GCC	p.S265A	ACTB_uc003sor.3_Missense_Mutation_p.S143A|ACTB_uc003sot.3_Missense_Mutation_p.S265A|ACTB_uc003soq.3_Missense_Mutation_p.S143A|ACTB_uc010ksy.2_Missense_Mutation_p.S143A	NM_001101	NP_001092	P60709	ACTB_HUMAN	beta actin	265					'de novo' posttranslational protein folding|adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol|MLL5-L complex|NuA4 histone acetyltransferase complex|ribonucleoprotein complex	ATP binding|kinesin binding|nitric-oxide synthase binding|structural constituent of cytoskeleton				0		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		CCCAGGAAGGAAGGCTGGAAG	0.607													4	67	---	---	---	---	PASS
AHR	196	broad.mit.edu	37	7	17378992	17378992	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17378992G>C	uc011jxz.1	+	10	2156	c.1543G>C	c.(1543-1545)GAC>CAC	p.D515H	AHR_uc003stt.3_RNA	NM_001621	NP_001612	P35869	AHR_HUMAN	aryl hydrocarbon receptor precursor	515					apoptosis|blood vessel development|cell cycle|regulation of B cell proliferation|response to stress|transcription from RNA polymerase II promoter|xenobiotic metabolic process	cytosolic aryl hydrocarbon receptor complex|transcription factor complex	Hsp90 protein binding|ligand-dependent nuclear receptor activity|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding			urinary_tract(1)|kidney(1)|pancreas(1)	3	Lung NSC(10;0.0392)|all_lung(11;0.0754)					TGAGCAAATTGACCAGCCTCA	0.393													4	68	---	---	---	---	PASS
TWISTNB	221830	broad.mit.edu	37	7	19739762	19739762	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19739762C>A	uc003sup.1	-	3	559	c.538G>T	c.(538-540)GAA>TAA	p.E180*		NM_001002926	NP_001002926	Q3B726	RPA43_HUMAN	TWIST neighbor	180						microtubule cytoskeleton|nucleolus	DNA-directed RNA polymerase activity			ovary(1)	1						CGAAATACTTCAAATTCTAGT	0.398													12	55	---	---	---	---	PASS
KLHL7	55975	broad.mit.edu	37	7	23191752	23191752	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23191752G>C	uc003svs.3	+	7	1153	c.860G>C	c.(859-861)AGA>ACA	p.R287T	KLHL7_uc003svr.3_Missense_Mutation_p.R265T|KLHL7_uc011jys.1_Missense_Mutation_p.R211T|KLHL7_uc011jyt.1_Missense_Mutation_p.R62T|KLHL7_uc003svt.2_Missense_Mutation_p.R239T|KLHL7_uc011jyv.1_Missense_Mutation_p.R62T	NM_001031710	NP_001026880	Q8IXQ5	KLHL7_HUMAN	kelch-like 7 isoform 1	287						Golgi apparatus|nucleolus|plasma membrane					0						ACAAGACCTAGAAGAAAGAAA	0.408													3	61	---	---	---	---	PASS
IGF2BP3	10643	broad.mit.edu	37	7	23353181	23353181	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23353181G>C	uc003swg.2	-	13	1753	c.1487C>G	c.(1486-1488)TCC>TGC	p.S496C	IGF2BP3_uc003swf.2_Missense_Mutation_p.S115C	NM_006547	NP_006538	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding	496	KH 4.				anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			ovary(2)	2						AGCAGCAAAGGATGGCACTCT	0.413													11	90	---	---	---	---	PASS
TRIL	9865	broad.mit.edu	37	7	28997039	28997039	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28997039G>A	uc003szt.2	-	3	991	c.624C>T	c.(622-624)CTC>CTT	p.L208L	uc003szu.1_5'Flank	NM_014817	NP_055632	Q7L0X0	TRIL_HUMAN	TLR4 interactor with leucine rich repeats	208	LRR 7.|Extracellular (Potential).				inflammatory response|innate immune response|regulation of cytokine production involved in immune response|toll-like receptor 4 signaling pathway	lipopolysaccharide receptor complex	lipopolysaccharide binding				0						CAGAGAGGTTGAGGAAGCGCA	0.637													5	35	---	---	---	---	PASS
GARS	2617	broad.mit.edu	37	7	30639587	30639587	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30639587G>A	uc003tbm.2	+	3	706	c.349G>A	c.(349-351)GAT>AAT	p.D117N		NM_002047	NP_002038	P41250	SYG_HUMAN	glycyl-tRNA synthetase	117	WHEP-TRS.				cell death|diadenosine tetraphosphate biosynthetic process|glycyl-tRNA aminoacylation	cytosol|mitochondrial matrix|soluble fraction	ATP binding|glycine-tRNA ligase activity|protein dimerization activity			ovary(1)	1					Glycine(DB00145)	GCCCAAAGATGATATTGTAGA	0.383													5	88	---	---	---	---	PASS
FKBP9	11328	broad.mit.edu	37	7	33014871	33014871	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33014871C>T	uc003tdh.2	+	3	626	c.445C>T	c.(445-447)CAG>TAG	p.Q149*	AVL9_uc011kai.1_Intron|FKBP9_uc011kak.1_RNA|FKBP9_uc011kal.1_Nonsense_Mutation_p.Q202*|FKBP9_uc003tdg.2_Nonsense_Mutation_p.Q149*|FKBP9_uc010kwm.2_Nonsense_Mutation_p.Q56*	NM_007270	NP_009201	O95302	FKBP9_HUMAN	FK506 binding protein 9 precursor	149					protein folding	endoplasmic reticulum|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity			central_nervous_system(13)|ovary(1)	14			GBM - Glioblastoma multiforme(11;0.0156)			AGACCAGGTTCAGATTCACAC	0.463													10	59	---	---	---	---	PASS
KIAA0895	23366	broad.mit.edu	37	7	36396704	36396704	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36396704A>G	uc003tfd.2	-	3	725	c.674T>C	c.(673-675)TTT>TCT	p.F225S	KIAA0895_uc003tfc.2_Missense_Mutation_p.F212S|KIAA0895_uc011kaw.1_Missense_Mutation_p.F74S|KIAA0895_uc003tfb.2_Missense_Mutation_p.F174S|KIAA0895_uc011kax.1_Missense_Mutation_p.F174S|KIAA0895_uc003tfe.2_Missense_Mutation_p.F212S|KIAA0895_uc011kay.1_Missense_Mutation_p.F174S	NM_001100425	NP_001093895	Q8NCT3	K0895_HUMAN	hypothetical protein LOC23366 isoform 1	225											0						TCCCTTTTCAAAGCTTCTAGA	0.413													6	84	---	---	---	---	PASS
RFC2	5982	broad.mit.edu	37	7	73646450	73646450	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73646450G>C	uc003uaj.2	-	11	1076	c.1051C>G	c.(1051-1053)CCG>GCG	p.P351A	RFC2_uc011kfa.1_RNA|RFC2_uc003uak.2_Missense_Mutation_p.P317A|RFC2_uc010lbp.2_Missense_Mutation_p.P280A|RFC2_uc003ual.2_Missense_Mutation_p.P250A	NM_181471	NP_852136	P35250	RFC2_HUMAN	replication factor C 2 isoform 1	351					cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2						CTGGCCACCGGGGCCATTGTC	0.522													13	84	---	---	---	---	PASS
HGF	3082	broad.mit.edu	37	7	81388044	81388044	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81388044C>T	uc003uhl.2	-	3	496	c.331G>A	c.(331-333)GAA>AAA	p.E111K	HGF_uc003uhm.2_Missense_Mutation_p.E111K|HGF_uc003uhn.1_Missense_Mutation_p.E111K|HGF_uc003uho.1_Missense_Mutation_p.E111K|HGF_uc003uhp.2_Missense_Mutation_p.E111K	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	111	PAN.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						TGGCCAAATTCTTTTTTCACT	0.313													7	66	---	---	---	---	PASS
DBF4	10926	broad.mit.edu	37	7	87536722	87536722	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87536722G>A	uc003ujf.1	+	12	1773	c.1269G>A	c.(1267-1269)TTG>TTA	p.L423L	DBF4_uc003ujh.1_Silent_p.L163L|DBF4_uc003ujg.1_Silent_p.L199L|DBF4_uc011khf.1_Silent_p.L190L	NM_006716	NP_006707	Q9UBU7	DBF4A_HUMAN	activator of S phase kinase	423					cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle	nucleoplasm	enzyme activator activity|nucleic acid binding|protein binding|zinc ion binding			lung(2)	2	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				CAAATGAATTGAGAGGGCTTA	0.378													7	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	92098668	92098668	+	IGR	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92098668G>A								GATAD1 (9926 upstream) : PEX1 (17670 downstream)																							gaactgagtagaggttgtgat	0.000													19	117	---	---	---	---	PASS
FBXO24	26261	broad.mit.edu	37	7	100187813	100187813	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100187813C>T	uc003uvm.1	+	3	448	c.155C>T	c.(154-156)TCA>TTA	p.S52L	FBXO24_uc010lha.1_RNA|FBXO24_uc003uvl.1_Missense_Mutation_p.S52L|FBXO24_uc003uvn.1_Intron|uc011kjy.1_Intron|FBXO24_uc011kjz.1_Missense_Mutation_p.S90L|FBXO24_uc011kka.1_Missense_Mutation_p.S40L	NM_033506	NP_277041	O75426	FBX24_HUMAN	F-box only protein 24 isoform 1	52	F-box.					ubiquitin ligase complex	ubiquitin-protein ligase activity			ovary(3)|skin(1)	4	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CATATCATCTCATTCCTCCCA	0.587													3	34	---	---	---	---	PASS
POP7	10248	broad.mit.edu	37	7	100304761	100304761	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100304761C>G	uc003uwh.3	+	2	570	c.308C>G	c.(307-309)TCC>TGC	p.S103C		NM_005837	NP_005828	O75817	POP7_HUMAN	processing of precursor 7	103					tRNA processing	nucleolar ribonuclease P complex	protein binding|ribonuclease P activity			ovary(1)	1	Lung NSC(181;0.041)|all_lung(186;0.0581)					GCCAATACCTCCACCGTGGAG	0.612													7	82	---	---	---	---	PASS
EPO	2056	broad.mit.edu	37	7	100319594	100319594	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100319594G>A	uc003uwi.2	+	3	350	c.169G>A	c.(169-171)GCT>ACT	p.A57T	EPO_uc011kkc.1_Missense_Mutation_p.A57T	NM_000799	NP_000790	P01588	EPO_HUMAN	erythropoietin precursor	57					blood circulation|cellular hyperosmotic response|erythrocyte maturation|negative regulation of apoptosis|negative regulation of ion transmembrane transporter activity|negative regulation of sodium ion transport|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat5 protein|signal transduction	extracellular space	erythropoietin receptor binding|eukaryotic cell surface binding|hormone activity			central_nervous_system(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)				Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)	GACGGGCTGTGCTGAACACTG	0.517													4	53	---	---	---	---	PASS
TRIP6	7205	broad.mit.edu	37	7	100470816	100470816	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100470816C>T	uc003uww.2	+	9	1492	c.1322C>T	c.(1321-1323)TCT>TTT	p.S441F	SRRT_uc010lhl.1_5'Flank|SRRT_uc003uwy.2_5'Flank|SRRT_uc003uxa.2_5'Flank|SRRT_uc003uwz.2_5'Flank	NM_003302	NP_003293	Q15654	TRIP6_HUMAN	thyroid receptor-interacting protein 6	441	LIM zinc-binding 3.				focal adhesion assembly|positive regulation of cell migration|regulation of transcription, DNA-dependent|release of cytoplasmic sequestered NF-kappaB|transcription, DNA-dependent	cytoplasm|cytoskeleton|focal adhesion|nucleus	identical protein binding|interleukin-1 receptor binding|kinase binding|thyroid hormone receptor binding|zinc ion binding			central_nervous_system(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)					CTGCTCTCCTCTGAGGGCGAG	0.433													8	47	---	---	---	---	PASS
SRRT	51593	broad.mit.edu	37	7	100486133	100486133	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100486133G>A	uc003uwy.2	+	21	2862	c.2594G>A	c.(2593-2595)CGG>CAG	p.R865Q	SRRT_uc010lhl.1_Missense_Mutation_p.R864Q|SRRT_uc003uxa.2_Missense_Mutation_p.R860Q|SRRT_uc003uwz.2_Missense_Mutation_p.R861Q|uc010lhm.1_5'Flank	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN	arsenate resistance protein 2 isoform a	865					cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding			ovary(2)	2						GTGGAATATCGGGACCTGGAT	0.537													9	49	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100682189	100682189	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100682189A>G	uc003uxp.1	+	3	7545	c.7492A>G	c.(7492-7494)ACA>GCA	p.T2498A	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	2498	Extracellular (Potential).|40.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					TTCATCTCCTACAACTGCTGA	0.512													41	229	---	---	---	---	PASS
TRIM56	81844	broad.mit.edu	37	7	100730884	100730884	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100730884G>A	uc003uxq.2	+	3	522	c.291G>A	c.(289-291)GGG>GGA	p.G97G	TRIM56_uc003uxr.2_Silent_p.G97G	NM_030961	NP_112223	Q9BRZ2	TRI56_HUMAN	tripartite motif-containing 56	97					defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			kidney(1)|central_nervous_system(1)|skin(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)					TGCGTGCCGGGAAGCCAGCCT	0.692													9	46	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119914774	119914774	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119914774C>T	uc003vjj.1	+	1	1053	c.88C>T	c.(88-90)CCC>TCC	p.P30S		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	30	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					TATGCCGGCTCCCCCGAGGCA	0.627													34	169	---	---	---	---	PASS
C7orf58	79974	broad.mit.edu	37	7	120764400	120764400	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120764400G>C	uc003vjq.3	+	8	1381	c.934G>C	c.(934-936)GAG>CAG	p.E312Q	C7orf58_uc003vjr.1_Missense_Mutation_p.E312Q|C7orf58_uc003vjs.3_Missense_Mutation_p.E312Q|C7orf58_uc003vjt.3_Missense_Mutation_p.E92Q|C7orf58_uc010lkk.1_Missense_Mutation_p.E92Q	NM_024913	NP_079189	A4D0V7	CG058_HUMAN	hypothetical protein LOC79974 isoform 1	312						endoplasmic reticulum				ovary(4)|large_intestine(2)|skin(2)|pancreas(1)	9	all_neural(327;0.117)					AACATTTTTTGAGACATTCCT	0.393													12	72	---	---	---	---	PASS
METTL2B	55798	broad.mit.edu	37	7	128138114	128138114	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128138114G>A	uc003vnf.2	+	7	871	c.834G>A	c.(832-834)CTG>CTA	p.L278L	METTL2B_uc003vng.2_Silent_p.L213L|METTL2B_uc011kop.1_Silent_p.L142L	NM_018396	NP_060866	Q6P1Q9	MTL2B_HUMAN	methyltransferase like 2B	278							methyltransferase activity			skin(1)	1						TCAACAGGCTGAGCAGGCTTC	0.473													6	53	---	---	---	---	PASS
AHCYL2	23382	broad.mit.edu	37	7	129053478	129053478	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129053478G>A	uc011kov.1	+	12	1464	c.1410G>A	c.(1408-1410)AAG>AAA	p.K470K	AHCYL2_uc003vot.2_Silent_p.K469K|AHCYL2_uc003vov.2_Silent_p.K367K|AHCYL2_uc011kow.1_Silent_p.K368K|AHCYL2_uc011kox.1_Silent_p.K367K	NM_015328	NP_056143	Q96HN2	SAHH3_HUMAN	S-adenosylhomocysteine hydrolase-like 2 isoform	470					one-carbon metabolic process		adenosylhomocysteinase activity			ovary(2)	2						ACCGTATGAAGAATAGCTGCA	0.393													16	78	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131883280	131883280	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131883280C>T	uc003vra.3	-	13	2931	c.2702G>A	c.(2701-2703)TGC>TAC	p.C901Y		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	901	IPT/TIG 1.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						TAAAGGGCTGCACTCCACGCC	0.577													7	36	---	---	---	---	PASS
SVOPL	136306	broad.mit.edu	37	7	138329598	138329598	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138329598G>C	uc011kqh.1	-						SVOPL_uc003vue.2_Intron	NM_001139456	NP_001132928	Q8N434	SVOPL_HUMAN	SVOP-like isoform 1							integral to membrane	transmembrane transporter activity				0						AAACTGGGTAGAGATTACAAA	0.502													4	72	---	---	---	---	PASS
JHDM1D	80853	broad.mit.edu	37	7	139827298	139827298	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139827298C>A	uc003vvm.2	-	5	649	c.645G>T	c.(643-645)ATG>ATT	p.M215I		NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase	215					midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					TGTTAGGATTCATGAAGTATT	0.378													6	130	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142104242	142104242	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142104242C>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc003vyy.3_RNA					SubName: Full=V_segment translation product; Flags: Fragment;																		TCTCCTTTGTCAGTGATACCA	0.517													17	102	---	---	---	---	PASS
ZNF777	27153	broad.mit.edu	37	7	149152780	149152780	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149152780C>T	uc003wfv.2	-	2	497	c.334G>A	c.(334-336)GAA>AAA	p.E112K		NM_015694	NP_056509	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	112					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			ACTTCTTGTTCAGCAGCAGCT	0.612													12	130	---	---	---	---	PASS
SMARCD3	6604	broad.mit.edu	37	7	150937513	150937513	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150937513G>C	uc003wjs.2	-	9	1136	c.1035C>G	c.(1033-1035)ATC>ATG	p.I345M	SMARCD3_uc003wjt.2_Missense_Mutation_p.I332M|SMARCD3_uc003wju.2_Missense_Mutation_p.I332M|SMARCD3_uc011kvh.1_3'UTR	NM_001003801	NP_001003801	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin	345					cellular lipid metabolic process|chromatin modification|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	nuclear hormone receptor binding|protein binding|transcription coactivator activity|transcription factor binding			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CACCTCACCTGATGACATGGT	0.403													4	24	---	---	---	---	PASS
UBE3C	9690	broad.mit.edu	37	7	157023842	157023842	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157023842G>C	uc010lqs.2	+	18	2614	c.2302G>C	c.(2302-2304)GAT>CAT	p.D768H	UBE3C_uc003wni.3_Missense_Mutation_p.D131H	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	768	HECT.				protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		AGCTGGCATTGATGGTGGTGG	0.438													14	60	---	---	---	---	PASS
MYOM2	9172	broad.mit.edu	37	8	2026823	2026823	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2026823T>C	uc003wpx.3	+	12	1409	c.1271T>C	c.(1270-1272)GTA>GCA	p.V424A	MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	424	Fibronectin type-III 1.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AGATGTGAAGTAGGAACGAAT	0.383													8	125	---	---	---	---	PASS
MSRA	4482	broad.mit.edu	37	8	10102676	10102676	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10102676C>G	uc003wsx.2	+	3	471	c.274C>G	c.(274-276)CAA>GAA	p.Q92E	MSRA_uc011kwx.1_Intron|MSRA_uc011kwy.1_Missense_Mutation_p.Q49E|MSRA_uc003wsz.2_Missense_Mutation_p.Q49E|MSRA_uc003wsy.2_Missense_Mutation_p.Q26E	NM_012331	NP_036463	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A isoform a	92					methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	GTATTCAACTCAAGTTGGTTT	0.358													5	100	---	---	---	---	PASS
ATP6V1B2	526	broad.mit.edu	37	8	20055039	20055039	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20055039C>G	uc003wzp.2	+	1	336	c.122C>G	c.(121-123)TCC>TGC	p.S41C		NM_001693	NP_001684	P21281	VATB2_HUMAN	vacuolar H+ATPase B2	41					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|endomembrane system|Golgi apparatus|melanosome|plasma membrane|proton-transporting V-type ATPase, V1 domain	ATP binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)		AACTACCTCTCCCAGCCTCGC	0.647													2	8	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30702093	30702093	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30702093C>G	uc003xil.2	-	1	4441	c.4441G>C	c.(4441-4443)GAA>CAA	p.E1481Q		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1481										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GTTGATCCTTCAGTCATGCTT	0.323													3	61	---	---	---	---	PASS
SFRP1	6422	broad.mit.edu	37	8	41166557	41166557	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41166557G>A	uc003xnt.2	-	1	424	c.122C>T	c.(121-123)TCG>TTG	p.S41L		NM_003012	NP_003003	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1 precursor	41					brain development|canonical Wnt receptor signaling pathway|cellular response to BMP stimulus|cellular response to estradiol stimulus|cellular response to fibroblast growth factor stimulus|cellular response to heparin|cellular response to hypoxia|cellular response to interleukin-1|cellular response to prostaglandin E stimulus|cellular response to starvation|cellular response to transforming growth factor beta stimulus|cellular response to tumor necrosis factor|cellular response to vitamin D|DNA fragmentation involved in apoptotic nuclear change|dorsal/ventral axis specification|hemopoietic progenitor cell differentiation|hemopoietic stem cell differentiation|menstrual cycle phase|negative regulation of androgen receptor signaling pathway|negative regulation of B cell differentiation|negative regulation of bone remodeling|negative regulation of canonical Wnt receptor signaling pathway involved in controlling type B pancreatic cell proliferation|negative regulation of cell growth|negative regulation of cell migration|negative regulation of cysteine-type endopeptidase activity|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast apoptosis|negative regulation of fibroblast proliferation|negative regulation of insulin secretion|negative regulation of ossification|negative regulation of osteoblast proliferation|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|osteoblast differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell growth|positive regulation of epithelial cell proliferation|positive regulation of fat cell differentiation|positive regulation of fibroblast apoptosis|positive regulation of focal adhesion assembly|positive regulation of non-canonical Wnt receptor signaling pathway|positive regulation of Rac GTPase activity|positive regulation of smoothened signaling pathway|positive regulation of stress fiber assembly|positive regulation of transcription, DNA-dependent|regulation of angiogenesis|regulation of cell cycle process|response to drug|response to organic cyclic compound|vasculature development	cell surface|cytosol|extracellular space|plasma membrane|proteinaceous extracellular matrix	cysteine-type endopeptidase activity|drug binding|frizzled binding|heparin binding|identical protein binding|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			GCCGATGTCCGACTGGAAGCT	0.711													3	18	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41554223	41554223	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41554223G>C	uc003xok.2	-	25	2790	c.2706C>G	c.(2704-2706)ATC>ATG	p.I902M	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Missense_Mutation_p.I218M|ANK1_uc003xoi.2_Missense_Mutation_p.I902M|ANK1_uc003xoj.2_Missense_Mutation_p.I902M|ANK1_uc003xol.2_Missense_Mutation_p.I902M|ANK1_uc003xom.2_Missense_Mutation_p.I943M	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	902				I -> T (in Ref. 3; AAB47805).	axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCACCGGGCTGATGTTGTCTG	0.632													4	35	---	---	---	---	PASS
SNTG1	54212	broad.mit.edu	37	8	51569549	51569549	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51569549G>A	uc010lxy.1	+	15	1301	c.930G>A	c.(928-930)CTG>CTA	p.L310L	SNTG1_uc003xqs.1_Silent_p.L310L|SNTG1_uc010lxz.1_Silent_p.L310L|SNTG1_uc011ldl.1_RNA	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	310	PH.				cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TCCTGGCCCTGAGGGGCTCAT	0.483													8	67	---	---	---	---	PASS
RGS20	8601	broad.mit.edu	37	8	54791944	54791944	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54791944C>T	uc003xrp.2	+	2	384	c.292C>T	c.(292-294)CCC>TCC	p.P98S	RGS20_uc003xrq.2_Intron|RGS20_uc010lye.2_Intron|RGS20_uc010lyf.2_Intron|RGS20_uc003xrr.2_5'Flank|RGS20_uc003xrs.2_5'Flank|RGS20_uc003xrt.2_5'Flank	NM_170587	NP_733466	O76081	RGS20_HUMAN	regulator of G-protein signaling 20 isoform a	98					negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|nucleus|plasma membrane	GTPase activator activity|protein binding|signal transducer activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			TCCCGAGGCTCCCCGGAGGCG	0.726													4	71	---	---	---	---	PASS
TRAM1	23471	broad.mit.edu	37	8	71495505	71495505	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71495505G>C	uc003xyo.1	-	10	1115	c.945C>G	c.(943-945)TTC>TTG	p.F315L	TRAM1_uc011lfc.1_Missense_Mutation_p.F284L	NM_014294	NP_055109	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1	315	Helical; (Potential).|TLC.				cotranslational protein targeting to membrane|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	protein binding|receptor activity			ovary(1)	1			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			GAAAATTAATGAACTTCCACA	0.368													5	41	---	---	---	---	PASS
JPH1	56704	broad.mit.edu	37	8	75157351	75157351	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75157351C>T	uc003yae.2	-	4	1358	c.1318G>A	c.(1318-1320)GAA>AAA	p.E440K	JPH1_uc003yaf.2_Missense_Mutation_p.E440K|JPH1_uc003yag.1_Missense_Mutation_p.E304K	NM_020647	NP_065698	Q9HDC5	JPH1_HUMAN	junctophilin 1	440	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane				ovary(1)	1	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			GGTACCTTTTCTTCTGGATTT	0.413													10	78	---	---	---	---	PASS
HEY1	23462	broad.mit.edu	37	8	80679445	80679445	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80679445G>C	uc003ybm.2	-						HEY1_uc010lzq.2_5'Flank|HEY1_uc003ybl.2_Intron	NM_012258	NP_036390	Q9Y5J3	HEY1_HUMAN	hairy/enhancer-of-split related with YRPW motif						angiogenesis|negative regulation of Notch signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|Notch signaling pathway|transcription, DNA-dependent	nucleus	DNA binding|protein binding			lung(3)	3	all_lung(9;5.1e-05)		Epithelial(68;0.076)|all cancers(69;0.179)			AGAGTGTAAAGAGACTCACTC	0.373													33	207	---	---	---	---	PASS
CPNE3	8895	broad.mit.edu	37	8	87552511	87552511	+	Missense_Mutation	SNP	C	G	G	rs139619960	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87552511C>G	uc003ydv.2	+	8	744	c.582C>G	c.(580-582)TTC>TTG	p.F194L		NM_003909	NP_003900	O75131	CPNE3_HUMAN	copine III	194	C2 2.				lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2						GGAGGCCTTTCAAGATCTCTC	0.303													4	109	---	---	---	---	PASS
CPNE3	8895	broad.mit.edu	37	8	87552528	87552528	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87552528C>G	uc003ydv.2	+	8	761	c.599C>G	c.(598-600)TCA>TGA	p.S200*		NM_003909	NP_003900	O75131	CPNE3_HUMAN	copine III	200	C2 2.				lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2						TCTCTTAACTCACTGTGTTAC	0.284													5	100	---	---	---	---	PASS
MTDH	92140	broad.mit.edu	37	8	98711993	98711993	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98711993G>A	uc003yhz.2	+	7	1388	c.1060G>A	c.(1060-1062)GAG>AAG	p.E354K	MTDH_uc010mbf.2_Intron	NM_178812	NP_848927	Q86UE4	LYRIC_HUMAN	metadherin	354	Cytoplasmic (Potential).				lipopolysaccharide-mediated signaling pathway|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of angiogenesis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein kinase B signaling cascade	apical plasma membrane|endoplasmic reticulum membrane|integral to membrane|intercellular canaliculus|nuclear body|nuclear membrane|nucleolus|perinuclear region of cytoplasm|tight junction	NF-kappaB binding|RNA polymerase II transcription factor binding|transcription coactivator activity			liver(1)|central_nervous_system(1)	2	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			GTCTACTGCTGAGCCAGTTTC	0.358													17	75	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100133458	100133458	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100133458C>T	uc003yiv.2	+	8	1102	c.991C>T	c.(991-993)CAA>TAA	p.Q331*	VPS13B_uc003yiw.2_Nonsense_Mutation_p.Q331*|VPS13B_uc003yit.2_Nonsense_Mutation_p.Q331*|VPS13B_uc003yiu.1_Nonsense_Mutation_p.Q331*|VPS13B_uc003yis.2_Nonsense_Mutation_p.Q331*|VPS13B_uc011lgy.1_Nonsense_Mutation_p.Q207*	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	331					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GCATAAAGGTCAAGAGTTATA	0.398													5	28	---	---	---	---	PASS
EIF3E	3646	broad.mit.edu	37	8	109226922	109226922	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109226922C>T	uc003ymu.2	-	10	1003	c.975G>A	c.(973-975)TTG>TTA	p.L325L	EIF3E_uc003ymt.2_Silent_p.L276L|EIF3E_uc003ymv.2_Silent_p.L232L|EIF3E_uc010mci.1_Intron	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	325	PCI.				negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			GACAAGCCACCAAGAAGAAGT	0.383													7	32	---	---	---	---	PASS
TMEM71	137835	broad.mit.edu	37	8	133726302	133726302	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133726302G>C	uc003ytp.2	-						TMEM71_uc003ytm.1_Intron|TMEM71_uc003ytn.2_Intron|TMEM71_uc003yto.2_Intron	NM_144649	NP_653250	Q6P5X7	TMM71_HUMAN	transmembrane protein 71 isoform 1							integral to membrane				ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TTCACATCTTGAGTGAAACAG	0.373													3	31	---	---	---	---	PASS
PTK2	5747	broad.mit.edu	37	8	141874446	141874446	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141874446C>T	uc003yvu.2	-	5	645	c.415G>A	c.(415-417)GAA>AAA	p.E139K	PTK2_uc003yvr.2_Missense_Mutation_p.E38K|PTK2_uc003yvs.2_Missense_Mutation_p.E139K|PTK2_uc003yvt.2_Missense_Mutation_p.E161K|PTK2_uc003yvv.2_Missense_Mutation_p.E26K|PTK2_uc011ljr.1_Missense_Mutation_p.E139K	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a	139	FERM.				axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			GGCTTATCTTCAGTAAACTGG	0.274													10	76	---	---	---	---	PASS
SLC45A4	57210	broad.mit.edu	37	8	142225950	142225950	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142225950C>T	uc003ywd.1	-	6	2004	c.1696G>A	c.(1696-1698)GCC>ACC	p.A566T	SLC45A4_uc003ywc.1_Missense_Mutation_p.A566T|SLC45A4_uc010meq.1_Missense_Mutation_p.A564T	NM_001080431	NP_001073900	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4	617	Helical; (Potential).				transport	integral to membrane				ovary(2)	2	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GTGACCATGGCGACGTAGACG	0.602													7	46	---	---	---	---	PASS
FAM83H	286077	broad.mit.edu	37	8	144810875	144810875	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144810875C>G	uc003yzk.2	-	5	825	c.756G>C	c.(754-756)GAG>GAC	p.E252D	FAM83H_uc010mfk.1_5'Flank	NM_198488	NP_940890	Q6ZRV2	FA83H_HUMAN	FAM83H	252					biomineral tissue development					lung(1)|central_nervous_system(1)|pancreas(1)	3	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GGTGGATCTTCTCAAAGGACC	0.662													3	32	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144998412	144998412	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144998412C>G	uc003zaf.1	-	31	6266	c.6096G>C	c.(6094-6096)CTG>CTC	p.L2032L	PLEC_uc003zab.1_Silent_p.L1895L|PLEC_uc003zac.1_Silent_p.L1899L|PLEC_uc003zad.2_Silent_p.L1895L|PLEC_uc003zae.1_Silent_p.L1863L|PLEC_uc003zag.1_Silent_p.L1873L|PLEC_uc003zah.2_Silent_p.L1881L|PLEC_uc003zaj.2_Silent_p.L1922L	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	2032	Central fibrous rod domain.|Potential.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GCAGCTGGGCCAGGCGCTCCT	0.711													4	14	---	---	---	---	PASS
GPAA1	8733	broad.mit.edu	37	8	145140656	145140656	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145140656G>A	uc003zax.2	+							NM_003801	NP_003792	O43292	GPAA1_HUMAN	glycosylphosphatidylinositol anchor attachment						attachment of GPI anchor to protein|C-terminal protein lipidation|protein complex assembly|protein retention in ER lumen	GPI-anchor transamidase complex	tubulin binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGTATGTATGGATCAGCCCCA	0.627													14	87	---	---	---	---	PASS
NFKBIL2	4796	broad.mit.edu	37	8	145657729	145657729	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145657729G>A	uc011llg.1	-	23	3689	c.3674C>T	c.(3673-3675)TCC>TTC	p.S1225F	uc011llh.1_5'Flank	NM_013432	NP_038460	Q96HA7	TONSL_HUMAN	NF-kappa-B inhibitor-like protein 2	1225					cytoplasmic sequestering of transcription factor|double-strand break repair via homologous recombination|replication fork processing	cytoplasm|nuclear replication fork	histone binding|transcription corepressor activity				0	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			GGCTGCCACGGAGCTGAGCTC	0.627													11	81	---	---	---	---	PASS
VLDLR	7436	broad.mit.edu	37	9	2648199	2648199	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2648199C>T	uc003zhk.1	+						VLDLR_uc003zhl.1_Intron|VLDLR_uc003zhm.1_Intron|VLDLR_uc003zhn.1_Intron	NM_003383	NP_003374	P98155	VLDLR_HUMAN	very low density lipoprotein receptor isoform a						cholesterol metabolic process|endocytosis|lipid transport|memory|very-low-density lipoprotein particle clearance	coated pit|integral to membrane|membrane fraction|plasma membrane|very-low-density lipoprotein particle	apolipoprotein binding|calcium ion binding|low-density lipoprotein receptor activity|very-low-density lipoprotein particle receptor activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		CAATTCTTTTCCTACCTAGAC	0.388													7	32	---	---	---	---	PASS
