Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MED18	54797	broad.mit.edu	37	1	28660972	28660972	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28660972C>T	uc001bpt.3	+	3	363	c.118C>T	c.(118-120)CGT>TGT	p.R40C	MED18_uc009vtg.2_Missense_Mutation_p.R40C	NM_017638	NP_060108	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	40					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex	identical protein binding				0		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		CCACCGCCTTCGTGGTTTGTG	0.478													125	329	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37346432	37346432	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37346432G>T	uc001caz.2	-	3	488	c.353C>A	c.(352-354)ACC>AAC	p.T118N	GRIK3_uc001cba.1_Missense_Mutation_p.T118N	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	118	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity	p.T118T(1)		ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	GACGGCATTGGTGCAGGAGCC	0.627													19	50	---	---	---	---	PASS
INPP5B	3633	broad.mit.edu	37	1	38397681	38397681	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38397681G>C	uc001ccg.1	-	7	530	c.436C>G	c.(436-438)CGG>GGG	p.R146G	INPP5B_uc009vvk.1_Missense_Mutation_p.R87G|INPP5B_uc001cch.2_Missense_Mutation_p.R87G|INPP5B_uc001ccf.1_5'Flank	NM_005540	NP_005531	P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	146					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CACCTATACCGAGACAGCCAC	0.612													5	69	---	---	---	---	PASS
SMAP2	64744	broad.mit.edu	37	1	40882625	40882625	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40882625G>T	uc001cfj.2	+	9	1086	c.1021G>T	c.(1021-1023)GGT>TGT	p.G341C	SMAP2_uc001cfk.2_Missense_Mutation_p.G311C|SMAP2_uc010oji.1_Missense_Mutation_p.G258C|SMAP2_uc010ojj.1_Missense_Mutation_p.G157C	NM_022733	NP_073570	Q8WU79	SMAP2_HUMAN	small ArfGAP2	341	Interaction with PICALM (By similarity).|Met-rich.				regulation of ARF GTPase activity	cytoplasm|nucleus	ARF GTPase activator activity|zinc ion binding				0	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			AGGCTATATGGGTGGCATGCA	0.577													21	100	---	---	---	---	PASS
ZMYND12	84217	broad.mit.edu	37	1	42896432	42896432	+	Missense_Mutation	SNP	G	A	A	rs143931631	byFrequency	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:42896432G>A	uc001chj.2	-	8	1343	c.1073C>T	c.(1072-1074)TCA>TTA	p.S358L	ZMYND12_uc010ojt.1_Missense_Mutation_p.S248L	NM_032257	NP_115633	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12 isoform 1	358						intracellular	zinc ion binding			ovary(1)	1	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GTCTTCAGTTGAAATGAGACT	0.453													59	216	---	---	---	---	PASS
ZFYVE9	9372	broad.mit.edu	37	1	52703393	52703393	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52703393A>G	uc001cto.2	+	4	476	c.304A>G	c.(304-306)ACA>GCA	p.T102A	ZFYVE9_uc001ctn.2_Missense_Mutation_p.T102A|ZFYVE9_uc001ctp.2_Missense_Mutation_p.T102A	NM_004799	NP_004790	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9 isoform 3	102					endocytosis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway	early endosome membrane	metal ion binding|protein binding|receptor activity|serine-type peptidase activity			ovary(2)|lung(2)|central_nervous_system(2)|skin(2)	8						AGAGATTGCCACAATGTGGAT	0.438													42	136	---	---	---	---	PASS
HSPB11	51668	broad.mit.edu	37	1	54395701	54395701	+	Intron	SNP	G	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54395701G>C	uc001cwh.2	-						HSPB11_uc001cwi.1_Intron	NM_016126	NP_057210	Q9Y547	HSB11_HUMAN	heat shock protein family B (small), member 11						cell adhesion|response to stress						0						attaatGTAAGATTTGCTTAC	0.333													19	72	---	---	---	---	PASS
KANK4	163782	broad.mit.edu	37	1	62740491	62740491	+	Silent	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62740491C>A	uc001dah.3	-	3	662	c.285G>T	c.(283-285)GTG>GTT	p.V95V	KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	95										ovary(3)|skin(2)|lung(1)	6						CCTCCCTTGGCACCACGGGAG	0.607													4	181	---	---	---	---	PASS
LEPROT	54741	broad.mit.edu	37	1	65895721	65895721	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65895721G>A	uc001dcf.2	+	3	358	c.269G>A	c.(268-270)CGT>CAT	p.R90H	LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc001dci.2_Intron|LEPR_uc009waq.2_Intron|LEPROT_uc009wap.2_Missense_Mutation_p.R99H	NM_017526	NP_059996	O15243	OBRG_HUMAN	leptin receptor gene-related protein	90						endosome membrane|Golgi membrane|integral to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		ATTCTTGCTCGTGTGGCTGTG	0.433													106	514	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70505002	70505002	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70505002G>T	uc001dep.2	+	19	3411	c.3381G>T	c.(3379-3381)ATG>ATT	p.M1127I	LRRC7_uc009wbg.2_Missense_Mutation_p.M411I|LRRC7_uc001deq.2_Missense_Mutation_p.M368I	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1127						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						AAATGGCCATGTTTAGAAGGG	0.587													54	229	---	---	---	---	PASS
RABGGTB	5876	broad.mit.edu	37	1	76257858	76257858	+	Intron	SNP	A	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76257858A>T	uc001dgy.1	+						RABGGTB_uc009wbt.1_Intron|RABGGTB_uc001dha.1_Intron|RABGGTB_uc001dhc.1_5'Flank	NM_004582	NP_004573	P53611	PGTB2_HUMAN	RAB geranylgeranyltransferase, beta subunit						protein modification process|visual perception		metal ion binding|protein binding|Rab geranylgeranyltransferase activity			ovary(1)	1						TTATGTCTGTAATTTTAGATC	0.289													8	77	---	---	---	---	PASS
ST6GALNAC3	256435	broad.mit.edu	37	1	76779598	76779598	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76779598C>T	uc001dhh.2	+	2	290	c.127C>T	c.(127-129)CCT>TCT	p.P43S	ST6GALNAC3_uc001dhg.3_Missense_Mutation_p.P43S|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1	43	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						CTTTGGACAACCTGGTACAAA	0.448													6	181	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79387437	79387437	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79387437C>T	uc001diq.3	-	9	1274	c.1118G>A	c.(1117-1119)TGG>TAG	p.W373*		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	373	GPS.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TGAGTAATTCCAAAATGCACA	0.398													19	103	---	---	---	---	PASS
VCAM1	7412	broad.mit.edu	37	1	101186048	101186048	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:101186048C>G	uc001dti.2	+	2	201	c.81C>G	c.(79-81)ATC>ATG	p.I27M	VCAM1_uc001dtj.2_Missense_Mutation_p.I27M|VCAM1_uc010ouj.1_Missense_Mutation_p.I27M	NM_001078	NP_001069	P19320	VCAM1_HUMAN	vascular cell adhesion molecule 1 isoform a	27	Ig-like C2-type 1.|Extracellular (Potential).				heterophilic cell-cell adhesion|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|leukocyte tethering or rolling|membrane to membrane docking|positive regulation of T cell proliferation|regulation of immune response	alpha9-beta1 integrin-vascular cell adhesion molecule-1 complex|apical part of cell|external side of plasma membrane|extracellular space|filopodium|integral to membrane|microvillus|podosome	cell adhesion molecule binding|integrin binding			central_nervous_system(1)	1		all_epithelial(167;3.83e-06)|all_lung(203;0.000485)|Lung NSC(277;0.0011)		Epithelial(280;0.0227)|all cancers(265;0.0276)|COAD - Colon adenocarcinoma(174;0.149)|Colorectal(144;0.169)|Lung(183;0.196)	Carvedilol(DB01136)	CTTTTAAAATCGAGACCACCC	0.408													50	214	---	---	---	---	PASS
