Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PTCHD2	57540	broad.mit.edu	37	1	11596393	11596393	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11596393C>T	uc001ash.3	+	21	3967	c.3829C>T	c.(3829-3831)CAG>TAG	p.Q1277*		NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1277	Extracellular (Potential).				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CGCCCGAACGCAGCGCCAGTG	0.706													9	34	---	---	---	---	PASS
PADI2	11240	broad.mit.edu	37	1	17422451	17422451	+	Missense_Mutation	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17422451C>G	uc001baf.2	-	4	446	c.364G>C	c.(364-366)GTG>CTG	p.V122L	PADI2_uc010ocm.1_Missense_Mutation_p.V122L|PADI2_uc001bag.1_Missense_Mutation_p.V122L	NM_007365	NP_031391	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	122					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(3)|pancreas(1)|central_nervous_system(1)|skin(1)	6		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	TCTGCGTCCACATCCAGGGAG	0.607													41	99	---	---	---	---	PASS
ACTL8	81569	broad.mit.edu	37	1	18152873	18152873	+	Silent	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18152873C>G	uc001bat.2	+	3	1176	c.960C>G	c.(958-960)GTC>GTG	p.V320V		NM_030812	NP_110439	Q9H568	ACTL8_HUMAN	actin-like 8	320						cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		GGGATCACGTCTCCTCCACCA	0.597											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	89	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	20991137	20991137	+	Silent	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20991137G>A	uc001bdr.3	-	15	3148	c.3030C>T	c.(3028-3030)ATC>ATT	p.I1010I	KIF17_uc001bdp.3_Silent_p.I287I|KIF17_uc001bdq.3_Silent_p.I288I|KIF17_uc009vpx.2_Silent_p.I380I|KIF17_uc001bds.3_Silent_p.I1009I	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	1010					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TGGTGAAAGGGATGTCGAGGG	0.587													18	122	---	---	---	---	PASS
PPP1R8	5511	broad.mit.edu	37	1	28161059	28161059	+	Intron	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28161059A>G	uc001bov.1	+						PPP1R8_uc001bow.1_Intron|PPP1R8_uc001box.1_Intron|PPP1R8_uc009vtc.1_Intron|PPP1R8_uc009vtd.1_Intron|SCARNA1_uc001boy.1_RNA	NM_014110	NP_054829	Q12972	PP1R8_HUMAN	protein phosphatase 1 regulatory inhibitor						mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|RNA splicing|transcription, DNA-dependent	cytoplasm|nuclear speck|spliceosomal complex	DNA binding|endonuclease activity|protein binding|protein serine/threonine phosphatase inhibitor activity|ribonuclease E activity|RNA binding				0		Colorectal(325;3.46e-05)|all_lung(284;0.000129)|Lung NSC(340;0.000259)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.76e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00248)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)		ACTCTGAGTTATAACTCAGAG	0.408													12	18	---	---	---	---	PASS
MAP7D1	55700	broad.mit.edu	37	1	36644891	36644891	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36644891G>C	uc001bzz.2	+	13	2375	c.2159G>C	c.(2158-2160)CGG>CCG	p.R720P	MAP7D1_uc001caa.2_Missense_Mutation_p.R688P|MAP7D1_uc001cab.2_Missense_Mutation_p.R683P|MAP7D1_uc001cac.2_Missense_Mutation_p.R420P|MAP7D1_uc001cad.2_Missense_Mutation_p.R257P	NM_018067	NP_060537	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	720	Potential.					cytoplasm|spindle				ovary(3)|breast(2)	5		Myeloproliferative disorder(586;0.0393)				AAGAGGACTCGGAAGTCAGAA	0.587													14	25	---	---	---	---	PASS
NT5C1A	84618	broad.mit.edu	37	1	40124970	40124970	+	Silent	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40124970A>T	uc001cdq.1	-	6	930	c.930T>A	c.(928-930)GCT>GCA	p.A310A		NM_032526	NP_115915	Q9BXI3	5NT1A_HUMAN	5'-nucleotidase, cytosolic IA	310					purine base metabolic process|purine nucleotide catabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	cytosol	5'-nucleotidase activity|magnesium ion binding|nucleotide binding			ovary(1)	1	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TGGGCGCTCCAGCAAGGAACA	0.612													62	108	---	---	---	---	PASS
CCDC30	728621	broad.mit.edu	37	1	43103011	43103011	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43103011G>C	uc009vwk.1	+	11	1710	c.1600G>C	c.(1600-1602)GAA>CAA	p.E534Q	CCDC30_uc001chm.2_Missense_Mutation_p.E232Q|CCDC30_uc001chn.2_Missense_Mutation_p.E323Q	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	534	Potential.										0						TAACCAATTTGAAGATGAAAT	0.343													7	27	---	---	---	---	PASS
AKR1A1	10327	broad.mit.edu	37	1	46027544	46027544	+	Silent	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46027544T>C	uc001cod.2	+	3	542	c.78T>C	c.(76-78)CCT>CCC	p.P26P	AKR1A1_uc009vxw.2_Silent_p.P26P|AKR1A1_uc001coe.2_Silent_p.P26P	NM_006066	NP_006057	P14550	AK1A1_HUMAN	aldo-keto reductase family 1, member A1	26					glucose metabolic process		alditol:NADP+ 1-oxidoreductase activity|electron carrier activity|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					AGAGTGAGCCTGGTCAGGTGA	0.557													13	131	---	---	---	---	PASS
IPP	3652	broad.mit.edu	37	1	46193388	46193388	+	Missense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46193388C>A	uc001cou.2	-	5	1230	c.963G>T	c.(961-963)CAG>CAT	p.Q321H	IPP_uc001cos.3_Missense_Mutation_p.Q321H	NM_005897	NP_005888	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	321	Kelch 1.					actin cytoskeleton|cytoplasm	actin binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					TGGTCCAGTACTGGCTAAAGG	0.478													12	165	---	---	---	---	PASS
MTMR11	10903	broad.mit.edu	37	1	149905804	149905804	+	Missense_Mutation	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149905804T>C	uc001etl.3	-	8	966	c.715A>G	c.(715-717)ATT>GTT	p.I239V	MTMR11_uc001etm.1_Missense_Mutation_p.I167V|MTMR11_uc010pbm.1_Missense_Mutation_p.I211V|MTMR11_uc010pbn.1_Missense_Mutation_p.I81V	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	239	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CTGTCCAGAATTCGGTTAGGG	0.478													34	147	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152283961	152283961	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152283961G>T	uc001ezu.1	-	3	3437	c.3401C>A	c.(3400-3402)ACC>AAC	p.T1134N	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	1134	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGGTCCTGGTCCGCCCATG	0.597									Ichthyosis				126	300	---	---	---	---	PASS
ETV3L	440695	broad.mit.edu	37	1	157068514	157068514	+	Missense_Mutation	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157068514A>T	uc001fqq.1	-	3	755	c.470T>A	c.(469-471)GTG>GAG	p.V157E		NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	157						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)				CTGCACACCCACGGGCACCAG	0.667													4	58	---	---	---	---	PASS
KCNJ9	3765	broad.mit.edu	37	1	160054077	160054077	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160054077G>T	uc001fuy.1	+	2	499	c.257G>T	c.(256-258)CGC>CTC	p.R86L		NM_004983	NP_004974	Q92806	IRK9_HUMAN	potassium inwardly-rectifying channel subfamily	86	Extracellular (By similarity).				synaptic transmission	integral to membrane|plasma membrane	G-protein activated inward rectifier potassium channel activity|protein binding			ovary(1)|skin(1)	2	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCCTACGGCCGCGGCGACCTG	0.657													16	20	---	---	---	---	PASS
CD84	8832	broad.mit.edu	37	1	160523900	160523900	+	Missense_Mutation	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160523900A>T	uc001fwh.3	-	3	449	c.425T>A	c.(424-426)ATG>AAG	p.M142K	CD84_uc001fwf.3_Missense_Mutation_p.M142K|CD84_uc001fwg.3_Missense_Mutation_p.M142K|CD84_uc009wtn.2_Missense_Mutation_p.M142K|CD84_uc001fwi.3_Missense_Mutation_p.M28K|CD84_uc001fwj.2_Missense_Mutation_p.M142K|CD84_uc001fwk.2_Missense_Mutation_p.M142K	NM_003874	NP_003865	Q9UIB8	SLAF5_HUMAN	CD84 molecule	142	Extracellular (Potential).|Ig-like C2-type.				blood coagulation|defense response|homophilic cell adhesion|leukocyte migration	integral to plasma membrane	receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CACAGATGCCATTAAACTCTG	0.363													25	49	---	---	---	---	PASS
DARS2	55157	broad.mit.edu	37	1	173806089	173806089	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173806089G>C	uc001gjh.1	+	8	1085	c.675G>C	c.(673-675)GAG>GAC	p.E225D		NM_018122	NP_060592	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial	225					tRNA aminoacylation for protein translation	mitochondrial matrix|nucleus	aspartate-tRNA ligase activity|ATP binding|nucleic acid binding			central_nervous_system(2)	2					L-Aspartic Acid(DB00128)	GTGCCAAAGAGTTTTTAGTAC	0.383													11	204	---	---	---	---	PASS
RFWD2	64326	broad.mit.edu	37	1	176133017	176133017	+	Silent	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176133017G>T	uc001gku.1	-	4	832	c.576C>A	c.(574-576)CTC>CTA	p.L192L	RFWD2_uc001gkv.1_Silent_p.L192L|RFWD2_uc001gkw.1_Intron|RFWD2_uc009wwv.2_5'Flank|RFWD2_uc001gkt.1_Silent_p.L51L	NM_022457	NP_071902	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2 isoform a	192					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						GTTTAAGAATGAGTTCATTCA	0.284													6	9	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197072580	197072580	+	Missense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197072580C>A	uc001gtu.2	-	18	6058	c.5801G>T	c.(5800-5802)TGG>TTG	p.W1934L	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	1934					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						TCCTGCAGTCCATGCTCTGAA	0.428													40	159	---	---	---	---	PASS
MYOG	4656	broad.mit.edu	37	1	203054778	203054778	+	Silent	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203054778C>T	uc001gzd.2	-	1	600	c.312G>A	c.(310-312)CTG>CTA	p.L104L		NM_002479	NP_002470	P15173	MYOG_HUMAN	myogenin	104	Helix-loop-helix motif.				muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter	transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity			skin(2)	2						TGCTTCTCTTCAGGGCCTCGA	0.637													27	86	---	---	---	---	PASS
RPS6KC1	26750	broad.mit.edu	37	1	213415152	213415152	+	Missense_Mutation	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213415152T>C	uc010ptr.1	+	11	2492	c.2333T>C	c.(2332-2334)GTA>GCA	p.V778A	RPS6KC1_uc001hkd.2_Missense_Mutation_p.V766A|RPS6KC1_uc010pts.1_Missense_Mutation_p.V566A|RPS6KC1_uc010ptt.1_Missense_Mutation_p.V566A|RPS6KC1_uc010ptu.1_Missense_Mutation_p.V597A|RPS6KC1_uc010ptv.1_Missense_Mutation_p.V313A|RPS6KC1_uc001hke.2_Missense_Mutation_p.V597A	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	778					cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		ATGTTATTTGTAGCAGCTGTT	0.448													30	114	---	---	---	---	PASS
DISC1	27185	broad.mit.edu	37	1	231903024	231903024	+	Intron	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231903024G>T	uc001huz.2	+						TSNAX-DISC1_uc010pwg.1_Intron|TSNAX-DISC1_uc010pwh.1_Intron|TSNAX-DISC1_uc010pwi.1_Intron|TSNAX-DISC1_uc010pwj.1_Intron|TSNAX-DISC1_uc010pwk.1_Intron|TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pwq.1_Intron|DISC1_uc010pwr.1_Intron|DISC1_uc010pws.1_Intron|DISC1_uc010pwt.1_Intron|DISC1_uc010pwu.1_Intron|DISC1_uc010pwv.1_Intron|DISC1_uc010pww.1_Intron|DISC1_uc010pwx.1_Intron|DISC1_uc010pwy.1_Intron|DISC1_uc010pwz.1_Intron|DISC1_uc010pxa.1_Intron|DISC1_uc001huy.2_Intron|DISC1_uc010pxb.1_Intron|DISC1_uc010pxc.1_Intron|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)				AGGTGAGCAGGTGAAAGATCT	0.333													8	28	---	---	---	---	PASS
GPR137B	7107	broad.mit.edu	37	1	236347124	236347124	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236347124G>C	uc001hxq.2	+	5	975	c.884G>C	c.(883-885)GGA>GCA	p.G295A	GPR137B_uc001hxr.1_Missense_Mutation_p.G77A|GPR137B_uc009xge.2_RNA	NM_003272	NP_003263	O60478	G137B_HUMAN	G protein-coupled receptor 137B	295	Helical; (Potential).					integral to plasma membrane|membrane fraction					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			GTATTATTTGGAGTGGTGTTA	0.393													12	36	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237780584	237780584	+	Splice_Site	SNP	A	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237780584A>C	uc001hyl.1	+	38	5836	c.5716_splice	c.e38-2	p.M1906_splice		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGGTCTCTTAGATGTGCCTA	0.333													3	12	---	---	---	---	PASS
OR2T8	343172	broad.mit.edu	37	1	248084490	248084490	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248084490G>T	uc010pzc.1	+	1	171	c.171G>T	c.(169-171)ATG>ATT	p.M57I		NM_001005522	NP_001005522	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T,	57	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACACGCCCATGTACTTCCTCC	0.522													9	157	---	---	---	---	PASS
OR2T12	127064	broad.mit.edu	37	1	248458710	248458710	+	Missense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248458710C>A	uc010pzj.1	-	1	171	c.171G>T	c.(169-171)ATG>ATT	p.M57I		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	57	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			GGAGGAAGTACATGGGCCTGT	0.527													9	46	---	---	---	---	PASS
OR2T12	127064	broad.mit.edu	37	1	248458891	248458891	+	5'Flank	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248458891G>T	uc010pzj.1	-							NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			AATTTCCCCTGGTGTGATGGT	0.408													32	96	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25467480	25467480	+	Silent	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25467480G>A	uc002rgc.2	-	14	1853	c.1596C>T	c.(1594-1596)GGC>GGT	p.G532G	DNMT3A_uc002rgd.2_Silent_p.G532G|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Silent_p.G343G	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	532	Interaction with the PRC2/EED-EZH2 complex (By similarity).|ADD.				regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGACTGGTAGCCGTCGTCGT	0.607			Mis|F|N|S		AML								25	61	---	---	---	---	PASS
ALK	238	broad.mit.edu	37	2	29456502	29456502	+	Missense_Mutation	SNP	G	C	C	rs80227749		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29456502G>C	uc002rmy.2	-	14	3323	c.2416C>G	c.(2416-2418)CGT>GGT	p.R806G		NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	806	Extracellular (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	CTGTTCACACGGATTTCTTCT	0.483			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				33	96	---	---	---	---	PASS
SIX2	10736	broad.mit.edu	37	2	45235864	45235864	+	Missense_Mutation	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45235864T>C	uc002ruo.2	-	1	679	c.386A>G	c.(385-387)TAC>TGC	p.Y129C	SIX2_uc002rup.2_Missense_Mutation_p.Y129C	NM_016932	NP_058628	Q9NPC8	SIX2_HUMAN	SIX homeobox 2	129	Homeobox.					nucleus	sequence-specific DNA binding transcription factor activity			pancreas(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTTGAAGCAGTAGCTGGTCTC	0.682													22	41	---	---	---	---	PASS
SNRNP27	11017	broad.mit.edu	37	2	70123625	70123625	+	Silent	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70123625A>G	uc002sfw.2	+	3	240	c.213A>G	c.(211-213)AGA>AGG	p.R71R	SNRNP27_uc002sfv.2_RNA|SNRNP27_uc002sfx.2_Silent_p.R71R	NM_006857	NP_006848	Q8WVK2	SNR27_HUMAN	small nuclear ribonucleoprotein 27kDa	71	Arg-rich.				mRNA processing|RNA splicing	nucleus	nucleic acid binding				0						aagaaagaagagatgaggaaa	0.279													14	39	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	79971515	79971515	+	Silent	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79971515G>A	uc010ysh.1	+	2	110	c.105G>A	c.(103-105)GTG>GTA	p.V35V	CTNNA2_uc010yse.1_Silent_p.V35V|CTNNA2_uc010ysf.1_Silent_p.V35V|CTNNA2_uc010ysg.1_Silent_p.V35V	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	35					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						TATTTAAGGTGACTACACTTG	0.368													9	36	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89326681	89326681	+	RNA	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89326681C>A	uc010ytr.1	-	68		c.6497G>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		CCAGTTGCTACGCTGCTGACA	0.473													42	64	---	---	---	---	PASS
SLC9A2	6549	broad.mit.edu	37	2	103321024	103321024	+	Missense_Mutation	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103321024A>T	uc002tca.2	+	10	2009	c.1867A>T	c.(1867-1869)AGT>TGT	p.S623C		NM_003048	NP_003039	Q9UBY0	SL9A2_HUMAN	solute carrier family 9 (sodium/hydrogen	623	Cytoplasmic (Potential).					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			central_nervous_system(3)|skin(3)|breast(2)	8						CAACAGACACAGTCTGACAGC	0.423													17	41	---	---	---	---	PASS