RANBP6	26953	broad.mit.edu	37	9	6013795	6013795	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6013795C>T	uc003zjr.2	-	1	1824	c.1813G>A	c.(1813-1815)GAT>AAT	p.D605N	RANBP6_uc011lmf.1_Missense_Mutation_p.D253N|RANBP6_uc003zjs.2_Missense_Mutation_p.D193N	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	605					protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		TGAGGGTCATCATCTTCCATA	0.388													11	193	---	---	---	---	PASS
TYRP1	7306	broad.mit.edu	37	9	12695566	12695566	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:12695566G>A	uc003zkv.3	+	3	615	c.437G>A	c.(436-438)CGG>CAG	p.R146Q		NM_000550	NP_000541	P17643	TYRP1_HUMAN	tyrosinase-related protein 1 precursor	146	Lumenal, melanosome (Potential).				melanin biosynthetic process	clathrin-coated endocytic vesicle membrane|endosome membrane|integral to membrane|melanosome membrane	copper ion binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen|protein heterodimerization activity|protein homodimerization activity			lung(1)	1		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		CACTTTGTCCGGGCCCTGGAT	0.453									Oculocutaneous_Albinism				4	63	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14737460	14737460	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14737460C>T	uc003zlm.2	-	37	7064	c.6474G>A	c.(6472-6474)GGG>GGA	p.G2158G	FREM1_uc010mic.2_RNA|FREM1_uc003zlk.2_RNA|FREM1_uc003zll.2_Silent_p.G694G	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	2158	C-type lectin.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		TTTGCCATTTCCCTTGTCTTT	0.473													3	36	---	---	---	---	PASS
DNAI1	27019	broad.mit.edu	37	9	34500823	34500823	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34500823C>G	uc003zum.2	+	11	1198	c.1005C>G	c.(1003-1005)GTC>GTG	p.V335V		NM_012144	NP_036276	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	335					cell projection organization	cilium axoneme|cytoplasm|dynein complex|microtubule	motor activity				0	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		GCCTGTCCGTCACTGCCCTCT	0.542									Kartagener_syndrome		OREG0019152	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	17	---	---	---	---	PASS
IL11RA	3590	broad.mit.edu	37	9	34658549	34658549	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34658549G>C	uc003zvi.2	+	8	2035	c.679G>C	c.(679-681)GAG>CAG	p.E227Q	IL11RA_uc011loq.1_Missense_Mutation_p.E227Q|IL11RA_uc003zvj.2_Missense_Mutation_p.E227Q|IL11RA_uc003zvk.2_Missense_Mutation_p.E227Q|IL11RA_uc010mke.2_Missense_Mutation_p.E109Q|IL11RA_uc003zvl.2_RNA	NM_004512	NP_004503	Q14626	I11RA_HUMAN	interleukin 11 receptor, alpha isoform 1	227	Extracellular (Potential).|Fibronectin type-III 2.					integral to plasma membrane	cytokine receptor activity			skin(1)	1	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.174)	Oprelvekin(DB00038)	CCTGCGGGTAGAGTCAGTACC	0.607													8	46	---	---	---	---	PASS
UNC13B	10497	broad.mit.edu	37	9	35377653	35377653	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35377653G>C	uc003zwq.2	+	15	2069	c.1777G>C	c.(1777-1779)GAT>CAT	p.D593H	UNC13B_uc003zwr.2_Missense_Mutation_p.D593H	NM_006377	NP_006368	O14795	UN13B_HUMAN	UNC13 (C. elegans)-like	593	C2 2.				excretion|induction of apoptosis|intracellular signal transduction	cell junction|Golgi apparatus|synapse	metal ion binding|receptor activity			ovary(3)|large_intestine(1)|skin(1)	5	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GAGTGTACTGGATGGCACCTC	0.522													4	17	---	---	---	---	PASS
MELK	9833	broad.mit.edu	37	9	36583616	36583616	+	Intron	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36583616C>A	uc003zzn.2	+						MELK_uc011lpm.1_Intron|MELK_uc011lpn.1_Intron|MELK_uc011lpo.1_Intron|MELK_uc010mll.2_Intron|MELK_uc011lpp.1_Intron|MELK_uc010mlm.2_Intron|MELK_uc011lpq.1_Intron|MELK_uc011lpr.1_Intron|MELK_uc011lps.1_Intron	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase							cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			ATACATTTTCCTACTTAGGTG	0.348													4	30	---	---	---	---	PASS
VPS13A	23230	broad.mit.edu	37	9	79936432	79936432	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79936432C>T	uc004akr.2	+	44	5860	c.5600C>T	c.(5599-5601)TCT>TTT	p.S1867F	VPS13A_uc004akp.3_Missense_Mutation_p.S1867F|VPS13A_uc004akq.3_Missense_Mutation_p.S1867F|VPS13A_uc004aks.2_Missense_Mutation_p.S1828F|VPS13A_uc004akt.2_Missense_Mutation_p.S207F	NM_033305	NP_150648	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13A isoform A	1867					Golgi to endosome transport|protein transport	intracellular	protein binding			pancreas(3)|skin(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)	10						GCCACTGGATCTTCAGCTGAC	0.338													12	47	---	---	---	---	PASS
C9orf64	84267	broad.mit.edu	37	9	86554522	86554522	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86554522G>A	uc004anb.2	-	4	1178	c.930C>T	c.(928-930)TCC>TCT	p.S310S	C9orf64_uc004anc.2_Silent_p.S169S	NM_032307	NP_115683	Q5T6V5	CI064_HUMAN	hypothetical protein LOC84267	310											0						CCAGAAGAATGGAATTGATCT	0.413													5	55	---	---	---	---	PASS
ECM2	1842	broad.mit.edu	37	9	95272246	95272246	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95272246G>C	uc004ash.2	-	6	1306	c.1241C>G	c.(1240-1242)TCT>TGT	p.S414C	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ECM2_uc004asf.3_Missense_Mutation_p.S392C|ECM2_uc011lty.1_Missense_Mutation_p.S414C|ECM2_uc004asg.2_Missense_Mutation_p.S392C	NM_001393	NP_001384	O94769	ECM2_HUMAN	extracellular matrix protein 2 precursor	414	LRR 2.				cell-matrix adhesion		integrin binding			ovary(1)|skin(1)	2						TTCTAATGTAGATGGCAATTG	0.299													3	41	---	---	---	---	PASS
CDC14B	8555	broad.mit.edu	37	9	99327720	99327720	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99327720G>A	uc004awj.2	-	2	658	c.206C>T	c.(205-207)TCA>TTA	p.S69L	CDC14B_uc004awk.2_Missense_Mutation_p.S69L|CDC14B_uc004awl.2_RNA|CDC14B_uc004awi.2_Missense_Mutation_p.S32L	NM_033331	NP_201588	O60729	CC14B_HUMAN	CDC14 homolog B isoform 2	69	A.				activation of anaphase-promoting complex activity|DNA repair|G2/M transition DNA damage checkpoint	nucleolus|nucleoplasm	protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				ATGTACATTTGATGCACTCTT	0.318													5	73	---	---	---	---	PASS
ZNF189	7743	broad.mit.edu	37	9	104171183	104171183	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104171183G>A	uc004bbh.1	+	3	1409	c.1133G>A	c.(1132-1134)GGG>GAG	p.G378E	ZNF189_uc004bbg.1_Missense_Mutation_p.G336E|ZNF189_uc004bbi.1_Missense_Mutation_p.G364E|ZNF189_uc011lvk.1_Missense_Mutation_p.G363E	NM_003452	NP_003443	O75820	ZN189_HUMAN	zinc finger protein 189 isoform 1	378	C2H2-type 9.				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|kidney(1)|central_nervous_system(1)	6		Acute lymphoblastic leukemia(62;0.0559)				AAAGAGTGTGGGAAAAGTTTC	0.418													4	47	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104499904	104499904	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104499904C>T	uc004bbp.1	-	1	959	c.358G>A	c.(358-360)GAG>AAG	p.E120K	GRIN3A_uc004bbq.1_Missense_Mutation_p.E120K	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	120	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	CACAGGGCCTCCGCCCTGGCG	0.716													7	9	---	---	---	---	PASS
BSPRY	54836	broad.mit.edu	37	9	116132318	116132318	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116132318G>A	uc004bhg.3	+	6	1153	c.1105G>A	c.(1105-1107)GAG>AAG	p.E369K	BSPRY_uc010muw.2_3'UTR	NM_017688	NP_060158	Q5W0U4	BSPRY_HUMAN	B-box and SPRY domain containing	369	B30.2/SPRY.				calcium ion transport	cytoplasm|membrane	zinc ion binding			breast(1)	1						GCTCTTCTATGAGCCAGCCTC	0.617													7	51	---	---	---	---	PASS
ORM1	5004	broad.mit.edu	37	9	117086080	117086080	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117086080G>C	uc004bik.3	+	2	363	c.252G>C	c.(250-252)CAG>CAC	p.Q84H	ORM1_uc011lxo.1_Missense_Mutation_p.Q84H	NM_000607	NP_000598	P02763	A1AG1_HUMAN	orosomucoid 1 precursor	84					acute-phase response|regulation of immune system process|transport	extracellular space	protein binding				0		Myeloproliferative disorder(63;0.163)			Acenocoumarol(DB01418)|Alfentanil(DB00802)|Aprindine(DB01429)|Disopyramide(DB00280)|Penbutolol(DB01359)|Phenprocoumon(DB00946)|Quinidine(DB00908)|Tamsulosin(DB00706)	GAGAGTACCAGACCCGGTGAG	0.537													3	57	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	121976287	121976287	+	Missense_Mutation	SNP	A	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121976287A>C	uc004bkc.2	-	6	1288	c.832T>G	c.(832-834)TGC>GGC	p.C278G	DBC1_uc004bkd.2_Missense_Mutation_p.C278G	NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	278					cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						GTGATGGGGCAGTTGCACTGC	0.557													5	78	---	---	---	---	PASS
OR1J4	26219	broad.mit.edu	37	9	125281780	125281780	+	Missense_Mutation	SNP	G	A	A	rs116874912	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125281780G>A	uc011lyw.1	+	1	361	c.361G>A	c.(361-363)GAT>AAT	p.D121N		NM_001004452	NP_001004452	Q8NGS1	OR1J4_HUMAN	olfactory receptor, family 1, subfamily J,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AATGGCATACGATCGGTATGT	0.433													6	105	---	---	---	---	PASS
FAM125B	89853	broad.mit.edu	37	9	129102821	129102821	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129102821C>G	uc004bqh.1	+	2	197	c.116C>G	c.(115-117)TCA>TGA	p.S39*	FAM125B_uc004bqg.1_Nonsense_Mutation_p.S39*|FAM125B_uc011lzy.1_Nonsense_Mutation_p.S24*	NM_033446	NP_258257	Q9H7P6	F125B_HUMAN	hypothetical protein LOC89853 isoform 1	39					protein transport	late endosome membrane					0						AAAGACCTCTCAGAAGCCTTG	0.463													12	71	---	---	---	---	PASS
PRDM12	59335	broad.mit.edu	37	9	133542164	133542164	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133542164G>T	uc004bzt.1	+	2	453	c.393G>T	c.(391-393)AAG>AAT	p.K131N		NM_021619	NP_067632	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	131	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		ACATCTGCAAGAACAACAACC	0.692													4	64	---	---	---	---	PASS
NTNG2	84628	broad.mit.edu	37	9	135042303	135042303	+	Missense_Mutation	SNP	G	C	C	rs138493692		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135042303G>C	uc004cbh.2	+	2	861	c.85G>C	c.(85-87)GAT>CAT	p.D29H		NM_032536	NP_115925	Q96CW9	NTNG2_HUMAN	netrin G2 precursor	29					axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		GGTGACCACAGATGAGGGCCC	0.607													16	84	---	---	---	---	PASS
GRIN1	2902	broad.mit.edu	37	9	140036545	140036545	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140036545C>G	uc004clk.2	+	2	669	c.339C>G	c.(337-339)TTC>TTG	p.F113L	GRIN1_uc004cli.1_5'UTR|GRIN1_uc004clj.1_Missense_Mutation_p.F110L|GRIN1_uc004cll.2_Missense_Mutation_p.F113L|GRIN1_uc004clm.2_Missense_Mutation_p.F113L|GRIN1_uc004cln.2_Missense_Mutation_p.F110L|GRIN1_uc004clo.2_Missense_Mutation_p.F110L	NM_007327	NP_015566	Q05586	NMDZ1_HUMAN	NMDA receptor 1 isoform NR1-3 precursor	113	Extracellular (Potential).				ionotropic glutamate receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|regulation of excitatory postsynaptic membrane potential|response to ethanol|visual learning	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane|synaptic vesicle|synaptosome	calcium ion binding|calmodulin binding|extracellular-glutamate-gated ion channel activity|glutamate binding|glycine binding			skin(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	CAGCCGGCTTCTACCGCATAC	0.622													6	88	---	---	---	---	PASS
CACNA1B	774	broad.mit.edu	37	9	140997167	140997167	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140997167C>T	uc004cog.2	+	37	5372	c.5227C>T	c.(5227-5229)CGC>TGC	p.R1743C	CACNA1B_uc004coi.2_Missense_Mutation_p.R955C|CACNA1B_uc004cok.1_Intron|CACNA1B_uc010ncp.1_Intron	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	1743	EF-hand.|Cytoplasmic (Potential).|By similarity.				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	TTCCAGTGGGCGCATCAGTTA	0.438													4	16	---	---	---	---	PASS
CACNA1B	774	broad.mit.edu	37	9	141010114	141010114	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:141010114C>T	uc004cog.2	+	41	5905	c.5760C>T	c.(5758-5760)CTC>CTT	p.L1920L	CACNA1B_uc004coi.2_Silent_p.L1132L	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	1920	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	CCACCTCCCTCAGCAATGGCG	0.577													6	31	---	---	---	---	PASS
IDI2	91734	broad.mit.edu	37	10	1070526	1070526	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1070526C>T	uc001ifv.1	-	2	203	c.138G>A	c.(136-138)GAG>GAA	p.E46E	C10orf110_uc010qaf.1_Intron|C10orf110_uc001ifx.3_Intron|C10orf110_uc001ifw.3_Intron|C10orf110_uc001ify.3_Intron	NM_033261	NP_150286	Q9BXS1	IDI2_HUMAN	isopentenyl-diphosphate delta isomerase 2	46					carotenoid biosynthetic process|cholesterol biosynthetic process	cytosol|peroxisome	hydrolase activity|isopentenyl-diphosphate delta-isomerase activity|metal ion binding				0		Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.143)	Epithelial(11;0.067)|OV - Ovarian serous cystadenocarcinoma(14;0.169)|all cancers(11;0.192)		GGCTACCTTTCTCAATGTTTT	0.493													5	36	---	---	---	---	PASS
DCLRE1C	64421	broad.mit.edu	37	10	14995991	14995991	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14995991G>A	uc001inn.2	-	1	104	c.19C>T	c.(19-21)CAG>TAG	p.Q7*	DCLRE1C_uc010qbx.1_Nonsense_Mutation_p.Q7*|DCLRE1C_uc001inl.2_5'UTR|DCLRE1C_uc009xji.2_5'UTR|DCLRE1C_uc001inm.2_5'UTR|DCLRE1C_uc001ino.2_5'UTR|DCLRE1C_uc009xjh.2_RNA|DCLRE1C_uc001inp.2_5'UTR|DCLRE1C_uc001inq.2_5'UTR|DCLRE1C_uc001inr.2_5'UTR	NM_001033855	NP_001029027	Q96SD1	DCR1C_HUMAN	artemis protein isoform a	7					DNA recombination	nucleus	5'-3' exonuclease activity|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)	1						TCGGCCATCTGCCCCTCGAAA	0.622								Involved_in_tolerance_or_repair_of_DNA_crosslinks|NHEJ					7	40	---	---	---	---	PASS
PARD3	56288	broad.mit.edu	37	10	34688326	34688326	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34688326G>A	uc010qej.1	-	7	822	c.822C>T	c.(820-822)CTC>CTT	p.L274L	PARD3_uc010qek.1_Silent_p.L274L|PARD3_uc010qel.1_Silent_p.L274L|PARD3_uc010qem.1_Silent_p.L274L|PARD3_uc010qen.1_Silent_p.L274L|PARD3_uc010qeo.1_Silent_p.L274L|PARD3_uc010qep.1_Silent_p.L230L|PARD3_uc010qeq.1_Silent_p.L230L|PARD3_uc001ixo.1_Silent_p.L4L|PARD3_uc001ixp.1_Silent_p.L139L|PARD3_uc001ixq.1_Silent_p.L274L|PARD3_uc001ixr.1_Silent_p.L274L|PARD3_uc001ixt.1_Silent_p.L95L|PARD3_uc001ixu.1_Silent_p.L230L	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog	274	PDZ 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				GGACTTCTACGAGCTTTACCA	0.398													4	65	---	---	---	---	PASS
IPMK	253430	broad.mit.edu	37	10	59976022	59976022	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:59976022C>T	uc001jkb.2	-	4	753	c.430G>A	c.(430-432)GAT>AAT	p.D144N		NM_152230	NP_689416	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase	144	Substrate binding (By similarity).					nucleus	ATP binding|inositol trisphosphate 6-kinase activity			ovary(1)	1						ATCTTTACATCCATTATACAG	0.328													5	25	---	---	---	---	PASS
KIAA1274	27143	broad.mit.edu	37	10	72297564	72297564	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72297564C>G	uc001jrd.3	+						KIAA1274_uc001jre.3_5'Flank	NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274											ovary(2)|central_nervous_system(1)	3						TCCTCTCTCTCAGGGAAGCGG	0.567													7	66	---	---	---	---	PASS
NDST2	8509	broad.mit.edu	37	10	75567715	75567715	+	Silent	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75567715G>C	uc001jvk.2	-	3	1236	c.432C>G	c.(430-432)CTC>CTG	p.L144L	NDST2_uc010qks.1_5'Flank|NDST2_uc010qkt.1_Silent_p.L21L|NDST2_uc009xro.2_5'Flank|NDST2_uc010qku.1_Silent_p.L21L	NM_003635	NP_003626	P52849	NDST2_HUMAN	heparan glucosaminyl	144	Lumenal (Potential).|Heparan sulfate N-deacetylase 2.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			ovary(1)	1	Prostate(51;0.0112)					TGACATACTTGAGCAGGTTCT	0.527													8	37	---	---	---	---	PASS
EIF5AL1	143244	broad.mit.edu	37	10	81272751	81272751	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81272751G>C	uc009xrx.2	+	1	395	c.346G>C	c.(346-348)GAG>CAG	p.E116Q	uc010qls.1_5'Flank	NM_001099692	NP_001093162	Q6IS14	IF5AL_HUMAN	eukaryotic translation initiation factor 5A-like	116					mRNA transport|peptidyl-lysine modification to hypusine|positive regulation of translational elongation|positive regulation of translational termination|protein transport|translational frameshifting|transmembrane transport	endoplasmic reticulum membrane|nuclear pore	ribosome binding|translation elongation factor activity				0	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			TCGTCTCCCTGAGGGAGACCT	0.537													3	59	---	---	---	---	PASS
FAS	355	broad.mit.edu	37	10	90773980	90773980	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90773980G>A	uc001kfr.2	+	9	1127	c.781G>A	c.(781-783)GAG>AAG	p.E261K	FAS_uc010qna.1_RNA|FAS_uc001kfs.2_3'UTR|FAS_uc001kft.2_Missense_Mutation_p.E240K|FAS_uc010qnb.1_RNA|FAS_uc010qnc.1_RNA|FAS_uc001kfw.2_3'UTR|FAS_uc010qnd.1_RNA|FAS_uc010qne.1_RNA|FAS_uc009xtp.2_RNA	NM_000043	NP_000034	P25445	TNR6_HUMAN	tumor necrosis factor receptor superfamily,	261	Death.|Interaction with HIPK3 (By similarity).|Cytoplasmic (Potential).			E->K: Loss of interaction with FADD.	activation of caspase activity|activation of pro-apoptotic gene products|anti-apoptosis|cellular response to mechanical stimulus|positive regulation of necrotic cell death	cytosol|extracellular region|integral to membrane|soluble fraction	identical protein binding|kinase binding			upper_aerodigestive_tract(1)|breast(1)	2		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)		CAAAATAGATGAGATCAAGAA	0.378									Autoimmune_Lymphoproliferative_syndrome_type_I				5	45	---	---	---	---	PASS
PANK1	53354	broad.mit.edu	37	10	91353697	91353697	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91353697C>G	uc001kgp.1	-	4	1516	c.1360G>C	c.(1360-1362)GAG>CAG	p.E454Q	PANK1_uc001kgn.1_Missense_Mutation_p.E229Q|PANK1_uc001kgo.1_Intron|PANK1_uc009xtu.1_Missense_Mutation_p.E256Q|uc001kgq.1_5'Flank|MIR107_hsa-mir-107|MI0000114_5'Flank	NM_148977	NP_683878	Q8TE04	PANK1_HUMAN	pantothenate kinase 1 isoform alpha	454					coenzyme A biosynthetic process|pantothenate metabolic process	cytosol|nucleus	ATP binding|pantothenate kinase activity				0					Bezafibrate(DB01393)	TCAAAGGTCTCACAACCAGTC	0.408													7	102	---	---	---	---	PASS
KIF20B	9585	broad.mit.edu	37	10	91497810	91497810	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91497810C>T	uc001kgs.1	+	20	3284	c.3212C>T	c.(3211-3213)TCT>TTT	p.S1071F	KIF20B_uc001kgr.1_Missense_Mutation_p.S1031F|KIF20B_uc001kgt.1_Missense_Mutation_p.S282F|KIF20B_uc009xtw.1_RNA	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1	1071					cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						GTGAAGGCCTCTTCCAAAAAA	0.348													8	67	---	---	---	---	PASS
BTAF1	9044	broad.mit.edu	37	10	93757460	93757460	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93757460C>T	uc001khr.2	+	25	3710	c.3612C>T	c.(3610-3612)TTC>TTT	p.F1204F		NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription	1204	HEAT 8.				negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				GTGTGAGATTCATGGCCACGC	0.378													6	48	---	---	---	---	PASS
IDE	3416	broad.mit.edu	37	10	94268606	94268606	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94268606G>A	uc001kia.2	-	7	1015	c.939C>T	c.(937-939)CTC>CTT	p.L313L		NM_004969	NP_004960	P14735	IDE_HUMAN	insulin-degrading enzyme isoform 1 precursor	313					beta-amyloid metabolic process|bradykinin catabolic process|interspecies interaction between organisms|sex differentiation	cell surface|extracellular space|soluble fraction	ATP binding|metalloendopeptidase activity|protein homodimerization activity|signal transducer activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3					Bacitracin(DB00626)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	ATGTCACATAGAGATTCCTAA	0.363													7	102	---	---	---	---	PASS
MYOF	26509	broad.mit.edu	37	10	95088619	95088619	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95088619G>A	uc001kin.2	-	45	5155	c.5032C>T	c.(5032-5034)CAA>TAA	p.Q1678*	MYOF_uc001kio.2_Nonsense_Mutation_p.Q1665*|MYOF_uc009xue.2_RNA	NM_013451	NP_038479	Q9NZM1	MYOF_HUMAN	myoferlin isoform a	1678	Cytoplasmic (Potential).				blood circulation|muscle contraction|plasma membrane repair	caveola|cytoplasmic vesicle membrane|integral to membrane|nuclear membrane	phospholipid binding|protein binding			ovary(3)|breast(1)	4						GCGACATTTTGAAGCAGCTGT	0.493													41	262	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	95891933	95891933	+	Silent	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95891933C>A	uc001kjk.2	+	3	1843	c.1209C>A	c.(1207-1209)ATC>ATA	p.I403I	PLCE1_uc010qnx.1_Silent_p.I403I|PLCE1_uc001kjm.2_Silent_p.I95I	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	403					activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				ATTCACAGATCTACAATGCAG	0.388													7	41	---	---	---	---	PASS
SORBS1	10580	broad.mit.edu	37	10	97135751	97135751	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97135751C>T	uc001kkp.2	-	17	1761	c.1716G>A	c.(1714-1716)TCG>TCA	p.S572S	SORBS1_uc001kkk.2_Intron|SORBS1_uc001kkl.2_Silent_p.S174S|SORBS1_uc001kkn.2_Silent_p.S359S|SORBS1_uc001kkm.2_Silent_p.S428S|SORBS1_uc001kko.2_Silent_p.S594S|SORBS1_uc001kkq.2_Silent_p.S457S|SORBS1_uc001kkr.2_Intron|SORBS1_uc001kks.2_Intron|SORBS1_uc001kkt.2_Intron|SORBS1_uc001kku.2_Intron|SORBS1_uc001kkv.2_Intron|SORBS1_uc001kkw.2_Silent_p.S526S|SORBS1_uc010qoe.1_Intron|SORBS1_uc010qof.1_Intron	NM_001034954	NP_001030126	Q9BX66	SRBS1_HUMAN	sorbin and SH3 domain containing 1 isoform 3	572					focal adhesion assembly|glucose transport|insulin receptor signaling pathway|muscle contraction|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of lipid biosynthetic process|stress fiber assembly	centrosome|cytosol|focal adhesion|membrane raft|nucleus|stress fiber|zonula adherens	actin binding|insulin receptor binding|SH3/SH2 adaptor activity			breast(1)	1		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		ACTCCAATTCCGAAAAGAATT	0.378													3	42	---	---	---	---	PASS
CUTC	51076	broad.mit.edu	37	10	101496079	101496079	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101496079G>C	uc001kqd.3	+						CUTC_uc010qpk.1_Intron|CUTC_uc001kqe.3_Intron	NM_015960	NP_057044	Q9NTM9	CUTC_HUMAN	cutC copper transporter homolog						copper ion homeostasis|copper ion transport|protein tetramerization	cytoplasm|nucleus	copper ion binding			breast(1)	1		Colorectal(252;0.234)		Epithelial(162;3e-10)|all cancers(201;2.37e-08)		GAGGAGGTAAGAGAAATCAGA	0.408													5	44	---	---	---	---	PASS
NFKB2	4791	broad.mit.edu	37	10	104160985	104160985	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104160985C>T	uc001kvb.2	+	19	2385	c.2120C>T	c.(2119-2121)TCA>TTA	p.S707L	NFKB2_uc001kva.2_Missense_Mutation_p.S707L|NFKB2_uc001kvd.2_Missense_Mutation_p.S707L|NFKB2_uc009xxc.2_Missense_Mutation_p.S707L	NM_001077494	NP_001070962	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene	707			Missing (in truncated form p80HT).|Missing (in truncated form LB40).|Missing (in truncated form EB308).		innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	Bcl3/NF-kappaB2 complex|cytosol|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			lung(3)	3		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)		CCACTGCCTTCACCCCCTACC	0.617			T	IGH@	B-NHL								4	56	---	---	---	---	PASS
PCGF6	84108	broad.mit.edu	37	10	105108522	105108522	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105108522G>C	uc001kwt.2	-	3	576	c.508C>G	c.(508-510)CCA>GCA	p.P170A	PCGF6_uc001kwu.2_Missense_Mutation_p.P170A|PCGF6_uc009xxk.2_RNA|PCGF6_uc009xxl.2_RNA|PCGF6_uc009xxm.2_RNA	NM_001011663	NP_001011663	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6 isoform a	170	RING-type.				negative regulation of transcription, DNA-dependent	PcG protein complex	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			kidney(1)	1		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		TTGCATTTTGGACATCTGTTG	0.289													5	47	---	---	---	---	PASS
PDCD11	22984	broad.mit.edu	37	10	105185029	105185029	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105185029G>A	uc001kwy.1	+	20	3139	c.3052G>A	c.(3052-3054)GAA>AAA	p.E1018K		NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11	1018					mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		TGAGGATGAAGAAGTGGATCC	0.552													3	42	---	---	---	---	PASS
INPP5F	22876	broad.mit.edu	37	10	121571450	121571450	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121571450C>T	uc001leo.2	+	15	2035	c.1869C>T	c.(1867-1869)CTC>CTT	p.L623L		NM_014937	NP_055752	Q9Y2H2	SAC2_HUMAN	inositol polyphosphate-5-phosphatase F	623							phosphoric ester hydrolase activity			ovary(2)	2		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		GCTGGGCCCTCATTGACTGTG	0.473													5	57	---	---	---	---	PASS
SEC23IP	11196	broad.mit.edu	37	10	121658415	121658415	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121658415C>G	uc001leu.1	+	2	712	c.640C>G	c.(640-642)CCA>GCA	p.P214A	SEC23IP_uc010qtc.1_Intron	NM_007190	NP_009121	Q9Y6Y8	S23IP_HUMAN	Sec23-interacting protein p125	214	Interaction with SEC23A.|Pro-rich.				Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		TGCTCATCCTCCACCTTCTGG	0.537													6	60	---	---	---	---	PASS
PLEKHA1	59338	broad.mit.edu	37	10	124184411	124184411	+	Splice_Site	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124184411G>A	uc001lge.1	+	10	870	c.747_splice	c.e10-1	p.S249_splice	PLEKHA1_uc001lgf.1_Splice_Site_p.S249_splice|PLEKHA1_uc001lgg.1_Splice_Site_p.S249_splice|PLEKHA1_uc001lgh.2_Splice_Site_p.S249_splice	NM_001001974	NP_001001974	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A						B cell receptor signaling pathway|cellular response to hydrogen peroxide|establishment of protein localization|negative regulation of protein kinase B signaling cascade|phosphatidylinositol 3-kinase cascade|ruffle organization	cytoplasm|nucleus|ruffle membrane	PDZ domain binding|phosphatidylinositol-3,4-bisphosphate binding			kidney(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TTTTCATACAGCGACATAATG	0.343													5	46	---	---	---	---	PASS
CUZD1	50624	broad.mit.edu	37	10	124596954	124596954	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124596954C>G	uc001lgq.2	-	4	897	c.565G>C	c.(565-567)GAT>CAT	p.D189H	CUZD1_uc001lgp.2_5'UTR|CUZD1_uc009yad.2_5'UTR|CUZD1_uc009yaf.2_Intron|CUZD1_uc001lgr.2_5'UTR|CUZD1_uc010qty.1_5'UTR|CUZD1_uc009yae.2_5'UTR|CUZD1_uc001lgs.2_Missense_Mutation_p.D189H|CUZD1_uc010qtz.1_Missense_Mutation_p.D189H	NM_022034	NP_071317	Q86UP6	CUZD1_HUMAN	CUB and zona pellucida-like domains 1 precursor	189	Extracellular (Potential).|CUB 2.				cell cycle|cell division|cell proliferation|substrate-dependent cell migration, cell attachment to substrate|trypsinogen activation	integral to membrane|transport vesicle membrane|zymogen granule membrane				ovary(1)|skin(1)	2		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		ATCTTGTAATCTTTCTCCACT	0.453													7	52	---	---	---	---	PASS
UROS	7390	broad.mit.edu	37	10	127500852	127500852	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127500852C>T	uc001liw.3	-	4	383	c.250G>A	c.(250-252)GAA>AAA	p.E84K	UROS_uc001liv.3_5'UTR|UROS_uc010quh.1_RNA|UROS_uc001lix.3_Missense_Mutation_p.E84K|UROS_uc001liy.3_RNA|UROS_uc001liz.2_RNA	NM_000375	NP_000366	P10746	HEM4_HUMAN	uroporphyrinogen III synthase	84					heme biosynthetic process|uroporphyrinogen III biosynthetic process	cytosol|mitochondrion	uroporphyrinogen-III synthase activity				0		all_lung(145;0.00756)|Lung NSC(174;0.0116)|Colorectal(57;0.0855)|all_neural(114;0.0937)|Breast(234;0.203)				AGAGACCTTTCCCAGACTGTA	0.403													4	64	---	---	---	---	PASS
FANK1	92565	broad.mit.edu	37	10	127697055	127697055	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127697055C>G	uc001ljh.3	+	8	889	c.785C>G	c.(784-786)TCT>TGT	p.S262C	FANK1_uc009yan.2_Missense_Mutation_p.S288C|FANK1_uc001lji.2_Missense_Mutation_p.S256C	NM_145235	NP_660278	Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains	262	ANK 5.					cytoplasm|nucleus				ovary(1)	1		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				AGGGTGGCCTCTCTTCTAATT	0.527													5	58	---	---	---	---	PASS
C10orf90	118611	broad.mit.edu	37	10	128193242	128193242	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128193242G>A	uc001ljq.2	-	3	648	c.527C>T	c.(526-528)GCG>GTG	p.A176V	C10orf90_uc001ljp.2_Missense_Mutation_p.A129V|C10orf90_uc010qum.1_Missense_Mutation_p.A273V|C10orf90_uc009yao.2_Missense_Mutation_p.A273V|C10orf90_uc001ljs.1_Missense_Mutation_p.A129V	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611	176										ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		AGCCGGGGGCGCCTGGAACAG	0.662											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	88	---	---	---	---	PASS
C10orf90	118611	broad.mit.edu	37	10	128202519	128202519	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128202519G>C	uc001ljq.2	-						C10orf90_uc010qum.1_Intron|C10orf90_uc009yao.2_Intron|C10orf90_uc001ljs.1_Intron	NM_001004298	NP_001004298	Q96M02	CJ090_HUMAN	hypothetical protein LOC118611											ovary(1)|skin(1)	2		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		CTAGGCAAAAGAAGATAATAT	0.343													7	49	---	---	---	---	PASS
PKP3	11187	broad.mit.edu	37	11	397562	397562	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:397562C>G	uc001lpc.2	+	4	1044	c.968C>G	c.(967-969)TCA>TGA	p.S323*		NM_007183	NP_009114	Q9Y446	PKP3_HUMAN	plakophilin 3	323	ARM 1.				cell adhesion	desmosome|nucleus	binding			skin(1)	1		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GACCTGCCCTCAGCAGTCAAG	0.607													7	41	---	---	---	---	PASS
OSBPL5	114879	broad.mit.edu	37	11	3114754	3114754	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3114754C>T	uc001lxk.2	-						OSBPL5_uc010qxq.1_Intron|OSBPL5_uc009ydw.2_Intron|OSBPL5_uc001lxl.2_Intron|OSBPL5_uc009ydx.2_Silent_p.*674*|OSBPL5_uc001lxj.2_Intron	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN	oxysterol-binding protein-like protein 5 isoform						cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TGACAGGCCTCACCTCTCGGA	0.662													10	64	---	---	---	---	PASS
OR52A1	23538	broad.mit.edu	37	11	5173510	5173510	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5173510C>T	uc010qyy.1	-	1	90	c.90G>A	c.(88-90)GGG>GGA	p.G30G		NM_012375	NP_036507	Q9UKL2	O52A1_HUMAN	olfactory receptor, family 52, subfamily A,	30	Helical; Name=1; (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAATGGAATCCCAATCCAGC	0.458													3	33	---	---	---	---	PASS
OR52B2	255725	broad.mit.edu	37	11	6191508	6191508	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6191508G>A	uc010qzy.1	-	1	49	c.49C>T	c.(49-51)CCT>TCT	p.P17S		NM_001004052	NP_001004052	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B,	17	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGATGCCAGGAAGGACAAAA	0.453													3	33	---	---	---	---	PASS
TUB	7275	broad.mit.edu	37	11	8122509	8122509	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8122509C>T	uc001mga.2	+	11	1501	c.1352C>T	c.(1351-1353)TCC>TTC	p.S451F	TUB_uc010rbk.1_Missense_Mutation_p.S457F|TUB_uc001mfy.2_Missense_Mutation_p.S506F	NM_177972	NP_813977	P50607	TUB_HUMAN	tubby isoform b	451					phagocytosis|positive regulation of phagocytosis|response to stimulus	cytoplasm|extracellular region|nucleus|plasma membrane				ovary(1)	1		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		ACACAGGCCTCCGTGAAGAAC	0.502													5	50	---	---	---	---	PASS
DENND5A	23258	broad.mit.edu	37	11	9199895	9199895	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9199895G>C	uc001mhl.2	-	8	1945	c.1690C>G	c.(1690-1692)CAG>GAG	p.Q564E	DENND5A_uc010rbw.1_Missense_Mutation_p.Q564E|DENND5A_uc010rbx.1_RNA	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1	564	dDENN.									liver(1)	1						GGCTCAGGCTGATCTGACAGA	0.428													3	26	---	---	---	---	PASS