OLFM3	118427	broad.mit.edu	37	1	102296361	102296361	+	Missense_Mutation	SNP	A	T	T	rs150051854	byFrequency	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:102296361A>T	uc001duf.2	-	3	370	c.299T>A	c.(298-300)ATT>AAT	p.I100N	OLFM3_uc001dug.2_Missense_Mutation_p.I80N|OLFM3_uc001duh.2_RNA|OLFM3_uc001dui.2_RNA|OLFM3_uc001duj.2_Missense_Mutation_p.I5N|OLFM3_uc001due.2_RNA	NM_058170	NP_477518	Q96PB7	NOE3_HUMAN	olfactomedin 3	100	Potential.					extracellular region				ovary(2)|skin(1)	3		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		TAAGACTTCAATAGACTGGGA	0.353													31	135	---	---	---	---	PASS
CASQ2	845	broad.mit.edu	37	1	116244008	116244008	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116244008G>T	uc001efx.3	-	11	1318	c.1054C>A	c.(1054-1056)CTT>ATT	p.L352I	CASQ2_uc010owu.1_Missense_Mutation_p.L281I	NM_001232	NP_001223	O14958	CASQ2_HUMAN	cardiac calsequestrin 2 precursor	352					heart development|striated muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;1.25e-06)|all_epithelial(167;1.02e-06)|all_lung(203;8.03e-06)|Lung NSC(69;5.01e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GCAGTTGGAAGATCGTCATCA	0.398													14	112	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152187662	152187662	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152187662C>A	uc001ezt.1	-	3	6519	c.6443G>T	c.(6442-6444)CGA>CTA	p.R2148L		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	2148					keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGATCCGTGTCGTTCACCCCT	0.587													30	696	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157772324	157772324	+	Silent	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157772324C>A	uc001frg.2	-	4	563	c.450G>T	c.(448-450)GGG>GGT	p.G150G	FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Silent_p.G150G|FCRL1_uc001fri.2_Silent_p.G150G|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	150	Ig-like C2-type 2.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			AACCTACAGCCCCTTTGTACC	0.517													40	107	---	---	---	---	PASS
PVRL4	81607	broad.mit.edu	37	1	161049520	161049520	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161049520T>A	uc001fxo.2	-	2	598	c.299A>T	c.(298-300)CAG>CTG	p.Q100L		NM_030916	NP_112178	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4 precursor	100	Ig-like V-type 1.|Extracellular (Potential).				adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane				ovary(2)	2	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GGGCGGCGGCTGCTCCACGCG	0.692													13	25	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190203572	190203572	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190203572A>T	uc001gse.1	-	5	886	c.654T>A	c.(652-654)AGT>AGA	p.S218R	FAM5C_uc010pot.1_Missense_Mutation_p.S116R	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	218						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					TGTCATAGTTACTGCAGCCAA	0.373													43	110	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197390731	197390731	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197390731C>A	uc001gtz.2	+	6	1908	c.1773C>A	c.(1771-1773)TGC>TGA	p.C591*	CRB1_uc010poz.1_Nonsense_Mutation_p.C522*|CRB1_uc010ppa.1_Intron|CRB1_uc009wza.2_Nonsense_Mutation_p.C479*|CRB1_uc010ppb.1_Nonsense_Mutation_p.C591*|CRB1_uc010ppc.1_Intron|CRB1_uc010ppd.1_Nonsense_Mutation_p.C72*|CRB1_uc001gub.1_Nonsense_Mutation_p.C240*	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	591	Extracellular (Potential).|Laminin G-like 1.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						AGGAGAAATGCATCGCGAAAG	0.463													11	229	---	---	---	---	PASS
IRF6	3664	broad.mit.edu	37	1	209969720	209969720	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209969720G>A	uc001hhq.1	-	4	615	c.352C>T	c.(352-354)CAG>TAG	p.Q118*	IRF6_uc010psm.1_Nonsense_Mutation_p.Q23*|IRF6_uc009xct.1_Nonsense_Mutation_p.Q118*	NM_006147	NP_006138	O14896	IRF6_HUMAN	interferon regulatory factor 6	118					cell cycle arrest|interferon-gamma-mediated signaling pathway|mammary gland epithelial cell differentiation|negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|type I interferon-mediated signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		CCCTGGGGCTGAGGGATGTCA	0.522										HNSCC(57;0.16)			29	85	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215853730	215853730	+	Intron	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215853730T>A	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGTAAGAAAATTAACAGGTTA	0.423										HNSCC(13;0.011)			52	116	---	---	---	---	PASS
B3GALNT2	148789	broad.mit.edu	37	1	235617588	235617588	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235617588C>G	uc001hxc.2	-	10	1420	c.1191G>C	c.(1189-1191)TGG>TGC	p.W397C		NM_152490	NP_689703	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2	397	Lumenal (Potential).				protein glycosylation	Golgi membrane|integral to membrane	galactosyltransferase activity			breast(1)	1	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			CCAACTCCTGCCACTTTCCGG	0.498													8	107	---	---	---	---	PASS
ZNF496	84838	broad.mit.edu	37	1	247471832	247471832	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247471832C>A	uc001ico.2	-	8	1416	c.951G>T	c.(949-951)CAG>CAT	p.Q317H	ZNF496_uc009xgv.2_Missense_Mutation_p.Q353H|ZNF496_uc001icp.2_Missense_Mutation_p.Q317H|ZNF496_uc001icq.1_Missense_Mutation_p.Q92H	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496	317					positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			ACTCTGGCACCTGCAGCTCCT	0.488													90	241	---	---	---	---	PASS
OR2G2	81470	broad.mit.edu	37	1	247752411	247752411	+	Silent	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247752411G>A	uc010pyy.1	+	1	750	c.750G>A	c.(748-750)GTG>GTA	p.V250V		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	250	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ACCTGacagtggtcaccatct	0.408													15	177	---	---	---	---	PASS
OR2L3	391192	broad.mit.edu	37	1	248224406	248224406	+	Silent	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248224406G>T	uc001idx.1	+	1	423	c.423G>T	c.(421-423)GTG>GTT	p.V141V	OR2L13_uc001ids.2_Intron	NM_001004687	NP_001004687	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L,	141	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GAATGTGTGTGCTGATGATAA	0.438													86	272	---	---	---	---	PASS
ADCY3	109	broad.mit.edu	37	2	25061400	25061400	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25061400C>A	uc002rfs.3	-	7	1646	c.1447G>T	c.(1447-1449)GAA>TAA	p.E483*	ADCY3_uc002rfr.3_Nonsense_Mutation_p.E116*|ADCY3_uc010ykm.1_Nonsense_Mutation_p.E483*	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3	483	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CCCTTCTCTTCTAGGTAATCA	0.532													51	243	---	---	---	---	PASS
C2orf39	92749	broad.mit.edu	37	2	26654794	26654794	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26654794G>C	uc002rhg.2	+	7	882	c.808G>C	c.(808-810)GAG>CAG	p.E270Q	C2orf39_uc010eym.1_RNA	NM_145038	NP_659475	Q96MC2	CC164_HUMAN	hypothetical protein LOC92749	270	Potential.										0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAGGACTATGAGAAGCAGCT	0.493													50	164	---	---	---	---	PASS