MARCO	8685	broad.mit.edu	37	2	119739940	119739940	+	Silent	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119739940C>A	uc002tln.1	+	12	1149	c.1017C>A	c.(1015-1017)CCC>CCA	p.P339P	MARCO_uc010yyf.1_Silent_p.P261P	NM_006770	NP_006761	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	339	Collagen-like.|Extracellular (Potential).				cell surface receptor linked signaling pathway|innate immune response	collagen|integral to plasma membrane	pattern recognition receptor activity|scavenger receptor activity			ovary(3)|skin(2)|central_nervous_system(1)	6						CAGGGAGCCCCGGGAGTCCAG	0.587													38	127	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133887640	133887640	+	Missense_Mutation	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133887640C>T	uc002ttp.2	-	6	625	c.251G>A	c.(250-252)CGT>CAT	p.R84H	NCKAP5_uc002ttq.2_Missense_Mutation_p.R84H|NCKAP5_uc002ttt.1_Missense_Mutation_p.R84H|NCKAP5_uc002tts.1_Missense_Mutation_p.R59H	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	84	Potential.						protein binding				0						GCTTTGAAGACGTAAGTGTCT	0.438													6	14	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141081545	141081545	+	Missense_Mutation	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141081545C>G	uc002tvj.1	-	81	13403	c.12431G>C	c.(12430-12432)GGC>GCC	p.G4144A		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4144	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGAACCATGGCCAAATTTTTG	0.289										TSP Lung(27;0.18)			6	32	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168106733	168106733	+	Missense_Mutation	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168106733T>C	uc002udx.2	+	8	8849	c.8831T>C	c.(8830-8832)ATA>ACA	p.I2944T	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.I2769T|XIRP2_uc010fpq.2_Missense_Mutation_p.I2722T|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.I290T	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2769	Potential.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GCCTTAAATATAGTGGAATTC	0.368													28	79	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168106746	168106746	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168106746G>C	uc002udx.2	+	8	8862	c.8844G>C	c.(8842-8844)TTG>TTC	p.L2948F	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.L2773F|XIRP2_uc010fpq.2_Missense_Mutation_p.L2726F|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.L294F	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2773	Potential.				actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TGGAATTCTTGAGAAAACGTG	0.363													27	86	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168108097	168108097	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168108097G>T	uc002udx.2	+	8	10213	c.10195G>T	c.(10195-10197)GAA>TAA	p.E3399*	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Nonsense_Mutation_p.E3224*|XIRP2_uc010fpq.2_Nonsense_Mutation_p.E3177*|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	3224					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						AGAACTGCGAGAAAAGATTCC	0.398													40	75	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189950500	189950500	+	Splice_Site	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189950500T>C	uc002uqk.2	-	10	966	c.691_splice	c.e10-1	p.G231_splice	COL5A2_uc010frx.2_Splice_Site	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein						axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TGCACCACCCTACAGTTGAAA	0.388													5	40	---	---	---	---	PASS
PTPRN	5798	broad.mit.edu	37	2	220161727	220161727	+	Missense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220161727C>A	uc002vkz.2	-	15	2305	c.2216G>T	c.(2215-2217)CGG>CTG	p.R739L	PTPRN_uc010zlc.1_Missense_Mutation_p.R649L|PTPRN_uc002vla.2_Missense_Mutation_p.R710L|uc010zld.1_5'Flank|MIR153-1_hsa-mir-153-1|MI0000463_5'Flank	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	739	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GTCAGGATGCCGGTTCTTTTT	0.647													46	108	---	---	---	---	PASS
CHPF	79586	broad.mit.edu	37	2	220406629	220406629	+	Silent	SNP	A	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220406629A>C	uc002vmc.3	-	2	824	c.597T>G	c.(595-597)CCT>CCG	p.P199P	CHPF_uc010zlh.1_Silent_p.P37P|CHPF_uc002vmd.3_Silent_p.P199P|TMEM198_uc002vme.2_5'Flank|TMEM198_uc002vmf.2_5'Flank	NM_024536	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	199	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity|protein binding				0		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		AGGTGGTGTCAGGCACCAGGA	0.677											OREG0015229	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	11	---	---	---	---	PASS
SUMF1	285362	broad.mit.edu	37	3	4494692	4494692	+	Silent	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4494692A>G	uc003bpz.1	-	2	337	c.312T>C	c.(310-312)GAT>GAC	p.D104D	SUMF1_uc003bps.1_RNA|SUMF1_uc011ass.1_Silent_p.D104D|SUMF1_uc010hby.1_Silent_p.D104D|SUMF1_uc011ast.1_Silent_p.D104D	NM_182760	NP_877437	Q8NBK3	SUMF1_HUMAN	sulfatase modifying factor 1 isoform 1	104						endoplasmic reticulum lumen	metal ion binding|oxidoreductase activity			upper_aerodigestive_tract(1)	1		Melanoma(143;0.068)|Colorectal(144;0.233)		Epithelial(13;0.0147)|OV - Ovarian serous cystadenocarcinoma(96;0.0444)|all cancers(10;0.0549)		TCTGAGGATCATCTGTGCCCA	0.453													21	20	---	---	---	---	PASS
ATP2B2	491	broad.mit.edu	37	3	10442751	10442751	+	Missense_Mutation	SNP	G	C	C	rs141093862		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10442751G>C	uc003bvt.2	-	5	1106	c.667C>G	c.(667-669)CCT>GCT	p.P223A	ATP2B2_uc003bvv.2_Missense_Mutation_p.P223A|ATP2B2_uc003bvw.2_Missense_Mutation_p.P223A|ATP2B2_uc010hdp.2_Missense_Mutation_p.P223A|ATP2B2_uc010hdo.2_5'UTR	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	223	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						CCGTCGGCAGGGAGGAGGTCA	0.577													19	26	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51126671	51126671	+	Intron	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51126671T>C	uc011bds.1	+							NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CTTCTTTCCATAGCATTTATC	0.318													9	8	---	---	---	---	PASS
CACNA2D3	55799	broad.mit.edu	37	3	54798301	54798301	+	Missense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54798301C>A	uc003dhf.2	+	13	1351	c.1303C>A	c.(1303-1305)CTT>ATT	p.L435I	CACNA2D3_uc011beu.1_RNA|CACNA2D3_uc003dhg.1_Missense_Mutation_p.L341I|CACNA2D3_uc003dhh.1_RNA|CACNA2D3_uc010hmv.1_Missense_Mutation_p.L169I	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	435	Extracellular (Potential).|VWFA.					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		CATGGAATACCTTCACGTGCT	0.512													57	57	---	---	---	---	PASS
POU1F1	5449	broad.mit.edu	37	3	87313626	87313626	+	Missense_Mutation	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87313626T>C	uc003dqq.1	-	3	376	c.251A>G	c.(250-252)CAC>CGC	p.H84R	POU1F1_uc010hoj.1_Missense_Mutation_p.H110R	NM_000306	NP_000297	P28069	PIT1_HUMAN	pituitary specific transcription factor 1	84					negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)|skin(1)	2	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00229)|Lung(72;0.00677)		ACTCAAGGTGTGGTCAGGAAA	0.398													21	20	---	---	---	---	PASS
COL8A1	1295	broad.mit.edu	37	3	99514450	99514450	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99514450G>T	uc003dtg.1	+	5	1950	c.1705G>T	c.(1705-1707)GGA>TGA	p.G569*	COL8A1_uc003dth.1_Nonsense_Mutation_p.G569*|COL8A1_uc003dti.1_Nonsense_Mutation_p.G570*	NM_001850	NP_001841	P27658	CO8A1_HUMAN	alpha 1 type VIII collagen precursor	569	Triple-helical region (COL1).				angiogenesis|cell adhesion	basement membrane|collagen type VIII					0						aggacctccaggacccccagC	0.507													22	51	---	---	---	---	PASS
ZPLD1	131368	broad.mit.edu	37	3	102175170	102175170	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:102175170G>A	uc003dvs.1	+	11	1343	c.461G>A	c.(460-462)AGT>AAT	p.S154N	ZPLD1_uc003dvt.1_Missense_Mutation_p.S170N|ZPLD1_uc011bhg.1_Missense_Mutation_p.S154N	NM_175056	NP_778226	Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	154	ZP.|Extracellular (Potential).					integral to membrane				ovary(2)|skin(2)|central_nervous_system(1)	5						TACAAATTTAGTTGTAGTTAT	0.368													58	130	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108682279	108682279	+	Silent	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108682279C>T	uc003dxl.2	-	27	2868	c.2781G>A	c.(2779-2781)TTG>TTA	p.L927L	MORC1_uc011bhn.1_Silent_p.L906L	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	927	Potential.				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						GTTTCTGCAACAATAGTGCCA	0.239													28	97	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108682280	108682280	+	Nonsense_Mutation	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108682280A>T	uc003dxl.2	-	27	2867	c.2780T>A	c.(2779-2781)TTG>TAG	p.L927*	MORC1_uc011bhn.1_Nonsense_Mutation_p.L906*	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	927	Potential.				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						TTTCTGCAACAATAGTGCCAG	0.239													28	96	---	---	---	---	PASS
DTX3L	151636	broad.mit.edu	37	3	122284830	122284830	+	Silent	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122284830G>C	uc003efk.2	+	2	401	c.312G>C	c.(310-312)CTG>CTC	p.L104L	DTX3L_uc010hrj.2_Silent_p.L104L|PARP9_uc003eff.3_5'Flank|PARP9_uc010hri.2_5'Flank|PARP9_uc011bjs.1_5'Flank|PARP9_uc003efg.2_5'Flank|PARP9_uc003efi.2_5'Flank|PARP9_uc003efh.2_5'Flank|PARP9_uc003efj.2_5'Flank	NM_138287	NP_612144	Q8TDB6	DTX3L_HUMAN	deltex 3-like	104					histone monoubiquitination|response to DNA damage stimulus	cytoplasm|nucleus	histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)	4				GBM - Glioblastoma multiforme(114;0.0459)		TTTCTTCACTGACACAATCAC	0.408													30	96	---	---	---	---	PASS
MRPS22	56945	broad.mit.edu	37	3	139071478	139071478	+	Intron	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139071478T>C	uc003etb.2	+						MRPS22_uc003etc.2_Intron|MRPS22_uc003etd.2_Intron|MRPS22_uc003ete.2_Intron	NM_020191	NP_064576	P82650	RT22_HUMAN	mitochondrial ribosomal protein S22							mitochondrial small ribosomal subunit	protein binding|structural constituent of ribosome			ovary(2)|skin(1)	3						AGTTGCATTTTATGTGGATAG	0.368													17	86	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	149700910	149700910	+	IGR	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149700910A>T								PFN2 (12169 upstream) : TSC22D2 (425878 downstream)																							CCTGCCGAACAGCGTTGGCTA	0.587													75	125	---	---	---	---	PASS
TTC14	151613	broad.mit.edu	37	3	180328230	180328230	+	Nonsense_Mutation	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180328230C>G	uc003fkk.2	+	12	2345	c.2213C>G	c.(2212-2214)TCA>TGA	p.S738*	TTC14_uc003fkl.2_3'UTR|TTC14_uc003fkm.2_Intron	NM_133462	NP_597719	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14 isoform a	738							RNA binding			ovary(1)	1	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AAAGAACACTCAGAAAGCAGT	0.299													16	91	---	---	---	---	PASS
DLG1	1739	broad.mit.edu	37	3	196863538	196863538	+	Missense_Mutation	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196863538T>C	uc003fxo.3	-	11	1184	c.994A>G	c.(994-996)AGC>GGC	p.S332G	DLG1_uc011bub.1_Missense_Mutation_p.S216G|DLG1_uc011buc.1_Missense_Mutation_p.S216G|DLG1_uc011bud.1_Missense_Mutation_p.S15G|DLG1_uc003fxn.3_Missense_Mutation_p.S332G|DLG1_uc011bue.1_Missense_Mutation_p.S299G|DLG1_uc010ial.2_Missense_Mutation_p.S332G|DLG1_uc011buf.1_RNA|DLG1_uc003fxp.2_RNA|DLG1_uc010iam.1_Missense_Mutation_p.S299G|DLG1_uc010ian.2_Missense_Mutation_p.S199G	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1	332	PDZ 2.				actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		CCAGCAATGCTAAACCCAAGA	0.383													66	129	---	---	---	---	PASS
GAK	2580	broad.mit.edu	37	4	905528	905528	+	Silent	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:905528C>G	uc003gbm.3	-	4	514	c.315G>C	c.(313-315)GCG>GCC	p.A105A	GAK_uc003gbn.3_Intron|GAK_uc010ibk.1_Intron|GAK_uc003gbo.2_RNA|GAK_uc003gbl.3_5'UTR	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase	105	Protein kinase.				cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		TTCCTATAGACGCTGCAGAAC	0.502													31	56	---	---	---	---	PASS
ZNF518B	85460	broad.mit.edu	37	4	10447122	10447122	+	Missense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10447122C>A	uc003gmn.2	-	3	1318	c.831G>T	c.(829-831)TTG>TTT	p.L277F		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	277					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4						GTTCAGGTAACAACATGATAT	0.363													50	211	---	---	---	---	PASS
PACRGL	133015	broad.mit.edu	37	4	20711361	20711361	+	Missense_Mutation	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20711361C>G	uc010iek.2	+	5	722	c.331C>G	c.(331-333)CTT>GTT	p.L111V	PACRGL_uc003gpu.2_RNA|PACRGL_uc010iei.1_Missense_Mutation_p.L159V|PACRGL_uc003gpz.2_Missense_Mutation_p.L111V|PACRGL_uc011bxm.1_Intron|PACRGL_uc003gqa.2_Intron|PACRGL_uc003gpx.3_RNA|PACRGL_uc003gpv.2_Missense_Mutation_p.L111V|PACRGL_uc003gpw.2_RNA|PACRGL_uc010iej.1_RNA|PACRGL_uc011bxn.1_Intron|PACRGL_uc003gpy.2_Intron	NM_145048	NP_659485	Q8N7B6	PACRL_HUMAN	PARK2 co-regulated-like isoform 1	111							binding				0						TCCTGAAAGTCTTTCATTTGA	0.289													5	44	---	---	---	---	PASS
GBA3	57733	broad.mit.edu	37	4	22748917	22748917	+	Splice_Site	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22748917A>G	uc003gqp.3	+	3	378	c.287_splice	c.e3-2	p.G96_splice	GBA3_uc010iep.2_Intron|GBA3_uc011bxo.1_Splice_Site_p.G97_splice	NM_020973	NP_066024	Q9H227	GBA3_HUMAN	cytosolic beta-glucosidase isoform a						glycoside catabolic process|glycosylceramide catabolic process	cytosol	beta-galactosidase activity|beta-glucosidase activity|cation binding|glycosylceramidase activity				0						TTTTCCTCCTAGGAATTGATT	0.323													25	74	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56875952	56875952	+	Silent	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56875952G>C	uc003hbi.2	+	19	2622	c.2388G>C	c.(2386-2388)CGG>CGC	p.R796R	CEP135_uc003hbj.2_Silent_p.R502R	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	796	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					ACAGCCTCCGGCGCCAGCTTG	0.398													21	40	---	---	---	---	PASS
ANKRD17	26057	broad.mit.edu	37	4	73963779	73963779	+	Intron	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73963779T>C	uc003hgp.2	-						ANKRD17_uc003hgo.2_Intron|ANKRD17_uc003hgq.2_Intron|ANKRD17_uc003hgr.2_Intron	NM_032217	NP_115593	O75179	ANR17_HUMAN	ankyrin repeat domain protein 17 isoform a						interspecies interaction between organisms	cytoplasm|nucleus	RNA binding			ovary(5)|skin(3)|upper_aerodigestive_tract(1)|lung(1)	10	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAAATAAAAATTGGAACTAAC	0.313													32	67	---	---	---	---	PASS
ANXA3	306	broad.mit.edu	37	4	79525538	79525538	+	Silent	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79525538A>G	uc003hld.2	+	12	1207	c.897A>G	c.(895-897)CTA>CTG	p.L299L	ANXA3_uc003hle.2_Silent_p.L260L|ANXA3_uc010ijk.2_Silent_p.L260L	NM_005139	NP_005130	P12429	ANXA3_HUMAN	annexin A3	299	Annexin 4.				defense response to bacterium|neutrophil degranulation|phagocytosis|positive regulation of angiogenesis|positive regulation of endothelial cell migration|positive regulation of sequence-specific DNA binding transcription factor activity	phagocytic vesicle membrane|plasma membrane|specific granule	calcium ion binding|calcium-dependent phospholipid binding|phospholipase A2 inhibitor activity				0						GCTATTCCCTATATTCAGCAA	0.338													16	43	---	---	---	---	PASS
MEPE	56955	broad.mit.edu	37	4	88766213	88766213	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88766213G>A	uc003hqy.2	+	4	232	c.193G>A	c.(193-195)GTC>ATC	p.V65I	MEPE_uc010ikn.2_5'UTR	NM_020203	NP_064588	Q9NQ76	MEPE_HUMAN	matrix, extracellular phosphoglycoprotein with	65					skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			ovary(1)|lung(1)|skin(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		AGAAAATATTGTCCAGGAAAG	0.313													10	56	---	---	---	---	PASS
CENPE	1062	broad.mit.edu	37	4	104067180	104067180	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104067180C>A	uc003hxb.1	-	30	4309	c.4219G>T	c.(4219-4221)GAG>TAG	p.E1407*	CENPE_uc003hxc.1_Nonsense_Mutation_p.E1382*	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E	1407	Potential.				blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TTGAATTGCTCCATCTCACTC	0.348													19	81	---	---	---	---	PASS