KIF18A	81930	broad.mit.edu	37	11	28057890	28057890	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28057890C>T	uc001msc.2	-	14	2452	c.2270G>A	c.(2269-2271)AGA>AAA	p.R757K		NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A	757					blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2						TTCTTTTCTTCTATTATGAGG	0.363													4	34	---	---	---	---	PASS
ELP4	26610	broad.mit.edu	37	11	31785081	31785081	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31785081G>A	uc001mtb.2	+						ELP4_uc001mtc.2_Missense_Mutation_p.E519K|ELP4_uc010rdz.1_Missense_Mutation_p.M423I	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)					CATTTTTAATGAGCTTCCTTG	0.408													7	138	---	---	---	---	PASS
PSMC3	5702	broad.mit.edu	37	11	47445656	47445656	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47445656C>G	uc001nfh.2	-	6	726	c.532G>C	c.(532-534)GAC>CAC	p.D178H	PSMC3_uc009ylr.1_Missense_Mutation_p.D136H	NM_002804	NP_002795	P17980	PRS6A_HUMAN	proteasome 26S ATPase subunit 3	178					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome complex	ATP binding|nucleoside-triphosphatase activity|protein binding|transcription coactivator activity|transcription corepressor activity			ovary(4)	4				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GGCCTCTCGTCTACCTCCATG	0.582													12	123	---	---	---	---	PASS
NUP160	23279	broad.mit.edu	37	11	47862037	47862037	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47862037C>T	uc001ngm.2	-	3	503	c.418G>A	c.(418-420)GGA>AGA	p.G140R	NUP160_uc009ylw.2_RNA|NUP160_uc001ngn.1_Missense_Mutation_p.G140R	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa	140					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						TAAACCCCTCCAGGTAAAACA	0.428													7	80	---	---	---	---	PASS
OR4C15	81309	broad.mit.edu	37	11	55322251	55322251	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55322251G>A	uc010rig.1	+	1	469	c.469G>A	c.(469-471)GAA>AAA	p.E157K		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GCTCTTTGCTGAACACTTCTT	0.463										HNSCC(20;0.049)			13	82	---	---	---	---	PASS
OR5AS1	219447	broad.mit.edu	37	11	55798595	55798595	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55798595G>A	uc010riw.1	+	1	701	c.701G>A	c.(700-702)AGA>AAA	p.R234K		NM_001001921	NP_001001921	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS,	234	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|liver(1)|skin(1)	5	Esophageal squamous(21;0.00693)					TCAGGTGGCAGAAGCAAAACA	0.453													6	114	---	---	---	---	PASS
FAM111A	63901	broad.mit.edu	37	11	58920959	58920959	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58920959G>A	uc010rkp.1	+	5	2045	c.1818G>A	c.(1816-1818)ATG>ATA	p.M606I	FAM111A_uc010rkq.1_Missense_Mutation_p.M606I|FAM111A_uc010rkr.1_Missense_Mutation_p.M606I|FAM111A_uc001nno.2_Missense_Mutation_p.M606I|FAM111A_uc001nnp.2_Missense_Mutation_p.M606I|FAM111A_uc001nnq.2_Missense_Mutation_p.M606I	NM_001142521	NP_001135993	Q96PZ2	F111A_HUMAN	hypothetical protein LOC63901	606					proteolysis		serine-type endopeptidase activity			ovary(3)	3		all_epithelial(135;0.139)				TAGAAATGATGAGTGATGAGG	0.363													5	42	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62296350	62296350	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62296350C>G	uc001ntl.2	-	5	5839	c.5539G>C	c.(5539-5541)GAG>CAG	p.E1847Q	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	1847					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				AAGTGCATCTCAGGCATCTTA	0.507													11	204	---	---	---	---	PASS
TRPT1	83707	broad.mit.edu	37	11	63991404	63991404	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63991404C>T	uc001nyo.2	-	8	920	c.706G>A	c.(706-708)GAG>AAG	p.E236K	TRPT1_uc010rnc.1_Missense_Mutation_p.E237K|TRPT1_uc010rnd.1_Missense_Mutation_p.E238K|TRPT1_uc001nyn.2_Missense_Mutation_p.E187K|TRPT1_uc010rne.1_Missense_Mutation_p.E199K|TRPT1_uc010rnf.1_Missense_Mutation_p.E236K|NUDT22_uc009ypd.2_5'Flank|NUDT22_uc001nyp.3_5'Flank|NUDT22_uc009ype.2_5'Flank|NUDT22_uc001nyq.3_5'Flank	NM_001033678	NP_001028850	Q86TN4	TRPT1_HUMAN	tRNA phosphotransferase 1 isoform 1	236							tRNA 2'-phosphotransferase activity				0						CTCTGACACTCTGTCTCTTCA	0.398													6	51	---	---	---	---	PASS
PELI3	246330	broad.mit.edu	37	11	66238754	66238754	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66238754G>A	uc001oic.3	+	4	430	c.266G>A	c.(265-267)CGA>CAA	p.R89Q	PELI3_uc001oib.2_Missense_Mutation_p.R89Q|PELI3_uc001oid.3_Missense_Mutation_p.R65Q|PELI3_uc001oie.3_5'UTR|PELI3_uc010rpd.1_5'Flank	NM_145065	NP_659502	Q8N2H9	PELI3_HUMAN	pellino 3 alpha isoform 1	89						cytosol	protein binding			ovary(1)	1						GGCCGCCGGCGAAGCCGCCTG	0.597													16	113	---	---	---	---	PASS
C11orf80	79703	broad.mit.edu	37	11	66605850	66605850	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66605850G>C	uc001ojf.2	+	15	1688	c.1681G>C	c.(1681-1683)GAA>CAA	p.E561Q	C11orf80_uc001ojg.2_Missense_Mutation_p.E328Q|C11orf80_uc001ojh.2_Missense_Mutation_p.E329Q|C11orf80_uc001oji.2_Missense_Mutation_p.E329Q|C11orf80_uc010rpl.1_Missense_Mutation_p.E195Q|C11orf80_uc001ojj.2_Missense_Mutation_p.E159Q	NM_024650	NP_078926	Q8N6T0	CK080_HUMAN	hypothetical protein LOC79703	406											0						GCTAACCCTAGAAAAAAAGGA	0.478													7	23	---	---	---	---	PASS
GPR152	390212	broad.mit.edu	37	11	67218801	67218801	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67218801C>T	uc001olm.2	-	1	1400	c.1395G>A	c.(1393-1395)CCG>CCA	p.P465P	uc009yrw.1_5'Flank|CABP4_uc001oln.2_5'Flank	NM_206997	NP_996880	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	465	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			GGCCTGCGCCCGGGGCCGCCT	0.682													17	56	---	---	---	---	PASS
CABP4	57010	broad.mit.edu	37	11	67225845	67225845	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67225845G>C	uc001olo.2	+	5	732	c.655G>C	c.(655-657)GAC>CAC	p.D219H	CABP4_uc001oln.2_Missense_Mutation_p.D114H	NM_145200	NP_660201	P57796	CABP4_HUMAN	calcium binding protein 4	219	EF-hand 3.|2 (Potential).				visual perception	cytoplasm|extracellular region|terminal button	calcium ion binding				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			ACCTTAGTTTGACAGGGACAG	0.547													8	44	---	---	---	---	PASS
USP35	57558	broad.mit.edu	37	11	77910692	77910692	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77910692C>T	uc009yva.1	+	4	1104	c.858C>T	c.(856-858)ATC>ATT	p.I286I	USP35_uc001oze.2_Silent_p.I42I|USP35_uc001ozc.2_Intron|USP35_uc010rsp.1_Intron|USP35_uc001ozd.2_Intron|USP35_uc001ozf.2_Silent_p.I17I	NM_020798	NP_065849	Q9P2H5	UBP35_HUMAN	ubiquitin specific protease 35	286					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)	3	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			ACAAGTGGATCATTGCACTGC	0.532													14	136	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78437208	78437208	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78437208T>C	uc001ozl.3	-	23	3929	c.3466A>G	c.(3466-3468)ACA>GCA	p.T1156A		NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	1156	Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						TGCAGCACTGTTGTTCTTTTT	0.438													32	188	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108123635	108123635	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108123635G>A	uc001pkb.1	+	12	2279	c.1894G>A	c.(1894-1896)GAA>AAA	p.E632K	ATM_uc009yxr.1_Missense_Mutation_p.E632K	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	632					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		AAGCGTGCCAGAATGGTATGT	0.313			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			6	30	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108124771	108124771	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108124771G>A	uc001pkb.1	+						ATM_uc009yxr.1_Intron	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1						cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		TCTGAGGTGAGATTTTTTAAA	0.398			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			3	32	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108384244	108384244	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108384244G>A	uc001pkk.2	-	6	2101	c.1990C>T	c.(1990-1992)CAT>TAT	p.H664Y	EXPH5_uc010rvy.1_Missense_Mutation_p.H476Y|EXPH5_uc010rvz.1_Missense_Mutation_p.H508Y|EXPH5_uc010rwa.1_Missense_Mutation_p.H588Y	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	664					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CTCATTGGATGAGAGGCAGGC	0.453													9	58	---	---	---	---	PASS
ZW10	9183	broad.mit.edu	37	11	113619050	113619050	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113619050C>G	uc001poe.2	-	8	1055	c.1018G>C	c.(1018-1020)GAG>CAG	p.E340Q	ZW10_uc009yyv.2_RNA	NM_004724	NP_004715	O43264	ZW10_HUMAN	centromere/kinetochore protein zw10	340					cell division|ER to Golgi vesicle-mediated transport|establishment of mitotic spindle orientation|meiosis|mitotic cell cycle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|protein complex assembly|protein localization to kinetochore|protein transport|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|endoplasmic reticulum membrane|kinetochore microtubule|nucleus|spindle pole	centromeric DNA binding|protein binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		ATGAGGCACTCAGACAAGTCC	0.413													10	62	---	---	---	---	PASS
NLRX1	79671	broad.mit.edu	37	11	119045980	119045980	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119045980C>G	uc001pvu.2	+	6	1883	c.1668C>G	c.(1666-1668)ATC>ATG	p.I556M	NLRX1_uc010rzc.1_Missense_Mutation_p.I378M|NLRX1_uc001pvv.2_Missense_Mutation_p.I556M|NLRX1_uc001pvw.2_Missense_Mutation_p.I556M|NLRX1_uc001pvx.2_Missense_Mutation_p.I556M	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	556	Required for interaction with MAVS.|Required for the repression of MAVS- induced interferon signaling.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		TCAACCTGATCAAGGTAACAT	0.632													4	54	---	---	---	---	PASS
PANX3	116337	broad.mit.edu	37	11	124489625	124489625	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124489625G>A	uc001qah.2	+	4	973	c.973G>A	c.(973-975)GAC>AAC	p.D325N		NM_052959	NP_443191	Q96QZ0	PANX3_HUMAN	pannexin 3	325	Cytoplasmic (Potential).				protein hexamerization	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity				0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		TCCCATCAATGACCTCAATGT	0.463													5	76	---	---	---	---	PASS
SLC6A12	6539	broad.mit.edu	37	12	304436	304436	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:304436G>A	uc001qhz.2	-	14	1927	c.1384C>T	c.(1384-1386)CTG>TTG	p.L462L	SLC6A12_uc001qhx.2_Silent_p.L119L|SLC6A12_uc001qhy.2_Silent_p.L18L|SLC6A12_uc001qia.2_Silent_p.L462L|SLC6A12_uc001qib.2_Silent_p.L462L|SLC6A12_uc009zdh.1_Silent_p.L462L	NM_003044	NP_003035	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter	462	Helical; Name=10; (Potential).				cellular nitrogen compound metabolic process|neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			GACAGGAACAGCAGGCATATG	0.562													11	89	---	---	---	---	PASS
KDM5A	5927	broad.mit.edu	37	12	431665	431665	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:431665G>A	uc001qif.1	-	17	2707	c.2344C>T	c.(2344-2346)CGA>TGA	p.R782*	KDM5A_uc001qie.1_Nonsense_Mutation_p.R782*|KDM5A_uc010sdn.1_Nonsense_Mutation_p.R741*	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	782					chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						CTGAGTTTTCGAAAGAGATCA	0.393			T 	NUP98	AML								13	102	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	1017163	1017163	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1017163C>T	uc001qio.3	+	27	7301	c.6794C>T	c.(6793-6795)TCA>TTA	p.S2265L	WNK1_uc001qip.3_Missense_Mutation_p.S2017L|WNK1_uc001qir.3_Missense_Mutation_p.S1438L|WNK1_uc009zdn.1_RNA	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	2265					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			ATGAATCTCTCAGGCAGGAGA	0.498													6	53	---	---	---	---	PASS
AKAP3	10566	broad.mit.edu	37	12	4737262	4737262	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4737262C>T	uc001qnb.3	-	4	1035	c.806G>A	c.(805-807)CGA>CAA	p.R269Q		NM_006422	NP_006413	O75969	AKAP3_HUMAN	A-kinase anchor protein 3	269					acrosome reaction|cellular component movement	acrosomal vesicle	protein kinase A binding			skin(3)|large_intestine(1)|ovary(1)|kidney(1)	6						TTCCTGCCCTCGAAACCTCTT	0.443													12	60	---	---	---	---	PASS
ANO2	57101	broad.mit.edu	37	12	5687152	5687152	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5687152G>C	uc001qnm.2	-	23	2480	c.2408C>G	c.(2407-2409)TCT>TGT	p.S803C		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	808	Helical; (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						GCCAATTCCAGAGAGAATGTC	0.502													12	86	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6707089	6707089	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6707089C>T	uc001qpo.2	-	12	2027	c.1863G>A	c.(1861-1863)TGG>TGA	p.W621*	CHD4_uc001qpn.2_Nonsense_Mutation_p.W614*|CHD4_uc001qpp.2_Nonsense_Mutation_p.W618*	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	621					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						GGATCATCATCCACTCGGGTT	0.507													5	174	---	---	---	---	PASS
ATN1	1822	broad.mit.edu	37	12	7043362	7043362	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7043362G>C	uc001qrw.1	+	3	288	c.51G>C	c.(49-51)AAG>AAC	p.K17N	ATN1_uc001qrx.1_Missense_Mutation_p.K17N|ATN1_uc001qry.1_Missense_Mutation_p.K17N	NM_001007026	NP_001007027	P54259	ATN1_HUMAN	atrophin-1	17	Nuclear localization signal.				cell death|central nervous system development	cytoplasm|nucleus	protein domain specific binding			ovary(2)|breast(2)|pancreas(1)|skin(1)	6						GTGGACGGAAGAAAGAGGCCC	0.537													8	50	---	---	---	---	PASS
ZNF705A	440077	broad.mit.edu	37	12	8330155	8330155	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8330155C>T	uc001qud.1	+	5	951	c.879C>T	c.(877-879)TTC>TTT	p.F293F	FAM66C_uc001que.3_5'Flank|FAM66C_uc001quf.3_5'Flank|FAM66C_uc009zgc.2_5'Flank|FAM66C_uc001qug.3_5'Flank	NM_001004328	NP_001004328	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	293					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				Kidney(36;0.0877)		GGAAGGCCTTCAGTCTGTCTT	0.428													6	74	---	---	---	---	PASS
CLEC4D	338339	broad.mit.edu	37	12	8673805	8673805	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8673805G>A	uc001qun.2	+	6	779	c.586G>A	c.(586-588)GAT>AAT	p.D196N		NM_080387	NP_525126	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	196	C-type lectin.|Extracellular (Potential).				innate immune response	integral to membrane	sugar binding				0	Lung SC(5;0.184)					GGCCTGGAATGATGTTCCTTG	0.378													8	59	---	---	---	---	PASS
STYK1	55359	broad.mit.edu	37	12	10777320	10777320	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10777320G>C	uc001qys.2	-	8	1377	c.856C>G	c.(856-858)CAA>GAA	p.Q286E		NM_018423	NP_060893	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	286	Protein kinase.					integral to membrane|plasma membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						GGTATGGTTTGAGTAGAGGAG	0.502										HNSCC(73;0.22)			18	136	---	---	---	---	PASS
PRH1	5554	broad.mit.edu	37	12	11035240	11035240	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11035240C>T	uc001qzc.2	-	7	746	c.158G>A	c.(157-159)GGA>GAA	p.G53E	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_RNA|PRB4_uc001qzf.1_Intron	NM_006250	NP_006241	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 1	53						extracellular space	protein binding				0				BRCA - Breast invasive adenocarcinoma(232;0.245)		AGATTGCTGTCCTCCCAAAGG	0.552													6	129	---	---	---	---	PASS
TAS2R42	353164	broad.mit.edu	37	12	11339076	11339076	+	Silent	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11339076G>C	uc001qzr.1	-	1	468	c.468C>G	c.(466-468)CTC>CTG	p.L156L	PRB4_uc001qzf.1_Intron	NM_181429	NP_852094	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	156	Extracellular (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			CTATTATATTGAGTGAGATAT	0.284													3	47	---	---	---	---	PASS
PRB1	5542	broad.mit.edu	37	12	11507447	11507447	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11507447C>T	uc001qzw.1	-						PRB1_uc001qzu.1_Intron|PRB1_uc001qzv.1_Intron	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1							extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			ACGAATCAGGCTTTACCTGCT	0.408													6	125	---	---	---	---	PASS
C12orf35	55196	broad.mit.edu	37	12	32135918	32135918	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32135918C>G	uc001rks.2	+	4	2443	c.2029C>G	c.(2029-2031)CTT>GTT	p.L677V		NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	677										ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			AGCAACCTGTCTTTCCCTGTG	0.423													3	38	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39703442	39703442	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39703442G>A	uc001rly.2	-	33	4369	c.4223C>T	c.(4222-4224)TCT>TTT	p.S1408F	KIF21A_uc001rlv.2_Missense_Mutation_p.S353F|KIF21A_uc001rlw.2_Missense_Mutation_p.S678F|KIF21A_uc001rlx.2_Missense_Mutation_p.S1395F|KIF21A_uc001rlz.2_Missense_Mutation_p.S1355F|KIF21A_uc010skl.1_Missense_Mutation_p.S1371F|KIF21A_uc001rlt.2_Missense_Mutation_p.S28F|KIF21A_uc001rlu.2_Missense_Mutation_p.S28F	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1408	WD 2.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				CTTAATATAAGATGTTGATAC	0.393													4	53	---	---	---	---	PASS
ANO6	196527	broad.mit.edu	37	12	45761520	45761520	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45761520C>T	uc001roo.2	+	9	1383	c.1048C>T	c.(1048-1050)CAG>TAG	p.Q350*	ANO6_uc010sld.1_Nonsense_Mutation_p.Q350*|ANO6_uc010sle.1_Nonsense_Mutation_p.Q350*|ANO6_uc010slf.1_Nonsense_Mutation_p.Q371*|ANO6_uc010slg.1_Nonsense_Mutation_p.Q332*	NM_001025356	NP_001020527	Q4KMQ2	ANO6_HUMAN	anoctamin 6 isoform a	350	Extracellular (Potential).				activation of blood coagulation via clotting cascade|phosphatidylserine exposure on blood platelet	chloride channel complex|plasma membrane	chloride channel activity			ovary(1)|kidney(1)	2						AATGTGTCCTCAGTGTGATAG	0.299													5	71	---	---	---	---	PASS
CCNT1	904	broad.mit.edu	37	12	49088062	49088062	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49088062G>C	uc001rse.1	-	9	1258	c.935C>G	c.(934-936)TCC>TGC	p.S312C	LOC144438_uc001rsd.3_5'Flank|CCNT1_uc009zkz.1_Missense_Mutation_p.S27C	NM_001240	NP_001231	O60563	CCNT1_HUMAN	cyclin T1	312					cell cycle|cell division|interspecies interaction between organisms|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	DNA binding|protein kinase binding			ovary(3)|lung(1)|breast(1)|skin(1)	6						GACTGGCAGGGAAGGCACTGC	0.488													9	59	---	---	---	---	PASS
LMBR1L	55716	broad.mit.edu	37	12	49496668	49496668	+	Splice_Site	SNP	A	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49496668A>G	uc001rth.3	-	8	1038	c.696_splice	c.e8+1	p.R232_splice	LMBR1L_uc001rtg.3_Splice_Site_p.R227_splice|LMBR1L_uc001rti.3_Splice_Site_p.R232_splice|LMBR1L_uc001rtj.1_Splice_Site_p.R76_splice|LMBR1L_uc009zld.1_Splice_Site_p.R105_splice|LMBR1L_uc010smf.1_Splice_Site	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor						endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						AATACCACATACCCGGGGCTT	0.532													7	49	---	---	---	---	PASS
FMNL3	91010	broad.mit.edu	37	12	50045026	50045026	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50045026G>A	uc001ruv.1	-	16	1956	c.1722C>T	c.(1720-1722)TTC>TTT	p.F574F	FMNL3_uc001ruw.1_Silent_p.F523F|FMNL3_uc001rut.1_Silent_p.F140F|FMNL3_uc001ruu.1_Silent_p.F424F	NM_175736	NP_783863	Q8IVF7	FMNL3_HUMAN	formin-like 3 isoform 1	574	FH2.				actin cytoskeleton organization		actin binding|Rho GTPase binding			breast(2)|pancreas(2)	4						CTGTCCAGTTGAAGACAGGCA	0.517													10	80	---	---	---	---	PASS
C12orf10	60314	broad.mit.edu	37	12	53694019	53694019	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53694019G>C	uc001scp.3	+	2	354	c.302G>C	c.(301-303)CGG>CCG	p.R101P	C12orf10_uc010sof.1_Missense_Mutation_p.R101P|C12orf10_uc009zmx.2_Missense_Mutation_p.R101P|C12orf10_uc001scq.3_5'UTR	NM_021640	NP_067653	Q86UA3	Q86UA3_HUMAN	MYG1 protein precursor	101										ovary(2)	2						TACGACCCTCGGAGACACCGA	0.537											OREG0021864	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	24	---	---	---	---	PASS
CALCOCO1	57658	broad.mit.edu	37	12	54109766	54109766	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54109766C>T	uc001sef.2	-	9	1215	c.1071G>A	c.(1069-1071)CAG>CAA	p.Q357Q	CALCOCO1_uc001see.2_5'Flank|CALCOCO1_uc010som.1_Silent_p.Q272Q|CALCOCO1_uc010son.1_Silent_p.Q234Q|CALCOCO1_uc001seh.2_Silent_p.Q357Q|CALCOCO1_uc009znd.2_Silent_p.Q357Q|CALCOCO1_uc001seg.2_Silent_p.Q182Q|CALCOCO1_uc010soo.1_Silent_p.Q350Q	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform	357					steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						GGGTGGCTTTCTGCTGGCTTG	0.612													4	35	---	---	---	---	PASS
HOXC5	3222	broad.mit.edu	37	12	54428255	54428255	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54428255G>A	uc001sew.2	+	2	723	c.648G>A	c.(646-648)ATG>ATA	p.M216I	HOXC5_uc001set.2_RNA|HOXC4_uc001seu.2_Intron	NM_018953	NP_061826	Q00444	HXC5_HUMAN	homeobox C5	216					regulation of transcription from RNA polymerase II promoter	cell junction|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						ATTCCAAAATGAAAAGCAAAG	0.537													4	27	---	---	---	---	PASS
NEUROD4	58158	broad.mit.edu	37	12	55421139	55421139	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55421139G>A	uc001sgp.3	+	2	1294	c.916G>A	c.(916-918)GAT>AAT	p.D306N		NM_021191	NP_067014	Q9HD90	NDF4_HUMAN	neurogenic differentiation 4	306					amacrine cell differentiation|positive regulation of cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(3)|skin(1)	4						CCCCCGTTATGATGTTCCTAT	0.448													63	435	---	---	---	---	PASS
MMP19	4327	broad.mit.edu	37	12	56234572	56234572	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56234572G>A	uc001sib.2	-	4	520	c.399C>T	c.(397-399)TTC>TTT	p.F133F	MMP19_uc001sia.2_5'Flank|MMP19_uc001sid.2_RNA|MMP19_uc010spw.1_Silent_p.F133F	NM_002429	NP_002420	Q99542	MMP19_HUMAN	matrix metalloproteinase 19 isoform rasi-1	133					angiogenesis|cell differentiation|collagen catabolic process|proteolysis	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding			ovary(1)	1						TCCAGTCCTGGAAGGCTTGAC	0.607													7	95	---	---	---	---	PASS
PAN2	9924	broad.mit.edu	37	12	56716998	56716998	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56716998C>G	uc001skx.2	-						PAN2_uc001skw.2_Intron|PAN2_uc001skz.2_Intron|PAN2_uc001sky.2_Intron	NM_001127460	NP_001120932	Q504Q3	PAN2_HUMAN	PAN2 polyA specific ribonuclease subunit homolog						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|ubiquitin-dependent protein catabolic process	cytosol|nucleus	nucleic acid binding|poly(A)-specific ribonuclease activity|ubiquitin thiolesterase activity			ovary(2)|skin(2)|large_intestine(1)|breast(1)	6						TCCTTCCTATCAGGTCAGAAG	0.473													8	115	---	---	---	---	PASS
PRIM1	5557	broad.mit.edu	37	12	57140747	57140747	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57140747C>T	uc001smd.2	-	3	395	c.331G>A	c.(331-333)GAC>AAC	p.D111N	PRIM1_uc001sme.1_RNA|PRIM1_uc009zoz.1_Intron|PRIM1_uc001smf.2_Missense_Mutation_p.D111N	NM_000946	NP_000937	P49642	PRI1_HUMAN	DNA primase polypeptide 1	111		Potential.			DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	DNA primase activity|metal ion binding				0						TCTGTCATGTCAATGTCAAAT	0.423													3	31	---	---	---	---	PASS
STAC3	246329	broad.mit.edu	37	12	57642536	57642536	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57642536C>T	uc001snp.2	-	4	580	c.385G>A	c.(385-387)GAA>AAA	p.E129K	STAC3_uc009zpl.2_Intron|STAC3_uc001snq.2_Missense_Mutation_p.E90K|STAC3_uc010srm.1_Intron	NM_145064	NP_659501	Q96MF2	STAC3_HUMAN	SH3 and cysteine rich domain 3	129	Phorbol-ester/DAG-type.				intracellular signal transduction		identical protein binding|metal ion binding			ovary(2)|skin(1)	3						TGACAGTGTTCATGGATGTTG	0.433													37	495	---	---	---	---	PASS
KIF5A	3798	broad.mit.edu	37	12	57975210	57975210	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57975210G>A	uc001sor.1	+	25	2976	c.2768G>A	c.(2767-2769)CGG>CAG	p.R923Q	KIF5A_uc010srr.1_Missense_Mutation_p.R834Q	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A	923	Globular.				blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						AAACCCGTCCGGCCTGGCCAC	0.542													8	54	---	---	---	---	PASS
MON2	23041	broad.mit.edu	37	12	62949938	62949938	+	Silent	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62949938C>A	uc001sre.2	+	25	3766	c.3375C>A	c.(3373-3375)ATC>ATA	p.I1125I	MON2_uc009zqj.2_Silent_p.I1125I|MON2_uc010ssl.1_Silent_p.I1053I|MON2_uc010ssm.1_Silent_p.I1102I|MON2_uc010ssn.1_Silent_p.I1125I|MON2_uc001srf.2_Silent_p.I888I	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog	1126					Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TAGCAAGGATCTTCAACACTA	0.338													5	36	---	---	---	---	PASS
SRGAP1	57522	broad.mit.edu	37	12	64519891	64519891	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64519891G>T	uc010ssp.1	+	19	2415	c.2359G>T	c.(2359-2361)GGG>TGG	p.G787W	SRGAP1_uc001srv.2_Missense_Mutation_p.G724W	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	787	SH3.				axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CAGGCACAACGGGATTGACGG	0.542													3	82	---	---	---	---	PASS
XPOT	11260	broad.mit.edu	37	12	64811848	64811848	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64811848C>T	uc001ssb.2	+	5	649	c.223C>T	c.(223-225)CAA>TAA	p.Q75*	XPOT_uc009zqm.1_Intron	NM_007235	NP_009166	O43592	XPOT_HUMAN	tRNA exportin	75	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(28;0.0404)		AACCACTGTTCAACAACAGCT	0.313													4	76	---	---	---	---	PASS
RASSF3	283349	broad.mit.edu	37	12	65082084	65082084	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65082084C>T	uc001ssd.2	+	3	428	c.308C>T	c.(307-309)TCT>TTT	p.S103F	RASSF3_uc009zqn.2_Intron|RASSF3_uc001sse.2_Missense_Mutation_p.S33F	NM_178169	NP_835463	Q86WH2	RASF3_HUMAN	Ras association (RalGDS/AF-6) domain family	103	Ras-associating.				signal transduction	cytoplasm|microtubule	identical protein binding				0			Lung(2;0.00133)|LUAD - Lung adenocarcinoma(6;0.0665)|LUSC - Lung squamous cell carcinoma(43;0.132)	GBM - Glioblastoma multiforme(28;0.0611)		GGAAAACTCTCTCCCAGTAGC	0.448													5	136	---	---	---	---	PASS
PPP1R12A	4659	broad.mit.edu	37	12	80214673	80214673	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80214673G>A	uc001syz.2	-	8	1262	c.995C>T	c.(994-996)TCC>TTC	p.S332F	PPP1R12A_uc010suc.1_Missense_Mutation_p.S245F|PPP1R12A_uc001sza.2_Missense_Mutation_p.S332F|PPP1R12A_uc010sud.1_Missense_Mutation_p.S332F|PPP1R12A_uc001szb.2_Missense_Mutation_p.S332F|PPP1R12A_uc001szc.2_Missense_Mutation_p.S332F	NM_002480	NP_002471	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	332						contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						TTCAATACGGGATGCATTTTT	0.353													7	50	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94637781	94637781	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94637781G>C	uc001tdc.2	+	12	2617	c.2368G>C	c.(2368-2370)GAA>CAA	p.E790Q		NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	790	Extracellular (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						CATTTCACATGAATTAAAAGG	0.333													3	52	---	---	---	---	PASS
TDG	6996	broad.mit.edu	37	12	104378641	104378641	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104378641G>C	uc001tkg.2	+	8	1130	c.907G>C	c.(907-909)GAA>CAA	p.E303Q	TDG_uc009zuk.2_Missense_Mutation_p.E299Q|TDG_uc010swi.1_Missense_Mutation_p.E160Q|TDG_uc010swj.1_Missense_Mutation_p.E91Q	NM_003211	NP_003202	Q13569	TDG_HUMAN	thymine-DNA glycosylase	303					depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity			ovary(3)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(302;0.00114)		GAAAGGCATTGAACGAAATAT	0.403								BER_DNA_glycosylases					6	118	---	---	---	---	PASS
HCFC2	29915	broad.mit.edu	37	12	104461751	104461751	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104461751G>A	uc001tkj.3	+	3	442	c.339G>A	c.(337-339)GTG>GTA	p.V113V	HCFC2_uc009zul.2_RNA	NM_013320	NP_037452	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	113	Kelch 2.				regulation of transcription from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleus	transcription coactivator activity			ovary(2)|central_nervous_system(1)	3						GGAAAAAAGTGAAACCCCATC	0.408													22	214	---	---	---	---	PASS
SLC41A2	84102	broad.mit.edu	37	12	105238306	105238306	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105238306G>C	uc001tla.2	-	9	1647	c.1480C>G	c.(1480-1482)CAT>GAT	p.H494D		NM_032148	NP_115524	Q96JW4	S41A2_HUMAN	solute carrier family 41, member 2	494	Cytoplasmic.					integral to membrane|plasma membrane	magnesium ion transmembrane transporter activity			ovary(1)|skin(1)	2						AAAGAAGTATGACCACTTTTC	0.323													6	67	---	---	---	---	PASS
POLR3B	55703	broad.mit.edu	37	12	106824154	106824154	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:106824154C>G	uc001tlp.2	+	14	1589	c.1367C>G	c.(1366-1368)TCT>TGT	p.S456C	POLR3B_uc001tlq.2_Missense_Mutation_p.S398C	NM_018082	NP_060552	Q9NW08	RPC2_HUMAN	DNA-directed RNA polymerase III B isoform 1	456					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|ribonucleoside binding			ovary(1)|central_nervous_system(1)	2						ACAAGAATCTCTTCCCAGTTT	0.478													6	158	---	---	---	---	PASS
UBE3B	89910	broad.mit.edu	37	12	109921666	109921666	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109921666G>T	uc001top.2	+	4	765	c.162G>T	c.(160-162)AGG>AGT	p.R54S	UBE3B_uc001toq.2_Missense_Mutation_p.R54S|UBE3B_uc001tol.1_Missense_Mutation_p.R54S|UBE3B_uc001tom.2_Missense_Mutation_p.R54S|UBE3B_uc001ton.2_Missense_Mutation_p.R54S|UBE3B_uc001too.1_RNA|UBE3B_uc009zvj.1_Missense_Mutation_p.R54S|UBE3B_uc001tor.2_Missense_Mutation_p.R54S	NM_130466	NP_569733	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	54	IQ.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			ovary(2)|lung(2)	4						TCTTTTCTAGGAGAGAGATTG	0.353													6	81	---	---	---	---	PASS
TPCN1	53373	broad.mit.edu	37	12	113724846	113724846	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113724846C>G	uc001tuw.2	+	19	1878	c.1581C>G	c.(1579-1581)CTC>CTG	p.L527L	TPCN1_uc001tux.2_Silent_p.L599L|TPCN1_uc010syt.1_Silent_p.L459L	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	527	Extracellular (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3						CGCTGGCCCTCAACATGGAGC	0.622													5	107	---	---	---	---	PASS
VSIG10	54621	broad.mit.edu	37	12	118511520	118511520	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118511520G>A	uc001tws.2	-	5	1537	c.1203C>T	c.(1201-1203)ATC>ATT	p.I401I		NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	401	Ig-like C2-type 4.|Extracellular (Potential).					integral to membrane					0						CACTCAGCCAGATTTCCATCT	0.577													3	43	---	---	---	---	PASS
ACADS	35	broad.mit.edu	37	12	121175684	121175684	+	Nonsense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121175684G>T	uc001tza.3	+	5	635	c.517G>T	c.(517-519)GAG>TAG	p.E173*	ACADS_uc010szl.1_Intron|ACADS_uc001tzb.3_Nonsense_Mutation_p.E100*	NM_000017	NP_000008	P16219	ACADS_HUMAN	short-chain acyl-CoA dehydrogenase precursor	173						mitochondrial matrix	butyryl-CoA dehydrogenase activity			central_nervous_system(2)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)	Lung NSC(355;0.163)			NADH(DB00157)	CGCCCGGGCCGAGGGCGACTC	0.652													3	52	---	---	---	---	PASS