GTF3C2	2976	broad.mit.edu	37	2	27556512	27556512	+	Intron	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27556512G>T	uc002rjv.1	-						GTF3C2_uc010eyy.1_Intron|GTF3C2_uc002rju.1_Intron|GTF3C2_uc002rjw.1_Intron|GTF3C2_uc010eyz.1_Missense_Mutation_p.T581N|uc002rjy.1_5'Flank	NM_001521	NP_001512	Q8WUA4	TF3C2_HUMAN	general transcription factor IIIC, polypeptide							transcription factor TFIIIC complex				ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTTATTTTGGTTTTTTTACC	0.393													11	239	---	---	---	---	PASS
MAP4K3	8491	broad.mit.edu	37	2	39487742	39487742	+	Intron	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39487742C>T	uc002rro.2	-						MAP4K3_uc002rrp.2_Intron|MAP4K3_uc010yns.1_Intron	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase						JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				ATAAAAATTACAAACCTGATT	0.348													7	45	---	---	---	---	PASS
ABCG5	64240	broad.mit.edu	37	2	44051083	44051083	+	Silent	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44051083C>A	uc002rtn.2	-	9	1433	c.1293G>T	c.(1291-1293)CCG>CCT	p.P431P	ABCG5_uc002rtm.2_Silent_p.P36P|ABCG5_uc002rto.2_Silent_p.P260P|ABCG5_uc002rtp.2_Silent_p.P36P	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5	431	Helical; Name=2; (Potential).|ABC transmembrane type-2.				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TGCCTGTGTACGGGGTGGCGC	0.537													15	115	---	---	---	---	PASS
MPHOSPH10	10199	broad.mit.edu	37	2	71360216	71360216	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71360216A>G	uc002sht.1	+	2	630	c.278A>G	c.(277-279)AAT>AGT	p.N93S	MCEE_uc002shs.2_5'Flank|MPHOSPH10_uc010feb.1_Missense_Mutation_p.N93S	NM_005791	NP_005782	O00566	MPP10_HUMAN	M-phase phosphoprotein 10	93					RNA splicing, via transesterification reactions|rRNA processing	chromosome|nucleolus|small nucleolar ribonucleoprotein complex	protein binding			skin(2)|ovary(1)	3						TACTTTCAGAATGCAGTTAGT	0.383													11	75	---	---	---	---	PASS
REV1	51455	broad.mit.edu	37	2	100019492	100019492	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100019492A>G	uc002tad.2	-	20	3456	c.3244T>C	c.(3244-3246)TCA>CCA	p.S1082P	REV1_uc002tac.2_Missense_Mutation_p.S1081P	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1	1082					DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						CTTTTTGGTGAACCAATGGtt	0.373								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					11	116	---	---	---	---	PASS
MAP4K4	9448	broad.mit.edu	37	2	102460737	102460737	+	Silent	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102460737T>A	uc002tbg.2	+	12	1252	c.1197T>A	c.(1195-1197)ATT>ATA	p.I399I	MAP4K4_uc002tbc.2_Silent_p.I399I|MAP4K4_uc002tbd.2_Silent_p.I399I|MAP4K4_uc002tbe.2_Silent_p.I399I|MAP4K4_uc002tbf.2_Silent_p.I399I|MAP4K4_uc010yvy.1_Silent_p.I399I|MAP4K4_uc002tbh.2_Silent_p.I399I|MAP4K4_uc002tbi.2_Silent_p.I252I|MAP4K4_uc010yvz.1_Silent_p.I379I|MAP4K4_uc002tbk.2_5'UTR|MAP4K4_uc002tbj.1_Silent_p.I295I	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	399					intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						AGAAGCGGATTGAGCAGCAGA	0.478													4	17	---	---	---	---	PASS
IL1RL1	9173	broad.mit.edu	37	2	102968370	102968370	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102968370C>G	uc002tbu.1	+	11	1931	c.1660C>G	c.(1660-1662)CAG>GAG	p.Q554E	IL18R1_uc002tbw.3_Intron	NM_016232	NP_057316	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1 isoform 1	554	Cytoplasmic (Potential).				innate immune response	integral to membrane	interleukin-1 receptor activity|receptor signaling protein activity			skin(2)|ovary(1)|central_nervous_system(1)	4						CTTGGCTGCCCAGAAGCAATA	0.498													12	96	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138169171	138169171	+	Intron	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138169171T>A	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TGTCTCTTGTTGGAACAGGGA	0.333													20	123	---	---	---	---	PASS
NOSTRIN	115677	broad.mit.edu	37	2	169718564	169718564	+	Intron	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169718564G>T	uc002ueg.2	+						NOSTRIN_uc002uef.2_Intron|NOSTRIN_uc002uei.2_Intron|NOSTRIN_uc010fpu.2_Intron|NOSTRIN_uc002ueh.2_Intron|NOSTRIN_uc002uej.2_Intron|NOSTRIN_uc002uek.2_Intron	NM_001039724	NP_001034813	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficker isoform 2						endocytosis|nitric oxide metabolic process|regulation of nitric-oxide synthase activity	cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	protein binding				0						AAAAGGGTAAGAATCATTCTC	0.418													23	123	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178936561	178936561	+	Missense_Mutation	SNP	G	T	T	rs77063376	by1000genomes	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178936561G>T	uc002ulq.2	-	1	922	c.604C>A	c.(604-606)CGT>AGT	p.R202S	PDE11A_uc002ulr.2_Intron|PDE11A_uc002ult.1_Intron	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4	202					platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			AAGAACTGACGCTCATTATGC	0.478									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				35	240	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179576701	179576701	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179576701C>A	uc010zfg.1	-	93	24348	c.24124G>T	c.(24124-24126)GTT>TTT	p.V8042F	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.V4703F	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8969							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATGCAGAAACTTCTCCCACG	0.353													37	132	---	---	---	---	PASS
SLC39A10	57181	broad.mit.edu	37	2	196583062	196583062	+	Intron	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196583062A>G	uc002utg.3	+						SLC39A10_uc002uth.3_Intron|SLC39A10_uc010zgp.1_Intron	NM_001127257	NP_001120729	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter),						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.221)			ATTAGGTAATATAACCTTAAA	0.229													9	108	---	---	---	---	PASS
PGAP1	80055	broad.mit.edu	37	2	197706014	197706014	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197706014G>T	uc002utw.2	-	27	2827	c.2713C>A	c.(2713-2715)CTT>ATT	p.L905I	PGAP1_uc002utx.2_Missense_Mutation_p.L731I|PGAP1_uc010fsi.2_Missense_Mutation_p.L144I	NM_024989	NP_079265	Q75T13	PGAP1_HUMAN	GPI deacylase	905	Helical; (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation|intracellular protein transport|myo-inositol transport	integral to membrane|intrinsic to endoplasmic reticulum membrane	nuclease activity|phosphoric ester hydrolase activity			ovary(3)|central_nervous_system(1)	4						AAGCATGGAAGCCTATATAAA	0.368													14	72	---	---	---	---	PASS
CLK1	1195	broad.mit.edu	37	2	201724413	201724413	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201724413C>A	uc002uwe.2	-	5	719	c.538G>T	c.(538-540)GAT>TAT	p.D180Y	CLK1_uc002uwd.2_5'Flank|CLK1_uc010zhi.1_Missense_Mutation_p.D222Y|CLK1_uc002uwf.2_5'UTR|CLK1_uc002uwg.2_Missense_Mutation_p.D29Y|CLK1_uc010fsv.2_RNA	NM_004071	NP_004062	P49759	CLK1_HUMAN	CDC-like kinase 1 isoform 1	180	Protein kinase.				cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			pancreas(2)	2						GCTTTATGATCGATGCACTCC	0.363													17	108	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212652768	212652768	+	Missense_Mutation	SNP	T	C	C	rs78887537		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212652768T>C	uc002veg.1	-	4	636	c.538A>G	c.(538-540)ACA>GCA	p.T180A	ERBB4_uc002veh.1_Missense_Mutation_p.T180A|ERBB4_uc010zji.1_Missense_Mutation_p.T180A|ERBB4_uc010zjj.1_Missense_Mutation_p.T180A|ERBB4_uc010fut.1_Missense_Mutation_p.T180A	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	180	Extracellular (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		CTACCATTTGTTGACACAAGA	0.363										TSP Lung(8;0.080)			21	109	---	---	---	---	PASS
