Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MMEL1	79258	broad.mit.edu	37	1	2523025	2523025	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2523025C>G	uc001ajy.2	-	23	2425	c.2211G>C	c.(2209-2211)AAG>AAC	p.K737N	MMEL1_uc009vlg.1_RNA	NM_033467	NP_258428	Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	737	Lumenal (Potential).				proteolysis	extracellular region|integral to membrane|intracellular membrane-bounded organelle	metal ion binding|metalloendopeptidase activity				0	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		GGACGTCTGTCTTGATGGATT	0.632													19	66	---	---	---	---	PASS
CAMTA1	23261	broad.mit.edu	37	1	7826535	7826535	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7826535A>G	uc001aoi.2	+	23	5213	c.5006A>G	c.(5005-5007)AAA>AGA	p.K1669R	CAMTA1_uc001aok.3_Missense_Mutation_p.K702E|CAMTA1_uc001aoj.2_Missense_Mutation_p.K622E|CAMTA1_uc009vmf.2_Missense_Mutation_p.K249E	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1	1669					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		AGAATTGAAAAAGGCCAAGGA	0.398													7	30	---	---	---	---	PASS
TMEM201	199953	broad.mit.edu	37	1	9661475	9661475	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9661475A>T	uc001apz.2	+	5	931	c.919A>T	c.(919-921)ACC>TCC	p.T307S	TMEM201_uc001apy.2_Missense_Mutation_p.T307S	NM_001130924	NP_001124396	Q5SNT2	TM201_HUMAN	transmembrane protein 201 isoform 1	307	Helical; (Potential).					integral to membrane|nuclear inner membrane					0	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		GGGCCTACTCACCTGCCTGCT	0.657													12	31	---	---	---	---	PASS
PTCHD2	57540	broad.mit.edu	37	1	11577558	11577558	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11577558C>T	uc001ash.3	+	7	1926	c.1788C>T	c.(1786-1788)CTC>CTT	p.L596L	PTCHD2_uc001asi.1_Silent_p.L596L	NM_020780	NP_065831	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	596	Helical; (Potential).|SSD.				cholesterol homeostasis|regulation of lipid transport|smoothened signaling pathway	endoplasmic reticulum|integral to membrane|nuclear membrane	hedgehog receptor activity			skin(3)|ovary(2)|pancreas(1)|breast(1)	7	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TCATGTCTCTCATCGTGTCCT	0.612													28	77	---	---	---	---	PASS
MIIP	60672	broad.mit.edu	37	1	12082420	12082420	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12082420C>T	uc001ato.1	+	3	563	c.383C>T	c.(382-384)TCA>TTA	p.S128L		NM_021933	NP_068752	Q5JXC2	MIIP_HUMAN	invasion inhibitory protein 45	128										ovary(1)	1						CCAGAGCCCTCAGGGAGGCTG	0.657													3	18	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12304675	12304675	+	Splice_Site	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12304675G>A	uc001atv.2	+	5	588	c.447_splice	c.e5+1	p.E149_splice	VPS13D_uc001atw.2_Splice_Site_p.E149_splice	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1						protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GAATATTGAAGTAAGTCCTGC	0.428													11	34	---	---	---	---	PASS
PRDM2	7799	broad.mit.edu	37	1	14108529	14108529	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14108529G>A	uc001avi.2	+	8	5095	c.4239G>A	c.(4237-4239)TCG>TCA	p.S1413S	PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_Silent_p.S1413S|PRDM2_uc001avj.2_Intron|PRDM2_uc001avk.2_Silent_p.S1212S|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger	1413	Arg/Lys-rich (basic).					Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		GCAAAATGTCGTCGAATAAGC	0.393													24	61	---	---	---	---	PASS
FBXO42	54455	broad.mit.edu	37	1	16577630	16577630	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16577630G>C	uc001ayg.2	-	10	1905	c.1689C>G	c.(1687-1689)ATC>ATG	p.I563M	FBXO42_uc001aye.3_Missense_Mutation_p.I281M|FBXO42_uc001ayf.2_Missense_Mutation_p.I470M	NM_018994	NP_061867	Q6P3S6	FBX42_HUMAN	F-box protein 42	563										upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		ACATCGCTTTGATGGCTTCCA	0.612													6	57	---	---	---	---	PASS
IGSF21	84966	broad.mit.edu	37	1	18688620	18688620	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18688620T>C	uc001bau.1	+	5	819	c.436T>C	c.(436-438)TCC>CCC	p.S146P	IGSF21_uc001bav.1_5'UTR	NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor	146						extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		TCCTCCCACCTCCATTGAAGT	0.567													3	11	---	---	---	---	PASS
RNF186	54546	broad.mit.edu	37	1	20141492	20141492	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20141492C>A	uc001bcr.2	-	1	280	c.103G>T	c.(103-105)GAA>TAA	p.E35*		NM_019062	NP_061935	Q9NXI6	RN186_HUMAN	ring finger protein 186	35						integral to membrane	zinc ion binding				0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;7.77e-05)|Kidney(64;0.000162)|GBM - Glioblastoma multiforme(114;0.00036)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		AGGTCACATTCTGTGGAGCCA	0.647													20	62	---	---	---	---	PASS
CELA3B	23436	broad.mit.edu	37	1	22332296	22332296	+	3'UTR	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22332296G>A	uc009vqf.2	+	4					CELA3A_uc001bfl.2_Intron			P08861	CEL3B_HUMAN	SubName: Full=Elastase 3A, pancreatic;						cholesterol metabolic process|proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						GTGGGTGAGTGAATGCTCCGG	0.537													9	64	---	---	---	---	PASS
ZBTB40	9923	broad.mit.edu	37	1	22816893	22816893	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22816893C>G	uc001bft.2	+	3	963	c.452C>G	c.(451-453)TCT>TGT	p.S151C	ZBTB40_uc001bfu.2_Missense_Mutation_p.S151C|ZBTB40_uc009vqi.1_Missense_Mutation_p.S151C	NM_001083621	NP_001077090	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	151					bone mineralization|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		ATCCTTTCATCTGAAGGTGCT	0.527													35	142	---	---	---	---	PASS
SFN	2810	broad.mit.edu	37	1	27190313	27190313	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27190313G>A	uc001bnc.1	+	1	681	c.610G>A	c.(610-612)GAT>AAT	p.D204N	uc010ofi.1_RNA	NM_006142	NP_006133	P31947	1433S_HUMAN	stratifin	204					DNA damage response, signal transduction resulting in induction of apoptosis|negative regulation of caspase activity|release of cytochrome c from mitochondria	cytoplasm|extracellular space|nucleus	protein domain specific binding|protein kinase C inhibitor activity				0		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.1e-52)|Epithelial(14;2.31e-52)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;1.31e-09)|COAD - Colon adenocarcinoma(152;3.45e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)|GBM - Glioblastoma multiforme(114;0.0767)|Lung(427;0.215)		GGCCATGGCTGATCTGCACAC	0.607													13	66	---	---	---	---	PASS
AHDC1	27245	broad.mit.edu	37	1	27876980	27876980	+	Silent	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27876980G>C	uc009vsy.2	-	6	2616	c.1647C>G	c.(1645-1647)CGC>CGG	p.R549R	AHDC1_uc009vsz.1_Silent_p.R549R	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	549	A.T hook 2.						DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		TCTTAGGAGGGCGGCCGCGCT	0.637													5	24	---	---	---	---	PASS
KIAA0319L	79932	broad.mit.edu	37	1	35909835	35909835	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35909835C>A	uc001byx.2	-	17	2841	c.2583G>T	c.(2581-2583)GCG>GCT	p.A861A	KIAA0319L_uc001byw.2_Silent_p.A303A|KIAA0319L_uc010ohv.1_Silent_p.A503A	NM_024874	NP_079150	Q8IZA0	K319L_HUMAN	dyslexia susceptibility 2-like	861	Extracellular (Potential).					cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TCTTGAGCATCGCTGCCACCT	0.463													24	38	---	---	---	---	PASS
CLSPN	63967	broad.mit.edu	37	1	36203671	36203671	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36203671C>A	uc001bzi.2	-	22	3666	c.3586G>T	c.(3586-3588)GAA>TAA	p.E1196*	CLSPN_uc009vux.2_Nonsense_Mutation_p.E1132*	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin	1196					activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TCTTCTTCTTCTTCAGCTGTA	0.338													24	38	---	---	---	---	PASS
EPHA10	284656	broad.mit.edu	37	1	38227557	38227557	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38227557C>T	uc009vvi.2	-	3	456	c.370G>A	c.(370-372)GAG>AAG	p.E124K	EPHA10_uc001cbw.3_Missense_Mutation_p.E124K	NM_001099439	NP_001092909	Q5JZY3	EPHAA_HUMAN	EPH receptor A10 isofom 3	124	Extracellular (Potential).					extracellular region|integral to membrane|integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding|transmembrane-ephrin receptor activity			breast(4)|stomach(3)|lung(1)	8	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TTGAAGGTCTCCTTGCAGGTA	0.662													32	145	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43787098	43787098	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43787098C>T	uc001ciu.2	+	21	3259	c.3180C>T	c.(3178-3180)GCC>GCT	p.A1060A	TIE1_uc010oke.1_Silent_p.A1015A|TIE1_uc009vwq.2_Silent_p.A1016A|TIE1_uc010okg.1_Silent_p.A705A	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	1060	Cytoplasmic (Potential).|Protein kinase.				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGACCTGTGCCGAGCTCTATG	0.592													11	28	---	---	---	---	PASS
MPL	4352	broad.mit.edu	37	1	43818205	43818205	+	Nonsense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43818205C>G	uc001ciw.2	+	12	1715	c.1670C>G	c.(1669-1671)TCA>TGA	p.S557*	MPL_uc009vwr.2_Nonsense_Mutation_p.S550*	NM_005373	NP_005364	P40238	TPOR_HUMAN	myeloproliferative leukemia virus oncogene	557	Cytoplasmic (Potential).				cell proliferation|platelet activation	integral to plasma membrane	cytokine receptor activity			haematopoietic_and_lymphoid_tissue(361)|upper_aerodigestive_tract(1)|pancreas(1)	363	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GCCACAGTCTCAGATACCTGT	0.557			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia						10	41	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43891796	43891796	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43891796A>G	uc001cjk.1	+	7	953	c.491A>G	c.(490-492)CAG>CGG	p.Q164R	KIAA0467_uc009vws.1_Missense_Mutation_p.Q1006R	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CAGCAGCTCCAGATGTTCTTC	0.512													15	15	---	---	---	---	PASS
IPP	3652	broad.mit.edu	37	1	46211819	46211819	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46211819G>A	uc001cou.2	-	2	532	c.265C>T	c.(265-267)CAG>TAG	p.Q89*	IPP_uc001cos.3_Nonsense_Mutation_p.Q89*	NM_005897	NP_005888	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	89	BTB.					actin cytoskeleton|cytoplasm	actin binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					AGAAGTATCTGAAAGATTCCT	0.343													8	45	---	---	---	---	PASS
C1orf177	163747	broad.mit.edu	37	1	55279497	55279497	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55279497C>G	uc001cyb.3	+	7	827	c.773C>G	c.(772-774)CCC>CGC	p.P258R	C1orf177_uc001cya.3_Missense_Mutation_p.P258R	NM_001110533	NP_001104003	Q3ZCV2	CA177_HUMAN	hypothetical protein LOC163747 isoform 2	258											0						AAAAAAAAGCCCAGGGAACTG	0.413													6	36	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75038884	75038884	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75038884C>T	uc001dgg.2	-	14	2729	c.2510G>A	c.(2509-2511)AGG>AAG	p.R837K		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	837	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CTCTGCCCCCCTTTCTATGCC	0.562													25	71	---	---	---	---	PASS
LRRC8C	84230	broad.mit.edu	37	1	90179638	90179638	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:90179638G>A	uc001dnl.3	+	3	1751	c.1509G>A	c.(1507-1509)ATG>ATA	p.M503I		NM_032270	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member	503	LRR 5.					endoplasmic reticulum membrane|integral to membrane				ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		TTGATGACATGAGGGAACTCC	0.488													16	39	---	---	---	---	PASS
ALG14	199857	broad.mit.edu	37	1	95448643	95448643	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95448643G>T	uc001dra.2	-	4	693	c.640C>A	c.(640-642)CGA>AGA	p.R214R		NM_144988	NP_659425	Q96F25	ALG14_HUMAN	asparagine-linked glycosylation 14 homolog	214	Cytoplasmic (Potential).				dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity				0		all_lung(203;0.0232)|Lung NSC(277;0.0739)		all cancers(265;0.0615)|Epithelial(280;0.139)		CAAACAATTCGCCCAAGGTAC	0.393													10	54	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109793561	109793561	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109793561C>T	uc001dxa.3	+	1	921	c.860C>T	c.(859-861)CCT>CTT	p.P287L		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	287	Cadherin 1.|Extracellular (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GACCATGACCCTGTGTTCGAG	0.602													15	40	---	---	---	---	PASS
AP4B1	10717	broad.mit.edu	37	1	114442820	114442820	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114442820G>A	uc001eeb.2	-	5	963	c.820C>T	c.(820-822)CTT>TTT	p.L274F	uc001edv.1_RNA|AP4B1_uc001eec.2_Missense_Mutation_p.L106F|AP4B1_uc001eed.2_Missense_Mutation_p.L274F|AP4B1_uc010owp.1_Missense_Mutation_p.L175F|AP4B1_uc001eea.1_Missense_Mutation_p.L68F|AP4B1_uc010owq.1_Missense_Mutation_p.L181F	NM_006594	NP_006585	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1	274					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|soluble fraction|trans-Golgi network	protein binding|protein transporter activity			ovary(3)|central_nervous_system(1)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACCCGCACAAGGACATCAGTT	0.478													10	37	---	---	---	---	PASS
CASQ2	845	broad.mit.edu	37	1	116244055	116244055	+	Intron	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116244055G>A	uc001efx.3	-						CASQ2_uc010owu.1_Intron	NM_001232	NP_001223	O14958	CASQ2_HUMAN	cardiac calsequestrin 2 precursor						heart development|striated muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		AGCCTGCAGTGAGGGACAAAA	0.517													9	15	---	---	---	---	PASS
CASQ2	845	broad.mit.edu	37	1	116245587	116245587	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116245587C>G	uc001efx.3	-	10	1233	c.969G>C	c.(967-969)AAG>AAC	p.K323N	CASQ2_uc010owu.1_Missense_Mutation_p.K252N	NM_001232	NP_001223	O14958	CASQ2_HUMAN	cardiac calsequestrin 2 precursor	323					heart development|striated muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		ATAGGTCAATCTTGAAAGTCT	0.522													4	9	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152188200	152188200	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152188200A>T	uc001ezt.1	-	3	5981	c.5905T>A	c.(5905-5907)TCT>ACT	p.S1969T		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	1969	22.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGAGCCAGACCCATATGGG	0.617													22	555	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152192012	152192012	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152192012G>C	uc001ezt.1	-	3	2169	c.2093C>G	c.(2092-2094)TCT>TGT	p.S698C		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	698	7.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AAAGCCGGAAGACTGGCCTGA	0.567													28	124	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152328900	152328900	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152328900G>T	uc001ezw.3	-	3	1435	c.1362C>A	c.(1360-1362)GGC>GGA	p.G454G	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	454	Filaggrin 2.|Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACTCATGCTGGCCACAAGTTT	0.493													24	89	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155726809	155726809	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155726809C>G	uc001flz.2	-	27	5554	c.5457G>C	c.(5455-5457)AAG>AAC	p.K1819N	GON4L_uc009wrg.1_RNA|GON4L_uc001fly.1_Missense_Mutation_p.K1819N|GON4L_uc009wrh.1_Missense_Mutation_p.K1819N|GON4L_uc001fma.1_Missense_Mutation_p.K1819N|GON4L_uc001fmb.3_Missense_Mutation_p.K1015N	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	1819					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CTGTGGGTATCTTGGGAGGCT	0.408													13	40	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155736446	155736446	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155736446C>G	uc001flz.2	-	21	2915	c.2818G>C	c.(2818-2820)GAG>CAG	p.E940Q	GON4L_uc009wrg.1_RNA|GON4L_uc001fly.1_Missense_Mutation_p.E940Q|GON4L_uc009wrh.1_Missense_Mutation_p.E940Q|GON4L_uc001fma.1_Missense_Mutation_p.E940Q|GON4L_uc001fmb.3_Missense_Mutation_p.E136Q|GON4L_uc001fmc.2_Missense_Mutation_p.E940Q|GON4L_uc001fmd.3_Missense_Mutation_p.E940Q|GON4L_uc009wri.2_Missense_Mutation_p.E526Q	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	940					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TTTCCTACCTCTCTAGCACCA	0.468													17	51	---	---	---	---	PASS
FCRL2	79368	broad.mit.edu	37	1	157737253	157737253	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157737253C>A	uc001fre.2	-	6	989	c.930G>T	c.(928-930)CAG>CAT	p.Q310H	FCRL2_uc001frd.2_Missense_Mutation_p.Q57H|FCRL2_uc010phz.1_Missense_Mutation_p.Q310H|FCRL2_uc009wsp.2_Intron	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor	310	Ig-like C2-type 4.|Extracellular (Potential).				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCACTGCAGCCTGGGCCCCAG	0.542													8	40	---	---	---	---	PASS
CD1A	909	broad.mit.edu	37	1	158226602	158226602	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158226602G>A	uc001frt.2	+	4	1164	c.631G>A	c.(631-633)GGC>AGC	p.G211S		NM_001763	NP_001754	P06126	CD1A_HUMAN	CD1A antigen precursor	211	Extracellular (Potential).|Ig-like.				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex				pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	GCTGTCCCATGGCCCCAGTCC	0.522													17	47	---	---	---	---	PASS
CD1A	909	broad.mit.edu	37	1	158226603	158226603	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158226603G>T	uc001frt.2	+	4	1165	c.632G>T	c.(631-633)GGC>GTC	p.G211V		NM_001763	NP_001754	P06126	CD1A_HUMAN	CD1A antigen precursor	211	Extracellular (Potential).|Ig-like.				antigen processing and presentation|immune response	endosome membrane|integral to plasma membrane|MHC class I protein complex				pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)				Antithymocyte globulin(DB00098)	CTGTCCCATGGCCCCAGTCCT	0.527													17	47	---	---	---	---	PASS
OR10Z1	128368	broad.mit.edu	37	1	158576474	158576474	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158576474C>A	uc010pio.1	+	1	246	c.246C>A	c.(244-246)CTC>CTA	p.L82L		NM_001004478	NP_001004478	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z,	82	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)|skin(1)	2	all_hematologic(112;0.0378)					CTAGAATGCTCTCTGGCCTGG	0.547													43	166	---	---	---	---	PASS
PVRL4	81607	broad.mit.edu	37	1	161047464	161047464	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161047464G>C	uc001fxo.2	-	3	808	c.509C>G	c.(508-510)TCC>TGC	p.S170C	PVRL4_uc010pjz.1_5'Flank	NM_030916	NP_112178	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4 precursor	170	Ig-like C2-type 1.|Extracellular (Potential).				adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane				ovary(2)	2	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			AGCTGTGCAGGAGGCTGCCAG	0.647													11	24	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175046886	175046886	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175046886G>T	uc001gkl.1	+	2	445	c.332G>T	c.(331-333)CGG>CTG	p.R111L	TNN_uc010pmx.1_Missense_Mutation_p.R111L	NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	111					cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		CTCCTGGCCCGGGTGAAGAAG	0.577													8	26	---	---	---	---	PASS
PLA2G4A	5321	broad.mit.edu	37	1	186880434	186880434	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186880434C>T	uc001gsc.2	+	7	676	c.471C>T	c.(469-471)TTC>TTT	p.F157F	PLA2G4A_uc010pos.1_Intron	NM_024420	NP_077734	P47712	PA24A_HUMAN	cytosolic phospholipase A2, group IVA	157	Phospholipid binding (Probable).|PLA2c.				phospholipid catabolic process|platelet activating factor biosynthetic process|platelet activation	cytosol|endoplasmic reticulum membrane	calcium ion binding|calcium-dependent phospholipid binding|lysophospholipase activity			lung(2)|breast(1)	3					Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Medrysone(DB00253)|Quinacrine(DB01103)	AGAAGACTTTCAGACAACAGA	0.438													19	79	---	---	---	---	PASS
CFHR5	81494	broad.mit.edu	37	1	196952141	196952141	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196952141C>A	uc001gts.3	+	2	313	c.185C>A	c.(184-186)CCT>CAT	p.P62H		NM_030787	NP_110414	Q9BXR6	FHR5_HUMAN	complement factor H-related 5 precursor	62	Sushi 1.				complement activation, alternative pathway	extracellular region				breast(1)|skin(1)	2						TTTGTGTCTCCTTCAAAATCC	0.393													18	59	---	---	---	---	PASS
DDX59	83479	broad.mit.edu	37	1	200635670	200635670	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200635670C>A	uc009wzk.2	-	2	442	c.199G>T	c.(199-201)GGC>TGC	p.G67C	DDX59_uc010ppl.1_Missense_Mutation_p.G67C	NM_001031725	NP_001026895	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	67						intracellular	ATP binding|ATP-dependent helicase activity|metal ion binding|RNA binding			ovary(2)|breast(1)|central_nervous_system(1)	4						GCCAACTGGCCACCTGGGCTG	0.527													12	58	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207758124	207758124	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207758124C>A	uc001hfy.2	+	25	4223	c.4083C>A	c.(4081-4083)AAC>AAA	p.N1361K	CR1_uc009xcl.1_Missense_Mutation_p.N911K|CR1_uc001hfx.2_Missense_Mutation_p.N1811K	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	1361	Extracellular (Potential).|Sushi 21.				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						TGACCTTCAACCTCATTGGGG	0.527													4	105	---	---	---	---	PASS
CAMK1G	57172	broad.mit.edu	37	1	209785331	209785331	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209785331G>A	uc001hhd.2	+	11	1212	c.1110G>A	c.(1108-1110)CTG>CTA	p.L370L	CAMK1G_uc001hhf.3_Silent_p.L370L|CAMK1G_uc001hhe.2_Silent_p.L370L	NM_020439	NP_065172	Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	370						Golgi membrane|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			breast(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		TCCCTGCCCTGACCCAATTAC	0.627													12	69	---	---	---	---	PASS
DEGS1	8560	broad.mit.edu	37	1	224377500	224377500	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224377500G>A	uc001hoj.2	+	2	415	c.304G>A	c.(304-306)GCA>ACA	p.A102T	DEGS1_uc001hoi.2_Missense_Mutation_p.A81T	NM_144780	NP_659004	O15121	DEGS1_HUMAN	degenerative spermatocyte homolog 1, lipid	102	Helical; (Potential).				sphingolipid metabolic process|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	electron carrier activity|protein binding|sphingolipid delta-4 desaturase activity				0	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		CAACTGCAAAGCAATGTGGAA	0.433													33	98	---	---	---	---	PASS
H3F3A	3020	broad.mit.edu	37	1	226253396	226253396	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226253396G>T	uc001hpw.2	+	3	283	c.168G>T	c.(166-168)CAG>CAT	p.Q56H	H3F3A_uc010pvl.1_Missense_Mutation_p.Q56H	NM_005324	NP_005315	P84243	H33_HUMAN	H3 histone, family 3B	56					blood coagulation|nucleosome assembly	nucleoplasm|nucleosome	DNA binding				0	Breast(184;0.179)			GBM - Glioblastoma multiforme(131;0.203)		GACGTTATCAGAAGTCCACTG	0.428													12	32	---	---	---	---	PASS
NUP133	55746	broad.mit.edu	37	1	229588372	229588372	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229588372C>A	uc001htn.2	-	22	3091	c.2999G>T	c.(2998-3000)CGC>CTC	p.R1000L		NM_018230	NP_060700	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	1000					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|nuclear pore organization|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			breast(4)|skin(2)|ovary(1)	7	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				CAGTAGAAAGCGCTCCTGCTC	0.438													7	26	---	---	---	---	PASS
GPR137B	7107	broad.mit.edu	37	1	236306222	236306222	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236306222C>G	uc001hxq.2	+	1	391	c.300C>G	c.(298-300)TTC>TTG	p.F100L		NM_003272	NP_003263	O60478	G137B_HUMAN	G protein-coupled receptor 137B	100	Helical; (Potential).					integral to plasma membrane|membrane fraction					0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			CCTTCTACTTCAAAGACTTCG	0.572													30	107	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	241031964	241031964	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241031964C>A	uc001hyv.2	-	9	862	c.532G>T	c.(532-534)GAC>TAC	p.D178Y	RGS7_uc010pyh.1_Missense_Mutation_p.D152Y|RGS7_uc010pyj.1_Missense_Mutation_p.D94Y|RGS7_uc001hyu.2_Missense_Mutation_p.D178Y|RGS7_uc009xgn.1_Missense_Mutation_p.D125Y|RGS7_uc001hyw.2_Missense_Mutation_p.D178Y|RGS7_uc001hyt.2_Missense_Mutation_p.D10Y	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	178					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CTCTTCTTGTCCACTCTGTCA	0.453													20	49	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	241031965	241031965	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241031965C>A	uc001hyv.2	-	9	861	c.531G>T	c.(529-531)GTG>GTT	p.V177V	RGS7_uc010pyh.1_Silent_p.V151V|RGS7_uc010pyj.1_Silent_p.V93V|RGS7_uc001hyu.2_Silent_p.V177V|RGS7_uc009xgn.1_Silent_p.V124V|RGS7_uc001hyw.2_Silent_p.V177V|RGS7_uc001hyt.2_Silent_p.V9V	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	177					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TCTTCTTGTCCACTCTGTCAA	0.458													21	50	---	---	---	---	PASS
ZNF496	84838	broad.mit.edu	37	1	247464220	247464220	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247464220C>T	uc001ico.2	-	9	1830	c.1365G>A	c.(1363-1365)GAG>GAA	p.E455E	ZNF496_uc009xgv.2_Silent_p.E491E|ZNF496_uc001icp.2_Silent_p.E455E	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496	455	C2H2-type 2.				positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			CCTCGTGGCTCTCTAGGTGCC	0.672													9	37	---	---	---	---	PASS
OR6F1	343169	broad.mit.edu	37	1	247875527	247875527	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247875527G>C	uc001idj.1	-	1	531	c.531C>G	c.(529-531)TTC>TTG	p.F177L		NM_001005286	NP_001005286	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F,	177	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TGTCACAGAAGAAGTGGTTGA	0.572													20	56	---	---	---	---	PASS
OR2T8	343172	broad.mit.edu	37	1	248084542	248084542	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248084542A>T	uc010pzc.1	+	1	223	c.223A>T	c.(223-225)ACT>TCT	p.T75S		NM_001005522	NP_001005522	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T,	75	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGTTTCCACCACTGTGCCCAA	0.582													10	39	---	---	---	---	PASS
OR2M4	26245	broad.mit.edu	37	1	248402872	248402872	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248402872C>A	uc010pzh.1	+	1	642	c.642C>A	c.(640-642)ATC>ATA	p.I214I		NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M,	214	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(2)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TTTCAGTTATCATACTTTCCT	0.473													17	43	---	---	---	---	PASS
OR14C36	127066	broad.mit.edu	37	1	248512452	248512452	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248512452C>A	uc010pzl.1	+	1	376	c.376C>A	c.(376-378)CAG>AAG	p.Q126K		NM_001001918	NP_001001918	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C,	126	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3						GGCTGTCTGCCAGCCACTTCA	0.512													10	36	---	---	---	---	PASS
OR2T11	127077	broad.mit.edu	37	1	248790376	248790376	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248790376A>T	uc001ier.1	-	1	54	c.54T>A	c.(52-54)AGT>AGA	p.S18R		NM_001001964	NP_001001964	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T,	18	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CGGCAGCCTCACTGTTCACCA	0.527													4	46	---	---	---	---	PASS
SNTG2	54221	broad.mit.edu	37	2	1168792	1168792	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1168792T>A	uc002qwq.2	+	8	642	c.514T>A	c.(514-516)TCC>ACC	p.S172T	SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	172					central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CCCAGGGCCATCCAGCGACCA	0.512													5	117	---	---	---	---	PASS
ALLC	55821	broad.mit.edu	37	2	3727473	3727473	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3727473G>T	uc010ewt.2	+	5	348	c.187G>T	c.(187-189)GTC>TTC	p.V63F		NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a	82							allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		CGACTGGTGTGTCCTCAGGCT	0.572										HNSCC(21;0.051)			13	64	---	---	---	---	PASS
SOS1	6654	broad.mit.edu	37	2	39224462	39224462	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39224462C>G	uc002rrk.3	-	18	2937	c.2896G>C	c.(2896-2898)GAA>CAA	p.E966Q	SOS1_uc002rrj.3_Missense_Mutation_p.E580Q	NM_005633	NP_005624	Q07889	SOS1_HUMAN	son of sevenless homolog 1	966	Ras-GEF.				apoptosis|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|induction of apoptosis by extracellular signals|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	DNA binding|protein binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			ovary(4)|breast(3)|lung(2)|central_nervous_system(1)	10		all_hematologic(82;0.21)				CCTGTTATTTCTGCTACTTTC	0.343									Noonan_syndrome				23	106	---	---	---	---	PASS
SLC3A1	6519	broad.mit.edu	37	2	44513255	44513255	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44513255G>T	uc002ruc.3	+	4	928	c.850G>T	c.(850-852)GAT>TAT	p.D284Y	SLC3A1_uc002rty.2_Missense_Mutation_p.D284Y|SLC3A1_uc002rtz.2_Missense_Mutation_p.D284Y|SLC3A1_uc002rua.2_Missense_Mutation_p.D284Y|SLC3A1_uc002rub.2_Missense_Mutation_p.D284Y|SLC3A1_uc002rud.3_Missense_Mutation_p.D6Y	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1	284	Extracellular (Potential).				carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	AGAGCAACCTGATTTAAATTT	0.348													19	66	---	---	---	---	PASS
ASB3	51130	broad.mit.edu	37	2	54023161	54023161	+	Intron	SNP	T	G	G	rs13421106	by1000genomes	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54023161T>G	uc002rxi.3	-						ERLEC1_uc002rxl.2_Intron|ERLEC1_uc002rxm.2_Intron|ERLEC1_uc002rxn.2_Intron	NM_001164165	NP_001157637	Q9Y575	ASB3_HUMAN	hypothetical protein LOC100302652						intracellular signal transduction					ovary(1)|kidney(1)	2			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GTATGTATTTTATGTTTACTT	0.323													9	31	---	---	---	---	PASS
ADD2	119	broad.mit.edu	37	2	70933427	70933427	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70933427C>A	uc002sgz.2	-	3	579	c.114G>T	c.(112-114)GCG>GCT	p.A38A	ADD2_uc010fds.1_RNA|ADD2_uc002sgy.2_Silent_p.A38A|ADD2_uc002sha.2_Silent_p.A38A|ADD2_uc002sgx.2_Silent_p.A38A|ADD2_uc010fdt.1_Silent_p.A38A|ADD2_uc002shc.1_Silent_p.A38A|ADD2_uc002shd.1_Silent_p.A38A|ADD2_uc010fdu.1_Silent_p.A54A	NM_001617	NP_001608	P35612	ADDB_HUMAN	adducin 2 isoform a	38					actin filament bundle assembly|barbed-end actin filament capping|positive regulation of protein binding	cytoplasm|F-actin capping protein complex|plasma membrane	actin filament binding|calmodulin binding|metal ion binding|protein heterodimerization activity|protein homodimerization activity|spectrin binding			ovary(2)|pancreas(1)	3						GCAGGTCCGCCGCCCGGTTGC	0.687													24	44	---	---	---	---	PASS
REG3A	5068	broad.mit.edu	37	2	79384760	79384760	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79384760C>A	uc002sod.1	-	4	653	c.398G>T	c.(397-399)TGG>TTG	p.W133L	REG3A_uc002soe.1_Missense_Mutation_p.W133L|REG3A_uc002sof.1_Missense_Mutation_p.W133L	NM_138938	NP_620355	Q06141	REG3A_HUMAN	pancreatitis-associated protein precursor	133	C-type lectin.				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding			skin(1)	1						ATTTCTCTCCCATGCAAAGTA	0.542													10	47	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89339943	89339943	+	RNA	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89339943G>T	uc010ytr.1	-	64		c.5916C>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		CCCGACAAGTGATGGTGACTC	0.498													15	66	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130877988	130877988	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130877988C>A	uc010fmh.2	-	3	501	c.101G>T	c.(100-102)TGC>TTC	p.C34F		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	34						cell cortex	ATP binding			skin(3)|ovary(2)	5						CTCCCTGCAGCAGGGGAAGCA	0.577													45	78	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	132021760	132021760	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132021760A>G	uc002tsn.2	+	15	2784	c.2732A>G	c.(2731-2733)GAC>GGC	p.D911G	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Missense_Mutation_p.D511G|POTEE_uc002tsl.2_Missense_Mutation_p.D493G|POTEE_uc010fmy.1_Missense_Mutation_p.D375G	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	911	Actin-like.						ATP binding				0						ATCGTGCGTGACATCAAAGAG	0.592													19	98	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164466745	164466745	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164466745T>A	uc002uck.1	-	3	1908	c.1597A>T	c.(1597-1599)ACA>TCA	p.T533S		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	533	ATP (By similarity).					nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						CCCAATAATGTTTTGCCTGTC	0.507													10	25	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166188042	166188042	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166188042G>A	uc002udc.2	+	14	2642	c.2352G>A	c.(2350-2352)ACG>ACA	p.T784T	SCN2A_uc002udd.2_Silent_p.T784T|SCN2A_uc002ude.2_Silent_p.T784T	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	784	II.				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	ATCCCATGACGGAGCAGTTCA	0.433													9	57	---	---	---	---	PASS