DDX55	57696	broad.mit.edu	37	12	124104570	124104570	+	Silent	SNP	A	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124104570A>G	uc001ufi.2	+	14	1710	c.1686A>G	c.(1684-1686)AAA>AAG	p.K562K	DDX55_uc001ufk.2_Silent_p.K415K|DDX55_uc001ufl.2_Silent_p.K169K	NM_020936	NP_065987	Q8NHQ9	DDX55_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55	562	Lys-rich.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000142)|Epithelial(86;0.000637)|all cancers(50;0.00772)		GACTCTTGAAAAAACTTAAGA	0.353													4	84	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129566467	129566467	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129566467G>A	uc009zyl.1	-	7	2088	c.1760C>T	c.(1759-1761)GCG>GTG	p.A587V	TMEM132D_uc001uia.2_Missense_Mutation_p.A125V	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	587	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGGGCCGGCCGCCTCAGCCAC	0.647													8	55	---	---	---	---	PASS
NUPL1	9818	broad.mit.edu	37	13	25901597	25901597	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25901597C>G	uc001uqi.2	+	12	1426	c.1180C>G	c.(1180-1182)CAA>GAA	p.Q394E	NUPL1_uc001uqg.1_Missense_Mutation_p.Q394E|NUPL1_uc001uqj.2_Missense_Mutation_p.Q382E	NM_014089	NP_054808	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1 isoform a	394	14 X 2 AA repeats of F-G.				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore					0		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		GAAAATTTATCAAACATTTGT	0.289													3	53	---	---	---	---	PASS
HSPH1	10808	broad.mit.edu	37	13	31725797	31725797	+	Silent	SNP	T	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31725797T>C	uc001utj.2	-	6	1010	c.612A>G	c.(610-612)GGA>GGG	p.G204G	HSPH1_uc001utk.2_Silent_p.G204G|HSPH1_uc010aaw.2_Silent_p.G163G|HSPH1_uc001utl.2_Silent_p.G206G|HSPH1_uc010tds.1_Intron|HSPH1_uc010tdt.1_Intron	NM_006644	NP_006635	Q92598	HS105_HUMAN	heat shock 105kD	204					positive regulation of MHC class I biosynthetic process|positive regulation of NK T cell activation|response to unfolded protein	cytoplasm|extracellular region	ATP binding				0		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		AAGCTGAATGTCCCATATCAA	0.378													9	43	---	---	---	---	PASS
CKAP2	26586	broad.mit.edu	37	13	53048161	53048161	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53048161G>A	uc001vgv.2	+	8	1944	c.1747G>A	c.(1747-1749)GAA>AAA	p.E583K	CKAP2_uc001vgu.2_Missense_Mutation_p.E582K|CKAP2_uc010tha.1_Missense_Mutation_p.E534K	NM_001098525	NP_001091995	Q8WWK9	CKAP2_HUMAN	cytoskeleton associated protein 2 isoform 2	583					apoptosis|cell cycle	centrosome|microtubule|spindle pole				ovary(1)|skin(1)	2		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		CCCCAATACAGAAACGAGGAC	0.333													4	44	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77754264	77754264	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77754264C>G	uc001vkf.2	-	35	5108	c.5017G>C	c.(5017-5019)GAG>CAG	p.E1673Q	MYCBP2_uc010aev.2_Missense_Mutation_p.E1077Q	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	1673					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TGTATTACCTCAGATCCCAGG	0.408													3	32	---	---	---	---	PASS
TPP2	7174	broad.mit.edu	37	13	103279418	103279418	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103279418G>A	uc001vpi.3	+	7	944	c.841G>A	c.(841-843)GAA>AAA	p.E281K		NM_003291	NP_003282	P29144	TPP2_HUMAN	tripeptidyl peptidase II	281					proteolysis	cytoplasm|nucleus	aminopeptidase activity|serine-type endopeptidase activity|tripeptidyl-peptidase activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AGAAGAACCTGAACGGAATGG	0.463													8	64	---	---	---	---	PASS
GRTP1	79774	broad.mit.edu	37	13	113980315	113980315	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113980315C>T	uc001vtn.2	-	6	751	c.654G>A	c.(652-654)CTG>CTA	p.L218L	GRTP1_uc010tkb.1_Silent_p.L140L|GRTP1_uc010tkc.1_Silent_p.L218L	NM_024719	NP_078995	Q5TC63	GRTP1_HUMAN	growth hormone regulated TBC protein 1	218	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			GACGCTCCATCAGGGCCCCCA	0.667													13	95	---	---	---	---	PASS
OR4K17	390436	broad.mit.edu	37	14	20585871	20585871	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20585871G>A	uc001vwo.1	+	1	306	c.306G>A	c.(304-306)ATG>ATA	p.M102I		NM_001004715	NP_001004715	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TTGTAGATATGACCCTTGCTT	0.388													28	218	---	---	---	---	PASS
METTL3	56339	broad.mit.edu	37	14	21967206	21967206	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21967206C>G	uc001wbc.2	-	10	1686	c.1594G>C	c.(1594-1596)GAG>CAG	p.E532Q	TOX4_uc001waz.2_3'UTR|TOX4_uc001wba.2_RNA|TOX4_uc010tlu.1_3'UTR|TOX4_uc010tlv.1_3'UTR|METTL3_uc001wbb.2_Missense_Mutation_p.E377Q	NM_019852	NP_062826	Q86U44	MTA70_HUMAN	methyltransferase like 3	532					gene expression	nuclear speck	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity|RNA binding			pancreas(1)|skin(1)	2	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		CCAAATAACTCAATCTTGCGA	0.423													4	64	---	---	---	---	PASS
RBM23	55147	broad.mit.edu	37	14	23371090	23371090	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23371090G>C	uc001whg.2	-	13	1448	c.1249C>G	c.(1249-1251)CTG>GTG	p.L417V	RBM23_uc001whh.2_Missense_Mutation_p.L401V|RBM23_uc001whi.2_Missense_Mutation_p.L383V|RBM23_uc010tne.1_Missense_Mutation_p.L247V|RBM23_uc001whj.2_Missense_Mutation_p.L167V	NM_001077351	NP_001070819	Q86U06	RBM23_HUMAN	RNA binding motif protein 23 isoform 1	417	Ala-rich.				mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		GCTGGACTCAGAGCTAGAACA	0.542													13	160	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23870053	23870053	+	Silent	SNP	G	A	A	rs61742470	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23870053G>A	uc001wjv.2	-	13	1342	c.1275C>T	c.(1273-1275)ATC>ATT	p.I425I	MYH6_uc010akp.1_Silent_p.I425I	NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	425	Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CCAGAGCCCCGATGGAGTAGT	0.582													8	70	---	---	---	---	PASS
HECTD1	25831	broad.mit.edu	37	14	31578645	31578645	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31578645C>T	uc001wrc.1	-	36	6927	c.6438G>A	c.(6436-6438)GAG>GAA	p.E2146E	HECTD1_uc001wra.1_Silent_p.E272E|HECTD1_uc001wrb.1_Silent_p.E272E	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	2146					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		GCATGACATTCTCAGCCCATT	0.448													16	90	---	---	---	---	PASS
HECTD1	25831	broad.mit.edu	37	14	31578721	31578721	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31578721C>T	uc001wrc.1	-	36	6851	c.6362G>A	c.(6361-6363)GGA>GAA	p.G2121E	HECTD1_uc001wra.1_Missense_Mutation_p.G247E|HECTD1_uc001wrb.1_Missense_Mutation_p.G247E	NM_015382	NP_056197	Q9ULT8	HECD1_HUMAN	HECT domain containing 1	2121					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	metal ion binding|protein binding|ubiquitin-protein ligase activity			ovary(3)|large_intestine(1)|lung(1)	5	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TCGAAACTCTCCAGGGTCATC	0.458													11	51	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33014856	33014856	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33014856C>G	uc001wrq.2	+	4	1167	c.997C>G	c.(997-999)CTG>GTG	p.L333V	AKAP6_uc010aml.2_Missense_Mutation_p.L330V	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	333					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AGGAGAAGCTCTGACAAATGC	0.493													9	39	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35227956	35227956	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35227956C>A	uc001wsk.2	-	25	4908	c.4340G>T	c.(4339-4341)CGA>CTA	p.R1447L	BAZ1A_uc001wsl.2_Missense_Mutation_p.R1415L	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1447	Bromo.				chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		GTCATCATGTCGTACCAATTC	0.408													4	57	---	---	---	---	PASS
CTAGE5	4253	broad.mit.edu	37	14	39771449	39771449	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39771449C>G	uc001wvg.3	+	10	1248	c.912C>G	c.(910-912)TAC>TAG	p.Y304*	CTAGE5_uc010tqe.1_Nonsense_Mutation_p.Y266*|CTAGE5_uc001wuz.3_Nonsense_Mutation_p.Y292*|CTAGE5_uc001wuy.3_Nonsense_Mutation_p.Y224*|CTAGE5_uc001wvb.3_Nonsense_Mutation_p.Y275*|CTAGE5_uc001wvc.3_Nonsense_Mutation_p.Y249*|CTAGE5_uc001wva.3_Nonsense_Mutation_p.Y275*|CTAGE5_uc001wve.1_Nonsense_Mutation_p.Y280*|CTAGE5_uc001wvh.3_Nonsense_Mutation_p.Y304*|CTAGE5_uc001wvf.3_Nonsense_Mutation_p.Y229*|CTAGE5_uc001wvi.3_Nonsense_Mutation_p.Y309*|CTAGE5_uc010amz.2_5'UTR|CTAGE5_uc001wvj.3_Nonsense_Mutation_p.Y275*	NM_005930	NP_005921	O15320	CTGE5_HUMAN	CTAGE family, member 5 isoform 1	304							enzyme activator activity|protein binding				0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		ATGGTGCTTACTTAGGTATTA	0.373													25	131	---	---	---	---	PASS
GPR137C	283554	broad.mit.edu	37	14	53098933	53098933	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53098933C>G	uc001wzu.3	+	4	773	c.773C>G	c.(772-774)TCT>TGT	p.S258C	GPR137C_uc001wzt.3_Missense_Mutation_p.S274C	NM_001099652	NP_001093122	Q8N3F9	G137C_HUMAN	G protein-coupled receptor 137C	258	Helical; (Potential).					integral to membrane					0	Breast(41;0.0716)					CTTCTGTACTCTTCCAGAGCT	0.368													5	33	---	---	---	---	PASS
NAA30	122830	broad.mit.edu	37	14	57876233	57876233	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57876233G>A	uc001xcx.3	+	5	1242	c.1088G>A	c.(1087-1089)TGA>TAA	p.*363*	NAA30_uc010trk.1_Silent_p.*105*|NAA30_uc010aow.2_RNA	NM_001011713	NP_001011713	Q147X3	NAA30_HUMAN	N-acetyltransferase 12	363						cytoplasm	peptide alpha-N-acetyltransferase activity			skin(1)	1						TGGCTGCGTTGAGAAACTGAC	0.383													21	46	---	---	---	---	PASS
DAAM1	23002	broad.mit.edu	37	14	59792434	59792434	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59792434A>G	uc001xdz.1	+	9	1167	c.1042A>G	c.(1042-1044)AAA>GAA	p.K348E	DAAM1_uc001xea.1_Missense_Mutation_p.K348E|DAAM1_uc001xeb.1_Missense_Mutation_p.K348E	NM_014992	NP_055807	Q9Y4D1	DAAM1_HUMAN	dishevelled-associated activator of	348	GBD/FH3.				actin cytoskeleton organization	cytoplasm|plasma membrane	actin binding|Rho GTPase binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.165)		AGAATTTGCCAAAAGATTTGA	0.318													7	57	---	---	---	---	PASS
RTN1	6252	broad.mit.edu	37	14	60070560	60070560	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60070560C>T	uc001xen.1	-						RTN1_uc001xem.1_Intron|RTN1_uc001xek.1_Intron|RTN1_uc001xel.1_Intron|RTN1_uc010apl.1_Intron	NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A						neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		ACAGTCTTATCTGCTCTTACC	0.468													8	44	---	---	---	---	PASS
PAPLN	89932	broad.mit.edu	37	14	73730416	73730416	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73730416C>T	uc010ttx.1	+	19	2950	c.2787C>T	c.(2785-2787)CTC>CTT	p.L929L	PAPLN_uc001xnw.3_Silent_p.L902L|PAPLN_uc010arl.2_RNA|PAPLN_uc010ttw.1_RNA|PAPLN_uc010tty.1_Silent_p.L913L|PAPLN_uc010arm.2_Silent_p.L128L|PAPLN_uc010arn.2_Silent_p.L129L	NM_173462	NP_775733	O95428	PPN_HUMAN	papilin	929	Ig-like C2-type 1.					proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase inhibitor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		TGGTGCGGCTCTCCTGCTCAG	0.632													5	54	---	---	---	---	PASS
NUMB	8650	broad.mit.edu	37	14	73749139	73749139	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73749139C>T	uc001xny.1	-	11	1344	c.1024G>A	c.(1024-1026)GAG>AAG	p.E342K	NUMB_uc010aro.1_Intron|NUMB_uc010arp.1_Intron|NUMB_uc010arq.1_Missense_Mutation_p.E244K|NUMB_uc010arr.1_Missense_Mutation_p.E233K|NUMB_uc001xoa.1_Missense_Mutation_p.E342K|NUMB_uc001xnz.1_Missense_Mutation_p.E331K|NUMB_uc001xob.1_Missense_Mutation_p.E331K|NUMB_uc001xod.1_Missense_Mutation_p.E342K|NUMB_uc001xoc.1_Missense_Mutation_p.E342K|NUMB_uc010ars.1_Missense_Mutation_p.E331K|NUMB_uc010ttz.1_Missense_Mutation_p.E88K	NM_001005743	NP_001005743	P49757	NUMB_HUMAN	numb homolog isoform 1	342					axon guidance|lateral ventricle development|neuroblast division in subventricular zone|positive regulation of neurogenesis	integral to plasma membrane				ovary(2)|central_nervous_system(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		AAGGGGTCCTCAGGTGTGCTG	0.368													6	47	---	---	---	---	PASS
ZNF410	57862	broad.mit.edu	37	14	74388889	74388889	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74388889C>G	uc001xoz.1	+	10	1432	c.1250C>G	c.(1249-1251)TCT>TGT	p.S417C	ZNF410_uc001xoy.1_RNA|ZNF410_uc010tuf.1_Intron|ZNF410_uc010tug.1_Missense_Mutation_p.S148C|ZNF410_uc010tuh.1_Missense_Mutation_p.S344C|ZNF410_uc010tui.1_RNA|ZNF410_uc010arz.1_Missense_Mutation_p.S434C|ZNF410_uc001xpa.1_Missense_Mutation_p.S221C|ZNF410_uc001xpb.1_Intron|ZNF410_uc001xpc.1_Missense_Mutation_p.S364C|ZNF410_uc010tuj.1_Missense_Mutation_p.S221C	NM_021188	NP_067011	Q86VK4	ZN410_HUMAN	zinc finger protein 410	417					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00369)		AATACCAATTCTATCCTGGGA	0.458													3	30	---	---	---	---	PASS
FAM161B	145483	broad.mit.edu	37	14	74409394	74409394	+	Missense_Mutation	SNP	C	T	T	rs146087407		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74409394C>T	uc001xpd.1	-	4	1056	c.950G>A	c.(949-951)CGC>CAC	p.R317H		NM_152445	NP_689658			hypothetical protein LOC145483											ovary(1)	1						CATTTGGATGCGAATTTTCCT	0.532													5	82	---	---	---	---	PASS
ALDH6A1	4329	broad.mit.edu	37	14	74539233	74539233	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74539233C>T	uc001xpo.2	-						C14orf45_uc001xpm.1_Intron|ALDH6A1_uc010asa.2_Intron|ALDH6A1_uc010tuq.1_Intron	NM_005589	NP_005580	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6A1 precursor							mitochondrial matrix|nucleus	fatty-acyl-CoA binding|malonate-semialdehyde dehydrogenase (acetylating) activity|methylmalonate-semialdehyde dehydrogenase (acylating) activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00354)	NADH(DB00157)	AAAGCAGCTTCGCTTACTGGG	0.418													22	75	---	---	---	---	PASS
DLST	1743	broad.mit.edu	37	14	75366617	75366617	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75366617C>G	uc001xqv.2	+						DLST_uc001xqu.2_Intron|DLST_uc001xqt.2_Intron|DLST_uc010tuw.1_Intron	NM_001933	NP_001924	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2						lysine catabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus	dihydrolipoyllysine-residue succinyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00698)		TGTATTTTCTCTCTCATAGTG	0.448													4	68	---	---	---	---	PASS
ADCK1	57143	broad.mit.edu	37	14	78399610	78399610	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78399610C>G	uc001xui.2	+	11	1547	c.1448C>G	c.(1447-1449)TCT>TGT	p.S483C	ADCK1_uc001xuj.2_Missense_Mutation_p.S415C|ADCK1_uc001xul.2_Missense_Mutation_p.S190C	NM_020421	NP_065154	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1 isoform a	490						extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		ACCCAGATCTCTTTCAGCGAG	0.398													6	45	---	---	---	---	PASS
TSHR	7253	broad.mit.edu	37	14	81610522	81610522	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81610522G>A	uc001xvd.1	+	10	2276	c.2120G>A	c.(2119-2121)CGG>CAG	p.R707Q		NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1	707	Cytoplasmic (Potential).				cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	CAGGCATACCGGGGGCAGAGG	0.488			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						7	98	---	---	---	---	PASS
PTPN21	11099	broad.mit.edu	37	14	88940104	88940104	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88940104G>C	uc001xwv.3	-	14	2885	c.2554C>G	c.(2554-2556)CTT>GTT	p.L852V	PTPN21_uc010twc.1_Missense_Mutation_p.L648V	NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type	852						cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)|skin(1)	4						GCCAGTTTAAGAGGACCAATT	0.403													6	81	---	---	---	---	PASS
TRIP11	9321	broad.mit.edu	37	14	92472277	92472277	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92472277C>G	uc001xzy.2	-	11	2831	c.2043G>C	c.(2041-2043)AAG>AAC	p.K681N	TRIP11_uc010auf.1_Missense_Mutation_p.K417N	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	681	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		CTAAAACTAACTTTTCATTTT	0.323			T	PDGFRB	AML								4	99	---	---	---	---	PASS
BTBD7	55727	broad.mit.edu	37	14	93727940	93727940	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93727940G>C	uc001ybo.2	-						BTBD7_uc010aur.2_Intron|BTBD7_uc010two.1_Intron|BTBD7_uc001ybp.2_Intron|BTBD7_uc001ybq.3_Intron	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7 isoform 1											pancreas(1)	1		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		CTAATTTTCGGAGCTTACCTC	0.363													6	118	---	---	---	---	PASS
DICER1	23405	broad.mit.edu	37	14	95574809	95574809	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95574809C>T	uc001ydw.2	-	16	2470	c.2288G>A	c.(2287-2289)AGA>AAA	p.R763K	DICER1_uc010avh.1_5'Flank|DICER1_uc001ydv.2_Missense_Mutation_p.R753K|DICER1_uc001ydx.2_Missense_Mutation_p.R763K	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	763					negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		CTGATCAGGTCTGGGATAACT	0.423			Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				16	85	---	---	---	---	PASS
YY1	7528	broad.mit.edu	37	14	100705963	100705963	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100705963G>A	uc001ygy.1	+	1	862	c.382G>A	c.(382-384)GAG>AAG	p.E128K		NM_003403	NP_003394	P25490	TYY1_HUMAN	YY1 transcription factor	128					cell differentiation|cellular response to UV|double-strand break repair via homologous recombination|negative regulation of transcription from RNA polymerase II promoter|response to UV-C|spermatogenesis	Ino80 complex|nuclear matrix|plasma membrane	four-way junction DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|transcription regulatory region DNA binding|zinc ion binding				0		Melanoma(154;0.152)				GGACGGCTTCGAGGATCAGAT	0.597													4	66	---	---	---	---	PASS
TECPR2	9895	broad.mit.edu	37	14	102900646	102900646	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102900646C>T	uc001ylw.1	+	9	1640	c.1492C>T	c.(1492-1494)CAG>TAG	p.Q498*	TECPR2_uc010awl.2_Nonsense_Mutation_p.Q498*|TECPR2_uc010txx.1_Intron	NM_014844	NP_055659	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	498							protein binding			lung(1)|central_nervous_system(1)|skin(1)	3						GGACAGTCCCCAGTCCTTGAA	0.507													7	45	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106967139	106967139	+	RNA	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106967139G>A	uc010tyt.1	-	201		c.9302C>T								Parts of antibodies, mostly variable regions.												0						TGGTCATGGTGACTCTGCCCT	0.562													19	178	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29346279	29346279	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29346279C>G	uc001zck.2	+	3	399	c.192C>G	c.(190-192)CAC>CAG	p.H64Q	APBA2_uc010azj.2_Missense_Mutation_p.H64Q|APBA2_uc010uat.1_Missense_Mutation_p.H64Q|APBA2_uc001zcl.2_Missense_Mutation_p.H64Q|APBA2_uc010uas.1_Missense_Mutation_p.H64Q	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	64					nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		AGGAGTGCCACAACCACAGCC	0.652													14	79	---	---	---	---	PASS
RPAP1	26015	broad.mit.edu	37	15	41823344	41823344	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41823344C>G	uc001zod.2	-	7	944	c.820G>C	c.(820-822)GAG>CAG	p.E274Q		NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	274						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GAGGCTGTCTCTCCTGTTTGC	0.557													16	188	---	---	---	---	PASS
MGA	23269	broad.mit.edu	37	15	41962081	41962081	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41962081G>A	uc001zog.1	+	2	1080	c.989G>A	c.(988-990)CGA>CAA	p.R330Q	MGA_uc010ucy.1_Missense_Mutation_p.R330Q|MGA_uc010ucz.1_Missense_Mutation_p.R330Q	NM_001080541	NP_001074010	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 2	330						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)		AATATAAAACGAGACTTTCTT	0.403													4	42	---	---	---	---	PASS
TP53BP1	7158	broad.mit.edu	37	15	43767874	43767874	+	Missense_Mutation	SNP	G	A	A	rs144313241	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43767874G>A	uc001zrs.2	-	9	1107	c.959C>T	c.(958-960)TCT>TTT	p.S320F	TP53BP1_uc010udp.1_Missense_Mutation_p.S320F|TP53BP1_uc001zrq.3_Missense_Mutation_p.S325F|TP53BP1_uc001zrr.3_Missense_Mutation_p.S325F|TP53BP1_uc010udq.1_Missense_Mutation_p.S325F	NM_005657	NP_005648	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1 isoform 3	320					double-strand break repair via homologous recombination|positive regulation of transcription from RNA polymerase II promoter	condensed chromosome kinetochore|cytoplasm|nucleoplasm	p53 binding|RNA polymerase II activating transcription factor binding|RNA polymerase II transcription cofactor activity			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)|kidney(1)	7		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TGAAGGAGTAGAGCAACCATC	0.473								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					5	60	---	---	---	---	PASS
SPG11	80208	broad.mit.edu	37	15	44890482	44890482	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44890482G>A	uc001ztx.2	-	23	4013	c.3982C>T	c.(3982-3984)CAG>TAG	p.Q1328*	SPG11_uc010ueh.1_Nonsense_Mutation_p.Q1328*|SPG11_uc010uei.1_Nonsense_Mutation_p.Q1328*|SPG11_uc001zty.1_Nonsense_Mutation_p.Q57*	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1	1328	Cytoplasmic (Potential).				cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TCCTGTTGCTGAATGCTGTTC	0.388													4	69	---	---	---	---	PASS
DUOX2	50506	broad.mit.edu	37	15	45398798	45398798	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45398798G>A	uc010bea.2	-	16	2076	c.1873C>T	c.(1873-1875)CGA>TGA	p.R625*	DUOX2_uc001zun.2_Nonsense_Mutation_p.R625*	NM_014080	NP_054799	Q9NRD8	DUOX2_HUMAN	dual oxidase 2 precursor	625	Cytoplasmic (Potential).				cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|response to virus	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|peroxidase activity			ovary(2)|skin(2)|pancreas(1)	5		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TTGTGTTCTCGGCCCCGGAAA	0.557													7	97	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48789456	48789456	+	Intron	SNP	T	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48789456T>G	uc001zwx.1	-							NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor						heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TGGGTAAAACTTCTCACCAAC	0.413													6	79	---	---	---	---	PASS
TRPM7	54822	broad.mit.edu	37	15	50886709	50886709	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50886709G>A	uc001zyt.3	-	24	3656	c.3392C>T	c.(3391-3393)CCA>CTA	p.P1131L	TRPM7_uc010bew.1_Missense_Mutation_p.P1131L	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,	1131	Cytoplasmic (Potential).				cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AATGATAAGTGGAGGAGGCAG	0.343													12	61	---	---	---	---	PASS
TRPM7	54822	broad.mit.edu	37	15	50903387	50903387	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50903387G>C	uc001zyt.3	-	17	2447	c.2183C>G	c.(2182-2184)TCA>TGA	p.S728*	TRPM7_uc010bew.1_Nonsense_Mutation_p.S728*|TRPM7_uc001zyu.2_Nonsense_Mutation_p.S286*	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,	728	Cytoplasmic (Potential).				cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TCTAAGTCTTGAAGAAACTGC	0.393													13	70	---	---	---	---	PASS
ZNF609	23060	broad.mit.edu	37	15	64791779	64791779	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64791779C>G	uc002ann.2	+	1	161	c.161C>G	c.(160-162)TCA>TGA	p.S54*	ZNF609_uc010bgy.2_Nonsense_Mutation_p.S54*	NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609	54						nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						ATGTCAGGCTCAAAGGAGGTG	0.527													9	74	---	---	---	---	PASS
UACA	55075	broad.mit.edu	37	15	70959860	70959860	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70959860G>C	uc002asr.2	-	16	3267	c.3163C>G	c.(3163-3165)CAT>GAT	p.H1055D	UACA_uc010uke.1_Missense_Mutation_p.H946D|UACA_uc002asq.2_Missense_Mutation_p.H1042D|UACA_uc010bin.1_Missense_Mutation_p.H1030D	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	1055	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						TCCATTTCATGAGACTTCTCA	0.343													7	65	---	---	---	---	PASS
UACA	55075	broad.mit.edu	37	15	70960836	70960836	+	Silent	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70960836G>C	uc002asr.2	-	16	2291	c.2187C>G	c.(2185-2187)CTC>CTG	p.L729L	UACA_uc010uke.1_Silent_p.L620L|UACA_uc002asq.2_Silent_p.L716L|UACA_uc010bin.1_Silent_p.L704L	NM_018003	NP_060473	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and	729	Potential.					cytoskeleton|extracellular region				ovary(2)|pancreas(1)|skin(1)	4						CTTGCTCCTTGAGGAGCTTAT	0.308													6	70	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	71549051	71549051	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71549051G>A	uc002atb.1	+	5	1091	c.1012G>A	c.(1012-1014)GAA>AAA	p.E338K	THSD4_uc002atd.1_Missense_Mutation_p.E12K	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	338						proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						ACCATTTGCAGAAGGTAAGAA	0.448													8	83	---	---	---	---	PASS
PARP6	56965	broad.mit.edu	37	15	72548856	72548856	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72548856G>A	uc002auc.2	-	13	1534	c.1075C>T	c.(1075-1077)CCC>TCC	p.P359S	PARP6_uc002aua.2_Missense_Mutation_p.P204S|PARP6_uc002aub.2_RNA|PARP6_uc002aud.3_RNA|PARP6_uc002auf.1_Missense_Mutation_p.P359S	NM_020214	NP_064599	Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	359							NAD+ ADP-ribosyltransferase activity				0						ACCACAGAGGGATAAGGCTCA	0.468													4	31	---	---	---	---	PASS
FANCI	55215	broad.mit.edu	37	15	89825022	89825022	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89825022G>C	uc010bnp.1	+	16	1629	c.1539G>C	c.(1537-1539)ATG>ATC	p.M513I	FANCI_uc002bnm.1_Missense_Mutation_p.M513I|FANCI_uc002bnn.1_RNA|FANCI_uc002bnp.1_Missense_Mutation_p.M334I|FANCI_uc002bnq.1_5'UTR	NM_001113378	NP_001106849	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I isoform	513					cell cycle|DNA repair	nucleoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0472)|all_lung(78;0.089)					GCATGTCAATGAGAGACTGCT	0.388								Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				15	110	---	---	---	---	PASS
C16orf11	146325	broad.mit.edu	37	16	613438	613438	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:613438G>A	uc002chk.2	+	2	423	c.144G>A	c.(142-144)GAG>GAA	p.E48E		NM_145270	NP_660313	P0CG20	CP011_HUMAN	hypothetical protein LOC146325	48										central_nervous_system(1)	1						CCTGCCTGGAGAAGTCACACC	0.612													5	53	---	---	---	---	PASS
RHOT2	89941	broad.mit.edu	37	16	722267	722267	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:722267G>C	uc002cip.2	+	15	1276	c.1209G>C	c.(1207-1209)AAG>AAC	p.K403N	RHOT2_uc002ciq.2_Missense_Mutation_p.K296N|RHOT2_uc010bqy.2_Missense_Mutation_p.K182N	NM_138769	NP_620124	Q8IXI1	MIRO2_HUMAN	ras homolog gene family, member T2	403	Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			pancreas(1)	1		Hepatocellular(780;0.0218)				CTCGTGAGAAGAGGCTGGACC	0.637													9	47	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2812010	2812010	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2812010G>A	uc002crk.2	+	11	2030	c.1481G>A	c.(1480-1482)CGA>CAA	p.R494Q	SRRM2_uc002crj.1_Missense_Mutation_p.R398Q|SRRM2_uc002crl.1_Missense_Mutation_p.R494Q|SRRM2_uc010bsu.1_Missense_Mutation_p.R398Q	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	494	Arg-rich.|Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						AAGAGAGGGCGATCTCGGTCT	0.577													8	48	---	---	---	---	PASS
TIGD7	91151	broad.mit.edu	37	16	3349121	3349121	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3349121C>G	uc002cus.2	-	1	2280	c.1494G>C	c.(1492-1494)CAG>CAC	p.Q498H	ZNF263_uc002cur.2_3'UTR	NM_033208	NP_149985	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	498					regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0						AGTGGAATCTCTGAAACTCAG	0.398													15	91	---	---	---	---	PASS
TIGD7	91151	broad.mit.edu	37	16	3349384	3349384	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3349384C>T	uc002cus.2	-	1	2017	c.1231G>A	c.(1231-1233)GAT>AAT	p.D411N	ZNF263_uc002cur.2_3'UTR	NM_033208	NP_149985	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	411					regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0						CCTTGAAAATCATATTCAGGT	0.348													22	168	---	---	---	---	PASS
TIGD7	91151	broad.mit.edu	37	16	3349549	3349549	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3349549C>T	uc002cus.2	-	1	1852	c.1066G>A	c.(1066-1068)GAA>AAA	p.E356K	ZNF263_uc002cur.2_3'UTR	NM_033208	NP_149985	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	356	DDE.				regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0						TCATCACTTTCTTCAAATATT	0.279													10	68	---	---	---	---	PASS
CLUAP1	23059	broad.mit.edu	37	16	3569980	3569980	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3569980G>C	uc002cvk.1	+	7	762	c.657G>C	c.(655-657)AAG>AAC	p.K219N	CLUAP1_uc002cvj.1_Missense_Mutation_p.K219N|CLUAP1_uc002cvl.1_Missense_Mutation_p.K219N|CLUAP1_uc002cvm.1_Missense_Mutation_p.K53N	NM_015041	NP_055856	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1 isoform 1	219	Potential.					nucleus	protein binding			ovary(1)|breast(1)|pancreas(1)	3						AAATCGAAAAGAGAAAATTAG	0.383													7	134	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9934661	9934661	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9934661G>A	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc010uyn.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	AGACCACCTGGATGCAAGGCa	0.463													4	13	---	---	---	---	PASS
ERCC4	2072	broad.mit.edu	37	16	14042076	14042076	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14042076G>A	uc002dce.2	+	11	2632	c.2623G>A	c.(2623-2625)GAA>AAA	p.E875K	ERCC4_uc010uyz.1_Missense_Mutation_p.E425K	NM_005236	NP_005227	Q92889	XPF_HUMAN	excision repair cross-complementing rodent	875	Interaction with EME1 and ERCC1.				double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10						GAACATCGCAGAATTAGCAGC	0.453			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				3	48	---	---	---	---	PASS
PARN	5073	broad.mit.edu	37	16	14723469	14723469	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14723469C>G	uc010uzd.1	-	2	224	c.82G>C	c.(82-84)GAT>CAT	p.D28H	PARN_uc010uzc.1_5'UTR|PARN_uc010uze.1_Missense_Mutation_p.D28H|PARN_uc010uzf.1_Missense_Mutation_p.D28H|PARN_uc010uzg.1_RNA	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation	28		Divalent metal cation; catalytic (Probable).		D->C: Loss of function in the presence of Mg(2+) but not in the presence of Mn(2+), Zn(2+), Co(2+) or Cd(2+).|D->A: Loss of function but does not abolish ability to bind RNA. Induces a decrease in degradation of mRNAs containing AREs.	female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						AACTCCCCATCGATGGCGAAG	0.522													4	44	---	---	---	---	PASS
XYLT1	64131	broad.mit.edu	37	16	17202795	17202795	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17202795G>A	uc002dfa.2	-	12	2722	c.2637C>T	c.(2635-2637)CTC>CTT	p.L879L		NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	879	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						TGGGCAGGCTGAGGACGGGGT	0.627													10	64	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18863424	18863424	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18863424G>C	uc002dfm.2	-	33	5380	c.5017C>G	c.(5017-5019)CTT>GTT	p.L1673V	SMG1_uc010bwb.2_Missense_Mutation_p.L1533V|SMG1_uc010bwa.2_Missense_Mutation_p.L404V|SMG1_uc002dfo.3_5'Flank	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	1673	FAT.|Interaction with SMG8 and SMG9.				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						GCCTGTCCAAGAATACCATAT	0.443													5	64	---	---	---	---	PASS