PECR	55825	broad.mit.edu	37	2	216930136	216930136	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216930136C>T	uc002vft.2	-	3	391	c.323G>A	c.(322-324)GGA>GAA	p.G108E	PECR_uc010zjq.1_RNA|PECR_uc002vfr.2_5'UTR|PECR_uc002vfs.2_5'UTR|PECR_uc002vfu.1_Missense_Mutation_p.G127E	NM_018441	NP_060911	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase	108					fatty acid biosynthetic process|regulation of apoptosis	peroxisome	binding|trans-2-enoyl-CoA reductase (NADPH) activity				0		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	CTGGCCTCCTCCATTGTTCAC	0.418													24	177	---	---	---	---	PASS
GIGYF2	26058	broad.mit.edu	37	2	233677120	233677120	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233677120A>T	uc002vti.3	+	20	2363	c.2026A>T	c.(2026-2028)ATT>TTT	p.I676F	GIGYF2_uc010zmj.1_Missense_Mutation_p.I676F|GIGYF2_uc002vtg.2_Missense_Mutation_p.I670F|GIGYF2_uc002vtj.3_Missense_Mutation_p.I697F|GIGYF2_uc002vtk.3_Missense_Mutation_p.I676F|GIGYF2_uc002vth.3_Missense_Mutation_p.I670F|GIGYF2_uc010zmk.1_RNA|GIGYF2_uc010zml.1_Missense_Mutation_p.I507F|GIGYF2_uc002vtq.3_Missense_Mutation_p.I9F	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b	676	Gln-rich.				cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		TCAGAACATCATTCCCTCAGT	0.378													20	67	---	---	---	---	PASS
UGT1A8	54576	broad.mit.edu	37	2	234526363	234526363	+	Missense_Mutation	SNP	A	G	G	rs150485330		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234526363A>G	uc002vup.2	+	1	73	c.10A>G	c.(10-12)ACA>GCA	p.T4A	UGT1A8_uc010zmv.1_Missense_Mutation_p.T4A	NM_019076	NP_061949	Q9HAW9	UD18_HUMAN	UDP glycosyltransferase 1 family, polypeptide A8	4					drug metabolic process|fatty acid metabolic process|flavone metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	enzyme inhibitor activity|fatty acid binding|glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|steroid binding			ovary(2)	2		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;2.56e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000482)|Lung(119;0.00404)|LUSC - Lung squamous cell carcinoma(224;0.008)		CATGGCTCGCACAGGGTGGAC	0.562													3	78	---	---	---	---	PASS
ATG7	10533	broad.mit.edu	37	3	11340856	11340856	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11340856G>T	uc003bwc.2	+	3	298	c.181G>T	c.(181-183)GCT>TCT	p.A61S	ATG7_uc003bwd.2_Missense_Mutation_p.A61S|ATG7_uc011aum.1_Missense_Mutation_p.A61S	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a	61					autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						TGGGCTGCCAGCTCGCTTAAC	0.368													49	175	---	---	---	---	PASS
ARPP21	10777	broad.mit.edu	37	3	35835355	35835355	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35835355C>T	uc003cgb.2	+	20	2608	c.2344C>T	c.(2344-2346)CCA>TCA	p.P782S	ARPP21_uc003cga.2_Missense_Mutation_p.P763S|ARPP21_uc011axy.1_Missense_Mutation_p.P783S|ARPP21_uc003cgf.2_Missense_Mutation_p.P618S|ARPP21_uc003cgg.2_Missense_Mutation_p.P305S	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD	782						cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3						GCTGATTGGCCCACACTGCCC	0.537													29	101	---	---	---	---	PASS
CCDC36	339834	broad.mit.edu	37	3	49294148	49294148	+	Silent	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49294148T>C	uc003cwk.2	+	10	1605	c.1218T>C	c.(1216-1218)AAT>AAC	p.N406N	CCDC36_uc011bck.1_Silent_p.N406N	NM_178173	NP_835467	Q8IYA8	CCD36_HUMAN	coiled-coil domain containing 36	406										ovary(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;9.11e-05)|Kidney(197;0.00248)|KIRC - Kidney renal clear cell carcinoma(197;0.00262)		GCATTAAGAATGCCTGCCAAA	0.458													34	120	---	---	---	---	PASS
ARHGEF3	50650	broad.mit.edu	37	3	56763415	56763415	+	Silent	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56763415T>C	uc003dig.2	-	10	1633	c.1464A>G	c.(1462-1464)CAA>CAG	p.Q488Q	ARHGEF3_uc011bew.1_Silent_p.Q488Q|ARHGEF3_uc003dih.2_Silent_p.Q520Q|ARHGEF3_uc011bev.1_Silent_p.Q459Q|ARHGEF3_uc003dif.2_Silent_p.Q494Q|ARHGEF3_uc010hmy.1_Silent_p.Q286Q	NM_019555	NP_062455	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor 3 isoform	488					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		CACTGTCCGATTGGTCCATCT	0.557													30	119	---	---	---	---	PASS
SHQ1	55164	broad.mit.edu	37	3	72799702	72799702	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72799702A>C	uc003dpf.2	-	11	1574	c.1467T>G	c.(1465-1467)AGT>AGG	p.S489R	SHQ1_uc010hod.2_Missense_Mutation_p.S400R	NM_018130	NP_060600	Q6PI26	SHQ1_HUMAN	SHQ1 homolog	489	Ser-rich.				ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding			ovary(2)|large_intestine(1)	3		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		CTTGCAAAGAACTGACTGTCT	0.473													13	159	---	---	---	---	PASS
MIR1324	100302212	broad.mit.edu	37	3	75679975	75679975	+	RNA	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:75679975C>A	hsa-mir-1324|MI0006657	+			c.62C>A																				0						CTCTGGGTACCAGACAGAATT	0.507													6	128	---	---	---	---	PASS
DZIP3	9666	broad.mit.edu	37	3	108363259	108363259	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108363259C>T	uc003dxd.2	+	14	1812	c.1390C>T	c.(1390-1392)CAG>TAG	p.Q464*	DZIP3_uc003dxf.1_Nonsense_Mutation_p.Q464*|DZIP3_uc011bhm.1_Intron|DZIP3_uc003dxe.1_Nonsense_Mutation_p.Q464*|DZIP3_uc003dxg.1_Nonsense_Mutation_p.Q187*	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	464					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GCAATCCAAACAGTTTGACTT	0.428													29	269	---	---	---	---	PASS
CD80	941	broad.mit.edu	37	3	119256055	119256055	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119256055G>C	uc003ecq.2	-	4	1024	c.629C>G	c.(628-630)ACC>AGC	p.T210S	CD80_uc010hqt.1_Missense_Mutation_p.T210S|CD80_uc010hqu.1_Intron	NM_005191	NP_005182	P33681	CD80_HUMAN	CD80 antigen precursor	210	Extracellular (Potential).|Ig-like C2-type.				interspecies interaction between organisms|intracellular signal transduction|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process|positive regulation of interleukin-2 biosynthetic process|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of signal transduction|positive regulation of T-helper 1 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation	intracellular	coreceptor activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2					Abatacept(DB01281)	GCTGTGGTTGGTTGTCATATT	0.393													80	379	---	---	---	---	PASS
C3orf15	89876	broad.mit.edu	37	3	119434428	119434428	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119434428C>A	uc003ede.3	+	6	597	c.520C>A	c.(520-522)CCT>ACT	p.P174T	C3orf15_uc003edc.2_Missense_Mutation_p.P174T|C3orf15_uc010hqy.1_Missense_Mutation_p.P174T|C3orf15_uc010hqz.2_Missense_Mutation_p.P112T|C3orf15_uc011bjd.1_Missense_Mutation_p.P48T|C3orf15_uc011bje.1_Missense_Mutation_p.P154T|C3orf15_uc010hra.1_5'UTR	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha	174						mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		ATACACTTTTCCTCCTACTTC	0.368													137	397	---	---	---	---	PASS
XRN1	54464	broad.mit.edu	37	3	142051383	142051383	+	Intron	SNP	G	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142051383G>C	uc003eus.2	-						XRN1_uc010huu.2_Intron|XRN1_uc003eut.2_Intron|XRN1_uc003euu.2_Intron	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						CCTTCTTTTTGAAAATGATTC	0.343													17	93	---	---	---	---	PASS