SCN2A	6326	broad.mit.edu	37	2	166188044	166188044	+	Missense_Mutation	SNP	A	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166188044A>C	uc002udc.2	+	14	2644	c.2354A>C	c.(2353-2355)GAG>GCG	p.E785A	SCN2A_uc002udd.2_Missense_Mutation_p.E785A|SCN2A_uc002ude.2_Missense_Mutation_p.E785A	NM_001040142	NP_001035232	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha	785	II.				myelination	node of Ranvier|voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|breast(1)|pancreas(1)	8					Lamotrigine(DB00555)	CCCATGACGGAGCAGTTCAGC	0.433													9	55	---	---	---	---	PASS
SCN9A	6335	broad.mit.edu	37	2	167141191	167141191	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167141191C>G	uc010fpl.2	-	12	2087	c.1746G>C	c.(1744-1746)GAG>GAC	p.E582D	uc002udp.2_Intron|SCN9A_uc002udr.1_Missense_Mutation_p.E453D|SCN9A_uc002uds.1_Missense_Mutation_p.E453D|SCN9A_uc002udt.1_Missense_Mutation_p.E453D	NM_002977	NP_002968	Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha	582						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|central_nervous_system(5)|skin(2)	13					Lamotrigine(DB00555)|Lidocaine(DB00281)	CCCTTCTGCTCTCATTGTCTC	0.512													16	46	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168105274	168105274	+	Missense_Mutation	SNP	A	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168105274A>C	uc002udx.2	+	8	7390	c.7372A>C	c.(7372-7374)ACT>CCT	p.T2458P	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.T2283P|XIRP2_uc010fpq.2_Missense_Mutation_p.T2236P|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2283					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ATGTAAAATTACTACCTCAAA	0.388													14	50	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179414381	179414381	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179414381A>T	uc010zfg.1	-	287	84588	c.84364T>A	c.(84364-84366)TAC>AAC	p.Y28122N	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Y21817N|TTN_uc010zfi.1_Missense_Mutation_p.Y21750N|TTN_uc010zfj.1_Missense_Mutation_p.Y21625N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29049							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGGAATTGGTATTCATTGCCG	0.403													11	46	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179590301	179590301	+	Missense_Mutation	SNP	A	G	G	rs142794598	by1000genomes	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179590301A>G	uc010zfg.1	-	68	17122	c.16898T>C	c.(16897-16899)ATA>ACA	p.I5633T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.I2294T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6560							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCGCCTTCTATGGATGCTTG	0.428													13	39	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179613430	179613430	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179613430G>T	uc002unb.2	-	46	13921	c.13697C>A	c.(13696-13698)GCT>GAT	p.A4566D	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	699							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCATGTTCAGCTCTTTTAGA	0.338													23	85	---	---	---	---	PASS
SSFA2	6744	broad.mit.edu	37	2	182766615	182766615	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182766615G>T	uc002uoi.2	+	8	1157	c.835G>T	c.(835-837)GAG>TAG	p.E279*	SSFA2_uc002uoh.2_Nonsense_Mutation_p.E279*|SSFA2_uc002uoj.2_Nonsense_Mutation_p.E279*|SSFA2_uc002uok.2_RNA|SSFA2_uc010zfo.1_Nonsense_Mutation_p.E126*|SSFA2_uc002uol.2_Nonsense_Mutation_p.E126*	NM_001130445	NP_001123917	P28290	SSFA2_HUMAN	sperm specific antigen 2 isoform 1	279						cytoplasm|plasma membrane	actin binding			breast(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			CTCTAACAAGGAGACAGACCC	0.423													10	28	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198949409	198949409	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198949409G>C	uc010fsp.2	+	2	1459	c.1168G>C	c.(1168-1170)GAT>CAT	p.D390H	PLCL1_uc002uuv.3_Missense_Mutation_p.D311H	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	390					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	TGACATTTTTGATCCTGAGCA	0.393													22	79	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201523958	201523958	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201523958C>T	uc002uvx.2	+	28	3343	c.3242C>T	c.(3241-3243)CCT>CTT	p.P1081L	AOX1_uc010zhf.1_Missense_Mutation_p.P637L|AOX1_uc010fsu.2_Missense_Mutation_p.P447L	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	1081					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GAAACTGTCCCTAATGCAAAT	0.448													5	47	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207146627	207146627	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207146627G>T	uc002vbp.2	+	3	304	c.54G>T	c.(52-54)CTG>CTT	p.L18L		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	18	DBF4-type.						nucleic acid binding|zinc ion binding			ovary(3)	3						ATAATAACCTGGAACAGGTGA	0.303													10	18	---	---	---	---	PASS
SMARCAL1	50485	broad.mit.edu	37	2	217329374	217329374	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217329374A>G	uc002vgc.3	+	13	2455	c.2125A>G	c.(2125-2127)AAA>GAA	p.K709E	SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.K709E|SMARCAL1_uc010fvg.2_Missense_Mutation_p.K687E	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN	SWI/SNF-related matrix-associated	709					chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity			ovary(3)|breast(3)|skin(1)	7		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		AGCTGAAGCTAAAATCCCATC	0.383									Schimke_Immuno-Osseous_Dysplasia				4	102	---	---	---	---	PASS
USP37	57695	broad.mit.edu	37	2	219346935	219346935	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219346935G>A	uc002vie.2	-	17	2146	c.1693C>T	c.(1693-1695)CGA>TGA	p.R565*	USP37_uc010fvs.1_Nonsense_Mutation_p.R565*|USP37_uc010zkf.1_Nonsense_Mutation_p.R565*|USP37_uc002vif.2_Nonsense_Mutation_p.R565*|USP37_uc002vig.2_Nonsense_Mutation_p.R493*	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	565					ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		AAGCTATATCGTTTCAAATGG	0.378													21	69	---	---	---	---	PASS
GLB1L	79411	broad.mit.edu	37	2	220103844	220103844	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220103844C>T	uc002vkm.2	-	11	1271	c.1032G>A	c.(1030-1032)AAG>AAA	p.K344K	GLB1L_uc002vkk.2_Silent_p.K101K|GLB1L_uc010zkx.1_Silent_p.K254K|GLB1L_uc002vkn.2_Silent_p.K344K	NM_024506	NP_078782	Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like precursor	344					carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds				0		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGCAAAAAGCTTAGGTGTGG	0.458													11	42	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220346038	220346038	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220346038C>T	uc010fwg.2	+	27	5382	c.5382C>T	c.(5380-5382)ATC>ATT	p.I1794I		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	1794	Protein kinase 1.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		TGACAGGAATCTCCCCGTTTG	0.582													11	42	---	---	---	---	PASS
IRS1	3667	broad.mit.edu	37	2	227662074	227662074	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227662074C>A	uc002voh.3	-	1	1433	c.1381G>T	c.(1381-1383)GAG>TAG	p.E461*		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	461					fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		TTGCTTAGCTCCTCCTCACCG	0.622											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	30	109	---	---	---	---	PASS
TM4SF20	79853	broad.mit.edu	37	2	228243943	228243943	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228243943G>A	uc002vpb.2	-	1	80	c.42C>T	c.(40-42)AGC>AGT	p.S14S		NM_024795	NP_079071	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20	14	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		GAACCAGCAGGCTGAATCCAT	0.473													15	46	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228882946	228882946	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228882946G>T	uc002vpq.2	-	7	2671	c.2624C>A	c.(2623-2625)GCT>GAT	p.A875D	SPHKAP_uc002vpp.2_Missense_Mutation_p.A875D|SPHKAP_uc010zlx.1_Missense_Mutation_p.A875D	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	875						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		ACTCTCCTCAGCCTCCTGGGA	0.507													153	631	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228884531	228884531	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228884531A>T	uc002vpq.2	-	7	1086	c.1039T>A	c.(1039-1041)TCC>ACC	p.S347T	SPHKAP_uc002vpp.2_Missense_Mutation_p.S347T|SPHKAP_uc010zlx.1_Missense_Mutation_p.S347T	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	347						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCCATCATGGAGAAATAAGCA	0.433													31	97	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230659957	230659957	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230659957G>C	uc002vpw.1	-	25	3790	c.3681C>G	c.(3679-3681)AGC>AGG	p.S1227R	TRIP12_uc002vpx.1_Missense_Mutation_p.S1275R|TRIP12_uc002vpy.1_Missense_Mutation_p.S957R	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1227					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GTTCCATCTGGCTGAGGCAGT	0.468													15	51	---	---	---	---	PASS
COPS7B	64708	broad.mit.edu	37	2	232660884	232660884	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232660884C>G	uc002vsg.1	+	5	499	c.396C>G	c.(394-396)ATC>ATG	p.I132M	COPS7B_uc010fxy.1_Missense_Mutation_p.I98M|COPS7B_uc002vsh.1_Missense_Mutation_p.I132M|COPS7B_uc002vsi.1_Missense_Mutation_p.I25M|COPS7B_uc002vsj.1_RNA|COPS7B_uc002vsk.1_Missense_Mutation_p.I25M	NM_022730	NP_073567	Q9H9Q2	CSN7B_HUMAN	COP9 constitutive photomorphogenic homolog	132	PCI.				cullin deneddylation	cytoplasm|signalosome				ovary(1)|liver(1)|skin(1)	3		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		AAGACCTTATCATTGAGGCTG	0.488													9	29	---	---	---	---	PASS
PRR21	643905	broad.mit.edu	37	2	240982175	240982175	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240982175G>T	uc010zod.1	-	1	225	c.225C>A	c.(223-225)CCC>CCA	p.P75P		NM_001080835	NP_001074304	Q8WXC7	PRR21_HUMAN	proline rich 21	75	Pro-rich.									ovary(1)|skin(1)	2						GAAGGGACATGGGTGAAGAGC	0.607													7	19	---	---	---	---	PASS
KIF1A	547	broad.mit.edu	37	2	241702689	241702689	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241702689G>C	uc002vzy.2	-	20	1962	c.1816C>G	c.(1816-1818)CGC>GGC	p.R606G	KIF1A_uc010fzk.2_Missense_Mutation_p.R615G|KIF1A_uc002vzz.1_Missense_Mutation_p.R615G	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles	606					anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CAAGGCGTGCGCTCACGCTCC	0.632													3	6	---	---	---	---	PASS
GAL3ST2	64090	broad.mit.edu	37	2	242741313	242741313	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242741313C>A	uc002wcj.1	+	3	368	c.237C>A	c.(235-237)AAC>AAA	p.N79K		NM_022134	NP_071417	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	79	Lumenal (Potential).				biosynthetic process	Golgi cisterna membrane|integral to membrane	galactosylceramide sulfotransferase activity				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		AGACCCACAACCTGTCCGTGG	0.667													7	51	---	---	---	---	PASS
IRAK2	3656	broad.mit.edu	37	3	10268100	10268100	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10268100C>T	uc003bve.1	+	10	1331	c.1255C>T	c.(1255-1257)CGA>TGA	p.R419*		NM_001570	NP_001561	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	419	Protein kinase.				activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8						GGATAACAACCGAAGCCCGGT	0.542													5	11	---	---	---	---	PASS
ATP2B2	491	broad.mit.edu	37	3	10413681	10413681	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10413681C>A	uc003bvt.2	-	12	1910	c.1471G>T	c.(1471-1473)GGC>TGC	p.G491C	ATP2B2_uc003bvv.2_Missense_Mutation_p.G446C|ATP2B2_uc003bvw.2_Missense_Mutation_p.G446C|ATP2B2_uc010hdo.2_Missense_Mutation_p.G196C	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	491	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						GTGGCATTGCCCATGGTCTCA	0.557													17	26	---	---	---	---	PASS
DOCK3	1795	broad.mit.edu	37	3	51308303	51308303	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51308303G>A	uc011bds.1	+	24	2436	c.2413G>A	c.(2413-2415)GTG>ATG	p.V805M		NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	805						cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding	p.V805L(2)			0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		AATGTTCACCGTGCAAGAGGT	0.522													3	38	---	---	---	---	PASS
VPRBP	9730	broad.mit.edu	37	3	51452138	51452138	+	Silent	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51452138A>G	uc003dbe.1	-	18	3945	c.3777T>C	c.(3775-3777)AAT>AAC	p.N1259N	VPRBP_uc003dbf.1_Silent_p.N535N	NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein	1259	WD 5.				interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		TGATGTTCATATTGAACTTGT	0.418													16	40	---	---	---	---	PASS
PROS1	5627	broad.mit.edu	37	3	93603660	93603660	+	Silent	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93603660T>C	uc003drb.3	-	12	1745	c.1404A>G	c.(1402-1404)CAA>CAG	p.Q468Q	PROS1_uc010hoo.2_Silent_p.Q337Q|PROS1_uc003dqz.3_Silent_p.Q337Q	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein	468	Laminin G-like 1.				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)	TTTGTTTTTCTTGAATAATTT	0.353													12	49	---	---	---	---	PASS
ZBTB11	27107	broad.mit.edu	37	3	101375038	101375038	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101375038G>A	uc003dve.3	-	7	2331	c.2101C>T	c.(2101-2103)CAT>TAT	p.H701Y		NM_014415	NP_055230	O95625	ZBT11_HUMAN	zinc finger protein ZNF-U69274	701	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TGTGATTGATGAAGACTCTGA	0.363													12	42	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108107918	108107918	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108107918G>T	uc003dxa.1	-	39	5551	c.5494C>A	c.(5494-5496)CGT>AGT	p.R1832S		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	1832	Potential.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						TCCAGTTCACGAACCTGCAAC	0.517													13	74	---	---	---	---	PASS
SLC9A10	285335	broad.mit.edu	37	3	111927206	111927206	+	Missense_Mutation	SNP	C	T	T	rs142600000		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111927206C>T	uc003dyu.2	-	16	2027	c.1805G>A	c.(1804-1806)CGT>CAT	p.R602H	SLC9A10_uc011bhu.1_Intron|SLC9A10_uc010hqc.2_Missense_Mutation_p.R554H	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	602	Ion transport-like.				cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						ATGGCATATACGAAAAAAGAA	0.274													23	81	---	---	---	---	PASS
CCDC52	152185	broad.mit.edu	37	3	113184568	113184568	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113184568G>A	uc003eag.3	-	11	1510	c.1219C>T	c.(1219-1221)CAT>TAT	p.H407Y	CCDC52_uc003eaf.3_RNA|CCDC52_uc003eah.1_Missense_Mutation_p.H303Y	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52	407	Potential.				cell division|mitosis	centriole|spindle	protein binding				0						AGCTCTCGATGATCACCTAAT	0.388													13	81	---	---	---	---	PASS
SIDT1	54847	broad.mit.edu	37	3	113286437	113286437	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113286437C>T	uc003eak.2	+	3	1046	c.395C>T	c.(394-396)TCA>TTA	p.S132L	SIDT1_uc011bif.1_RNA|SIDT1_uc003eaj.1_Missense_Mutation_p.S132L|SIDT1_uc011big.1_5'UTR	NM_017699	NP_060169	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1 precursor	132	Extracellular (Potential).					integral to membrane				ovary(3)|pancreas(1)|skin(1)	5						TTATGTCCCTCAGAAGCAACC	0.473													24	123	---	---	---	---	PASS
IGSF11	152404	broad.mit.edu	37	3	118649069	118649069	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118649069G>T	uc003ebw.2	-	2	353	c.106C>A	c.(106-108)CGG>AGG	p.R36R	IGSF11_uc011biv.1_Silent_p.R36R|IGSF11_uc003ebx.2_Silent_p.R36R|IGSF11_uc003eby.2_Silent_p.R35R|IGSF11_uc003ebz.2_Silent_p.R35R|IGSF11_uc010hqs.2_Silent_p.R35R	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b	36	Ig-like V-type.|Extracellular (Potential).				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						GGCTGACCCCGGGCCACCTGG	0.552													20	53	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124165652	124165652	+	Missense_Mutation	SNP	A	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124165652A>C	uc003ehg.2	+	21	3593	c.3466A>C	c.(3466-3468)ACA>CCA	p.T1156P	KALRN_uc010hrv.1_Missense_Mutation_p.T1147P|KALRN_uc003ehf.1_Missense_Mutation_p.T1156P|KALRN_uc011bjy.1_Missense_Mutation_p.T1147P|KALRN_uc003ehh.1_Missense_Mutation_p.T502P	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	1156	Spectrin 5.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						TTACCTCTCAACACATACCTC	0.493													27	114	---	---	---	---	PASS
C3orf37	56941	broad.mit.edu	37	3	129020813	129020813	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129020813G>T	uc003elt.2	+	6	744	c.656G>T	c.(655-657)GGA>GTA	p.G219V	C3orf37_uc003elu.2_Missense_Mutation_p.G177V|C3orf37_uc003elv.2_Missense_Mutation_p.G219V|C3orf37_uc003elw.2_Missense_Mutation_p.G219V	NM_020187	NP_064572	Q96FZ2	CC037_HUMAN	hypothetical protein LOC56941	219										ovary(1)	1						ATATTAGATGGAGAGGAGGCA	0.473													48	70	---	---	---	---	PASS
PRR23B	389151	broad.mit.edu	37	3	138739131	138739131	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138739131C>A	uc003esy.1	-	1	638	c.373G>T	c.(373-375)GAC>TAC	p.D125Y		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	125										breast(1)	1						AGGAAAACGTCCACTTCCAGC	0.632													24	44	---	---	---	---	PASS
GPR171	29909	broad.mit.edu	37	3	150916843	150916843	+	Missense_Mutation	SNP	C	T	T	rs151172001		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150916843C>T	uc003eyq.3	-	3	571	c.331G>A	c.(331-333)GAC>AAC	p.D111N	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron	NM_013308	NP_037440	O14626	GP171_HUMAN	G protein-coupled receptor 171	111	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGACAGCGGTCAATGCTGACA	0.428													23	103	---	---	---	---	PASS
P2RY1	5028	broad.mit.edu	37	3	152553988	152553988	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152553988C>G	uc003ezq.2	+	1	1253	c.417C>G	c.(415-417)ATC>ATG	p.I139M		NM_002563	NP_002554	P47900	P2RY1_HUMAN	purinergic receptor P2Y1	139	Helical; Name=3; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			ATGGCAGCATCTTGTTTCTGA	0.498													16	75	---	---	---	---	PASS
IL12A	3592	broad.mit.edu	37	3	159711632	159711632	+	Splice_Site	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:159711632G>C	uc003fcx.2	+	6	821	c.606_splice	c.e6+1	p.Q202_splice	uc003fcw.1_Intron	NM_000882	NP_000873	P29459	IL12A_HUMAN	interleukin 12A precursor						cell cycle arrest|cell migration|defense response to Gram-positive bacterium|immune response|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of cell adhesion|positive regulation of interferon-gamma production|positive regulation of natural killer cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of NK T cell activation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of tyrosine phosphorylation of Stat4 protein|response to lipopolysaccharide|response to UV-B|response to virus	interleukin-12 complex	cytokine activity|growth factor activity|interleukin-12 receptor binding|interleukin-27 binding|protein heterodimerization activity				0			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GCTGATGCAGGTAAGACTTCA	0.413													12	190	---	---	---	---	PASS
KPNA4	3840	broad.mit.edu	37	3	160219892	160219892	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160219892C>T	uc003fdn.2	-	17	1872	c.1566G>A	c.(1564-1566)TAG>TAA	p.*522*		NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4	522					NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			CAACATCTTTCTAAAACTGGA	0.308													25	153	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164908292	164908292	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164908292C>T	uc003fej.3	-	2	771	c.327G>A	c.(325-327)GGG>GGA	p.G109G	SLITRK3_uc003fek.2_Silent_p.G109G	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	109	LRR 2.|Extracellular (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						ATGCATTGTTCCCAAGATTAA	0.338										HNSCC(40;0.11)			12	93	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	G	G	rs121913279		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178952085A>G	uc003fjk.2	+	21	3297	c.3140A>G	c.(3139-3141)CAT>CGT	p.H1047R		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	1047	PI3K/PI4K.		H -> L (in cancer).|H -> R (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane).|H -> Y (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.H1047R(1269)|p.H1047L(152)|p.H1047Y(31)|p.H1047Q(3)|p.H1047T(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			AATGATGCACATCATGGTGGC	0.378	H1047R(BT20_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(MCAS_OVARY)|H1047R(HCC1954_BREAST)|H1047R(RKO_LARGE_INTESTINE)|H1047L(EFM19_BREAST)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(CAL29_URINARY_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(T47D_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(SKOV3_OVARY)|H1047R(MDAMB453_BREAST)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			62	57	---	---	---	---	PASS
HTR3C	170572	broad.mit.edu	37	3	183777983	183777983	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183777983G>C	uc003fmk.2	+	9	1221	c.1187G>C	c.(1186-1188)AGA>ACA	p.R396T		NM_130770	NP_570126	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine receptor 3 subunit C	396	Cytoplasmic (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			CTGGGACCCAGAGAGACCGAG	0.607													13	85	---	---	---	---	PASS
EIF4G1	1981	broad.mit.edu	37	3	184039394	184039394	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184039394C>A	uc003fnp.2	+	10	1220	c.1022C>A	c.(1021-1023)TCT>TAT	p.S341Y	EIF4G1_uc003fno.1_Missense_Mutation_p.S282Y|EIF4G1_uc010hxw.1_Missense_Mutation_p.S177Y|EIF4G1_uc003fnt.2_Missense_Mutation_p.S52Y|EIF4G1_uc003fnq.2_Missense_Mutation_p.S254Y|EIF4G1_uc003fnr.2_Missense_Mutation_p.S177Y|EIF4G1_uc010hxx.2_Missense_Mutation_p.S348Y|EIF4G1_uc003fns.2_Missense_Mutation_p.S301Y|EIF4G1_uc010hxy.2_Missense_Mutation_p.S348Y|EIF4G1_uc003fnv.3_Missense_Mutation_p.S341Y|EIF4G1_uc003fnu.3_Missense_Mutation_p.S341Y|EIF4G1_uc003fnw.2_Missense_Mutation_p.S348Y|EIF4G1_uc003fnx.2_Missense_Mutation_p.S145Y|EIF4G1_uc003fny.3_Missense_Mutation_p.S145Y	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	341					insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCTGAGTTTTCTTCCAGTCCT	0.527													10	160	---	---	---	---	PASS
CHRD	8646	broad.mit.edu	37	3	184107145	184107145	+	Intron	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184107145C>T	uc003fov.2	+						CHRD_uc003fow.2_Intron|CHRD_uc003fox.2_Intron|CHRD_uc003foy.2_Intron|CHRD_uc010hyc.2_Intron|CHRD_uc011brr.1_Intron	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor						BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCCCTCCCTTCTGTCTCCAGC	0.423													4	23	---	---	---	---	PASS
MAP3K13	9175	broad.mit.edu	37	3	185169078	185169078	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185169078G>C	uc010hyf.2	+	8	1439	c.1173G>C	c.(1171-1173)CAG>CAC	p.Q391H	MAP3K13_uc011brt.1_Missense_Mutation_p.Q184H|MAP3K13_uc003fph.3_Missense_Mutation_p.Q159H|MAP3K13_uc011bru.1_Missense_Mutation_p.Q247H|MAP3K13_uc003fpi.2_Missense_Mutation_p.Q391H|MAP3K13_uc010hyg.2_Missense_Mutation_p.Q81H	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase	391	Protein kinase.				activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			CTTTTAGGCAGAGTAAACCTC	0.373													15	87	---	---	---	---	PASS
TRA2B	6434	broad.mit.edu	37	3	185641673	185641673	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185641673C>A	uc003fpv.2	-	4	709	c.433G>T	c.(433-435)GCC>TCC	p.A145S	TRA2B_uc003fpt.2_RNA|TRA2B_uc003fpu.2_RNA|TRA2B_uc010hym.2_Missense_Mutation_p.A45S|TRA2B_uc003fpw.2_Missense_Mutation_p.A145S	NM_004593	NP_004584	P62995	TRA2B_HUMAN	splicing factor, arginine/serine-rich 10	145	RRM.				nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|protein binding|RNA binding			ovary(2)	2						GACACATCGGCAATGGGACCA	0.403													17	101	---	---	---	---	PASS
DGKG	1608	broad.mit.edu	37	3	186038260	186038260	+	5'UTR	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186038260A>T	uc003fqa.2	-	2					DGKG_uc003fqb.2_5'UTR|DGKG_uc003fqc.2_5'UTR|DGKG_uc011brx.1_5'UTR	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TTTAAACTTTATGTGAGTGGC	0.473													6	132	---	---	---	---	PASS
EIF4A2	1974	broad.mit.edu	37	3	186503789	186503789	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186503789G>A	uc003fqs.2	+	5	505	c.466G>A	c.(466-468)GTT>ATT	p.V156I	EIF4A2_uc003fqt.2_RNA|EIF4A2_uc003fqu.2_Missense_Mutation_p.V157I|EIF4A2_uc003fqv.2_Missense_Mutation_p.V61I|EIF4A2_uc003fqw.2_Missense_Mutation_p.V61I|EIF4A2_uc011bsb.1_Missense_Mutation_p.V29I|MIR1248_hsa-mir-1248|MI0006383_5'Flank|SNORA81_uc010hyv.1_5'Flank|SNORA63_uc010hyw.1_5'Flank|SNORA4_uc010hyx.1_5'Flank	NM_001967	NP_001958	Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	156	Helicase ATP-binding.				interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	ATP binding|ATP-dependent helicase activity|protein binding|translation initiation factor activity			ovary(2)|breast(2)	4	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		ACCACATATTGTTGTTGGTAC	0.383			T	BCL6	NHL								7	161	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186940936	186940936	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186940936C>A	uc003frh.1	-	14	2120	c.1788G>T	c.(1786-1788)AGG>AGT	p.R596S		NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	596	Peptidase S1.				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TCTCTGGGAACCTTTGCAAGA	0.522													12	57	---	---	---	---	PASS
ZDHHC19	131540	broad.mit.edu	37	3	195937563	195937563	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195937563G>A	uc003fwc.2	-	2	306	c.192C>T	c.(190-192)ATC>ATT	p.I64I	ZDHHC19_uc010hzz.2_RNA|ZDHHC19_uc010iaa.2_Intron|ZDHHC19_uc010iab.2_RNA	NM_001039617	NP_001034706	Q8WVZ1	ZDH19_HUMAN	zinc finger, DHHC domain containing 19	64	Helical; (Potential).					integral to membrane	acyltransferase activity|zinc ion binding			ovary(3)	3	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.89e-25)|all cancers(36;1.46e-23)|OV - Ovarian serous cystadenocarcinoma(49;2.1e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0022)		GGGAGCCTGTGATAACAGGAA	0.582													10	51	---	---	---	---	PASS
ZFYVE28	57732	broad.mit.edu	37	4	2274986	2274986	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2274986G>T	uc003gex.1	-	10	2556	c.2237C>A	c.(2236-2238)GCC>GAC	p.A746D	ZFYVE28_uc011bvk.1_Missense_Mutation_p.A676D|ZFYVE28_uc011bvl.1_Missense_Mutation_p.A716D|ZFYVE28_uc003gew.1_Missense_Mutation_p.A632D	NM_020972	NP_066023	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	746					negative regulation of epidermal growth factor receptor activity	cytosol|early endosome membrane	metal ion binding|phosphatidylinositol-3-phosphate binding|protein binding			skin(2)|ovary(1)	3						CAGGTCACTGGCATAGTTCGT	0.532													12	27	---	---	---	---	PASS
CRMP1	1400	broad.mit.edu	37	4	5868476	5868476	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5868476C>G	uc003gip.2	-	3	148	c.47G>C	c.(46-48)CGA>CCA	p.R16P	CRMP1_uc003gin.1_5'UTR|CRMP1_uc003giq.2_Missense_Mutation_p.R16P|CRMP1_uc003gir.2_Missense_Mutation_p.R11P|CRMP1_uc003gis.2_Missense_Mutation_p.R130P	NM_001313	NP_001304	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1 isoform 2	16					axon guidance|pyrimidine base catabolic process	cytosol|microtubule organizing center|spindle	dihydropyrimidinase activity|protein binding			ovary(2)	2				Colorectal(103;0.0721)		GATGAGGAGTCGGTCACTCTG	0.373													21	35	---	---	---	---	PASS
CD38	952	broad.mit.edu	37	4	15839788	15839788	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15839788G>A	uc011bxc.1	+	5	766	c.659G>A	c.(658-660)AGC>AAC	p.S220N	CD38_uc003gol.1_Missense_Mutation_p.S220N	NM_001775	NP_001766	P28907	CD38_HUMAN	CD38 antigen	220	Extracellular (Potential).				B cell receptor signaling pathway|induction of apoptosis by extracellular signals|negative regulation of apoptosis|negative regulation of transcription, DNA-dependent|positive regulation of B cell proliferation|positive regulation of transcription, DNA-dependent|response to drug	integral to membrane|plasma membrane	binding|NAD+ nucleosidase activity|receptor activity			ovary(2)	2						GACAAAAACAGGTACACATTT	0.368													5	20	---	---	---	---	PASS
ANAPC4	29945	broad.mit.edu	37	4	25419243	25419243	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25419243A>G	uc003gro.2	+	28	2210	c.2081A>G	c.(2080-2082)GAT>GGT	p.D694G	ANAPC4_uc003grp.2_Missense_Mutation_p.D580G|ANAPC4_uc003grq.2_Missense_Mutation_p.D147G	NM_013367	NP_037499	Q9UJX5	APC4_HUMAN	anaphase-promoting complex subunit 4	694					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5		Breast(46;0.0503)				TTTAGGCTAGATGAACAGTGT	0.413													23	72	---	---	---	---	PASS
EXOC1	55763	broad.mit.edu	37	4	56737265	56737265	+	Splice_Site	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56737265A>G	uc003hbe.1	+	7	990	c.832_splice	c.e7-2	p.N278_splice	EXOC1_uc003hbf.1_Splice_Site_p.N278_splice|EXOC1_uc003hbg.1_Splice_Site_p.N278_splice	NM_018261	NP_060731	Q9NV70	EXOC1_HUMAN	exocyst complex component 1 isoform 1						exocytosis|protein transport	exocyst	protein binding			ovary(2)|skin(2)|lung(1)|central_nervous_system(1)	6	Glioma(25;0.08)|all_neural(26;0.101)					CATATATTCTAGAACCACATG	0.413													11	47	---	---	---	---	PASS
TMPRSS11B	132724	broad.mit.edu	37	4	69094472	69094472	+	Silent	SNP	A	G	G	rs34044450	byFrequency	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69094472A>G	uc003hdw.3	-	9	1213	c.1077T>C	c.(1075-1077)GCT>GCC	p.A359A		NM_182502	NP_872308	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	359	Peptidase S1.|Extracellular (Potential).				proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						GACATGCATCAGCTTCTCCTG	0.323													12	51	---	---	---	---	PASS
UGT2A1	10941	broad.mit.edu	37	4	70462038	70462038	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70462038G>T	uc003hem.3	-	3	989	c.926C>A	c.(925-927)TCA>TAA	p.S309*	UGT2A1_uc011caq.1_Intron|UGT2A1_uc010ihu.2_Intron|UGT2A1_uc010iht.2_Intron|UGT2A1_uc010ihs.2_Nonsense_Mutation_p.S310*	NM_006798	NP_006789	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family,	309	Extracellular (Potential).				detection of chemical stimulus|sensory perception of smell	integral to membrane	glucuronosyltransferase activity|glucuronosyltransferase activity			ovary(1)	1						TTTGACCATTGATCCCAGAGA	0.413													12	35	---	---	---	---	PASS
C4orf35	85438	broad.mit.edu	37	4	71201608	71201608	+	Silent	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71201608T>A	uc003hff.2	+	1	938	c.852T>A	c.(850-852)ACT>ACA	p.T284T		NM_033122	NP_149113	Q96KC9	CABS1_HUMAN	testis development protein NYD-SP26	284						flagellum	calcium ion binding				0		all_hematologic(202;0.196)				GGGAAGATACTCTGCTAACTG	0.428													15	40	---	---	---	---	PASS
PRDM8	56978	broad.mit.edu	37	4	81124467	81124467	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81124467C>T	uc010ijo.2	+	8	2690	c.1851C>T	c.(1849-1851)ACC>ACT	p.T617T	PRDM8_uc003hmb.3_Silent_p.T617T|PRDM8_uc003hmc.3_Silent_p.T617T	NM_020226	NP_064611	Q9NQV8	PRDM8_HUMAN	PR domain containing 8	617					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						cCTCCTTCACCTCGCTGTGTC	0.338													5	14	---	---	---	---	PASS
PRKG2	5593	broad.mit.edu	37	4	82126129	82126129	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82126129C>A	uc003hmh.2	-	1	87	c.73G>T	c.(73-75)GCT>TCT	p.A25S	PRKG2_uc011cch.1_Missense_Mutation_p.A25S	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	25					platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						TTCCGCAGAGCATCAGTGGTG	0.527													7	32	---	---	---	---	PASS
HELQ	113510	broad.mit.edu	37	4	84342756	84342756	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84342756C>G	uc003hom.2	-	15	3088	c.2909G>C	c.(2908-2910)GGA>GCA	p.G970A	HELQ_uc010ikb.2_Missense_Mutation_p.G903A|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308	970							ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3						TGAGGCAGTTCCAGTGAGAAG	0.333								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					4	24	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85750243	85750243	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85750243G>A	uc003hpd.2	-	9	1278	c.870C>T	c.(868-870)CTC>CTT	p.L290L	WDFY3_uc003hpf.2_Silent_p.L290L	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	290						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TGGAATCTTTGAGGAAACAAG	0.393													18	60	---	---	---	---	PASS
HERC6	55008	broad.mit.edu	37	4	89358063	89358063	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89358063G>A	uc011cdi.1	+	19	2607	c.2424G>A	c.(2422-2424)TTG>TTA	p.L808L	HERC6_uc011cdj.1_Silent_p.L772L|HERC6_uc011cdk.1_RNA|HERC6_uc011cdl.1_RNA	NM_017912	NP_060382	Q8IVU3	HERC6_HUMAN	hect domain and RLD 6 isoform 1	808	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytosol	ubiquitin-protein ligase activity			lung(3)|ovary(1)|kidney(1)	5		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		TTAGGAGTTTGCAAGAAGTTC	0.299													5	18	---	---	---	---	PASS