NEUROG2	63973	broad.mit.edu	37	4	113436115	113436115	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113436115G>C	uc003ias.2	-	2	844	c.517C>G	c.(517-519)CAC>GAC	p.H173D		NM_024019	NP_076924	Q9H2A3	NGN2_HUMAN	neurogenin 2	173					positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent	nucleus	E-box binding			skin(2)|central_nervous_system(1)	3		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00168)		cccccgcAGTGATCCGCCAGG	0.552													3	23	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114269456	114269456	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114269456G>C	uc003ibe.3	+	36	4496	c.4396G>C	c.(4396-4398)GAG>CAG	p.E1466Q	ANK2_uc003ibd.3_Missense_Mutation_p.E1457Q|ANK2_uc003ibf.3_Missense_Mutation_p.E1466Q|ANK2_uc011cgc.1_Missense_Mutation_p.E642Q|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Missense_Mutation_p.E140Q|ANK2_uc011cgb.1_Missense_Mutation_p.E1481Q	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1433					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCAAGAACAGGAGGAAGAGGT	0.413													12	32	---	---	---	---	PASS
ANP32C	23520	broad.mit.edu	37	4	165118299	165118299	+	Missense_Mutation	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165118299C>G	uc011cjk.1	-	1	565	c.565G>C	c.(565-567)GAG>CAG	p.E189Q	MARCH1_uc003iqs.1_Intron	NM_012403	NP_036535	O43423	AN32C_HUMAN	acidic nuclear phosphoprotein 32C	189	Asp/Glu-rich (highly acidic).										0	all_hematologic(180;0.203)	Prostate(90;0.0138)|Melanoma(52;0.18)|all_neural(102;0.223)		KIRC - Kidney renal clear cell carcinoma(143;0.242)		tcctcctcctcctcgccctcc	0.219													12	11	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19473819	19473819	+	Missense_Mutation	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19473819A>T	uc003jgc.2	-	12	2266	c.1889T>A	c.(1888-1890)GTG>GAG	p.V630E	CDH18_uc003jgd.2_Missense_Mutation_p.V630E|CDH18_uc011cnm.1_3'UTR	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	630	Helical; (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					AAAAAGTACCACAATTGCTGA	0.413													60	272	---	---	---	---	PASS
FBXL17	64839	broad.mit.edu	37	5	107521909	107521909	+	Missense_Mutation	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:107521909C>T	uc011cvc.1	-	6	2061	c.1654G>A	c.(1654-1656)GAA>AAA	p.E552K	FBXL17_uc003kon.3_Missense_Mutation_p.E154K	NM_001163315	NP_001156787	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17	552											0		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		TTATCCAGTTCAGTGATATGA	0.358													10	23	---	---	---	---	PASS
KCNN2	3781	broad.mit.edu	37	5	113740225	113740225	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:113740225G>T	uc003kqo.2	+	3	1130	c.673G>T	c.(673-675)GCT>TCT	p.A225S		NM_021614	NP_067627	Q9H2S1	KCNN2_HUMAN	small conductance calcium-activated potassium	225	Helical; Name=Segment S3; (Potential).					integral to membrane	calmodulin binding|small conductance calcium-activated potassium channel activity			ovary(2)	2		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)		ACTGGTGTGTGCTATTCATCC	0.443													55	92	---	---	---	---	PASS
TIMD4	91937	broad.mit.edu	37	5	156346515	156346515	+	Missense_Mutation	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156346515C>G	uc003lwh.2	-	9	1147	c.1090G>C	c.(1090-1092)GAC>CAC	p.D364H	TIMD4_uc010jii.2_Missense_Mutation_p.D336H|TIMD4_uc003lwg.2_Missense_Mutation_p.D66H	NM_138379	NP_612388	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain	364	Cytoplasmic (Potential).					integral to membrane				ovary(2)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGCTGCACGTCATTGAGGACA	0.433													30	39	---	---	---	---	PASS
GPLD1	2822	broad.mit.edu	37	6	24448431	24448431	+	Silent	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24448431G>A	uc003ned.1	-	16	1563	c.1452C>T	c.(1450-1452)GCC>GCT	p.A484A	GPLD1_uc010jpr.1_Silent_p.A321A|GPLD1_uc010jps.1_Silent_p.A484A	NM_001503	NP_001494	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific	484	FG-GAP 2.					extracellular region	glycosylphosphatidylinositol phospholipase D activity			ovary(2)|kidney(1)	3						AGACATACACGGCACCCTAGA	0.433													4	52	---	---	---	---	PASS
C6orf15	29113	broad.mit.edu	37	6	31079488	31079488	+	Silent	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31079488C>A	uc003nsk.1	-	2	648	c.648G>T	c.(646-648)GTG>GTT	p.V216V		NM_014070	NP_054789	Q6UXA7	CF015_HUMAN	STG protein precursor	216											0						CTCCCCAGGACACACTGGGAT	0.607													14	41	---	---	---	---	PASS
LY6G6F	259215	broad.mit.edu	37	6	31675844	31675844	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31675844G>C	uc003nwa.1	+	3	579	c.579G>C	c.(577-579)AGG>AGC	p.R193S	BAT5_uc011dnz.1_Intron|LY6G6F_uc003nwb.1_Missense_Mutation_p.R193S	NM_001003693	NP_001003693	Q5SQ64	LY66F_HUMAN	G6f protein precursor	193	Extracellular (Potential).					integral to membrane|plasma membrane				breast(1)|central_nervous_system(1)	2						CTGAGCCCAGGAGCCGAAGAC	0.582													23	106	---	---	---	---	PASS
TAP1	6890	broad.mit.edu	37	6	32821269	32821269	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32821269G>C	uc003ocg.2	-	1	480	c.325C>G	c.(325-327)CCC>GCC	p.P109A	TAP1_uc011dqi.1_5'Flank|PSMB9_uc011dqj.1_5'Flank|PSMB9_uc003sga.2_5'Flank	NM_000593	NP_000584	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family	109	Lumenal (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I|cytosol to ER transport|intracellular transport of viral proteins in host cell|positive regulation of T cell mediated cytotoxicity	cytosol|plasma membrane|TAP complex	ADP binding|ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding			skin(1)	1						AGCGCGGTGGGCACCAGCAGG	0.711													7	33	---	---	---	---	PASS
VPS52	6293	broad.mit.edu	37	6	33232686	33232686	+	Intron	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33232686T>C	uc003odm.1	-						VPS52_uc003odn.1_Intron	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52						protein transport	endosome membrane|Golgi apparatus				ovary(4)|skin(1)	5						TTCTGTGTGATTGGGGAACAA	0.433													83	192	---	---	---	---	PASS
GPR110	266977	broad.mit.edu	37	6	46977383	46977383	+	Silent	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46977383G>A	uc003oyt.2	-	11	1987	c.1788C>T	c.(1786-1788)TCC>TCT	p.S596S	GPR110_uc011dwl.1_Silent_p.S284S	NM_153840	NP_722582	Q5T601	GP110_HUMAN	G-protein coupled receptor 110 isoform 1	596	Helical; Name=1; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(2)|pancreas(1)	3						GACTTCCAATGGAGATACCCA	0.433													19	33	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51503653	51503653	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51503653G>A	uc003pah.1	-	64	11776	c.11500C>T	c.(11500-11502)CCT>TCT	p.P3834S		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3834	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTACCTGGAGGAGAAGTGACA	0.368													30	114	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	70990699	70990699	+	Intron	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70990699C>A	uc003pfg.3	-						COL9A1_uc003pfe.3_5'Flank|COL9A1_uc003pff.3_Intron	NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor						axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						ATGCTCCAATCAACTTACCGG	0.577													8	40	---	---	---	---	PASS
NDUFAF4	29078	broad.mit.edu	37	6	97339162	97339162	+	Missense_Mutation	SNP	T	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97339162T>A	uc003pow.2	-	3	436	c.346A>T	c.(346-348)ATT>TTT	p.I116F	NDUFAF4_uc003pov.2_RNA	NM_014165	NP_054884	Q9P032	NDUF4_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	116					mitochondrial respiratory chain complex I assembly	mitochondrial membrane	calmodulin binding			ovary(1)	1						GCTTCTACAATGGAAATTTTG	0.373													15	36	---	---	---	---	PASS
AMD1	262	broad.mit.edu	37	6	111214269	111214269	+	Splice_Site	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:111214269G>A	uc003puk.1	+	8	1186	c.864_splice	c.e8+1	p.Q288_splice	AMD1_uc011eay.1_Splice_Site_p.Q219_splice|AMD1_uc011eaz.1_Splice_Site_p.Q259_splice|AMD1_uc011eba.1_Splice_Site_p.Q168_splice|AMD1_uc003pul.1_Splice_Site_p.Q140_splice	NM_001634	NP_001625	P17707	DCAM_HUMAN	adenosylmethionine decarboxylase 1 isoform 1						spermidine biosynthetic process|spermine biosynthetic process	cytosol	adenosylmethionine decarboxylase activity			upper_aerodigestive_tract(1)	1		all_cancers(87;3.83e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.0522)|Epithelial(106;0.111)|all cancers(137;0.143)	S-Adenosylmethionine(DB00118)	TGTTAATCAGGtaattttata	0.323													16	36	---	---	---	---	PASS
RFX6	222546	broad.mit.edu	37	6	117246638	117246638	+	Silent	SNP	T	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117246638T>A	uc003pxm.2	+	16	1764	c.1701T>A	c.(1699-1701)ACT>ACA	p.T567T		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	567					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						CTGCTTTCACTGCTTCTCCGA	0.418													40	108	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129468139	129468139	+	Silent	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129468139G>C	uc003qbn.2	+	6	960	c.855G>C	c.(853-855)GGG>GGC	p.G285G	LAMA2_uc003qbo.2_Silent_p.G285G	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	285	Laminin N-terminal.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CAGTTGGAGGGATGTGCATCT	0.433													60	148	---	---	---	---	PASS
SAMD3	154075	broad.mit.edu	37	6	130505655	130505655	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130505655G>C	uc003qbv.2	-	7	823	c.497C>G	c.(496-498)CCG>CGG	p.P166R	SAMD3_uc003qbx.2_Missense_Mutation_p.P166R|SAMD3_uc003qbw.2_Missense_Mutation_p.P166R|SAMD3_uc010kfg.1_Missense_Mutation_p.P166R|SAMD3_uc003qby.2_Missense_Mutation_p.P166R|SAMD3_uc003qbz.1_Missense_Mutation_p.P125R	NM_001017373	NP_001017373	Q8N6K7	SAMD3_HUMAN	sterile alpha motif domain containing 3 isoform	166										ovary(1)	1				GBM - Glioblastoma multiforme(226;0.00594)|OV - Ovarian serous cystadenocarcinoma(155;0.128)		GCTGTGATCCGGGCACTTCTG	0.458													21	55	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143094043	143094043	+	Silent	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143094043A>G	uc003qjd.2	-	5	2576	c.1833T>C	c.(1831-1833)CAT>CAC	p.H611H		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	611					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		ACATCCTGCCATGGTGCTCGA	0.542													81	115	---	---	---	---	PASS
TAGAP	117289	broad.mit.edu	37	6	159462507	159462507	+	Missense_Mutation	SNP	T	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159462507T>G	uc003qrz.2	-	6	688	c.356A>C	c.(355-357)GAA>GCA	p.E119A	TAGAP_uc011eft.1_Missense_Mutation_p.E56A|TAGAP_uc003qsa.2_5'UTR|TAGAP_uc003qsb.2_Missense_Mutation_p.E119A|uc003qsc.2_5'Flank	NM_054114	NP_473455	Q8N103	TAGAP_HUMAN	T-cell activation Rho GTPase-activating protein	119	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(1)	1		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GAATATCCCTTCCGTTGAAGG	0.498													11	41	---	---	---	---	PASS
FAM120B	84498	broad.mit.edu	37	6	170632160	170632160	+	Intron	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170632160C>G	uc003qxp.2	+						FAM120B_uc003qxo.1_Intron|FAM120B_uc011ehd.1_Intron	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B						cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		ATTTAAATTTCAAACAGGTTG	0.388													6	49	---	---	---	---	PASS
FERD3L	222894	broad.mit.edu	37	7	19184904	19184904	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19184904G>T	uc003suo.1	-	1	141	c.82C>A	c.(82-84)CCT>ACT	p.P28T	uc003sun.1_RNA	NM_152898	NP_690862	Q96RJ6	FER3L_HUMAN	nephew of atonal 3	28					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			large_intestine(1)	1						CAGAGGAGAGGGCGTCTCGGG	0.642													27	62	---	---	---	---	PASS
KBTBD2	25948	broad.mit.edu	37	7	32909450	32909450	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32909450G>T	uc003tdb.2	-	4	2038	c.1379C>A	c.(1378-1380)TCC>TAC	p.S460Y	AVL9_uc011kai.1_Intron	NM_015483	NP_056298	Q8IY47	KBTB2_HUMAN	kelch repeat and BTB (POZ) domain containing 2	460	Kelch 3.										0			GBM - Glioblastoma multiforme(11;0.0499)			TGAAGCAAAGGACCTACTAGT	0.428													10	85	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43484785	43484785	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43484785G>T	uc003tid.1	+	11	2619	c.2014G>T	c.(2014-2016)GGC>TGC	p.G672C	HECW1_uc011kbi.1_Missense_Mutation_p.G672C	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	672	Cys-rich.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						CAGTTGCGAGGGCTGTGACGC	0.687													22	39	---	---	---	---	PASS
POM121L12	285877	broad.mit.edu	37	7	53103631	53103631	+	Silent	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53103631G>A	uc003tpz.2	+	1	283	c.267G>A	c.(265-267)CCG>CCA	p.P89P		NM_182595	NP_872401	Q8N7R1	P1L12_HUMAN	POM121 membrane glycoprotein-like 12	89											0						CCGCCAAGCCGCAGCGGGTGG	0.697													8	22	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82581908	82581908	+	Silent	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82581908A>T	uc003uhx.2	-	5	8650	c.8361T>A	c.(8359-8361)CCT>CCA	p.P2787P	PCLO_uc003uhv.2_Silent_p.P2787P|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2718					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CCAGAGATACAGGAGTCACTA	0.428													18	62	---	---	---	---	PASS
CROT	54677	broad.mit.edu	37	7	87005150	87005150	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87005150G>C	uc003uit.2	+	9	1002	c.757G>C	c.(757-759)GAA>CAA	p.E253Q	CROT_uc003uiu.2_Missense_Mutation_p.E281Q	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN	peroxisomal carnitine O-octanoyltransferase	253					fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity			ovary(2)|lung(1)	3	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	TTAGGCACGAGAATATCTGAT	0.353													16	42	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88964013	88964013	+	Silent	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88964013T>C	uc011khi.1	+	4	2255	c.1717T>C	c.(1717-1719)TTG>CTG	p.L573L		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	573						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TGCAAATGATTTGGAAATGAA	0.353										HNSCC(36;0.09)			19	29	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103191531	103191531	+	Silent	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103191531C>T	uc003vca.2	-	41	6445	c.6285G>A	c.(6283-6285)GGG>GGA	p.G2095G	RELN_uc010liz.2_Silent_p.G2095G	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	2095					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		GGTGCAGCTTCCCAAAGTGCA	0.542													16	25	---	---	---	---	PASS
SLC26A4	5172	broad.mit.edu	37	7	107338519	107338519	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107338519G>T	uc003vep.2	+	14	1801	c.1577G>T	c.(1576-1578)AGC>ATC	p.S526I	SLC26A4_uc011kmb.1_Missense_Mutation_p.S113I|SLC26A4_uc011kmc.1_Missense_Mutation_p.S87I|SLC26A4_uc011kmd.1_Missense_Mutation_p.S95I	NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin	526	Cytoplasmic (Potential).				regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						AGCATCCCTAGCACAGATATC	0.378									Pendred_syndrome				7	50	---	---	---	---	PASS
FEZF1	389549	broad.mit.edu	37	7	121943744	121943744	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121943744G>A	uc003vkd.2	-	1	822	c.748C>T	c.(748-750)CGA>TGA	p.R250*	FEZF1_uc003vkc.2_Nonsense_Mutation_p.R200*|uc010lko.1_RNA|uc003vkf.1_5'Flank	NM_001024613	NP_001019784	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1 isoform 1	250					cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)	3						GGAGAGCCTCGGCTGAAATCC	0.438													20	159	---	---	---	---	PASS
ZNF425	155054	broad.mit.edu	37	7	148801944	148801944	+	Missense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148801944C>A	uc003wfj.2	-	4	1092	c.1019G>T	c.(1018-1020)CGC>CTC	p.R340L		NM_001001661	NP_001001661	Q6IV72	ZN425_HUMAN	zinc finger protein 425	340	C2H2-type 5.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			CCTCTTCAGGCGGAAGCACCG	0.662													15	48	---	---	---	---	PASS
ARHGEF10	9639	broad.mit.edu	37	8	1846692	1846692	+	Splice_Site	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1846692G>C	uc003wpr.2	+	15	1828	c.1650_splice	c.e15+1	p.Q550_splice	ARHGEF10_uc003wpq.1_Splice_Site_p.Q574_splice|ARHGEF10_uc003wps.2_Splice_Site_p.Q512_splice|ARHGEF10_uc003wpt.2_Splice_Site_p.Q426_splice|ARHGEF10_uc003wpv.2_Splice_Site_p.Q283_splice|ARHGEF10_uc010lre.2_Splice_Site_p.Q230_splice	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10						centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		CCTGCTCCAGGTAAGTGCTTC	0.572													9	22	---	---	---	---	PASS
TNKS	8658	broad.mit.edu	37	8	9623794	9623794	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9623794G>A	uc003wss.2	+	25	3604	c.3599G>A	c.(3598-3600)CGA>CAA	p.R1200Q	TNKS_uc011kww.1_Missense_Mutation_p.R963Q	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related	1200	PARP catalytic.				mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		TTTGATGAGCGACATGCATAC	0.383													37	91	---	---	---	---	PASS