ABCC5	10057	broad.mit.edu	37	3	183683230	183683230	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183683230C>G	uc003fmg.2	-	13	2058	c.1893G>C	c.(1891-1893)CAG>CAC	p.Q631H	ABCC5_uc011bqt.1_Missense_Mutation_p.Q159H|ABCC5_uc010hxl.2_Missense_Mutation_p.Q631H	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	631	ABC transporter 1.					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GGATCCAGGCCTGCTGGGCCA	0.473													43	201	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195517500	195517500	+	Silent	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195517500G>A	uc011bto.1	-	2	1411	c.951C>T	c.(949-951)GAC>GAT	p.D317D	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Silent_p.D199D	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	322					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGCTGTTGTGTCCTGAGTAG	0.463													53	261	---	---	---	---	PASS
C4orf50	389197	broad.mit.edu	37	4	5981919	5981919	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5981919C>A	uc003git.1	-	2	240	c.150G>T	c.(148-150)CAG>CAT	p.Q50H		NM_207405	NP_997288	Q6ZRC1	CD050_HUMAN	hypothetical protein LOC389197	50	Potential.									pancreas(2)|breast(1)	3						GGAGCTCCTCCTGGAGGCGGG	0.652													6	61	---	---	---	---	PASS
TBC1D14	57533	broad.mit.edu	37	4	7012487	7012487	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7012487T>G	uc011bwg.1	+	11	1705	c.1626T>G	c.(1624-1626)TTT>TTG	p.F542L	TBC1D14_uc003gjs.3_Missense_Mutation_p.F542L|TBC1D14_uc010idh.2_Missense_Mutation_p.F262L|TBC1D14_uc011bwh.1_Missense_Mutation_p.F189L|TBC1D14_uc003gju.3_Missense_Mutation_p.F33L	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a	542	Rab-GAP TBC.					intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						AAATGGCGTTTTTTAGAGTGG	0.443													35	302	---	---	---	---	PASS
PDGFRA	5156	broad.mit.edu	37	4	55139838	55139838	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55139838G>T	uc003han.3	+	10	1830	c.1499G>T	c.(1498-1500)CGA>CTA	p.R500L	PDGFRA_uc003haa.2_Intron|PDGFRA_uc010igq.1_Missense_Mutation_p.R394L|PDGFRA_uc003ham.2_RNA	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha	500	Ig-like C2-type 5.|Extracellular (Potential).				cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity	p.R500R(1)		soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	ATCGCCGTGCGATGCCTGGCT	0.557			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			18	141	---	---	---	---	PASS
RASGEF1B	153020	broad.mit.edu	37	4	82363480	82363480	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82363480C>G	uc003hmi.1	-	9	1123	c.979G>C	c.(979-981)GTG>CTG	p.V327L	RASGEF1B_uc003hmj.1_Missense_Mutation_p.V326L|RASGEF1B_uc010ijq.1_Missense_Mutation_p.V285L	NM_152545	NP_689758	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B	327	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						GCAGTCTTCACTTTGGCCCAA	0.388													13	138	---	---	---	---	PASS
ADH4	127	broad.mit.edu	37	4	100062715	100062715	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100062715G>T	uc003hun.2	-	3	315	c.239C>A	c.(238-240)CCA>CAA	p.P80Q	uc003hum.1_Intron|ADH4_uc011ced.1_Missense_Mutation_p.P99Q	NM_000670	NP_000661	P08319	ADH4_HUMAN	class II alcohol dehydrogenase, pi subunit	80					alcohol catabolic process|cellular aldehyde metabolic process|ethanol oxidation|quinone cofactor metabolic process|retinol metabolic process|xenobiotic metabolic process	cytosol|microtubule cytoskeleton	alcohol dehydrogenase activity, zinc-dependent|all-trans retinal binding|benzaldehyde dehydrogenase activity|NAD binding|NADPH:quinone reductase activity|retinol binding|retinol dehydrogenase activity|zinc ion binding			skin(2)	2				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)	NADH(DB00157)	GGTCACTCCTGGCCCAATACT	0.413													7	72	---	---	---	---	PASS
ENPEP	2028	broad.mit.edu	37	4	111409723	111409723	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111409723C>T	uc003iab.3	+	2	1013	c.671C>T	c.(670-672)CCA>CTA	p.P224L		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	224	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	GATCATGAACCAACAGATGCC	0.393													9	54	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113544995	113544995	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113544995C>A	uc003iau.2	-	4	351	c.140G>T	c.(139-141)AGT>ATT	p.S47I	C4orf21_uc003iaw.2_Missense_Mutation_p.S47I	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	Error:Variant_position_missing_in_Q6ZU11_after_alignment						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		AAGAAACAGACTCTCCAAACA	0.259													4	42	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114257161	114257161	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114257161A>C	uc003ibe.3	+	30	3639	c.3539A>C	c.(3538-3540)CAG>CCG	p.Q1180P	ANK2_uc003ibd.3_Missense_Mutation_p.Q1171P|ANK2_uc003ibf.3_Missense_Mutation_p.Q1180P|ANK2_uc011cgc.1_Missense_Mutation_p.Q356P|ANK2_uc003ibg.3_Missense_Mutation_p.Q175P|ANK2_uc003ibc.2_Missense_Mutation_p.Q1156P|ANK2_uc011cgb.1_Missense_Mutation_p.Q1195P	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1147					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CCCCAGGTGCAGGCCGTCTTC	0.532													23	179	---	---	---	---	PASS
INTU	27152	broad.mit.edu	37	4	128584730	128584730	+	Silent	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128584730A>G	uc003ifk.1	+	4	1033	c.963A>G	c.(961-963)TCA>TCG	p.S321S	INTU_uc011cgq.1_RNA	NM_015693	NP_056508	Q9ULD6	PDZD6_HUMAN	PDZ domain containing 6	321										ovary(1)	1						CAGAAACCTCAAAGGAAGAGG	0.423													13	112	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151769965	151769965	+	Intron	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151769965C>T	uc010ipj.2	-						LRBA_uc003ilt.3_Intron|LRBA_uc003ilu.3_Intron	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and							endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					TTTTTAGCAGCTCACCTAGTC	0.348													28	135	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23510043	23510043	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23510043C>T	uc003jgo.2	+	4	390	c.208C>T	c.(208-210)CGA>TGA	p.R70*		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	70	KRAB-related.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						CAGAGCCACTCGACCAGCTTT	0.483										HNSCC(3;0.000094)			8	172	---	---	---	---	PASS
SPEF2	79925	broad.mit.edu	37	5	35793334	35793334	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35793334C>T	uc003jjo.2	+	32	4739	c.4628C>T	c.(4627-4629)TCA>TTA	p.S1543L	SPEF2_uc003jjp.1_Missense_Mutation_p.S1029L|SPEF2_uc003jjr.2_Missense_Mutation_p.S598L	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1	1543					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTAGTAACCTCAATGCCTTGG	0.463													18	202	---	---	---	---	PASS
SV2C	22987	broad.mit.edu	37	5	75469629	75469629	+	Intron	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75469629C>T	uc003kei.1	+						uc003kej.2_RNA	NM_014979	NP_055794	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C						neurotransmitter transport	cell junction|integral to membrane|synaptic vesicle membrane	transmembrane transporter activity			skin(1)	1		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TTGTTCCTTCCCTACAACTCT	0.353													28	291	---	---	---	---	PASS