MTTP	4547	broad.mit.edu	37	4	100534143	100534143	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100534143C>A	uc003hvc.3	+	16	2319	c.2063C>A	c.(2062-2064)TCC>TAC	p.S688Y	MTTP_uc011cej.1_Missense_Mutation_p.S715Y	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large	688					lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	AACCTTGACTCCTATGCTGGT	0.463													21	64	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134073621	134073621	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134073621C>A	uc003iha.2	+	1	3152	c.2326C>A	c.(2326-2328)CGG>AGG	p.R776R	PCDH10_uc003igz.2_Silent_p.R776R	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	776	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		CCGCCAAGCCCGGGCGCGCAA	0.602													8	16	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177071328	177071328	+	Intron	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177071328A>T	uc003iuj.2	+						WDR17_uc003iuk.2_Intron|WDR17_uc003ium.3_Intron|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_5'Flank	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1											ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TTTATCTGTAAGTATTACAGG	0.299													13	21	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177089850	177089850	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177089850G>T	uc003iuj.2	+	25	3291	c.3135G>T	c.(3133-3135)ATG>ATT	p.M1045I	WDR17_uc003iuk.2_Missense_Mutation_p.M1021I|WDR17_uc003ium.3_Missense_Mutation_p.M1006I|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Missense_Mutation_p.M256I	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	1045										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TTCTTCTGATGATTCCTGATA	0.343													9	52	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5146538	5146538	+	Silent	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5146538C>G	uc003jdl.2	+	3	609	c.471C>G	c.(469-471)TCC>TCG	p.S157S	ADAMTS16_uc003jdk.1_Silent_p.S157S|ADAMTS16_uc003jdj.1_Silent_p.S157S	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	157					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						ACAGAAACTCCTCAGTGGCCC	0.537													21	150	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5209307	5209307	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5209307G>T	uc003jdl.2	+	10	1691	c.1553G>T	c.(1552-1554)TGC>TTC	p.C518F	ADAMTS16_uc003jdk.1_Missense_Mutation_p.C518F|ADAMTS16_uc003jdj.1_Missense_Mutation_p.C518F	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	518	Disintegrin.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						AACACACAGTGCAAGTGGCAG	0.443													24	138	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5239838	5239838	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5239838C>A	uc003jdl.2	+	16	2461	c.2323C>A	c.(2323-2325)CGC>AGC	p.R775S	ADAMTS16_uc003jdk.1_Missense_Mutation_p.R775S	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	775	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CCGGAGTATCCGCATCTATGA	0.498													28	172	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9122846	9122846	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9122846C>A	uc003jek.2	-	14	2415	c.1703G>T	c.(1702-1704)CGC>CTC	p.R568L		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	568	Extracellular (Potential).|TSP type-1 1.				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						GTCGCAGGAGCGGGTTCGACA	0.652													41	50	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21854841	21854841	+	Silent	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21854841A>G	uc010iuc.2	-	4	1043	c.585T>C	c.(583-585)AGT>AGC	p.S195S	CDH12_uc011cno.1_Intron|CDH12_uc003jgk.2_Silent_p.S195S	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	195	Extracellular (Potential).|Cadherin 2.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						CGACTCTGGCACTGTTTCCAT	0.408										HNSCC(59;0.17)			14	70	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26886151	26886151	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26886151G>T	uc003jgs.1	-	10	1723	c.1554C>A	c.(1552-1554)CCC>CCA	p.P518P	CDH9_uc011cnv.1_Silent_p.P111P	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	518	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						TGTGACCTCGGGGAGGGTCAT	0.323													24	149	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31435975	31435975	+	Intron	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31435975C>A	uc003jhg.2	-						RNASEN_uc003jhh.2_Intron|RNASEN_uc003jhi.2_Intron	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						ATGGACGCTACAAAAAAAAAA	0.289													6	41	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31526589	31526589	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31526589T>C	uc003jhg.2	-	4	810	c.451A>G	c.(451-453)ATG>GTG	p.M151V	RNASEN_uc003jhh.2_Missense_Mutation_p.M151V|RNASEN_uc003jhi.2_Missense_Mutation_p.M151V|RNASEN_uc010iui.1_Missense_Mutation_p.M142V	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1	151	Pro-rich.				gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						GGATGAGGCATGGAGGGAGGG	0.577													14	12	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33535065	33535065	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33535065C>G	uc003jia.1	-	23	4642	c.4479G>C	c.(4477-4479)AAG>AAC	p.K1493N	ADAMTS12_uc010iuq.1_Missense_Mutation_p.K1408N	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1493	TSP type-1 8.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						GGACAGTCCTCTTCTGAAAGC	0.473										HNSCC(64;0.19)			23	62	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35861032	35861032	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35861032C>T	uc003jjs.2	+	2	250	c.161C>T	c.(160-162)TCA>TTA	p.S54L	IL7R_uc011coo.1_Missense_Mutation_p.S54L|IL7R_uc011cop.1_RNA	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor	54	Extracellular (Potential).				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TCGCAGCACTCACTGACCTGT	0.458													28	186	---	---	---	---	PASS
ERBB2IP	55914	broad.mit.edu	37	5	65349907	65349907	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:65349907G>C	uc003juk.1	+	21	3069	c.2761G>C	c.(2761-2763)GAT>CAT	p.D921H	ERBB2IP_uc003jui.1_Missense_Mutation_p.D921H|ERBB2IP_uc003juj.1_Missense_Mutation_p.D921H|ERBB2IP_uc011cqx.1_Missense_Mutation_p.D921H|ERBB2IP_uc011cqy.1_Missense_Mutation_p.D921H|ERBB2IP_uc011cqz.1_Intron|ERBB2IP_uc010iwx.1_Missense_Mutation_p.D917H|ERBB2IP_uc003jul.1_Missense_Mutation_p.D917H	NM_018695	NP_061165	Q96RT1	LAP2_HUMAN	ERBB2 interacting protein isoform 2	921					basal protein localization|cell adhesion|cell cycle|cell growth|epidermal growth factor receptor signaling pathway|establishment or maintenance of epithelial cell apical/basal polarity|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization	basement membrane|cytoplasm|hemidesmosome|nucleus	ErbB-2 class receptor binding|integrin binding|structural constituent of cytoskeleton			ovary(3)|lung(2)|central_nervous_system(2)	7		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		ACTGTTGTATGATCAACCATT	0.378													224	443	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82837411	82837411	+	Missense_Mutation	SNP	T	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82837411T>G	uc003kii.3	+	8	8945	c.8589T>G	c.(8587-8589)GAT>GAG	p.D2863E	VCAN_uc003kij.3_Missense_Mutation_p.D1876E|VCAN_uc010jau.2_Intron|VCAN_uc003kik.3_Intron|VCAN_uc003kil.3_Missense_Mutation_p.D1527E	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	2863	GAG-beta.				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		CCCCACAGGATTCTTTTAAGG	0.463													16	40	---	---	---	---	PASS
MCTP1	79772	broad.mit.edu	37	5	94278092	94278092	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:94278092C>A	uc003kkx.2	-	4	1021	c.1021G>T	c.(1021-1023)GGC>TGC	p.G341C	MCTP1_uc003kkv.2_Missense_Mutation_p.G120C|MCTP1_uc003kkw.2_Missense_Mutation_p.G120C|MCTP1_uc003kkz.2_Missense_Mutation_p.G2C	NM_024717	NP_078993	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1 isoform L	341	C2 1.				calcium-mediated signaling	integral to membrane|membrane fraction	calcium ion binding			ovary(2)	2		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		AAGGCTGAGCCCATAAAGTCA	0.333													7	24	---	---	---	---	PASS
REEP2	51308	broad.mit.edu	37	5	137777063	137777063	+	Intron	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137777063C>T	uc003lcz.2	+						REEP2_uc003lda.2_Intron|REEP2_uc011cyt.1_Intron	NM_016606	NP_057690	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2							integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GCGCTTCCCTCTGTCCCTCAG	0.617													11	31	---	---	---	---	PASS
REEP2	51308	broad.mit.edu	37	5	137777071	137777071	+	Intron	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137777071C>T	uc003lcz.2	+						REEP2_uc003lda.2_Intron|REEP2_uc011cyt.1_Intron	NM_016606	NP_057690	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2							integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CTCTGTCCCTCAGGTGAAATG	0.622													10	33	---	---	---	---	PASS
EGR1	1958	broad.mit.edu	37	5	137802653	137802653	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137802653C>T	uc003ldb.1	+	2	785	c.515C>T	c.(514-516)TCC>TTC	p.S172F	EGR1_uc011cyu.1_Intron	NM_001964	NP_001955	P18146	EGR1_HUMAN	early growth response 1	172					cellular response to heparin|cellular response to mycophenolic acid|glomerular mesangial cell proliferation|interleukin-1-mediated signaling pathway|positive regulation of glomerular metanephric mesangial cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of protein sumoylation|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytoplasm|nucleus	histone acetyltransferase binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GCCTCCTCGTCCTCAGCACCA	0.647													32	61	---	---	---	---	PASS
PCDHB16	57717	broad.mit.edu	37	5	140562948	140562948	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140562948G>T	uc003liv.2	+	1	1969	c.814G>T	c.(814-816)GGA>TGA	p.G272*	PCDHB16_uc010jfw.1_Intron	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	272	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTTAGACGGCGGAGCCAATGG	0.488													24	42	---	---	---	---	PASS
PCDHB16	57717	broad.mit.edu	37	5	140562949	140562949	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140562949G>T	uc003liv.2	+	1	1970	c.815G>T	c.(814-816)GGA>GTA	p.G272V	PCDHB16_uc010jfw.1_Intron	NM_020957	NP_066008	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16 precursor	272	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTAGACGGCGGAGCCAATGGA	0.488													25	40	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169410135	169410135	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169410135T>A	uc003maf.2	+	28	2943	c.2863T>A	c.(2863-2865)TAC>AAC	p.Y955N	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.Y447N|FAM196B_uc003mag.2_5'Flank	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	955	Interaction with CRKL.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTACTCCTTCTACATTGAGAC	0.468													16	47	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176638561	176638561	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176638561G>C	uc003mfr.3	+	5	3299	c.3161G>C	c.(3160-3162)AGA>ACA	p.R1054T	NSD1_uc003mft.3_Missense_Mutation_p.R785T|NSD1_uc003mfs.1_Missense_Mutation_p.R951T|NSD1_uc011dfx.1_Missense_Mutation_p.R702T	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1054					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GAGCGCAAAAGAAAACTGAAT	0.463			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			22	61	---	---	---	---	PASS
DBN1	1627	broad.mit.edu	37	5	176884733	176884733	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176884733G>A	uc003mgy.2	-	13	1974	c.1802C>T	c.(1801-1803)TCA>TTA	p.S601L	DBN1_uc011dga.1_Missense_Mutation_p.S333L|DBN1_uc003mgx.2_Missense_Mutation_p.S603L|DBN1_uc010jkn.1_Missense_Mutation_p.S551L	NM_004395	NP_004386	Q16643	DREB_HUMAN	drebrin 1 isoform a	601					actin filament organization|regulation of dendrite development|regulation of neuronal synaptic plasticity	actomyosin|cytoplasm|dendrite	actin binding|profilin binding			breast(3)|ovary(1)|lung(1)|skin(1)	6	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCCTCCTGTGATTGACTGAA	0.587											OREG0016462	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	27	---	---	---	---	PASS
GRM6	2916	broad.mit.edu	37	5	178410091	178410091	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178410091G>T	uc003mjr.2	-	9	2435	c.2256C>A	c.(2254-2256)ATC>ATA	p.I752I	GRM6_uc003mjq.2_Silent_p.I155I	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	752	Helical; Name=5; (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		CCAGGCAGCCGATGAGAGACA	0.632													6	57	---	---	---	---	PASS
ADAMTS2	9509	broad.mit.edu	37	5	178559295	178559295	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178559295A>T	uc003mjw.2	-	15	2226	c.2226T>A	c.(2224-2226)TTT>TTA	p.F742L		NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	742	Spacer.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CAGGGATCTCAAACATCTTGA	0.537													4	26	---	---	---	---	PASS
BPHL	670	broad.mit.edu	37	6	3127490	3127490	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3127490G>A	uc003mva.2	+	3	275	c.226G>A	c.(226-228)GAT>AAT	p.D76N	BPHL_uc003muz.2_RNA|BPHL_uc011dht.1_RNA|BPHL_uc003muy.2_Missense_Mutation_p.D59N	NM_004332	NP_004323	Q86WA6	BPHL_HUMAN	biphenyl hydrolase-like precursor	76					cellular amino acid metabolic process|response to toxin	mitochondrion	hydrolase activity				0	Ovarian(93;0.0386)	all_hematologic(90;0.108)				TGGAGAGACTGATTTTGGACC	0.463													14	38	---	---	---	---	PASS
KIAA0319	9856	broad.mit.edu	37	6	24596652	24596652	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24596652G>T	uc011djo.1	-	3	487	c.250C>A	c.(250-252)CAC>AAC	p.H84N	KIAA0319_uc011djp.1_Missense_Mutation_p.H39N|KIAA0319_uc003neh.1_Missense_Mutation_p.H84N|KIAA0319_uc011djq.1_Missense_Mutation_p.H75N|KIAA0319_uc011djr.1_Missense_Mutation_p.H84N	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor	84	MANSC.|Extracellular (Potential).				negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						TTCTCTTTGTGGGGGCAGCTC	0.602													10	34	---	---	---	---	PASS
LRRC16A	55604	broad.mit.edu	37	6	25581154	25581154	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25581154G>A	uc011djw.1	+	30	3121	c.2745G>A	c.(2743-2745)ATG>ATA	p.M915I	LRRC16A_uc010jpx.2_Missense_Mutation_p.M915I|LRRC16A_uc010jpy.2_Missense_Mutation_p.M915I	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	915					actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						ATTTCTAGATGACCCCTAAAT	0.388													7	3	---	---	---	---	PASS
HLA-A	3105	broad.mit.edu	37	6	29911898	29911898	+	Splice_Site	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29911898G>A	uc003nol.2	+	4	620	c.620_splice	c.e4-1	p.D207_splice	HLA-G_uc011dmb.1_Intron|HCG4P6_uc003nog.1_5'Flank|HLA-A_uc010jrq.2_Splice_Site_p.D86_splice|HLA-A_uc003nok.2_Splice_Site_p.D86_splice|HLA-A_uc003non.2_Splice_Site_p.D207_splice|HLA-A_uc003noo.2_Splice_Site_p.D207_splice|HLA-A_uc010jrr.2_Splice_Site_p.D207_splice|HLA-A_uc003nom.2_Splice_Site_p.D86_splice|HLA-A_uc010klp.2_Splice_Site_p.D179_splice|HLA-A_uc011dmc.1_Splice_Site_p.D86_splice|HLA-A_uc011dmd.1_Splice_Site_p.D86_splice	NM_002116	NP_002107	P30443	1A01_HUMAN	major histocompatibility complex, class I, A						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2						CTTCCCGTCAGACCCCCCCAA	0.572									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of|Osteosarcoma_Familial_Clustering_of|Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of	Multiple Myeloma(9;0.094)			17	151	---	---	---	---	PASS
BAT2	7916	broad.mit.edu	37	6	31599915	31599915	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31599915C>T	uc003nvb.3	+	16	3714	c.3465C>T	c.(3463-3465)GCC>GCT	p.A1155A	BAT2_uc011dnv.1_Intron|BAT2_uc003nvc.3_Silent_p.A1155A	NM_080686	NP_542417	P48634	PRC2A_HUMAN	HLA-B associated transcript-2	1155	4 X 57 AA type A repeats.					cytoplasm|nucleus	protein binding				0						GCTTCACTGCCCGGGGTGGGC	0.697													4	37	---	---	---	---	PASS
NEU1	4758	broad.mit.edu	37	6	31828012	31828012	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31828012G>A	uc003nxq.3	-	5	984	c.828C>T	c.(826-828)GTC>GTT	p.V276V	NEU1_uc010jtg.2_RNA|NEU1_uc003nxr.3_Intron|NEU1_uc010jth.2_Silent_p.V107V|NEU1_uc003nxs.3_3'UTR	NM_000434	NP_000425	Q99519	NEUR1_HUMAN	neuraminidase precursor	276						cytoplasmic membrane-bounded vesicle|lysosomal lumen|lysosomal membrane|plasma membrane	exo-alpha-sialidase activity|protein binding			ovary(1)	1					Oseltamivir(DB00198)|Zanamivir(DB00558)	GGGCATTGATGACGACTGAGC	0.577													5	30	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38941582	38941582	+	Nonsense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38941582T>A	uc003ooe.1	+	82	12620	c.12020T>A	c.(12019-12021)TTG>TAG	p.L4007*	DNAH8_uc003oog.1_Nonsense_Mutation_p.L456*	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						CCAATTACATTGCTTCAGGTT	0.388													6	35	---	---	---	---	PASS
CCND3	896	broad.mit.edu	37	6	41903775	41903775	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41903775G>C	uc003orn.2	-	5	947	c.782C>G	c.(781-783)ACC>AGC	p.T261S	CCND3_uc003orp.2_Missense_Mutation_p.T180S|CCND3_uc011duk.1_Missense_Mutation_p.T65S|CCND3_uc003orm.2_Missense_Mutation_p.T211S|CCND3_uc003oro.2_Missense_Mutation_p.T189S	NM_001760	NP_001751	P30281	CCND3_HUMAN	cyclin D3 isoform 2	261					cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding				0	Colorectal(47;0.121)		Epithelial(12;0.000178)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GCTGGAGCTGGTCTGAGAGGC	0.637			T	IGH@	MM								4	12	---	---	---	---	PASS
C6orf226	441150	broad.mit.edu	37	6	42858257	42858257	+	Silent	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42858257C>G	uc003osw.2	-	1	298	c.270G>C	c.(268-270)GCG>GCC	p.A90A		NM_001008739	NP_001008739	Q5I0X4	CF226_HUMAN	hypothetical protein LOC441150	90											0						AAGGCGCAGTCGCTGCCTCAA	0.672													15	33	---	---	---	---	PASS
PTCRA	171558	broad.mit.edu	37	6	42892021	42892021	+	Intron	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42892021C>A	uc003osx.2	+						PTCRA_uc010jxx.1_Missense_Mutation_p.P106T|PTCRA_uc010jxy.2_Intron|PTCRA_uc010jxz.2_Intron	NM_138296	NP_612153	Q6ISU1	PTCRA_HUMAN	pre T-cell antigen receptor alpha precursor							integral to membrane	receptor activity			ovary(2)	2	Colorectal(47;0.196)		all cancers(41;0.000731)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			GGTGAGTACTCCGGGCAAGGG	0.622													12	33	---	---	---	---	PASS
RUNX2	860	broad.mit.edu	37	6	45480080	45480080	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:45480080C>A	uc011dvx.1	+	7	1167	c.957C>A	c.(955-957)ACC>ACA	p.T319T	RUNX2_uc011dvy.1_Silent_p.T319T|RUNX2_uc003oxt.2_Silent_p.T305T	NM_001024630	NP_001019801	Q13950	RUNX2_HUMAN	runt-related transcription factor 2 isoform a	319	Pro/Ser/Thr-rich.				negative regulation of transcription, DNA-dependent|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3						ACTCTACCACCCCGCTGTCTT	0.587													15	48	---	---	---	---	PASS
IL17F	112744	broad.mit.edu	37	6	52103543	52103543	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52103543G>T	uc003pam.1	-	2	310	c.239C>A	c.(238-240)TCC>TAC	p.S80Y	IL17F_uc003pal.1_Missense_Mutation_p.S26Y	NM_052872	NP_443104	Q96PD4	IL17F_HUMAN	interleukin 17F precursor	80					cartilage development|inflammatory response|lymphotoxin A biosynthetic process|negative regulation of angiogenesis|proteoglycan metabolic process|regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|regulation of interleukin-2 biosynthetic process|regulation of interleukin-6 biosynthetic process|regulation of interleukin-8 biosynthetic process|regulation of transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|cytokine binding|protein homodimerization activity			ovary(1)	1	Lung NSC(77;0.116)					ATTCCAGGGGGAGGTGGAGCG	0.418													11	19	---	---	---	---	PASS
CGA	1081	broad.mit.edu	37	6	87796149	87796149	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87796149C>T	uc003plj.1	-	3	193	c.92G>A	c.(91-93)TGC>TAC	p.C31Y		NM_000735	NP_000726	P01215	GLHA_HUMAN	glycoprotein hormones, alpha polypeptide	31					hormone biosynthetic process|peptide hormone processing|signal transduction	extracellular region|soluble fraction	hormone activity			ovary(1)	1		all_cancers(76;5.98e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000102)		BRCA - Breast invasive adenocarcinoma(108;0.0484)		GCATTCTGGGCAATCTATCAG	0.368													21	51	---	---	---	---	PASS
C6orf174	387104	broad.mit.edu	37	6	127797194	127797194	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127797194C>A	uc003qbd.2	-	6	2842	c.1977G>T	c.(1975-1977)CTG>CTT	p.L659L	C6orf174_uc003qbc.2_5'Flank	NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor	659	Potential.					integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		CGTTCCTCCGCAGCAGCTCCG	0.647													17	26	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129828633	129828633	+	Splice_Site	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129828633G>A	uc003qbn.2	+	61	8809	c.8704_splice	c.e61-1	p.V2902_splice	LAMA2_uc003qbo.2_Splice_Site_p.V2898_splice|uc003qbq.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TGAATGTTTAGGTGACCTATA	0.458													17	55	---	---	---	---	PASS
EYA4	2070	broad.mit.edu	37	6	133783575	133783575	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133783575C>A	uc003qec.3	+	8	998	c.540C>A	c.(538-540)GCC>GCA	p.A180A	EYA4_uc011ecq.1_Silent_p.A126A|EYA4_uc011ecr.1_Silent_p.A126A|EYA4_uc003qed.3_Silent_p.A180A|EYA4_uc003qee.3_Silent_p.A157A|EYA4_uc011ecs.1_Silent_p.A180A|uc003qef.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a	180					anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TCTACACAGCCTACTCACAGA	0.502													38	39	---	---	---	---	PASS
MYB	4602	broad.mit.edu	37	6	135518136	135518136	+	Intron	SNP	T	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135518136T>G	uc003qfc.2	+						MYB_uc003qfh.2_Missense_Mutation_p.F414C|MYB_uc003qfi.2_Missense_Mutation_p.F398C|MYB_uc010kgi.2_Intron|MYB_uc003qfq.2_Missense_Mutation_p.F411C|MYB_uc010kgj.2_Intron|MYB_uc003qfo.2_Intron|MYB_uc003qfu.2_Intron|MYB_uc003qfl.2_Intron|MYB_uc003qfv.2_Intron|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_Intron|MYB_uc003qga.2_Intron|MYB_uc003qgb.2_Intron|MYB_uc010kgk.2_Intron|MYB_uc003qfd.2_Intron|MYB_uc003qfe.2_Intron|MYB_uc003qfg.2_Intron|MYB_uc003qff.2_Intron|MYB_uc003qfj.2_Intron|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_Intron|MYB_uc003qfk.2_Intron|MYB_uc003qfr.2_Intron|MYB_uc003qfs.2_Intron|MYB_uc003qft.2_Intron|MYB_uc003qfw.2_Intron|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_Intron|MYB_uc003qfb.1_Intron|MYB_uc003qge.1_RNA	NM_005375	NP_005366	P10242	MYB_HUMAN	v-myb myeloblastosis viral oncogene homolog						blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding			lung(1)	1	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		AGTTTTGAATTCTTTGAAGAA	0.453			T	NFIB	adenoid cystic carcinoma								45	45	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136582558	136582558	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136582558T>C	uc003qgx.1	-	12	2855	c.2602A>G	c.(2602-2604)ACT>GCT	p.T868A	BCLAF1_uc011edb.1_Missense_Mutation_p.T147A|BCLAF1_uc003qgw.1_Missense_Mutation_p.T695A|BCLAF1_uc003qgy.1_Missense_Mutation_p.T817A|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.T866A	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	868					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CGTTGAAAAGTACCACGACCT	0.413													28	260	---	---	---	---	PASS
KIAA1244	57221	broad.mit.edu	37	6	138584068	138584068	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138584068G>A	uc003qhu.2	+	12	1448	c.1448G>A	c.(1447-1449)CGG>CAG	p.R483Q		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	483					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CGCTGGCAGCGGCGAGTGCTG	0.592													3	2	---	---	---	---	PASS
VTA1	51534	broad.mit.edu	37	6	142491526	142491526	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142491526G>T	uc003qiw.2	+	4	394	c.379G>T	c.(379-381)GTC>TTC	p.V127F	VTA1_uc011edt.1_RNA|VTA1_uc011edu.1_Missense_Mutation_p.V69F	NM_016485	NP_057569	Q9NP79	VTA1_HUMAN	Vps20-associated 1 homolog	127	Interaction with IST1.				cellular membrane organization|endosome transport|protein transport	cytosol|endosome membrane	protein binding				0	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		TTTGATAGATGTCATAACAGT	0.313													63	63	---	---	---	---	PASS
ULBP1	80329	broad.mit.edu	37	6	150291161	150291161	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150291161C>G	uc003qnp.2	+	4	678	c.635C>G	c.(634-636)TCT>TGT	p.S212C		NM_025218	NP_079494	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1 precursor	212					antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|endoplasmic reticulum|MHC class I protein complex	MHC class I receptor activity			pancreas(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)		GAACCACCCTCTCTGGCCCCA	0.562													7	5	---	---	---	---	PASS
RADIL	55698	broad.mit.edu	37	7	4839816	4839816	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4839816G>A	uc003snj.1	-	13	3141	c.2968C>T	c.(2968-2970)CTG>TTG	p.L990L	RADIL_uc003sng.1_RNA|RADIL_uc003sni.1_Silent_p.L495L|RADIL_uc011jwc.1_Silent_p.L750L|RADIL_uc011jwd.1_RNA|RADIL_uc003snh.1_Silent_p.L286L	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor	990	PDZ.				cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CCGTCGATCAGGCCCATCCCC	0.697													5	13	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38398295	38398295	+	Intron	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38398295C>A	uc003tgp.1	+						uc003tgr.2_Nonsense_Mutation_p.E58*					Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		GCCTTCCCCTCCTGGTGTAGG	0.493													18	79	---	---	---	---	PASS
NUDCD3	23386	broad.mit.edu	37	7	44432005	44432005	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44432005T>A	uc003tkz.2	-	5	1052	c.866A>T	c.(865-867)AAC>ATC	p.N289I	NUDCD3_uc010kye.2_RNA	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3	289											0						GCGCTCCTTGTTGATCTTGTC	0.577													22	72	---	---	---	---	PASS
POM121	9883	broad.mit.edu	37	7	72400523	72400523	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72400523C>A	uc003twk.2	+	5	1149	c.1149C>A	c.(1147-1149)GAC>GAA	p.D383E	POM121_uc003twj.2_Missense_Mutation_p.D118E|POM121_uc010lam.1_Missense_Mutation_p.D118E	NM_172020	NP_742017	Q96HA1	P121A_HUMAN	nuclear pore membrane protein 121	383	Ser-rich.|Pore side (Potential).				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore					0		Lung NSC(55;0.163)				GCTCAGATGACCACTTGAATA	0.468													3	93	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82583224	82583224	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82583224C>A	uc003uhx.2	-	5	7334	c.7045G>T	c.(7045-7047)GCC>TCC	p.A2349S	PCLO_uc003uhv.2_Missense_Mutation_p.A2349S|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2280					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						ATTGGAAGGGCTATTACAGAA	0.433													22	51	---	---	---	---	PASS
MTERF	7978	broad.mit.edu	37	7	91503548	91503548	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91503548C>G	uc003ulb.1	-	2	604	c.560G>C	c.(559-561)GGA>GCA	p.G187A	MTERF_uc010let.1_Intron|MTERF_uc003ulc.1_Missense_Mutation_p.G187A|MTERF_uc011khm.1_Missense_Mutation_p.G167A|MTERF_uc010leu.1_Missense_Mutation_p.G167A	NM_006980	NP_008911	Q99551	MTERF_HUMAN	mitochondrial transcription termination factor	187					DNA geometric change|regulation of transcription, DNA-dependent|termination of mitochondrial transcription	mitochondrial nucleoid	double-stranded DNA binding				0	all_cancers(62;2.28e-09)|all_epithelial(64;1.07e-07)|Breast(17;0.00371)|all_hematologic(106;0.091)|all_lung(186;0.178)|Lung NSC(181;0.235)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.0993)|Kidney(17;0.118)|Epithelial(20;0.136)|LUSC - Lung squamous cell carcinoma(200;0.176)			ACGGGTCAATCCAACTGAGTA	0.373													15	34	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94039027	94039027	+	Intron	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94039027C>T	uc003ung.1	+						COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor						axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CTGCATTTTCCTTCACAGGGC	0.567										HNSCC(75;0.22)			28	60	---	---	---	---	PASS
CASD1	64921	broad.mit.edu	37	7	94163055	94163055	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94163055C>A	uc003uni.3	+	7	796	c.569C>A	c.(568-570)TCC>TAC	p.S190Y	CASD1_uc003unh.2_Missense_Mutation_p.S190Y|CASD1_uc003unj.3_Missense_Mutation_p.S190Y	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor	190						integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			AACATCACCTCCATAGCACCA	0.323													5	73	---	---	---	---	PASS
ZNF498	221785	broad.mit.edu	37	7	99227070	99227070	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99227070G>T	uc003url.1	+	8	1389	c.1062G>T	c.(1060-1062)GGG>GGT	p.G354G	ZNF498_uc003urm.1_Silent_p.G190G|ZNF498_uc010lge.1_Silent_p.G190G|ZNF498_uc003urn.2_Intron|ZNF498_uc010lgf.1_Silent_p.G282G|ZNF498_uc003uro.1_Silent_p.G138G	NM_145115	NP_660090	Q6NSZ9	ZN498_HUMAN	zinc finger and SCAN domain containing 25	354	C2H2-type 1.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_epithelial(64;1.95e-08)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					CTGAGTGTGGGAAAGGATTCA	0.587													10	43	---	---	---	---	PASS
BCAP29	55973	broad.mit.edu	37	7	107224331	107224331	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107224331C>T	uc003vej.2	+	3	436	c.97C>T	c.(97-99)CAG>TAG	p.Q33*	BCAP29_uc011kly.1_5'UTR|BCAP29_uc011klz.1_Nonsense_Mutation_p.Q33*|BCAP29_uc011kma.1_Nonsense_Mutation_p.Q33*	NM_018844	NP_061332	Q9UHQ4	BAP29_HUMAN	B-cell receptor-associated protein BAP29 isoform	33	Cytoplasmic (Potential).				apoptosis|intracellular protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|integral to membrane				large_intestine(1)|ovary(1)	2						TTACAGATGGCAGAAGATTTT	0.264													14	43	---	---	---	---	PASS
PAX4	5078	broad.mit.edu	37	7	127253085	127253085	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127253085G>C	uc010lld.1	-	6	888	c.682C>G	c.(682-684)CAG>GAG	p.Q228E	PAX4_uc003vmf.2_Missense_Mutation_p.Q226E|PAX4_uc003vmg.1_Missense_Mutation_p.Q228E|PAX4_uc003vmh.2_Missense_Mutation_p.Q226E	NM_006193	NP_006184	O43316	PAX4_HUMAN	paired box 4	236					cell differentiation|endocrine pancreas development|organ morphogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCTGGCAGCTGCATTTCCCAC	0.388													7	13	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128480920	128480920	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128480920G>C	uc003vnz.3	+	11	1918	c.1709G>C	c.(1708-1710)GGA>GCA	p.G570A	FLNC_uc003voa.3_Missense_Mutation_p.G570A	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	570	Filamin 4.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						CCAGAGGCAGGAGTGCAAAAG	0.627													6	15	---	---	---	---	PASS
MGAM	8972	broad.mit.edu	37	7	141750562	141750562	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141750562G>T	uc003vwy.2	+	24	2757	c.2703G>T	c.(2701-2703)GAG>GAT	p.E901D		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	901	Lumenal (Potential).|Maltase.				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CATTTAATGAGATTAAAATTC	0.388													10	30	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142162372	142162372	+	Intron	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142162372C>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron|uc011krw.1_5'UTR					SubName: Full=V_segment translation product; Flags: Fragment;																		ATGGCAGGTGCTCCAGGACGG	0.577													11	28	---	---	---	---	PASS
TAS2R39	259285	broad.mit.edu	37	7	142880888	142880888	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142880888G>T	uc011ksw.1	+	1	377	c.377G>T	c.(376-378)TGG>TTG	p.W126L		NM_176881	NP_795362	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	126	Helical; Name=3; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			skin(1)	1	Melanoma(164;0.059)					TGTAGCCTGTGGTTTGCTGCC	0.378													23	73	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	144707428	144707428	+	IGR	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144707428C>A								TPK1 (174282 upstream) : None (None downstream)																							TGACCCAACTCGTGAAGCTTC	0.428													37	106	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	2808633	2808633	+	Intron	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2808633T>C	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CTTCGGGACCTACCTGTCAAC	0.428													7	22	---	---	---	---	PASS
INTS10	55174	broad.mit.edu	37	8	19677966	19677966	+	Silent	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19677966A>G	uc003wzj.2	+	4	509	c.378A>G	c.(376-378)TTA>TTG	p.L126L		NM_018142	NP_060612	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	126					snRNA processing	integrator complex	protein binding			ovary(1)	1				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		TCAACACGTTAGAACGATCAG	0.403													22	42	---	---	---	---	PASS
EPB49	2039	broad.mit.edu	37	8	21931238	21931238	+	Intron	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21931238C>T	uc011kyt.1	+						EPB49_uc010ltl.2_Intron|EPB49_uc011kys.1_Intron|EPB49_uc010ltn.2_Intron|EPB49_uc011kyu.1_Intron|EPB49_uc011kyv.1_Intron|EPB49_uc010ltq.2_Intron	NM_001114136	NP_001107608	Q08495	DEMA_HUMAN	erythrocyte membrane protein band 4.9 isoform 1						actin filament bundle assembly|actin filament capping	actin cytoskeleton|nucleus	actin binding			central_nervous_system(1)	1				Colorectal(74;9.05e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0631)		TCTCCCTCCTCAGGTTACTTC	0.348													10	16	---	---	---	---	PASS