SLC18A1	6570	broad.mit.edu	37	8	20036923	20036923	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20036923G>T	uc011kyq.1	-	4	668	c.197C>A	c.(196-198)GCC>GAC	p.A66D	SLC18A1_uc003wzm.2_Missense_Mutation_p.A66D|SLC18A1_uc011kyr.1_Missense_Mutation_p.A66D|SLC18A1_uc003wzn.2_Missense_Mutation_p.A66D|SLC18A1_uc010ltf.2_RNA|SLC18A1_uc003wzo.2_Missense_Mutation_p.A66D	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),	66	Lumenal, vesicle (Potential).				neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)		GGAACTTCCGGCATGGCCGAG	0.512													16	46	---	---	---	---	PASS
ELP3	55140	broad.mit.edu	37	8	27989839	27989839	+	Missense_Mutation	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27989839A>G	uc003xgo.3	+	9	972	c.824A>G	c.(823-825)AAA>AGA	p.K275R	ELP3_uc003xgn.3_Missense_Mutation_p.K260R|ELP3_uc011laq.1_Missense_Mutation_p.K203R|ELP3_uc011lar.1_Missense_Mutation_p.K183R|ELP3_uc011las.1_Missense_Mutation_p.K156R|ELP3_uc011lat.1_Missense_Mutation_p.K156R	NM_018091	NP_060561	Q9H9T3	ELP3_HUMAN	elongation protein 3 homolog	275					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	histone acetyltransferase activity|iron-sulfur cluster binding|metal ion binding|phosphorylase kinase regulator activity|protein binding				0		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		CACCTGGCCAAAGATTCCGGT	0.453													9	27	---	---	---	---	PASS
ADAM2	2515	broad.mit.edu	37	8	39602414	39602414	+	Splice_Site	SNP	T	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39602414T>A	uc003xnj.2	-	20	2250	c.2175_splice	c.e20-1	p.E725_splice	ADAM2_uc003xnk.2_Splice_Site_p.E706_splice|ADAM2_uc011lck.1_Splice_Site_p.E662_splice|ADAM2_uc003xnl.2_Splice_Site_p.E569_splice	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein						cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		TCAGGTTGCCTGCatattaaa	0.294													12	47	---	---	---	---	PASS
C8orf22	492307	broad.mit.edu	37	8	49986797	49986797	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49986797G>C	uc003xqq.3	+	4	321	c.138G>C	c.(136-138)TTG>TTC	p.L46F		NM_001007176	NP_001007177	Q8WWR9	PDPFL_HUMAN	hypothetical protein LOC492307	46											0		all_cancers(86;0.0452)|all_epithelial(80;0.000863)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				TAATAGGGTTGCCTGAAGTGG	0.333													14	25	---	---	---	---	PASS
TERF1	7013	broad.mit.edu	37	8	73926132	73926132	+	Missense_Mutation	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73926132A>G	uc003xzd.2	+	2	347	c.322A>G	c.(322-324)ATT>GTT	p.I108V	TERF1_uc003xzc.2_RNA|TERF1_uc003xze.2_Missense_Mutation_p.I108V	NM_017489	NP_059523	P54274	TERF1_HUMAN	telomeric repeat binding factor 1 isoform 1	108	TRFH dimerization.				age-dependent telomere shortening|cell division|G2/M transition of mitotic cell cycle|induction of apoptosis|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of telomere maintenance via semi-conservative replication|negative regulation of telomere maintenance via telomerase|positive regulation of microtubule polymerization|positive regulation of mitosis|positive regulation of mitotic cell cycle|protein homooligomerization|regulation of transcription, DNA-dependent|telomere maintenance via telomerase|telomere maintenance via telomerase|telomere maintenance via telomere shortening	chromosome, telomeric region|cytoplasm|nuclear telomere cap complex|nucleoplasm|nucleus|spindle	caspase activator activity|DNA bending activity|double-stranded telomeric DNA binding|identical protein binding|microtubule binding|protein heterodimerization activity|protein homodimerization activity|telomerase inhibitor activity|telomeric DNA binding			ovary(1)|lung(1)|skin(1)	3	Breast(64;0.218)		Epithelial(68;0.0984)			TTTTTTAGCTATTATTCATGG	0.323													6	19	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87591048	87591048	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87591048G>T	uc003ydx.2	-	17	2018	c.1972C>A	c.(1972-1974)CCA>ACA	p.P658T	CNGB3_uc010maj.2_Missense_Mutation_p.P515T	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	658	Cytoplasmic (Potential).|cGMP (By similarity).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						TCTTTTCTTGGAGGGGTTGCT	0.458													29	78	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113304884	113304884	+	Silent	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113304884C>A	uc003ynu.2	-	55	8829	c.8670G>T	c.(8668-8670)GGG>GGT	p.G2890G	CSMD3_uc003yns.2_Silent_p.G2092G|CSMD3_uc003ynt.2_Silent_p.G2850G|CSMD3_uc011lhx.1_Silent_p.G2721G	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2890	Extracellular (Potential).|Sushi 19.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TAAAGTTGAACCCATTTCCAC	0.448										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			29	67	---	---	---	---	PASS
COLEC10	10584	broad.mit.edu	37	8	120103468	120103468	+	Intron	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120103468C>T	uc003yoo.2	+							NM_006438	NP_006429	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 precursor							collagen|cytoplasm	mannose binding			ovary(2)|skin(1)	3	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			GGGTAAGTTGCATCTTACTAT	0.284													19	42	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143560803	143560803	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143560803G>A	uc003ywm.2	+	7	1864	c.1681G>A	c.(1681-1683)GGC>AGC	p.G561S		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	561	Extracellular (Potential).|TSP type-1 5.				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					AGCCTGCCAGGGCCCCCAGGA	0.711													5	11	---	---	---	---	PASS
TEK	7010	broad.mit.edu	37	9	27229204	27229204	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27229204G>C	uc003zqi.3	+	23	3791	c.3349G>C	c.(3349-3351)GAC>CAC	p.D1117H	TEK_uc011lno.1_Missense_Mutation_p.D1074H|TEK_uc011lnp.1_Missense_Mutation_p.D969H	NM_000459	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial precursor	1117	Cytoplasmic (Potential).				angiogenesis|blood coagulation|cell-cell signaling|leukocyte migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein kinase B signaling cascade|protein oligomerization|transmembrane receptor protein tyrosine kinase signaling pathway	apical plasma membrane|basolateral plasma membrane|cell surface|integral to plasma membrane|membrane raft|microvillus	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			ovary(3)|central_nervous_system(3)|breast(3)|lung(2)|kidney(1)	12		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)		TGCAGGAATTGACTGTTCTGC	0.458													41	64	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90502148	90502148	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90502148G>T	uc004app.3	+	4	2781	c.2746G>T	c.(2746-2748)GTG>TTG	p.V916L	C9orf79_uc004apo.1_Missense_Mutation_p.V728L	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	916						integral to membrane				ovary(3)	3						AGTCCCGACCGTGAGTGGCCC	0.587													9	51	---	---	---	---	PASS
TRIM14	9830	broad.mit.edu	37	9	100881413	100881413	+	Missense_Mutation	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100881413A>G	uc004ayd.2	-	1	76	c.58T>C	c.(58-60)TGC>CGC	p.C20R	TRIM14_uc004ayf.1_5'UTR|TRIM14_uc004ayg.1_Missense_Mutation_p.C20R|TRIM14_uc004ayh.1_Missense_Mutation_p.C20R|TRIM14_uc004ayi.1_Missense_Mutation_p.C20R|TRIM14_uc004ayj.1_5'UTR	NM_033220	NP_150089	Q14142	TRI14_HUMAN	tripartite motif protein TRIM14 isoform alpha	20	B box-type.					cytoplasm|intracellular	zinc ion binding			central_nervous_system(1)	1		Acute lymphoblastic leukemia(62;0.0559)				CGCCAGCCGCATCCCTCGACA	0.746													9	25	---	---	---	---	PASS
PPAPDC3	84814	broad.mit.edu	37	9	134183301	134183301	+	Intron	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134183301C>T	uc004cal.2	+							NM_032728	NP_116117	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain							endoplasmic reticulum membrane|integral to membrane|nuclear envelope	hydrolase activity			breast(1)	1	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		CTCTGTCTCCCCCCAACAGCC	0.517													8	19	---	---	---	---	PASS
SURF2	6835	broad.mit.edu	37	9	136226846	136226846	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136226846G>T	uc004cdi.2	+	4	406	c.358G>T	c.(358-360)GGG>TGG	p.G120W		NM_017503	NP_059973	Q15527	SURF2_HUMAN	surfeit 2	120							protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;4.87e-07)|Epithelial(140;4.02e-06)|all cancers(34;3.71e-05)		TCAGAAGCAAGGGGTGGAGTA	0.637													5	23	---	---	---	---	PASS
ATP5C1	509	broad.mit.edu	37	10	7844746	7844746	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7844746G>C	uc001iju.2	+	8	897	c.819G>C	c.(817-819)TTG>TTC	p.L273F	ATP5C1_uc009xiq.1_Missense_Mutation_p.L273F|ATP5C1_uc010qbc.1_Missense_Mutation_p.L224F|ATP5C1_uc001ijv.2_Missense_Mutation_p.L273F	NM_001001973	NP_001001973	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1	273					oxidative phosphorylation|respiratory electron transport chain	mitochondrial matrix|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1)	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0						AATTGACATTGACATTCAACC	0.368													23	71	---	---	---	---	PASS
ST8SIA6	338596	broad.mit.edu	37	10	17432531	17432531	+	Missense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17432531C>A	uc001ipd.2	-	3	289	c.289G>T	c.(289-291)GGG>TGG	p.G97W	ST8SIA6_uc010qce.1_RNA|uc001ipe.2_Intron|uc001ipf.1_Intron	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide	97	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						AGAACTTACCCTTTCGTTTTG	0.363													14	114	---	---	---	---	PASS
SPAG6	9576	broad.mit.edu	37	10	22653832	22653832	+	Missense_Mutation	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22653832C>G	uc001iri.2	+	3	314	c.172C>G	c.(172-174)CAA>GAA	p.Q58E	SPAG6_uc001irj.2_Missense_Mutation_p.Q58E|SPAG6_uc010qct.1_Missense_Mutation_p.Q28E|SPAG6_uc009xkh.2_Missense_Mutation_p.Q36E	NM_012443	NP_036575	O75602	SPAG6_HUMAN	sperm associated antigen 6 isoform 1	58	ARM 1.				cell projection organization|spermatid development	axoneme|cilium|cytoplasm|flagellum|microtubule	binding			breast(1)	1						CCCAACAATTCAACAGACTGC	0.393													16	52	---	---	---	---	PASS
BMS1	9790	broad.mit.edu	37	10	43318687	43318687	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43318687G>T	uc001jaj.2	+	20	3612	c.3254G>T	c.(3253-3255)AGC>ATC	p.S1085I		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	1085					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3						TTCAGGGCCAGCTTTGAGGAT	0.517													31	83	---	---	---	---	PASS
GDF10	2662	broad.mit.edu	37	10	48429451	48429451	+	Silent	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48429451C>T	uc001jfb.2	-	2	891	c.435G>A	c.(433-435)GCG>GCA	p.A145A	GDF10_uc009xnp.2_Silent_p.A144A|GDF10_uc009xnq.1_Silent_p.A145A	NM_004962	NP_004953	P55107	BMP3B_HUMAN	growth differentiation factor 10 precursor	145					growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity			lung(1)|central_nervous_system(1)	2						GCACCTCGAGCGCTCGAGGCC	0.632													9	21	---	---	---	---	PASS
C10orf27	219793	broad.mit.edu	37	10	72531216	72531216	+	Silent	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72531216C>T	uc001jrj.1	-	11	1362	c.972G>A	c.(970-972)GAG>GAA	p.E324E	C10orf27_uc010qjm.1_Silent_p.E325E|C10orf27_uc009xqh.1_RNA|C10orf27_uc010qjn.1_Silent_p.E323E	NM_152710	NP_689923	Q96M53	SPATL_HUMAN	stromal protein associated with thymii and lymph	324					cell differentiation|multicellular organismal development|spermatogenesis	cytosol				skin(1)	1						CTCCAATGTACTCTAGTGGGA	0.582													14	109	---	---	---	---	PASS
TTC18	118491	broad.mit.edu	37	10	75036992	75036992	+	Intron	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75036992T>C	uc009xrc.2	-						TTC18_uc001jty.2_Intron|TTC18_uc001jtv.3_Intron|TTC18_uc001jtw.3_Intron|TTC18_uc001jtx.2_Intron	NM_145170	NP_660153	Q5T0N1	TTC18_HUMAN	tetratricopeptide repeat domain 18								binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)					TTCCAAATACTCTGACCTGCA	0.388													11	89	---	---	---	---	PASS
TTC18	118491	broad.mit.edu	37	10	75036993	75036993	+	Intron	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75036993C>T	uc009xrc.2	-						TTC18_uc001jty.2_Intron|TTC18_uc001jtv.3_Intron|TTC18_uc001jtw.3_Intron|TTC18_uc001jtx.2_Intron	NM_145170	NP_660153	Q5T0N1	TTC18_HUMAN	tetratricopeptide repeat domain 18								binding			ovary(2)|central_nervous_system(1)	3	Prostate(51;0.0119)					TCCAAATACTCTGACCTGCAC	0.393													11	91	---	---	---	---	PASS
TMEM20	159371	broad.mit.edu	37	10	95660927	95660927	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95660927G>A	uc001kjg.1	+	3	839	c.778G>A	c.(778-780)GTA>ATA	p.V260I	TMEM20_uc001kji.2_Intron|TMEM20_uc001kjf.1_Missense_Mutation_p.V259I|TMEM20_uc001kjh.2_Intron|TMEM20_uc010qnw.1_Missense_Mutation_p.V243I|TMEM20_uc001kjj.2_Intron	NM_001134658	NP_001128130	Q2M3R5	TMM20_HUMAN	transmembrane protein 20 isoform 1	260	DUF6 2.|Helical; (Potential).					integral to membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;3.46e-05)|Renal(717;0.018)|Ovarian(717;0.0228)|all_hematologic(284;0.189)		STAD - Stomach adenocarcinoma(243;0.00345)		GTATTATGTAGTACTTGGCCT	0.433													21	106	---	---	---	---	PASS
SFRP5	6425	broad.mit.edu	37	10	99527577	99527577	+	Silent	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99527577C>T	uc001kor.3	-	3	814	c.648G>A	c.(646-648)GGG>GGA	p.G216G		NM_003015	NP_003006	Q5T4F7	SFRP5_HUMAN	secreted frizzled-related protein 5 precursor	216	NTR.				apoptosis|brain development|cell differentiation|embryo development|establishment or maintenance of cell polarity|gonad development|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of protein kinase B signaling cascade|negative regulation of sequence-specific DNA binding transcription factor activity|vasculature development|visual perception	cytoplasm|extracellular space|plasma membrane	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(1)	1		Colorectal(252;0.234)		Epithelial(162;4.98e-10)|all cancers(201;3.58e-08)		GCTTCCGGTCCCCATTCTCTA	0.542													31	84	---	---	---	---	PASS
GPAM	57678	broad.mit.edu	37	10	113915650	113915650	+	Silent	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113915650G>T	uc009xxy.1	-	20	2481	c.2283C>A	c.(2281-2283)ACC>ACA	p.T761T	GPAM_uc001kzp.2_Silent_p.T761T|GPAM_uc001kzq.1_3'UTR	NM_020918	NP_065969	Q9HCL2	GPAT1_HUMAN	mitochondrial glycerol 3-phosphate	761	Mitochondrial intermembrane (Potential).|Mitochondrial intermembrane (Potential).				phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity			ovary(1)|skin(1)	2				Epithelial(162;0.0306)|all cancers(201;0.123)		TTTCTGTTCTGGTTATTAGGT	0.348													7	44	---	---	---	---	PASS
PTPRE	5791	broad.mit.edu	37	10	129875936	129875936	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129875936G>T	uc001lkb.2	+	19	2060	c.1781G>T	c.(1780-1782)GGC>GTC	p.G594V	PTPRE_uc009yat.2_Missense_Mutation_p.G605V|PTPRE_uc009yau.2_Missense_Mutation_p.G594V|PTPRE_uc001lkd.2_Missense_Mutation_p.G536V|PTPRE_uc010quq.1_Missense_Mutation_p.G495V	NM_006504	NP_006495	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	594	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				negative regulation of insulin receptor signaling pathway|protein phosphorylation	cytoplasm|integral to membrane|intermediate filament cytoskeleton|nucleus|plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(1)	1		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)				CACTTCCACGGCTGGCCTGAG	0.662													15	36	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1268821	1268821	+	Missense_Mutation	SNP	T	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1268821T>A	uc009ycr.1	+	50	12421	c.12295T>A	c.(12295-12297)TGT>AGT	p.C4099S	MUC5B_uc001ltb.2_Missense_Mutation_p.C3574S	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3571	7 X Cys-rich subdomain repeats.|Cys-rich subdomain 6.|Thr-rich.|HAT 2.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GACCACGGGCTGTGAGCCCCA	0.667													20	48	---	---	---	---	PASS
CARS	833	broad.mit.edu	37	11	3047975	3047975	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3047975C>A	uc001lxh.2	-	9	909	c.835G>T	c.(835-837)GAG>TAG	p.E279*	CARS_uc001lxe.2_Nonsense_Mutation_p.E269*|CARS_uc001lxf.2_Nonsense_Mutation_p.E362*|CARS_uc001lxg.2_Nonsense_Mutation_p.E279*|CARS_uc010qxo.1_Nonsense_Mutation_p.E362*|CARS_uc010qxp.1_Nonsense_Mutation_p.E292*|uc001lxi.1_5'Flank	NM_001751	NP_001742	P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase isoform b	279					cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding		CARS/ALK(5)	soft_tissue(5)|ovary(2)	7		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	GAGTGCTTCTCGCTAGAAGCA	0.517			T	ALK	ALCL								43	89	---	---	---	---	PASS
ANO5	203859	broad.mit.edu	37	11	22261155	22261155	+	Missense_Mutation	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22261155A>G	uc001mqi.2	+	9	1120	c.803A>G	c.(802-804)AAT>AGT	p.N268S	ANO5_uc001mqj.2_Missense_Mutation_p.N267S	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	268	Cytoplasmic (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						AATCCTACCAATGAAAGATAC	0.408													36	113	---	---	---	---	PASS