JMY	133746	broad.mit.edu	37	5	78533462	78533462	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78533462G>A	uc003kfx.3	+	1	1509	c.989G>A	c.(988-990)GGC>GAC	p.G330D		NM_152405	NP_689618	Q8N9B5	JMY_HUMAN	junction-mediating and regulatory protein	330	Potential.				'de novo' actin filament nucleation|actin polymerization-dependent cell motility|Arp2/3 complex-mediated actin nucleation|cell cycle arrest|DNA repair|induction of apoptosis|positive regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter	cell leading edge|cytoplasm|cytoskeleton|nucleus	actin binding|transcription coactivator activity				0		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		CGGCAGAAGGGCTACGAAGAA	0.582													16	88	---	---	---	---	PASS
MEGF10	84466	broad.mit.edu	37	5	126755734	126755734	+	Splice_Site	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126755734A>G	uc003kuh.3	+	13	1789	c.1427_splice	c.e13-2	p.G476_splice	MEGF10_uc010jdc.1_Splice_Site_p.G476_splice|MEGF10_uc010jdd.1_Splice_Site_p.G476_splice|MEGF10_uc003kui.3_Splice_Site_p.G476_splice	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10 precursor						cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		CTTGTCGCACAGGCTGGCACG	0.557													18	84	---	---	---	---	PASS
KIF20A	10112	broad.mit.edu	37	5	137518647	137518647	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137518647T>C	uc003lcj.2	+	7	1296	c.800T>C	c.(799-801)ATC>ACC	p.I267T	KIF20A_uc011cyo.1_Missense_Mutation_p.I249T	NM_005733	NP_005724	O95235	KI20A_HUMAN	kinesin family member 20A	267	Kinesin-motor.				cytokinesis|M phase of mitotic cell cycle|microtubule-based movement|protein transport|vesicle-mediated transport	Golgi apparatus|microtubule|nucleoplasm	ATP binding|microtubule motor activity|protein binding|transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CTCTCTTCTATCAGTCAGTGT	0.517													24	70	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140209904	140209904	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140209904G>A	uc003lho.2	+	1	2255	c.2228G>A	c.(2227-2229)AGC>AAC	p.S743N	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Missense_Mutation_p.S743N	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	743	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGTGCTCCAGCGCAGTGGGG	0.682													13	45	---	---	---	---	PASS
PCDHA13	56136	broad.mit.edu	37	5	140263278	140263278	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140263278C>G	uc003lif.2	+	1	1425	c.1425C>G	c.(1423-1425)TTC>TTG	p.F475L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Intron|PCDHA10_uc003lhx.2_Intron|PCDHA11_uc003lia.2_Intron|PCDHA12_uc003lic.2_Intron|PCDHA13_uc003lie.1_Missense_Mutation_p.F475L|PCDHA13_uc003lid.2_Missense_Mutation_p.F475L	NM_018904	NP_061727	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13 isoform 1 precursor	475	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCACATCTTCACGGTGTCTG	0.667													20	92	---	---	---	---	PASS
PCDHB7	56129	broad.mit.edu	37	5	140554682	140554682	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140554682G>T	uc003lit.2	+	1	2440	c.2266G>T	c.(2266-2268)GGC>TGC	p.G756C	PCDHB8_uc011dai.1_5'Flank	NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	756	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGACTGGAGGCTCCGGGAC	0.557													24	283	---	---	---	---	PASS
PCDHB14	56122	broad.mit.edu	37	5	140604043	140604043	+	Silent	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140604043A>G	uc003ljb.2	+	1	966	c.966A>G	c.(964-966)ACA>ACG	p.T322T	PCDHB14_uc011dal.1_Silent_p.T169T	NM_018934	NP_061757	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14 precursor	322	Extracellular (Potential).|Cadherin 3.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCAGGCAACAGATGGTGGGG	0.373													27	120	---	---	---	---	PASS
GABRA6	2559	broad.mit.edu	37	5	161128669	161128669	+	Missense_Mutation	SNP	G	T	T	rs142468532		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161128669G>T	uc003lyu.2	+	9	1590	c.1252G>T	c.(1252-1254)GAC>TAC	p.D418Y	GABRA6_uc003lyv.2_Missense_Mutation_p.D189Y	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	418	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CAGTAAAATAGACCAGTATTC	0.473										TCGA Ovarian(5;0.080)			36	86	---	---	---	---	PASS
EXOC2	55770	broad.mit.edu	37	6	572615	572615	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:572615C>A	uc003mtd.2	-	13	1482	c.1348G>T	c.(1348-1350)GCC>TCC	p.A450S	EXOC2_uc003mte.2_Missense_Mutation_p.A450S|EXOC2_uc011dho.1_Missense_Mutation_p.A45S	NM_018303	NP_060773	Q96KP1	EXOC2_HUMAN	Sec5 protein	450					exocytosis|protein transport					breast(4)|ovary(2)|pancreas(1)	7	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		TCAACAAAGGCCACCCTGTGG	0.433													35	156	---	---	---	---	PASS
CDYL	9425	broad.mit.edu	37	6	4952549	4952549	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4952549G>T	uc003mwi.2	+	8	1675	c.1544G>T	c.(1543-1545)TGT>TTT	p.C515F	CDYL_uc003mwj.2_Missense_Mutation_p.C461F|CDYL_uc003mwk.2_Missense_Mutation_p.C226F|CDYL_uc011dhx.1_Missense_Mutation_p.C329F|CDYL_uc011dhy.1_Missense_Mutation_p.C329F	NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN	chromodomain protein, Y chromosome-like isoform	515					regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		CAGGAGGCGTGTGGCAAGGGC	0.567													26	101	---	---	---	---	PASS
GMNN	51053	broad.mit.edu	37	6	24781805	24781805	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24781805A>G	uc003nem.2	+	4	437	c.230A>G	c.(229-231)AAT>AGT	p.N77S	GMNN_uc003nen.2_Missense_Mutation_p.N77S	NM_015895	NP_056979	O75496	GEMI_HUMAN	geminin	77					M/G1 transition of mitotic cell cycle|negative regulation of cell cycle|negative regulation of DNA replication|negative regulation of transcription, DNA-dependent	cytosol|nucleoplasm	histone deacetylase binding			ovary(1)	1						GAAAATAAAAATCTTGGAGGA	0.353													17	78	---	---	---	---	PASS
HIST1H2BD	3017	broad.mit.edu	37	6	26158775	26158775	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26158775G>C	uc003ngr.2	+	1	427	c.378G>C	c.(376-378)AAG>AAC	p.K126N	HIST1H2BD_uc003ngs.2_Missense_Mutation_p.K126N	NM_021063	NP_066407	P58876	H2B1D_HUMAN	histone cluster 1, H2bd	126					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(1)|pancreas(1)	2						CCAGTTCCAAGTAACTTTGCC	0.512													18	134	---	---	---	---	PASS
RNF5	6048	broad.mit.edu	37	6	32147865	32147865	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32147865C>T	uc003oaj.3	+	5	534	c.407C>T	c.(406-408)ACC>ATC	p.T136I	AGPAT1_uc003oaf.2_5'Flank|AGPAT1_uc003oag.2_5'Flank|AGPAT1_uc003oah.2_5'Flank	NM_006913	NP_008844	Q99942	RNF5_HUMAN	ring finger protein 5	136	Helical; (Potential).				ER-associated misfolded protein catabolic process|protein K48-linked ubiquitination|protein K63-linked ubiquitination	endoplasmic reticulum membrane|integral to membrane|mitochondrial membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						TTTTTCACCACCGTCTTCAAT	0.557													8	338	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56426101	56426101	+	Intron	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56426101T>C	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACCCACAGAATATACCTTATT	0.274													10	38	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57472406	57472406	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57472406C>A	uc003pdx.2	+	13	1282	c.1195C>A	c.(1195-1197)CAG>AAG	p.Q399K		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	399					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GCAAAAGTTGCAGTCATACAA	0.438													12	90	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57472407	57472407	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57472407A>G	uc003pdx.2	+	13	1283	c.1196A>G	c.(1195-1197)CAG>CGG	p.Q399R		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	399					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CAAAAGTTGCAGTCATACAAG	0.438													13	89	---	---	---	---	PASS