TMC5	79838	broad.mit.edu	37	16	19492729	19492729	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19492729C>G	uc002dgc.3	+	15	3054	c.2305C>G	c.(2305-2307)CAG>GAG	p.Q769E	TMC5_uc010vaq.1_Missense_Mutation_p.Q717E|TMC5_uc002dgb.3_Missense_Mutation_p.Q769E|TMC5_uc010var.1_Missense_Mutation_p.Q769E|TMC5_uc002dgd.1_Missense_Mutation_p.Q523E|TMC5_uc002dge.3_Missense_Mutation_p.Q523E|TMC5_uc002dgf.3_Missense_Mutation_p.Q452E|TMC5_uc002dgg.3_Missense_Mutation_p.Q410E	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	769	Cytoplasmic (Potential).					integral to membrane				skin(1)	1						TCTTGGCCTTCAGGAGTTTGA	0.443													11	147	---	---	---	---	PASS
POLR3E	55718	broad.mit.edu	37	16	22337138	22337138	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22337138C>T	uc002dkk.2	+	18	1561	c.1405C>T	c.(1405-1407)CAG>TAG	p.Q469*	POLR3E_uc002dkj.1_Nonsense_Mutation_p.Q469*|POLR3E_uc002dkm.2_Nonsense_Mutation_p.Q433*|POLR3E_uc010vbr.1_Nonsense_Mutation_p.Q469*|POLR3E_uc002dkl.2_Nonsense_Mutation_p.Q469*|POLR3E_uc010vbs.1_Nonsense_Mutation_p.Q433*|POLR3E_uc010vbt.1_Nonsense_Mutation_p.Q413*	NM_018119	NP_060589	Q9NVU0	RPC5_HUMAN	RNA polymerase III polypeptide E	469					innate immune response|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	nucleoplasm	DNA-directed RNA polymerase activity			ovary(1)|central_nervous_system(1)	2				GBM - Glioblastoma multiforme(48;0.012)		AACCAAGGCCCAGCAGAACCA	0.692													5	36	---	---	---	---	PASS
KIF22	3835	broad.mit.edu	37	16	29814187	29814187	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29814187C>G	uc002dts.3	+	9	1402	c.1378C>G	c.(1378-1380)CTG>GTG	p.L460V	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|KIF22_uc010vdv.1_Missense_Mutation_p.L392V|KIF22_uc010vdw.1_Missense_Mutation_p.L392V|KIF22_uc010bzf.2_Missense_Mutation_p.L392V|KIF22_uc002dtt.1_5'Flank|KIF22_uc002frc.1_5'Flank	NM_007317	NP_015556	Q14807	KIF22_HUMAN	kinesin family member 22	460					blood coagulation|DNA repair|microtubule-based movement|mitosis	cytosol|kinetochore|microtubule|nucleus	ATP binding|DNA binding|microtubule motor activity|protein binding				0						GGGGGCCCCTCTGTTGAGTAC	0.592													6	70	---	---	---	---	PASS
SEZ6L2	26470	broad.mit.edu	37	16	29889630	29889630	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29889630G>A	uc002duq.3	-	10	1930	c.1690C>T	c.(1690-1692)CGC>TGC	p.R564C	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Missense_Mutation_p.R494C|SEZ6L2_uc002dur.3_Missense_Mutation_p.R494C|SEZ6L2_uc002dus.3_Missense_Mutation_p.R450C|SEZ6L2_uc010vec.1_Missense_Mutation_p.R564C|SEZ6L2_uc010ved.1_Missense_Mutation_p.R520C	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform	564	CUB 3.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						AGCAAGATGCGCTTCTCTTCC	0.597													4	51	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30724940	30724940	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30724940C>G	uc002dze.1	+	16	2786	c.2401C>G	c.(2401-2403)CGC>GGC	p.R801G	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.R658G|SRCAP_uc010bzz.1_Missense_Mutation_p.R371G	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	801					interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CCAGTCTCATCGCGAGTTCAA	0.527													14	88	---	---	---	---	PASS
RNF40	9810	broad.mit.edu	37	16	30779514	30779514	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30779514G>C	uc002dzq.2	+	13	1765	c.1642G>C	c.(1642-1644)GAG>CAG	p.E548Q	RNF40_uc010caa.2_Missense_Mutation_p.E548Q|RNF40_uc010cab.2_Missense_Mutation_p.E448Q|RNF40_uc010vfa.1_Intron|RNF40_uc002dzr.2_Missense_Mutation_p.E548Q|RNF40_uc010vfb.1_Missense_Mutation_p.E240Q|RNF40_uc010vfc.1_5'Flank	NM_014771	NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40	548					histone H2B ubiquitination|histone monoubiquitination|ubiquitin-dependent protein catabolic process	nucleus|synaptosome|ubiquitin ligase complex	protein homodimerization activity|ubiquitin protein ligase binding|zinc ion binding			central_nervous_system(1)	1			Colorectal(24;0.198)			CCCAGGGAAAGAGGAGGGTGG	0.642													12	95	---	---	---	---	PASS
ITGAM	3684	broad.mit.edu	37	16	31282346	31282346	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31282346C>T	uc002ebq.2	+	6	597	c.499C>T	c.(499-501)CGG>TGG	p.R167W	ITGAM_uc002ebr.2_Missense_Mutation_p.R167W	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	167	VWFA.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						ACATGACTTTCGGCGGATGAA	0.473													12	170	---	---	---	---	PASS
RBL2	5934	broad.mit.edu	37	16	53498171	53498171	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53498171C>G	uc002ehi.3	+	12	1712	c.1594C>G	c.(1594-1596)CTC>GTC	p.L532V	RBL2_uc010vgv.1_Missense_Mutation_p.L458V|RBL2_uc002ehj.2_Missense_Mutation_p.L242V|RBL2_uc010vgw.1_Missense_Mutation_p.L316V	NM_005611	NP_005602	Q08999	RBL2_HUMAN	retinoblastoma-like 2 (p130)	532	Domain A.|Pocket; binds E1A.				cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						CCACAGATCTCTCTTGGCCTG	0.348													3	65	---	---	---	---	PASS
NUP93	9688	broad.mit.edu	37	16	56864512	56864512	+	Missense_Mutation	SNP	G	A	A	rs145578512		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56864512G>A	uc002eka.2	+	10	1121	c.1000G>A	c.(1000-1002)GCT>ACT	p.A334T	NUP93_uc002ekb.2_Missense_Mutation_p.A211T|NUP93_uc010vhi.1_Missense_Mutation_p.A211T	NM_014669	NP_055484	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	334					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2						CCTGCTTGCCGCTTCACAGGT	0.502													13	91	---	---	---	---	PASS
CPNE2	221184	broad.mit.edu	37	16	57155594	57155594	+	Silent	SNP	C	T	T	rs3751709	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57155594C>T	uc002eks.1	+	9	1018	c.789C>T	c.(787-789)TTC>TTT	p.F263F	CPNE2_uc010cct.1_Silent_p.F289F|CPNE2_uc010ccu.1_Silent_p.F263F|CPNE2_uc002ekt.1_5'Flank	NM_152727	NP_689940	Q96FN4	CPNE2_HUMAN	copine II	263										central_nervous_system(1)|skin(1)	2		all_neural(199;0.224)				AGCTGGAGTTCGAGTGCATCA	0.522													20	136	---	---	---	---	PASS
CX3CL1	6376	broad.mit.edu	37	16	57416625	57416625	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57416625C>G	uc002eli.2	+	3	942	c.875C>G	c.(874-876)TCC>TGC	p.S292C		NM_002996	NP_002987	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1 precursor	292	Mucin-like stalk.|Extracellular (Potential).				cell adhesion|cytokine-mediated signaling pathway|defense response|immune response|leukocyte adhesive activation|positive regulation of calcium-independent cell-cell adhesion|positive regulation of inflammatory response	cell surface|extracellular space|integral to membrane|plasma membrane	chemokine activity				0						GTCCCTGTCTCCTCAGAAGGG	0.667													5	59	---	---	---	---	PASS
LRRC36	55282	broad.mit.edu	37	16	67401275	67401275	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67401275C>T	uc002esv.2	+	8	1129	c.1110C>T	c.(1108-1110)ACC>ACT	p.T370T	LRRC36_uc002esw.2_Intron|LRRC36_uc010ceh.2_Intron|LRRC36_uc002esx.2_Silent_p.T249T|LRRC36_uc010vjk.1_Silent_p.T249T|LRRC36_uc010vjl.1_Intron|LRRC36_uc002esy.2_Intron	NM_018296	NP_060766	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36 isoform 1	370											0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		ACATAAAGACCACCGCTTCAC	0.428													10	285	---	---	---	---	PASS
TMCO7	79613	broad.mit.edu	37	16	68936274	68936274	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68936274G>A	uc002ewi.3	+	9	1546	c.1534G>A	c.(1534-1536)GAA>AAA	p.E512K		NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7	512						integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		GGGGAAGCTGGAAAGGAAGAA	0.453													5	64	---	---	---	---	PASS
WWP2	11060	broad.mit.edu	37	16	69969897	69969897	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69969897C>T	uc002exu.1	+						WWP2_uc002exv.1_Intron|WWP2_uc010vlm.1_Intron|WWP2_uc010vln.1_Intron|WWP2_uc002exw.1_Intron	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase						entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						CAAGTGAGTTCCCTGCCCCCT	0.547													6	64	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72993631	72993631	+	Silent	SNP	G	A	A	rs62640011	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72993631G>A	uc002fck.2	-	2	1087	c.414C>T	c.(412-414)GAC>GAT	p.D138D	ZFHX3_uc002fcl.2_Intron	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	138					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				ACGCGGAGCCGTCCGGCTGGT	0.682													4	49	---	---	---	---	PASS
RFWD3	55159	broad.mit.edu	37	16	74694992	74694992	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74694992G>A	uc002fda.2	-	2	454	c.356C>T	c.(355-357)TCA>TTA	p.S119L	RFWD3_uc010cgq.2_Missense_Mutation_p.S119L	NM_018124	NP_060594	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	119					DNA repair|mitotic cell cycle G1/S transition DNA damage checkpoint|response to ionizing radiation	nucleus	MDM2 binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(1)	3						GTTGGTCATTGAATGCAACGA	0.463													6	57	---	---	---	---	PASS
LDHD	197257	broad.mit.edu	37	16	75149147	75149147	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75149147G>A	uc002fdm.2	-	3	323	c.276C>T	c.(274-276)ATC>ATT	p.I92I	LDHD_uc002fdn.2_Silent_p.I92I	NM_153486	NP_705690	Q86WU2	LDHD_HUMAN	D-lactate dehydrogenase isoform 1 precursor	92	FAD-binding PCMH-type.						D-lactate dehydrogenase (cytochrome) activity|flavin adenine dinucleotide binding|protein binding				0						CGAATGGGATGATGGGCACAC	0.657													9	124	---	---	---	---	PASS
BCMO1	53630	broad.mit.edu	37	16	81301620	81301620	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81301620G>A	uc002fgn.1	+	6	945	c.727G>A	c.(727-729)GAG>AAG	p.E243K	BCMO1_uc010vnp.1_Missense_Mutation_p.E174K	NM_017429	NP_059125	Q9HAY6	BCDO1_HUMAN	beta-carotene 15,15'-monooxygenase	243					retinoid metabolic process|steroid metabolic process	cytosol	beta-carotene 15,15'-monooxygenase activity|metal ion binding|monooxygenase activity				0						TGGAGTCACCGAGAACTATGT	0.552													4	72	---	---	---	---	PASS
GAN	8139	broad.mit.edu	37	16	81410830	81410830	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81410830C>G	uc002fgo.2	+	10	1657	c.1509C>G	c.(1507-1509)ATC>ATG	p.I503M		NM_022041	NP_071324	Q9H2C0	GAN_HUMAN	gigaxonin	503	Kelch 5.				cell death	cytoplasm|neurofilament	protein binding			ovary(2)	2		Colorectal(91;0.153)				TCAGGTGGATCTATCTTAACG	0.408													7	184	---	---	---	---	PASS
LRRC50	123872	broad.mit.edu	37	16	84203648	84203648	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84203648G>A	uc002fhl.3	+	8	1395	c.1214G>A	c.(1213-1215)AGA>AAA	p.R405K	LRRC50_uc010vnw.1_Missense_Mutation_p.R169K	NM_178452	NP_848547	Q8NEP3	DAAF1_HUMAN	leucine rich repeat containing 50	405	Pro-rich.				axonemal dynein complex assembly|cilium morphogenesis	cilium axoneme|cytoplasm|spindle pole	dynein binding				0						GAGGCTAAAAGAGAGGATGGA	0.567									Kartagener_syndrome				4	51	---	---	---	---	PASS
KLHL36	79786	broad.mit.edu	37	16	84690971	84690971	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84690971G>A	uc002fig.2	+	3	699	c.558G>A	c.(556-558)CAG>CAA	p.Q186Q	KLHL36_uc010chl.2_Silent_p.Q185Q	NM_024731	NP_079007	Q8N4N3	KLH36_HUMAN	kelch-like 36	186	BACK.									skin(2)	2						ACTTCCTGCAGAACGTCTCCA	0.607													4	37	---	---	---	---	PASS
ZCCHC14	23174	broad.mit.edu	37	16	87443876	87443876	+	3'UTR	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87443876G>A	uc002fjz.1	-	13					ZCCHC14_uc002fka.1_RNA	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14						cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)		TCTGTTGCCAGAGAAAAATAT	0.373													11	174	---	---	---	---	PASS
SNAI3	333929	broad.mit.edu	37	16	88744857	88744857	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88744857C>T	uc002flj.2	-	3	946	c.878G>A	c.(877-879)TGA>TAA	p.*293*	MGC23284_uc002fli.3_Intron	NM_178310	NP_840101	Q3KNW1	SNAI3_HUMAN	snail homolog 3	293					oxidation-reduction process		copper ion binding|DNA binding|zinc ion binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.048)		ACGTGCCTCTCAGGGGCCCGG	0.701													4	17	---	---	---	---	PASS
FANCA	2175	broad.mit.edu	37	16	89882319	89882319	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89882319C>G	uc002fou.1	-	2	197	c.155G>C	c.(154-156)CGA>CCA	p.R52P	FANCA_uc010vpn.1_Missense_Mutation_p.R52P|FANCA_uc002fov.1_Missense_Mutation_p.R35P|FANCA_uc002fow.1_Missense_Mutation_p.R52P|FANCA_uc002fox.1_Missense_Mutation_p.R52P|FANCA_uc010ciu.1_Missense_Mutation_p.R52P|FANCA_uc002foy.2_Missense_Mutation_p.R52P	NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform	52					DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CTGATGGCTTCGCAGGAGGCG	0.522			D|Mis|N|F|S			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				13	79	---	---	---	---	PASS
GEMIN4	50628	broad.mit.edu	37	17	650372	650372	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:650372G>A	uc002frs.1	-	2	1030	c.911C>T	c.(910-912)TCG>TTG	p.S304L	GEMIN4_uc010vqa.1_3'UTR	NM_015721	NP_056536	P57678	GEMI4_HUMAN	gemin 4	304					rRNA processing|spliceosomal snRNP assembly	Cajal body|cytosol|nucleolus|small nuclear ribonucleoprotein complex|spliceosomal complex	protein binding			ovary(2)|kidney(1)|skin(1)	4		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TTTGGCCAGCGAGGTCAGGCT	0.627													13	107	---	---	---	---	PASS
RNMTL1	55178	broad.mit.edu	37	17	686411	686411	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:686411C>T	uc002frw.2	+	2	509	c.403C>T	c.(403-405)CTC>TTC	p.L135F	GLOD4_uc002fru.2_5'Flank|GLOD4_uc010vqc.1_5'Flank|GLOD4_uc002frv.2_5'Flank	NM_018146	NP_060616	Q9HC36	RMTL1_HUMAN	RNA methyltransferase like 1	135					RNA processing		protein binding|RNA binding|RNA methyltransferase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0219)		TTCAGACGCTCTCAAGGCTGG	0.463													3	46	---	---	---	---	PASS
ABR	29	broad.mit.edu	37	17	953287	953287	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:953287C>G	uc002fsd.2	-						ABR_uc002fse.2_Intron|ABR_uc010vqg.1_Intron|ABR_uc002fsg.2_Intron|ABR_uc002fsh.1_Intron	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		GCCCTGGCCTCACCTGGATCT	0.532													29	171	---	---	---	---	PASS
SMYD4	114826	broad.mit.edu	37	17	1703264	1703264	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1703264G>A	uc002ftm.3	-	5	1592	c.1424C>T	c.(1423-1425)GCA>GTA	p.A475V	SMYD4_uc002ftn.1_Missense_Mutation_p.A330V	NM_052928	NP_443160	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	475	SET.						zinc ion binding			skin(3)|kidney(2)	5						TGTCACTGCTGCTTTAAGCTG	0.512													6	35	---	---	---	---	PASS
SMYD4	114826	broad.mit.edu	37	17	1703353	1703353	+	Silent	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1703353G>C	uc002ftm.3	-	5	1503	c.1335C>G	c.(1333-1335)CTC>CTG	p.L445L	SMYD4_uc002ftn.1_Silent_p.L300L	NM_052928	NP_443160	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	445							zinc ion binding			skin(3)|kidney(2)	5						CAGAAACACAGAGAGCACAGA	0.453													9	53	---	---	---	---	PASS
SMYD4	114826	broad.mit.edu	37	17	1703679	1703679	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1703679G>C	uc002ftm.3	-	5	1177	c.1009C>G	c.(1009-1011)CTG>GTG	p.L337V	SMYD4_uc002ftn.1_Missense_Mutation_p.L192V	NM_052928	NP_443160	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	337							zinc ion binding			skin(3)|kidney(2)	5						AGCCCTCCCAGAGGACATTCT	0.517													12	36	---	---	---	---	PASS
SMG6	23293	broad.mit.edu	37	17	2201212	2201212	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2201212G>A	uc002fub.1	-	3	2040	c.1985C>T	c.(1984-1986)CCG>CTG	p.P662L		NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay	662					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						CTCAACATTCGGATCCTTGAC	0.413													7	89	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3953058	3953058	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3953058C>T	uc002fxe.2	-	37	6023	c.5959G>A	c.(5959-5961)GAG>AAG	p.E1987K	ZZEF1_uc002fxh.2_Missense_Mutation_p.E301K|ZZEF1_uc002fxi.2_Missense_Mutation_p.E222K|ZZEF1_uc002fxj.1_Missense_Mutation_p.E600K	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	1987							calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						AGCTGCTCCTCTGACGCTCCG	0.512													3	52	---	---	---	---	PASS
PSMB6	5694	broad.mit.edu	37	17	4701366	4701366	+	Silent	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4701366G>C	uc002fzb.2	+	5	528	c.495G>C	c.(493-495)GGG>GGC	p.G165G		NM_002798	NP_002789	P28072	PSB6_HUMAN	proteasome beta 6 subunit precursor	165					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity			ovary(2)	2						GAGGCTCCGGGAGCTCCTACA	0.522													10	65	---	---	---	---	PASS
KDM6B	23135	broad.mit.edu	37	17	7750518	7750518	+	Silent	SNP	A	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7750518A>C	uc002giw.1	+	10	1381	c.1005A>C	c.(1003-1005)CCA>CCC	p.P335P	KDM6B_uc002gix.2_5'Flank	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	335	Pro-rich.				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2						CTGCTCCCCCAGGCCCAGGCC	0.692													5	45	---	---	---	---	PASS
ZNF624	57547	broad.mit.edu	37	17	16537969	16537969	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16537969C>T	uc010cpi.1	-	4	338	c.255G>A	c.(253-255)GAG>GAA	p.E85E		NM_020787	NP_065838	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	85	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TCCTGTAATTCTCTAGCATCA	0.453													3	58	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17701149	17701149	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17701149C>T	uc002grm.2	+	3	5356	c.4887C>T	c.(4885-4887)TCC>TCT	p.S1629S	RAI1_uc002grn.1_Silent_p.S1629S	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1629	Ser-rich.					cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		AGCCTtcctcctctgcctcct	0.517													13	59	---	---	---	---	PASS
NLK	51701	broad.mit.edu	37	17	26518054	26518054	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26518054G>C	uc010crj.2	+	9	1456	c.1244G>C	c.(1243-1245)AGA>ACA	p.R415T	NLK_uc010cri.1_RNA	NM_016231	NP_057315	Q9UBE8	NLK_HUMAN	nemo like kinase	415	Protein kinase.				intracellular protein kinase cascade|negative regulation of Wnt receptor signaling pathway|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|serine phosphorylation of STAT3 protein|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|MAP kinase activity|SH2 domain binding|transcription factor binding|ubiquitin protein ligase binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CAGTCCAAAAGAATATCCGCT	0.413													5	46	---	---	---	---	PASS
PHF12	57649	broad.mit.edu	37	17	27244444	27244444	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27244444C>G	uc002hdg.1	-	7	1523	c.993G>C	c.(991-993)CTG>CTC	p.L331L	PHF12_uc010wbb.1_Silent_p.L313L|PHF12_uc002hdi.1_Silent_p.L327L|PHF12_uc002hdj.1_Silent_p.L331L|PHF12_uc010crw.1_Silent_p.L34L|PHF12_uc002hdh.1_Silent_p.L114L	NM_001033561	NP_001028733	Q96QT6	PHF12_HUMAN	PHD finger protein 12 isoform 1	331	Interaction with SIN3A.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcriptional repressor complex	protein binding|zinc ion binding			ovary(1)	1	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			ACCGATTGCTCAGTGTCATAT	0.512													4	45	---	---	---	---	PASS
ANKRD13B	124930	broad.mit.edu	37	17	27938969	27938969	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27938969G>C	uc002hei.2	+	10	1158	c.1045G>C	c.(1045-1047)GAG>CAG	p.E349Q	ANKRD13B_uc002heh.2_Missense_Mutation_p.E217Q|ANKRD13B_uc002hej.2_RNA|ANKRD13B_uc002hek.2_5'Flank	NM_152345	NP_689558	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	349											0						CCCCAACTTTGAGCTGGGCAA	0.612													6	41	---	---	---	---	PASS
SSH2	85464	broad.mit.edu	37	17	27958302	27958302	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27958302C>T	uc002heo.1	-	15	3829	c.3829G>A	c.(3829-3831)GAG>AAG	p.E1277K	SSH2_uc010wbh.1_Missense_Mutation_p.E1304K	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	1277					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						GAGGCAGGCTCCCTCTCTGGT	0.522													8	71	---	---	---	---	PASS
SSH2	85464	broad.mit.edu	37	17	27977722	27977722	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27977722C>T	uc002heo.1	-	12	1095	c.1095G>A	c.(1093-1095)ACG>ACA	p.T365T	SSH2_uc010wbh.1_Silent_p.T392T|SSH2_uc002hep.1_Silent_p.T365T	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	365	Tyrosine-protein phosphatase.				actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						CCAGGAGATCCGTTGCCTCTT	0.433													16	94	---	---	---	---	PASS
CRLF3	51379	broad.mit.edu	37	17	29111235	29111235	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29111235G>C	uc002hfr.3	-	8	1408	c.1299C>G	c.(1297-1299)TTC>TTG	p.F433L	CRLF3_uc010wbr.1_Missense_Mutation_p.F317L	NM_015986	NP_057070	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	433					negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				ATCCAGGATAGAAAAATGAGC	0.398													7	54	---	---	---	---	PASS
SLFN11	91607	broad.mit.edu	37	17	33679437	33679437	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33679437G>C	uc010ctp.2	-	7	3086	c.2644C>G	c.(2644-2646)CTG>GTG	p.L882V	SLFN11_uc010ctq.2_Missense_Mutation_p.L882V|SLFN11_uc002hjh.3_Missense_Mutation_p.L882V|SLFN11_uc002hjg.3_Missense_Mutation_p.L882V|SLFN11_uc010ctr.2_Missense_Mutation_p.L882V	NM_001104588	NP_001098058	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	882						nucleus	ATP binding			large_intestine(1)|ovary(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGACAGATCAGAACATTGGGT	0.463													12	134	---	---	---	---	PASS
CASC3	22794	broad.mit.edu	37	17	38320212	38320212	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38320212G>A	uc010cwt.1	+	7	1559	c.1264G>A	c.(1264-1266)GAG>AAG	p.E422K	CASC3_uc010cws.1_Missense_Mutation_p.E422K|CASC3_uc002hue.2_Missense_Mutation_p.E422K	NM_007359	NP_031385	O15234	CASC3_HUMAN	metastatic lymph node 51	422	Necessary for localization in cytoplasmic stress granules.				mRNA processing|mRNA transport|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translation|response to stress|RNA splicing	exon-exon junction complex|nuclear speck|perinuclear region of cytoplasm	identical protein binding|RNA binding|ubiquitin protein ligase binding			ovary(1)	1						CAAGCTTGCAGAGGAGGTGCC	0.557													6	82	---	---	---	---	PASS
CCR7	1236	broad.mit.edu	37	17	38711879	38711879	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38711879G>C	uc002huw.2	-	3	315	c.252C>G	c.(250-252)ATC>ATG	p.I84M		NM_001838	NP_001829	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7 precursor	84	Helical; Name=1; (Potential).				cell maturation|immunological synapse formation|inflammatory response|interleukin-12 secretion|lymphocyte migration into lymph node|positive regulation of dendritic cell antigen processing and presentation|positive regulation of glycoprotein biosynthetic process|positive regulation of humoral immune response|positive regulation of hypersensitivity|positive regulation of interleukin-12 production|positive regulation of neutrophil chemotaxis|regulation of interferon-gamma production|regulation of interleukin-1 beta secretion|T cell costimulation	integral to membrane|intracellular	C-C chemokine receptor activity|chemokine (C-C motif) ligand 19 binding|chemokine (C-C motif) ligand 21 binding			breast(1)	1		Breast(137;0.000496)				TCTTGAAATAGATATAGGTCA	0.532													6	38	---	---	---	---	PASS
SMARCE1	6605	broad.mit.edu	37	17	38788620	38788620	+	Splice_Site	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38788620C>G	uc002hux.2	-	8	666	c.542_splice	c.e8-1	p.D181_splice	SMARCE1_uc010wff.1_Splice_Site_p.D146_splice|SMARCE1_uc010wfg.1_Splice_Site_p.D111_splice|SMARCE1_uc002huy.2_Splice_Site_p.D146_splice|SMARCE1_uc010wfh.1_Splice_Site_p.D111_splice|SMARCE1_uc010wfi.1_Splice_Site_p.D163_splice	NM_003079	NP_003070	Q969G3	SMCE1_HUMAN	SWI/SNF-related matrix-associated						chromatin modification|negative regulation of transcription, DNA-dependent|nervous system development|nucleosome disassembly|regulation of transcription from RNA polymerase II promoter	nBAF complex|npBAF complex|nuclear chromosome|SWI/SNF complex|transcriptional repressor complex	chromatin binding|DNA binding|N-acetyltransferase activity|protein binding|protein N-terminus binding|transcription coactivator activity				0		Breast(137;0.000812)				TCATCATAATCTGGAGTGAAC	0.433													9	19	---	---	---	---	PASS
KLHL10	317719	broad.mit.edu	37	17	39994369	39994369	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39994369C>G	uc010cxr.2	+	1	327	c.185C>G	c.(184-186)TCC>TGC	p.S62C	NT5C3L_uc010wfu.1_5'Flank|NT5C3L_uc002hyb.3_5'Flank|NT5C3L_uc002hyc.3_5'Flank|NT5C3L_uc002hyd.3_5'Flank|NT5C3L_uc002hxy.3_5'Flank|NT5C3L_uc002hxz.3_5'Flank|NT5C3L_uc002hya.3_5'Flank|KLHL10_uc010wfv.1_Intron|KLHL10_uc010wfw.1_Intron	NM_152467	NP_689680	Q6JEL2	KLH10_HUMAN	kelch-like 10	62	BTB.					cytoplasm				ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		Breast(137;0.000162)				AGCTGCAGTTCCTACTTTAGG	0.463													4	50	---	---	---	---	PASS
KLHL10	317719	broad.mit.edu	37	17	40004567	40004567	+	3'UTR	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40004567C>T	uc010cxr.2	+	5					KLHL10_uc010wfw.1_3'UTR	NM_152467	NP_689680	Q6JEL2	KLH10_HUMAN	kelch-like 10							cytoplasm				ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		Breast(137;0.000162)				TGAGCCTCTTCATTTAGCTAA	0.348													11	95	---	---	---	---	PASS
ATP6V0A1	535	broad.mit.edu	37	17	40639168	40639168	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40639168C>T	uc002hzr.2	+						ATP6V0A1_uc002hzq.2_Intron|ATP6V0A1_uc002hzs.2_Intron|ATP6V0A1_uc010wgj.1_Intron|ATP6V0A1_uc010wgk.1_Intron|ATP6V0A1_uc010cyg.2_Intron|ATP6V0A1_uc010wgl.1_Intron	NM_001130021	NP_001123493	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytoplasmic vesicle membrane|endosome membrane|Golgi apparatus|integral to membrane|melanosome|nucleus|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		CTTTTCTCCCCAAAGGTTCTG	0.488													4	63	---	---	---	---	PASS
NAGLU	4669	broad.mit.edu	37	17	40690348	40690348	+	Intron	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40690348C>A	uc002hzv.2	+							NM_000263	NP_000254	P54802	ANAG_HUMAN	alpha-N-acetylglucosaminidase precursor							lysosome	alpha-N-acetylglucosaminidase activity				0		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	GTGGGCCCTTCTTCCTCAGGT	0.338													7	155	---	---	---	---	PASS
TMEM101	84336	broad.mit.edu	37	17	42089329	42089329	+	Silent	SNP	G	A	A	rs116587312	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42089329G>A	uc002ieu.2	-	4	766	c.741C>T	c.(739-741)TTC>TTT	p.F247F	TMEM101_uc010wis.1_Silent_p.F189F	NM_032376	NP_115752	Q96IK0	TM101_HUMAN	transmembrane protein 101	247	Helical; (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		Breast(137;0.0264)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CAGCAGTTCCGAAGATGCCCA	0.547													10	41	---	---	---	---	PASS
NMT1	4836	broad.mit.edu	37	17	43173589	43173589	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43173589G>C	uc002ihz.2	+	5	550	c.532G>C	c.(532-534)GAG>CAG	p.E178Q	NMT1_uc002iia.2_RNA	NM_021079	NP_066565	P30419	NMT1_HUMAN	N-myristoyltransferase 1	178					activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals|N-terminal protein myristoylation|protein lipoylation	actin cytoskeleton|cell junction|cytosol	glycylpeptide N-tetradecanoyltransferase activity				0		Prostate(33;0.155)				CCTCCTGAATGAGAACTATGT	0.448													6	118	---	---	---	---	PASS
ABCC3	8714	broad.mit.edu	37	17	48735556	48735556	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48735556G>C	uc002isl.2	+	5	680	c.600G>C	c.(598-600)AAG>AAC	p.K200N	ABCC3_uc002isk.3_Missense_Mutation_p.K200N	NM_003786	NP_003777	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C, member 3	200	Cytoplasmic (By similarity).				bile acid metabolic process	integral to plasma membrane|membrane fraction	ATP binding|bile acid-exporting ATPase activity|organic anion transmembrane transporter activity			skin(3)|central_nervous_system(1)	4			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Glibenclamide(DB01016)	TCTCCGCAAAGAATGTCGACC	0.572													7	60	---	---	---	---	PASS
TMEM100	55273	broad.mit.edu	37	17	53798348	53798348	+	Missense_Mutation	SNP	T	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53798348T>G	uc002iuj.3	-	2	395	c.84A>C	c.(82-84)GAA>GAC	p.E28D	TMEM100_uc002iuk.3_Missense_Mutation_p.E28D	NM_018286	NP_060756	Q9NV29	TM100_HUMAN	transmembrane protein 100	28						integral to membrane					0						TGATCACAACTTCACTCTTGG	0.542													7	86	---	---	---	---	PASS
C17orf71	55181	broad.mit.edu	37	17	57290613	57290613	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57290613G>C	uc002ixi.2	+	3	2471	c.2429G>C	c.(2428-2430)GGA>GCA	p.G810A		NM_018149	NP_060619	Q8ND04	SMG8_HUMAN	SMG8 protein	810					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of protein kinase activity		protein binding				0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					GAAGATGAAGGAGACTTAGAC	0.433													16	71	---	---	---	---	PASS
DHX40	79665	broad.mit.edu	37	17	57647978	57647978	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57647978G>A	uc002ixn.1	+	3	527	c.380G>A	c.(379-381)GGA>GAA	p.G127E	DHX40_uc010woe.1_Intron|DHX40_uc002ixo.1_Missense_Mutation_p.G28E	NM_024612	NP_078888	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40	127	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|nucleic acid binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TGCACTTTGGGATCCAAAGTA	0.328													8	81	---	---	---	---	PASS
MED13	9969	broad.mit.edu	37	17	60030396	60030396	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60030396G>A	uc002izo.2	-	27	6124	c.6047C>T	c.(6046-6048)CCT>CTT	p.P2016L		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	2016					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						TGGAGAAGCAGGAAGGATATT	0.418													7	71	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62043880	62043880	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62043880G>C	uc002jds.1	-	7	1138	c.1061C>G	c.(1060-1062)TCC>TGC	p.S354C		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	354	I.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	GGCATCGTTGGAGCCCTCCAG	0.572													4	30	---	---	---	---	PASS
GNA13	10672	broad.mit.edu	37	17	63010459	63010459	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63010459G>C	uc002jfc.2	-	4	1259	c.1050C>G	c.(1048-1050)ATC>ATG	p.I350M	GNA13_uc010wqh.1_Missense_Mutation_p.I255M	NM_006572	NP_006563	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein),	350					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase D activity|cellular component movement|platelet activation|Rho protein signal transduction	brush border membrane|heterotrimeric G-protein complex|melanosome	D5 dopamine receptor binding|G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|signal transducer activity|type 1 angiotensin receptor binding				0						TCTCCGTGTTGATAGCAGTGG	0.473													8	56	---	---	---	---	PASS
NOL11	25926	broad.mit.edu	37	17	65717522	65717522	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65717522C>G	uc002jgd.1	+	4	344	c.341C>G	c.(340-342)TCA>TGA	p.S114*	NOL11_uc010wql.1_5'UTR|NOL11_uc010deu.1_5'UTR	NM_015462	NP_056277	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	114						nucleolus					0	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGGATACTTTCAGTGCAAGGG	0.358													14	73	---	---	---	---	PASS