ADAM7	8756	broad.mit.edu	37	8	24298630	24298630	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24298630C>T	uc003xeb.2	+	1	122	c.9C>T	c.(7-9)CCC>CCT	p.P3P	ADAM7_uc003xea.1_Silent_p.P3P	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN	a disintegrin and metalloproteinase domain 7	3					proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		GAATGCTTCCCGGGTGTATAT	0.428													20	73	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25234921	25234921	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25234921C>T	uc003xeg.2	+	38	4054	c.3917C>T	c.(3916-3918)TCA>TTA	p.S1306L	PPP2R2A_uc003xek.2_Missense_Mutation_p.S95L|DOCK5_uc003xei.2_Missense_Mutation_p.S876L|DOCK5_uc003xej.2_RNA	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1306	DHR-2.					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GAAATCATATCATATTTCGAC	0.353													7	16	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61754539	61754539	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61754539G>T	uc003xue.2	+	21	5255	c.4778G>T	c.(4777-4779)CGT>CTT	p.R1593L		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1593					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AAGCCACGGCGTCCCCAGGAT	0.483													4	8	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61764685	61764685	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61764685A>G	uc003xue.2	+	29	6250	c.5773A>G	c.(5773-5775)AAA>GAA	p.K1925E		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1925					central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GCGCAGCTATAAAAGGCAACA	0.537													8	23	---	---	---	---	PASS
ASPH	444	broad.mit.edu	37	8	62479831	62479831	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:62479831C>A	uc003xuj.2	-	17	1465	c.1196G>T	c.(1195-1197)CGT>CTT	p.R399L	ASPH_uc011leg.1_Missense_Mutation_p.R370L|ASPH_uc003xuo.2_Missense_Mutation_p.R380L	NM_004318	NP_004309	Q12797	ASPH_HUMAN	aspartate beta-hydroxylase isoform a	399	Lumenal (Potential).				muscle contraction	integral to endoplasmic reticulum membrane	calcium ion binding|electron carrier activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity|structural constituent of muscle			ovary(3)	3	Lung SC(2;0.153)	Lung NSC(129;0.0358)|all_lung(136;0.0654)|all_epithelial(80;0.101)			L-Aspartic Acid(DB00128)|Succinic acid(DB00139)	GATGGCTCCACGTAGCACCTC	0.498													11	44	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100146912	100146912	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100146912C>G	uc003yiv.2	+	9	1370	c.1259C>G	c.(1258-1260)TCT>TGT	p.S420C	VPS13B_uc003yiw.2_Missense_Mutation_p.S420C|VPS13B_uc003yit.2_Missense_Mutation_p.S420C|VPS13B_uc003yiu.1_Missense_Mutation_p.S420C|VPS13B_uc003yix.1_5'Flank	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	420					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAAGTAAAATCTAAAGAAGTA	0.254													7	32	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103299699	103299699	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103299699C>G	uc003ykr.1	-	37	4952	c.4919G>C	c.(4918-4920)AGA>ACA	p.R1640T	UBR5_uc003yks.1_Missense_Mutation_p.R1640T	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	1640					cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			GACAACGCTTCTGCGCCCACT	0.458													11	37	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113697629	113697629	+	Intron	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113697629A>G	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AGAAACAGAAACTTACTGTTG	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			6	42	---	---	---	---	PASS
KIAA0196	9897	broad.mit.edu	37	8	126079918	126079918	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126079918C>G	uc003yrt.2	-	10	1523	c.1194G>C	c.(1192-1194)CAG>CAC	p.Q398H	KIAA0196_uc011lir.1_Missense_Mutation_p.Q250H|KIAA0196_uc003yru.1_5'UTR	NM_014846	NP_055661	Q12768	STRUM_HUMAN	strumpellin	398					cell death	WASH complex				ovary(2)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			CTGTTAGAATCTGGTCCTTGA	0.378													7	68	---	---	---	---	PASS
KIAA0196	9897	broad.mit.edu	37	8	126085518	126085518	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126085518G>C	uc003yrt.2	-	9	1356	c.1027C>G	c.(1027-1029)CAA>GAA	p.Q343E	KIAA0196_uc011lir.1_Missense_Mutation_p.Q195E	NM_014846	NP_055661	Q12768	STRUM_HUMAN	strumpellin	343					cell death	WASH complex				ovary(2)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			TTTAGAAATTGCTGCACTTGA	0.388													27	46	---	---	---	---	PASS
OC90	729330	broad.mit.edu	37	8	133045387	133045387	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133045387C>T	uc003ytg.2	-	10	758	c.758G>A	c.(757-759)AGG>AAG	p.R253K	OC90_uc011lix.1_Missense_Mutation_p.R253K	NM_001080399	NP_001073868	Q02509	OC90_HUMAN	otoconin 90	269					lipid catabolic process|phospholipid metabolic process		calcium ion binding|phospholipase A2 activity			ovary(2)|skin(1)	3	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			AGCTGTAACCCTTGTTGCAAC	0.428													3	11	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139153476	139153476	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139153476C>A	uc003yuy.2	-	17	3926	c.3755G>T	c.(3754-3756)GGA>GTA	p.G1252V	FAM135B_uc003yux.2_Missense_Mutation_p.G1153V|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1252										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GTACAGGGTTCCCAGGTGAGG	0.537										HNSCC(54;0.14)			9	32	---	---	---	---	PASS
RPL8	6132	broad.mit.edu	37	8	146015201	146015201	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146015201C>T	uc003zeb.2	-	6	873	c.762G>A	c.(760-762)GAG>GAA	p.E254E	RPL8_uc003zdz.2_RNA|RPL8_uc003zea.2_Silent_p.E218E|RPL8_uc003zec.2_Silent_p.E254E	NM_033301	NP_150644	P62917	RL8_HUMAN	ribosomal protein L8	254					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	rRNA binding|structural constituent of ribosome				0	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.191)		AGTTCTCTTTCTCCTGCACAG	0.597													44	200	---	---	---	---	PASS
KIAA2026	158358	broad.mit.edu	37	9	5921399	5921399	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5921399G>C	uc003zjq.3	-	8	4813	c.4597C>G	c.(4597-4599)CCT>GCT	p.P1533A	KIAA2026_uc010mht.2_Missense_Mutation_p.P708A	NM_001017969	NP_001017969	Q5HYC2	K2026_HUMAN	hypothetical protein LOC158358	1533										ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TGCAATGGAGGAGGAAGAGTT	0.403													4	173	---	---	---	---	PASS
PTPRD	5789	broad.mit.edu	37	9	8317909	8317909	+	Missense_Mutation	SNP	C	G	G	rs139384612		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8317909C>G	uc003zkk.2	-	45	6415	c.5704G>C	c.(5704-5706)GAG>CAG	p.E1902Q	PTPRD_uc003zkp.2_Missense_Mutation_p.E1496Q|PTPRD_uc003zkq.2_Missense_Mutation_p.E1495Q|PTPRD_uc003zkr.2_Missense_Mutation_p.E1486Q|PTPRD_uc003zks.2_Missense_Mutation_p.E1495Q|PTPRD_uc003zkl.2_Missense_Mutation_p.E1893Q|PTPRD_uc003zkm.2_Missense_Mutation_p.E1889Q|PTPRD_uc003zkn.2_Missense_Mutation_p.E1491Q|PTPRD_uc003zko.2_Missense_Mutation_p.E1492Q	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1902	Cytoplasmic (Potential).|Tyrosine-protein phosphatase 2.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CCCAGGTACTCTAGTGCGGCA	0.438										TSP Lung(15;0.13)			37	57	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14788993	14788993	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14788993G>A	uc003zlm.2	-	23	4691	c.4101C>T	c.(4099-4101)TTC>TTT	p.F1367F	FREM1_uc010mic.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1367	CSPG 9.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		GGTAGAAGGTGAAGCTATCTT	0.483													5	5	---	---	---	---	PASS
C9orf131	138724	broad.mit.edu	37	9	35045721	35045721	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35045721G>T	uc003zvw.2	+	2	3124	c.3095G>T	c.(3094-3096)CGC>CTC	p.R1032L	C9orf131_uc003zvu.2_Missense_Mutation_p.R984L|C9orf131_uc003zvv.2_Missense_Mutation_p.R959L|C9orf131_uc003zvx.2_Missense_Mutation_p.R997L	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	1032											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			CTGACCCCTCGCCACTGTAAG	0.562													4	88	---	---	---	---	PASS
CD72	971	broad.mit.edu	37	9	35616043	35616043	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35616043C>A	uc003zxb.2	-	5	709	c.585G>T	c.(583-585)ACG>ACT	p.T195T	CD72_uc003zxc.1_5'UTR|CD72_uc010mkt.1_5'UTR|CD72_uc010mku.2_Silent_p.T195T|CD72_uc010mkv.2_3'UTR|CD72_uc010mkw.1_RNA	NM_001782	NP_001773	P21854	CD72_HUMAN	CD72 molecule	195	Extracellular (Potential).				axon guidance|cell adhesion	integral to plasma membrane	receptor binding|sugar binding|transmembrane receptor activity				0			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			AGGTCTCCTTCGTCTTCTGTC	0.582													39	80	---	---	---	---	PASS
CNTNAP3	79937	broad.mit.edu	37	9	39176101	39176101	+	Intron	SNP	A	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39176101A>C	uc004abi.2	-						CNTNAP3_uc004abj.2_Intron|CNTNAP3_uc011lqr.1_Intron|CNTNAP3_uc004abk.1_Intron|CNTNAP3_uc011lqs.1_Intron|CNTNAP3_uc004abl.1_Intron	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor						cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TTAGAAAGAAAAATGACATAA	0.348													9	25	---	---	---	---	PASS
PGM5	5239	broad.mit.edu	37	9	71006545	71006545	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71006545C>T	uc004agr.2	+	5	1022	c.793C>T	c.(793-795)CAG>TAG	p.Q265*		NM_021965	NP_068800	Q15124	PGM5_HUMAN	phosphoglucomutase 5	265					cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity			ovary(1)|pancreas(1)	2						CTTTGGAGGGCAGCACCCTGA	0.478													14	27	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119976666	119976666	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119976666C>A	uc004bjs.1	-	3	1087	c.986G>T	c.(985-987)GGG>GTG	p.G329V	ASTN2_uc004bjr.1_Missense_Mutation_p.G329V|ASTN2_uc004bjt.1_Missense_Mutation_p.G329V	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	329	Cytoplasmic (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						CTTCTCTTCCCCTGGATGTCC	0.567													42	54	---	---	---	---	PASS
FAM129B	64855	broad.mit.edu	37	9	130279138	130279138	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130279138C>G	uc004brh.2	-	8	1173	c.971G>C	c.(970-972)CGA>CCA	p.R324P	FAM129B_uc004bri.2_Missense_Mutation_p.R311P|FAM129B_uc004brj.3_Missense_Mutation_p.R324P	NM_022833	NP_073744	Q96TA1	NIBL1_HUMAN	hypothetical protein LOC64855 isoform 1	324							protein binding				0						CTGCCTACCTCGGATCTTGCT	0.547													83	252	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139393419	139393419	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139393419C>A	uc004chz.2	-	33	6112	c.6112G>T	c.(6112-6114)GTG>TTG	p.V2038L		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	2038	Cytoplasmic (Potential).|ANK 4.				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	p.V2038L(1)|p.V2039L(1)		haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		ACATTGTTCACGGCGGCGGCC	0.617			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			66	75	---	---	---	---	PASS
ATP5C1	509	broad.mit.edu	37	10	7844259	7844259	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7844259G>T	uc001iju.2	+	7	742	c.664G>T	c.(664-666)GAT>TAT	p.D222Y	ATP5C1_uc009xiq.1_Missense_Mutation_p.D222Y|ATP5C1_uc010qbc.1_Missense_Mutation_p.D173Y|ATP5C1_uc001ijv.2_Missense_Mutation_p.D222Y	NM_001001973	NP_001001973	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1	222					oxidative phosphorylation|respiratory electron transport chain	mitochondrial matrix|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1)	hydrogen ion transporting ATP synthase activity, rotational mechanism|proton-transporting ATPase activity, rotational mechanism				0						TGACGATATTGATGCTGACGT	0.393													3	19	---	---	---	---	PASS
VIM	7431	broad.mit.edu	37	10	17271466	17271466	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17271466C>A	uc001iou.2	+	2	458	c.45C>A	c.(43-45)TTC>TTA	p.F15L	uc001iot.1_RNA|VIM_uc001iov.1_Missense_Mutation_p.F15L|VIM_uc001iow.1_RNA|VIM_uc001iox.1_Missense_Mutation_p.F15L|VIM_uc001ioy.1_Missense_Mutation_p.F15L|VIM_uc001ioz.1_RNA|VIM_uc001ipb.1_RNA|VIM_uc009xjv.1_Missense_Mutation_p.F15L|VIM_uc001ipc.1_Missense_Mutation_p.F15L	NM_003380	NP_003371	P08670	VIME_HUMAN	vimentin	15	Head.				cellular component disassembly involved in apoptosis|cellular component movement|interspecies interaction between organisms|muscle filament sliding	cytosol|intermediate filament	protein C-terminus binding|structural constituent of cytoskeleton			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						GCAGGATGTTCGGCGGCCCGG	0.741													4	13	---	---	---	---	PASS
ABI1	10006	broad.mit.edu	37	10	27112098	27112098	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27112098C>T	uc001isx.2	-	2	421	c.254G>A	c.(253-255)AGA>AAA	p.R85K	ABI1_uc001ite.2_Missense_Mutation_p.R85K|ABI1_uc010qdh.1_Missense_Mutation_p.R85K|ABI1_uc010qdi.1_Missense_Mutation_p.R85K|ABI1_uc001isy.2_Missense_Mutation_p.R85K|ABI1_uc001ita.2_Missense_Mutation_p.R85K|ABI1_uc001isz.2_Missense_Mutation_p.R85K|ABI1_uc001itb.2_Missense_Mutation_p.R102K|ABI1_uc001itc.2_Missense_Mutation_p.R85K|ABI1_uc010qdj.1_Missense_Mutation_p.R85K|ABI1_uc001itd.2_Missense_Mutation_p.R85K|ABI1_uc010qdk.1_Missense_Mutation_p.R85K	NM_005470	NP_005461	Q8IZP0	ABI1_HUMAN	abl-interactor 1 isoform a	85	t-SNARE coiled-coil homology.				actin polymerization or depolymerization|cellular component movement|negative regulation of cell proliferation|peptidyl-tyrosine phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	cell junction|cytoskeleton|cytosol|endoplasmic reticulum|filopodium|growth cone|lamellipodium|nucleus|soluble fraction|synapse|synaptosome	cytoskeletal protein binding			central_nervous_system(1)	1						AGACTCCATTCTCCGAAGCTG	0.368													25	78	---	---	---	---	PASS
KIF5B	3799	broad.mit.edu	37	10	32317465	32317465	+	Missense_Mutation	SNP	T	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32317465T>G	uc001iwe.3	-	15	2086	c.1616A>C	c.(1615-1617)AAA>ACA	p.K539T		NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B	539					stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				TTCCTTAAGTTTCTGAAGCTC	0.353													17	65	---	---	---	---	PASS
C10orf68	79741	broad.mit.edu	37	10	33015720	33015720	+	Silent	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33015720A>G	uc001iwn.3	+	8	1022	c.549A>G	c.(547-549)CAA>CAG	p.Q183Q	C10orf68_uc001iwl.1_Silent_p.Q191Q|C10orf68_uc001iwm.1_Silent_p.Q159Q|C10orf68_uc010qei.1_Silent_p.Q110Q|C10orf68_uc001iwo.3_5'Flank	NM_024688	NP_078964	Q9H943	CJ068_HUMAN	chromosome 10 open reading frame 68	183										skin(2)|ovary(1)	3						TCCAAATGCAAGAAAAGAAAA	0.289													3	20	---	---	---	---	PASS
ITGB1	3688	broad.mit.edu	37	10	33199357	33199357	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33199357T>C	uc001iws.3	-	14	2094	c.1958A>G	c.(1957-1959)AAT>AGT	p.N653S	ITGB1_uc001iwp.3_Missense_Mutation_p.N653S|ITGB1_uc001iwq.3_Missense_Mutation_p.N653S|ITGB1_uc001iwr.3_Missense_Mutation_p.N653S|ITGB1_uc001iwt.3_Missense_Mutation_p.N653S|ITGB1_uc001iwu.1_Missense_Mutation_p.N653S	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	653	Extracellular (Potential).				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)				TTCTCCTTTATTGAAGGCTCT	0.343													18	36	---	---	---	---	PASS
USP54	159195	broad.mit.edu	37	10	75277120	75277120	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75277120G>C	uc001juo.2	-	18	3081	c.3064C>G	c.(3064-3066)CAA>GAA	p.Q1022E	USP54_uc010qkk.1_Missense_Mutation_p.Q204E|USP54_uc001juk.2_Missense_Mutation_p.Q110E|USP54_uc001jul.2_Missense_Mutation_p.Q110E|USP54_uc001jum.2_RNA|USP54_uc001jun.2_RNA	NM_152586	NP_689799	Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1022					ubiquitin-dependent protein catabolic process		protein binding|ubiquitin thiolesterase activity			breast(3)|lung(2)|kidney(1)	6	Prostate(51;0.0112)					AGCTGTTCTTGAGCAATGCCT	0.547													14	70	---	---	---	---	PASS
PDE6C	5146	broad.mit.edu	37	10	95399935	95399935	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95399935G>C	uc001kiu.3	+	12	1729	c.1591G>C	c.(1591-1593)GAA>CAA	p.E531Q		NM_006204	NP_006195	P51160	PDE6C_HUMAN	phosphodiesterase 6C	531					visual perception	plasma membrane	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|metal ion binding			ovary(2)|kidney(1)|skin(1)	4		Colorectal(252;0.123)				ACTGTTTTTTGAAATAAATGT	0.418													21	71	---	---	---	---	PASS
ENTPD1	953	broad.mit.edu	37	10	97599541	97599541	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97599541C>G	uc001klh.3	+	3	562	c.238C>G	c.(238-240)CAA>GAA	p.Q80E	ENTPD1_uc001kle.1_Missense_Mutation_p.Q87E|ENTPD1_uc001kli.3_Missense_Mutation_p.Q87E|uc001klg.1_Intron|ENTPD1_uc010qoj.1_Missense_Mutation_p.Q92E|ENTPD1_uc010qok.1_Translation_Start_Site|ENTPD1_uc010qol.1_Translation_Start_Site|ENTPD1_uc010qom.1_Missense_Mutation_p.Q80E|ENTPD1_uc010qon.1_Translation_Start_Site|ENTPD1_uc009xva.2_Intron|ENTPD1_uc009xuz.2_RNA	NM_001776	NP_001767	P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1	80	Extracellular (Potential).				cell adhesion	integral to plasma membrane	ATP binding	p.Q80*(1)		ovary(3)	3		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		CGTGGTGCATCAAGTAGAAGA	0.473													13	68	---	---	---	---	PASS
GBF1	8729	broad.mit.edu	37	10	104112241	104112241	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104112241A>G	uc001kux.1	+	7	790	c.550A>G	c.(550-552)ACT>GCT	p.T184A	GBF1_uc001kuw.2_Missense_Mutation_p.T184A|GBF1_uc001kuy.1_Missense_Mutation_p.T184A|GBF1_uc001kuz.1_Missense_Mutation_p.T184A	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	184					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		CGCAGAGCACACTCTCGTAGA	0.498											OREG0020477	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	33	---	---	---	---	PASS
FGFR2	2263	broad.mit.edu	37	10	123239480	123239480	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123239480G>T	uc010qtk.1	-	19	3004	c.2357C>A	c.(2356-2358)ACA>AAA	p.T786K	FGFR2_uc010qtg.1_Missense_Mutation_p.T674K|FGFR2_uc010qth.1_Missense_Mutation_p.T671K|FGFR2_uc010qti.1_Intron|FGFR2_uc010qtj.1_Missense_Mutation_p.T787K|FGFR2_uc010qtl.1_Missense_Mutation_p.T670K|FGFR2_uc010qtm.1_Missense_Mutation_p.T669K|FGFR2_uc001lfg.3_Missense_Mutation_p.T394K|FGFR2_uc001lfk.1_RNA	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1	786	Cytoplasmic (Potential).				angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	AGAACTTCTTGTGTCAGGGTA	0.448		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				18	52	---	---	---	---	PASS
HTRA1	5654	broad.mit.edu	37	10	124268201	124268201	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124268201G>A	uc001lgj.2	+	6	1163	c.1035G>A	c.(1033-1035)TTG>TTA	p.L345L		NM_002775	NP_002766	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1 precursor	345	Serine protease.				proteolysis|regulation of cell growth	extracellular space	insulin-like growth factor binding|serine-type endopeptidase activity				0		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				TTAACACTTTGAAAGTGACAG	0.473													36	106	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124376784	124376784	+	Intron	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124376784A>G	uc001lgk.1	+						DMBT1_uc001lgl.1_Intron|DMBT1_uc001lgm.1_Intron|DMBT1_uc009xzz.1_Intron|DMBT1_uc010qtx.1_Intron|DMBT1_uc009yab.1_Intron	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b						epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				CAGGTAAACAATCCTCTCACC	0.453													57	183	---	---	---	---	PASS
FRG2B	441581	broad.mit.edu	37	10	135440182	135440182	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135440182G>T	uc010qvg.1	-	1	118	c.65C>A	c.(64-66)CCC>CAC	p.P22H		NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	22						nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TTGGAAAGGGGGCTGGTCAGT	0.507													17	122	---	---	---	---	PASS
DEAF1	10522	broad.mit.edu	37	11	654013	654013	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:654013C>A	uc001lqq.1	-	11	2235	c.1542G>T	c.(1540-1542)GAG>GAT	p.E514D	DEAF1_uc009ycf.1_RNA	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1	514	MYND-type.				embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		AGCCGGTGCACTCGCTCATAG	0.627													8	19	---	---	---	---	PASS
OR52M1	119772	broad.mit.edu	37	11	4566688	4566688	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4566688G>T	uc010qyf.1	+	1	268	c.268G>T	c.(268-270)GGT>TGT	p.G90C		NM_001004137	NP_001004137	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M,	90	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTTCTGGTTCGGTGCTTGTGA	0.502													17	50	---	---	---	---	PASS
C11orf16	56673	broad.mit.edu	37	11	8947274	8947274	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8947274G>T	uc001mhb.3	-	5	1064	c.940C>A	c.(940-942)CAG>AAG	p.Q314K	C11orf16_uc001mhc.3_Missense_Mutation_p.Q314K	NM_020643	NP_065694	Q9NQ32	CK016_HUMAN	hypothetical protein LOC56673	314										upper_aerodigestive_tract(1)|pancreas(1)	2				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		GGCAAAAGCTGTGCTGTGGGC	0.567													4	69	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40136891	40136891	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40136891C>A	uc001mxa.1	-	2	2916	c.952G>T	c.(952-954)GAC>TAC	p.D318Y	LRRC4C_uc001mxc.1_Missense_Mutation_p.D314Y|LRRC4C_uc001mxd.1_Missense_Mutation_p.D314Y|LRRC4C_uc001mxb.1_Missense_Mutation_p.D314Y	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	318	LRRCT.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				GGGGCCATGTCTTTTATCCAC	0.488													6	31	---	---	---	---	PASS
ALX4	60529	broad.mit.edu	37	11	44289133	44289133	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44289133C>A	uc001myb.2	-	3	921	c.817G>T	c.(817-819)GAG>TAG	p.E273*		NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4	273	Homeobox.				hair follicle development						0						CCAAAACGCTCCCGCTTCCTC	0.587													11	21	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55595023	55595023	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55595023C>G	uc001nhy.1	+	1	329	c.329C>G	c.(328-330)ACT>AGT	p.T110S		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	110	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				TGTGGAGTCACTGAGGTCTTC	0.498										HNSCC(27;0.073)			32	96	---	---	---	---	PASS
OR10AG1	282770	broad.mit.edu	37	11	55735343	55735343	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55735343C>T	uc010rit.1	-	1	597	c.597G>A	c.(595-597)ACG>ACA	p.T199T		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	199	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					GAAATGGCACCGTGATAAACA	0.408													6	17	---	---	---	---	PASS
OR5B2	390190	broad.mit.edu	37	11	58190006	58190006	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58190006G>T	uc010rkg.1	-	1	729	c.729C>A	c.(727-729)TTC>TTA	p.F243L		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	243	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AGACTGCAGTGAAGTGAGAGG	0.448													9	29	---	---	---	---	PASS
CPSF7	79869	broad.mit.edu	37	11	61196668	61196668	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61196668C>G	uc001nrq.2	-	2	174	c.40G>C	c.(40-42)GAG>CAG	p.E14Q	SDHAF2_uc001nrt.2_5'Flank|CPSF7_uc001nro.2_Missense_Mutation_p.E14Q|CPSF7_uc001nrp.2_Missense_Mutation_p.E57Q|CPSF7_uc001nrr.2_Missense_Mutation_p.E14Q|CPSF7_uc001nrs.1_5'UTR|CPSF7_uc009ynp.2_Missense_Mutation_p.E14Q	NM_001136040	NP_001129512	Q8N684	CPSF7_HUMAN	pre-mRNA cleavage factor I, 59 kDa subunit	14					mRNA 3'-end processing|nuclear mRNA splicing, via spliceosome|protein tetramerization|termination of RNA polymerase II transcription	mRNA cleavage factor complex	nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						TTGAACTCCTCGTCAGCATAT	0.488													31	151	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62285078	62285078	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62285078G>A	uc001ntl.2	-	5	17111	c.16811C>T	c.(16810-16812)TCT>TTT	p.S5604F	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	5604	Gly-rich.				nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				GTTGAGAGCAGAGGAGACTTG	0.537													53	120	---	---	---	---	PASS
C11orf48	79081	broad.mit.edu	37	11	62430634	62430634	+	Intron	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62430634G>C	uc001nue.2	-						C11orf48_uc001nuf.2_Intron|METTL12_uc001nug.1_5'Flank|METTL12_uc001nuh.2_5'Flank|SNORA57_uc009yoa.1_5'Flank|METTL12_uc010rmc.1_5'Flank	NM_024099	NP_077004	Q9BQE6	CK048_HUMAN	hypothetical protein LOC79081												0						GGCTTCCACTGAGTAAAGGGA	0.493													11	32	---	---	---	---	PASS
SF3B2	10992	broad.mit.edu	37	11	65827324	65827324	+	Silent	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65827324C>G	uc001ogy.1	+	13	1513	c.1473C>G	c.(1471-1473)CTC>CTG	p.L491L		NM_006842	NP_006833	Q13435	SF3B2_HUMAN	splicing factor 3B subunit 2	491					interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3						TGGTTCACCTCAAGGCCACTC	0.572													17	43	---	---	---	---	PASS
NPAS4	266743	broad.mit.edu	37	11	66191496	66191496	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66191496C>A	uc001ohx.1	+	7	1311	c.1135C>A	c.(1135-1137)CCT>ACT	p.P379T	NPAS4_uc010rpc.1_Missense_Mutation_p.P169T	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	379					transcription, DNA-dependent		DNA binding|signal transducer activity				0						CCCCAGTGCTCCTGAACTGAG	0.542													32	119	---	---	---	---	PASS
NDUFS8	4728	broad.mit.edu	37	11	67804071	67804071	+	3'UTR	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67804071G>T	uc001onc.2	+	7					NDUFS8_uc009ysb.1_RNA|NDUFS8_uc009ysc.1_3'UTR|TCIRG1_uc001ond.1_5'Flank|TCIRG1_uc001one.2_5'Flank	NM_002496	NP_002487	O00217	NDUS8_HUMAN	NADH dehydrogenase ubiquinone Fe-S 8 precursor						mitochondrial electron transport, NADH to ubiquinone|mitochondrial respiratory chain complex I assembly|response to oxidative stress|transport	mitochondrial respiratory chain complex I	4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity			skin(1)	1					NADH(DB00157)	CGCCCCACCGGCCCGCAGCCC	0.632													5	25	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70189808	70189808	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70189808G>A	uc001opo.2	+	15	1939	c.1741G>A	c.(1741-1743)GCC>ACC	p.A581T	PPFIA1_uc001opn.1_Missense_Mutation_p.A581T|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	581					cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TTGGGAACGTGCCCAGCAAGC	0.413													4	118	---	---	---	---	PASS
P4HA3	283208	broad.mit.edu	37	11	74013511	74013511	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74013511C>G	uc001ouz.2	-	3	513	c.470G>C	c.(469-471)GGT>GCT	p.G157A	P4HA3_uc001ouy.3_RNA|P4HA3_uc010rrj.1_Missense_Mutation_p.G157A	NM_182904	NP_878907	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha III subunit	157						endoplasmic reticulum lumen	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			skin(1)	1	Breast(11;2.31e-05)					CTGAAAGACACCTCGGGCCAG	0.562													22	88	---	---	---	---	PASS
LRRC32	2615	broad.mit.edu	37	11	76372075	76372075	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76372075T>A	uc001oxq.3	-	3	805	c.562A>T	c.(562-564)ATC>TTC	p.I188F	LRRC32_uc001oxr.3_Missense_Mutation_p.I188F|LRRC32_uc010rsf.1_Missense_Mutation_p.I188F	NM_005512	NP_005503	Q14392	LRC32_HUMAN	leucine rich repeat containing 32 precursor	188	Extracellular (Potential).|LRR 6.					integral to plasma membrane					0						CCATCCTCGATGTCCATCAGC	0.622													13	49	---	---	---	---	PASS
GDPD4	220032	broad.mit.edu	37	11	76969559	76969559	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76969559C>A	uc001oyf.2	-	10	987	c.736G>T	c.(736-738)GAC>TAC	p.D246Y		NM_182833	NP_878253	Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain	246	GDPD.|Extracellular (Potential).				glycerol metabolic process|lipid metabolic process	integral to membrane	glycerophosphodiester phosphodiesterase activity|metal ion binding			skin(1)	1						AGGTCAAAGTCATGCATGAGG	0.478													20	83	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78380188	78380188	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78380188C>G	uc001ozl.3	-	32	7665	c.7202G>C	c.(7201-7203)GGC>GCC	p.G2401A	ODZ4_uc001ozk.3_Missense_Mutation_p.G626A|ODZ4_uc009yvb.1_Missense_Mutation_p.G985A	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	2401	Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						ACCATGGTAGCCTATGATGAT	0.517													10	20	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83252873	83252873	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83252873C>T	uc001paj.2	-	15	1957	c.1654G>A	c.(1654-1656)GAC>AAC	p.D552N	DLG2_uc001pai.2_Missense_Mutation_p.D449N|DLG2_uc010rsy.1_Missense_Mutation_p.D519N|DLG2_uc010rsz.1_Missense_Mutation_p.D552N|DLG2_uc010rta.1_Missense_Mutation_p.D552N|DLG2_uc001pak.2_Missense_Mutation_p.D657N|DLG2_uc010rtb.1_Missense_Mutation_p.D519N|DLG2_uc010rsw.1_Missense_Mutation_p.D34N|DLG2_uc010rsx.1_Missense_Mutation_p.D33N	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	552	SH3.					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				AGCCCACTGTCCTTGCTCTTG	0.443													11	48	---	---	---	---	PASS
C11orf54	28970	broad.mit.edu	37	11	93494785	93494785	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93494785C>A	uc009ywi.2	+	10	1210	c.879C>A	c.(877-879)TAC>TAA	p.Y293*	C11orf54_uc001pef.2_Nonsense_Mutation_p.Y243*|C11orf54_uc001peg.2_Nonsense_Mutation_p.Y293*|C11orf54_uc001peh.2_Nonsense_Mutation_p.Y293*|C11orf54_uc001pei.2_Nonsense_Mutation_p.Y274*|C11orf54_uc001pej.2_Nonsense_Mutation_p.Y274*|C11orf54_uc001pek.2_Nonsense_Mutation_p.Y182*	NM_014039	NP_054758	Q9H0W9	CK054_HUMAN	hypothetical protein LOC28970	293						nucleus	hydrolase activity, acting on ester bonds|protein binding|zinc ion binding				0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				ATCTTGGATACTTCTTACCTG	0.378													12	60	---	---	---	---	PASS
JRKL	8690	broad.mit.edu	37	11	96125203	96125203	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:96125203G>T	uc009ywu.2	+	2	1642	c.1390G>T	c.(1390-1392)GAG>TAG	p.E464*	CCDC82_uc001pfx.3_5'Flank|CCDC82_uc009ywr.2_5'Flank|CCDC82_uc009ywt.1_5'Flank|JRKL_uc001pfy.2_Nonsense_Mutation_p.E464*	NM_003772	NP_003763	Q9Y4A0	JERKL_HUMAN	jerky homolog-like	464					central nervous system development|regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)		BRCA - Breast invasive adenocarcinoma(274;0.148)		CAGTGAAAATGAGGAGGAGGA	0.408													7	16	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	100141928	100141928	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100141928G>T	uc001pga.2	+	18	2608	c.2269G>T	c.(2269-2271)GGA>TGA	p.G757*	CNTN5_uc001pfz.2_Nonsense_Mutation_p.G757*|CNTN5_uc001pgb.2_Nonsense_Mutation_p.G683*|CNTN5_uc010ruk.1_Nonsense_Mutation_p.G28*	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	757	Fibronectin type-III 1.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TATTGGGACAGGAGATCCAAG	0.458													10	25	---	---	---	---	PASS
PGR	5241	broad.mit.edu	37	11	100920673	100920673	+	Silent	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100920673T>C	uc001pgh.2	-	6	3218	c.2475A>G	c.(2473-2475)TTA>TTG	p.L825L	PGR_uc001pgg.2_Silent_p.L206L|PGR_uc001pgi.2_Silent_p.L723L|PGR_uc009yww.1_Intron|PGR_uc001pgj.2_RNA|PGR_uc009ywx.1_RNA	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	825	Steroid-binding.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)	TATTAAGAAGTAACAATACTT	0.328													10	34	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	103029721	103029721	+	Nonsense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103029721C>G	uc001pho.2	+	28	4487	c.4343C>G	c.(4342-4344)TCA>TGA	p.S1448*	DYNC2H1_uc001phn.1_Nonsense_Mutation_p.S1448*|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1448	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		ACCAACCCATCAGTGATTCAG	0.264													3	17	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	103029734	103029734	+	Silent	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103029734T>A	uc001pho.2	+	28	4500	c.4356T>A	c.(4354-4356)TCT>TCA	p.S1452S	DYNC2H1_uc001phn.1_Silent_p.S1452S|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1452	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGATTCAGTCTCACCTGAAGA	0.254													3	14	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	103029735	103029735	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103029735C>T	uc001pho.2	+	28	4501	c.4357C>T	c.(4357-4359)CAC>TAC	p.H1453Y	DYNC2H1_uc001phn.1_Missense_Mutation_p.H1453Y|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1453	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GATTCAGTCTCACCTGAAGAA	0.254													3	14	---	---	---	---	PASS
PCSK7	9159	broad.mit.edu	37	11	117097964	117097964	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117097964G>T	uc001pqr.2	-	5	879	c.678C>A	c.(676-678)AAC>AAA	p.N226K		NM_004716	NP_004707	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7	226	Catalytic.|Extracellular (Potential).				peptide hormone processing	integral to Golgi membrane	serine-type endopeptidase activity				0	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		TGCCATGGTGGTTGCCATTCT	0.577			T	IGH@	MLCLS								7	64	---	---	---	---	PASS
CEP164	22897	broad.mit.edu	37	11	117241984	117241984	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117241984G>C	uc001prc.2	+	9	1101	c.954G>C	c.(952-954)AAG>AAC	p.K318N	CEP164_uc001prb.2_Missense_Mutation_p.K318N|CEP164_uc010rxk.1_Missense_Mutation_p.K292N|CEP164_uc001prf.2_RNA|CEP164_uc009yzp.1_RNA	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	318					cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		AAAATGAGAAGAGTGAACCTA	0.542													18	72	---	---	---	---	PASS
CXCR5	643	broad.mit.edu	37	11	118765034	118765034	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118765034G>T	uc001pue.3	+	2	891	c.781G>T	c.(781-783)GCC>TCC	p.A261S	CXCR5_uc001puf.2_Missense_Mutation_p.A216S	NM_001716	NP_001707	P32302	CXCR5_HUMAN	Burkitt lymphoma receptor 1 isoform 1	261	Helical; Name=6; (Potential).				B cell activation|cellular component movement	integral to plasma membrane	C-X-C chemokine receptor activity			breast(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		AGTCAGGGTGGCCATCCTGGT	0.632													5	22	---	---	---	---	PASS
FLI1	2313	broad.mit.edu	37	11	128680809	128680809	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128680809G>C	uc010sbu.1	+	9	1626	c.1285G>C	c.(1285-1287)GGA>CGA	p.G429R	FLI1_uc010sbt.1_Missense_Mutation_p.G236R|FLI1_uc010sbv.1_Missense_Mutation_p.G396R|FLI1_uc009zci.2_Missense_Mutation_p.G363R	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1	429					hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		CCCCACGGGGGGAATCTACCC	0.562			T	EWSR1	Ewing sarcoma								6	22	---	---	---	---	PASS