HTR1E	3354	broad.mit.edu	37	6	87725839	87725839	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87725839A>G	uc003pli.2	+	2	1490	c.787A>G	c.(787-789)ATC>GTC	p.I263V		NM_000865	NP_000856	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E	263	Cytoplasmic (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|synaptic transmission	integral to plasma membrane	protein binding|serotonin binding|serotonin receptor activity			ovary(2)|skin(1)	3		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Eletriptan(DB00216)	CCATGCCTCCATCAGGATCCC	0.502													40	391	---	---	---	---	PASS
C6orf225	619208	broad.mit.edu	37	6	112420591	112420591	+	Silent	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112420591G>T	uc003pvs.2	+	3	530	c.105G>T	c.(103-105)GGG>GGT	p.G35G		NM_001033564	NP_001028736	Q4G0N7	CF225_HUMAN	hypothetical protein LOC619208	35											0						CCTGTAATGGGAAGGAGATGT	0.453													7	218	---	---	---	---	PASS
CLVS2	134829	broad.mit.edu	37	6	123332243	123332243	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123332243C>A	uc003pzi.1	+	3	1372	c.503C>A	c.(502-504)ACT>AAT	p.T168N		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	168	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						AGTAACTTCACTTTCAAGCAA	0.413													23	97	---	---	---	---	PASS
ADAT2	134637	broad.mit.edu	37	6	143771755	143771755	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143771755G>A	uc003qjj.2	-	1	87	c.41C>T	c.(40-42)GCG>GTG	p.A14V	PEX3_uc011edx.1_5'Flank|PEX3_uc003qjl.2_5'Flank	NM_182503	NP_872309	Q7Z6V5	ADAT2_HUMAN	deaminase domain containing 1	14					tRNA processing		hydrolase activity|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(155;5.61e-06)|GBM - Glioblastoma multiforme(68;0.0115)		CACCGAGCACGCGCCGCTTGC	0.672													24	142	---	---	---	---	PASS
GNA12	2768	broad.mit.edu	37	7	2834600	2834600	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2834600T>A	uc003smu.2	-	2	651	c.487A>T	c.(487-489)ATC>TTC	p.I163F	GNA12_uc011jwb.1_Missense_Mutation_p.I163F|GNA12_uc003smt.2_Missense_Mutation_p.I104F	NM_007353	NP_031379	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein)	163					G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|Rho protein signal transduction	brush border membrane|heterotrimeric G-protein complex	D5 dopamine receptor binding|G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)		GCCTCCCTGATGCCAGAATCC	0.572													54	163	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	4273008	4273008	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4273008G>T	uc003smx.2	+	41	6088	c.5949G>T	c.(5947-5949)GAG>GAT	p.E1983D	SDK1_uc010kso.2_Missense_Mutation_p.E1239D|SDK1_uc003smy.2_Missense_Mutation_p.E470D|SDK1_uc003smz.2_Missense_Mutation_p.E43D	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	1983	Fibronectin type-III 13.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CTGTGAATGAGGCGGGCTACG	0.612													17	109	---	---	---	---	PASS
SP4	6671	broad.mit.edu	37	7	21469888	21469888	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21469888G>T	uc003sva.2	+	3	1286	c.1105G>T	c.(1105-1107)GAG>TAG	p.E369*	SP4_uc003svb.2_Nonsense_Mutation_p.E56*	NM_003112	NP_003103	Q02446	SP4_HUMAN	Sp4 transcription factor	369					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(3)|skin(2)	5						TGCTGCTACTGAGTCTGAAGC	0.478													17	128	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21847537	21847537	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21847537A>G	uc003svc.2	+	64	10254	c.10223A>G	c.(10222-10224)GAA>GGA	p.E3408G		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3408	Potential.|Stalk (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						AAGTCCTTTGAAGCTCAAGAG	0.473									Kartagener_syndrome				10	50	---	---	---	---	PASS
NEUROD6	63974	broad.mit.edu	37	7	31378481	31378481	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31378481C>G	uc003tch.2	-	2	755	c.402G>C	c.(400-402)GAG>GAC	p.E134D		NM_022728	NP_073565	Q96NK8	NDF6_HUMAN	neurogenic differentiation 6	134	Helix-loop-helix motif.				cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)	2						GTCGTAAAGTCTCTATTTTGG	0.463													35	144	---	---	---	---	PASS
NEUROD6	63974	broad.mit.edu	37	7	31378518	31378518	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31378518G>A	uc003tch.2	-	2	718	c.365C>T	c.(364-366)CCC>CTC	p.P122L		NM_022728	NP_073565	Q96NK8	NDF6_HUMAN	neurogenic differentiation 6	122	Helix-loop-helix motif.				cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)	2						AGAATAACAGGGGACCACTTT	0.478													38	179	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42007413	42007413	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42007413T>C	uc011kbh.1	-	14	2303	c.2212A>G	c.(2212-2214)ATA>GTA	p.I738V	GLI3_uc011kbg.1_Missense_Mutation_p.I679V	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	738					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						AGGTCTCCTATACTACCTCCA	0.552									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				44	222	---	---	---	---	PASS
COBL	23242	broad.mit.edu	37	7	51096398	51096398	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51096398G>A	uc003tpr.3	-	10	2580	c.2395C>T	c.(2395-2397)CAG>TAG	p.Q799*	COBL_uc003tps.2_Nonsense_Mutation_p.Q856*|COBL_uc011kcl.1_Nonsense_Mutation_p.Q799*|COBL_uc003tpp.3_Nonsense_Mutation_p.Q585*|COBL_uc003tpq.3_Nonsense_Mutation_p.Q740*|COBL_uc003tpo.3_Nonsense_Mutation_p.Q341*	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	799										skin(3)|ovary(2)	5	Glioma(55;0.08)					TTCTGCGTCTGCGTGGGCACA	0.622													5	91	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	70597922	70597922	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70597922G>A	uc003tvy.2	+	1	134	c.134G>A	c.(133-135)CGC>CAC	p.R45H		NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	45	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ATCCGGCCGCGCGCCGAGGTG	0.682													7	23	---	---	---	---	PASS
WNT2	7472	broad.mit.edu	37	7	116960739	116960739	+	Silent	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:116960739G>A	uc003viz.2	-	2	492	c.192C>T	c.(190-192)GCC>GCT	p.A64A	WNT2_uc003vja.2_5'UTR	NM_003391	NP_003382	P09544	WNT2_HUMAN	wingless-type MMTV integration site family	64					atrial cardiac muscle tissue morphogenesis|canonical Wnt receptor signaling pathway|cardiac epithelial to mesenchymal transition|cellular response to retinoic acid|cellular response to transforming growth factor beta stimulus|dorsal/ventral axis specification|iris morphogenesis|labyrinthine layer blood vessel development|lens development in camera-type eye|lung induction|mammary gland epithelium development|neuron differentiation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of fibroblast proliferation|positive regulation of mesenchymal cell proliferation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, calcium modulating pathway	cytoplasm|extracellular space|proteinaceous extracellular matrix	cytokine activity|frizzled binding|frizzled-2 binding|signal transducer activity			breast(2)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	7	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		CCTGGCTAATGGCACGCATCA	0.602													8	48	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128485048	128485048	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128485048A>T	uc003vnz.3	+	21	3738	c.3529A>T	c.(3529-3531)ACT>TCT	p.T1177S	FLNC_uc003voa.3_Missense_Mutation_p.T1177S	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	1177	Filamin 10.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						AGCCACCTTCACTGTGGACTG	0.647													17	48	---	---	---	---	PASS