DNAI2	64446	broad.mit.edu	37	17	72285751	72285751	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72285751G>C	uc002jkf.2	+	5	585	c.486G>C	c.(484-486)AAG>AAC	p.K162N	DNAI2_uc002jkg.2_RNA|DNAI2_uc010dfp.2_RNA	NM_023036	NP_075462	Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate polypeptide 2	162	WD 1.				cilium assembly	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	microtubule motor activity			ovary(2)|central_nervous_system(1)	3						AGGAAATCAAGAGGGCTGCCA	0.527									Kartagener_syndrome				4	26	---	---	---	---	PASS
GPRC5C	55890	broad.mit.edu	37	17	72436356	72436356	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72436356G>A	uc002jks.2	+	1	480	c.441G>A	c.(439-441)AAG>AAA	p.K147K	GPRC5C_uc002jkp.2_Silent_p.K192K|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Silent_p.K159K|GPRC5C_uc002jkt.2_Silent_p.K147K|GPRC5C_uc002jku.2_5'Flank	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,	147	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						TGGCCCGGAAGAACCACGGGC	0.592													4	81	---	---	---	---	PASS
EVPL	2125	broad.mit.edu	37	17	74005070	74005070	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74005070C>G	uc002jqi.2	-	22	4444	c.4216G>C	c.(4216-4218)GAG>CAG	p.E1406Q	EVPL_uc010wss.1_Missense_Mutation_p.E1428Q|EVPL_uc010wst.1_Missense_Mutation_p.E876Q	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	1406	Central fibrous rod domain.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						ACCTCAAGCTCTAGCTGGCGC	0.697													4	71	---	---	---	---	PASS
MGAT5B	146664	broad.mit.edu	37	17	74921144	74921144	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74921144G>A	uc002jti.2	+	8	1258	c.1155G>A	c.(1153-1155)ATG>ATA	p.M385I	MGAT5B_uc002jth.2_Missense_Mutation_p.M374I	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN	N-acetylglucosaminyltranferase VB isoform 2	374	Lumenal (Potential).					Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						TGCAGCAGATGAAGCGGCACA	0.632													9	72	---	---	---	---	PASS
ZNF750	79755	broad.mit.edu	37	17	80790328	80790328	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80790328C>G	uc002kga.2	-	2	314	c.3G>C	c.(1-3)ATG>ATC	p.M1I	TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron|TBCD_uc002kfz.2_Intron	NM_024702	NP_078978	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	1						intracellular	zinc ion binding			central_nervous_system(1)	1	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			TGAGGAGACTCATTTTCCTCC	0.512													24	32	---	---	---	---	PASS
NDC80	10403	broad.mit.edu	37	18	2616481	2616481	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2616481G>C	uc002kli.2	+	17	2019	c.1837G>C	c.(1837-1839)GAA>CAA	p.E613Q		NM_006101	NP_006092	O14777	NDC80_HUMAN	kinetochore associated 2	613	Potential.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.|Interaction with NEK2 and ZWINT.				attachment of spindle microtubules to kinetochore|cell division|establishment of mitotic spindle orientation|mitotic prometaphase|mitotic sister chromatid segregation|mitotic spindle organization|phosphatidylinositol-mediated signaling	condensed nuclear chromosome outer kinetochore|cytosol|Ndc80 complex	protein binding			ovary(1)	1						AGAATATGAAGAATGCATGTC	0.269													3	29	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9257110	9257110	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9257110C>G	uc002knv.2	+	9	4102	c.3845C>G	c.(3844-3846)TCA>TGA	p.S1282*	ANKRD12_uc002knw.2_Nonsense_Mutation_p.S1259*|ANKRD12_uc002knx.2_Nonsense_Mutation_p.S1259*|ANKRD12_uc010dkx.1_Nonsense_Mutation_p.S989*	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	1282						nucleus				ovary(2)|central_nervous_system(1)	3						AACAGACTTTCAACATCCCAT	0.433													4	71	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9258686	9258686	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9258686G>A	uc002knv.2	+	9	5678	c.5421G>A	c.(5419-5421)GAG>GAA	p.E1807E	ANKRD12_uc002knw.2_Silent_p.E1784E|ANKRD12_uc002knx.2_Silent_p.E1784E|ANKRD12_uc010dkx.1_Silent_p.E1514E	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	1807						nucleus				ovary(2)|central_nervous_system(1)	3						AAGCAAAAGAGAAAACTCAGC	0.423													8	44	---	---	---	---	PASS
PTPN2	5771	broad.mit.edu	37	18	12830990	12830990	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12830990C>G	uc002krp.2	-	4	506	c.312G>C	c.(310-312)CAG>CAC	p.Q104H	PTPN2_uc002krl.2_Missense_Mutation_p.Q104H|PTPN2_uc002krn.2_Missense_Mutation_p.Q104H|PTPN2_uc002kro.2_Missense_Mutation_p.Q104H|PTPN2_uc002krm.2_Missense_Mutation_p.Q104H	NM_002828	NP_002819	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type	104	Tyrosine-protein phosphatase.				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway	endoplasmic reticulum|nucleoplasm	protein binding			skin(2)	2		Lung NSC(161;8.94e-06)				CTTTGGTCTTCTGCTGCCAAA	0.433													4	30	---	---	---	---	PASS
ZNF519	162655	broad.mit.edu	37	18	14105524	14105524	+	Nonsense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14105524G>A	uc002kst.1	-	3	1168	c.1015C>T	c.(1015-1017)CAG>TAG	p.Q339*	ZNF519_uc002ksq.1_Intron|ZNF519_uc002ksr.1_Intron|ZNF519_uc010dlm.1_Intron	NM_145287	NP_660330	Q8TB69	ZN519_HUMAN	zinc finger protein 519	339	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TGGATTCTCTGATGTTGAGTA	0.438													6	105	---	---	---	---	PASS
CTAGE1	64693	broad.mit.edu	37	18	19995686	19995686	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19995686A>G	uc002ktv.1	-	1	2193	c.2089T>C	c.(2089-2091)TTT>CTT	p.F697L		NM_172241	NP_758441	Q96RT6	CTGE2_HUMAN	cutaneous T-cell lymphoma-associated antigen 1	697	Pro-rich.					integral to membrane				ovary(1)	1	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					GAAGCTCCAAACACGGTTCCT	0.483													13	81	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21492846	21492846	+	Splice_Site	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21492846G>A	uc002kuq.2	+	56	7415	c.7329_splice	c.e56+1	p.D2443_splice	LAMA3_uc002kur.2_Splice_Site_p.D2387_splice|LAMA3_uc002kus.3_Splice_Site_p.D834_splice|LAMA3_uc002kut.3_Splice_Site_p.D778_splice	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	AAATAAAGATGTAAGTATTGC	0.413													10	62	---	---	---	---	PASS
DSG4	147409	broad.mit.edu	37	18	28989406	28989406	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28989406C>T	uc002kwq.2	+						DSG4_uc002kwr.2_Intron	NM_177986	NP_817123	Q86SJ6	DSG4_HUMAN	desmoglein 4 isoform 2 preproprotein						homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			central_nervous_system(5)|ovary(3)	8			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTGTCACTTTCTTGGGCAGTG	0.483													6	160	---	---	---	---	PASS
KLHL14	57565	broad.mit.edu	37	18	30350039	30350039	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30350039G>A	uc002kxm.1	-	2	904	c.516C>T	c.(514-516)CTC>CTT	p.L172L		NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14	172						cytosol|endoplasmic reticulum membrane				ovary(1)	1						ACTGCACGCAGAGCTTGGTGA	0.607													10	60	---	---	---	---	PASS
MEX3C	51320	broad.mit.edu	37	18	48703244	48703244	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48703244G>A	uc002lfc.3	-	2	1457	c.1457C>T	c.(1456-1458)TCT>TTT	p.S486F		NM_016626	NP_057710	Q5U5Q3	MEX3C_HUMAN	ring finger and KH domain containing 2	486						cytoplasm|nucleus	RNA binding|zinc ion binding			lung(2)|ovary(1)|skin(1)	4		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		TGAGCCTACAGATGGTAGTGT	0.458													5	106	---	---	---	---	PASS
WDR7	23335	broad.mit.edu	37	18	54424343	54424343	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54424343G>C	uc002lgk.1	+	15	2730	c.2519G>C	c.(2518-2520)AGA>ACA	p.R840T	WDR7_uc010dpk.1_RNA|WDR7_uc002lgl.1_Missense_Mutation_p.R840T	NM_015285	NP_056100	Q9Y4E6	WDR7_HUMAN	rabconnectin-3 beta isoform 1	840										ovary(2)|skin(1)	3				Lung(128;0.0238)|Colorectal(16;0.0296)		CTCTTGTCAAGAGGAGGCCAT	0.507													6	118	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56202911	56202911	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56202911C>T	uc002lhj.3	-	5	4722	c.4508G>A	c.(4507-4509)AGA>AAA	p.R1503K	ALPK2_uc002lhk.1_Missense_Mutation_p.R834K	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	1503							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						ACTTGGAATTCTTTCACCGCC	0.478													4	65	---	---	---	---	PASS
LMAN1	3998	broad.mit.edu	37	18	57005980	57005980	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57005980C>G	uc002lhz.2	-							NM_005570	NP_005561	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1 precursor						blood coagulation|ER to Golgi vesicle-mediated transport|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	mannose binding|metal ion binding|unfolded protein binding			skin(1)	1		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	TCTGCATATTCTGCAAGCCCA	0.453													19	178	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72353008	72353008	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72353008C>G	uc002llw.2	+	2	4789	c.4732C>G	c.(4732-4734)CAG>GAG	p.Q1578E	ZNF407_uc010xfc.1_Missense_Mutation_p.Q1578E|ZNF407_uc010dqu.1_Missense_Mutation_p.Q1578E	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	1578	C2H2-type 15.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TGCAACAGCTCAGCTTGGAGA	0.393													5	93	---	---	---	---	PASS
ZNF516	9658	broad.mit.edu	37	18	74092249	74092249	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74092249C>T	uc010dqx.1	-	3	2056	c.1821G>A	c.(1819-1821)CCG>CCA	p.P607P	ZNF516_uc002lme.2_RNA|ZNF516_uc002lmd.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	607					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		AGCAGCGGCGCGGCTGTCCCC	0.542													5	33	---	---	---	---	PASS
ABCA7	10347	broad.mit.edu	37	19	1042790	1042790	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1042790A>G	uc002lqw.3	+	7	775	c.544A>G	c.(544-546)AGC>GGC	p.S182G	ABCA7_uc010dsb.1_Missense_Mutation_p.S44G	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	182	Extracellular (By similarity).				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCTTGCACAGCTTGTTGGA	0.627													5	66	---	---	---	---	PASS
DIRAS1	148252	broad.mit.edu	37	19	2717297	2717297	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2717297G>A	uc002lwf.3	-	2	666	c.508C>T	c.(508-510)CGC>TGC	p.R170C		NM_145173	NP_660156	O95057	DIRA1_HUMAN	DIRAS family, GTP-binding RAS-like 1	170					small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGTTCCGGCGCGTCTCCAGC	0.612													7	96	---	---	---	---	PASS
KDM4B	23030	broad.mit.edu	37	19	5135454	5135454	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5135454G>A	uc002mbq.3	+	15	2416	c.2190G>A	c.(2188-2190)GAG>GAA	p.E730E	KDM4B_uc010xim.1_Silent_p.E764E|KDM4B_uc002mbr.3_Silent_p.E488E	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B	730					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1						TCATCCCTGAGATGTGCTTCA	0.627													4	26	---	---	---	---	PASS
ACSBG2	81616	broad.mit.edu	37	19	6183146	6183146	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6183146C>T	uc002mef.1	+	10	1412	c.1185C>T	c.(1183-1185)ATC>ATT	p.I395I	ACSBG2_uc002mee.1_Silent_p.I208I|ACSBG2_uc002meg.1_Silent_p.I395I|ACSBG2_uc002meh.1_Silent_p.I395I|ACSBG2_uc002mei.1_Silent_p.I345I|ACSBG2_uc010xiz.1_Silent_p.I395I	NM_030924	NP_112186	Q5FVE4	ACBG2_HUMAN	bubblegum-related acyl-CoA synthetase 2	395					cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1						ACTCTTTTATCAGTGGGACTG	0.502													11	81	---	---	---	---	PASS
SLC25A23	79085	broad.mit.edu	37	19	6454376	6454376	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6454376C>G	uc002mex.1	-	6	895	c.753G>C	c.(751-753)AAG>AAC	p.K251N	SLC25A23_uc002mev.2_RNA|SLC25A23_uc010xjd.1_Missense_Mutation_p.K68N	NM_024103	NP_077008	Q9BV35	SCMC3_HUMAN	solute carrier family 25, member 23	251	Solcar 1.|Helical; Name=2; (Potential).				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)|pancreas(1)	2						CGGGGGCAATCTTGAGTACAT	0.542													19	132	---	---	---	---	PASS
TUBB4	10382	broad.mit.edu	37	19	6495300	6495300	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6495300C>T	uc002mfg.1	-	4	1317	c.1210G>A	c.(1210-1212)GAC>AAC	p.D404N	TUBB4_uc002mff.1_Missense_Mutation_p.D332N|MIR220B_hsa-mir-220b|MI0005529_5'Flank	NM_006087	NP_006078	P04350	TBB4_HUMAN	tubulin, beta 4	404					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(2)	2		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)		TCCATCTCGTCCATGCCCTCG	0.612													12	134	---	---	---	---	PASS
MYO1F	4542	broad.mit.edu	37	19	8620554	8620554	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8620554C>T	uc002mkg.2	-	2	244	c.130G>A	c.(130-132)GAC>AAC	p.D44N	MYO1F_uc002mkh.2_Missense_Mutation_p.D44N|MYO1F_uc010xkf.1_Missense_Mutation_p.D44N	NM_012335	NP_036467	O00160	MYO1F_HUMAN	myosin IF	44	Myosin head-like.					unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3						AAGATGTAGTCGTCCATGAAG	0.612													12	54	---	---	---	---	PASS
ADAMTS10	81794	broad.mit.edu	37	19	8660996	8660996	+	Nonsense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8660996C>T	uc002mkj.1	-	11	1572	c.1298G>A	c.(1297-1299)TGG>TAG	p.W433*	ADAMTS10_uc002mkk.1_Nonsense_Mutation_p.W65*	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	433	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4						GCAGGATGACCACACGAATGG	0.587													8	86	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9066336	9066336	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9066336G>C	uc002mkp.2	-	3	21314	c.21110C>G	c.(21109-21111)TCT>TGT	p.S7037C		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7039	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGTAGACCCAGAAGGACCTGT	0.478													9	159	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9087916	9087916	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9087916G>A	uc002mkp.2	-	1	4103	c.3899C>T	c.(3898-3900)TCT>TTT	p.S1300F		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1300	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AGACCCAGAAGAGTAAGCCAT	0.493													5	123	---	---	---	---	PASS
COL5A3	50509	broad.mit.edu	37	19	10112470	10112470	+	Missense_Mutation	SNP	T	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10112470T>C	uc002mmq.1	-	7	1023	c.937A>G	c.(937-939)ACT>GCT	p.T313A		NM_015719	NP_056534	P25940	CO5A3_HUMAN	collagen, type V, alpha 3 preproprotein	313	Nonhelical region.				collagen fibril organization|skin development	collagen type V	collagen binding|extracellular matrix structural constituent			ovary(7)|lung(1)|central_nervous_system(1)|skin(1)	10			Epithelial(33;7.11e-05)			TTGAGTCCAGTAGTCACAGTG	0.567											OREG0025228	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	99	---	---	---	---	PASS
DNMT1	1786	broad.mit.edu	37	19	10260212	10260212	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10260212C>T	uc002mng.2	-	25	2635	c.2455G>A	c.(2455-2457)GAA>AAA	p.E819K	DNMT1_uc010xlc.1_Missense_Mutation_p.E835K|DNMT1_uc002mnh.2_Missense_Mutation_p.E714K|DNMT1_uc010xld.1_Missense_Mutation_p.E819K	NM_001379	NP_001370	P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1 isoform b	819	BAH 1.				chromatin modification|maintenance of DNA methylation|negative regulation of histone H3-K9 methylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of gene expression|positive regulation of histone H3-K4 methylation|transcription, DNA-dependent	nucleus	DNA (cytosine-5-)-methyltransferase activity|DNA binding|transcription factor binding			ovary(2)|prostate(1)|lung(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Ifosfamide(DB01181)|Procainamide(DB01035)	TCCTCACATTCATCCACCAAG	0.562													22	339	---	---	---	---	PASS
SLC44A2	57153	broad.mit.edu	37	19	10741983	10741983	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10741983C>T	uc002mpf.2	+	6	502	c.363C>T	c.(361-363)CTC>CTT	p.L121L	SLC44A2_uc002mpe.3_Silent_p.L119L	NM_020428	NP_065161	Q8IWA5	CTL2_HUMAN	solute carrier family 44, member 2 isoform 1	121	Extracellular (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane|plasma membrane	choline transmembrane transporter activity|signal transducer activity			ovary(1)	1			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	ACCGCTACCTCACGTACCTGA	0.542													14	102	---	---	---	---	PASS
ELAVL3	1995	broad.mit.edu	37	19	11565683	11565683	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11565683C>T	uc002mry.1	-	7	1142	c.762G>A	c.(760-762)TCG>TCA	p.S254S	ELAVL3_uc002mrx.1_Intron	NM_001420	NP_001411	Q14576	ELAV3_HUMAN	ELAV-like protein 3 isoform 1	254					cell differentiation|nervous system development		AU-rich element binding|nucleotide binding			ovary(1)|breast(1)|skin(1)	3						TGGCGATGAGCGACAGGGGAC	0.562													32	228	---	---	---	---	PASS
ZNF564	163050	broad.mit.edu	37	19	12638201	12638201	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12638201G>C	uc002mty.2	-	4	931	c.721C>G	c.(721-723)CAA>GAA	p.Q241E	ZNF709_uc002mtx.3_Intron	NM_144976	NP_659413	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	241	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						ATGTGTCTTTGAAAACTTGGA	0.398													4	78	---	---	---	---	PASS
FBXW9	84261	broad.mit.edu	37	19	12801993	12801993	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12801993G>C	uc010dyx.2	-	5	840	c.840C>G	c.(838-840)ATC>ATG	p.I280M	FBXW9_uc010xmp.1_RNA|FBXW9_uc002mum.1_Missense_Mutation_p.I290M|FBXW9_uc002mun.1_Missense_Mutation_p.I127M	NM_032301	NP_115677	Q5XUX1	FBXW9_HUMAN	F-box and WD-40 domain protein 9	290	WD 3.						protein binding			ovary(1)	1						TGGGGTCGTAGATGGTCACCT	0.512													4	139	---	---	---	---	PASS
CALR	811	broad.mit.edu	37	19	13054347	13054347	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13054347C>G	uc002mvu.2	+						CALR_uc002mvv.2_5'Flank|RAD23A_uc002mvw.1_5'Flank|RAD23A_uc002mvx.1_5'Flank|RAD23A_uc002mvz.1_5'Flank|RAD23A_uc002mwa.1_5'Flank|RAD23A_uc002mvy.1_5'Flank|RAD23A_uc010xmw.1_5'Flank	NM_004343	NP_004334	P27797	CALR_HUMAN	calreticulin precursor						cell cycle arrest|cellular senescence|glucocorticoid receptor signaling pathway|negative regulation of neuron differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of steroid hormone receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of translation|peptide antigen assembly with MHC class I protein complex|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of phagocytosis|post-translational protein modification|protein export from nucleus|protein maturation by protein folding|protein N-linked glycosylation via asparagine|protein stabilization|regulation of apoptosis|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|extracellular space|MHC class I peptide loading complex|nucleus|perinuclear region of cytoplasm|polysome|proteinaceous extracellular matrix	androgen receptor binding|calcium ion binding|chaperone binding|complement component C1q binding|DNA binding|integrin binding|mRNA binding|protein binding involved in protein folding|sugar binding|ubiquitin protein ligase binding|unfolded protein binding|zinc ion binding			ovary(1)	1					Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	CATTCATCCTCCAGGTCAAGT	0.512													3	39	---	---	---	---	PASS
RFX1	5989	broad.mit.edu	37	19	14073987	14073987	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14073987C>T	uc002mxv.2	-	19	2943	c.2671G>A	c.(2671-2673)GAG>AAG	p.E891K		NM_002918	NP_002909	P22670	RFX1_HUMAN	regulatory factor X1	891	Necessary for dimerization.				immune response	nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			lung(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			ACGCGGTGCTCGATCAGGTAG	0.572													5	29	---	---	---	---	PASS
B3GNT3	10331	broad.mit.edu	37	19	17919158	17919158	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17919158C>G	uc002nhk.1	+	2	627	c.542C>G	c.(541-543)TCC>TGC	p.S181C	B3GNT3_uc002nhl.1_Missense_Mutation_p.S181C|B3GNT3_uc010ebd.1_Missense_Mutation_p.S181C|B3GNT3_uc010ebe.1_Missense_Mutation_p.S181C	NM_014256	NP_055071	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal	181	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to plasma membrane	galactosyltransferase activity			upper_aerodigestive_tract(1)	1						TTCCACGACTCCTTCTTCAAC	0.622													7	47	---	---	---	---	PASS
TMEM59L	25789	broad.mit.edu	37	19	18731208	18731208	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18731208C>G	uc002njy.3	+							NM_012109	NP_036241	Q9UK28	TM59L_HUMAN	brain-specific membrane-anchored protein							Golgi membrane|integral to membrane|membrane fraction				ovary(2)|skin(2)	4						CCTCCCCTCTCTTCCTGCAGC	0.572													7	35	---	---	---	---	PASS
TMEM161A	54929	broad.mit.edu	37	19	19231571	19231571	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19231571C>G	uc002nlg.2	-						TMEM161A_uc010eca.2_Intron|TMEM161A_uc002nlh.2_Intron|TMEM161A_uc002nli.2_Intron|TMEM161A_uc002nlj.2_Intron	NM_017814	NP_060284	Q9NX61	T161A_HUMAN	transmembrane protein 161A precursor						cellular response to oxidative stress|cellular response to UV|negative regulation of apoptosis|positive regulation of DNA repair|response to retinoic acid	integral to membrane				breast(2)	2			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			CGCGGCATCTCACCCAGCGTC	0.493													12	75	---	---	---	---	PASS
HPN	3249	broad.mit.edu	37	19	35551526	35551526	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35551526G>C	uc002nxq.1	+						HPN_uc002nxr.1_Intron|HPN_uc002nxs.1_Intron|HPN_uc010xsh.1_Intron|HPN_uc002nxt.1_Intron|LOC100128675_uc010xsi.1_Intron	NM_002151	NP_002142	P05981	HEPS_HUMAN	hepsin						cell growth|proteolysis	cytoplasm|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(1)|central_nervous_system(1)	2	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	CCCTTTCCCTGGTAGGCGGAA	0.682													4	46	---	---	---	---	PASS
ARHGAP33	115703	broad.mit.edu	37	19	36272096	36272096	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36272096G>A	uc002obr.1	+	12	1112	c.1027G>A	c.(1027-1029)GGG>AGG	p.G343R	ARHGAP33_uc002obs.1_Missense_Mutation_p.G343R|ARHGAP33_uc002obt.1_Missense_Mutation_p.G207R|ARHGAP33_uc010eel.2_5'Flank|ARHGAP33_uc002obv.1_5'Flank	NM_052948	NP_443180	O14559	RHG33_HUMAN	sorting nexin 26	343	Rho-GAP.				cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding			skin(2)|ovary(1)|pancreas(1)	4						TGAGGCCCACGGGGTGGTGGA	0.592													4	79	---	---	---	---	PASS
ZNF565	147929	broad.mit.edu	37	19	36674105	36674105	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36674105C>G	uc002odn.2	-	5	871	c.763G>C	c.(763-765)GAA>CAA	p.E255Q	ZNF565_uc010ees.2_Missense_Mutation_p.E190Q|ZNF565_uc002odo.2_Missense_Mutation_p.E255Q	NM_152477	NP_689690	Q8N9K5	ZN565_HUMAN	zinc finger protein 565	255	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			TTCCCACATTCTTTACATTCA	0.433													6	84	---	---	---	---	PASS
ZNF569	148266	broad.mit.edu	37	19	37904385	37904385	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37904385G>C	uc002ogi.2	-	6	1733	c.1175C>G	c.(1174-1176)TCT>TGT	p.S392C	ZNF569_uc002ogh.2_Missense_Mutation_p.S233C|ZNF569_uc002ogj.2_Missense_Mutation_p.S416C	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	392	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGAGCTTTGAGAGAAGGCTTT	0.393													9	60	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38991620	38991620	+	Nonsense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38991620C>A	uc002oit.2	+	47	7734	c.7604C>A	c.(7603-7605)TCG>TAG	p.S2535*	RYR1_uc002oiu.2_Nonsense_Mutation_p.S2535*|RYR1_uc002oiv.1_5'UTR	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	2535	Cytoplasmic.|6 X approximate repeats.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GCAGCCGCCTCGCTGGACACG	0.622													3	11	---	---	---	---	PASS
SARS2	54938	broad.mit.edu	37	19	39408622	39408622	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39408622C>T	uc002oka.2	-	11	1149	c.989G>A	c.(988-990)CGG>CAG	p.R330Q	SARS2_uc002ojz.2_Missense_Mutation_p.R140Q|SARS2_uc010xup.1_Missense_Mutation_p.R332Q|SARS2_uc002okb.2_Missense_Mutation_p.R330Q|SARS2_uc010xuq.1_Missense_Mutation_p.R330Q|SARS2_uc010xur.1_RNA	NM_017827	NP_060297	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2 isoform b precursor	330	ATP (By similarity).				seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TGTCTCTGCCCGGTAGCAGGT	0.597													3	3	---	---	---	---	PASS
LRFN1	57622	broad.mit.edu	37	19	39798838	39798838	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39798838G>A	uc002okw.2	-	2	1751	c.1751C>T	c.(1750-1752)TCG>TTG	p.S584L		NM_020862	NP_065913	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III	584	Cytoplasmic (Potential).					cell junction|integral to membrane|postsynaptic density|postsynaptic membrane				ovary(2)	2	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GTTGGTCTGCGAGCACACGTG	0.701													3	21	---	---	---	---	PASS
ZNF780A	284323	broad.mit.edu	37	19	40580980	40580980	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40580980G>A	uc002omy.2	-	6	1594	c.1369C>T	c.(1369-1371)CAT>TAT	p.H457Y	ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Missense_Mutation_p.H457Y|ZNF780A_uc010xvh.1_Missense_Mutation_p.H458Y	NM_001010880	NP_001010880	O75290	Z780A_HUMAN	zinc finger protein 780A isoform b	457	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGTTGGCAATGATATCTAAAG	0.408													10	104	---	---	---	---	PASS
PRX	57716	broad.mit.edu	37	19	40904465	40904465	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40904465C>T	uc002onr.2	-						PRX_uc002onq.2_Intron|PRX_uc002ons.2_Silent_p.*148*	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2						axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GAATGGGGCTCACGGCGCAGA	0.652													6	34	---	---	---	---	PASS
ZNF226	7769	broad.mit.edu	37	19	44680964	44680964	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44680964C>T	uc002oyp.2	+	6	1693	c.1549C>T	c.(1549-1551)CAT>TAT	p.H517Y	ZNF226_uc002oyq.2_Missense_Mutation_p.H400Y|ZNF226_uc002oyr.2_Missense_Mutation_p.H400Y|ZNF226_uc010ejg.2_3'UTR|ZNF226_uc002oys.2_Missense_Mutation_p.H517Y|ZNF226_uc002oyt.2_Missense_Mutation_p.H517Y	NM_001032373	NP_001027545	Q9NYT6	ZN226_HUMAN	zinc finger protein 226 isoform a	517	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)|all_neural(266;0.202)				GAGGAATTCCCATTATCAAGT	0.433													7	48	---	---	---	---	PASS
ZNF227	7770	broad.mit.edu	37	19	44740722	44740722	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44740722G>A	uc002oyu.2	+	6	2344	c.2139G>A	c.(2137-2139)GAG>GAA	p.E713E	ZNF227_uc010xwu.1_Silent_p.E662E|ZNF227_uc002oyv.2_Silent_p.E713E|ZNF227_uc010xwv.1_Silent_p.E662E|ZNF227_uc010xww.1_Silent_p.E634E|ZNF227_uc002oyw.2_Silent_p.E685E|ZNF227_uc010ejh.2_Silent_p.E706E|ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_3'UTR	NM_182490	NP_872296	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	713					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0435)				ACACGGGAGAGAAACCCCATA	0.488													6	56	---	---	---	---	PASS
CEACAM16	388551	broad.mit.edu	37	19	45206685	45206685	+	Missense_Mutation	SNP	A	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45206685A>G	uc010xxd.1	+	3	310	c.104A>G	c.(103-105)GAC>GGC	p.D35G	CEACAM16_uc002ozq.2_Missense_Mutation_p.D94G	NM_001039213	NP_001034302	A7LI12	A7LI12_HUMAN	carcinoembryonic antigen-related cell adhesion	35										ovary(1)	1	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				AGCGAAGGGGACAACGTCACG	0.602													6	46	---	---	---	---	PASS
RELB	5971	broad.mit.edu	37	19	45525444	45525444	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45525444G>A	uc002paj.1	+	6	764	c.638G>A	c.(637-639)CGG>CAG	p.R213Q		NM_006509	NP_006500	Q01201	RELB_HUMAN	reticuloendotheliosis viral oncogene homolog B	213	RHD.					nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		GTGCGGCTCCGGCCTCACGTC	0.637													7	52	---	---	---	---	PASS
SNRPD2	6633	broad.mit.edu	37	19	46191776	46191776	+	Missense_Mutation	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46191776C>A	uc002pcw.2	-	2	348	c.51G>T	c.(49-51)CAG>CAT	p.Q17H	SNRPD2_uc002pcv.2_Missense_Mutation_p.Q7H	NM_004597	NP_004588	P62316	SMD2_HUMAN	small nuclear ribonucleoprotein D2 isoform 1	17					ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	catalytic step 2 spliceosome|cytosol|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	protein binding				0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00546)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.194)		CCTCTCGCTTCTGCAGCTCCT	0.512													5	134	---	---	---	---	PASS
RSPH6A	81492	broad.mit.edu	37	19	46307697	46307697	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46307697G>C	uc002pdm.2	-	3	1609	c.1466C>G	c.(1465-1467)TCG>TGG	p.S489W	RSPH6A_uc002pdl.2_Missense_Mutation_p.S225W	NM_030785	NP_110412	Q9H0K4	RSH6A_HUMAN	radial spokehead-like 1	489						intracellular				ovary(1)|central_nervous_system(1)	2						CGTGGCGGCCGAGATGCGGGC	0.642													5	40	---	---	---	---	PASS
IRF2BP1	26145	broad.mit.edu	37	19	46388496	46388496	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46388496C>G	uc002pds.1	-	1	881	c.537G>C	c.(535-537)CTG>CTC	p.L179L		NM_015649	NP_056464	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein	179					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		GTGCCAGCGTCAGGCCTCGGC	0.647													9	52	---	---	---	---	PASS
HIF3A	64344	broad.mit.edu	37	19	46815367	46815367	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46815367C>G	uc002peh.2	+						HIF3A_uc002pef.1_Intron|HIF3A_uc002peg.3_Intron|HIF3A_uc010xxx.1_Intron|HIF3A_uc002pei.3_Intron|HIF3A_uc002pej.1_Intron|HIF3A_uc002pek.2_Intron|HIF3A_uc010xxy.1_Intron|HIF3A_uc002pel.2_Intron|HIF3A_uc010xxz.1_Intron	NM_152795	NP_690008	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		TGCCTACCCTCTCTCTCACCC	0.498													13	226	---	---	---	---	PASS
GRLF1	2909	broad.mit.edu	37	19	47422775	47422775	+	Silent	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47422775G>C	uc010ekv.2	+	1	843	c.843G>C	c.(841-843)GTG>GTC	p.V281V		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	281	FF 1.				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		AGTGGCTGGTGAGTCGCATTG	0.458													6	44	---	---	---	---	PASS
GLTSCR2	29997	broad.mit.edu	37	19	48253494	48253494	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48253494C>T	uc002phm.2	+	3	373	c.349C>T	c.(349-351)CGG>TGG	p.R117W	GLTSCR2_uc002phk.2_Missense_Mutation_p.R117W|GLTSCR2_uc002phl.2_Missense_Mutation_p.R117W|GLTSCR2_uc010elj.2_Missense_Mutation_p.R117W|GLTSCR2_uc010elk.1_5'Flank	NM_015710	NP_056525	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	117						nucleolus				central_nervous_system(1)	1		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		GAAACCCCTTCGGGTTGACCT	0.527													5	50	---	---	---	---	PASS
CARD8	22900	broad.mit.edu	37	19	48722273	48722273	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48722273G>C	uc002pie.3	-						CARD8_uc002pii.3_Intron|CARD8_uc002pid.1_5'Flank|CARD8_uc010xzi.1_Intron|CARD8_uc010els.2_Intron|CARD8_uc010xzj.1_Intron|CARD8_uc010xzk.1_Intron|CARD8_uc002pif.3_Intron|CARD8_uc002pig.3_Intron|CARD8_uc002pih.3_Intron|CARD8_uc010xzl.1_Intron|CARD8_uc010xzm.1_Intron	NM_014959	NP_055774	Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8						negative regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion	cytoplasm|nucleus	caspase activator activity|NACHT domain binding|protein homodimerization activity				0		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		TCAACTCCTAGAGGAAACACA	0.478													4	42	---	---	---	---	PASS
KDELR1	10945	broad.mit.edu	37	19	48892949	48892949	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48892949G>C	uc002pjb.1	-	3	407	c.212C>G	c.(211-213)TCC>TGC	p.S71C	KDELR1_uc002pja.1_Missense_Mutation_p.S9C	NM_006801	NP_006792	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum	71	Helical; (Potential).				intracellular protein transport|protein retention in ER lumen|vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane|membrane fraction	KDEL sequence binding|protein binding|receptor activity				0		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		CGTGGTGAAGGAGCAGGCTAT	0.557													5	55	---	---	---	---	PASS