SLC6A13	6540	broad.mit.edu	37	12	344326	344326	+	Missense_Mutation	SNP	G	C	C	rs140808969	by1000genomes	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:344326G>C	uc001qic.1	-	7	814	c.761C>G	c.(760-762)ACG>AGG	p.T254R	SLC6A13_uc009zdj.1_Missense_Mutation_p.T254R|SLC6A13_uc010sdl.1_Missense_Mutation_p.T162R|SLC6A13_uc010sdm.1_Missense_Mutation_p.T135R	NM_016615	NP_057699	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter	254					neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			CCCAGGCAACGTCACCCCTCG	0.542													16	40	---	---	---	---	PASS
ERC1	23085	broad.mit.edu	37	12	1225120	1225120	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1225120C>T	uc001qjb.2	+	7	1731	c.1490C>T	c.(1489-1491)TCA>TTA	p.S497L	ERC1_uc001qiz.2_RNA|ERC1_uc001qjc.2_Missense_Mutation_p.S469L|ERC1_uc001qja.2_RNA|ERC1_uc001qjd.2_Intron|ERC1_uc001qjf.2_Missense_Mutation_p.S497L|ERC1_uc010sdv.1_Missense_Mutation_p.S245L|ERC1_uc009zdp.2_Missense_Mutation_p.S137L	NM_178040	NP_829884	Q8IUD2	RB6I2_HUMAN	RAB6-interacting protein 2 isoform epsilon	497	Potential.				I-kappaB phosphorylation|multicellular organismal development|positive regulation of anti-apoptosis|positive regulation of NF-kappaB transcription factor activity|protein transport	Golgi membrane|IkappaB kinase complex|presynaptic membrane	leucine zipper domain binding			ovary(2)|lung(2)|breast(1)	5	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			AACCAGTTCTCAGATAGTAAA	0.468													9	46	---	---	---	---	PASS
DYRK4	8798	broad.mit.edu	37	12	4700464	4700464	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4700464G>A	uc001qmx.2	+	3	278	c.118G>A	c.(118-120)GAG>AAG	p.E40K	DYRK4_uc009zeh.1_Missense_Mutation_p.E155K|DYRK4_uc001qmy.1_Missense_Mutation_p.E40K	NM_003845	NP_003836	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation	40						Golgi apparatus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(2)|skin(1)	3			Colorectal(7;0.103)			GACAGCGGCAGGTATGCCTTT	0.408													6	19	---	---	---	---	PASS
IFFO1	25900	broad.mit.edu	37	12	6650740	6650740	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6650740C>A	uc001qpd.1	-	8	1546	c.1512G>T	c.(1510-1512)ATG>ATT	p.M504I	IFFO1_uc001qoy.2_RNA|IFFO1_uc001qpa.1_Missense_Mutation_p.M144I|IFFO1_uc001qpb.1_Missense_Mutation_p.M181I|IFFO1_uc001qpe.1_RNA|IFFO1_uc010sfe.1_Missense_Mutation_p.M516I|IFFO1_uc001qpf.1_Missense_Mutation_p.M507I|IFFO1_uc001qoz.1_Missense_Mutation_p.M145I|IFFO1_uc001qpc.1_Missense_Mutation_p.M508I|IFFO1_uc001qpg.2_Missense_Mutation_p.M145I	NM_080730	NP_542768	Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan isoform 2	504						intermediate filament					0						GGCCGCGCTTCATGCTGCACA	0.657													21	100	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9311032	9311032	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9311032A>G	uc001qvl.2	-	26	3307	c.3278T>C	c.(3277-3279)CTC>CCC	p.L1093P	PZP_uc009zgl.2_Missense_Mutation_p.L879P	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						GGCATTGTTGAGCAGTGACCC	0.493													41	68	---	---	---	---	PASS
KIAA1467	57613	broad.mit.edu	37	12	13221653	13221653	+	Intron	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13221653T>A	uc001rbi.2	+						KIAA1467_uc009zhx.1_Intron	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613							integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		AAGGTAAAACTTTGGGCCTCA	0.239													17	75	---	---	---	---	PASS
PDE6H	5149	broad.mit.edu	37	12	15131001	15131001	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15131001C>A	uc001rcr.2	+	2	139	c.55C>A	c.(55-57)CCA>ACA	p.P19T		NM_006205	NP_006196	Q13956	CNCG_HUMAN	phosphodiesterase 6H	19					visual perception		3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|enzyme inhibitor activity			ovary(1)|skin(1)	2						TCCTACCACCCCACGCAAAGG	0.507													6	31	---	---	---	---	PASS
PDE6H	5149	broad.mit.edu	37	12	15131002	15131002	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15131002C>G	uc001rcr.2	+	2	140	c.56C>G	c.(55-57)CCA>CGA	p.P19R		NM_006205	NP_006196	Q13956	CNCG_HUMAN	phosphodiesterase 6H	19					visual perception		3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|enzyme inhibitor activity			ovary(1)|skin(1)	2						CCTACCACCCCACGCAAAGGC	0.502													6	31	---	---	---	---	PASS
SLCO1B1	10599	broad.mit.edu	37	12	21329714	21329714	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21329714A>T	uc001req.3	+	5	468	c.364A>T	c.(364-366)AGG>TGG	p.R122W		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	122	Extracellular (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	TTACAGTTACAGGTATTCTAA	0.294													12	68	---	---	---	---	PASS
TMTC1	83857	broad.mit.edu	37	12	29671421	29671421	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29671421C>T	uc001rjb.2	-	13	2158	c.1684G>A	c.(1684-1686)GAA>AAA	p.E562K	TMTC1_uc001riz.2_Missense_Mutation_p.E319K|TMTC1_uc001rja.2_Missense_Mutation_p.E406K|TMTC1_uc001riy.2_Missense_Mutation_p.E18K	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	670	TPR 6.					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					TACCATTCTTCAGCCATGCTG	0.473													28	163	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31278407	31278407	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31278407C>A	uc010sjy.1	-	27	3582	c.3582G>T	c.(3580-3582)TTG>TTT	p.L1194F						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		AAATGACAGCCAACAGCACAT	0.468													7	23	---	---	---	---	PASS
BICD1	636	broad.mit.edu	37	12	32459057	32459057	+	Splice_Site	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32459057G>A	uc001rku.2	+	4	1086	c.1005_splice	c.e4+1	p.Q335_splice	BICD1_uc001rkv.2_Splice_Site_p.Q335_splice|BICD1_uc010skd.1_Splice_Site	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GCTTATGCAGGTAAGAACTTT	0.413													8	24	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43944794	43944794	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43944794G>T	uc010skx.1	-	2	371	c.371C>A	c.(370-372)TCG>TAG	p.S124*		NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	124						proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GCGCAGGTCCGAGGGCCCTGC	0.667													6	18	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48372394	48372394	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48372394C>T	uc001rqu.2	-	42	3062	c.2881G>A	c.(2881-2883)GAT>AAT	p.D961N	COL2A1_uc001rqt.2_5'Flank|COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Missense_Mutation_p.D892N	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	961	Triple-helical region.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GGACCGTCATCTCCAGGCTCT	0.657													7	17	---	---	---	---	PASS
C12orf41	54934	broad.mit.edu	37	12	49065628	49065628	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49065628C>A	uc001rrx.2	-	5	738	c.663G>T	c.(661-663)AAG>AAT	p.K221N	C12orf41_uc001rrw.2_Missense_Mutation_p.K26N|C12orf41_uc001rrz.2_Missense_Mutation_p.K404N|C12orf41_uc001rry.2_RNA|C12orf41_uc001rrv.2_5'UTR	NM_017822	NP_060292	Q9H9L4	CL041_HUMAN	hypothetical protein LOC54934	221										ovary(2)	2						ATCGGCGCTTCTTCTCCTTGA	0.423													52	148	---	---	---	---	PASS
AQP2	359	broad.mit.edu	37	12	50349271	50349271	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50349271G>C	uc001rvn.2	+	4	786	c.696G>C	c.(694-696)GAG>GAC	p.E232D	AQP2_uc009zll.1_5'Flank	NM_000486	NP_000477	P41181	AQP2_HUMAN	aquaporin 2	232	Cytoplasmic (Potential).				cellular response to copper ion|cellular response to mercury ion|excretion	apical plasma membrane|integral to membrane|transport vesicle membrane	glycerol transmembrane transporter activity|water channel activity			ovary(2)	2						GCCTGTCGGAGCGCCTGGCAG	0.687													3	17	---	---	---	---	PASS
KRT79	338785	broad.mit.edu	37	12	53227729	53227729	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53227729C>G	uc001sbb.2	-	1	349	c.316G>C	c.(316-318)GGG>CGG	p.G106R		NM_175834	NP_787028	Q5XKE5	K2C79_HUMAN	keratin 6L	106	Head.					keratin filament	structural molecule activity			ovary(2)|skin(2)	4						CAAGCAGGCCCAAACGTCTGC	0.647													11	36	---	---	---	---	PASS
PAN2	9924	broad.mit.edu	37	12	56720625	56720625	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56720625G>T	uc001skx.2	-	7	1411	c.1038C>A	c.(1036-1038)GCC>GCA	p.A346A	PAN2_uc001skw.2_5'Flank|PAN2_uc001skz.2_Silent_p.A346A|PAN2_uc001sky.2_Silent_p.A346A	NM_001127460	NP_001120932	Q504Q3	PAN2_HUMAN	PAN2 polyA specific ribonuclease subunit homolog	346					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|ubiquitin-dependent protein catabolic process	cytosol|nucleus	nucleic acid binding|poly(A)-specific ribonuclease activity|ubiquitin thiolesterase activity			ovary(2)|skin(2)|large_intestine(1)|breast(1)	6						AATCCCCAAAGGCCAGAGCCT	0.562													4	87	---	---	---	---	PASS
AVPR1A	552	broad.mit.edu	37	12	63544531	63544531	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63544531C>A	uc001sro.1	-	1	2060	c.86G>T	c.(85-87)AGC>ATC	p.S29I		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	29	Extracellular (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)	GGCCTCCCGGCTTGTGTTGCC	0.701													6	34	---	---	---	---	PASS
RAB21	23011	broad.mit.edu	37	12	72167786	72167786	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72167786C>T	uc001swt.2	+	4	627	c.375C>T	c.(373-375)ATC>ATT	p.I125I		NM_014999	NP_055814	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family	125					protein transport|small GTPase mediated signal transduction	cleavage furrow|cytoplasmic vesicle membrane|early endosome membrane|endoplasmic reticulum membrane|Golgi membrane	GDP binding|GTP binding|GTPase activity|protein binding				0						GAAATGAAATCTGTTTATGTA	0.274													9	45	---	---	---	---	PASS
ATP2B1	490	broad.mit.edu	37	12	89992912	89992912	+	Silent	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89992912C>G	uc001tbh.2	-	19	3514	c.3333G>C	c.(3331-3333)CTG>CTC	p.L1111L	ATP2B1_uc001tbg.2_Silent_p.L1111L|ATP2B1_uc009zsr.2_RNA|ATP2B1_uc001tbf.2_Silent_p.L745L	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b	1111	Cytoplasmic (Potential).|Calmodulin-binding subdomain A.				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3						GGATTCTGTTCAGACCTCTAA	0.502													17	80	---	---	---	---	PASS
TMPO	7112	broad.mit.edu	37	12	98941352	98941352	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98941352G>T	uc001tfj.2	+	9	1318	c.1081G>T	c.(1081-1083)GCT>TCT	p.A361S	TMPO_uc001tfk.2_Missense_Mutation_p.A252S|TMPO_uc001tfl.2_RNA	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta	361	Nucleoplasmic (Potential).|Binds lamins B.|NAKAP95-binding C.					integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						TCCCAACAGTGCTAGTTGCCG	0.398													7	55	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99201645	99201645	+	Intron	SNP	A	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99201645A>C	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Intron|ANKS1B_uc010svd.1_Intron|ANKS1B_uc001tgd.1_Intron|ANKS1B_uc009ztq.2_Intron|ANKS1B_uc010sve.1_Missense_Mutation_p.S45A|ANKS1B_uc001tgh.3_Intron|ANKS1B_uc001tgi.2_Missense_Mutation_p.S265A|ANKS1B_uc009ztr.2_Missense_Mutation_p.S205A|ANKS1B_uc001tgj.2_Intron|ANKS1B_uc009ztp.2_Missense_Mutation_p.S46A|ANKS1B_uc010svf.1_Missense_Mutation_p.S45A|ANKS1B_uc001tgg.3_Missense_Mutation_p.S113A|ANKS1B_uc010svg.1_Intron|ANKS1B_uc009zts.1_Intron	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TGGATCGCTGAGAAAGGAAAT	0.383													9	20	---	---	---	---	PASS
SCYL2	55681	broad.mit.edu	37	12	100729640	100729640	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100729640G>C	uc001thn.2	+	16	2031	c.1981G>C	c.(1981-1983)GAG>CAG	p.E661Q	SCYL2_uc001thm.1_Missense_Mutation_p.E661Q	NM_017988	NP_060458	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 protein	661	Potential.				endosome to lysosome transport|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of clathrin-mediated endocytosis|positive regulation of receptor internalization	clathrin-coated vesicle|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|protein kinase activity|receptor binding			lung(3)|ovary(2)|skin(1)	6						GACTGGCAGTGAGTCCGAAAA	0.338													21	94	---	---	---	---	PASS
SLC17A8	246213	broad.mit.edu	37	12	100774544	100774544	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100774544A>T	uc010svi.1	+	2	480	c.167A>T	c.(166-168)CAG>CTG	p.Q56L	SLC17A8_uc009ztx.2_Missense_Mutation_p.Q56L	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent	56	Cytoplasmic (Potential).				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						AGGCCGGTGCAGACGTCCAGG	0.507													24	106	---	---	---	---	PASS
SLC17A8	246213	broad.mit.edu	37	12	100813829	100813829	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100813829T>A	uc010svi.1	+	12	1975	c.1662T>A	c.(1660-1662)AAT>AAA	p.N554K	SLC17A8_uc009ztx.2_Missense_Mutation_p.N504K	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent	554	Cytoplasmic (Potential).				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						CCTCCCAGAATTGTGAAGTCC	0.453													4	23	---	---	---	---	PASS
SELPLG	6404	broad.mit.edu	37	12	109017554	109017554	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109017554G>A	uc001tni.2	-	2	690	c.530C>T	c.(529-531)GCA>GTA	p.A177V	SELPLG_uc001tnh.2_Missense_Mutation_p.A167V|SELPLG_uc010sxe.1_Missense_Mutation_p.A193V	NM_003006	NP_002997	Q14242	SELPL_HUMAN	selectin P ligand	177	Extracellular (Potential).|12 X 10 AA tandem repeats.				blood coagulation|cellular response to interleukin-6	integral to plasma membrane|membrane fraction	bacterial cell surface binding|receptor binding				0						TTCCGTGGCTGCTGGTGGAGT	0.627													16	56	---	---	---	---	PASS
TBX3	6926	broad.mit.edu	37	12	115120793	115120793	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115120793C>T	uc001tvt.1	-	1	1177	c.213G>A	c.(211-213)GCG>GCA	p.A71A	TBX3_uc001tvu.1_Silent_p.A71A|TBX3_uc010syw.1_Silent_p.A71A	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2	71					anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding			ovary(2)|skin(1)	3	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CGGTCTCGGCCGCCCCCACCA	0.697													9	16	---	---	---	---	PASS
TBX3	6926	broad.mit.edu	37	12	115120862	115120862	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115120862G>T	uc001tvt.1	-	1	1108	c.144C>A	c.(142-144)CCC>CCA	p.P48P	TBX3_uc001tvu.1_Silent_p.P48P|TBX3_uc010syw.1_Silent_p.P48P	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2	48					anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding			ovary(2)|skin(1)	3	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CCGCGCCGTTGGGAGGCAGCG	0.711													8	22	---	---	---	---	PASS
ZNF664	144348	broad.mit.edu	37	12	124496735	124496735	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124496735G>T	uc001ufz.2	+	6	1874	c.44G>T	c.(43-45)AGA>ATA	p.R15I	ZNF664_uc001uga.2_Missense_Mutation_p.R15I|ZNF664_uc001ugb.2_Missense_Mutation_p.R15I	NM_152437	NP_689650	Q8N3J9	ZN664_HUMAN	zinc finger protein 664	15	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.000239)|OV - Ovarian serous cystadenocarcinoma(86;0.000247)|all cancers(50;0.00155)|BRCA - Breast invasive adenocarcinoma(302;0.249)		TTCTCTGAGAGAGCAGATCTT	0.353													11	34	---	---	---	---	PASS
GJB2	2706	broad.mit.edu	37	13	20763693	20763693	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20763693G>T	uc001umy.2	-	2	243	c.28C>A	c.(28-30)CTG>ATG	p.L10M		NM_004004	NP_003995	P29033	CXB2_HUMAN	gap junction protein beta 2	10	Cytoplasmic (Potential).				cell-cell signaling|cellular membrane organization|gap junction assembly|sensory perception of sound|transport	connexon complex|ER-Golgi intermediate compartment|integral to membrane					0		all_cancers(29;3.95e-22)|all_epithelial(30;2.36e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000435)|Epithelial(112;0.000722)|OV - Ovarian serous cystadenocarcinoma(117;0.0096)|Lung(94;0.0236)|LUSC - Lung squamous cell carcinoma(192;0.0738)		ACACCCCCCAGGATCGTCTGC	0.507									Keratitis_Ichthyosis_and_Deafness_syndrome		OREG0022282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	25	60	---	---	---	---	PASS
SGCG	6445	broad.mit.edu	37	13	23898647	23898647	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23898647C>T	uc001uom.2	+	8	998	c.843C>T	c.(841-843)ACC>ACT	p.T281T	SGCG_uc009zzv.2_Silent_p.T281T|SGCG_uc009zzw.2_Silent_p.T281T	NM_000231	NP_000222	Q13326	SGCG_HUMAN	gamma sarcoglycan	281	Extracellular (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)		GTGTGAGCACCACGTGCCAGG	0.627													4	16	---	---	---	---	PASS
ATP12A	479	broad.mit.edu	37	13	25280474	25280474	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25280474C>T	uc001upp.2	+	15	2229	c.2042C>T	c.(2041-2043)ACT>ATT	p.T681I	ATP12A_uc010aaa.2_Missense_Mutation_p.T687I	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A	681	Cytoplasmic (Potential).				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	GCTGTGGTGACTGGCATGGAG	0.557													7	23	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29599365	29599365	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29599365T>C	uc001usl.3	+	1	618	c.560T>C	c.(559-561)TTG>TCG	p.L187S		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	177						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						AGGCATTCTTTGGAAAGAGCA	0.537													6	34	---	---	---	---	PASS
RXFP2	122042	broad.mit.edu	37	13	32363281	32363281	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32363281C>A	uc001utt.2	+	14	1167	c.1096C>A	c.(1096-1098)CCA>ACA	p.P366T	RXFP2_uc010aba.2_Missense_Mutation_p.P325T	NM_130806	NP_570718	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	366	Extracellular (Potential).|LRR 10.					integral to membrane|plasma membrane					0		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		GATAGAGATTCCAAATATAAA	0.338													13	48	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39264179	39264179	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39264179G>T	uc001uwv.2	+	1	3007	c.2698G>T	c.(2698-2700)GTT>TTT	p.V900F		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	900	CSPG 5.|Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACAGGGCCGAGTTTCCTATGC	0.512													7	8	---	---	---	---	PASS
UGGT2	55757	broad.mit.edu	37	13	96642288	96642288	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96642288G>C	uc001vmt.2	-	8	1040	c.870C>G	c.(868-870)TTC>TTG	p.F290L	UGGT2_uc010afo.2_Intron|UGGT2_uc001vmv.2_Missense_Mutation_p.F290L|UGGT2_uc010afp.2_Missense_Mutation_p.F290L	NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	290					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						GGTATTTTTGGAATGCTGTCA	0.318													29	116	---	---	---	---	PASS
HS6ST3	266722	broad.mit.edu	37	13	97485053	97485053	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97485053G>C	uc001vmw.2	+	2	1041	c.1017G>C	c.(1015-1017)CAG>CAC	p.Q339H		NM_153456	NP_703157	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	339	Lumenal (Potential).					integral to membrane	sulfotransferase activity			ovary(1)|skin(1)	2	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					TCCTGTTGCAGAGTGCAAAGA	0.478													15	56	---	---	---	---	PASS
POTEG	404785	broad.mit.edu	37	14	19559057	19559057	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19559057C>T	uc001vuz.1	+	3	755	c.703C>T	c.(703-705)CCA>TCA	p.P235S	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	235										ovary(1)	1						TCCGAATATTCCAGATGAGTA	0.398													10	176	---	---	---	---	PASS
RNASE10	338879	broad.mit.edu	37	14	20978688	20978688	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20978688G>T	uc010tlj.1	+	1	58	c.58G>T	c.(58-60)GGG>TGG	p.G20W	RNASE10_uc001vxp.2_Missense_Mutation_p.G48W	NM_001012975	NP_001012993	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	20						extracellular region	nucleic acid binding|pancreatic ribonuclease activity				0	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		gctgggcctggggatgggcct	0.353													22	128	---	---	---	---	PASS
RNASE8	122665	broad.mit.edu	37	14	21526420	21526420	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21526420G>A	uc010tlm.1	+	1	369	c.369G>A	c.(367-369)AAG>AAA	p.K123K	NDRG2_uc010tll.1_Intron	NM_138331	NP_612204	Q8TDE3	RNAS8_HUMAN	ribonuclease, RNase A family, 8 precursor	123						extracellular region	nucleic acid binding|pancreatic ribonuclease activity				0	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;3.42e-11)|Epithelial(56;5.57e-09)|all cancers(55;2.36e-08)	GBM - Glioblastoma multiforme(265;0.0188)		ACAAAGAGAAGCACCTGAACA	0.532													76	78	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22265983	22265983	+	Intron	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22265983G>A	uc010tmf.1	+						uc010air.1_Missense_Mutation_p.S89N					SubName: Full=Putative uncharacterized protein ENSP00000374943;																		TTTATAAAGAGTAAATTCTCC	0.478													9	72	---	---	---	---	PASS
SLC22A17	51310	broad.mit.edu	37	14	23816673	23816673	+	Silent	SNP	G	A	A	rs147658314	by1000genomes	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23816673G>A	uc001wjl.2	-	7	1268	c.1212C>T	c.(1210-1212)AAC>AAT	p.N404N	SLC22A17_uc010akk.2_Intron|SLC22A17_uc001wjn.2_Intron|SLC22A17_uc001wjm.2_Intron	NM_020372	NP_065105	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17 isoform a	404					siderophore transport	integral to organelle membrane|integral to plasma membrane|vacuolar membrane	transmembrane receptor activity|transmembrane transporter activity				0	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		AAGCACCTCTGTTGGGGTTCC	0.607													16	16	---	---	---	---	PASS
MIPOL1	145282	broad.mit.edu	37	14	37739624	37739624	+	Splice_Site	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37739624G>T	uc001wuc.2	+	7	891	c.388_splice	c.e7-1	p.L130_splice	MIPOL1_uc010amr.2_Splice_Site|MIPOL1_uc001wub.3_Splice_Site_p.L99_splice|MIPOL1_uc001wud.2_Splice_Site_p.L130_splice|MIPOL1_uc010ams.2_Splice_Site_p.L130_splice|MIPOL1_uc001wue.2_Splice_Site_p.L99_splice|MIPOL1_uc010amt.2_Intron	NM_138731	NP_620059	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1											ovary(1)|central_nervous_system(1)	2	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		ATGTGCTTTAGCTTCAGCAGA	0.274													9	48	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42360510	42360510	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42360510G>T	uc001wvm.2	+	4	2641	c.1443G>T	c.(1441-1443)ATG>ATT	p.M481I	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	481	Extracellular (Potential).|Fibronectin type-III.					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CTGGAACTATGTATGACTTGT	0.408										HNSCC(30;0.082)			36	102	---	---	---	---	PASS
SOCS4	122809	broad.mit.edu	37	14	55510557	55510557	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55510557G>T	uc001xbo.2	+	3	1363	c.798G>T	c.(796-798)ACG>ACT	p.T266T	SOCS4_uc001xbp.2_Silent_p.T266T	NM_199421	NP_955453	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4	266					intracellular signal transduction|negative regulation of signal transduction|regulation of growth					ovary(1)|kidney(1)	2						AATACCACACGCAGATTGATT	0.418													9	49	---	---	---	---	PASS
NAA30	122830	broad.mit.edu	37	14	57857946	57857946	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57857946G>T	uc001xcx.3	+	2	425	c.271G>T	c.(271-273)GAA>TAA	p.E91*	NAA30_uc010trk.1_Intron|NAA30_uc010aow.2_Intron	NM_001011713	NP_001011713	Q147X3	NAA30_HUMAN	N-acetyltransferase 12	91						cytoplasm	peptide alpha-N-acetyltransferase activity			skin(1)	1						GATTAGCCCCGAACTGCGGCA	0.711													4	27	---	---	---	---	PASS
SYT16	83851	broad.mit.edu	37	14	62462942	62462942	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62462942G>C	uc001xfu.1	+	1	402	c.205G>C	c.(205-207)GAT>CAT	p.D69H	SYT16_uc010tsd.1_Missense_Mutation_p.D69H	NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	69										central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GTACTTTGAAGATGAAGAACA	0.368													28	95	---	---	---	---	PASS
ZFYVE1	53349	broad.mit.edu	37	14	73464678	73464678	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73464678A>G	uc001xnm.2	-	3	1469	c.829T>C	c.(829-831)TTC>CTC	p.F277L	ZFYVE1_uc010arj.2_Missense_Mutation_p.F277L	NM_021260	NP_067083	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1 isoform 1	277						endoplasmic reticulum|Golgi stack|perinuclear region of cytoplasm	1-phosphatidylinositol binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|zinc ion binding			skin(1)	1		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		AGGAATTTGAAGAGGTCGTTA	0.532													4	30	---	---	---	---	PASS
C14orf179	112752	broad.mit.edu	37	14	76455252	76455252	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76455252C>G	uc010asm.1	+	2	113	c.79C>G	c.(79-81)CAA>GAA	p.Q27E	C14orf179_uc001xsf.2_RNA|C14orf179_uc010asl.1_Missense_Mutation_p.Q27E|C14orf179_uc001xsg.2_Missense_Mutation_p.Q27E|C14orf179_uc010tve.1_RNA|C14orf179_uc001xse.2_Missense_Mutation_p.Q27E	NM_001102564	NP_001096034	Q96FT9	IFT43_HUMAN	hypothetical protein LOC112752 isoform 2	27					cilium morphogenesis|intraflagellar retrograde transport						0				BRCA - Breast invasive adenocarcinoma(234;0.0199)		TCGCCGAGCTCAACAGGAGTC	0.468													6	38	---	---	---	---	PASS
SNW1	22938	broad.mit.edu	37	14	78217834	78217834	+	Intron	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78217834G>T	uc001xuf.2	-						SNW1_uc010tvm.1_Intron|SNW1_uc010asu.2_Intron|SNW1_uc010tvn.1_Intron	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein						negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		CTACACATTAGAAGTAGTTAA	0.274													4	18	---	---	---	---	PASS
RIN3	79890	broad.mit.edu	37	14	93125655	93125655	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93125655G>A	uc001yap.2	+	7	2328	c.2176G>A	c.(2176-2178)GAC>AAC	p.D726N	RIN3_uc010auk.2_Missense_Mutation_p.D388N|RIN3_uc001yaq.2_Missense_Mutation_p.D651N|RIN3_uc001yar.1_Missense_Mutation_p.D388N|RIN3_uc001yas.1_Missense_Mutation_p.D388N	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	726	Interaction with RAB5B.|VPS9.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				CACCACCACTGACCTAGGTGT	0.552													17	85	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94044262	94044262	+	Silent	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94044262T>C	uc001ybv.1	+	15	1838	c.1755T>C	c.(1753-1755)AGT>AGC	p.S585S	KIAA1409_uc001ybs.1_Silent_p.S585S	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	762						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		CTTTCCAGAGTCCGTTTCGGA	0.453													47	175	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94139791	94139791	+	Missense_Mutation	SNP	T	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94139791T>G	uc001ybv.1	+	40	6466	c.6383T>G	c.(6382-6384)CTG>CGG	p.L2128R	KIAA1409_uc001ybs.1_Missense_Mutation_p.L2106R	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	2283						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		AACCTTCTTCTGCTTGTTCAG	0.383													15	55	---	---	---	---	PASS
SERPINA10	51156	broad.mit.edu	37	14	94752574	94752574	+	Silent	SNP	C	T	T	rs140430900		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94752574C>T	uc001yct.2	-	4	1480	c.1014G>A	c.(1012-1014)CCG>CCA	p.P338P	SERPINA10_uc001ycu.3_Silent_p.P338P	NM_016186	NP_057270	Q9UK55	ZPI_HUMAN	serine (or cysteine) proteinase inhibitor, clade	338					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		GCTTGAACTTCGGAAAGAAAA	0.418													10	47	---	---	---	---	PASS
C14orf49	161176	broad.mit.edu	37	14	95934295	95934295	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95934295G>A	uc001yei.3	-	2	169	c.154C>T	c.(154-156)CAG>TAG	p.Q52*	C14orf49_uc010avi.2_Nonsense_Mutation_p.Q52*|C14orf49_uc001yej.1_Nonsense_Mutation_p.Q52*	NM_152592	NP_689805	Q6ZMZ3	SYNE3_HUMAN	nesprin-3	52	Cytoplasmic (Potential).				cytoskeletal anchoring at nuclear membrane	integral to membrane|nuclear outer membrane|SUN-KASH complex	actin binding			central_nervous_system(1)	1		all_cancers(154;0.0937)		COAD - Colon adenocarcinoma(157;0.245)		GGCTCCAGCTGGCATATTTTC	0.527													6	18	---	---	---	---	PASS
TCL6	27004	broad.mit.edu	37	14	96134839	96134839	+	Intron	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96134839G>T	uc001yeq.2	+						TCL6_uc001yep.1_Intron|TCL6_uc001yes.2_3'UTR|TCL6_uc001yet.1_Intron|TCL6_uc001yeu.2_3'UTR|TCL6_uc001yev.2_3'UTR|TCL1B_uc001yew.2_Intron|TCL1B_uc001yex.2_RNA|TCL1B_uc010avj.2_RNA|TCL6_uc010avk.1_5'Flank	NM_020554	NP_065579			SubName: Full=T-cell leukemia/lymphoma 6 ORF163;												0		all_cancers(154;0.103)		Epithelial(152;0.0655)|all cancers(159;0.149)|BRCA - Breast invasive adenocarcinoma(234;0.206)|COAD - Colon adenocarcinoma(157;0.207)		ATGTGATCTGGCTACAGTTTG	0.348			T	TRA@	T-ALL								17	52	---	---	---	---	PASS
BDKRB2	624	broad.mit.edu	37	14	96706782	96706782	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96706782C>T	uc010avm.1	+	3	313	c.117C>T	c.(115-117)AAC>AAT	p.N39N	BDKRB2_uc010avl.1_3'UTR|BDKRB2_uc010twu.1_Silent_p.N12N|BDKRB2_uc001yfg.2_Silent_p.N39N	NM_000623	NP_000614	P30411	BKRB2_HUMAN	bradykinin receptor B2	39	Extracellular (Potential).				arachidonic acid secretion|elevation of cytosolic calcium ion concentration|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|breast(1)|kidney(1)	5		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)		CCACTCTTAACGGGACCTTTG	0.577													51	190	---	---	---	---	PASS
EIF5	1983	broad.mit.edu	37	14	103802201	103802201	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103802201T>C	uc001ymq.2	+	3	526	c.4T>C	c.(4-6)TCT>CCT	p.S2P	EIF5_uc001ymr.2_Missense_Mutation_p.S2P|EIF5_uc001yms.2_Missense_Mutation_p.S2P|EIF5_uc001ymt.2_Missense_Mutation_p.S2P|EIF5_uc001ymu.2_Missense_Mutation_p.S2P|SNORA28_uc001ymv.1_5'Flank	NM_001969	NP_001960	P55010	IF5_HUMAN	eukaryotic translation initiation factor 5	2					regulation of translational initiation|RNA metabolic process	cytosol	GTP binding|GTPase activity|translation initiation factor activity			pancreas(1)|breast(1)|skin(1)	3		Melanoma(154;0.155)	Epithelial(46;0.182)			AGCCAAAATGTCTGTCAATGT	0.408													27	69	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105410942	105410942	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105410942C>G	uc010axc.1	-	7	10966	c.10846G>C	c.(10846-10848)GAT>CAT	p.D3616H	AHNAK2_uc001ypx.2_Missense_Mutation_p.D3516H	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3616						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CGCCCAGCATCCAGCTTGGCC	0.592													32	137	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20658865	20658865	+	Intron	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20658865C>A	uc001ytg.2	-						uc010tyx.1_Intron|uc001yth.3_Intron|uc010tyy.1_Intron|uc010tyz.1_Intron					RecName: Full=Putative HERC2-like protein 3;																		AATATGCTAACATTTTACCCT	0.378													12	100	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25321137	25321137	+	Intron	SNP	T	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25321137T>G	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-11_uc001yxu.2_RNA|SNORD116-12_uc001yxv.1_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						AGTGAAAACTTTATACTGTCA	0.453													12	46	---	---	---	---	PASS
C15orf55	256646	broad.mit.edu	37	15	34640164	34640164	+	Intron	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34640164C>G	uc001zif.2	+						C15orf55_uc010ucc.1_Intron|C15orf55_uc010ucd.1_Intron	NM_175741	NP_786883	Q86Y26	NUT_HUMAN	nuclear protein in testis							cytoplasm|nucleus			BRD4_ENST00000263377/C15orf55(24)|BRD3/C15orf55(3)	midline_organs(25)|ovary(2)|lung(2)|skin(1)	30		all_lung(180;2.78e-08)		all cancers(64;4.53e-18)|GBM - Glioblastoma multiforme(113;8.29e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0249)		TTCTTTGTCTCAACAGCATCT	0.418			T	BRD3|BRD4	lethal midline carcinoma								14	19	---	---	---	---	PASS
C15orf52	388115	broad.mit.edu	37	15	40628970	40628970	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40628970C>G	uc001zlh.3	-	8	935	c.919G>C	c.(919-921)GAT>CAT	p.D307H	C15orf52_uc001zli.1_3'UTR|C15orf52_uc010ucn.1_Missense_Mutation_p.D97H	NM_207380	NP_997263	Q6ZUT6	CO052_HUMAN	hypothetical protein LOC388115	307										large_intestine(1)	1		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		CCTTTTCCATCAGGGAGCAAT	0.577													23	75	---	---	---	---	PASS
C15orf33	196951	broad.mit.edu	37	15	49882182	49882182	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49882182T>A	uc001zxl.2	-	4	422	c.128A>T	c.(127-129)CAT>CTT	p.H43L	C15orf33_uc001zxm.2_Missense_Mutation_p.H43L	NM_152647	NP_689860	Q96M60	CO033_HUMAN	hypothetical protein LOC196951	43										ovary(1)	1		all_lung(180;0.00187)		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)		ATCTCTAAAATGGATTTCCCT	0.303													8	49	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	54007544	54007544	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54007544C>A	uc002acj.2	-	5	402	c.360G>T	c.(358-360)CGG>CGT	p.R120R	WDR72_uc010bfi.1_Silent_p.R120R	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	120										lung(1)|skin(1)	2				all cancers(107;0.0511)		CTCCTGTCATCCGGAATGAGC	0.343													7	33	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54707198	54707198	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54707198C>T	uc002ack.2	+	17	4866	c.4866C>T	c.(4864-4866)AAC>AAT	p.N1622N	UNC13C_uc002acl.2_Silent_p.N452N	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1622					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AAGAGCTGAACATGGGAAAAA	0.303													5	21	---	---	---	---	PASS