LGR4	55366	broad.mit.edu	37	11	27390517	27390517	+	Silent	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27390517A>G	uc001mrj.3	-	18	2238	c.1753T>C	c.(1753-1755)TTA>CTA	p.L585L	LGR4_uc001mrk.3_Silent_p.L561L	NM_018490	NP_060960	Q9BXB1	LGR4_HUMAN	leucine-rich repeat-containing G protein-coupled	585	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			ovary(1)	1						CCCATGAATAAGTTAGACACA	0.403													25	45	---	---	---	---	PASS
ACCSL	390110	broad.mit.edu	37	11	44072937	44072937	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44072937C>T	uc001mxw.1	+	4	744	c.688C>T	c.(688-690)CGA>TGA	p.R230*	ACCSL_uc009ykr.2_Nonsense_Mutation_p.R49*	NM_001031854	NP_001027025	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase	230							1-aminocyclopropane-1-carboxylate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(5)	5						GGCACCTACCCGACTTGACCC	0.572													21	60	---	---	---	---	PASS
SLC35C1	55343	broad.mit.edu	37	11	45832694	45832694	+	Silent	SNP	G	T	T	rs150743224		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45832694G>T	uc001nbp.2	+	2	1615	c.903G>T	c.(901-903)ACG>ACT	p.T301T	SLC35C1_uc001nbo.2_Silent_p.T288T|SLC35C1_uc010rgm.1_Silent_p.T288T	NM_018389	NP_060859	Q96A29	FUCT1_HUMAN	GDP-fucose transporter 1 isoform a	301						Golgi membrane|integral to membrane	GDP-fucose transmembrane transporter activity				0				GBM - Glioblastoma multiforme(35;0.227)		TGTCGGGCACGGCCAAGGCCT	0.607													23	57	---	---	---	---	PASS
OR5L1	219437	broad.mit.edu	37	11	55579417	55579417	+	Missense_Mutation	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55579417C>T	uc001nhw.1	+	1	475	c.475C>T	c.(475-477)CAT>TAT	p.H159Y		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	159	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)				TTCTCTGATTCATTTGTGCTT	0.443													11	194	---	---	---	---	PASS
OR5D18	219438	broad.mit.edu	37	11	55587891	55587891	+	Silent	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587891G>T	uc010rin.1	+	1	786	c.786G>T	c.(784-786)GTG>GTT	p.V262V		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	262	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				TTTACTGTGTGCCCAACTCCA	0.527													22	58	---	---	---	---	PASS
MYEOV	26579	broad.mit.edu	37	11	69062910	69062910	+	Missense_Mutation	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69062910C>T	uc001oov.2	+	2	539	c.89C>T	c.(88-90)TCC>TTC	p.S30F	MYEOV_uc001oox.2_Intron|MYEOV_uc009ysl.2_Missense_Mutation_p.S30F|MYEOV_uc001oow.2_5'UTR	NM_138768	NP_620123	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	30											0	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		cagtctccctcctggtgtcAT	0.264													32	101	---	---	---	---	PASS
P4HA3	283208	broad.mit.edu	37	11	74000142	74000142	+	Silent	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74000142G>T	uc001ouz.2	-	5	794	c.751C>A	c.(751-753)CGG>AGG	p.R251R	P4HA3_uc001ouy.3_RNA|P4HA3_uc010rrj.1_Silent_p.R251R	NM_182904	NP_878907	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha III subunit	251	TPR.					endoplasmic reticulum lumen	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			skin(1)	1	Breast(11;2.31e-05)					agaaactcccgagagaggctg	0.244													5	4	---	---	---	---	PASS
USP35	57558	broad.mit.edu	37	11	77920699	77920699	+	Missense_Mutation	SNP	T	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77920699T>G	uc009yva.1	+	10	2044	c.1798T>G	c.(1798-1800)TTC>GTC	p.F600V	USP35_uc001oze.2_Missense_Mutation_p.F356V|USP35_uc001ozc.2_Missense_Mutation_p.F168V|USP35_uc010rsp.1_Missense_Mutation_p.F32V|USP35_uc001ozd.2_Missense_Mutation_p.F211V|USP35_uc001ozf.2_Missense_Mutation_p.F331V	NM_020798	NP_065849	Q9P2H5	UBP35_HUMAN	ubiquitin specific protease 35	600					ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)	3	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CTCTCTCGCCTTCCCTCCTCC	0.622													31	94	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	120984356	120984356	+	Missense_Mutation	SNP	A	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120984356A>C	uc010rzo.1	+	5	719	c.719A>C	c.(718-720)AAT>ACT	p.N240T		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	240	NIDO.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		ACAAACGTCAATGTTCCAGGC	0.512													14	35	---	---	---	---	PASS
TULP3	7289	broad.mit.edu	37	12	3031460	3031460	+	Missense_Mutation	SNP	G	T	T	rs148720872		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3031460G>T	uc010seh.1	+	4	367	c.286G>T	c.(286-288)GAC>TAC	p.D96Y	TULP3_uc010sef.1_RNA|TULP3_uc009zec.1_5'UTR|TULP3_uc010seg.1_RNA|TULP3_uc001qlj.2_Missense_Mutation_p.D96Y|TULP3_uc010sei.1_5'UTR	NM_003324	NP_003315	O75386	TULP3_HUMAN	tubby like protein 3 isoform 1	96					G-protein coupled receptor protein signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|extracellular region|nucleus|plasma membrane	phosphatidylinositol-4,5-bisphosphate binding				0			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CCTGAAACCAGACGAAGTTCA	0.438													38	132	---	---	---	---	PASS
GNB3	2784	broad.mit.edu	37	12	6950762	6950762	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6950762G>C	uc001qrd.2	+	4	475	c.70G>C	c.(70-72)GCC>CCC	p.A24P	GNB3_uc001qrc.2_5'UTR|GNB3_uc009zfe.2_Missense_Mutation_p.A24P	NM_002075	NP_002066	P16520	GBB3_HUMAN	guanine nucleotide-binding protein, beta-3	24					cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of blood pressure|synaptic transmission	plasma membrane	GTPase activity|GTPase binding|signal transducer activity				0						TGCCAGGAAAGCCTGTGCTGA	0.652													5	32	---	---	---	---	PASS
RIMKLB	57494	broad.mit.edu	37	12	8906573	8906573	+	Missense_Mutation	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8906573A>T	uc001quu.2	+	5	832	c.581A>T	c.(580-582)AAG>ATG	p.K194M	RIMKLB_uc009zgf.1_RNA|RIMKLB_uc001qux.2_Missense_Mutation_p.K194M|RIMKLB_uc010sgl.1_Missense_Mutation_p.K194M|RIMKLB_uc001quw.2_Missense_Mutation_p.K194M	NM_020734	NP_065785	Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family	194	ATP-grasp.|ATP (By similarity).				protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						CTGTTCCAGAAGTATGTTAAA	0.458													21	53	---	---	---	---	PASS
PIK3C2G	5288	broad.mit.edu	37	12	18691193	18691193	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18691193G>T	uc001rdt.2	+	24	3420	c.3304G>T	c.(3304-3306)GCT>TCT	p.A1102S	PIK3C2G_uc010sia.1_RNA|PIK3C2G_uc010sib.1_Missense_Mutation_p.A1143S|PIK3C2G_uc010sic.1_Missense_Mutation_p.A921S	NM_004570	NP_004561	O75747	P3C2G_HUMAN	phosphoinositide-3-kinase, class 2 gamma	1102	PI3K/PI4K.				cell communication|phosphatidylinositol-mediated signaling	membrane|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(8)|central_nervous_system(6)|breast(3)|stomach(2)|ovary(2)	21		Hepatocellular(102;0.194)				TTGCTGTCGTGCTTATAATAT	0.373													18	44	---	---	---	---	PASS
LST-3TM12	338821	broad.mit.edu	37	12	21207463	21207463	+	Silent	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21207463A>T	uc010sin.1	+	10	1434	c.1434A>T	c.(1432-1434)CCA>CCT	p.P478P	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Silent_p.P525P	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	478						membrane	transporter activity				0						GTGAATGCCCAAGAGATGATG	0.368													17	30	---	---	---	---	PASS
TROAP	10024	broad.mit.edu	37	12	49725031	49725031	+	Silent	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49725031G>A	uc001rtx.3	+	14	2300	c.2133G>A	c.(2131-2133)CTG>CTA	p.L711L	TROAP_uc009zlh.2_Silent_p.L801L|TROAP_uc001rty.2_Silent_p.L390L	NM_005480	NP_005471	Q12815	TROAP_HUMAN	tastin isoform 1	711					cell adhesion	cytoplasm				ovary(1)	1						CCCTAGCCCTGAGGGAGCGCC	0.577													17	53	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80651718	80651718	+	IGR	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80651718G>A								PPP1R12A (322483 upstream) : PTPRQ (186408 downstream)																							GCTTACTAGCGCATGGAAAAG	0.328													13	21	---	---	---	---	PASS
RFX4	5992	broad.mit.edu	37	12	107103138	107103138	+	Silent	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107103138G>A	uc001tlr.2	+	9	930	c.864G>A	c.(862-864)AAG>AAA	p.K288K	RFX4_uc010swv.1_RNA|RFX4_uc001tls.2_Silent_p.K297K|RFX4_uc001tlt.2_Silent_p.K297K|RFX4_uc001tlv.2_Silent_p.K194K	NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c	288					transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1						AGTTTGCCAAGCAACTGGATG	0.473													16	32	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116675334	116675334	+	Silent	SNP	T	C	C	rs138672862		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116675334T>C	uc001tvw.2	-	2	304	c.249A>G	c.(247-249)TTA>TTG	p.L83L		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	83					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		AGAATATCCATAACTCTTTGC	0.413													24	81	---	---	---	---	PASS
CRYL1	51084	broad.mit.edu	37	13	20978773	20978773	+	Splice_Site	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20978773C>A	uc001une.2	-	7	925	c.846_splice	c.e7+1	p.Q282_splice	CRYL1_uc001unf.2_Splice_Site_p.Q260_splice|CRYL1_uc001ung.2_Splice_Site_p.Q260_splice	NM_015974	NP_057058	Q9Y2S2	CRYL1_HUMAN	lambda-crystallin						fatty acid metabolic process	cytosol	3-hydroxyacyl-CoA dehydrogenase activity|L-gulonate 3-dehydrogenase activity|NAD+ binding|protein homodimerization activity				0		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		AAGTTACATACCTGGTTAACC	0.532													35	79	---	---	---	---	PASS
SACS	26278	broad.mit.edu	37	13	23906282	23906282	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23906282G>T	uc001uon.2	-	10	12322	c.11733C>A	c.(11731-11733)AGC>AGA	p.S3911R	SACS_uc001uoo.2_Missense_Mutation_p.S3764R|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	3911					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TACCATCCTGGCTTGGGAGGT	0.438													44	74	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32937315	32937315	+	Splice_Site	SNP	G	A	A	rs81002874		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32937315G>A	uc001uub.1	+	18	8204	c.7977_splice	c.e18-1	p.R2659_splice		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset						cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTCACTTTTAGATATGATACG	0.328			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			14	24	---	---	---	---	PASS
SIAH3	283514	broad.mit.edu	37	13	46357979	46357979	+	Missense_Mutation	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46357979C>T	uc001vap.2	-	2	431	c.349G>A	c.(349-351)GAA>AAA	p.E117K		NM_198849	NP_942146	Q8IW03	SIAH3_HUMAN	seven in absentia homolog 3	117	SIAH-type; degenerate.				multicellular organismal development|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding			ovary(1)|skin(1)	2						AGGCGGCCTTCCCACTGGCAG	0.562													25	56	---	---	---	---	PASS
RB1	5925	broad.mit.edu	37	13	48881481	48881481	+	Missense_Mutation	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48881481A>G	uc001vcb.2	+	2	369	c.203A>G	c.(202-204)GAT>GGT	p.D68G	RB1_uc010acs.1_Intron	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	68					androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.0?(13)|p.?(3)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AAGATACCAGATCATGTCAGA	0.313		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			13	43	---	---	---	---	PASS
ERCC5	2073	broad.mit.edu	37	13	103504584	103504584	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103504584C>T	uc001vpw.2	+	2	648	c.205C>T	c.(205-207)CGA>TGA	p.R69*	ERCC5_uc001vpu.1_Nonsense_Mutation_p.R523*|ERCC5_uc010tjb.1_Nonsense_Mutation_p.R69*|ERCC5_uc010tjc.1_RNA|ERCC5_uc010tjd.1_5'UTR	NM_000123	NP_000114	P28715	ERCC5_HUMAN	XPG-complementing protein	69	N-domain.				negative regulation of apoptosis|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|response to UV-C|transcription-coupled nucleotide-excision repair|UV protection	nucleoplasm	bubble DNA binding|double-stranded DNA binding|endodeoxyribonuclease activity|metal ion binding|protein homodimerization activity|protein N-terminus binding|single-stranded DNA binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CTTATTTTTTCGAATTCGTCC	0.373			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				6	64	---	---	---	---	PASS
COCH	1690	broad.mit.edu	37	14	31349801	31349801	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31349801G>C	uc001wqr.2	+	8	570	c.490G>C	c.(490-492)GCA>CCA	p.A164P	COCH_uc001wqp.2_Missense_Mutation_p.A164P|COCH_uc001wqq.3_Missense_Mutation_p.A164P|uc001wqs.2_Intron|COCH_uc001wqt.1_5'UTR	NM_004086	NP_004077	O43405	COCH_HUMAN	cochlin precursor	164					sensory perception of sound	proteinaceous extracellular matrix				pancreas(1)|central_nervous_system(1)|skin(1)	3	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		AGATTGTAAAGCAGACATTGC	0.413													50	44	---	---	---	---	PASS
C14orf104	55172	broad.mit.edu	37	14	50101477	50101477	+	Missense_Mutation	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50101477A>T	uc001wws.3	-	1	472	c.391T>A	c.(391-393)TAC>AAC	p.Y131N	SDCCAG1_uc010anj.1_Intron|C14orf104_uc001wwt.3_Missense_Mutation_p.Y131N	NM_018139	NP_060609	Q9NVR5	KTU_HUMAN	kintoun isoform 1	131					axonemal dynein complex assembly|ciliary cell motility|flagellar cell motility	cytoplasm					0	all_epithelial(31;0.0021)|Breast(41;0.0124)					CGCCCCGCGTACTCGCGGCCG	0.746									Kartagener_syndrome				6	6	---	---	---	---	PASS
NAA30	122830	broad.mit.edu	37	14	57858325	57858325	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57858325G>C	uc001xcx.3	+	2	804	c.650G>C	c.(649-651)CGA>CCA	p.R217P	NAA30_uc010trk.1_Intron|NAA30_uc010aow.2_Intron	NM_001011713	NP_001011713	Q147X3	NAA30_HUMAN	N-acetyltransferase 12	217	N-acetyltransferase.					cytoplasm	peptide alpha-N-acetyltransferase activity			skin(1)	1						CGATATGTCCGATATGAATCC	0.507													94	90	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64681149	64681149	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64681149G>A	uc001xgm.2	+	106	19524	c.19294G>A	c.(19294-19296)GAA>AAA	p.E6432K	SYNE2_uc001xgl.2_Missense_Mutation_p.E6432K|SYNE2_uc010apy.2_Missense_Mutation_p.E2817K|SYNE2_uc001xgn.2_Missense_Mutation_p.E1394K|SYNE2_uc001xgo.2_RNA|SYNE2_uc010aqa.2_Missense_Mutation_p.E402K|SYNE2_uc001xgq.2_Missense_Mutation_p.E797K|SYNE2_uc001xgr.2_Missense_Mutation_p.E215K|SYNE2_uc010tsi.1_Missense_Mutation_p.E66K|SYNE2_uc001xgs.2_Missense_Mutation_p.E66K|SYNE2_uc001xgt.2_5'Flank	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6432	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CTCCTCTCACGAAGAGGACGA	0.627													26	22	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68238912	68238912	+	Missense_Mutation	SNP	T	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68238912T>A	uc001xka.2	-	28	5475	c.5336A>T	c.(5335-5337)CAT>CTT	p.H1779L	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.H1779L	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1779					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		ACTAGGGGAATGTATACTGGA	0.428													3	4	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68256124	68256124	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68256124G>A	uc001xka.2	-	16	3086	c.2947C>T	c.(2947-2949)CAG>TAG	p.Q983*	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Nonsense_Mutation_p.Q983*	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	983					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TTCCAGAGCTGGCACTGAGAG	0.557													6	92	---	---	---	---	PASS
ZFYVE26	23503	broad.mit.edu	37	14	68256132	68256132	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68256132G>C	uc001xka.2	-	16	3078	c.2939C>G	c.(2938-2940)TCT>TGT	p.S980C	ZFYVE26_uc010tsz.1_RNA|ZFYVE26_uc001xkc.3_Missense_Mutation_p.S980C	NM_015346	NP_056161	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	980					cell cycle|cell death|cytokinesis|double-strand break repair via homologous recombination	centrosome|midbody	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			ovary(9)|breast(2)	11				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CTGGCACTGAGAGCAAGCTAG	0.547													8	89	---	---	---	---	PASS
STON2	85439	broad.mit.edu	37	14	81744567	81744567	+	Missense_Mutation	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81744567T>C	uc010tvu.1	-	4	1289	c.1088A>G	c.(1087-1089)TAC>TGC	p.Y363C	STON2_uc001xvk.1_Missense_Mutation_p.Y363C|STON2_uc010tvt.1_Missense_Mutation_p.Y160C	NM_033104	NP_149095	Q8WXE9	STON2_HUMAN	stonin 2	363					endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			skin(3)|pancreas(2)	5				BRCA - Breast invasive adenocarcinoma(234;0.0348)		GGCATCCTGGTAGATGACAAT	0.448													63	58	---	---	---	---	PASS