TULP2	7288	broad.mit.edu	37	19	49398376	49398376	+	Silent	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49398376G>C	uc002pkz.2	-	6	544	c.393C>G	c.(391-393)CTC>CTG	p.L131L		NM_003323	NP_003314	O00295	TULP2_HUMAN	tubby like protein 2	131					visual perception	cytoplasm|extracellular region				ovary(1)|kidney(1)|skin(1)	3		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		AATTGTCTGGGAGCCAGGATA	0.542													5	37	---	---	---	---	PASS
PIH1D1	55011	broad.mit.edu	37	19	49949850	49949850	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49949850G>A	uc002pns.2	-	8	1073	c.789C>T	c.(787-789)ATC>ATT	p.I263I	uc002pnr.1_5'Flank	NM_017916	NP_060386	Q9NWS0	PIHD1_HUMAN	NOP17	263					box C/D snoRNP assembly	pre-snoRNP complex					0		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		CATGAGAGTTGATCTGCAGCG	0.622													21	109	---	---	---	---	PASS
SIGLEC11	114132	broad.mit.edu	37	19	50461830	50461830	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50461830G>A	uc010ybh.1	-						SIGLEC11_uc010ybi.1_Intron	NM_052884	NP_443116	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11 isoform 1						cell adhesion	integral to membrane	sugar binding			ovary(3)|central_nervous_system(2)|pancreas(1)	6		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		TGGAGGGTCTGTGGGGAGGGA	0.692													6	20	---	---	---	---	PASS
MYH14	79784	broad.mit.edu	37	19	50760689	50760689	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50760689C>G	uc002prr.1	+	16	2102	c.2055C>G	c.(2053-2055)CTC>CTG	p.L685L	MYH14_uc010enu.1_Silent_p.L726L|MYH14_uc002prq.1_Silent_p.L693L	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2	685	Myosin head-like.				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TGGCCACACTCAGCAACACCA	0.647													2	7	---	---	---	---	PASS
KLK6	5653	broad.mit.edu	37	19	51471362	51471362	+	5'UTR	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51471362G>A	uc002pui.2	-	3					KLK6_uc010eoj.2_5'UTR|KLK6_uc002puh.2_Missense_Mutation_p.A9V|KLK6_uc002puj.2_Intron|KLK6_uc010ycn.1_5'UTR|KLK6_uc002pul.2_5'UTR|KLK6_uc002pum.2_5'UTR	NM_001012964	NP_001012982	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform A						amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		CTTCTTCATGGCCGCTCCTGA	0.547													11	54	---	---	---	---	PASS
ZNF836	162962	broad.mit.edu	37	19	52659957	52659957	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52659957C>G	uc010ydi.1	-	5	1353	c.979G>C	c.(979-981)GAG>CAG	p.E327Q	ZNF836_uc010ydj.1_Missense_Mutation_p.E327Q	NM_001102657	NP_001096127	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	327					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TAAGGTTTCTCTCCAGTGTGA	0.393													3	31	---	---	---	---	PASS
ZNF611	81856	broad.mit.edu	37	19	53209437	53209437	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53209437C>T	uc002pzz.2	-	7	1188	c.871G>A	c.(871-873)GAG>AAG	p.E291K	ZNF611_uc010eqc.2_Missense_Mutation_p.E221K|ZNF611_uc010ydo.1_Missense_Mutation_p.E221K|ZNF611_uc010ydr.1_Missense_Mutation_p.E222K|ZNF611_uc010ydp.1_Missense_Mutation_p.E291K|ZNF611_uc010ydq.1_Missense_Mutation_p.E291K|ZNF611_uc002qaa.3_Missense_Mutation_p.E221K	NM_030972	NP_112234	Q8N823	ZN611_HUMAN	zinc finger protein 611 isoform a	291	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		TTGCCACACTCTTTACACTTG	0.408													9	154	---	---	---	---	PASS
ZNF347	84671	broad.mit.edu	37	19	53644231	53644231	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53644231C>T	uc002qbb.1	-	5	1919	c.1850G>A	c.(1849-1851)CGA>CAA	p.R617Q	ZNF347_uc010eql.1_Missense_Mutation_p.R618Q|ZNF347_uc002qbc.1_Missense_Mutation_p.R618Q	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN	zinc finger protein 347	617	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0179)		AGTATGAATTCGCTGATGCCT	0.393													9	87	---	---	---	---	PASS
C19orf51	352909	broad.mit.edu	37	19	55677762	55677762	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55677762G>C	uc002qji.1	-	2	54	c.20C>G	c.(19-21)TCC>TGC	p.S7C	C19orf51_uc002qjj.1_Missense_Mutation_p.S54C|C19orf51_uc002qjk.1_5'UTR|C19orf51_uc002qjl.1_Missense_Mutation_p.S54C			Q8N9W5	CS051_HUMAN	RecName: Full=UPF0470 protein C19orf51;	7											0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GCCGCTGCCGGAGCCGGCAGG	0.657											OREG0025679	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	52	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56477742	56477742	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56477742C>T	uc002qmh.2	+	5	2448	c.2377C>T	c.(2377-2379)CTC>TTC	p.L793F	NLRP8_uc010etg.2_Missense_Mutation_p.L793F	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	793						cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TCTGCAGTGTCTCAGGTGAGA	0.542													5	50	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56549517	56549517	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56549517C>T	uc002qmj.2	+	10	2742	c.2742C>T	c.(2740-2742)CTC>CTT	p.L914L	NLRP5_uc002qmi.2_Silent_p.L895L	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	914	LRR 7.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		TAATGCCTCTCAGTGATGCCT	0.522													5	91	---	---	---	---	PASS
ZSCAN5B	342933	broad.mit.edu	37	19	56701945	56701945	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56701945C>T	uc010ygh.1	-							NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						CTCACCAGATCTGGTGGAAGA	0.493													6	61	---	---	---	---	PASS
ZNF582	147948	broad.mit.edu	37	19	56895628	56895628	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56895628C>G	uc002qmz.1	-	5	1317	c.1158G>C	c.(1156-1158)CAG>CAC	p.Q386H	ZNF582_uc002qmy.2_Missense_Mutation_p.Q417H	NM_144690	NP_653291	Q96NG8	ZN582_HUMAN	zinc finger protein 582	386	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|large_intestine(1)	4		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		TGTGAATTCTCTGATGTTGCT	0.433													3	83	---	---	---	---	PASS
ZSCAN4	201516	broad.mit.edu	37	19	58187739	58187739	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58187739G>A	uc002qpu.2	+	3	923	c.226G>A	c.(226-228)GAA>AAA	p.E76K		NM_152677	NP_689890	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	76	SCAN box.				telomere maintenance via telomere lengthening|viral reproduction	nuclear chromosome, telomeric region	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GCTGCAACCAGAAAAGCACAG	0.398													6	94	---	---	---	---	PASS
ZNF606	80095	broad.mit.edu	37	19	58490489	58490489	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58490489G>A	uc002qqw.2	-	7	2177	c.1559C>T	c.(1558-1560)TCA>TTA	p.S520L	ZNF606_uc010yhp.1_Missense_Mutation_p.S430L	NM_025027	NP_079303	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	520	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		CCAGCTGAATGATTTCCCACA	0.398													5	40	---	---	---	---	PASS
ZSCAN18	65982	broad.mit.edu	37	19	58596539	58596539	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58596539G>A	uc002qri.2	-	7	1355	c.1046C>T	c.(1045-1047)TCG>TTG	p.S349L	ZSCAN18_uc002qrj.3_Missense_Mutation_p.S348L|ZSCAN18_uc010yhs.1_Missense_Mutation_p.S213L|ZSCAN18_uc002qrh.2_Missense_Mutation_p.S349L|ZSCAN18_uc010yht.1_Missense_Mutation_p.S405L|ZSCAN18_uc002qrk.1_3'UTR|ZSCAN18_uc002qrl.2_3'UTR	NM_001145543	NP_001139015	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	349					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CTGCCTCTGCGATCCGGTGGC	0.706													5	13	---	---	---	---	PASS
ZNF329	79673	broad.mit.edu	37	19	58640056	58640056	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58640056G>A	uc002qrn.2	-	4	1052	c.815C>T	c.(814-816)TCA>TTA	p.S272L	ZNF329_uc010euk.1_RNA|ZNF329_uc002qro.1_RNA|ZNF329_uc002qrp.1_RNA	NM_024620	NP_078896	Q86UD4	ZN329_HUMAN	zinc finger protein 329	272	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		TGTCAGAGCTGAGCCATCACT	0.438													14	128	---	---	---	---	PASS
SLC4A11	83959	broad.mit.edu	37	20	3210347	3210347	+	Nonsense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3210347G>C	uc002wig.2	-	13	1661	c.1613C>G	c.(1612-1614)TCA>TGA	p.S538*	SLC4A11_uc010zqe.1_Nonsense_Mutation_p.S565*|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Nonsense_Mutation_p.S522*	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	538	Extracellular (Potential).|Membrane (bicarbonate transporter).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						GCCGAGGCCTGACAGGCTGAC	0.602													4	24	---	---	---	---	PASS
HAO1	54363	broad.mit.edu	37	20	7920973	7920973	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7920973C>T	uc002wmw.1	-	1	121	c.97G>A	c.(97-99)GAT>AAT	p.D33N	HAO1_uc010gbu.2_Missense_Mutation_p.D33N	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	33	FMN hydroxy acid dehydrogenase.				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3						GTTTCTTCATCATTTGCCCCA	0.318													7	51	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16360398	16360398	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16360398C>T	uc002wpg.1	-	19	2407	c.2249G>A	c.(2248-2250)AGA>AAA	p.R750K	KIF16B_uc002wpe.1_Missense_Mutation_p.R132K|KIF16B_uc002wpf.1_Missense_Mutation_p.R132K|KIF16B_uc010gch.1_Missense_Mutation_p.R750K|KIF16B_uc010gci.1_Missense_Mutation_p.R750K|KIF16B_uc010gcj.1_Missense_Mutation_p.R761K	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	750	Glu-rich.|Potential.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						CTCCTCTAGTCTCTTTTTTTC	0.502													6	119	---	---	---	---	PASS
C20orf118	140711	broad.mit.edu	37	20	35515883	35515883	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35515883C>G	uc002xgg.1	+	5	472	c.464C>G	c.(463-465)TCT>TGT	p.S155C		NM_080628	NP_542195	A0PJX2	CT118_HUMAN	hypothetical protein LOC140711	155	TLD.										0		Myeloproliferative disorder(115;0.00874)				GGAAGCAACTCTTTCTTTGTG	0.532											OREG0025911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	16	83	---	---	---	---	PASS
KIAA0406	9675	broad.mit.edu	37	20	36640989	36640989	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36640989G>A	uc002xhl.2	-	3	1439	c.1230C>T	c.(1228-1230)CTC>CTT	p.L410L	KIAA0406_uc002xhm.2_Silent_p.L410L	NM_014657	NP_055472	O43156	TTI1_HUMAN	hypothetical protein LOC9675	410							binding				0		Myeloproliferative disorder(115;0.00874)				TTGGGCCCAAGAGTTTCAGAT	0.478													5	44	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40116320	40116320	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40116320C>G	uc002xka.1	-	14	2164	c.1986G>C	c.(1984-1986)CTG>CTC	p.L662L	CHD6_uc002xkd.2_Silent_p.L640L	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	662					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				CCTCTGTTTTCAGATCTCCAA	0.448													6	58	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47274692	47274692	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47274692C>G	uc002xtw.1	-	17	1979	c.1956G>C	c.(1954-1956)CAG>CAC	p.Q652H	PREX1_uc002xtv.1_5'Flank	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	652	PDZ.				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GCGAGCCCCTCTGGACGGACT	0.652											OREG0026010	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	50	265	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47324968	47324968	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47324968G>C	uc002xtw.1	-							NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,						actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TCCTGGGGTAGAATAGAGGTG	0.493													13	100	---	---	---	---	PASS
ARFGEF2	10564	broad.mit.edu	37	20	47585822	47585822	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47585822G>A	uc002xtx.3	+							NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine						exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AAAGTAAGCAGACAGCAGTTC	0.512													6	42	---	---	---	---	PASS
ARFGEF2	10564	broad.mit.edu	37	20	47587889	47587889	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47587889G>C	uc002xtx.3	+	10	1575	c.1423G>C	c.(1423-1425)GAG>CAG	p.E475Q		NM_006420	NP_006411	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine	475					exocytosis|intracellular signal transduction|regulation of ARF protein signal transduction	cytosol|Golgi membrane	ARF guanyl-nucleotide exchange factor activity			breast(3)|upper_aerodigestive_tract(1)	4			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AATGCAGATAGAGGTACGGAT	0.313													6	52	---	---	---	---	PASS
C20orf106	200232	broad.mit.edu	37	20	55099992	55099992	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55099992G>T	uc002xxx.2	+	1	208	c.128G>T	c.(127-129)CGG>CTG	p.R43L	GCNT7_uc010zzg.1_Intron|C20orf107_uc010zzh.1_Missense_Mutation_p.R43L	NM_001012971	NP_001012989	Q5JX71	CT106_HUMAN	hypothetical protein LOC200232 precursor	43	Extracellular (Potential).					integral to membrane					0			Colorectal(105;0.202)			GAGCACTTTCGGATTCGGCAG	0.507													10	70	---	---	---	---	PASS
UCKL1	54963	broad.mit.edu	37	20	62577046	62577046	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62577046G>C	uc010gkn.2	-	5	655	c.612C>G	c.(610-612)ATC>ATG	p.I204M	UCKL1_uc011abm.1_Missense_Mutation_p.I189M|UCKL1_uc011abn.1_RNA|UCKL1_uc011abo.1_RNA|MIR647_hsa-mir-647|MI0003662_5'Flank	NM_017859	NP_060329	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	204					interspecies interaction between organisms	endoplasmic reticulum|nucleus	ATP binding|phosphotransferase activity, alcohol group as acceptor|protein binding|uridine kinase activity				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGCCCTCAAAGATGATGACGT	0.602													9	81	---	---	---	---	PASS
NRIP1	8204	broad.mit.edu	37	21	16338158	16338158	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16338158G>T	uc002yjx.2	-	4	2954	c.2356C>A	c.(2356-2358)CCT>ACT	p.P786T		NM_003489	NP_003480	P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	786	Repression domain 3.				androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity				0				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TGCACAGCAGGAGCCATACCC	0.458													6	74	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32598171	32598171	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32598171G>A	uc002yow.1	-	8	2152	c.1680C>T	c.(1678-1680)CTC>CTT	p.L560L	TIAM1_uc011adk.1_Silent_p.L560L|TIAM1_uc011adl.1_Silent_p.L560L|TIAM1_uc002yox.1_Silent_p.L168L	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	560					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						TCAGGAGTCGGAGCGTGTCTT	0.502													6	122	---	---	---	---	PASS
CRYZL1	9946	broad.mit.edu	37	21	34969645	34969645	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34969645C>T	uc011adw.1	-	10	919	c.739G>A	c.(739-741)GAT>AAT	p.D247N	DONSON_uc002ysn.1_Intron|CRYZL1_uc002ysr.1_Missense_Mutation_p.D271N|CRYZL1_uc002yss.1_RNA|CRYZL1_uc002yst.1_RNA|DONSON_uc002ysm.2_5'Flank|uc002ysp.2_5'Flank|CRYZL1_uc002ysq.2_RNA	NM_145858	NP_665857	O95825	QORL1_HUMAN	crystallin, zeta-like 1	247					quinone cofactor metabolic process	cytosol	NADP binding|NADPH:quinone reductase activity|zinc ion binding				0						GTGATGATATCATGTTTATGT	0.373													12	116	---	---	---	---	PASS
TTC3	7267	broad.mit.edu	37	21	38525250	38525250	+	Splice_Site	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38525250G>C	uc002yvz.2	+	27	2519	c.2414_splice	c.e27-1	p.E805_splice	TTC3_uc011aee.1_Splice_Site_p.E495_splice|TTC3_uc002ywa.2_Splice_Site_p.E805_splice|TTC3_uc002ywb.2_Splice_Site_p.E805_splice|TTC3_uc010gnf.2_Splice_Site_p.E570_splice|TTC3_uc002ywc.2_Splice_Site_p.E495_splice|TTC3_uc011aed.1_Splice_Site_p.E495_splice	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				TTTATCCTTAGAAACTGTAGA	0.294													3	25	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40570985	40570985	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40570985C>T	uc002yxk.1	-	40	5496	c.5357G>A	c.(5356-5358)AGC>AAC	p.S1786N	BRWD1_uc010goc.1_Missense_Mutation_p.S429N|BRWD1_uc002yxl.2_Missense_Mutation_p.S1786N	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1786					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CTCTGAGATGCTCTCTGCCTT	0.408													22	120	---	---	---	---	PASS
ZNF295	49854	broad.mit.edu	37	21	43411094	43411094	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43411094G>A	uc002zab.3	-	3	3325	c.3111C>T	c.(3109-3111)ATC>ATT	p.I1037I	ZNF295_uc002yzz.3_Silent_p.I836I|ZNF295_uc002yzy.3_Silent_p.I1037I|ZNF295_uc002zaa.3_Silent_p.I1037I	NM_001098402	NP_001091872	Q9ULJ3	ZN295_HUMAN	zinc finger protein 295 isoform L	1037					negative regulation of transcription, DNA-dependent|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|nucleus	methyl-CpG binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3						TTTTAAATGTGATTGCTGAAA	0.438													9	91	---	---	---	---	PASS
WDR4	10785	broad.mit.edu	37	21	44299535	44299535	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44299535G>A	uc002zci.2	-	1	144	c.71C>T	c.(70-72)GCC>GTC	p.A24V	WDR4_uc002zck.1_Missense_Mutation_p.A24V|WDR4_uc002zcl.1_Intron|WDR4_uc010gpg.1_Missense_Mutation_p.A24V|WDR4_uc011aew.1_Intron|WDR4_uc010gph.1_5'UTR	NM_033661	NP_387510	P57081	WDR4_HUMAN	WD repeat domain 4 protein	24					tRNA modification	cytoplasm|nucleoplasm	protein binding			ovary(1)	1				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		TATGGAGGTGGCCAGGAATCG	0.697													4	78	---	---	---	---	PASS
RRP1	8568	broad.mit.edu	37	21	45211274	45211274	+	Silent	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45211274G>T	uc002zds.2	+	2	270	c.177G>T	c.(175-177)CTG>CTT	p.L59L	RRP1_uc011aez.1_Silent_p.L59L|RRP1_uc010gpk.1_5'UTR|RRP1_uc010gpl.1_5'Flank	NM_003683	NP_003674	P56182	RRP1_HUMAN	ribosomal RNA processing 1 homolog	59					rRNA processing	nucleolus|preribosome, small subunit precursor					0				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		GGAAAGGACTGTTTTATTGCA	0.547													6	72	---	---	---	---	PASS
PWP2	5822	broad.mit.edu	37	21	45548178	45548178	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45548178G>A	uc002zeb.2	+	19	2500	c.2410G>A	c.(2410-2412)GAG>AAG	p.E804K		NM_005049	NP_005040	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog	804						cytoplasm|nucleolus	signal transducer activity			pancreas(1)	1				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		GAAAGTGCTGGAGTTTTTAGC	0.478													9	139	---	---	---	---	PASS
TRPM2	7226	broad.mit.edu	37	21	45786718	45786718	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45786718C>G	uc002zet.1	+	5	718	c.505C>G	c.(505-507)CTC>GTC	p.L169V	TRPM2_uc002zeu.1_Missense_Mutation_p.L169V|TRPM2_uc002zew.1_Missense_Mutation_p.L169V|TRPM2_uc010gpt.1_Missense_Mutation_p.L169V|TRPM2_uc002zex.1_5'Flank	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	169	Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CGTCCCCAATCTCTTGATCTC	0.607													3	51	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47545731	47545731	+	Missense_Mutation	SNP	G	C	C	rs138948335		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47545731G>C	uc002zia.1	+	26	2084	c.2002G>C	c.(2002-2004)GAG>CAG	p.E668Q	COL6A2_uc002zhy.1_Missense_Mutation_p.E668Q|COL6A2_uc002zhz.1_Missense_Mutation_p.E668Q|COL6A2_uc002zib.1_Missense_Mutation_p.E74Q|COL6A2_uc002zic.1_5'Flank	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	668	VWFA 2.|Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GTACAGCCACGAGGGCACCTT	0.647													3	22	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47704270	47704270	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47704270C>T	uc002zir.1	-	1	967	c.931G>A	c.(931-933)GAT>AAT	p.D311N	C21orf57_uc002zit.1_5'Flank|C21orf57_uc002ziu.1_5'Flank|C21orf57_uc002ziv.2_5'Flank|C21orf57_uc002ziw.2_5'Flank|C21orf57_uc002zix.2_5'Flank|C21orf57_uc010gqh.2_5'Flank|C21orf57_uc002ziy.2_5'Flank	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	311					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					GGATCCGAATCTTCTGCTGGC	0.562													11	146	---	---	---	---	PASS
DIP2A	23181	broad.mit.edu	37	21	47971731	47971731	+	Intron	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47971731G>A	uc002zjo.2	+						DIP2A_uc011afy.1_Intron|DIP2A_uc011afz.1_Intron	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a						multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		TCGCCCTCTCGTGCAGTTCCT	0.652													3	16	---	---	---	---	PASS
CCT8L2	150160	broad.mit.edu	37	22	17072424	17072424	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17072424G>A	uc002zlp.1	-	1	1277	c.1017C>T	c.(1015-1017)CTC>CTT	p.L339L		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	339					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				TCTGGGGAGGGAGCAGACGAG	0.552													8	106	---	---	---	---	PASS
MAPK1	5594	broad.mit.edu	37	22	22127164	22127164	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22127164C>T	uc002zvn.2	-	7	1204	c.964G>A	c.(964-966)GAG>AAG	p.E322K	MAPK1_uc002zvo.2_Missense_Mutation_p.E322K|MAPK1_uc010gtk.1_Missense_Mutation_p.E278K	NM_002745	NP_002736	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	322					activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)	GCTCTTACCTCGTCACTCGGG	0.478													9	54	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22556259	22556259	+	Intron	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22556259C>T	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						CGTGCTGACTCAGCCGCCCTC	0.612											OREG0026354	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	29	---	---	---	---	PASS
ASPHD2	57168	broad.mit.edu	37	22	26830049	26830049	+	Silent	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26830049C>G	uc003acg.2	+	2	865	c.468C>G	c.(466-468)CTC>CTG	p.L156L		NM_020437	NP_065170	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	156	Lumenal (Potential).				peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity			ovary(1)	1						GCCGGTACCTCAACAGCCGGC	0.627													4	29	---	---	---	---	PASS
SEC14L3	266629	broad.mit.edu	37	22	30867929	30867929	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30867929C>G	uc003ahy.2	-	1	106	c.17G>C	c.(16-18)GGA>GCA	p.G6A	SEC14L3_uc003ahz.2_5'UTR|SEC14L3_uc003aia.2_5'UTR|SEC14L3_uc003aib.2_5'UTR	NM_174975	NP_777635	Q9UDX4	S14L3_HUMAN	SEC14-like 3	6						integral to membrane|intracellular	lipid binding|transporter activity			ovary(3)|pancreas(1)|skin(1)	5					Vitamin E(DB00163)	GCTCAGGTCTCCAACTCGGCC	0.632													5	63	---	---	---	---	PASS
PES1	23481	broad.mit.edu	37	22	30976619	30976619	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30976619C>G	uc003aij.1	-	10	1056	c.982G>C	c.(982-984)GAG>CAG	p.E328Q	PES1_uc003aik.1_Missense_Mutation_p.E323Q|PES1_uc003ail.1_Missense_Mutation_p.E311Q|PES1_uc003aim.1_Missense_Mutation_p.E328Q|PES1_uc003ain.1_Missense_Mutation_p.E189Q|PES1_uc003aio.1_Missense_Mutation_p.E189Q	NM_014303	NP_055118	O00541	PESC_HUMAN	pescadillo homolog 1, containing BRCT domain	328	Sufficient for interaction with MAP1B (By similarity).|BRCT.				cell proliferation|maturation of 5.8S rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|maturation of LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|regulation of cell cycle	chromosome|nucleoplasm|PeBoW complex|preribosome, large subunit precursor	protein binding				0						TTCAGGCCCTCAAAAAGCTTC	0.607													4	60	---	---	---	---	PASS
SELM	140606	broad.mit.edu	37	22	31501635	31501635	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31501635G>C	uc011ali.1	-						SELM_uc011alj.1_Intron|INPP5J_uc010gwf.2_5'Flank	NM_080430	NP_536355	Q8WWX9	SELM_HUMAN	selenoprotein M precursor							endoplasmic reticulum|Golgi apparatus|nucleus|perinuclear region of cytoplasm					0						CCCCAGAACAGAAGGATACTA	0.423													5	84	---	---	---	---	PASS
PATZ1	23598	broad.mit.edu	37	22	31740573	31740573	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31740573G>C	uc003akq.2	-	1	1677	c.1016C>G	c.(1015-1017)TCT>TGT	p.S339C	PATZ1_uc003akp.2_Missense_Mutation_p.S339C|PATZ1_uc003akr.2_Missense_Mutation_p.S339C|PATZ1_uc003aks.2_Missense_Mutation_p.S339C|uc003akt.2_5'Flank	NM_014323	NP_055138	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	339					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding		EWSR1/PATZ1(2)	soft_tissue(2)	2						GGGGTCTTCAGAGATGGGTAG	0.622													6	44	---	---	---	---	PASS
SFI1	9814	broad.mit.edu	37	22	31953057	31953057	+	Intron	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31953057C>G	uc003ale.2	+						SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Intron|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform						G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						TGAGTCTGCTCAACTGCCCTA	0.433													4	89	---	---	---	---	PASS
RFPL3	10738	broad.mit.edu	37	22	32756345	32756345	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32756345C>T	uc003amj.2	+	2	685	c.480C>T	c.(478-480)GCC>GCT	p.A160A	RFPL3_uc010gwn.2_Silent_p.A131A|RFPL3S_uc003amk.2_RNA|RFPL3S_uc003aml.2_RNA	NM_001098535	NP_001092005	O75679	RFPL3_HUMAN	ret finger protein-like 3 isoform 1	160	B30.2/SPRY.						zinc ion binding			ovary(1)	1						AAGACCTTGCCGAGAGATTTG	0.572													5	74	---	---	---	---	PASS
RBM9	23543	broad.mit.edu	37	22	36155971	36155971	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36155971C>T	uc003aon.3	-	10	1185	c.1073G>A	c.(1072-1074)CGA>CAA	p.R358Q	RBM9_uc003aog.3_Missense_Mutation_p.R264Q|RBM9_uc003aol.3_Missense_Mutation_p.R283Q|RBM9_uc003aoj.3_Missense_Mutation_p.R287Q|RBM9_uc003aok.3_Missense_Mutation_p.R284Q|RBM9_uc003aoh.3_Missense_Mutation_p.R287Q|RBM9_uc003aom.3_Missense_Mutation_p.R265Q|RBM9_uc010gwu.2_Missense_Mutation_p.R263Q|RBM9_uc003aoo.3_Missense_Mutation_p.R357Q	NM_001082578	NP_001076047	O43251	RFOX2_HUMAN	RNA binding motif protein 9 isoform 5	297	Ala-rich.				estrogen receptor signaling pathway|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of cell proliferation|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding|transcription corepressor activity|transcription factor binding				0						AGGTACCGCTCGGACTGCACC	0.517													6	36	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36684327	36684327	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36684327C>T	uc003apg.2	-	34	5134	c.4903G>A	c.(4903-4905)GAA>AAA	p.E1635K		NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	1635	Potential.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						TTGATGGCTTCGTCCCGGTTC	0.637			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				17	126	---	---	---	---	PASS
DNAJB7	150353	broad.mit.edu	37	22	41257650	41257650	+	Missense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41257650C>G	uc003azj.2	-	1	481	c.349G>C	c.(349-351)GAG>CAG	p.E117Q	XPNPEP3_uc011aox.1_Intron|XPNPEP3_uc003azh.2_Intron|XPNPEP3_uc003azi.2_Intron|XPNPEP3_uc011aoy.1_5'Flank|XPNPEP3_uc003azg.1_RNA|XPNPEP3_uc003azf.1_RNA|XPNPEP3_uc010gyh.1_5'Flank	NM_145174	NP_660157	Q7Z6W7	DNJB7_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 7	117					protein folding		heat shock protein binding|unfolded protein binding			ovary(1)	1						AACAGGTCCTCAAGCGAGTCT	0.378													8	109	---	---	---	---	PASS
EP300	2033	broad.mit.edu	37	22	41525927	41525927	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41525927C>G	uc003azl.3	+	5	1597	c.1202C>G	c.(1201-1203)TCA>TGA	p.S401*		NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300	401	TAZ-type 1.				apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						CAAATCATTTCACACTGGAAG	0.338			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				8	56	---	---	---	---	PASS
NAGA	4668	broad.mit.edu	37	22	42463190	42463190	+	Missense_Mutation	SNP	C	G	G	rs138260186		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42463190C>G	uc003bbx.2	-	5	566	c.429G>C	c.(427-429)CAG>CAC	p.Q143H	NAGA_uc003bby.2_Missense_Mutation_p.Q143H|NAGA_uc003bbw.3_Missense_Mutation_p.Q143H	NM_000262	NP_000253	P17050	NAGAB_HUMAN	alpha-N-acetylgalactosaminidase precursor	143					glycoside catabolic process|glycosylceramide catabolic process|oligosaccharide metabolic process	lysosome	alpha-galactosidase activity|alpha-N-acetylgalactosaminidase activity|cation binding|protein homodimerization activity			central_nervous_system(1)	1						CGGCGAAGGTCTGAGCATCCT	0.617													14	172	---	---	---	---	PASS
FAM109B	150368	broad.mit.edu	37	22	42473479	42473479	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42473479G>T	uc003bbz.2	+	3	369	c.182G>T	c.(181-183)CGG>CTG	p.R61L	C22orf32_uc003bca.2_5'Flank	NM_001002034	NP_001002034	Q6ICB4	SESQ2_HUMAN	hypothetical protein LOC150368	61	PH.				endosome organization|receptor recycling|retrograde transport, endosome to Golgi	clathrin-coated vesicle|early endosome|recycling endosome|trans-Golgi network	protein homodimerization activity				0						CGCGAGGGCCGGGCCCCACTG	0.647													4	84	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42607402	42607402	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42607402G>A	uc003bcj.1	-	1	4044	c.3910C>T	c.(3910-3912)CAC>TAC	p.H1304Y	TCF20_uc003bck.1_Missense_Mutation_p.H1304Y|TCF20_uc003bnt.2_Missense_Mutation_p.H1304Y	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1304					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						TCCTGACTGTGAGAAAGATGG	0.453													31	125	---	---	---	---	PASS
TTLL12	23170	broad.mit.edu	37	22	43570300	43570300	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43570300C>T	uc003bdq.2	-	8	1176	c.1144G>A	c.(1144-1146)GAG>AAG	p.E382K	TTLL12_uc003bdr.1_Missense_Mutation_p.E382K	NM_015140	NP_055955	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	382	TTL.				protein modification process		tubulin-tyrosine ligase activity			central_nervous_system(1)	1		Ovarian(80;0.221)|Glioma(61;0.222)				GGTGGGCCCTCGGGGCCACCT	0.657													5	94	---	---	---	---	PASS
GTSE1	51512	broad.mit.edu	37	22	46712238	46712238	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46712238C>T	uc011aqy.1	+	7	1573	c.1361C>T	c.(1360-1362)TCC>TTC	p.S454F	GTSE1_uc011aqz.1_Missense_Mutation_p.S301F|GTSE1_uc003bhl.1_Missense_Mutation_p.S79F|GTSE1_uc003bhm.1_Missense_Mutation_p.S79F	NM_016426	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	435					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G2 phase of mitotic cell cycle|microtubule-based process	cytoplasmic microtubule				ovary(1)	1		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		CGGCGAGATTCCTGTCTAAAT	0.413													19	166	---	---	---	---	PASS
MOV10L1	54456	broad.mit.edu	37	22	50564699	50564699	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50564699G>C	uc003bjj.2	+	12	1899	c.1816G>C	c.(1816-1818)GAG>CAG	p.E606Q	MOV10L1_uc003bjk.3_Missense_Mutation_p.E606Q|MOV10L1_uc011arp.1_Missense_Mutation_p.E586Q|MOV10L1_uc011arq.1_Missense_Mutation_p.E367Q|MOV10L1_uc010hao.1_Intron	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	606					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CTACGTGACTGAGGTGAGAGC	0.423													7	49	---	---	---	---	PASS
CXorf58	254158	broad.mit.edu	37	X	23957380	23957380	+	Nonsense_Mutation	SNP	C	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23957380C>G	uc004daz.1	+	9	1303	c.959C>G	c.(958-960)TCA>TGA	p.S320*	CXorf58_uc011mju.1_Nonsense_Mutation_p.S318*	NM_152761	NP_689974	Q96LI9	CX058_HUMAN	hypothetical protein LOC254158	320											0						ACGGGCCCATCAGGTACAAAG	0.328													4	87	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32380904	32380904	+	Splice_Site	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32380904C>A	uc004dda.1	-	37	5569	c.5325_splice	c.e37+1	p.K1775_splice	DMD_uc004dcw.2_Splice_Site_p.K431_splice|DMD_uc004dcx.2_Splice_Site_p.K434_splice|DMD_uc004dcz.2_Splice_Site_p.K1652_splice|DMD_uc004dcy.1_Splice_Site_p.K1771_splice|DMD_uc004ddb.1_Splice_Site_p.K1767_splice|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GATCTTCCTACCTTTCCAGTC	0.483													10	79	---	---	---	---	PASS