SCAMP2	10066	broad.mit.edu	37	15	75141031	75141031	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75141031G>C	uc002azb.1	-	7	718	c.644C>G	c.(643-645)TCT>TGT	p.S215C	SCAMP2_uc002aza.1_Missense_Mutation_p.S65C|SCAMP2_uc010bkg.1_Intron	NM_005697	NP_005688	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2	215	Cytoplasmic (Potential).|Interaction with SLC9A7.				post-Golgi vesicle-mediated transport|protein transport	integral to membrane|nucleus|recycling endosome membrane|trans-Golgi network membrane	protein binding			ovary(1)	1						GAAGCTGAAAGAGTTGTCGGA	0.488													5	17	---	---	---	---	PASS
FAH	2184	broad.mit.edu	37	15	80469898	80469898	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80469898G>T	uc002bfj.2	+	12	1015	c.933G>T	c.(931-933)GCG>GCT	p.A311A	FAH_uc002bfk.1_Silent_p.A311A|FAH_uc002bfm.1_Silent_p.A311A|FAH_uc002bfn.1_Silent_p.A241A|FAH_uc010bln.1_RNA|FAH_uc010blo.1_RNA	NM_000137	NP_000128	P16930	FAAA_HUMAN	fumarylacetoacetase	311					L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	fumarylacetoacetase activity|metal ion binding				0						TGAGCCAGGCGGCTACCATAT	0.403									Tyrosinemia_type_1				17	57	---	---	---	---	PASS
CHD2	1106	broad.mit.edu	37	15	93482893	93482893	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93482893G>A	uc002bsp.2	+	7	1212	c.637G>A	c.(637-639)GAT>AAT	p.D213N	CHD2_uc002bsm.1_Missense_Mutation_p.D213N|CHD2_uc002bsn.2_Missense_Mutation_p.D213N|CHD2_uc002bso.1_Missense_Mutation_p.D213N|CHD2_uc010urb.1_Missense_Mutation_p.D226N	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	213					regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TGAGGATGATGATGATGACGA	0.443													23	63	---	---	---	---	PASS
SPATA8	145946	broad.mit.edu	37	15	97327381	97327381	+	Splice_Site	SNP	A	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97327381A>C	uc002bue.2	+	2	300	c.90_splice	c.e2-2	p.R30_splice	uc010urp.1_5'Flank|uc002bud.1_5'Flank	NM_173499	NP_775770	Q6RVD6	SPAT8_HUMAN	spermatogenesis associated 8											ovary(1)|skin(1)	2	Melanoma(26;0.0142)|Lung NSC(78;0.041)|all_lung(78;0.0468)		OV - Ovarian serous cystadenocarcinoma(32;0.0718)			TCTCTTCTGCAGAACCTCGTC	0.577													10	28	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1389610	1389610	+	Intron	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1389610C>A	uc002clk.1	+						BAIAP3_uc002clj.2_Intron|BAIAP3_uc010uuz.1_Intron|BAIAP3_uc010uva.1_Intron|BAIAP3_uc010uvb.1_Intron|BAIAP3_uc010uvc.1_Intron	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3						G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				AGCAGGTCAGCCCACCCTGAC	0.632													4	6	---	---	---	---	PASS
TELO2	9894	broad.mit.edu	37	16	1552039	1552039	+	Intron	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1552039C>T	uc002cly.2	+							NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog							chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)				CTGCTTTGCTCTCCCACAGCG	0.622													11	34	---	---	---	---	PASS
CORO7	79585	broad.mit.edu	37	16	4390417	4390417	+	Intron	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4390417A>T	uc002cwf.2	-						CORO7_uc002cwe.2_Intron|TIMM16_uc002cwd.2_Intron	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7							cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						CTAGTGGGTCACGGATAATCA	0.587													4	19	---	---	---	---	PASS
ABCC6	368	broad.mit.edu	37	16	16278887	16278887	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16278887G>A	uc002den.3	-	15	1909	c.1872C>T	c.(1870-1872)GCC>GCT	p.A624A	ABCC6_uc010bvo.2_RNA|ABCC6_uc010uzz.1_Silent_p.A636A	NM_001171	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C, member 6	624	Cytoplasmic (By similarity).				response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances	p.A624V(1)		skin(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		AATCCTTCCCGGCAGCTGCAG	0.652													6	25	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20554480	20554480	+	Silent	SNP	T	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20554480T>G	uc002dhj.3	-	12	1596	c.1386A>C	c.(1384-1386)GCA>GCC	p.A462A	ACSM2B_uc002dhk.3_Silent_p.A462A|ACSM2B_uc010bwf.1_Silent_p.A462A	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	462					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						TGATATCATCTGCCCGTCCCA	0.507													40	252	---	---	---	---	PASS
NCRNA00169	400508	broad.mit.edu	37	16	21328221	21328221	+	RNA	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21328221C>T	uc010bwr.1	+	3		c.613C>T				NR_026675				Homo sapiens cDNA FLJ41766 fis, clone IMR322006222.											central_nervous_system(1)	1						AAATGGTCCTCACATTTCTGT	0.403													32	103	---	---	---	---	PASS
PALB2	79728	broad.mit.edu	37	16	23641656	23641656	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23641656G>C	uc002dlx.1	-	5	2019	c.1819C>G	c.(1819-1821)CTC>GTC	p.L607V		NM_024675	NP_078951	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	607					double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding			lung(3)|breast(3)|ovary(2)|skin(1)|kidney(1)|pancreas(1)	11				GBM - Glioblastoma multiforme(48;0.0167)		GTGATACTGAGAAAAGACAGT	0.408			F|N|Mis			Wilms tumor|medulloblastoma|AML ,breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia_type_N|Fanconi_Anemia|PALB2-associated_Familial_Breast_and_Pancreatic_Cancer|Pancreatic_Cancer_Familial_Clustering_of				9	68	---	---	---	---	PASS
MYST1	84148	broad.mit.edu	37	16	31142524	31142524	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31142524G>C	uc002eay.2	+	11	1339	c.1321G>C	c.(1321-1323)GTC>CTC	p.V441L	MYST1_uc002eax.2_3'UTR|MYST1_uc002eaz.2_Missense_Mutation_p.V283L|MYST1_uc002eba.2_3'UTR|MYST1_uc002ebb.2_RNA	NM_032188	NP_115564	Q9H7Z6	MYST1_HUMAN	MYST histone acetyltransferase 1 isoform 1	441					histone H4-K16 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex|MSL complex	histone acetyltransferase activity|metal ion binding|methylated histone residue binding|transcription factor binding			ovary(1)	1						AGTGGACTCCGTCTGCCTCAA	0.667													5	14	---	---	---	---	PASS
ARMC5	79798	broad.mit.edu	37	16	31473871	31473871	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31473871C>T	uc002ecc.2	+	3	1532	c.1003C>T	c.(1003-1005)CGG>TGG	p.R335W	ARMC5_uc010vfn.1_Missense_Mutation_p.R430W|ARMC5_uc010vfo.1_Missense_Mutation_p.R367W|ARMC5_uc002eca.3_Missense_Mutation_p.R335W|ARMC5_uc010vfp.1_Intron|ARMC5_uc002ecb.2_Missense_Mutation_p.R335W	NM_001105247	NP_001098717	Q96C12	ARMC5_HUMAN	armadillo repeat containing 5 isoform a	335	ARM 5.						binding	p.R335C(1)		pancreas(1)	1						CCGGCAGCGCCGGGATCCTAA	0.652													11	26	---	---	---	---	PASS
NOD2	64127	broad.mit.edu	37	16	50741806	50741806	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50741806G>C	uc002egm.1	+	3	686	c.581G>C	c.(580-582)GGA>GCA	p.G194A	NOD2_uc010cbk.1_Missense_Mutation_p.G167A|NOD2_uc002egl.1_Intron|NOD2_uc010cbl.1_5'Flank|NOD2_uc010cbm.1_5'Flank|NOD2_uc010cbn.1_5'Flank|NOD2_uc010cbo.1_5'Flank	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	194	CARD 2.				activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)				AAAGCGAATGGATTGGCTGCC	0.483													25	70	---	---	---	---	PASS
NUP93	9688	broad.mit.edu	37	16	56792532	56792532	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56792532G>T	uc002eka.2	+	3	383	c.262G>T	c.(262-264)GAG>TAG	p.E88*		NM_014669	NP_055484	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	88					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2						CACCACCTTTGAGCCTCTTGA	0.537													12	42	---	---	---	---	PASS
CES2	8824	broad.mit.edu	37	16	66977219	66977219	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66977219G>T	uc002eqr.2	+	11	2630	c.1630G>T	c.(1630-1632)GAG>TAG	p.E544*	CES2_uc002eqq.2_Nonsense_Mutation_p.E528*|CES2_uc002eqs.2_Nonsense_Mutation_p.E387*	NM_003869	NP_003860	O00748	EST2_HUMAN	carboxylesterase 2 isoform 1	480					catabolic process	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)		CACTGAGGAAGAGGAGCAGCT	0.542													14	32	---	---	---	---	PASS
RLTPR	146206	broad.mit.edu	37	16	67683724	67683724	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67683724C>T	uc002etn.2	+	21	2055	c.1935C>T	c.(1933-1935)GAC>GAT	p.D645D	RLTPR_uc010cel.1_Silent_p.D638D|RLTPR_uc010vjr.1_Silent_p.D609D	NM_001013838	NP_001013860	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin	645	Tropomodulin-like.|LRR 15.									breast(1)	1		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TGGTCTGGGACCGGAACCACA	0.662													9	39	---	---	---	---	PASS
PRMT7	54496	broad.mit.edu	37	16	68390996	68390996	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68390996T>A	uc002evy.1	+	19	2224	c.1948T>A	c.(1948-1950)TAC>AAC	p.Y650N	PRMT7_uc010vlg.1_Missense_Mutation_p.Y600N|PRMT7_uc002evz.1_Missense_Mutation_p.Y422N	NM_019023	NP_061896	Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	650					cell differentiation|DNA methylation involved in gamete generation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|spliceosomal snRNP assembly|transcription, DNA-dependent	cytosol|nucleus	[myelin basic protein]-arginine N-methyltransferase activity|histone methyltransferase activity (H4-R3 specific)|protein-arginine omega-N monomethyltransferase activity|protein-arginine omega-N symmetric methyltransferase activity|ribonucleoprotein binding				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		GCAGGCCGTCTACTTCTTCAG	0.612													7	45	---	---	---	---	PASS
GLG1	2734	broad.mit.edu	37	16	74497378	74497378	+	Splice_Site	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74497378C>G	uc002fcy.3	-	20	2718	c.2668_splice	c.e20-1	p.R890_splice	GLG1_uc002fcx.2_Splice_Site_p.R890_splice|GLG1_uc002fcw.3_Splice_Site_p.R879_splice|GLG1_uc002fcz.3_Splice_Site_p.R307_splice	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						GACAGAACCTCTGCAAAGAAA	0.323													24	77	---	---	---	---	PASS
ACSF3	197322	broad.mit.edu	37	16	89211672	89211672	+	Intron	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89211672C>A	uc002fmp.2	+						ACSF3_uc010cig.1_Intron|ACSF3_uc010cih.1_Intron|ACSF3_uc002fmq.1_Intron|ACSF3_uc010cii.1_RNA|ACSF3_uc002fmr.1_Intron	NM_174917	NP_777577	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3 precursor						fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)		CCCTTTTCCTCAGGGGACACC	0.567													6	16	---	---	---	---	PASS
ZFP3	124961	broad.mit.edu	37	17	4996231	4996231	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4996231G>C	uc002gaq.2	+	2	1557	c.1432G>C	c.(1432-1434)GAG>CAG	p.E478Q		NM_153018	NP_694563	Q96NJ6	ZFP3_HUMAN	zinc finger protein-3	478	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GAAGCCTTATGAGTGCCAAGA	0.413													15	32	---	---	---	---	PASS
WSCD1	23302	broad.mit.edu	37	17	5983988	5983988	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5983988C>A	uc010cli.2	+	2	389	c.10C>A	c.(10-12)CCT>ACT	p.P4T	WSCD1_uc002gcn.2_Missense_Mutation_p.P4T|WSCD1_uc002gco.2_Missense_Mutation_p.P4T|WSCD1_uc010clj.2_5'UTR	NM_015253	NP_056068	Q658N2	WSCD1_HUMAN	WSC domain containing 1	4						integral to membrane	sulfotransferase activity				0						CATGGCCAAACCTTTCTTCCG	0.657													9	26	---	---	---	---	PASS
KIAA0753	9851	broad.mit.edu	37	17	6531662	6531662	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6531662C>A	uc002gde.3	-	3	852	c.493G>T	c.(493-495)GAA>TAA	p.E165*	KIAA0753_uc010clo.2_5'UTR|KIAA0753_uc010vte.1_5'UTR	NM_014804	NP_055619	Q2KHM9	K0753_HUMAN	hypothetical protein LOC9851	165						centrosome					0				COAD - Colon adenocarcinoma(228;0.157)		CTGGAGATTTCTACTTTGGAT	0.488													11	31	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578265A>C	uc002gim.2	-	6	778	c.584T>G	c.(583-585)ATC>AGC	p.I195S	TP53_uc002gig.1_Missense_Mutation_p.I195S|TP53_uc002gih.2_Missense_Mutation_p.I195S|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.I63S|TP53_uc010cng.1_Missense_Mutation_p.I63S|TP53_uc002gii.1_Missense_Mutation_p.I63S|TP53_uc010cnh.1_Missense_Mutation_p.I195S|TP53_uc010cni.1_Missense_Mutation_p.I195S|TP53_uc002gij.2_Missense_Mutation_p.I195S|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.I102S|TP53_uc002gio.2_Missense_Mutation_p.I63S|TP53_uc010vug.1_Missense_Mutation_p.I156S	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	195	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|I -> N (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.I195T(61)|p.I195F(16)|p.I195N(12)|p.0?(7)|p.I195S(4)|p.A189_V197delAPPQHLIRV(4)|p.I195fs*14(3)|p.I195fs*52(3)|p.K164_P219del(1)|p.I195L(1)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.H193_I195delHLI(1)|p.H193_I195>AP(1)|p.I195fs*12(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTCCACTCGGATAAGATGCTG	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			8	25	---	---	---	---	PASS
TMEM107	84314	broad.mit.edu	37	17	8076845	8076845	+	3'UTR	SNP	A	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8076845A>C	uc002gkg.3	-	5					TMEM107_uc002gkh.3_3'UTR|TMEM107_uc002gki.3_3'UTR|TMEM107_uc002gkj.3_RNA	NM_183065	NP_898888	Q6UX40	TM107_HUMAN	transmembrane protein 107 isoform 2							integral to membrane					0						tgcatctccaatcatcatgtt	0.134													8	21	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10366280	10366280	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10366280G>A	uc002gmn.2	-	11	1021	c.910C>T	c.(910-912)CTT>TTT	p.L304F	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	304	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						GTGATCAGAAGCATTTCTGAA	0.433													11	18	---	---	---	---	PASS
SPAG5	10615	broad.mit.edu	37	17	26906445	26906445	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26906445C>T	uc002hbq.2	-	18	3035	c.2943G>A	c.(2941-2943)CAG>CAA	p.Q981Q	ALDOC_uc002hbp.2_5'Flank|ALDOC_uc010cro.2_5'Flank	NM_006461	NP_006452	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	981	Potential.				cell division|mitosis|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytoplasm|spindle pole	protein binding			central_nervous_system(1)	1	Lung NSC(42;0.00431)					AACAAAGACTCTGAAGCTCAG	0.493													38	89	---	---	---	---	PASS
MYO18A	399687	broad.mit.edu	37	17	27449231	27449231	+	Missense_Mutation	SNP	T	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27449231T>G	uc002hdt.1	-	3	1198	c.1040A>C	c.(1039-1041)AAT>ACT	p.N347T	MYO18A_uc010wbc.1_5'Flank|MYO18A_uc002hds.2_5'UTR|MYO18A_uc010csa.1_Missense_Mutation_p.N347T|MYO18A_uc002hdu.1_Missense_Mutation_p.N347T|MYO18A_uc010wbd.1_Missense_Mutation_p.N16T	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	347					anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CTCCGTCTCATTCCAGGCCTC	0.552													3	4	---	---	---	---	PASS
CCDC55	84081	broad.mit.edu	37	17	28499605	28499605	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28499605G>T	uc002heu.2	+	3	188	c.160G>T	c.(160-162)GCC>TCC	p.A54S	CCDC55_uc002hev.2_5'UTR|CCDC55_uc010wbl.1_5'UTR|CCDC55_uc010wbm.1_5'UTR|CCDC55_uc002hex.2_5'UTR	NM_032141	NP_115517	Q9H0G5	NSRP1_HUMAN	coiled-coil domain containing 55 isoform 1	54					developmental process|nucleocytoplasmic transport|regulation of alternative nuclear mRNA splicing, via spliceosome	nuclear speck|ribonucleoprotein complex	mRNA binding|protein binding				0						TAAGAAGCAGGCCATGAAACA	0.383													6	23	---	---	---	---	PASS
CCL2	6347	broad.mit.edu	37	17	32582450	32582450	+	Intron	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32582450G>T	uc002hhy.2	+							NM_002982	NP_002973	P13500	CCL2_HUMAN	small inducible cytokine A2 precursor						angiogenesis|anti-apoptosis|apoptotic cell clearance|astrocyte cell migration|cell adhesion|cellular response to interferon-gamma|cellular response to interleukin-1|cellular response to lipopolysaccharide|cellular response to tumor necrosis factor|G-protein signaling, coupled to cyclic nucleotide second messenger|helper T cell extravasation|humoral immune response|inflammatory response|JAK-STAT cascade|macrophage chemotaxis|monocyte chemotaxis|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of T cell activation|viral genome replication	extracellular space	CCR2 chemokine receptor binding|chemokine activity|protein kinase activity|signal transducer activity			pancreas(1)	1	Breast(3;0.00224)	Ovarian(249;0.0694)|Breast(31;0.151)|Lung NSC(157;0.153)		UCEC - Uterine corpus endometrioid carcinoma (308;0.000241)|BRCA - Breast invasive adenocarcinoma(366;0.0103)	Atorvastatin(DB01076)|Danazol(DB01406)|Mimosine(DB01055)|Simvastatin(DB00641)	GCCAGGTAAGGCCCCCTCTTC	0.537													7	28	---	---	---	---	PASS
GAS2L2	246176	broad.mit.edu	37	17	34072636	34072636	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34072636G>T	uc002hjv.1	-	6	1908	c.1880C>A	c.(1879-1881)TCT>TAT	p.S627Y		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	627					cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GATGACCCCAGACCTTGTGCC	0.577													39	117	---	---	---	---	PASS
KRT13	3860	broad.mit.edu	37	17	39658978	39658978	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39658978G>T	uc002hwu.1	-	5	1047	c.984C>A	c.(982-984)CTC>CTA	p.L328L	KRT13_uc002hwv.1_Silent_p.L328L|KRT13_uc002hww.2_Silent_p.L221L|KRT13_uc010wfr.1_Silent_p.L221L|KRT13_uc010cxo.2_Silent_p.L328L|KRT13_uc002hwx.1_Silent_p.L316L	NM_153490	NP_705694	P13646	K1C13_HUMAN	keratin 13 isoform a	328	Rod.|Coil 2.				epidermis development	intermediate filament	structural molecule activity			ovary(2)|skin(2)|pancreas(1)	5		Breast(137;0.000286)				CCAGGCCTTGGAGCGTGCGCC	0.587													35	98	---	---	---	---	PASS
KRT17	3872	broad.mit.edu	37	17	39777062	39777062	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39777062C>A	uc002hxh.2	-	6	1151	c.1030G>T	c.(1030-1032)GGG>TGG	p.G344W	JUP_uc010wfs.1_Intron	NM_000422	NP_000413	Q04695	K1C17_HUMAN	keratin 17	344	Peptide epitope S4; induces T-cell and keratinocyte proliferation and IFN-gamma production.|Coil 2.|Rod.				epidermis development	cytoplasm|intermediate filament	protein binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2		Breast(137;0.000307)				CCAATCAGCCCCTGGATCTGG	0.607									Steatocystoma_Multiplex				13	54	---	---	---	---	PASS
ACLY	47	broad.mit.edu	37	17	40062774	40062774	+	Intron	SNP	C	G	G	rs62076883	by1000genomes	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40062774C>G	uc002hyg.2	-						ACLY_uc002hyh.2_Intron|ACLY_uc002hyi.2_Intron|ACLY_uc010wfx.1_Intron|ACLY_uc010wfy.1_Intron	NM_001096	NP_001087	P53396	ACLY_HUMAN	ATP citrate lyase isoform 1						ATP catabolic process|cellular carbohydrate metabolic process|citrate metabolic process|coenzyme A metabolic process|energy reserve metabolic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|triglyceride biosynthetic process	citrate lyase complex|cytosol|nucleus	ATP binding|ATP citrate synthase activity|citrate (pro-3S)-lyase activity|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			ovary(2)|central_nervous_system(1)	3		Breast(137;0.000143)				CAACCCCCTTCGGTCACCTGT	0.602													14	66	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41246589	41246589	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41246589C>G	uc002icq.2	-	10	1191	c.959G>C	c.(958-960)AGA>ACA	p.R320T	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.R249T|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.R273T|BRCA1_uc002ict.2_Missense_Mutation_p.R320T|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.R320T|BRCA1_uc002ide.1_Missense_Mutation_p.R151T|BRCA1_uc010cyy.1_Missense_Mutation_p.R320T|BRCA1_uc010whs.1_Missense_Mutation_p.R320T|BRCA1_uc010cyz.2_Missense_Mutation_p.R273T|BRCA1_uc010cza.2_Missense_Mutation_p.R294T|BRCA1_uc010wht.1_Missense_Mutation_p.R24T	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	320					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCCAGCCCATCTGTTATGTTG	0.413			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			28	114	---	---	---	---	PASS
TMEM106A	113277	broad.mit.edu	37	17	41365217	41365217	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41365217G>A	uc002idn.1	+	3	394	c.157G>A	c.(157-159)GAT>AAT	p.D53N	TMEM106A_uc010why.1_Missense_Mutation_p.D5N|TMEM106A_uc010cze.1_Missense_Mutation_p.D53N|TMEM106A_uc010whz.1_Missense_Mutation_p.D53N	NM_145041	NP_659478	Q96A25	T106A_HUMAN	transmembrane protein 106A	53						integral to membrane					0		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		AGGAACTGCTGATGCCAGCTT	0.552													23	61	---	---	---	---	PASS
TANC2	26115	broad.mit.edu	37	17	61432617	61432617	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61432617G>A	uc002jal.3	+	12	2249	c.2226G>A	c.(2224-2226)CAG>CAA	p.Q742Q	TANC2_uc010wpe.1_Silent_p.Q652Q|TANC2_uc002jam.1_Silent_p.Q109Q	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and	742							binding			ovary(2)	2						AGGATTTTCAGCAGAGAATGG	0.478													8	29	---	---	---	---	PASS
ERN1	2081	broad.mit.edu	37	17	62175585	62175585	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62175585C>T	uc002jdz.2	-	2	184	c.71G>A	c.(70-72)AGC>AAC	p.S24N		NM_001433	NP_001424	O75460	ERN1_HUMAN	endoplasmic reticulum to nucleus signalling 1	24	Lumenal (Potential).				activation of signaling protein activity involved in unfolded protein response|apoptosis|cell cycle arrest|induction of apoptosis|mRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to endoplasmic reticulum membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(4)|lung(2)|stomach(1)|ovary(1)|kidney(1)	9						CGTCACTGTGCTGGTACTTCC	0.448													13	31	---	---	---	---	PASS
TMC6	11322	broad.mit.edu	37	17	76116838	76116838	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76116838C>A	uc002juj.1	-	12	1737	c.1611G>T	c.(1609-1611)CAG>CAT	p.Q537H	TMC6_uc002jui.1_Intron|TMC6_uc010dhf.1_Missense_Mutation_p.Q370H|TMC6_uc002juk.2_Missense_Mutation_p.Q537H|TMC6_uc010dhg.1_Intron|TMC6_uc002jul.1_Missense_Mutation_p.Q537H|TMC6_uc002jum.3_Missense_Mutation_p.Q328H|TMC6_uc002jun.3_Missense_Mutation_p.Q537H|TMC6_uc002juo.2_3'UTR	NM_007267	NP_009198	Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	537	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane					0			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AGCACTGGCCCTGCAGGACGC	0.622									Epidermodysplasia_Verruciformis_Familial_Clustering_of				23	65	---	---	---	---	PASS
USP36	57602	broad.mit.edu	37	17	76794637	76794637	+	Intron	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76794637G>C	uc002jvz.1	-						USP36_uc002jwa.1_Intron|USP36_uc002jvy.1_Intron	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36						ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			TCTTTTCCTAGACCAAGAATC	0.498													28	95	---	---	---	---	PASS
P4HB	5034	broad.mit.edu	37	17	79803439	79803439	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79803439T>C	uc002kbn.1	-	9	1554	c.1357A>G	c.(1357-1359)ACG>GCG	p.T453A	P4HB_uc002kbl.1_Missense_Mutation_p.T130A|P4HB_uc002kbm.1_Missense_Mutation_p.T130A	NM_000918	NP_000909	P07237	PDIA1_HUMAN	prolyl 4-hydroxylase, beta subunit precursor	453	Thioredoxin 2.				cell redox homeostasis|glycerol ether metabolic process|lipid metabolic process|lipoprotein metabolic process|peptidyl-proline hydroxylation to 4-hydroxy-L-proline	cell surface|endoplasmic reticulum lumen|ER-Golgi intermediate compartment|extracellular region|melanosome|plasma membrane	electron carrier activity|procollagen-proline 4-dioxygenase activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0509)			AGGCGCACCGTCCTGTCGGCA	0.642													5	12	---	---	---	---	PASS
NOTUM	147111	broad.mit.edu	37	17	79910847	79910847	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79910847T>A	uc010wvg.1	-	11	1753	c.1481A>T	c.(1480-1482)AAC>ATC	p.N494I		NM_178493	NP_848588	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog precursor	494						extracellular region	hydrolase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CTAGCTTCCGTTGCTCAGCAT	0.667													24	67	---	---	---	---	PASS
FN3K	64122	broad.mit.edu	37	17	80708298	80708298	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80708298G>C	uc010wvs.1	+	6	658	c.597G>C	c.(595-597)AAG>AAC	p.K199N	TBCD_uc002kfx.1_5'Flank|TBCD_uc002kfy.1_5'Flank|TBCD_uc002kfz.2_5'Flank	NM_022158	NP_071441	Q9H479	FN3K_HUMAN	fructosamine 3 kinase	199					fructoselysine metabolic process		fructosamine-3-kinase activity				0	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			CGTAGGTGAAGATCCCGGATC	0.577													18	26	---	---	---	---	PASS
LPIN2	9663	broad.mit.edu	37	18	2920816	2920816	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2920816C>G	uc002klo.2	-	19	2745	c.2506G>C	c.(2506-2508)GGT>CGT	p.G836R		NM_014646	NP_055461	Q92539	LPIN2_HUMAN	lipin 2	836	C-LIP.				fatty acid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|triglyceride biosynthetic process	cytosol|endoplasmic reticulum membrane|nucleus	phosphatidate phosphatase activity|transcription coactivator activity			ovary(1)|skin(1)	2				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		ATTAATTCACCCTTGGGGTTC	0.493													7	56	---	---	---	---	PASS
RBBP8	5932	broad.mit.edu	37	18	20570896	20570896	+	Intron	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20570896G>C	uc002ktw.2	+						RBBP8_uc002kty.2_Intron|RBBP8_uc002ktz.2_Intron|RBBP8_uc002kua.2_Intron|RBBP8_uc002ktx.1_Intron	NM_002894	NP_002885	Q99708	COM1_HUMAN	retinoblastoma binding protein 8 isoform a						cell cycle checkpoint|DNA double-strand break processing involved in repair via single-strand annealing|meiosis|regulation of transcription from RNA polymerase II promoter	nucleus	damaged DNA binding|protein binding|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)|lung(1)|skin(1)	3	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			ttttACTCTTGAAGGAAACTC	0.239								Direct_reversal_of_damage|Homologous_recombination					3	16	---	---	---	---	PASS
SLC14A2	8170	broad.mit.edu	37	18	43262473	43262473	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43262473G>A	uc010dnj.2	+	21	3073	c.2752G>A	c.(2752-2754)GAT>AAT	p.D918N	SLC14A2_uc002lbe.2_Missense_Mutation_p.D918N	NM_007163	NP_009094	Q15849	UT2_HUMAN	solute carrier family 14 (urea transporter),	918						apical plasma membrane|integral to membrane|membrane fraction	protein binding|urea transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|skin(1)	4						TCAGGCCTACGATGTCTCCTA	0.498													9	36	---	---	---	---	PASS
KIAA0427	9811	broad.mit.edu	37	18	46145966	46145966	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46145966C>T	uc002ldc.2	+	2	315	c.30C>T	c.(28-30)TCC>TCT	p.S10S	KIAA0427_uc002ldd.2_Silent_p.S10S	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1	10	Interaction with NCBP1/CBP80.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						CATCAGCCTCCTCGGAGGCAG	0.637													5	4	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2216567	2216567	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2216567G>T	uc002lvb.3	+	20	2247	c.2211G>T	c.(2209-2211)CAG>CAT	p.Q737H	DOT1L_uc002lvc.1_Missense_Mutation_p.Q31H|uc002lvd.1_5'Flank|DOT1L_uc002lve.1_Missense_Mutation_p.Q31H	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	737						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACACGCCCCAGTACCTGGCCT	0.672													15	46	---	---	---	---	PASS
ZNF556	80032	broad.mit.edu	37	19	2878324	2878324	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2878324G>T	uc002lwp.1	+	4	1455	c.1368G>T	c.(1366-1368)AAG>AAT	p.K456N	ZNF556_uc002lwq.2_Missense_Mutation_p.K455N	NM_024967	NP_079243	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	456					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTACATCTAAGTAATGGGGGA	0.333													4	41	---	---	---	---	PASS
STAP2	55620	broad.mit.edu	37	19	4333705	4333705	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4333705C>A	uc002mab.2	-	3	380	c.283G>T	c.(283-285)GAG>TAG	p.E95*	STAP2_uc002mac.2_Nonsense_Mutation_p.E95*|STAP2_uc002mad.2_5'UTR	NM_001013841	NP_001013863	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	95	PH.					cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		AACTTGATCTCCTGATCCCGG	0.537													10	26	---	---	---	---	PASS
C3	718	broad.mit.edu	37	19	6678018	6678018	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6678018C>G	uc002mfm.2	-	41	4929	c.4867G>C	c.(4867-4869)GGG>CGG	p.G1623R	C3_uc002mfl.2_Missense_Mutation_p.G359R	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor	1623	NTR.				complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		GTGTCCTTCCCGATGATGTAG	0.622													14	53	---	---	---	---	PASS
INSR	3643	broad.mit.edu	37	19	7117363	7117363	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7117363C>T	uc002mgd.1	-	22	3962	c.3853G>A	c.(3853-3855)GAG>AAG	p.E1285K	INSR_uc002mge.1_Missense_Mutation_p.E1273K	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	1285	Protein kinase.|Cytoplasmic (Potential).				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTGACAATCTCCAGGAAGGTT	0.597													16	55	---	---	---	---	PASS
EVI5L	115704	broad.mit.edu	37	19	7913882	7913882	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7913882C>T	uc002min.2	+	4	557	c.403C>T	c.(403-405)CCC>TCC	p.P135S	EVI5L_uc010xjz.1_Missense_Mutation_p.P135S|EVI5L_uc002mio.1_5'Flank	NM_145245	NP_660288	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like isoform	135	Rab-GAP TBC.					intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						CACGGACATGCCCGTCAAGAA	0.642													3	25	---	---	---	---	PASS
ICAM1	3383	broad.mit.edu	37	19	10394882	10394882	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10394882T>C	uc002mnq.2	+	4	1130	c.811T>C	c.(811-813)TCG>CCG	p.S271P	ICAM1_uc010xle.1_Missense_Mutation_p.S49P|ICAM4_uc002mnr.1_5'Flank|ICAM4_uc002mns.1_5'Flank|ICAM4_uc002mnt.1_5'Flank	NM_000201	NP_000192	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1 precursor	271	Ig-like C2-type 3.|Extracellular (Potential).				adhesion to symbiont|heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking|positive regulation of cellular extravasation|regulation of immune response|regulation of leukocyte mediated cytotoxicity|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell|virion attachment, binding of host cell surface receptor	extracellular space|integral to plasma membrane	integrin binding|transmembrane receptor activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Natalizumab(DB00108)|Simvastatin(DB00641)	CGACTCCTTCTCGGCCAAGGC	0.627													9	31	---	---	---	---	PASS
KANK2	25959	broad.mit.edu	37	19	11304442	11304442	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11304442C>T	uc010dxv.2	-	6	872	c.314G>A	c.(313-315)CGT>CAT	p.R105H	KANK2_uc002mqm.2_Missense_Mutation_p.R105H|KANK2_uc002mqo.3_Missense_Mutation_p.R105H|KANK2_uc002mqp.1_Translation_Start_Site|KANK2_uc002mqq.2_Missense_Mutation_p.R105H	NM_015493	NP_056308	Q63ZY3	KANK2_HUMAN	ankyrin repeat domain 25 isoform 1	105											0						GTAGAAGCCACGGCCGCAGTA	0.667													13	44	---	---	---	---	PASS
TNPO2	30000	broad.mit.edu	37	19	12814277	12814277	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12814277G>A	uc002muo.2	-	19	2359	c.2174C>T	c.(2173-2175)GCC>GTC	p.A725V	TNPO2_uc002mup.2_Missense_Mutation_p.A817V|TNPO2_uc002muq.2_Missense_Mutation_p.A725V|TNPO2_uc002mur.2_Missense_Mutation_p.A725V	NM_001136196	NP_001129668	O14787	TNPO2_HUMAN	transportin 2 (importin 3, karyopherin beta 2b)	725	HEAT 12.				intracellular protein transport	cytoplasm|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			ovary(1)	1						GGCCCAGGTGGCGTTGTTGCA	0.607													18	68	---	---	---	---	PASS
AKAP8	10270	broad.mit.edu	37	19	15479110	15479110	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15479110C>A	uc002nav.2	-	9	1157	c.1096G>T	c.(1096-1098)GAT>TAT	p.D366Y	AKAP8_uc010dzy.2_5'UTR|AKAP8_uc010dzz.1_RNA|AKAP8_uc010xog.1_Missense_Mutation_p.D180Y	NM_005858	NP_005849	O43823	AKAP8_HUMAN	A-kinase anchor protein 8	366					signal transduction	nuclear matrix				ovary(1)|breast(1)	2						ttcttcacatcctcgtcctcg	0.458													12	72	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22155187	22155187	+	Missense_Mutation	SNP	A	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22155187A>C	uc002nqp.2	-	5	2498	c.2349T>G	c.(2347-2349)CAT>CAG	p.H783Q	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TCTCTCCAGTATGAATTTTCT	0.373													18	46	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31767946	31767946	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31767946G>A	uc002nsy.3	-	2	2818	c.2753C>T	c.(2752-2754)TCA>TTA	p.S918L		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	918	Homeobox; atypical.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					CTTCCCTTCTGAGGTCTGCCG	0.632													4	18	---	---	---	---	PASS
LRP3	4037	broad.mit.edu	37	19	33698454	33698454	+	Silent	SNP	C	T	T	rs150965907		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33698454C>T	uc010edh.2	+	7	2379	c.2286C>T	c.(2284-2286)AGC>AGT	p.S762S	LRP3_uc002nuk.3_Silent_p.S636S	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	762	Cytoplasmic (Potential).				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					TGGAGGCCAGCGATGATGAGG	0.652													5	10	---	---	---	---	PASS
ZNF181	339318	broad.mit.edu	37	19	35231910	35231910	+	Silent	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35231910A>G	uc002nvu.3	+	4	1087	c.624A>G	c.(622-624)AAA>AAG	p.K208K	ZNF181_uc010xsa.1_Silent_p.K207K|ZNF181_uc010xsb.1_Silent_p.K207K|ZNF181_uc010xsc.1_Silent_p.K143K	NM_001029997	NP_001025168	Q2M3W8	ZN181_HUMAN	zinc finger protein 181 isoform 1	208					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			GTGGAAAGAAACTTTTGAATT	0.343													11	90	---	---	---	---	PASS
NPHS1	4868	broad.mit.edu	37	19	36330159	36330159	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36330159T>A	uc002oby.2	-	22	3089	c.3089A>T	c.(3088-3090)CAG>CTG	p.Q1030L	NPHS1_uc010eem.1_RNA	NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	1030	Fibronectin type-III.|Extracellular (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GATGGGAAGCTGGGTCCCTTT	0.473													22	52	---	---	---	---	PASS