C14orf49	161176	broad.mit.edu	37	14	95932315	95932315	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95932315G>A	uc001yei.3	-	3	595	c.580C>T	c.(580-582)CAG>TAG	p.Q194*	C14orf49_uc010avi.2_Nonsense_Mutation_p.Q194*|C14orf49_uc001yej.1_Nonsense_Mutation_p.Q194*	NM_152592	NP_689805	Q6ZMZ3	SYNE3_HUMAN	nesprin-3	194	Cytoplasmic (Potential).				cytoskeletal anchoring at nuclear membrane	integral to membrane|nuclear outer membrane|SUN-KASH complex	actin binding			central_nervous_system(1)	1		all_cancers(154;0.0937)		COAD - Colon adenocarcinoma(157;0.245)		ATTCTCTTCTGGGCATCTTCG	0.552													42	61	---	---	---	---	PASS
WDR25	79446	broad.mit.edu	37	14	100950396	100950396	+	Missense_Mutation	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100950396C>T	uc010avx.2	+	4	1129	c.1036C>T	c.(1036-1038)CAC>TAC	p.H346Y	WDR25_uc001yhm.2_Missense_Mutation_p.H338Y|WDR25_uc001yhn.2_Missense_Mutation_p.H346Y|WDR25_uc010avy.2_RNA|WDR25_uc001yho.2_Missense_Mutation_p.H89Y	NM_001161476	NP_001154948	Q64LD2	WDR25_HUMAN	WD repeat domain 25	346	WD 3.										0		Melanoma(154;0.212)				TCCAAAAGACCACAACATCTT	0.408													44	86	---	---	---	---	PASS
MKRN3	7681	broad.mit.edu	37	15	23811400	23811400	+	Silent	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23811400G>C	uc001ywh.3	+	1	947	c.471G>C	c.(469-471)GCG>GCC	p.A157A	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Silent_p.A157A	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	157						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		AGGAAGTGGCGGAAGCCCCCC	0.642													18	47	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25328735	25328735	+	Intron	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25328735G>T	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|IPW_uc001yyb.3_Intron|SNORD116-19_uc001yyc.2_RNA|uc001yyd.2_5'Flank|SNORD116-18_uc010ayk.2_5'Flank|SNORD116-19_uc001yye.1_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						TAATGTGCATGGATCGATGAT	0.438													31	77	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	25427577	25427577	+	Intron	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25427577A>T	uc001yyy.1	+						uc001yza.1_5'Flank|SNORD115-7_uc001yyw.1_RNA|SNORD115-7_uc001yyz.2_RNA					Homo sapiens clone Rt-7 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																		GTGATAACTTAAAAATCATGC	0.527													67	215	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28460816	28460816	+	Missense_Mutation	SNP	T	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28460816T>G	uc001zbj.2	-	39	6267	c.6161A>C	c.(6160-6162)AAG>ACG	p.K2054T		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	2054					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTCCACGACCTTCATGAGCAG	0.632													14	31	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31339311	31339311	+	Intron	SNP	T	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31339311T>A	uc001zfm.2	-						TRPM1_uc010azy.2_Intron|TRPM1_uc001zfl.2_Intron	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,						cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CACTGAGTTCTACCCTCTTTG	0.532													30	104	---	---	---	---	PASS
GREM1	26585	broad.mit.edu	37	15	33023077	33023077	+	Missense_Mutation	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33023077A>T	uc001zhe.1	+	2	345	c.186A>T	c.(184-186)CAA>CAT	p.Q62H	GREM1_uc001zhd.1_Intron|GREM1_uc010uby.1_Intron	NM_013372	NP_037504	O60565	GREM1_HUMAN	gremlin-1 precursor	62					negative regulation of BMP signaling pathway|nervous system development|regulation of epithelial to mesenchymal transition	extracellular space	cytokine activity				0		all_lung(180;1.49e-09)		all cancers(64;2.97e-18)|Epithelial(43;3.15e-12)|GBM - Glioblastoma multiforme(186;2.32e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0107)		GGCGGGGCCAAGGGCGGGGCA	0.662													12	43	---	---	---	---	PASS
CAPN3	825	broad.mit.edu	37	15	42678366	42678366	+	Silent	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42678366G>T	uc001zpn.1	+	3	687	c.381G>T	c.(379-381)GGG>GGT	p.G127G	CAPN3_uc001zpk.1_5'UTR|CAPN3_uc001zpl.1_Silent_p.G40G|CAPN3_uc010udf.1_Silent_p.G40G|CAPN3_uc010udg.1_Silent_p.G40G|CAPN3_uc001zpo.1_Silent_p.G127G|CAPN3_uc001zpp.1_Silent_p.G127G	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a	127	Calpain catalytic.				muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		TGCCTGCAGGGGACTGCTGGT	0.562											OREG0023085	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	46	106	---	---	---	---	PASS
CAPN3	825	broad.mit.edu	37	15	42678367	42678367	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42678367G>T	uc001zpn.1	+	3	688	c.382G>T	c.(382-384)GAC>TAC	p.D128Y	CAPN3_uc001zpk.1_5'UTR|CAPN3_uc001zpl.1_Missense_Mutation_p.D41Y|CAPN3_uc010udf.1_Missense_Mutation_p.D41Y|CAPN3_uc010udg.1_Missense_Mutation_p.D41Y|CAPN3_uc001zpo.1_Missense_Mutation_p.D128Y|CAPN3_uc001zpp.1_Missense_Mutation_p.D128Y	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a	128	Calpain catalytic.				muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		GCCTGCAGGGGACTGCTGGTT	0.567											OREG0023085	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	45	105	---	---	---	---	PASS
LCMT2	9836	broad.mit.edu	37	15	43622200	43622200	+	Missense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43622200C>A	uc001zrg.2	-	1	692	c.488G>T	c.(487-489)CGG>CTG	p.R163L	LCMT2_uc010udn.1_Intron|ADAL_uc001zrh.2_5'Flank|ADAL_uc010udo.1_5'Flank	NM_014793	NP_055608	O60294	LCMT2_HUMAN	leucine carboxyl methyltransferase 2	163					tRNA processing		methyltransferase activity|protein binding				0		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	CTGGAGCTGCCGCAAGTCCAG	0.697													33	47	---	---	---	---	PASS
SPG11	80208	broad.mit.edu	37	15	44888526	44888526	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44888526G>T	uc001ztx.2	-	25	4220	c.4189C>A	c.(4189-4191)CCA>ACA	p.P1397T	SPG11_uc010ueh.1_Missense_Mutation_p.P1397T|SPG11_uc010uei.1_Missense_Mutation_p.P1397T|SPG11_uc001zty.1_Missense_Mutation_p.P126T	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1	1397	Cytoplasmic (Potential).				cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TGAATGACTGGGCTGAAGTAC	0.453													19	64	---	---	---	---	PASS
SPG11	80208	broad.mit.edu	37	15	44888527	44888527	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44888527G>T	uc001ztx.2	-	25	4219	c.4188C>A	c.(4186-4188)AGC>AGA	p.S1396R	SPG11_uc010ueh.1_Missense_Mutation_p.S1396R|SPG11_uc010uei.1_Missense_Mutation_p.S1396R|SPG11_uc001zty.1_Missense_Mutation_p.S125R	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1	1396	Cytoplasmic (Potential).				cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		GAATGACTGGGCTGAAGTACT	0.453													18	63	---	---	---	---	PASS
NARG2	79664	broad.mit.edu	37	15	60768275	60768275	+	Missense_Mutation	SNP	C	A	A	rs145938558		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60768275C>A	uc002agp.2	-	3	368	c.133G>T	c.(133-135)GTT>TTT	p.V45F	NARG2_uc002ago.2_5'UTR|NARG2_uc010bgk.2_Missense_Mutation_p.V45F|NARG2_uc002agr.1_Missense_Mutation_p.V45F	NM_024611	NP_078887	Q659A1	NARG2_HUMAN	NMDA receptor regulated 2 isoform a	45						nucleus				ovary(1)|lung(1)	2						TTGGATAAAACACGTAGTTCT	0.313													10	31	---	---	---	---	PASS
NOX5	79400	broad.mit.edu	37	15	69349038	69349038	+	3'UTR	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69349038C>A	uc002ars.1	+	16					NOX5_uc002arp.1_3'UTR|NOX5_uc002arq.1_3'UTR|NOX5_uc010bid.1_3'UTR|NOX5_uc002arr.1_3'UTR|NOX5_uc010bie.1_3'UTR|NOX5_uc010bif.1_RNA	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5						angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2						AATTTCTAGCCTCACCTCTCC	0.527													20	26	---	---	---	---	PASS
HCN4	10021	broad.mit.edu	37	15	73616427	73616427	+	Intron	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73616427C>T	uc002avp.2	-							NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic						blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)		CCCTCCCCCTCACCAATGCGG	0.657													34	58	---	---	---	---	PASS
FAM154B	283726	broad.mit.edu	37	15	82574477	82574477	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82574477G>A	uc002bgv.2	+	3	340	c.271G>A	c.(271-273)GAC>AAC	p.D91N	FAM154B_uc010unr.1_Missense_Mutation_p.D76N|FAM154B_uc010uns.1_RNA	NM_001008226	NP_001008227	Q658L1	F154B_HUMAN	hypothetical protein LOC283726	91										skin(2)	2						TAGAGCTTGGGACCTTCATAA	0.328													38	77	---	---	---	---	PASS
OR4F15	390649	broad.mit.edu	37	15	102358599	102358599	+	Silent	SNP	T	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102358599T>C	uc010uts.1	+	1	210	c.210T>C	c.(208-210)GAT>GAC	p.D70D		NM_001001674	NP_001001674	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			CAATCATTGATATGGCATTTT	0.423													65	246	---	---	---	---	PASS
MYH11	4629	broad.mit.edu	37	16	15818093	15818093	+	Missense_Mutation	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15818093G>T	uc002ddy.2	-	31	4397	c.4290C>A	c.(4288-4290)GAC>GAA	p.D1430E	MYH11_uc002ddv.2_Missense_Mutation_p.D1437E|MYH11_uc002ddw.2_Missense_Mutation_p.D1430E|MYH11_uc002ddx.2_Missense_Mutation_p.D1437E|MYH11_uc010bvg.2_Missense_Mutation_p.D1262E|NDE1_uc010uzy.1_Silent_p.S331S|NDE1_uc002dds.2_Silent_p.S331S|MYH11_uc010bvh.2_Missense_Mutation_p.D136E|NDE1_uc002ddz.1_RNA	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	1430	Potential.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						CAACCAGGTCGTCCAGCTCCT	0.537			T	CBFB	AML								14	64	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20974654	20974654	+	Missense_Mutation	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20974654A>G	uc010vbe.1	-	53	10552	c.10552T>C	c.(10552-10554)TGT>CGT	p.C3518R	DNAH3_uc010vbd.1_Missense_Mutation_p.C953R	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3518	AAA 6 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		AAAGGCGCACAGCAGCTGGAA	0.517													17	47	---	---	---	---	PASS
SEPT1	1731	broad.mit.edu	37	16	30392759	30392759	+	Missense_Mutation	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30392759A>G	uc002dxy.2	-	6	528	c.341T>C	c.(340-342)TTT>TCT	p.F114S	SEPT1_uc002dxw.2_5'Flank|SEPT1_uc002dxx.2_5'UTR|SEPT1_uc010veq.1_Missense_Mutation_p.F161S	NM_052838	NP_443070	Q8WYJ6	SEPT1_HUMAN	septin 1	114					cell cycle|cell division	microtubule organizing center|septin complex	GTP binding|protein binding			ovary(1)	1			Colorectal(24;0.193)			GTACTGCTCAAATTGCTCCTC	0.587													44	101	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49670404	49670404	+	Missense_Mutation	SNP	C	A	A	rs147413663		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49670404C>A	uc002efs.2	-	5	2957	c.2659G>T	c.(2659-2661)GGC>TGC	p.G887C	ZNF423_uc010vgn.1_Missense_Mutation_p.G770C	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	887	C2H2-type 21; degenerate.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				ATGTCACAGCCGTACATGGGC	0.627													16	65	---	---	---	---	PASS
IRX3	79191	broad.mit.edu	37	16	54318159	54318159	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54318159G>A	uc002eht.1	-	3	1866	c.1450C>T	c.(1450-1452)CGG>TGG	p.R484W		NM_024336	NP_077312	P78415	IRX3_HUMAN	iroquois homeobox 3	484					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GTTTCTTACCGCCTGGGCACG	0.617													6	23	---	---	---	---	PASS
MT1H	4496	broad.mit.edu	37	16	56704808	56704808	+	Splice_Site	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56704808A>T	uc002ejw.2	+	3	166	c.95_splice	c.e3-2	p.S32_splice	MT1G_uc002eju.1_5'Flank|MT1G_uc002ejv.1_5'Flank	NM_005951	NP_005942	P80294	MT1H_HUMAN	metallothionein 1H								metal ion binding|protein binding				0						CTTTTTCCCCAGGCTGCTGCT	0.622													22	99	---	---	---	---	PASS
MT1H	4496	broad.mit.edu	37	16	56704809	56704809	+	Splice_Site	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56704809G>T	uc002ejw.2	+	3	166	c.95_splice	c.e3-1	p.S32_splice	MT1G_uc002eju.1_5'Flank|MT1G_uc002ejv.1_5'Flank	NM_005951	NP_005942	P80294	MT1H_HUMAN	metallothionein 1H								metal ion binding|protein binding				0						TTTTTCCCCAGGCTGCTGCTC	0.617													22	101	---	---	---	---	PASS
PLEKHG4	25894	broad.mit.edu	37	16	67316121	67316121	+	Silent	SNP	A	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67316121A>T	uc002eso.3	+	8	3657	c.1122A>T	c.(1120-1122)CTA>CTT	p.L374L	PLEKHG4_uc002esp.3_Silent_p.L181L|PLEKHG4_uc002esq.3_Silent_p.L374L|PLEKHG4_uc010cef.2_Silent_p.L374L|PLEKHG4_uc002ess.3_Silent_p.L374L|PLEKHG4_uc010ceg.2_Silent_p.L293L	NM_015432	NP_056247	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G	374					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)|pancreas(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		GTCAGCTGCTACAGCAGACAG	0.602													27	85	---	---	---	---	PASS
PARD6A	50855	broad.mit.edu	37	16	67695950	67695950	+	Missense_Mutation	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67695950C>G	uc002ett.2	+	3	532	c.441C>G	c.(439-441)GAC>GAG	p.D147E	ACD_uc002etp.3_5'Flank|ACD_uc002etq.3_5'Flank|ACD_uc002etr.3_5'Flank|ACD_uc010vjt.1_5'Flank|PARD6A_uc002ets.2_Missense_Mutation_p.D146E|PARD6A_uc002etu.2_5'UTR	NM_016948	NP_058644	Q9NPB6	PAR6A_HUMAN	par-6 partitioning defective 6 homolog alpha	147	Pseudo-CRIB.|Interaction with PARD3 and CDC42 (By similarity).				cell cycle|cell division|cell-cell junction maintenance|tight junction assembly|viral reproduction	cytosol|nucleus|ruffle|tight junction	GTP-dependent protein binding|Rho GTPase binding|transcription factor binding			ovary(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		CAGTCATAGACGTGGACCTAC	0.627													14	58	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577609	7577609	+	Splice_Site	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577609C>A	uc002gim.2	-	7	867	c.673_splice	c.e7-1	p.V225_splice	TP53_uc002gig.1_Splice_Site_p.V225_splice|TP53_uc002gih.2_Splice_Site_p.V225_splice|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Splice_Site_p.V93_splice|TP53_uc010cng.1_Splice_Site_p.V93_splice|TP53_uc002gii.1_Splice_Site_p.V93_splice|TP53_uc010cnh.1_Splice_Site_p.V225_splice|TP53_uc010cni.1_Splice_Site_p.V225_splice|TP53_uc002gij.2_Splice_Site_p.V225_splice|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a						activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.?(12)|p.0?(7)|p.V225fs*24(1)|p.E224_V225insXX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CAGAGCCAACCTAGGAGATAA	0.488		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			34	21	---	---	---	---	PASS
ALOX15B	247	broad.mit.edu	37	17	7950907	7950907	+	Silent	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7950907G>T	uc002gju.2	+	12	1721	c.1605G>T	c.(1603-1605)CGG>CGT	p.R535R	ALOX15B_uc002gjv.2_Silent_p.R506R|ALOX15B_uc002gjw.2_Silent_p.R461R|ALOX15B_uc010vun.1_Silent_p.R523R|ALOX15B_uc010cnp.2_Silent_p.R341R	NM_001141	NP_001132	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, second type	535	Lipoxygenase.				induction of apoptosis|leukotriene biosynthetic process|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of growth|prostate gland development|regulation of epithelial cell differentiation	cytoplasm	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			ovary(1)	1						TGGAGACCCGGGAAGCCCTGG	0.632													7	6	---	---	---	---	PASS
NEK8	284086	broad.mit.edu	37	17	27064993	27064993	+	Missense_Mutation	SNP	G	T	T	rs140363905	byFrequency	TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27064993G>T	uc002hcp.2	+	7	1046	c.1046G>T	c.(1045-1047)CGC>CTC	p.R349L		NM_178170	NP_835464	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	349	RCC1 1.					cytoplasm|primary cilium	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|pancreas(1)|liver(1)|skin(1)	6	Lung NSC(42;0.0158)					GGCGTCACGCGCTCTGGGCGT	0.701													19	50	---	---	---	---	PASS
PIP4K2B	8396	broad.mit.edu	37	17	36940564	36940564	+	Missense_Mutation	SNP	T	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36940564T>G	uc002hqs.2	-	3	767	c.286A>C	c.(286-288)AAG>CAG	p.K96Q	PIP4K2B_uc010wdt.1_Missense_Mutation_p.K96Q|PIP4K2B_uc010wdu.1_Missense_Mutation_p.K32Q	NM_003559	NP_003550	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	96	PIPK.				cell surface receptor linked signaling pathway	endoplasmic reticulum membrane|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|receptor signaling protein activity			ovary(1)	1						CAATACTCCTTAAACTTAAAG	0.433													14	34	---	---	---	---	PASS
UNK	85451	broad.mit.edu	37	17	73780747	73780747	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73780747G>A	uc002jpm.2	+	1	67	c.67G>A	c.(67-69)GAT>AAT	p.D23N	UNK_uc002jpn.2_5'Flank|UNK_uc002jpo.2_5'Flank	NM_001080419	NP_001073888	Q9C0B0	UNK_HUMAN	zinc finger CCCH-type domain containing 5	Error:Variant_position_missing_in_Q9C0B0_after_alignment							nucleic acid binding|zinc ion binding				0			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			TAGCAGCAAGGATCCCTGGGT	0.562													4	14	---	---	---	---	PASS