DDX3X	1654	broad.mit.edu	37	X	41205768	41205768	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41205768G>C	uc004dfe.2	+	14	2363	c.1508G>C	c.(1507-1509)AGA>ACA	p.R503T	DDX3X_uc004dff.2_Missense_Mutation_p.R503T|DDX3X_uc011mkq.1_Missense_Mutation_p.R487T|DDX3X_uc011mkr.1_Intron|DDX3X_uc011mks.1_Intron|DDX3X_uc004dfg.2_RNA|DDX3X_uc011mkt.1_RNA	NM_001356	NP_001347	O00571	DDX3X_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3	503	Helicase C-terminal.|Necessary for interaction with XPO1.				interspecies interaction between organisms	cytoplasm|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|DNA binding|protein binding|RNA binding			ovary(2)|breast(2)|central_nervous_system(1)|skin(1)	6						GTAGCAGCAAGAGGACTGGAC	0.343										HNSCC(61;0.18)			13	126	---	---	---	---	PASS
PHF16	9767	broad.mit.edu	37	X	46913877	46913877	+	Missense_Mutation	SNP	C	G	G	rs144726372	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46913877C>G	uc004dgx.2	+	9	1341	c.1290C>G	c.(1288-1290)ATC>ATG	p.I430M	PHF16_uc004dgy.2_Missense_Mutation_p.I430M	NM_001077445	NP_001070913	Q92613	JADE3_HUMAN	PHD finger protein 16	430					histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding				0						TGGACTTTATCTATAACTACT	0.478													4	49	---	---	---	---	PASS
ZNF157	7712	broad.mit.edu	37	X	47269681	47269681	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47269681G>A	uc004dhr.1	+	2	148	c.79G>A	c.(79-81)GTG>ATG	p.V27M		NM_003446	NP_003437	P51786	ZN157_HUMAN	zinc finger protein 157	27	KRAB.				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ACAGGGGTCCGTGTCATTCGA	0.483													10	60	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53589843	53589843	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53589843C>T	uc004dsp.2	-	53	7555	c.7153G>A	c.(7153-7155)GAA>AAA	p.E2385K	HUWE1_uc004dsn.2_Missense_Mutation_p.E1209K	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	2385	Glu-rich.				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						GAAGGAGCTTCATCCATCAGC	0.547													8	69	---	---	---	---	PASS
RRAGB	10325	broad.mit.edu	37	X	55782357	55782357	+	Silent	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55782357G>A	uc004dup.2	+	9	1554	c.903G>A	c.(901-903)CTG>CTA	p.L301L	RRAGB_uc004duq.2_Silent_p.L273L	NM_016656	NP_057740	Q5VZM2	RRAGB_HUMAN	Ras-related GTP binding B long isoform	301					cellular protein localization|cellular response to amino acid stimulus|positive regulation of TOR signaling cascade|signal transduction	Golgi apparatus|lysosome|nucleus	GTP binding|protein binding				0						AGTTCAAGCTGAGCTGCAGGT	0.313													3	27	---	---	---	---	PASS
ARHGEF9	23229	broad.mit.edu	37	X	62863882	62863882	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62863882C>T	uc004dvl.2	-	9	2186	c.1347G>A	c.(1345-1347)GTG>GTA	p.V449V	ARHGEF9_uc004dvj.1_Silent_p.V338V|ARHGEF9_uc004dvk.1_Silent_p.V267V|ARHGEF9_uc011mos.1_Silent_p.V428V|ARHGEF9_uc004dvm.1_Silent_p.V428V|ARHGEF9_uc011mot.1_Silent_p.V396V|ARHGEF9_uc004dvn.2_Silent_p.V456V	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9	449					apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						GGACTTTTCTCACAGTCATTG	0.328													4	25	---	---	---	---	PASS
KIF4A	24137	broad.mit.edu	37	X	69639642	69639642	+	Intron	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69639642G>C	uc004dyg.2	+						KIF4A_uc010nkw.2_Intron	NM_012310	NP_036442	O95239	KIF4A_HUMAN	kinesin family member 4						anterograde axon cargo transport|axon guidance|blood coagulation|organelle organization	chromosome|cytosol|midbody|nuclear matrix|spindle microtubule	ATP binding|DNA binding|microtubule motor activity|protein binding			ovary(4)	4						AGGTAGGTGGGCTAAAAGGCA	0.502													6	66	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79999553	79999553	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79999553G>A	uc004edt.2	-	8	1054	c.791C>T	c.(790-792)TCA>TTA	p.S264L	BRWD3_uc004edo.2_5'UTR|BRWD3_uc004edp.2_Missense_Mutation_p.S93L|BRWD3_uc004edq.2_5'UTR|BRWD3_uc010nmj.1_5'UTR|BRWD3_uc004edr.2_5'UTR|BRWD3_uc004eds.2_5'UTR|BRWD3_uc004edu.2_5'UTR|BRWD3_uc004edv.2_5'UTR|BRWD3_uc004edw.2_5'UTR|BRWD3_uc004edx.2_5'UTR|BRWD3_uc004edy.2_5'UTR|BRWD3_uc004edz.2_5'UTR|BRWD3_uc004eea.2_5'UTR|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	264	WD 4.									ovary(4)	4						AATAGAAGCTGAATGGCCCTG	0.378													9	92	---	---	---	---	PASS
PABPC5	140886	broad.mit.edu	37	X	90691233	90691233	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:90691233C>T	uc004efg.2	+	2	1097	c.657C>T	c.(655-657)TTC>TTT	p.F219F	PABPC5_uc004eff.1_Silent_p.F55F	NM_080832	NP_543022	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	219	RRM 3.					cytoplasm	nucleotide binding|RNA binding			ovary(1)|lung(1)|pancreas(1)	3						AGGAACTTTTCTGTGAATATG	0.438													4	52	---	---	---	---	PASS
TCEAL7	56849	broad.mit.edu	37	X	102586554	102586554	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102586554G>C	uc004ekc.1	+	3	436	c.223G>C	c.(223-225)GAG>CAG	p.E75Q		NM_152278	NP_689491	Q9BRU2	TCAL7_HUMAN	transcription elongation factor A (SII)-like 7	75	Potential.				negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				upper_aerodigestive_tract(1)	1						gtgtttggaagagataagggg	0.065													9	158	---	---	---	---	PASS
ESX1	80712	broad.mit.edu	37	X	103499539	103499539	+	5'UTR	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103499539C>T	uc004ely.2	-	1						NM_153448	NP_703149	Q8N693	ESX1_HUMAN	extraembryonic, spermatogenesis, homeobox						negative regulation of transcription, DNA-dependent|regulation of cell cycle	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						ATGCTTCAAGCGCTGTCGATA	0.592													8	104	---	---	---	---	PASS
PSMD10	5716	broad.mit.edu	37	X	107328211	107328211	+	Missense_Mutation	SNP	T	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107328211T>A	uc004enp.1	-	5	772	c.674A>T	c.(673-675)GAA>GTA	p.E225V	PSMD10_uc004enq.1_3'UTR	NM_002814	NP_002805	O75832	PSD10_HUMAN	proteasome 26S non-ATPase subunit 10 isoform 1	225	ANK 7.|Interaction with RELA.|Interaction with RB1.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cytoplasmic sequestering of NF-kappaB|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of apoptosis|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of MAPKKK cascade|negative regulation of NF-kappaB transcription factor activity|negative regulation of release of cytochrome c from mitochondria|negative regulation of transcription from RNA polymerase II promoter|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of cell growth|positive regulation of cyclin-dependent protein kinase activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|proteasome regulatory particle assembly|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	actin cytoskeleton|cytoplasm|intermediate filament cytoskeleton|nucleus|proteasome regulatory particle	transcription factor binding			ovary(1)	1						TGTTTAACCTTCCACCATTCT	0.398													12	146	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123224510	123224510	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123224510C>T	uc004etz.3	+	30	3702	c.3363C>T	c.(3361-3363)CTC>CTT	p.L1121L	STAG2_uc004eua.2_Silent_p.L1121L|STAG2_uc004eub.2_Silent_p.L1121L|STAG2_uc004euc.2_Silent_p.L1121L|STAG2_uc004eud.2_Silent_p.L1121L|STAG2_uc004eue.2_Silent_p.L1121L	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	1121					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						CACCACAACTCACCTCCACTA	0.418													10	97	---	---	---	---	PASS
DCAF12L2	340578	broad.mit.edu	37	X	125299852	125299852	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:125299852C>T	uc004euk.1	-	1	83	c.56G>A	c.(55-57)GGA>GAA	p.G19E		NM_001013628	NP_001013650	Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	19										lung(2)|skin(2)|large_intestine(1)|pancreas(1)|ovary(1)	7						GCTCCCGGCTCCCGCCTCGAC	0.612													3	25	---	---	---	---	PASS
OCRL	4952	broad.mit.edu	37	X	128695239	128695239	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128695239G>C	uc004euq.2	+	10	1073	c.908G>C	c.(907-909)AGA>ACA	p.R303T	OCRL_uc004eur.2_Missense_Mutation_p.R303T	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	303					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						GCTGTAGAGAGAGGTTTGCAT	0.398													5	151	---	---	---	---	PASS
GPR119	139760	broad.mit.edu	37	X	129518528	129518528	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129518528C>T	uc011muv.1	-	1	894	c.894G>A	c.(892-894)AAG>AAA	p.K298K		NM_178471	NP_848566	Q8TDV5	GP119_HUMAN	G protein-coupled receptor 119	298	Cytoplasmic (Potential).					integral to membrane|plasma membrane	lipid binding			ovary(2)	2						TGAGCACCTTCTTCACTCCTA	0.572													4	61	---	---	---	---	PASS
ENOX2	10495	broad.mit.edu	37	X	129765491	129765491	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129765491C>T	uc004evw.2	-	14	1984	c.1566G>A	c.(1564-1566)AAG>AAA	p.K522K	ENOX2_uc004evx.2_Silent_p.K493K|ENOX2_uc004evy.2_Silent_p.K493K|ENOX2_uc004evv.2_Silent_p.K347K	NM_182314	NP_872114	Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2 isoform b	522					cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1						TGTTCATGGTCTTCTCAAGAG	0.473													9	117	---	---	---	---	PASS
FRMD7	90167	broad.mit.edu	37	X	131214219	131214219	+	Intron	SNP	C	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131214219C>A	uc004ewn.2	-						FRMD7_uc011muy.1_Intron	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7						regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					GAAACAAAATCATGTACCTTT	0.383													11	77	---	---	---	---	PASS
MAP7D3	79649	broad.mit.edu	37	X	135310928	135310928	+	Intron	SNP	T	G	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135310928T>G	uc004ezt.2	-						MAP7D3_uc004ezs.2_Intron|MAP7D3_uc011mwc.1_Intron|MAP7D3_uc010nsa.1_Intron	NM_024597	NP_078873	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3							cytoplasm|spindle				ovary(2)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;0.000127)					CTAGTTTAAATAAATATGTGC	0.373													11	65	---	---	---	---	PASS
HTATSF1	27336	broad.mit.edu	37	X	135593171	135593171	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135593171G>A	uc004ezw.2	+	10	1689	c.1267G>A	c.(1267-1269)GAA>AAA	p.E423K	HTATSF1_uc004ezx.2_Missense_Mutation_p.E423K	NM_001163280	NP_001156752	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	423	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					AATGGCGTTTGAAGAACCTAT	0.438													5	164	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140953261	140953261	+	Missense_Mutation	SNP	G	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140953261G>A	uc011mwp.1	+	2	128	c.128G>A	c.(127-129)CGG>CAG	p.R43Q		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	43										skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					GAGTAGCCCCGGAAAAAGGCC	0.488													4	65	---	---	---	---	PASS
MTMR1	8776	broad.mit.edu	37	X	149905175	149905175	+	Missense_Mutation	SNP	G	C	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149905175G>C	uc004fei.2	+	10	1300	c.1165G>C	c.(1165-1167)GAG>CAG	p.E389Q	MTMR1_uc011mya.1_Missense_Mutation_p.E295Q|MTMR1_uc004feh.1_Missense_Mutation_p.E397Q|MTMR1_uc004fej.2_RNA|MTMR1_uc010ntf.2_Intron	NM_003828	NP_003819	Q13613	MTMR1_HUMAN	myotubularin-related protein 1	389	Myotubularin phosphatase.					plasma membrane	protein tyrosine phosphatase activity			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					CAAATTAAAAGAGATTGTGTA	0.443													4	62	---	---	---	---	PASS
MAGEA10	4109	broad.mit.edu	37	X	151303779	151303779	+	Missense_Mutation	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151303779G>T	uc004ffk.2	-	5	722	c.314C>A	c.(313-315)TCT>TAT	p.S105Y	MAGEA10_uc004ffl.2_Missense_Mutation_p.S105Y	NM_001011543	NP_001011543	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	105											0	Acute lymphoblastic leukemia(192;6.56e-05)					GCCCTCATCAGATTGATCTAA	0.527													16	258	---	---	---	---	PASS
MAGEA3	4102	broad.mit.edu	37	X	151935841	151935841	+	Missense_Mutation	SNP	A	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151935841A>T	uc004fgp.2	-	3	535	c.326T>A	c.(325-327)CTC>CAC	p.L109H		NM_005362	NP_005353	P43357	MAGA3_HUMAN	melanoma antigen family A, 3	109	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					CTTCCTACTGAGTGCTGCTTG	0.552													17	130	---	---	---	---	PASS
BCAP31	10134	broad.mit.edu	37	X	152966397	152966397	+	Missense_Mutation	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152966397C>T	uc011myz.1	-	8	892	c.736G>A	c.(736-738)GAG>AAG	p.E246K	BCAP31_uc011myy.1_Missense_Mutation_p.E158K|BCAP31_uc004fid.2_Missense_Mutation_p.E313K|BCAP31_uc011mza.1_Missense_Mutation_p.E246K|BCAP31_uc004fie.2_Missense_Mutation_p.E246K	NM_001139441	NP_001132913	P51572	BAP31_HUMAN	B-cell receptor-associated protein 31 isoform b	246	Di-lysine motif.|Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|immune response|intracellular protein transport|vesicle-mediated transport	cytosol|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to plasma membrane	receptor binding				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGCCCTTACTCTTCCTTCTTG	0.612													4	38	---	---	---	---	PASS
PLXNB3	5365	broad.mit.edu	37	X	153033712	153033712	+	Silent	SNP	C	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153033712C>T	uc004fii.2	+	4	1269	c.1095C>T	c.(1093-1095)CCC>CCT	p.P365P	PLXNB3_uc011mzb.1_Intron|PLXNB3_uc011mzc.1_Silent_p.P47P|PLXNB3_uc010nuk.2_Silent_p.P388P|PLXNB3_uc011mzd.1_Silent_p.P4P	NM_005393	NP_005384	Q9ULL4	PLXB3_HUMAN	plexin B3 isoform 1	365	Extracellular (Potential).|Sema.				axon guidance	integral to membrane|intracellular|plasma membrane	protein binding|receptor activity			lung(1)	1	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					AGGATTCCCCCGAGTCGTACC	0.687													6	81	---	---	---	---	PASS
G6PD	2539	broad.mit.edu	37	X	153763457	153763457	+	Silent	SNP	G	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153763457G>T	uc004fly.1	-	5	524	c.411C>A	c.(409-411)CTC>CTA	p.L137L	G6PD_uc004flx.1_Silent_p.L167L	NM_001042351	NP_001035810	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase isoform b	137					cellular response to oxidative stress|cholesterol biosynthetic process|cytokine production|erythrocyte maturation|glucose 6-phosphate metabolic process|glutathione metabolic process|negative regulation of protein glutathionylation|pentose-phosphate shunt, oxidative branch|ribose phosphate biosynthetic process	centrosome|cytosol|internal side of plasma membrane|intracellular membrane-bounded organelle	glucose binding|glucose-6-phosphate dehydrogenase activity|NADP binding|protein homodimerization activity			ovary(4)	4	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCAGGTAGAAGAGGCGGTTGG	0.602													14	68	---	---	---	---	PASS
CHRNG	1146	broad.mit.edu	37	2	233408191	233408191	+	Intron	DEL	C	-	-	rs68041074		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233408191delC	uc002vsx.1	+						CHRNG_uc010fye.1_Intron	NM_005199	NP_005190	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma						muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)		CCTCCATCCACCCCCCCCATC	0.622													4	4	---	---	---	---	
AGAP1	116987	broad.mit.edu	37	2	236908145	236908147	+	Intron	DEL	GTA	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236908145_236908147delGTA	uc002vvs.2	+						AGAP1_uc002vvt.2_Intron	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1						protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						ggtggtggtggtagtggtgatgg	0.000													4	2	---	---	---	---	
KPNA4	3840	broad.mit.edu	37	3	160219811	160219812	+	3'UTR	DEL	TA	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160219811_160219812delTA	uc003fdn.2	-	17						NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			tatatatatgtatatatatata	0.302													4	2	---	---	---	---	
PIK3CA	5290	broad.mit.edu	37	3	178938736	178938737	+	Intron	DEL	TA	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178938736_178938737delTA	uc003fjk.2	+							NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GATTTAAGACtatatatatata	0.267		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			4	2	---	---	---	---	
YEATS2	55689	broad.mit.edu	37	3	183521660	183521660	+	Intron	DEL	A	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183521660delA	uc003fly.2	+							NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TTTTTTCTTTAAAAAAAAAAA	0.328													4	2	---	---	---	---	
FHDC1	85462	broad.mit.edu	37	4	153895638	153895639	+	Intron	DEL	AC	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153895638_153895639delAC	uc003inf.2	+							NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1						actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					CCCTCCCTCTacacacacacac	0.391													4	2	---	---	---	---	
DHX29	54505	broad.mit.edu	37	5	54562821	54562821	+	Intron	DEL	G	-	-	rs113524236		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54562821delG	uc003jpx.2	-						DHX29_uc010ivw.2_Intron	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29								ATP binding|ATP-dependent helicase activity|translation initiation factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				CTGGAAGAAAGAAGTACAATC	0.164													2	4	---	---	---	---	
GRIA1	2890	broad.mit.edu	37	5	153085222	153085223	+	Intron	INS	-	TTTT	TTTT	rs140530536		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153085222_153085223insTTTT	uc003lva.3	+						GRIA1_uc003luy.3_Intron|GRIA1_uc003luz.3_Intron|GRIA1_uc011dcv.1_Intron|GRIA1_uc011dcw.1_Intron|GRIA1_uc011dcx.1_Intron|GRIA1_uc011dcy.1_Intron|GRIA1_uc011dcz.1_Intron|GRIA1_uc010jia.1_Intron	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform						synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GCTCACCTGCAttttttttttt	0.361													4	2	---	---	---	---	
E2F3	1871	broad.mit.edu	37	6	20483287	20483288	+	Intron	DEL	TG	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20483287_20483288delTG	uc003nda.2	+							NM_001949	NP_001940	O00716	E2F3_HUMAN	E2F transcription factor 3						G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|transcription initiation from RNA polymerase II promoter	transcription factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			tgtgtgtgtatgtgtgtgtgtg	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	34158925	34158925	+	IGR	DEL	A	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34158925delA								GRM4 (45056 upstream) : HMGA1 (45652 downstream)																							GTCATTGTGGaaaaaaaaaaa	0.294													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152712728	152712730	+	Intron	DEL	AAG	-	-	rs72208404		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152712728_152712730delAAG	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		aaaaaaaaaaaagaaaaaaaaTT	0.433										HNSCC(10;0.0054)			5	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	4494737	4494737	+	Intron	DEL	C	-	-	rs112131815		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4494737delC	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ttgaagtcagcgaggccacga	0.070													5	3	---	---	---	---	
LOC349196	349196	broad.mit.edu	37	8	7191540	7191541	+	Intron	DEL	CA	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7191540_7191541delCA	uc010lrk.1	-						uc011kwo.1_Intron					Homo sapiens cDNA FLJ37516 fis, clone BRCAN2000832.												0						GGGGTGcacgcacacacacaca	0.366													9	5	---	---	---	---	
LRRC14	9684	broad.mit.edu	37	8	145748920	145748921	+	3'UTR	INS	-	G	G	rs142436931	by1000genomes	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145748920_145748921insG	uc003zdk.1	+	4					LRRC24_uc003zdm.2_Intron|LRRC24_uc003zdn.2_Intron|LRRC14_uc003zdl.1_3'UTR|LRRC14_uc003zdo.2_Intron	NM_014665	NP_055480	Q15048	LRC14_HUMAN	leucine rich repeat containing 14												0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			ACGGAGTCCAAGGCCCTGCCAC	0.614													4	2	---	---	---	---	
SLC35D2	11046	broad.mit.edu	37	9	99130723	99130723	+	Intron	DEL	T	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99130723delT	uc004awc.2	-						SLC35D2_uc010msd.2_Intron|SLC35D2_uc010mse.2_Intron|SLC35D2_uc010msf.2_Intron|SLC35D2_uc004awd.2_Intron|SLC35D2_uc004awe.2_Intron	NM_007001	NP_008932	Q76EJ3	S35D2_HUMAN	solute carrier family 35, member D2							Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity				0		Acute lymphoblastic leukemia(62;0.0167)				catttaattcttttttttttt	0.090													4	3	---	---	---	---	
KIAA1529	57653	broad.mit.edu	37	9	100133212	100133213	+	Intron	INS	-	GGC	GGC	rs142691576	by1000genomes	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100133212_100133213insGGC	uc011lut.1	+						KIAA1529_uc004axe.1_Intron|KIAA1529_uc004axg.1_Intron|KIAA1529_uc004axh.1_Intron|KIAA1529_uc011luw.1_Intron	NM_020893	NP_065944			hypothetical protein LOC57653											ovary(4)|large_intestine(2)|skin(1)	7		Acute lymphoblastic leukemia(62;0.154)				TGGCCATTATTGGCTGTTTTAA	0.277													3	3	---	---	---	---	
PAMR1	25891	broad.mit.edu	37	11	35462850	35462851	+	Intron	INS	-	A	A	rs113713187		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35462850_35462851insA	uc001mwg.2	-						PAMR1_uc001mwf.2_Intron|PAMR1_uc010rew.1_Intron|PAMR1_uc010rex.1_Intron	NM_001001991	NP_001001991	Q6UXH9	PAMR1_HUMAN	regeneration associated muscle protease isoform						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						CTCTTGAGGTCAAAAAAAAAAA	0.391													4	2	---	---	---	---	
CKAP5	9793	broad.mit.edu	37	11	46810124	46810125	+	Intron	INS	-	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46810124_46810125insA	uc001ndi.1	-						CKAP5_uc009ylg.1_Intron|CKAP5_uc001ndj.1_Intron	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein						cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2						aactccgtctcaaaaaaaaaaa	0.119													4	2	---	---	---	---	
PZP	5858	broad.mit.edu	37	12	9313510	9313511	+	Intron	INS	-	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9313510_9313511insA	uc001qvl.2	-						PZP_uc009zgl.2_Intron|PZP_uc010sgo.1_Intron	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						gactccatctcaaaaaaataaa	0.149													3	3	---	---	---	---	
DNM1L	10059	broad.mit.edu	37	12	32895822	32895822	+	Intron	DEL	C	-	-	rs74934269		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32895822delC	uc001rld.2	+						DNM1L_uc001rle.2_Intron|DNM1L_uc001rlf.2_Intron|DNM1L_uc010skh.1_Intron|DNM1L_uc001rlg.2_Intron|DNM1L_uc001rlh.2_Intron|DNM1L_uc010ski.1_Intron	NM_012062	NP_036192	O00429	DNM1L_HUMAN	dynamin 1-like isoform 1						cellular component disassembly involved in apoptosis|mitochondrial fragmentation involved in apoptosis|mitochondrial membrane organization|positive regulation of mitochondrial fission	cis-Golgi network|cytosol|endomembrane system|endoplasmic reticulum|mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TGATAAGAATCtttttttttt	0.149													5	4	---	---	---	---	
YARS2	51067	broad.mit.edu	37	12	32902681	32902682	+	Intron	INS	-	TTT	TTT			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32902681_32902682insTTT	uc001rli.2	-							NM_001040436	NP_001035526	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial						tyrosyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|RNA binding|tyrosine-tRNA ligase activity				0	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	tgcccggctaatttgtattttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80750741	80750742	+	Intron	INS	-	A	A	rs148677716	by1000genomes	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80750741_80750742insA	uc009zsg.1	+						uc001szd.2_Intron					RecName: Full=Uncharacterized protein C12orf64;																		AAGGATCTAGGAAAAAAATCTC	0.322													6	4	---	---	---	---	
HNF1A	6927	broad.mit.edu	37	12	121438709	121438710	+	Intron	INS	-	TT	TT	rs149257187	by1000genomes	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121438709_121438710insTT	uc001tzg.2	+						HNF1A_uc010szn.1_Intron	NM_000545	NP_000536	P20823	HNF1A_HUMAN	hepatic nuclear factor-1-alpha						glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GGCTCCCTTTGAAGAACCGAGG	0.584									Hepatic_Adenoma_Familial_Clustering_of				5	5	---	---	---	---	
RPGRIP1	57096	broad.mit.edu	37	14	21790311	21790312	+	Intron	INS	-	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21790311_21790312insT	uc001wag.2	+						RPGRIP1_uc001wah.2_Intron|RPGRIP1_uc001wai.2_Intron|RPGRIP1_uc001waj.1_Intron|RPGRIP1_uc001wak.2_Intron|RPGRIP1_uc010aim.2_Intron|RPGRIP1_uc001wal.2_Intron|RPGRIP1_uc001wam.2_5'Flank	NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator						response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		CAtttttgttgtttttttttgc	0.193													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	34669510	34669513	+	IGR	DEL	GATG	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:34669510_34669513delGATG								EGLN3 (249223 upstream) : C14orf147 (232632 downstream)																							aacagagcaagaTggatggatgga	0.000													2	4	---	---	---	---	
CHGA	1113	broad.mit.edu	37	14	93398250	93398250	+	Intron	DEL	G	-	-	rs62793360	by1000genomes	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93398250delG	uc001ybc.3	+						CHGA_uc010aum.2_Intron|CHGA_uc001ybd.3_Intron	NM_001275	NP_001266	P10645	CMGA_HUMAN	chromogranin A precursor						regulation of blood pressure	extracellular region|stored secretory granule				skin(2)	2		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		caaaagctgaggttctacccc	0.119													3	3	---	---	---	---	
HDC	3067	broad.mit.edu	37	15	50546973	50546974	+	Intron	INS	-	TGTGTG	TGTGTG	rs71424050		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50546973_50546974insTGTGTG	uc001zxz.2	-						HDC_uc001zxy.2_5'Flank|HDC_uc010uff.1_Intron|HDC_uc010bet.1_Intron|HDC_uc010beu.1_Intron	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase						catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	ctctctctctctgtgtgtgtat	0.307													4	2	---	---	---	---	
SLTM	79811	broad.mit.edu	37	15	59185671	59185671	+	Intron	DEL	A	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59185671delA	uc002afp.2	-						SLTM_uc002afn.2_Intron|SLTM_uc002afo.2_Intron|SLTM_uc002afq.2_Intron|SLTM_uc010bgd.2_Intron	NM_024755	NP_079031	Q9NWH9	SLTM_HUMAN	modulator of estrogen induced transcription						apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)	1						TACATGAAATAAAAAAACTAC	0.244													4	8	---	---	---	---	
MYO9A	4649	broad.mit.edu	37	15	72208543	72208543	+	Intron	DEL	T	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72208543delT	uc002atl.3	-						MYO9A_uc010biq.2_Intron|MYO9A_uc002atn.1_Intron	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						GGCATCTGACTTTTTTTTTTT	0.303													5	3	---	---	---	---	
PGPEP1L	145814	broad.mit.edu	37	15	99514424	99514430	+	Intron	DEL	GGGGGGG	-	-	rs74852431		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99514424_99514430delGGGGGGG	uc002bum.2	-						PGPEP1L_uc010bop.2_Intron|PGPEP1L_uc002bun.2_Intron	NM_001102612	NP_001096082	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase 1-like protein						proteolysis		cysteine-type peptidase activity				0						CTCAGTTGATGGGGGGGGGGGGGGGGT	0.614													6	3	---	---	---	---	
SMG1	23049	broad.mit.edu	37	16	18883764	18883764	+	Intron	DEL	A	-	-	rs117332168	by1000genomes	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18883764delA	uc002dfm.2	-						SMG1_uc010bwb.2_Intron	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						TCTATCCATTAAAAAAAAAAA	0.313													3	3	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	21033224	21033225	+	Intron	INS	-	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21033224_21033225insA	uc010vbe.1	-							NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		gacttcatctcaaaaaaaaaag	0.208													9	4	---	---	---	---	
CHD9	80205	broad.mit.edu	37	16	53326632	53326632	+	Intron	DEL	T	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53326632delT	uc002ehb.2	+						CHD9_uc002egy.2_Intron|CHD9_uc002ehc.2_Intron|CHD9_uc002ehf.2_Intron|CHD9_uc010cbw.2_Intron	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9						cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				GAGAAATATGTTTTTTTTTCC	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	3895235	3895238	+	IGR	DEL	CTTC	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3895235_3895238delCTTC								ATP2A3 (27499 upstream) : ZZEF1 (12502 downstream)																							tccttcctttcttccttccttcct	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	22253184	22253185	+	IGR	INS	-	A	A	rs2202992		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22253184_22253185insA								FLJ36000 (340114 upstream) : None (None downstream)																							cgcacagaactaaacagaagca	0.000													4	9	---	---	---	---	
ERAL1	26284	broad.mit.edu	37	17	27183733	27183733	+	Intron	DEL	T	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27183733delT	uc002hcy.1	+						ERAL1_uc002hcx.1_3'UTR|ERAL1_uc002hcz.1_Intron|ERAL1_uc002hda.1_5'Flank|ERAL1_uc002hdb.1_5'Flank	NM_005702	NP_005693	O75616	ERAL1_HUMAN	Era-like 1						ribosomal small subunit assembly	mitochondrial inner membrane|mitochondrial matrix	GTP binding|ribosomal small subunit binding|rRNA binding			skin(1)	1	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.12e-05)|all cancers(11;5.32e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000272)|OV - Ovarian serous cystadenocarcinoma(11;0.105)			tttctttttcttttttttttt	0.199													4	2	---	---	---	---	
LRRC37A3	374819	broad.mit.edu	37	17	62864850	62864851	+	Intron	INS	-	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62864850_62864851insT	uc002jey.2	-						LRRC37A3_uc010wqg.1_Intron|LRRC37A3_uc010wqf.1_Intron|LRRC37A3_uc010dek.1_Intron	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3							integral to membrane					0						AGAACTTACACTTTTTTTTTTT	0.292													3	3	---	---	---	---	
LMNB2	84823	broad.mit.edu	37	19	2433561	2433561	+	Intron	DEL	C	-	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2433561delC	uc002lvy.2	-						LMNB2_uc002lwa.1_Intron	NM_032737	NP_116126	Q03252	LMNB2_HUMAN	lamin B2							nuclear inner membrane	structural molecule activity			large_intestine(1)|ovary(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCCTGGTCACCCCCATCAGC	0.682													4	2	---	---	---	---	
TLE2	7089	broad.mit.edu	37	19	3013986	3013987	+	Intron	INS	-	T	T	rs138074658		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3013986_3013987insT	uc002lww.2	-						TLE2_uc010xhb.1_Intron|TLE2_uc010dth.2_Intron|TLE2_uc010xhc.1_Intron|TLE2_uc010dti.2_Intron|TLE2_uc010xhd.1_Intron	NM_003260	NP_003251	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		tgtaaaatgtattttttttttt	0.129													4	2	---	---	---	---	
HSD17B14	51171	broad.mit.edu	37	19	49337748	49337749	+	Intron	INS	-	A	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49337748_49337749insA	uc002pkv.1	-						HSD17B14_uc010emk.1_Intron	NM_016246	NP_057330	Q9BPX1	DHB14_HUMAN	dehydrogenase/reductase (SDR family) member 10						steroid catabolic process	centrosome|cytosol	estradiol 17-beta-dehydrogenase activity|protein binding|testosterone 17-beta-dehydrogenase (NADP+) activity				0		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		gaggggctgaggtctggactcc	0.000													4	2	---	---	---	---	
CLCN5	1184	broad.mit.edu	37	X	49845141	49845142	+	Intron	INS	-	T	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49845141_49845142insT	uc004dos.1	+						CLCN5_uc004dor.1_Intron|CLCN5_uc004doq.1_Intron|CLCN5_uc004dot.1_Intron	NM_000084	NP_000075	P51795	CLCN5_HUMAN	chloride channel 5 isoform b						excretion	apical part of cell|endosome membrane|Golgi membrane|integral to plasma membrane	antiporter activity|ATP binding			ovary(2)|lung(1)|central_nervous_system(1)	4	Ovarian(276;0.236)					AATCTCGGTGGTTTTTTTTTTT	0.376													4	2	---	---	---	---	