GGN	199720	broad.mit.edu	37	19	38876086	38876086	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38876086G>T	uc002oij.1	-	3	1951	c.1816C>A	c.(1816-1818)CGC>AGC	p.R606S	GGN_uc002oik.1_RNA|GGN_uc010efy.1_3'UTR	NM_152657	NP_689870	Q86UU5	GGN_HUMAN	gametogenetin	606	Interactions with ZNF403/GGNBP2 and OAZ3 (By similarity).				cell differentiation|multicellular organismal development|spermatogenesis						0	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CGTGGCAGGCGGCGATGGCGT	0.637													4	23	---	---	---	---	PASS
SAMD4B	55095	broad.mit.edu	37	19	39866417	39866417	+	Silent	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39866417C>G	uc002olb.2	+	7	1830	c.795C>G	c.(793-795)CCC>CCG	p.P265P	SAMD4B_uc002ola.2_Silent_p.P265P	NM_018028	NP_060498	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	265							protein binding				0	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			TTACCACGCCCGATCACGCAC	0.647													16	115	---	---	---	---	PASS
CEACAM8	1088	broad.mit.edu	37	19	43092999	43092999	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43092999A>T	uc002oud.2	-	4	997	c.895T>A	c.(895-897)TGC>AGC	p.C299S	uc010eif.1_Intron|uc010eig.1_Intron|uc010eih.1_Intron	NM_001816	NP_001807	P31997	CEAM8_HUMAN	carcinoembryonic antigen-related cell adhesion	299	Ig-like C2-type 2.				immune response	anchored to membrane|extracellular space|integral to plasma membrane				ovary(1)	1		Prostate(69;0.00899)				GTGGTGTGGCAGGCATAGGAT	0.493													16	65	---	---	---	---	PASS
PHLDB3	653583	broad.mit.edu	37	19	43998909	43998909	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43998909T>C	uc002own.3	-	9	1353	c.1094A>G	c.(1093-1095)CAC>CGC	p.H365R	PHLDB3_uc010eit.2_Missense_Mutation_p.H69R	NM_198850	NP_942147	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B,	365											0		Prostate(69;0.0153)				GGCAGCGGAGTGGGCCACGGC	0.592													4	10	---	---	---	---	PASS
SYMPK	8189	broad.mit.edu	37	19	46318944	46318944	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46318944C>T	uc002pdn.2	-	27	3944	c.3699G>A	c.(3697-3699)GCG>GCA	p.A1233A	RSPH6A_uc002pdm.2_5'Flank	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	1233					cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		TCAGCCCGCCCGCTGCCGTCT	0.701													3	13	---	---	---	---	PASS
SYMPK	8189	broad.mit.edu	37	19	46331129	46331129	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46331129G>A	uc002pdn.2	-	15	2278	c.2033C>T	c.(2032-2034)GCC>GTC	p.A678V	SYMPK_uc002pdo.1_Missense_Mutation_p.A678V|SYMPK_uc002pdp.1_Missense_Mutation_p.A678V	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	678					cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CACCTCCAGGGCACTCTCTGT	0.652													29	101	---	---	---	---	PASS
IGFL3	388555	broad.mit.edu	37	19	46627157	46627157	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46627157G>A	uc002pea.1	-	3	361	c.336C>T	c.(334-336)TCC>TCT	p.S112S		NM_207393	NP_997276	Q6UXB1	IGFL3_HUMAN	IGF-like family member 3 precursor	112						extracellular region	protein binding				0		Ovarian(192;0.0175)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00473)|GBM - Glioblastoma multiforme(486;0.0149)|Epithelial(262;0.239)		TACAGCTCCGGGAGATGGGAG	0.493													51	165	---	---	---	---	PASS
SLC8A2	6543	broad.mit.edu	37	19	47969318	47969318	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47969318C>T	uc002pgx.2	-	2	621	c.343G>A	c.(343-345)GAG>AAG	p.E115K	SLC8A2_uc010xyq.1_Intron|SLC8A2_uc010xyr.1_Intron|SLC8A2_uc010ele.2_Missense_Mutation_p.E115K	NM_015063	NP_055878	Q9UPR5	NAC2_HUMAN	solute carrier family 8 member 2 precursor	115	Cytoplasmic (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(1)	4		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		ACGCTGGTCTCACCGTTGGCC	0.577													13	48	---	---	---	---	PASS
PNKP	11284	broad.mit.edu	37	19	50365447	50365447	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50365447G>A	uc002pqh.2	-	11	1173	c.1121C>T	c.(1120-1122)CCT>CTT	p.P374L	PNKP_uc002pqg.2_Missense_Mutation_p.P155L|PNKP_uc002pqi.2_Missense_Mutation_p.P335L|PNKP_uc002pqj.2_Missense_Mutation_p.P374L|PNKP_uc010enm.2_Missense_Mutation_p.P343L|PNKP_uc002pqk.2_Missense_Mutation_p.P374L	NM_007254	NP_009185	Q96T60	PNKP_HUMAN	polynucleotide kinase 3' phosphatase	374	ATP (Potential).				DNA damage response, detection of DNA damage|DNA-dependent DNA replication|nucleotide-excision repair, DNA damage removal|response to oxidative stress|response to radiation	nucleolus	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|damaged DNA binding|double-stranded DNA binding|endonuclease activity|nucleotide kinase activity|polynucleotide 3'-phosphatase activity|protein binding			ovary(1)|kidney(1)	2		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		CTTACCCCCAGGGAATCCCAC	0.692								Other_BER_factors					4	8	---	---	---	---	PASS
LILRA5	353514	broad.mit.edu	37	19	54822998	54822998	+	Intron	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54822998G>T	uc002qfe.2	-						LILRA5_uc002qff.2_Intron|LILRA5_uc010yev.1_Intron|LILRA5_uc010yew.1_Intron|LILRA5_uc002qfh.1_Intron|LILRA5_uc002qfg.1_Intron	NM_021250	NP_067073	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor subfamily						innate immune response	extracellular region|integral to membrane	receptor activity			upper_aerodigestive_tract(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TAGGAGAGAAGGAGGCACCGT	0.612													9	48	---	---	---	---	PASS
LILRA2	11027	broad.mit.edu	37	19	55086198	55086198	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55086198G>C	uc002qgg.3	+	4	442	c.353G>C	c.(352-354)GGA>GCA	p.G118A	LILRA2_uc010ern.2_Missense_Mutation_p.G118A|LILRA2_uc002qgf.2_Missense_Mutation_p.G118A|LILRA2_uc010yfe.1_Missense_Mutation_p.G118A|LILRA2_uc010yff.1_Missense_Mutation_p.G106A|LILRA2_uc010ero.2_Missense_Mutation_p.G106A|LILRA2_uc010yfg.1_Missense_Mutation_p.G118A	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	118	Extracellular (Potential).|Ig-like C2-type 2.				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		TCTCTCCTAGGAGCCTACAGC	0.607													11	71	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55494355	55494355	+	Missense_Mutation	SNP	T	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55494355T>G	uc002qij.2	+	6	1375	c.1289T>G	c.(1288-1290)CTG>CGG	p.L430R	NLRP2_uc010yfp.1_Missense_Mutation_p.L407R|NLRP2_uc010esn.2_Missense_Mutation_p.L406R|NLRP2_uc010eso.2_Missense_Mutation_p.L427R|NLRP2_uc010esp.2_Missense_Mutation_p.L408R	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	430	NACHT.				apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GGGCTGTTCCTGCGTTTCCTC	0.721													4	8	---	---	---	---	PASS
ZNF470	388566	broad.mit.edu	37	19	57089577	57089577	+	Nonsense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57089577G>T	uc002qnl.3	+	6	2456	c.1780G>T	c.(1780-1782)GAA>TAA	p.E594*	ZNF470_uc010etn.2_Intron	NM_001001668	NP_001001668	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	594	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		AAGACCGTATGAATGTCTTGA	0.433													16	64	---	---	---	---	PASS
DUXA	503835	broad.mit.edu	37	19	57678812	57678812	+	5'UTR	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57678812G>T	uc002qoa.1	-	1						NM_001012729	NP_001012747	A6NLW8	DUXA_HUMAN	double homeobox A							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0123)		CTTCGGCCATGCTGGAAGAGA	0.512													22	79	---	---	---	---	PASS
ZNF548	147694	broad.mit.edu	37	19	57909797	57909797	+	Splice_Site	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57909797G>T	uc002qom.2	+	3	393	c.143_splice	c.e3-1	p.G48_splice	ZNF547_uc002qpm.3_Intron|ZNF548_uc002qon.2_Splice_Site_p.G51_splice	NM_152909	NP_690873	Q8NEK5	ZN548_HUMAN	zinc finger protein 548						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGTTCTGACAGGTTCTTGGCA	0.507													14	51	---	---	---	---	PASS
ZNF416	55659	broad.mit.edu	37	19	58084835	58084835	+	Missense_Mutation	SNP	T	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58084835T>G	uc002qpf.2	-	4	608	c.437A>C	c.(436-438)GAG>GCG	p.E146A	ZNF547_uc002qpm.3_Intron	NM_017879	NP_060349	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	146					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		CAAGGGTTTCTCTGCACTATG	0.522													12	27	---	---	---	---	PASS
SIRPD	128646	broad.mit.edu	37	20	1532540	1532540	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1532540T>A	uc002wfi.2	-	2	262	c.218A>T	c.(217-219)AAA>ATA	p.K73I		NM_178460	NP_848555	Q9H106	SIRPD_HUMAN	signal-regulatory protein delta precursor	73	Ig-like V-type.					extracellular region				ovary(1)|kidney(1)|skin(1)	3						GTAGATTAATTTCCGGTTTGG	0.458													9	45	---	---	---	---	PASS
SIRPG	55423	broad.mit.edu	37	20	1629992	1629992	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1629992C>T	uc002wfm.1	-	2	201	c.136G>A	c.(136-138)GGA>AGA	p.G46R	SIRPG_uc002wfn.1_Missense_Mutation_p.G46R|SIRPG_uc002wfo.1_Missense_Mutation_p.G46R	NM_018556	NP_061026	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma isoform 1	46	Extracellular (Potential).|Ig-like V-type.				blood coagulation|cell adhesion|cell junction assembly|cell-cell signaling|intracellular signal transduction|leukocyte migration|negative regulation of cell proliferation|positive regulation of cell proliferation|positive regulation of cell-cell adhesion|positive regulation of T cell activation	integral to membrane|intracellular|plasma membrane	protein binding			ovary(1)	1						GCTGTCTTTCCAACTGTGACC	0.512													9	43	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3675336	3675336	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3675336G>A	uc002wja.2	-	11	2918	c.2918C>T	c.(2917-2919)GCT>GTT	p.A973V	SIGLEC1_uc002wjb.1_5'Flank|SIGLEC1_uc002wiz.3_Missense_Mutation_p.A973V	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	973	Ig-like C2-type 9.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						GATGGGTGCAGCTAGGCTCGT	0.602													10	30	---	---	---	---	PASS
PRNT	149830	broad.mit.edu	37	20	4713082	4713082	+	RNA	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4713082C>G	uc002wlb.2	-	2		c.942G>C			PRNT_uc010zqp.1_RNA|PRNT_uc010zqq.1_RNA	NR_024268				Homo sapiens mRNA for putative M8 protein, isoform 2.												0						gcctggcagtccactggaatc	0.149													3	6	---	---	---	---	PASS
RALGAPA2	57186	broad.mit.edu	37	20	20392785	20392785	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20392785C>T	uc002wrz.2	-	38	5646	c.5503G>A	c.(5503-5505)GAG>AAG	p.E1835K	RALGAPA2_uc010gcx.2_Missense_Mutation_p.E1539K|RALGAPA2_uc010zsg.1_Missense_Mutation_p.E1283K	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	1835	Rap-GAP.				activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						AGAGCTCGCTCTTCATAGCTG	0.458													32	100	---	---	---	---	PASS
KIAA0406	9675	broad.mit.edu	37	20	36625155	36625155	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36625155G>A	uc002xhl.2	-	7	3203	c.2994C>T	c.(2992-2994)GAC>GAT	p.D998D	KIAA0406_uc002xhm.2_Silent_p.D998D	NM_014657	NP_055472	O43156	TTI1_HUMAN	hypothetical protein LOC9675	998							binding				0		Myeloproliferative disorder(115;0.00874)				ACCCACCTAGGTCCAGTCTCT	0.612													24	90	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47249125	47249125	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47249125G>A	uc002xtw.1	-	34	4343	c.4320C>T	c.(4318-4320)ATC>ATT	p.I1440I	PREX1_uc002xtv.1_Silent_p.I737I	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	1440					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CGAGGTAGAAGATGACCTTCA	0.612													13	27	---	---	---	---	PASS
BCAS1	8537	broad.mit.edu	37	20	52570017	52570017	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52570017C>A	uc002xws.2	-	11	1972	c.1634G>T	c.(1633-1635)AGA>ATA	p.R545I	BCAS1_uc010zza.1_Missense_Mutation_p.R211I|BCAS1_uc010zzb.1_Missense_Mutation_p.R471I|BCAS1_uc010gim.2_Missense_Mutation_p.R401I|BCAS1_uc002xwt.2_Missense_Mutation_p.R531I|BCAS1_uc010gil.1_Missense_Mutation_p.R467I	NM_003657	NP_003648	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	545						cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			CTTCTCAGGTCTCTTTTGGAG	0.542													19	57	---	---	---	---	PASS
CBLN4	140689	broad.mit.edu	37	20	54573783	54573783	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54573783C>T	uc002xxa.2	-	3	1221	c.436G>A	c.(436-438)GTA>ATA	p.V146I		NM_080617	NP_542184	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	146	C1q.					cell junction|extracellular region|synapse				ovary(3)|pancreas(1)	4			Colorectal(105;0.202)			GCAGATATTACTGGTTTTCCA	0.353													7	42	---	---	---	---	PASS
OSBPL2	9885	broad.mit.edu	37	20	60856156	60856156	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60856156C>A	uc002yck.1	+	8	919	c.717C>A	c.(715-717)GTC>GTA	p.V239V	OSBPL2_uc002ycl.1_Silent_p.V227V|OSBPL2_uc011aah.1_Silent_p.V147V|OSBPL2_uc002ycm.1_Silent_p.V51V	NM_144498	NP_653081	Q9H1P3	OSBL2_HUMAN	oxysterol-binding protein-like protein 2 isoform	239					lipid transport		lipid binding			ovary(1)|central_nervous_system(1)	2	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			CCTGCTGCGTCCACAACGTCA	0.532													26	84	---	---	---	---	PASS
OPRL1	4987	broad.mit.edu	37	20	62724187	62724187	+	Silent	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62724187C>G	uc002yic.2	+	3	516	c.114C>G	c.(112-114)CTC>CTG	p.L38L	OPRL1_uc002yid.2_Silent_p.L38L|OPRL1_uc002yif.3_Silent_p.L38L	NM_182647	NP_872588	P41146	OPRX_HUMAN	opiate receptor-like 1	38	Extracellular (Potential).				elevation of cytosolic calcium ion concentration|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception	integral to plasma membrane	protein binding|X-opioid receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					ATCTGCTGCTCAATGCCAGCC	0.662													10	43	---	---	---	---	PASS
KRTAP24-1	643803	broad.mit.edu	37	21	31654736	31654736	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31654736G>C	uc002ynv.2	-	1	541	c.515C>G	c.(514-516)ACT>AGT	p.T172S		NM_001085455	NP_001078924	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	172						keratin filament	structural molecule activity				0						ATACCCCAAAGTACTCAATCT	0.438													19	86	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40670440	40670440	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40670440C>A	uc002yxk.1	-	5	406	c.267G>T	c.(265-267)TTG>TTT	p.L89F	BRWD1_uc002yxl.2_Missense_Mutation_p.L89F|BRWD1_uc002yxm.2_Missense_Mutation_p.L89F	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	89					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TTTCTTTATCCAACATAGGAC	0.363													23	104	---	---	---	---	PASS
TRPM2	7226	broad.mit.edu	37	21	45825915	45825915	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45825915C>T	uc002zet.1	+	19	2998	c.2785C>T	c.(2785-2787)CGG>TGG	p.R929W	TRPM2_uc002zeu.1_Missense_Mutation_p.R929W|TRPM2_uc002zew.1_Missense_Mutation_p.R929W|TRPM2_uc010gpt.1_Missense_Mutation_p.R929W|TRPM2_uc002zex.1_Missense_Mutation_p.R715W|TRPM2_uc002zey.1_Missense_Mutation_p.R442W	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	929	Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						CATTGTGAAGCGGATGGTAAG	0.637													26	121	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47531447	47531447	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47531447G>C	uc002zia.1	+	2	139	c.57G>C	c.(55-57)CAG>CAC	p.Q19H	COL6A2_uc002zhy.1_Missense_Mutation_p.Q19H|COL6A2_uc002zhz.1_Missense_Mutation_p.Q19H|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	19					axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGGCCATCCAGGCCCAGCAGC	0.672													6	29	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47531448	47531448	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47531448G>T	uc002zia.1	+	2	140	c.58G>T	c.(58-60)GCC>TCC	p.A20S	COL6A2_uc002zhy.1_Missense_Mutation_p.A20S|COL6A2_uc002zhz.1_Missense_Mutation_p.A20S|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	20					axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGCCATCCAGGCCCAGCAGCA	0.672													7	29	---	---	---	---	PASS
CCT8L2	150160	broad.mit.edu	37	22	17072241	17072241	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17072241G>C	uc002zlp.1	-	1	1460	c.1200C>G	c.(1198-1200)TTC>TTG	p.F400L		NM_014406	NP_055221	Q96SF2	TCPQM_HUMAN	T-complex protein 1	400					cellular protein metabolic process	cytoplasm	anion channel activity|ATP binding|calcium-activated potassium channel activity			ovary(1)	1	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GACATAGCTGGAAATAGGCAT	0.557													8	54	---	---	---	---	PASS
SLC25A1	6576	broad.mit.edu	37	22	19164016	19164016	+	Intron	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19164016G>T	uc002zoz.2	-						SLC25A1_uc002zoy.2_Intron|SLC25A1_uc002zpa.2_Intron	NM_005984	NP_005975	P53007	TXTP_HUMAN	solute carrier family 25 (mitochondrial carrier;						gluconeogenesis|long-chain fatty-acyl-CoA biosynthetic process|mitochondrial citrate transport|triglyceride biosynthetic process	integral to membrane|mitochondrial inner membrane	citrate transmembrane transporter activity|protein binding				0	Colorectal(54;0.0993)	all_lung(157;9.94e-09)		Lung(27;0.124)		CCCTATGGGGGACATCAGCAG	0.647													14	43	---	---	---	---	PASS
TOP3B	8940	broad.mit.edu	37	22	22322090	22322090	+	Splice_Site	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22322090T>C	uc002zvs.2	-	8	1174	c.739_splice	c.e8-1	p.V247_splice	TOP3B_uc010gtm.1_Splice_Site|TOP3B_uc002zvr.2_Splice_Site|TOP3B_uc010gtl.2_Splice_Site_p.V247_splice|TOP3B_uc002zvt.3_Splice_Site_p.V247_splice	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta						DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		AGTGTTAACCTGCAGGAAAAA	0.483													9	35	---	---	---	---	PASS
ADORA2A	135	broad.mit.edu	37	22	24836814	24836814	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24836814G>T	uc002zzx.2	+	5	1359	c.596G>T	c.(595-597)CGG>CTG	p.R199L	ADORA2A_uc002zzy.3_Missense_Mutation_p.R199L|ADORA2A_uc011ajs.1_Missense_Mutation_p.R60L|ADORA2A_uc010gup.2_Missense_Mutation_p.R199L|ADORA2A_uc010guq.2_Missense_Mutation_p.R199L|ADORA2A_uc003aab.2_Missense_Mutation_p.R199L|ADORA2A_uc003aac.2_Missense_Mutation_p.R60L|C22orf45_uc003aad.1_Intron	NM_000675	NP_000666	P29274	AA2AR_HUMAN	adenosine A2a receptor	199	Cytoplasmic.				apoptosis|blood coagulation|cAMP biosynthetic process|cellular defense response|inflammatory response|nerve growth factor receptor signaling pathway|phagocytosis|sensory perception	integral to plasma membrane|membrane fraction	enzyme binding				0	Colorectal(2;0.196)				Caffeine(DB00201)|Defibrotide(DB04932)|Pegademase bovine(DB00061)|Theophylline(DB00277)	GTCTATTTGCGGATCTTCCTG	0.592													44	137	---	---	---	---	PASS
HORMAD2	150280	broad.mit.edu	37	22	30572094	30572094	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30572094T>C	uc003agy.2	+	11	927	c.862T>C	c.(862-864)TGC>CGC	p.C288R		NM_152510	NP_689723	Q8N7B1	HORM2_HUMAN	HORMA domain containing 2	288					meiosis|mitosis	chromosome|nucleus					0			Epithelial(10;0.125)			AAGTTCTGAGTGCTCCAGGAA	0.383													8	21	---	---	---	---	PASS
SLC35E4	339665	broad.mit.edu	37	22	31042935	31042935	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31042935C>G	uc003ais.1	+	2	1615	c.970C>G	c.(970-972)CTT>GTT	p.L324V	SLC35E4_uc003ait.2_Intron	NM_001001479	NP_001001479	Q6ICL7	S35E4_HUMAN	solute carrier family 35, member E4	324	Helical; (Potential).					integral to membrane					0						AGGAATGTTCCTTTACCACAA	0.627													15	46	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38165342	38165342	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38165342G>T	uc003atr.2	+	21	7080	c.6809G>T	c.(6808-6810)GGC>GTC	p.G2270V	TRIOBP_uc003atu.2_Missense_Mutation_p.G2098V|TRIOBP_uc003atw.2_Missense_Mutation_p.G557V|TRIOBP_uc003atx.1_Missense_Mutation_p.G153V|TRIOBP_uc010gxh.2_Missense_Mutation_p.G153V	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	2270					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					ATGGGCAATGGCTGCGGGCGC	0.667													5	11	---	---	---	---	PASS
TNRC6B	23112	broad.mit.edu	37	22	40657837	40657837	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40657837G>A	uc011aor.1	+	4	328	c.117G>A	c.(115-117)GTG>GTA	p.V39V	TNRC6B_uc003aym.2_Silent_p.V75V|TNRC6B_uc003ayn.3_Silent_p.V39V|TNRC6B_uc003ayo.2_5'Flank	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1	39	Potential.				gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						CTCTTTTAGTGCCCGAAGTGA	0.373													7	35	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50728004	50728004	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50728004G>A	uc003bkv.3	-	3	1116	c.1010C>T	c.(1009-1011)GCC>GTC	p.A337V		NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	337	Extracellular (Potential).|Sema.				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GATGTCACGGGCCTCCCGGGT	0.677													12	23	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3242718	3242718	+	Missense_Mutation	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3242718G>C	uc004crg.3	-	5	1165	c.1008C>G	c.(1006-1008)ATC>ATG	p.I336M		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	336						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TTGGTTTCTTGATGTCACAGA	0.463													9	38	---	---	---	---	PASS
SHROOM2	357	broad.mit.edu	37	X	9864571	9864571	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9864571G>A	uc004csu.1	+	4	2713	c.2623G>A	c.(2623-2625)GAG>AAG	p.E875K		NM_001649	NP_001640	Q13796	SHRM2_HUMAN	apical protein of Xenopus-like	875					apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)				CACCTTTGCAGAGTATCAGGC	0.637													5	15	---	---	---	---	PASS
MID1	4281	broad.mit.edu	37	X	10450578	10450578	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10450578A>T	uc004cte.3	-	5	1146	c.955T>A	c.(955-957)TCT>ACT	p.S319T	MID1_uc004ctd.3_Missense_Mutation_p.S30T|MID1_uc004ctg.3_Missense_Mutation_p.S319T|MID1_uc004cth.3_Missense_Mutation_p.S281T|MID1_uc004ctk.3_Missense_Mutation_p.S319T|MID1_uc004cti.3_Missense_Mutation_p.S319T|MID1_uc004ctj.3_Missense_Mutation_p.S319T|MID1_uc011mie.1_RNA|MID1_uc004ctm.1_Missense_Mutation_p.S370T|MID1_uc004ctn.1_Missense_Mutation_p.S319T|MID1_uc004cto.1_Missense_Mutation_p.S281T|MID1_uc010ndw.1_Missense_Mutation_p.S30T|MID1_uc004cts.1_Missense_Mutation_p.S86T|MID1_uc004ctt.2_Missense_Mutation_p.S370T|MID1_uc004ctu.2_Missense_Mutation_p.S319T|MID1_uc004ctv.2_Missense_Mutation_p.S332T|MID1_uc004ctw.2_Missense_Mutation_p.S281T|MID1_uc010ndy.1_Missense_Mutation_p.S283T|MID1_uc004ctc.3_Missense_Mutation_p.S86T|MID1_uc004ctp.1_Intron|MID1_uc004ctq.1_Missense_Mutation_p.S86T|MID1_uc004ctr.1_Missense_Mutation_p.S86T|MID1_uc010ndu.1_Missense_Mutation_p.S86T|MID1_uc010ndv.1_Missense_Mutation_p.S30T|MID1_uc010ndx.1_RNA	NM_033290	NP_150632	O15344	TRI18_HUMAN	midline 1	319					microtubule cytoskeleton organization|pattern specification process|positive regulation of stress-activated MAPK cascade	cytoplasm|microtubule|microtubule associated complex|spindle	ligase activity|ubiquitin protein ligase binding|zinc ion binding			ovary(2)|pancreas(1)	3						TCCTTCAGAGAGTGTTCCGCT	0.522													19	60	---	---	---	---	PASS
ARHGAP6	395	broad.mit.edu	37	X	11162211	11162211	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11162211C>A	uc004cup.1	-	11	2938	c.2065G>T	c.(2065-2067)GCC>TCC	p.A689S	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Missense_Mutation_p.A689S|ARHGAP6_uc004cum.1_Missense_Mutation_p.A486S|ARHGAP6_uc004cun.1_Missense_Mutation_p.A509S|ARHGAP6_uc010neb.1_Missense_Mutation_p.A511S|ARHGAP6_uc011mif.1_3'UTR	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	689					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						CCCCCCGGGGCCGCGTCCTCT	0.582											OREG0019666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	87	---	---	---	---	PASS
MSL3	10943	broad.mit.edu	37	X	11783734	11783734	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11783734C>T	uc004cuw.2	+	9	1162	c.1057C>T	c.(1057-1059)CGC>TGC	p.R353C	MSL3_uc004cuv.1_Missense_Mutation_p.R353C|MSL3_uc004cux.2_Missense_Mutation_p.R294C|MSL3_uc011mig.1_Missense_Mutation_p.R204C|MSL3_uc011mih.1_Missense_Mutation_p.R341C|MSL3_uc004cuy.2_Missense_Mutation_p.R187C	NM_078629	NP_523353	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3-like 1 isoform a	353					histone H4-K16 acetylation|multicellular organismal development|transcription from RNA polymerase II promoter	MSL complex	DNA binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GCGGTCCACGCGCCACAGTGC	0.622													19	141	---	---	---	---	PASS
RAB9A	9367	broad.mit.edu	37	X	13727078	13727078	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13727078C>T	uc004cvm.2	+	3	395	c.213C>T	c.(211-213)AGC>AGT	p.S71S	RAB9A_uc010neh.2_Silent_p.S71S	NM_004251	NP_004242	P51151	RAB9A_HUMAN	RAB9A, member RAS oncogene family	71					protein transport|small GTPase mediated signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome|lysosome|plasma membrane	GDP binding|GTP binding|GTPase activity|protein binding			ovary(1)	1						GATTCCGAAGCCTGAGGACAC	0.413													46	161	---	---	---	---	PASS
FIGF	2277	broad.mit.edu	37	X	15365296	15365296	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15365296C>G	uc004cwt.1	-	6	1437	c.928G>C	c.(928-930)GAC>CAC	p.D310H		NM_004469	NP_004460	O43915	VEGFD_HUMAN	vascular endothelial growth factor D	310	4.|4 X 16 AA repeats of C-X(10)-C-X-C- X(1,3)-C.				angiogenesis|cell differentiation|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of cell proliferation|positive regulation of mast cell chemotaxis|vascular endothelial growth factor receptor signaling pathway	extracellular space|membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity|platelet-derived growth factor receptor binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Hepatocellular(33;0.183)					CTGCAGGTGTCTGGGTGAAAT	0.423													31	97	---	---	---	---	PASS
ACE2	59272	broad.mit.edu	37	X	15619037	15619037	+	5'UTR	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15619037T>A	uc004cxa.1	-	1					ACE2_uc004cxb.2_5'UTR	NM_021804	NP_068576	Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2 precursor						angiotensin-mediated drinking behavior|proteolysis|receptor biosynthetic process|regulation of cell proliferation|virion attachment, binding of host cell surface receptor	cell surface|extracellular space|integral to membrane|membrane raft|plasma membrane	carboxypeptidase activity|glycoprotein binding|metallopeptidase activity|peptidyl-dipeptidase activity|viral receptor activity|zinc ion binding			ovary(3)	3	Hepatocellular(33;0.183)				Moexipril(DB00691)	CTTGACATCGTCCCCTGTGAG	0.473													8	19	---	---	---	---	PASS
NHS	4810	broad.mit.edu	37	X	17750265	17750265	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17750265C>A	uc004cxx.2	+	8	4912	c.4574C>A	c.(4573-4575)CCC>CAC	p.P1525H	NHS_uc011mix.1_Missense_Mutation_p.P1546H|NHS_uc004cxy.2_Missense_Mutation_p.P1369H|NHS_uc004cxz.2_Missense_Mutation_p.P1348H|NHS_uc004cya.2_Missense_Mutation_p.P1248H	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	1525						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					CCCATACTGCCCAAACCTCCT	0.547													10	64	---	---	---	---	PASS
NHS	4810	broad.mit.edu	37	X	17750266	17750266	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17750266C>A	uc004cxx.2	+	8	4913	c.4575C>A	c.(4573-4575)CCC>CCA	p.P1525P	NHS_uc011mix.1_Silent_p.P1546P|NHS_uc004cxy.2_Silent_p.P1369P|NHS_uc004cxz.2_Silent_p.P1348P|NHS_uc004cya.2_Silent_p.P1248P	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	1525						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					CCATACTGCCCAAACCTCCTG	0.547													10	65	---	---	---	---	PASS
PPEF1	5475	broad.mit.edu	37	X	18767943	18767943	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18767943A>G	uc004cyq.2	+	7	750	c.269A>G	c.(268-270)GAC>GGC	p.D90G	PPEF1_uc004cyp.2_Missense_Mutation_p.D90G|PPEF1_uc004cyr.2_Missense_Mutation_p.D90G|PPEF1_uc004cys.2_Missense_Mutation_p.D90G|PPEF1_uc011mja.1_Missense_Mutation_p.D25G|PPEF1_uc011mjb.1_Missense_Mutation_p.D34G	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	90					detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					AGCGAACAGGACATGAGGGAT	0.353													29	90	---	---	---	---	PASS
GPR64	10149	broad.mit.edu	37	X	19025395	19025395	+	Silent	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19025395T>C	uc004cyx.2	-	20	1811	c.1647A>G	c.(1645-1647)ACA>ACG	p.T549T	GPR64_uc004cyy.2_Silent_p.T546T|GPR64_uc004cyz.2_Silent_p.T535T|GPR64_uc004czb.2_Silent_p.T549T|GPR64_uc004czc.2_Silent_p.T533T|GPR64_uc004czd.2_Silent_p.T525T|GPR64_uc004cze.2_Silent_p.T519T|GPR64_uc004czf.2_Silent_p.T511T|GPR64_uc004cza.2_Silent_p.T527T|GPR64_uc004cyw.2_Silent_p.T533T|GPR64_uc010nfj.2_Intron	NM_001079858	NP_001073327	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64 isoform 1	549	Extracellular (Potential).				neuropeptide signaling pathway|spermatogenesis	cytoplasm|integral to plasma membrane	G-protein coupled receptor activity				0	Hepatocellular(33;0.183)					TCACGTTTCTTGTCAAGTTCC	0.502													14	43	---	---	---	---	PASS
DDX53	168400	broad.mit.edu	37	X	23018668	23018668	+	Missense_Mutation	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23018668A>G	uc004daj.2	+	1	582	c.494A>G	c.(493-495)AAG>AGG	p.K165R		NM_182699	NP_874358	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	165						nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			large_intestine(1)|ovary(1)|kidney(1)	3						GAGTGCGAAAAGAGAAAATGG	0.428													21	73	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32305785	32305785	+	Missense_Mutation	SNP	G	A	A	rs140791274	byFrequency	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32305785G>A	uc004dda.1	-	43	6395	c.6151C>T	c.(6151-6153)CGG>TGG	p.R2051W	DMD_uc004dcw.2_Missense_Mutation_p.R707W|DMD_uc004dcx.2_Missense_Mutation_p.R710W|DMD_uc004dcz.2_Missense_Mutation_p.R1928W|DMD_uc004dcy.1_Missense_Mutation_p.R2047W|DMD_uc004ddb.1_Missense_Mutation_p.R2043W|DMD_uc010ngo.1_Intron|DMD_uc010ngn.1_RNA	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	2051	Spectrin 14.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ATGTCAATCCGACCTGAGCTT	0.348													11	35	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32490278	32490278	+	Intron	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32490278G>C	uc004dda.1	-						DMD_uc004dcz.2_Intron|DMD_uc004dcy.1_Intron|DMD_uc004ddb.1_Intron|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform						muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AATATTCACAGACCTGCAATT	0.378													21	91	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34150174	34150174	+	Silent	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34150174G>A	uc004ddg.2	-	1	255	c.222C>T	c.(220-222)GAC>GAT	p.D74D		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	74										ovary(4)|central_nervous_system(1)	5						GTAAAAACTCGTCACGGCGAC	0.532													21	52	---	---	---	---	PASS
CXorf59	286464	broad.mit.edu	37	X	36083860	36083860	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36083860G>T	uc004ddk.1	+	2	229	c.43G>T	c.(43-45)GAT>TAT	p.D15Y		NM_173695	NP_775966	Q8N9S7	CX059_HUMAN	hypothetical protein LOC286464	15						integral to membrane				central_nervous_system(1)	1						TTTAAAGAATGGTAAGCTATG	0.308													6	27	---	---	---	---	PASS
CXorf36	79742	broad.mit.edu	37	X	45060020	45060020	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:45060020C>A	uc004dgg.2	-	1	127	c.52G>T	c.(52-54)GCC>TCC	p.A18S	CXorf36_uc004dgi.3_Missense_Mutation_p.A18S	NM_176819	NP_789789	Q9H7Y0	CX036_HUMAN	hypothetical protein LOC79742 isoform 1	18						extracellular region				lung(1)	1						AGCAGCAGGGCCAGCCAGCCA	0.632													9	18	---	---	---	---	PASS
USP11	8237	broad.mit.edu	37	X	47101575	47101575	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47101575G>T	uc004dhp.2	+	10	1403	c.1403G>T	c.(1402-1404)TGC>TTC	p.C468F	USP11_uc004dhq.2_Missense_Mutation_p.C195F	NM_004651	NP_004642	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	468					protein deubiquitination|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(1)|lung(1)|central_nervous_system(1)	3						ACGCTGGTGTGCCCCGATTGT	0.542													8	23	---	---	---	---	PASS
GATA1	2623	broad.mit.edu	37	X	48650417	48650417	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48650417C>A	uc004dkq.3	+	3	478	c.387C>A	c.(385-387)AGC>AGA	p.S129R		NM_002049	NP_002040	P15976	GATA1_HUMAN	GATA binding protein 1	129					basophil differentiation|eosinophil differentiation|erythrocyte development|megakaryocyte differentiation|platelet aggregation|platelet formation|positive regulation of anti-apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|regulation of glycoprotein biosynthetic process|transcription from RNA polymerase II promoter	nuclear membrane|nucleolus|nucleoplasm	C2H2 zinc finger domain binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.?(2)|p.V74_C199del(1)		haematopoietic_and_lymphoid_tissue(246)|lung(2)	248						GAAAAGGCAGCACCAGCTTCC	0.612			Mis|F		megakaryoblastic leukemia of Downs Syndrome								6	43	---	---	---	---	PASS
CCDC120	90060	broad.mit.edu	37	X	48922153	48922153	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48922153C>A	uc010nik.2	+	6	1084	c.577C>A	c.(577-579)CAG>AAG	p.Q193K	CCDC120_uc011mmq.1_Missense_Mutation_p.Q181K|CCDC120_uc004dmf.2_Missense_Mutation_p.Q193K|CCDC120_uc010nil.2_Missense_Mutation_p.Q193K|CCDC120_uc011mmr.1_Missense_Mutation_p.Q193K|CCDC120_uc011mms.1_Missense_Mutation_p.Q181K	NM_033626	NP_296375	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120 isoform 3	193							protein binding			pancreas(1)	1						GATCACCACCCAGGGAGTCTG	0.657													4	8	---	---	---	---	PASS
PRICKLE3	4007	broad.mit.edu	37	X	49032245	49032245	+	Missense_Mutation	SNP	G	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49032245G>A	uc004dmy.1	-	9	1651	c.1625C>T	c.(1624-1626)TCG>TTG	p.S542L	PRICKLE3_uc011mmv.1_Missense_Mutation_p.S474L|PRICKLE3_uc011mmw.1_Missense_Mutation_p.S461L|PRICKLE3_uc011mmx.1_Missense_Mutation_p.S504L	NM_006150	NP_006141	O43900	PRIC3_HUMAN	LIM domain only 6	542							protein binding|zinc ion binding			breast(1)	1						GCAAGATTCCGAGTCTGACCC	0.502													27	98	---	---	---	---	PASS