AATK	9625	broad.mit.edu	37	17	79101378	79101378	+	Intron	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79101378C>G	uc010dia.2	-						MIR657_hsa-mir-657|MI0003681_5'Flank|uc010wuj.1_5'Flank|MIR338_hsa-mir-338|MI0000814_5'Flank	NM_001080395	NP_001073864	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase							integral to membrane|mitochondrion|perinuclear region of cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(4)|ovary(2)|lung(2)|upper_aerodigestive_tract(1)	9	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CGGGCAGCAGCTCACCAGTGG	0.687													3	11	---	---	---	---	PASS
MYOM1	8736	broad.mit.edu	37	18	3100308	3100308	+	Intron	SNP	T	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3100308T>G	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						TGCACTGATTTTAAACTTACC	0.358													8	19	---	---	---	---	PASS
TTR	7276	broad.mit.edu	37	18	29172998	29172998	+	Intron	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29172998C>T	uc002kwx.3	+							NM_000371	NP_000362	P02766	TTHY_HUMAN	transthyretin precursor						transport	cytoplasm	hormone activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(10;0.00523)		Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diflunisal(DB00861)|Dimethyl sulfoxide(DB01093)|Levothyroxine(DB00451)|Liothyronine(DB00279)	GGGTAAGTTGCCAAAGAACCC	0.502													24	54	---	---	---	---	PASS
C19orf26	255057	broad.mit.edu	37	19	1235847	1235847	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1235847G>A	uc002lrm.2	-	3	433	c.158C>T	c.(157-159)ACG>ATG	p.T53M		NM_152769	NP_689982	Q8N350	DOS_HUMAN	downstream of Stk11	53	Helical; (Potential).					integral to membrane					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCACCAGCGTGCCCCCCAC	0.677										HNSCC(14;0.022)			38	70	---	---	---	---	PASS
CD209	30835	broad.mit.edu	37	19	7812232	7812232	+	Silent	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7812232G>A	uc002mht.2	-	2	133	c.66C>T	c.(64-66)GGC>GGT	p.G22G	CD209_uc010xju.1_Silent_p.G22G|CD209_uc010dvp.2_Silent_p.G22G|CD209_uc002mhr.2_Silent_p.G22G|CD209_uc002mhs.2_Silent_p.G22G|CD209_uc002mhu.2_Silent_p.G22G|CD209_uc010dvq.2_Silent_p.G22G|CD209_uc002mhq.2_Silent_p.G22G|CD209_uc002mhv.2_Silent_p.G22G|CD209_uc002mhx.2_Intron|CD209_uc002mhw.2_Intron|CD209_uc010dvr.2_Silent_p.G22G	NM_021155	NP_066978	Q9NNX6	CD209_HUMAN	CD209 molecule isoform 1	22	Cytoplasmic (Probable).				cell-cell recognition|endocytosis|heterophilic cell-cell adhesion|innate immune response|intracellular signal transduction|intracellular virion transport|leukocyte cell-cell adhesion|peptide antigen transport|viral genome replication|virion attachment to host cell surface receptor	cytoplasm|extracellular region|integral to membrane|plasma membrane	mannose binding|metal ion binding|peptide antigen binding|receptor activity|virion binding			skin(1)	1						GGAATCCAAGGCCTCTCAGCT	0.443													133	416	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9084935	9084935	+	Missense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9084935C>A	uc002mkp.2	-	1	7084	c.6880G>T	c.(6880-6882)GAT>TAT	p.D2294Y		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	2294	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CTCATCCAATCCCCAGGAATA	0.458													8	15	---	---	---	---	PASS
DAND5	199699	broad.mit.edu	37	19	13084218	13084218	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13084218G>A	uc002mwc.1	+	2	383	c.340G>A	c.(340-342)GGC>AGC	p.G114S	DAND5_uc010dyz.1_3'UTR	NM_152654	NP_689867	Q8N907	DAND5_HUMAN	dante precursor	114	CTCK.					extracellular region				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(19;1.87e-18)			CTCCCGGCCCGGCTGCTCAGC	0.617													29	81	---	---	---	---	PASS
CYP4F2	8529	broad.mit.edu	37	19	16006308	16006308	+	Intron	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16006308G>C	uc002nbs.1	-						CYP4F2_uc010xot.1_Intron|CYP4F2_uc010xou.1_Intron	NM_001082	NP_001073	P78329	CP4F2_HUMAN	cytochrome P450, family 4, subfamily F,						leukotriene metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	alkane 1-monooxygenase activity|electron carrier activity|heme binding|leukotriene-B4 20-monooxygenase activity|oxygen binding|protein binding			ovary(1)|skin(1)	2						AGCTGTTCCAGATGGTACCTG	0.597													68	191	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17122287	17122287	+	Missense_Mutation	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17122287G>A	uc002nfb.2	-	5	646	c.614C>T	c.(613-615)CCT>CTT	p.P205L		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	158						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						CTCGTTGACAGGCCTCAGATT	0.572													40	101	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38949782	38949782	+	Intron	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38949782G>T	uc002oit.2	+						RYR1_uc002oiu.2_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	GGTGACTGATGCAGGACACGT	0.577													13	59	---	---	---	---	PASS
CAPN12	147968	broad.mit.edu	37	19	39230753	39230753	+	Missense_Mutation	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39230753C>T	uc002ojd.1	-	5	976	c.667G>A	c.(667-669)GGG>AGG	p.G223R		NM_144691	NP_653292	Q6ZSI9	CAN12_HUMAN	calpain 12	223	Calpain catalytic.				proteolysis	intracellular	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			GAGAACAGCCCCATGCTGTTT	0.627													16	32	---	---	---	---	PASS
LGALS14	56891	broad.mit.edu	37	19	40199883	40199883	+	Missense_Mutation	SNP	C	A	A	rs141177809	by1000genomes	TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40199883C>A	uc002omg.2	+	4	573	c.350C>A	c.(349-351)CCG>CAG	p.P117Q	LGALS14_uc002omf.2_Missense_Mutation_p.P146Q	NM_020129	NP_064514	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14 isoform	117	Galectin.					nucleus	sugar binding			ovary(1)|skin(1)	2	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)			CATCGATTCCCGCCAGCATCT	0.463													11	40	---	---	---	---	PASS
MEGF8	1954	broad.mit.edu	37	19	42880163	42880163	+	Missense_Mutation	SNP	G	T	T	rs148860986		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42880163G>T	uc002otl.3	+	41	8208	c.7573G>T	c.(7573-7575)GTG>TTG	p.V2525L	MEGF8_uc002otm.3_Missense_Mutation_p.V2133L|MEGF8_uc002otn.3_Missense_Mutation_p.V186L	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2592	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				GGTCCGCGGCGTGCGGGACCG	0.692													8	52	---	---	---	---	PASS
GRWD1	83743	broad.mit.edu	37	19	48953722	48953722	+	Missense_Mutation	SNP	C	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48953722C>G	uc002pjd.2	+	4	854	c.621C>G	c.(619-621)ATC>ATG	p.I207M		NM_031485	NP_113673	Q9BQ67	GRWD1_HUMAN	glutamate-rich WD repeat containing 1	207						nucleolus				ovary(1)	1		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000206)|all cancers(93;0.000207)|Epithelial(262;0.0125)|GBM - Glioblastoma multiforme(486;0.0222)		TGAAGCCCATCTTCTCCTTCG	0.667													32	85	---	---	---	---	PASS
PIH1D1	55011	broad.mit.edu	37	19	49949859	49949859	+	Silent	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49949859C>A	uc002pns.2	-	8	1064	c.780G>T	c.(778-780)CCG>CCT	p.P260P	uc002pnr.1_5'Flank	NM_017916	NP_060386	Q9NWS0	PIHD1_HUMAN	NOP17	260					box C/D snoRNP assembly	pre-snoRNP complex					0		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		TGATCTGCAGCGGGATATAAG	0.627													34	101	---	---	---	---	PASS
LILRB4	11006	broad.mit.edu	37	19	55179347	55179347	+	Silent	SNP	G	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55179347G>A	uc002qgp.2	+	12	1586	c.1224G>A	c.(1222-1224)CAG>CAA	p.Q408Q	LILRB4_uc002qgq.2_Silent_p.Q407Q|LILRB4_uc002qgr.2_Silent_p.Q450Q|LILRB4_uc010ert.2_Silent_p.Q449Q|LILRB4_uc010eru.2_Silent_p.Q438Q	NM_006847	NP_006838	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor,	408	Cytoplasmic (Potential).					integral to membrane|plasma membrane	antigen binding|receptor activity			ovary(3)	3				GBM - Glioblastoma multiforme(193;0.035)		AAGCCCCCCAGGATGTGACCT	0.642													32	88	---	---	---	---	PASS
ZNF544	27300	broad.mit.edu	37	19	58772270	58772270	+	Missense_Mutation	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58772270A>G	uc010euo.2	+	7	772	c.298A>G	c.(298-300)AGG>GGG	p.R100G	ZNF544_uc010yhw.1_Intron|ZNF544_uc010yhx.1_Missense_Mutation_p.R72G|ZNF544_uc010yhy.1_Missense_Mutation_p.R72G|ZNF544_uc002qrt.3_5'UTR|ZNF544_uc002qru.3_5'UTR|uc002qrx.1_Intron	NM_014480	NP_055295	Q6NX49	ZN544_HUMAN	zinc finger protein 544	100					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		AGATCGAGCTAGGGAAGAACT	0.443													9	18	---	---	---	---	PASS
C20orf54	113278	broad.mit.edu	37	20	746322	746322	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:746322C>A	uc002wed.3	-	2	436	c.97G>T	c.(97-99)GAG>TAG	p.E33*	C20orf54_uc002wee.2_Nonsense_Mutation_p.E33*	NM_033409	NP_212134	Q9NQ40	RFT2_HUMAN	hypothetical protein LOC113278 precursor	33					sensory perception of sound	integral to plasma membrane	riboflavin transporter activity			ovary(2)	2						TCGGGCAGCTCCATCACCAGC	0.647													11	23	---	---	---	---	PASS
EPB41L1	2036	broad.mit.edu	37	20	34797497	34797497	+	Missense_Mutation	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34797497G>C	uc002xfb.2	+	15	1927	c.1756G>C	c.(1756-1758)GAC>CAC	p.D586H	EPB41L1_uc002xeu.2_Missense_Mutation_p.D512H|EPB41L1_uc010zvo.1_Missense_Mutation_p.D586H|EPB41L1_uc002xev.2_Missense_Mutation_p.D586H|EPB41L1_uc002xew.2_Missense_Mutation_p.D477H|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Intron|EPB41L1_uc002xez.2_Missense_Mutation_p.D512H|EPB41L1_uc010gfq.2_Missense_Mutation_p.D685H	NM_012156	NP_036288	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	586					cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)					TGAGGACCAGGACCAGGAGAG	0.607													15	36	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40049481	40049481	+	Missense_Mutation	SNP	C	A	A	rs113050531		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40049481C>A	uc002xka.1	-	31	5972	c.5794G>T	c.(5794-5796)GCT>TCT	p.A1932S		NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1932					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				GCTGCTGGAGCGGGGAAAGCC	0.498													50	106	---	---	---	---	PASS
MYBL2	4605	broad.mit.edu	37	20	42328597	42328597	+	Silent	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42328597G>T	uc002xlb.1	+	7	1079	c.864G>T	c.(862-864)CTG>CTT	p.L288L	MYBL2_uc010zwj.1_Silent_p.L264L|MYBL2_uc002xla.1_Silent_p.L288L	NM_002466	NP_002457	P10244	MYBB_HUMAN	MYB-related protein B	288						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AAACGAGCCTGCCTTACAAGT	0.582													21	29	---	---	---	---	PASS
MYBL2	4605	broad.mit.edu	37	20	42340250	42340250	+	Intron	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42340250G>T	uc002xlb.1	+						MYBL2_uc010zwj.1_Intron	NM_002466	NP_002457	P10244	MYBB_HUMAN	MYB-related protein B							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(3)|kidney(2)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GGGTGAGTAGGGTAGGGGTGG	0.617													7	18	---	---	---	---	PASS
KRTAP10-7	386675	broad.mit.edu	37	21	46020944	46020944	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46020944C>A	uc002zfn.3	+	2	433	c.408C>A	c.(406-408)TGC>TGA	p.C136*	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198689	NP_941962	P60409	KR107_HUMAN	keratin associated protein 10-7	141	9.|30 X 5 AA repeats of C-C-X(3).					keratin filament					0						CTTCATGCTGCCAGCAGTCTA	0.617													37	120	---	---	---	---	PASS
GSTT2	2953	broad.mit.edu	37	22	24323194	24323194	+	Silent	SNP	G	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24323194G>T	uc002zzb.3	+	2	243	c.168G>T	c.(166-168)ACG>ACT	p.T56T	DDT_uc002zza.3_5'Flank|GSTT2_uc002zzc.3_Silent_p.T56T	NM_000854	NP_000845	P0CG30	GSTT2_HUMAN	glutathione S-transferase theta 2	56	GST N-terminal.					cytoplasm	glutathione transferase activity				0						AACTGCCGACGCTCAAGGATG	0.557													22	172	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26688759	26688759	+	Missense_Mutation	SNP	C	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26688759C>A	uc003acb.2	+	2	638	c.482C>A	c.(481-483)ACG>AAG	p.T161K	SEZ6L_uc003acc.2_Missense_Mutation_p.T161K|SEZ6L_uc011akc.1_Missense_Mutation_p.T161K|SEZ6L_uc003acd.2_Missense_Mutation_p.T161K|SEZ6L_uc011akd.1_Missense_Mutation_p.T161K|SEZ6L_uc003ace.2_Missense_Mutation_p.T161K|SEZ6L_uc003acf.1_5'UTR|SEZ6L_uc010gvc.1_5'UTR	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	161	Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane		p.T161M(1)		ovary(4)|central_nervous_system(1)|pancreas(1)	6						TCCTCCTCCACGGAGAAGCCT	0.677													25	55	---	---	---	---	PASS
IL2RB	3560	broad.mit.edu	37	22	37539578	37539578	+	Silent	SNP	A	G	G			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37539578A>G	uc003aqv.1	-	3	317	c.186T>C	c.(184-186)CAT>CAC	p.H62H		NM_000878	NP_000869	P14784	IL2RB_HUMAN	interleukin 2 receptor beta precursor	62	Extracellular (Potential).				interspecies interaction between organisms|positive regulation of survival gene product expression|protein complex assembly	external side of plasma membrane|integral to plasma membrane	interleukin-2 receptor activity				0					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CCGGCCAGGCATGGACTTGGC	0.547													15	37	---	---	---	---	PASS
AR	367	broad.mit.edu	37	X	66766596	66766596	+	Silent	SNP	G	C	C			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66766596G>C	uc004dwu.1	+	1	2723	c.1608G>C	c.(1606-1608)GGG>GGC	p.G536G	AR_uc011mpd.1_Silent_p.G536G|AR_uc011mpe.1_RNA|AR_uc011mpf.1_Silent_p.G536G	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1	535	Modulating.				cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)	GACCTTACGGGGACATGCGGT	0.572									Androgen_Insensitivity_Syndrome				7	4	---	---	---	---	PASS
GLUD2	2747	broad.mit.edu	37	X	120181666	120181666	+	Missense_Mutation	SNP	C	T	T			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120181666C>T	uc004eto.2	+	1	205	c.128C>T	c.(127-129)CCG>CTG	p.P43L		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2 precursor	43					glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)	GCCTCGCAGCCGGGGCTCGCA	0.751													10	19	---	---	---	---	PASS
FAM183A	440585	broad.mit.edu	37	1	43613850	43613851	+	Intron	INS	-	A	A	rs142077481	by1000genomes	TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43613850_43613851insA	uc009vwo.2	+							NM_001101376	NP_001094846	A6NL82	F183A_HUMAN	hCG23177											ovary(3)	3						GCGGTCCCAGCAAAAACTCTTT	0.455													3	3	---	---	---	---	
ORC1L	4998	broad.mit.edu	37	1	52847236	52847236	+	Intron	DEL	A	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52847236delA	uc001ctt.2	-						ORC1L_uc010oni.1_Intron|ORC1L_uc001ctu.2_Intron|ORC1L_uc009vzd.2_Intron	NM_004153	NP_004144	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1						cell cycle checkpoint|DNA-dependent DNA replication initiation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle	cytosol|nuclear origin of replication recognition complex|nucleolus|nucleoplasm|plasma membrane	ATP binding|DNA binding|nucleoside-triphosphatase activity|protein binding				0						Acctcagagcaccagcatagg	0.264													6	5	---	---	---	---	
MRPL9	65005	broad.mit.edu	37	1	151732617	151732617	+	Frame_Shift_Del	DEL	A	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151732617delA	uc001eyv.2	-	7	798	c.713delT	c.(712-714)GTGfs	p.V238fs	MRPL9_uc009wmz.2_RNA	NM_031420	NP_113608	Q9BYD2	RM09_HUMAN	mitochondrial ribosomal protein L9 precursor	238					translation	mitochondrial ribosome	structural constituent of ribosome			ovary(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTCAAAGTTCACGACAGACAT	0.468													46	22	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237620129	237620130	+	Intron	INS	-	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237620129_237620130insA	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			gtaattccagcaatttgggagg	0.114													7	6	---	---	---	---	
BIRC6	57448	broad.mit.edu	37	2	32690254	32690254	+	Intron	DEL	T	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32690254delT	uc010ezu.2	+							NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6						anti-apoptosis|apoptosis	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					CTTTCttaaattttttttttt	0.333													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	139569394	139569405	+	IGR	DEL	CCTCCCTCCCTC	-	-	rs10201237		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139569394_139569405delCCTCCCTCCCTC								NXPH2 (31583 upstream) : None (None downstream)																							ttccttccttcctccctccctcccttccttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	223680424	223680424	+	IGR	DEL	G	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223680424delG								MOGAT1 (105775 upstream) : ACSL3 (45308 downstream)																							ctctgcctctgcctctgcctc	0.015													4	3	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	185867774	185867775	+	3'UTR	DEL	TG	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185867774_185867775delTG	uc003fqa.2	-	25					DGKG_uc003fqb.2_3'UTR|DGKG_uc003fqc.2_3'UTR|DGKG_uc011brx.1_3'UTR	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	AGAgtgtgtatgtgtgtgtgtg	0.366													4	2	---	---	---	---	