GPR173	54328	broad.mit.edu	37	X	53105980	53105980	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53105980C>T	uc004dru.2	+	2	435	c.177C>T	c.(175-177)TAC>TAT	p.Y59Y		NM_018969	NP_061842	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	59	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						CTCCTTACTACTTCCTGCTGG	0.597													11	58	---	---	---	---	PASS
ITIH5L	347365	broad.mit.edu	37	X	54783783	54783783	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54783783G>T	uc004dtj.2	-	8	2754	c.2724C>A	c.(2722-2724)ATC>ATA	p.I908I		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	908	Pro-rich.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6						TGGAACTTGAGATTGTATTTG	0.562													7	48	---	---	---	---	PASS
TRO	7216	broad.mit.edu	37	X	54957721	54957721	+	3'UTR	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54957721C>A	uc004dtq.2	+	13					TRO_uc004dts.2_Missense_Mutation_p.P691T|TRO_uc004dtr.2_Missense_Mutation_p.P691T|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_RNA|TRO_uc004dtv.2_Missense_Mutation_p.P294T|TRO_uc011mok.1_3'UTR|TRO_uc004dtw.2_3'UTR|TRO_uc004dtx.2_3'UTR	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5						embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						GAATCTTTGTCCACACAGCAG	0.413													17	68	---	---	---	---	PASS
TRO	7216	broad.mit.edu	37	X	54957722	54957722	+	3'UTR	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54957722C>A	uc004dtq.2	+	13					TRO_uc004dts.2_Missense_Mutation_p.P691Q|TRO_uc004dtr.2_Missense_Mutation_p.P691Q|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_RNA|TRO_uc004dtv.2_Missense_Mutation_p.P294Q|TRO_uc011mok.1_3'UTR|TRO_uc004dtw.2_3'UTR|TRO_uc004dtx.2_3'UTR	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5						embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						AATCTTTGTCCACACAGCAGT	0.418													17	68	---	---	---	---	PASS
FAAH2	158584	broad.mit.edu	37	X	57358226	57358226	+	Missense_Mutation	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57358226T>A	uc004dvc.2	+	4	757	c.608T>A	c.(607-609)GTA>GAA	p.V203E		NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	203						integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						CAGCATATTGTAGGTGGAAGT	0.333										HNSCC(52;0.14)			21	83	---	---	---	---	PASS
ZXDB	158586	broad.mit.edu	37	X	57618658	57618658	+	Silent	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57618658C>T	uc004dvd.2	+	1	390	c.177C>T	c.(175-177)CGC>CGT	p.R59R		NM_007157	NP_009088	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	59					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						ggcggcggcgcgAGGAGGCCA	0.537													4	11	---	---	---	---	PASS
SPIN4	139886	broad.mit.edu	37	X	62570674	62570674	+	Missense_Mutation	SNP	T	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62570674T>G	uc004dvf.2	-	1	545	c.25A>C	c.(25-27)ATG>CTG	p.M9L		NM_001012968	NP_001012986	Q56A73	SPIN4_HUMAN	spindlin family, member 4	9					gamete generation					ovary(1)|lung(1)	2						TCTACCCCCATCGGAGGCACG	0.537													5	33	---	---	---	---	PASS
MTMR8	55613	broad.mit.edu	37	X	63445176	63445176	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63445176G>T	uc011mou.1	-	10	1548	c.1480C>A	c.(1480-1482)CTG>ATG	p.L494M	ASB12_uc004dvp.1_Missense_Mutation_p.L110M|ASB12_uc004dvq.1_Missense_Mutation_p.L119M|ASB12_uc004dvr.1_Missense_Mutation_p.L119M	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	310	Myotubularin phosphatase.					nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4						ACACAGTCCAGATGGCCATGA	0.532													5	17	---	---	---	---	PASS
LAS1L	81887	broad.mit.edu	37	X	64737901	64737901	+	Silent	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64737901T>A	uc004dwa.1	-	12	1965	c.1893A>T	c.(1891-1893)GGA>GGT	p.G631G	LAS1L_uc004dwc.1_Silent_p.G614G|LAS1L_uc004dwd.1_Silent_p.G572G|LAS1L_uc004dvy.1_Silent_p.G144G|LAS1L_uc004dvz.1_Silent_p.G144G	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like	631						MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4						CCTGCAAAGCTCCTCTTTTCT	0.483													5	21	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70360719	70360719	+	Intron	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70360719G>T	uc004dyy.2	+						MED12_uc004dyz.2_Intron|MED12_uc004dza.2_Intron|MED12_uc010nla.2_Intron	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12						androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					TAAGGCACTGGGATTTCATCT	0.323													9	28	---	---	---	---	PASS
TAF1	6872	broad.mit.edu	37	X	70603821	70603821	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70603821C>G	uc004dzu.3	+	13	2005	c.1954C>G	c.(1954-1956)CAA>GAA	p.Q652E	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.Q673E	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	652					G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				GATGAGAGAACAAGAGAGGCA	0.428													20	93	---	---	---	---	PASS
TAF1	6872	broad.mit.edu	37	X	70621431	70621431	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70621431C>G	uc004dzu.3	+	25	3888	c.3837C>G	c.(3835-3837)TGC>TGG	p.C1279W	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.C1300W|TAF1_uc004dzv.3_Missense_Mutation_p.C453W	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	1279					G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				ACAAATTCTGCCCCCTCTATT	0.443													12	73	---	---	---	---	PASS
XIST	7503	broad.mit.edu	37	X	73066015	73066015	+	RNA	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73066015G>T	uc004ebm.1	-	1		c.6574C>A				NR_001564				Homo sapiens cDNA: FLJ21545 fis, clone COL06195.												0						CGCATACCAGGCCAGGAAAAA	0.512													15	86	---	---	---	---	PASS
ZDHHC15	158866	broad.mit.edu	37	X	74641769	74641769	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74641769C>A	uc004ecg.2	-	9	1271	c.793G>T	c.(793-795)GGC>TGC	p.G265C	ZDHHC15_uc004ech.2_Missense_Mutation_p.G256C|ZDHHC15_uc011mqo.1_RNA	NM_144969	NP_659406	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15 isoform 1	265						integral to membrane	zinc ion binding			ovary(2)	2						TTGATGAAGCCAAGGTTGAAC	0.428													17	37	---	---	---	---	PASS
MAGEE1	57692	broad.mit.edu	37	X	75650228	75650228	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75650228G>T	uc004ecm.1	+	1	2112	c.1905G>T	c.(1903-1905)CAG>CAT	p.Q635H		NM_020932	NP_065983	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	635	MAGE 1.					dendrite|nucleus|perinuclear region of cytoplasm|postsynaptic membrane				breast(3)|ovary(1)|pancreas(1)|skin(1)	6						TTGTATGGCAGCGTTACTTAG	0.478													10	24	---	---	---	---	PASS
TAF9B	51616	broad.mit.edu	37	X	77393468	77393468	+	Silent	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77393468G>T	uc004eda.2	-	3	332	c.261C>A	c.(259-261)CCC>CCA	p.P87P		NM_015975	NP_057059	Q9HBM6	TAF9B_HUMAN	transcription associated factor 9B	87					negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|positive regulation of cell growth|transcription initiation, DNA-dependent	transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding				0						CATCTCTTGGGGGAGGAGAGG	0.338													18	76	---	---	---	---	PASS
SATL1	340562	broad.mit.edu	37	X	84362765	84362765	+	Missense_Mutation	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84362765A>T	uc011mqx.1	-	1	1210	c.1210T>A	c.(1210-1212)TCA>ACA	p.S404T	SATL1_uc004een.2_Missense_Mutation_p.S404T	NM_001163541	NP_001157013	Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	217	Gln-rich.						N-acetyltransferase activity			breast(2)	2						CTTGTGCCTGATTGGCTGGTG	0.532													21	66	---	---	---	---	PASS
SYTL4	94121	broad.mit.edu	37	X	99956580	99956580	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99956580T>C	uc004egd.3	-	5	556	c.200A>G	c.(199-201)CAG>CGG	p.Q67R	SYTL4_uc010nnc.2_Missense_Mutation_p.Q67R|SYTL4_uc004ege.3_Missense_Mutation_p.Q67R|SYTL4_uc004egf.3_Missense_Mutation_p.Q67R|SYTL4_uc004egg.3_Missense_Mutation_p.Q67R	NM_080737	NP_542775	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	67	RabBD.|FYVE-type.				exocytosis|intracellular protein transport	extrinsic to membrane|plasma membrane|synaptic vesicle|transport vesicle membrane	neurexin binding|phospholipid binding|Rab GTPase binding|transporter activity|zinc ion binding			ovary(2)	2					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CAGGCTCTCCTGGCACCGGGC	0.547													13	81	---	---	---	---	PASS
BTK	695	broad.mit.edu	37	X	100630170	100630170	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100630170G>T	uc004ehg.2	-	2	296	c.103C>A	c.(103-105)CAC>AAC	p.H35N	BTK_uc010nnn.2_Missense_Mutation_p.H35N|BTK_uc010nno.2_Missense_Mutation_p.H69N|BTK_uc004ehi.2_Missense_Mutation_p.H35N	NM_000061	NP_000052	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	35	PH.				calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding			lung(3)|central_nervous_system(2)|ovary(1)	6						GAGAGTTTGTGCACGGTCAAG	0.433									Agammaglobulinemia_X-linked				39	101	---	---	---	---	PASS
CHRDL1	91851	broad.mit.edu	37	X	109963158	109963158	+	Splice_Site	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109963158T>A	uc004eou.3	-	6	797	c.448_splice	c.e6-1	p.E150_splice	CHRDL1_uc004eov.2_Splice_Site_p.E144_splice|CHRDL1_uc004eow.2_Splice_Site_p.E149_splice|CHRDL1_uc010nps.2_Splice_Site_p.E149_splice|CHRDL1_uc004eot.2_Intron|CHRDL1_uc011mss.1_Intron|CHRDL1_uc004eox.3_Intron	NM_001143981	NP_001137453	Q9BU40	CRDL1_HUMAN	chordin-like 1 isoform 1 precursor						BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region					0						GTTTCCCTCCTGCCAAGGAGA	0.468													13	31	---	---	---	---	PASS
WDR44	54521	broad.mit.edu	37	X	117540902	117540902	+	Silent	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117540902A>G	uc004eqn.2	+	10	1871	c.1446A>G	c.(1444-1446)CCA>CCG	p.P482P	WDR44_uc004eqo.2_Silent_p.P482P|WDR44_uc011mtr.1_Silent_p.P457P|WDR44_uc010nqi.2_Silent_p.P192P	NM_019045	NP_061918	Q5JSH3	WDR44_HUMAN	WD repeat domain 44 protein	482						cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm				lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						ACACAAGACCAGTTAAATTCA	0.373													30	66	---	---	---	---	PASS
C1GALT1C1	29071	broad.mit.edu	37	X	119760290	119760290	+	Silent	SNP	A	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119760290A>G	uc004esy.2	-	3	1079	c.732T>C	c.(730-732)GAT>GAC	p.D244D	C1GALT1C1_uc004esz.2_Silent_p.D244D	NM_152692	NP_689905	Q96EU7	C1GLC_HUMAN	C1GALT1-specific chaperone 1	244	Lumenal (Potential).					integral to membrane					0						TATTAAATACATCTTTTCCAT	0.388													27	91	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123224532	123224532	+	Missense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123224532C>T	uc004etz.3	+	30	3724	c.3385C>T	c.(3385-3387)CCC>TCC	p.P1129S	STAG2_uc004eua.2_Missense_Mutation_p.P1129S|STAG2_uc004eub.2_Missense_Mutation_p.P1129S|STAG2_uc004euc.2_Missense_Mutation_p.P1129S|STAG2_uc004eud.2_Missense_Mutation_p.P1129S|STAG2_uc004eue.2_Missense_Mutation_p.P1129S	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	1129					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						TATGAGAGAGCCCAAAAGATT	0.408													22	65	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123538947	123538947	+	Silent	SNP	G	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123538947G>C	uc004euj.2	-	26	5368	c.5304C>G	c.(5302-5304)CTC>CTG	p.L1768L	ODZ1_uc011muj.1_Silent_p.L1774L|ODZ1_uc010nqy.2_Silent_p.L1775L	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1768	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						GCCACTCGATGAGGTTTGCAT	0.517													24	77	---	---	---	---	PASS
UTP14A	10813	broad.mit.edu	37	X	129063396	129063396	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129063396C>T	uc004euz.2	+	15	2156	c.2128C>T	c.(2128-2130)CAG>TAG	p.Q710*	UTP14A_uc011mup.1_Nonsense_Mutation_p.Q658*|UTP14A_uc011muq.1_Nonsense_Mutation_p.Q656*	NM_006649	NP_006640	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein,	710					rRNA processing	nucleolus|small-subunit processome	protein binding			ovary(2)	2						ATGGAACACCCAGAGGGCTTT	0.507													22	64	---	---	---	---	PASS
FRMD7	90167	broad.mit.edu	37	X	131219974	131219974	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:131219974C>G	uc004ewn.2	-	6	649	c.471G>C	c.(469-471)AAG>AAC	p.K157N	FRMD7_uc011muy.1_Missense_Mutation_p.K142N	NM_194277	NP_919253	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	157	FERM.				regulation of neuron projection development	cytoskeleton|growth cone|neuronal cell body	binding			skin(1)	1	Acute lymphoblastic leukemia(192;0.000127)					AGTGCATGATCTTGCCCTCTA	0.453													36	117	---	---	---	---	PASS
MAP7D3	79649	broad.mit.edu	37	X	135312596	135312596	+	Silent	SNP	A	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135312596A>T	uc004ezt.2	-	10	1789	c.1698T>A	c.(1696-1698)TCT>TCA	p.S566S	MAP7D3_uc004ezs.2_Silent_p.S530S|MAP7D3_uc011mwc.1_Silent_p.S548S|MAP7D3_uc010nsa.1_Silent_p.S524S	NM_024597	NP_078873	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	566	Potential.					cytoplasm|spindle				ovary(2)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;0.000127)					TAGTGGTTTTAGAAACTGTTT	0.353													16	98	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135427978	135427978	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135427978C>A	uc004ezu.1	+	6	2404	c.2113C>A	c.(2113-2115)CTG>ATG	p.L705M	GPR112_uc010nsb.1_Missense_Mutation_p.L500M|GPR112_uc010nsc.1_Missense_Mutation_p.L472M	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	705	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TATCACCCCACTGAAAGCATC	0.393													14	64	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135496412	135496412	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135496412C>A	uc004ezu.1	+	25	9422	c.9131C>A	c.(9130-9132)TCA>TAA	p.S3044*	GPR112_uc010nsb.1_Nonsense_Mutation_p.S2839*	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	3044	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TCTCTCAAGTCAACTGCAACT	0.418													41	138	---	---	---	---	PASS
FGF13	2258	broad.mit.edu	37	X	137715014	137715014	+	Silent	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:137715014C>G	uc004fam.2	-	5	1397	c.735G>C	c.(733-735)ACG>ACC	p.T245T	FGF13_uc004fan.2_Silent_p.T192T|FGF13_uc011mwi.1_Silent_p.T226T|FGF13_uc004faq.2_Silent_p.T255T|FGF13_uc004far.2_Silent_p.T226T|FGF13_uc011mwj.1_Silent_p.T255T|FGF13_uc011mwk.1_Silent_p.T199T	NM_004114	NP_004105	Q92913	FGF13_HUMAN	fibroblast growth factor 13 isoform 1	245					cell-cell signaling|MAPKKK cascade|nervous system development	cytoplasm|nucleus	growth factor activity|protein kinase activator activity			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					TCACTGGCTACGTTGATTCAT	0.502													42	132	---	---	---	---	PASS
SLITRK4	139065	broad.mit.edu	37	X	142717782	142717782	+	Missense_Mutation	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142717782C>A	uc004fbx.2	-	2	1519	c.1143G>T	c.(1141-1143)AAG>AAT	p.K381N	SLITRK4_uc004fby.2_Missense_Mutation_p.K381N	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	381	Extracellular (Potential).|LRR 7.					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					TGACGTGCAGCTTCTTCGCAT	0.413													34	148	---	---	---	---	PASS
PASD1	139135	broad.mit.edu	37	X	150817144	150817144	+	Silent	SNP	T	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150817144T>A	uc004fev.3	+	9	1019	c.687T>A	c.(685-687)GCT>GCA	p.A229A		NM_173493	NP_775764	Q8IV76	PASD1_HUMAN	PAS domain containing 1	229	Poly-Ala.					nucleus	signal transducer activity			ovary(3)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TTGAACCCgctgctgctgctg	0.348													22	72	---	---	---	---	PASS
MAGEA4	4103	broad.mit.edu	37	X	151092001	151092001	+	Intron	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151092001G>T	uc004fez.2	+						MAGEA4_uc004ffa.2_Intron|MAGEA4_uc004ffb.2_Intron|MAGEA4_uc004ffc.2_Intron|MAGEA4_uc004ffd.2_Intron	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4								protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					AGATCTGTAAGTAAGCCTTTG	0.547													11	37	---	---	---	---	PASS
PNMA3	29944	broad.mit.edu	37	X	152226044	152226044	+	Missense_Mutation	SNP	G	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152226044G>T	uc004fhc.2	+	2	968	c.632G>T	c.(631-633)GGC>GTC	p.G211V	PNMA5_uc004fha.3_5'Flank|PNMA3_uc004fhd.2_5'Flank	NM_013364	NP_037496	Q9UL41	PNMA3_HUMAN	paraneoplastic cancer-testis-brain antigen	211					apoptosis	nucleolus	nucleic acid binding|zinc ion binding			skin(2)|large_intestine(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					tgcttacggggccctgctctc	0.000													19	72	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153587658	153587658	+	Missense_Mutation	SNP	C	G	G			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153587658C>G	uc004fkk.2	-	25	4508	c.4259G>C	c.(4258-4260)GGC>GCC	p.G1420A	FLNA_uc011mzn.1_5'Flank|FLNA_uc010nuu.1_Missense_Mutation_p.G1420A	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	1420	Filamin 12.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCTGTAGGTGCCAGCCTCATA	0.637													21	77	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153595790	153595790	+	Silent	SNP	C	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153595790C>A	uc004fkk.2	-	5	1092	c.843G>T	c.(841-843)CCG>CCT	p.P281P	FLNA_uc010nuu.1_Silent_p.P281P	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	281	Filamin 1.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGGCTTTCTTCGGGTTCAGTT	0.622													14	48	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154134724	154134724	+	Missense_Mutation	SNP	T	C	C			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154134724T>C	uc004fmt.2	-	15	5515	c.5344A>G	c.(5344-5346)ATA>GTA	p.I1782V	F8_uc010nvi.1_Translation_Start_Site	NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	1782	F5/8 type A 3.|Plastocyanin-like 5.		I -> R (in HEMA; severe sporadic).		acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TCTGCTCTTATATATGGCCCC	0.343													25	92	---	---	---	---	PASS
ATP13A2	23400	broad.mit.edu	37	1	17331172	17331172	+	Intron	DEL	T	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17331172delT	uc001baa.2	-						ATP13A2_uc001bab.2_Intron|ATP13A2_uc001bac.2_Intron	NM_022089	NP_071372	Q9NQ11	AT132_HUMAN	ATPase type 13A2 isoform 1						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		gggcaaggactttttcaGAAC	0.308													81	44	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	20952456	20952456	+	IGR	DEL	A	-	-	rs151080214		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20952456delA								CDA (7058 upstream) : PINK1 (7492 downstream)																							gccttggaagaaaaggaaggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143391935	143391936	+	IGR	INS	-	TG	TG			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143391935_143391936insTG								None (None upstream) : LOC100286793 (255703 downstream)																							ATATATATATATAAAGAGATTG	0.252													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	178587971	178587972	+	IGR	INS	-	GAAGGAAGGAAG	GAAGGAAGGAAG			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178587971_178587972insGAAGGAAGGAAG								C1orf220 (69947 upstream) : RALGPS2 (106328 downstream)																							aaagagagagagaaggaaggaa	0.000													4	2	---	---	---	---	
DISC1	27185	broad.mit.edu	37	1	232094666	232094667	+	Intron	DEL	CG	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232094666_232094667delCG	uc001huz.2	+						TSNAX-DISC1_uc010pwl.1_Intron|DISC1_uc010pxb.1_3'UTR|DISC1_uc010pxc.1_3'UTR|DISC1_uc010pxd.1_Intron|DISC1_uc010pxe.1_Intron|DISC1_uc009xfr.2_Intron|DISC1_uc010pxf.1_Intron|DISC1_uc010pxg.1_Intron|DISC1_uc010pxh.1_Intron|DISC1_uc010pxi.1_Intron|DISC1_uc010pxj.1_Intron|DISC1_uc010pxk.1_Intron|DISC1_uc010pxl.1_Intron|DISC1_uc010pxm.1_Intron|DISC1_uc010pxn.1_Intron|DISC1_uc001hva.2_Intron	NM_018662	NP_061132	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1 isoform L						microtubule cytoskeleton organization|neuron migration|positive regulation of neuroblast proliferation|positive regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway	centrosome|microtubule	protein binding			skin(1)	1		all_cancers(173;0.0208)|Prostate(94;0.0975)				TTTCAGACTCCGTAGCACATCT	0.327													14	9	---	---	---	---	
C1orf57	84284	broad.mit.edu	37	1	233091296	233091296	+	Intron	DEL	A	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233091296delA	uc001hvj.1	+						C1orf57_uc001hvi.2_Intron|C1orf57_uc009xft.1_Intron	NM_032324	NP_115700	Q9BSD7	NTPCR_HUMAN	nucleoside-triphosphatase C1orf57								ATP binding|nucleoside-triphosphatase activity|nucleotide phosphatase activity|transferase activity				0		all_cancers(173;0.0818)|Prostate(94;0.137)				ttttttttttattttAGGAGT	0.368													4	3	---	---	---	---	
PELI1	57162	broad.mit.edu	37	2	64331637	64331637	+	Intron	DEL	T	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64331637delT	uc002scs.3	-						PELI1_uc002sct.3_Intron	NM_020651	NP_065702	Q96FA3	PELI1_HUMAN	pellino protein						innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol				ovary(1)	1						tggtttgtcatttttttttta	0.025													3	3	---	---	---	---	
ITGA6	3655	broad.mit.edu	37	2	173368990	173368990	+	3'UTR	DEL	A	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173368990delA	uc002uhp.1	+	25					ITGA6_uc010zdy.1_3'UTR|ITGA6_uc002uho.1_3'UTR|ITGA6_uc010fqm.1_3'UTR	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a						blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			GCGGGGGCCTAAAAAAAAAAA	0.378													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	175585078	175585078	+	Intron	DEL	C	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175585078delC	uc002uiw.2	+											Homo sapiens cDNA FLJ11228 fis, clone PLACE1008329.																		ATTTCATTCTCAAAAAAAAAA	0.368											OREG0015078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	24597671	24597671	+	IGR	DEL	G	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24597671delG								THRB (61218 upstream) : RARB (618152 downstream)																							CAGGCCTTCTGGCAAGCCCTG	0.473													4	4	---	---	---	---	
MAGEF1	64110	broad.mit.edu	37	3	184429387	184429387	+	Frame_Shift_Del	DEL	G	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184429387delG	uc003fpa.2	-	1	450	c.223delC	c.(223-225)CGGfs	p.R75fs		NM_022149	NP_071432	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1	75										ovary(1)	1	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			CGATTCAGCCGGCGGTAGGCC	0.647													137	100	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	25497611	25497612	+	IGR	INS	-	CTTT	CTTT	rs144415784	by1000genomes	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25497611_25497612insCTTT								ANAPC4 (77492 upstream) : SLC34A2 (159823 downstream)																							ttccttccttccttccttcctt	0.040													3	3	---	---	---	---	
SCLT1	132320	broad.mit.edu	37	4	129869515	129869515	+	Intron	DEL	G	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129869515delG	uc003igp.2	-						SCLT1_uc003ign.2_Intron|SCLT1_uc003igo.2_Intron|SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1							centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						aaaaaaaaaagaaaagaaaag	0.164													4	2	---	---	---	---	
TLR2	7097	broad.mit.edu	37	4	154623915	154623932	+	Intron	DEL	TGTGTGTGTGTGTGTGTG	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154623915_154623932delTGTGTGTGTGTGTGTGTG	uc003inq.2	+						TLR2_uc003inr.2_Intron|TLR2_uc003ins.2_Intron	NM_003264	NP_003255	O60603	TLR2_HUMAN	toll-like receptor 2 precursor						cellular response to diacyl bacterial lipopeptide|cellular response to lipoteichoic acid|cellular response to triacyl bacterial lipopeptide|detection of diacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|I-kappaB phosphorylation|induction of apoptosis|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of interferon-beta production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of Wnt receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|integral to plasma membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	Gram-positive bacterial cell surface binding|lipopolysaccharide receptor activity|peptidoglycan binding|protein heterodimerization activity|transmembrane receptor activity|triacyl lipopeptide binding			ovary(1)|lung(1)|breast(1)	3	all_hematologic(180;0.093)	Renal(120;0.117)				TCTCTCTCTTtgtgtgtgtgtgtgtgtgtgtgtgtgtg	0.280													6	3	---	---	---	---	
COL23A1	91522	broad.mit.edu	37	5	177673154	177673171	+	Intron	DEL	GTGCAGGGACCCAGTGAG	-	-	rs35716676		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177673154_177673171delGTGCAGGGACCCAGTGAG	uc003mje.2	-						COL23A1_uc010jkt.2_Intron	NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		GCCCTGCGAAGTGCAGGGACCCAGTGAGGTACAGGGTT	0.624													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	107231882	107231883	+	Intron	DEL	TC	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107231882_107231883delTC	uc003pro.1	-						MIR587_hsa-mir-587|MI0003595_5'Flank					Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 1534000.																		AGAGGAGAGGtctctctctctc	0.302													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	22813177	22813178	+	IGR	INS	-	C	C	rs145036723	by1000genomes	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22813177_22813178insC								IL6 (41558 upstream) : TOMM7 (39076 downstream)																							TCCTAGATAAGCCCCTACACTC	0.337													4	2	---	---	---	---	
DOCK4	9732	broad.mit.edu	37	7	111474750	111474750	+	Intron	DEL	A	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111474750delA	uc003vfx.2	-						DOCK4_uc003vfw.2_Intron|DOCK4_uc003vfy.2_Intron	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CCCCTAAGTTAAAAAAAAAAA	0.318													5	3	---	---	---	---	
MCPH1	79648	broad.mit.edu	37	8	6272541	6272541	+	Intron	DEL	G	-	-	rs3214738		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6272541delG	uc003wqi.2	+						MCPH1_uc003wqh.2_Intron|MCPH1_uc011kwl.1_Intron	NM_024596	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin							microtubule organizing center				central_nervous_system(1)|skin(1)	2		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		CTAGTAATTTGAAATCCTCCA	0.408													2	4	---	---	---	---	
NKAIN3	286183	broad.mit.edu	37	8	63502435	63502448	+	Intron	DEL	TGTGTGTGTGTGTG	-	-	rs72423486		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:63502435_63502448delTGTGTGTGTGTGTG	uc010lyq.1	+							NM_173688	NP_775959	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3							integral to membrane|plasma membrane					0	Breast(64;0.127)	Lung NSC(129;0.187)				ATAGGTATATtgtgtgtgtgtgtgtgtgtgtgtg	0.248													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	76858720	76858723	+	IGR	DEL	TTCC	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76858720_76858723delTTCC								HNF4G (379661 upstream) : LOC100192378 (664392 downstream)																							ccttccttcgttccttccttcctt	0.074													6	3	---	---	---	---	
C9orf84	158401	broad.mit.edu	37	9	114455967	114455967	+	Intron	DEL	T	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114455967delT	uc004bfr.2	-						C9orf84_uc011lwt.1_Intron|C9orf84_uc004bfq.2_Intron|C9orf84_uc010mug.2_Intron	NM_173521	NP_775792	Q5VXU9	CI084_HUMAN	hypothetical protein LOC158401 isoform 1											ovary(2)	2						CTATTTGAAGTCCAAAACAAT	0.214													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38931303	38931304	+	IGR	INS	-	T	T	rs142011881		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38931303_38931304insT								LOC399744 (190223 upstream) : None (None downstream)																							ATGGAAAAAAATTGTAAAGTAT	0.272													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81632947	81632948	+	IGR	INS	-	T	T			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81632947_81632948insT								LOC650623 (184299 upstream) : MBL1P (31706 downstream)																							CTCTTCAtttcttttttttttt	0.218													5	3	---	---	---	---	
RAD9B	144715	broad.mit.edu	37	12	110950776	110950776	+	Intron	DEL	T	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110950776delT	uc001trf.3	+						RAD9B_uc001trg.3_Intron|RAD9B_uc010sya.1_Intron|RAD9B_uc001tre.3_Intron|RAD9B_uc001trd.3_Intron	NM_152442	NP_689655	Q6WBX8	RAD9B_HUMAN	RAD9 homolog B						cell cycle checkpoint|DNA repair|DNA replication	nucleoplasm	protein binding			pancreas(1)|skin(1)	2						AGTCGGCACAttttttttttt	0.204													4	2	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	117968609	117968609	+	Intron	DEL	C	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117968609delC	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTCTCTCTGACCCCCTTGTAC	0.522													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	120706716	120706717	+	IGR	INS	-	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120706716_120706717insA								PXN (3153 upstream) : NME2P1 (13223 downstream)																							gagactctgtcaaaaaaaaaaa	0.030													4	2	---	---	---	---	
LCP1	3936	broad.mit.edu	37	13	46716269	46716269	+	Intron	DEL	A	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46716269delA	uc001vaz.3	-						LCP1_uc010ack.2_Intron|LCP1_uc001vay.3_Intron|LCP1_uc001vba.3_Intron	NM_002298	NP_002289	P13796	PLSL_HUMAN	L-plastin						regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding			lung(4)|ovary(3)	7		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		gataggactgaaaaaaaaaaA	0.134			T	BCL6	NHL 								6	3	---	---	---	---	
COL4A2	1284	broad.mit.edu	37	13	111086680	111086681	+	Intron	INS	-	A	A			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111086680_111086681insA	uc001vqx.2	+							NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CTTTTTCTAAGAAAAATAATTT	0.257													20	16	---	---	---	---	
ARID4A	5926	broad.mit.edu	37	14	58832185	58832186	+	Intron	INS	-	T	T	rs71448949		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58832185_58832186insT	uc001xdp.2	+						ARID4A_uc001xdo.2_Intron|ARID4A_uc001xdq.2_Intron	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I						negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						TATACTTGCTCttttttttttt	0.297													6	3	---	---	---	---	
SLC28A1	9154	broad.mit.edu	37	15	85443229	85443232	+	Intron	DEL	AGGC	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85443229_85443232delAGGC	uc002blg.2	+						SLC28A1_uc010upd.1_Intron|SLC28A1_uc010bnb.2_Intron|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Intron|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1						nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			gaaAAGAAAAaggcaggcaggcag	0.025													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	64770704	64770705	+	IGR	INS	-	CCAGTGATGGTCACCT	CCAGTGATGGTCACCT	rs140029302	by1000genomes	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64770704_64770705insCCAGTGATGGTCACCT								None (None upstream) : CDH11 (209980 downstream)																							TGTCACCACTGCCACCTTGTTC	0.371													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	79731579	79731580	+	IGR	INS	-	CT	CT	rs142861107	by1000genomes	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79731579_79731580insCT								MAF (96957 upstream) : DYNLRB2 (843274 downstream)																							tttctttcttcctctttctttc	0.000													4	2	---	---	---	---	
NLRP1	22861	broad.mit.edu	37	17	5424771	5424771	+	Intron	DEL	G	-	-			TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5424771delG	uc002gci.2	-						NLRP1_uc002gcg.1_Intron|NLRP1_uc002gck.2_Intron|NLRP1_uc002gcj.2_Intron|NLRP1_uc002gcl.2_Intron|NLRP1_uc002gch.3_Intron	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1						defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				AGACCCTCTAGGGGGCTCTCT	0.547													14	13	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3131594	3131594	+	Intron	DEL	T	-	-	rs34489383		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3131594delT	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						AAAACAATTCTTTTTTTTTTA	0.174													4	4	---	---	---	---	
PPP4R1	9989	broad.mit.edu	37	18	9576901	9576905	+	Intron	DEL	TAAAG	-	-	rs76696293		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9576901_9576905delTAAAG	uc002koe.1	-						PPP4R1_uc010wzo.1_Intron|PPP4R1_uc002kod.1_Intron|PPP4R1_uc010wzp.1_Intron	NM_001042388	NP_001035847	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1						protein phosphorylation|signal transduction	protein phosphatase 4 complex	protein binding|protein phosphatase type 4 regulator activity			skin(1)	1						CAAATGCGCTTAAAGTAAAGCTCTA	0.180													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	4778279	4778280	+	IGR	INS	-	C	C	rs74640575		TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4778279_4778280insC								C19orf30 (5712 upstream) : FEM1A (13448 downstream)																							cttctttcctttcttccttcct	0.025													2	4	---	---	---	---	
CKM	1158	broad.mit.edu	37	19	45822684	45822685	+	Intron	INS	-	C	C	rs148572878	by1000genomes	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45822684_45822685insC	uc002pbd.2	-							NM_001824	NP_001815	P06732	KCRM_HUMAN	muscle creatine kinase						creatine metabolic process	cytosol	ATP binding|creatine kinase activity			skin(1)	1		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)	gaaaactgaggcCCCCCCCCCT	0.337													2	5	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53652847	53652852	+	Intron	DEL	GCCGGT	-	-	rs11091285	by1000genomes	TCGA-21-5782-01A-01D-1632-08	TCGA-21-5782-10A-01D-1632-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53652847_53652852delGCCGGT	uc004dsp.2	-							NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						cggggccggggccggtgccgggactg	0.199													6	18	---	---	---	---	