CLGN	1047	broad.mit.edu	37	4	141317098	141317098	+	Frame_Shift_Del	DEL	C	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141317098delC	uc011chi.1	-	11	1242	c.1024delG	c.(1024-1026)GAGfs	p.E342fs	CLGN_uc003iii.2_Frame_Shift_Del_p.E342fs	NM_001130675	NP_001124147	O14967	CLGN_HUMAN	calmegin precursor	342	Lumenal (Potential).|2-1.				protein folding	endoplasmic reticulum membrane|integral to membrane	calcium ion binding|unfolded protein binding			ovary(2)|skin(1)	3	all_hematologic(180;0.162)					TGAGGTGCCTCCCATTCTCCA	0.413													35	24	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32557588	32557589	+	5'Flank	INS	-	T	T	rs35683586		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32557588_32557589insT	uc003obk.3	-						HLA-DRB1_uc003obp.3_5'Flank	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						ACTATGAACCCCTCCACCCACA	0.520													4	2	---	---	---	---	
LRFN2	57497	broad.mit.edu	37	6	40360203	40360203	+	Frame_Shift_Del	DEL	G	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:40360203delG	uc003oph.1	-	3	2314	c.1849delC	c.(1849-1851)CGCfs	p.R617fs		NM_020737	NP_065788	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III	617	Cytoplasmic (Potential).					cell junction|integral to membrane|postsynaptic membrane				ovary(2)|skin(1)	3	Ovarian(28;0.0418)|Colorectal(47;0.196)					TCACTGGCGCGGGCCAGGCTG	0.756													4	2	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152685861	152685862	+	Intron	INS	-	AGGG	AGGG	rs9478327	by1000genomes	TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152685861_152685862insAGGG	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kja.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ggaaggaaggaagggaggaagg	0.158										HNSCC(10;0.0054)			7	4	---	---	---	---	
ELN	2006	broad.mit.edu	37	7	73456757	73456758	+	Intron	INS	-	A	A	rs141916734		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73456757_73456758insA	uc003tzw.2	+						RFC2_uc011kfa.1_Intron|ELN_uc003tzm.1_Intron|ELN_uc011kfe.1_Intron|ELN_uc003tzn.2_Intron|ELN_uc003tzz.2_Intron|ELN_uc003tzo.2_Intron|ELN_uc003tzp.2_Intron|ELN_uc003tzq.2_Intron|ELN_uc003tzr.2_Intron|ELN_uc003tzs.2_Intron|ELN_uc003tzt.2_Intron|ELN_uc003tzu.2_Intron|ELN_uc003tzv.2_Intron|ELN_uc003tzx.2_Intron|ELN_uc011kff.1_Intron|ELN_uc003tzy.2_Intron	NM_000501	NP_001075224	P15502	ELN_HUMAN	elastin isoform a precursor						blood circulation|cell proliferation|organ morphogenesis|respiratory gaseous exchange	proteinaceous extracellular matrix	extracellular matrix constituent conferring elasticity|protein binding			ovary(3)|pancreas(2)	5		Lung NSC(55;0.159)			Rofecoxib(DB00533)	gaccttgtgtcaaaaaaaaaaa	0.238			T	PAX5	B-ALL		Supravalvular Aortic Stenosis|Cutis laxa |Williams-Beuren Syndrome						4	3	---	---	---	---	
ST7	7982	broad.mit.edu	37	7	116590678	116590678	+	5'Flank	DEL	T	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116590678delT	uc003vin.2	+						ST7_uc011knl.1_5'Flank|ST7_uc003vio.2_5'Flank	NM_021908	NP_068708	Q9NRC1	ST7_HUMAN	suppression of tumorigenicity 7 isoform b							integral to membrane	binding			central_nervous_system(1)|skin(1)	2	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		ccttccttccttccttcctcc	0.080													4	2	---	---	---	---	
ZNF786	136051	broad.mit.edu	37	7	148771739	148771740	+	Intron	INS	-	A	A			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148771739_148771740insA	uc003wfh.2	-						ZNF786_uc011kuk.1_Intron|ZNF786_uc003wfi.2_Intron	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			AACAACATGTCAAAAAAAAAAA	0.376													4	3	---	---	---	---	
TMEM67	91147	broad.mit.edu	37	8	94822199	94822199	+	Intron	DEL	C	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94822199delC	uc011lgk.1	+						TMEM67_uc010maw.2_3'UTR|TMEM67_uc003yga.3_Intron|TMEM67_uc011lgl.1_Intron	NM_153704	NP_714915	Q5HYA8	MKS3_HUMAN	meckelin isoform 1						cilium assembly|ER-associated protein catabolic process|negative regulation of centrosome duplication	centrosome|cilium membrane|cytoplasmic vesicle membrane|endoplasmic reticulum membrane|integral to membrane|microtubule basal body	unfolded protein binding			ovary(2)	2	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			ttctttttttctttttttttt	0.129													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	116686698	116686699	+	IGR	INS	-	CCTC	CCTC	rs142743732	by1000genomes	TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116686698_116686699insCCTC								TRPS1 (5470 upstream) : EIF3H (970357 downstream)																							cttccttccttcctccctccct	0.124													5	8	---	---	---	---	
ZNF25	219749	broad.mit.edu	37	10	38245843	38245844	+	Intron	INS	-	A	A	rs145977445		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38245843_38245844insA	uc001ize.1	-						ZNF25_uc001izf.1_Intron	NM_145011	NP_659448	P17030	ZNF25_HUMAN	zinc finger protein 25						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)|central_nervous_system(1)	4		all_neural(218;0.0218)|Breast(68;0.0389)|Ovarian(717;0.0443)|Renal(717;0.157)				aactctgtttcaaaaaaaaaaa	0.168													8	6	---	---	---	---	
NPAT	4863	broad.mit.edu	37	11	108061063	108061065	+	Intron	DEL	AAG	-	-	rs71047681		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108061063_108061065delAAG	uc001pjz.3	-						NPAT_uc001pka.2_5'Flank	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus						positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		aaaaaaaaaaaagaaagaaaaaC	0.118													6	3	---	---	---	---	
OPCML	4978	broad.mit.edu	37	11	132307004	132307017	+	Intron	DEL	CCTGTTGGCAGGAA	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132307004_132307017delCCTGTTGGCAGGAA	uc001qgs.2	-						OPCML_uc001qgu.2_Intron|OPCML_uc010sck.1_Intron|OPCML_uc001qgt.2_Intron|OPCML_uc010scl.1_Intron	NM_002545	NP_002536	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GAAGTATTTTCCTGTTGGCAGGAACCTGGGTCCT	0.523													20	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	43072603	43072604	+	IGR	DEL	TT	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43072603_43072604delTT								PRICKLE1 (89031 upstream) : ADAMTS20 (675409 downstream)																							AGAACTCTGCtttttttttttt	0.416													3	4	---	---	---	---	
LOC283392	283392	broad.mit.edu	37	12	72666481	72666483	+	Intron	DEL	AAG	-	-	rs111457826		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72666481_72666483delAAG	uc010stv.1	-						TRHDE_uc001sxa.2_5'Flank	NR_026836				Homo sapiens thyrotropin-releasing hormone degrading enzyme, mRNA (cDNA clone IMAGE:4992272).												0						gaagaagaaaaagaagaggaaga	0.488													4	3	---	---	---	---	
C13orf18	80183	broad.mit.edu	37	13	46962441	46962444	+	5'Flank	DEL	GAAG	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46962441_46962444delGAAG	uc010acl.2	-						C13orf18_uc001vbf.3_5'Flank|C13orf18_uc001vbg.3_5'Flank|C13orf18_uc010tfz.1_5'Flank|C13orf18_uc010acm.2_5'Flank|C13orf18_uc010acn.2_5'Flank|C13orf18_uc001vbe.3_5'Flank|C13orf18_uc001vbh.3_Intron|C13orf18_uc001vbi.3_Intron	NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183												0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)		agggagggaagaaggaaggaagga	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20264514	20264514	+	IGR	DEL	C	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20264514delC								OR4M1 (15092 upstream) : OR4N2 (31094 downstream)																							ATAAAGATAGCAAACAACACA	0.348													73	71	---	---	---	---	
RBM25	58517	broad.mit.edu	37	14	73563904	73563905	+	Intron	INS	-	T	T	rs67768323		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73563904_73563905insT	uc001xno.2	+						RBM25_uc001xnn.3_Intron|RBM25_uc010ttu.1_Intron|RBM25_uc001xnp.2_Intron	NM_021239	NP_067062	P49756	RBM25_HUMAN	RNA binding motif protein 25						apoptosis|mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome|RNA splicing	cytoplasm|nuclear speck	mRNA binding|nucleotide binding|protein binding			central_nervous_system(2)|ovary(1)|breast(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		tttttcttttcttttttttttt	0.134													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	84419301	84419302	+	IGR	INS	-	GGAA	GGAA			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84419301_84419302insGGAA								None (None upstream) : None (None downstream)																							gagggagggagggaaggaagga	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	97980586	97980593	+	IGR	DEL	TTCCTTTT	-	-	rs71883285	by1000genomes	TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97980586_97980593delTTCCTTTT								VRK1 (632636 upstream) : C14orf64 (411354 downstream)																							ccttccttccttccttttttccttcctt	0.120													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22566684	22566684	+	IGR	DEL	A	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22566684delA								MIR1268 (53404 upstream) : GOLGA8DP (135601 downstream)																							GTAAAGCGTGAACAAGTAAGA	0.299													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9250813	9250813	+	IGR	DEL	T	-	-	rs115093816	by1000genomes	TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9250813delT								C16orf72 (37268 upstream) : GRIN2A (596454 downstream)																							cggagccctcttttttttttt	0.164													4	2	---	---	---	---	
DNAH3	55567	broad.mit.edu	37	16	21109760	21109760	+	Intron	DEL	A	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21109760delA	uc010vbe.1	-							NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		accttgtctcaaaaaaaaaaa	0.124													3	3	---	---	---	---	
CDH3	1001	broad.mit.edu	37	16	68713597	68713598	+	Intron	INS	-	AA	AA	rs71382055		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68713597_68713598insAA	uc002ewf.2	+						CDH3_uc010vli.1_Intron	NM_001793	NP_001784	P22223	CADH3_HUMAN	cadherin 3, type 1 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|response to stimulus|visual perception	integral to membrane	calcium ion binding	p.?(1)		ovary(3)|breast(1)|skin(1)	5		Ovarian(137;0.0564)		OV - Ovarian serous cystadenocarcinoma(108;0.000782)|Epithelial(162;0.0054)|all cancers(182;0.0384)		gacttcatctcaaaaaaaaaaa	0.158													4	2	---	---	---	---	
HYDIN	54768	broad.mit.edu	37	16	71061896	71061896	+	Intron	DEL	T	-	-	rs142337199		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71061896delT	uc002ezr.2	-						HYDIN_uc010cfz.1_Intron|HYDIN_uc002ezv.2_Intron	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a											ovary(1)|skin(1)	2		Ovarian(137;0.0654)				AATATAAGACTTTTTTTTTTT	0.408													5	3	---	---	---	---	
ALOX12B	242	broad.mit.edu	37	17	7990546	7990557	+	Intron	DEL	ACACACACAGAC	-	-	rs72449480		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7990546_7990557delACACACACAGAC	uc002gjy.1	-						hsa-mir-4314|MI0015846_5'Flank	NM_001139	NP_001130	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type						epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity				0						acacacacagacacacacagacacacacacac	0.392										Multiple Myeloma(8;0.094)			15	13	---	---	---	---	
MFSD11	79157	broad.mit.edu	37	17	74771143	74771143	+	Frame_Shift_Del	DEL	G	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74771143delG	uc002jta.2	+	12	1912	c.939delG	c.(937-939)TTGfs	p.L313fs	MFSD11_uc002jtb.2_Frame_Shift_Del_p.L313fs|MFSD11_uc010dha.2_Frame_Shift_Del_p.L261fs|MFSD11_uc002jtc.2_Frame_Shift_Del_p.L313fs|MFSD11_uc002jtd.3_Frame_Shift_Del_p.L313fs|MFSD11_uc010dhb.2_Frame_Shift_Del_p.L261fs|MFSD11_uc002jte.2_Frame_Shift_Del_p.L313fs	NM_024311	NP_077287	O43934	MFS11_HUMAN	major facilitator superfamily domain containing	313	Helical; (Potential).					integral to membrane				ovary(1)	1						TTGTGCTGTTGGGCATCCTGG	0.453													173	79	---	---	---	---	
AZI1	22994	broad.mit.edu	37	17	79171437	79171437	+	Intron	DEL	C	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79171437delC	uc002jzp.1	-						AZI1_uc002jzm.1_5'Flank|AZI1_uc002jzn.1_Intron|AZI1_uc002jzo.1_Intron|AZI1_uc010wum.1_Intron	NM_014984	NP_055799	Q9UPN4	AZI1_HUMAN	5-azacytidine induced 1 isoform a						cell differentiation|G2/M transition of mitotic cell cycle|multicellular organismal development|spermatogenesis	centrosome|cytosol|intracellular membrane-bounded organelle				central_nervous_system(2)|large_intestine(1)|ovary(1)	4	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GGGGCCTCCTCCCCCGAGGGC	0.746													8	5	---	---	---	---	
PPP4R1	9989	broad.mit.edu	37	18	9583268	9583268	+	Frame_Shift_Del	DEL	G	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9583268delG	uc002koe.1	-	9	883	c.765delC	c.(763-765)CCCfs	p.P255fs	PPP4R1_uc010wzo.1_Intron|PPP4R1_uc002kod.1_Frame_Shift_Del_p.P238fs|PPP4R1_uc010wzp.1_RNA	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	255	HEAT 8.				protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1						GGAAAAATCTGGGCAGCTATG	0.398													36	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	63778855	63778858	+	IGR	DEL	GAAG	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63778855_63778858delGAAG								CDH7 (230681 upstream) : CDH19 (392463 downstream)																							aaggaagaaagaaggaaggaagga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	64559977	64559978	+	IGR	INS	-	AAGGAAGGAAGGAAGA	AAGGAAGGAAGGAAGA	rs151112863	by1000genomes	TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:64559977_64559978insAAGGAAGGAAGGAAGA								CDH19 (288761 upstream) : DSEL (613841 downstream)																							aaggaaagaggaaggaaggaag	0.000													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42107414	42107415	+	IGR	DEL	CA	-	-	rs72172011		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107414_42107415delCA								CEACAM21 (14218 upstream) : CEACAM4 (17929 downstream)																							Gacacgcacgcacgcgcgcgcg	0.183													4	2	---	---	---	---	
TEAD2	8463	broad.mit.edu	37	19	49845484	49845485	+	Intron	INS	-	CCACATCAGTT	CCACATCAGTT	rs149352076	by1000genomes	TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49845484_49845485insCCACATCAGTT	uc002pnj.2	-						uc002pnb.1_5'Flank|TEAD2_uc002png.2_Intron|TEAD2_uc002pnh.2_Intron|TEAD2_uc002pni.2_Intron|TEAD2_uc010yao.1_Intron|TEAD2_uc010emw.2_Intron	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		TGACATCCCCACCCTGGGTGAA	0.327													5	3	---	---	---	---	
COL9A3	1299	broad.mit.edu	37	20	61471746	61471747	+	Intron	INS	-	CT	CT	rs140852150	by1000genomes	TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61471746_61471747insCT	uc002ydm.2	+						COL9A3_uc002ydn.2_Intron	NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor						axon guidance	collagen type IX					0	Breast(26;5.68e-08)					CTTTGTGTGCCGTTCCCTCGGC	0.688													5	3	---	---	---	---	
PI4KA	5297	broad.mit.edu	37	22	21097228	21097228	+	Intron	DEL	T	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21097228delT	uc002zsz.3	-							NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha						phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TGATCACAGCTTTTTTTTTTT	0.393													4	2	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36744887	36744887	+	Intron	DEL	C	-	-	rs56147525		TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36744887delC	uc003apg.2	-						MYH9_uc003api.1_Intron	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GGAAGACCCGCCCCCCCCCCC	0.627			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				6	4	---	---	---	---	
XG	7499	broad.mit.edu	37	X	2683418	2683425	+	Intron	DEL	GGAAGGAA	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2683418_2683425delGGAAGGAA	uc011mhg.1	+						XG_uc010ndb.2_Intron|XG_uc004cqp.2_Intron	NM_175569	NP_780778	P55808	XG_HUMAN	XG glycoprotein isoform 1 precursor							integral to membrane|plasma membrane				ovary(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				agggagggagggaaggaaggaaggaagg	0.135													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	57247389	57247389	+	IGR	DEL	C	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57247389delC								SPIN2A (83331 upstream) : FAAH2 (65721 downstream)																							tttgcctcatccaagccaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	14359924	14359926	+	IGR	DEL	AAA	-	-			TCGA-18-4086-01A-01D-1352-08	TCGA-18-4086-11A-01D-1352-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:14359924_14359926delAAA								None (None upstream) : TTTY15 (414372 downstream)																							cccgtctcagaaaaaaaaaaaaa	0.020													4	2	---	---	---	---	