DGKI	9162	broad.mit.edu	37	7	137257552	137257552	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137257552C>A	uc003vtt.2	-	18	1795	c.1794G>T	c.(1792-1794)CAG>CAT	p.Q598H	DGKI_uc003vtu.2_Missense_Mutation_p.Q298H	NM_004717	NP_004708	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	598					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	nucleus|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)|skin(1)	3						ACTTCAGTTCCTGAATCTTTG	0.373													56	128	---	---	---	---	PASS
TBXAS1	6916	broad.mit.edu	37	7	139715640	139715640	+	Silent	SNP	G	A	A	rs147299625		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139715640G>A	uc011kqv.1	+	12	1649	c.1485G>A	c.(1483-1485)CCG>CCA	p.P495P	TBXAS1_uc003vvh.2_Silent_p.P449P|TBXAS1_uc010lne.2_Silent_p.P381P|TBXAS1_uc011kqu.1_Silent_p.P400P|TBXAS1_uc003vvi.2_Silent_p.P449P|TBXAS1_uc003vvj.2_Silent_p.P449P|TBXAS1_uc011kqw.1_Silent_p.P429P	NM_001130966	NP_001124438	P24557	THAS_HUMAN	thromboxane A synthase 1, platelet isoform	448	Cytoplasmic (Potential).				hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)					GGCCAAGCCCGGAGACCTTCA	0.597													4	121	---	---	---	---	PASS
MKRN1	23608	broad.mit.edu	37	7	140155025	140155025	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140155025G>A	uc003vvt.2	-	7	1331	c.1106C>T	c.(1105-1107)GCG>GTG	p.A369V	MKRN1_uc003vvs.2_Missense_Mutation_p.A305V|MKRN1_uc011krd.1_Missense_Mutation_p.A103V	NM_013446	NP_038474	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1 isoform 1	369	C3H1-type 4.						ligase activity|nucleic acid binding|protein binding|zinc ion binding			ovary(1)	1	Melanoma(164;0.00956)					ATACCTGCACGCCTTGTTGCT	0.473													6	285	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151927121	151927121	+	Intron	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151927121A>G	uc003wla.2	-						MLL3_uc003wkz.2_Intron	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TCCTGAAGTTAAGAAAACAGA	0.343			N		medulloblastoma								22	357	---	---	---	---	PASS
PRSS55	203074	broad.mit.edu	37	8	10387042	10387042	+	Silent	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10387042G>A	uc003wta.2	+	2	195	c.180G>A	c.(178-180)GAG>GAA	p.E60E	uc010lru.2_Intron|PRSS55_uc003wtb.2_RNA	NM_198464	NP_940866	Q6UWB4	PRS55_HUMAN	hypothetical protein LOC203074 precursor	60	Extracellular (Potential).				proteolysis	integral to membrane	serine-type endopeptidase activity			ovary(1)	1						CTATTTTCGAGGGAAGAACTC	0.517													37	280	---	---	---	---	PASS
MTMR7	9108	broad.mit.edu	37	8	17169148	17169148	+	Intron	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17169148A>G	uc003wxm.2	-						MTMR7_uc003wxn.2_Intron|MTMR7_uc011kya.1_5'UTR|MTMR7_uc011kyb.1_5'UTR	NM_004686	NP_004677	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7								protein tyrosine phosphatase activity			skin(1)	1				Colorectal(111;0.112)		GACACTGCCTAGAAAACACAC	0.512													87	384	---	---	---	---	PASS
BRF2	55290	broad.mit.edu	37	8	37704488	37704488	+	Silent	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37704488C>A	uc003xkk.2	-	3	530	c.420G>T	c.(418-420)ACG>ACT	p.T140T		NM_018310	NP_060780	Q9HAW0	BRF2_HUMAN	RNA polymerase III transcription initiation	140	1.				regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter|transcription initiation, DNA-dependent	nucleoplasm	protein binding|zinc ion binding				0		Lung NSC(58;0.118)|all_lung(54;0.195)	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;1.81e-10)			CATACAACAGCGTGCAGATGG	0.527													79	593	---	---	---	---	PASS
GOT1L1	137362	broad.mit.edu	37	8	37794297	37794297	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37794297A>G	uc011lbj.1	-	6	804	c.704T>C	c.(703-705)GTG>GCG	p.V235A		NM_152413	NP_689626	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1	235					biosynthetic process|cellular amino acid metabolic process	cytoplasm	pyridoxal phosphate binding|transaminase activity			ovary(1)	1	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			gccttgagacacaaagtattg	0.184													13	64	---	---	---	---	PASS
ASH2L	9070	broad.mit.edu	37	8	37968287	37968287	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37968287C>T	uc003xkt.3	+	5	579	c.521C>T	c.(520-522)GCC>GTC	p.A174V	ASH2L_uc011lbk.1_Missense_Mutation_p.A35V|ASH2L_uc003xku.3_Missense_Mutation_p.A80V|ASH2L_uc010lwa.2_Missense_Mutation_p.A80V	NM_004674	NP_004665	Q9UBL3	ASH2L_HUMAN	ash2-like isoform a	174					hemopoiesis|histone H3-K4 methylation|positive regulation of cell proliferation|regulation of transcription, DNA-dependent|response to estrogen stimulus|transcription from RNA polymerase II promoter	Set1C/COMPASS complex	metal ion binding|protein binding|transcription regulatory region DNA binding			ovary(1)|lung(1)	2	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				AGTGCTTTGGCCAACCTGACA	0.403													3	50	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38146064	38146064	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38146064C>T	uc003xli.2	-	19	3960	c.3442G>A	c.(3442-3444)GAG>AAG	p.E1148K	WHSC1L1_uc011lbm.1_Missense_Mutation_p.E1148K|WHSC1L1_uc010lwe.2_Missense_Mutation_p.E1099K	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	1148	SET.				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TTGATGATCTCTGCATCAGGG	0.532			T	NUP98	AML								114	817	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38146112	38146112	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38146112C>T	uc003xli.2	-	19	3912	c.3394G>A	c.(3394-3396)GAT>AAT	p.D1132N	WHSC1L1_uc011lbm.1_Missense_Mutation_p.D1132N|WHSC1L1_uc010lwe.2_Missense_Mutation_p.D1083N	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	1132	AWS.				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			TGACAACGATCTCCAGCTGGG	0.517			T	NUP98	AML								73	826	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38146142	38146142	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38146142C>T	uc003xli.2	-	19	3882	c.3364G>A	c.(3364-3366)GAA>AAA	p.E1122K	WHSC1L1_uc011lbm.1_Missense_Mutation_p.E1122K|WHSC1L1_uc010lwe.2_Missense_Mutation_p.E1073K	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	1122	AWS.				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			GGGTGGCATTCATACTGCAAC	0.517			T	NUP98	AML								78	818	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38146156	38146156	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38146156C>T	uc003xli.2	-	19	3868	c.3350G>A	c.(3349-3351)AGA>AAA	p.R1117K	WHSC1L1_uc011lbm.1_Missense_Mutation_p.R1117K|WHSC1L1_uc010lwe.2_Missense_Mutation_p.R1068K	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	1117	AWS.				cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			CTGCAACATTCTGTTCAGGCA	0.512			T	NUP98	AML								79	773	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41547781	41547781	+	Silent	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41547781G>T	uc003xok.2	-	33	4152	c.4068C>A	c.(4066-4068)CTC>CTA	p.L1356L	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Silent_p.L672L|ANK1_uc003xoi.2_Silent_p.L1356L|ANK1_uc003xoj.2_Silent_p.L1356L|ANK1_uc003xol.2_Silent_p.L1356L|ANK1_uc003xom.2_Silent_p.L1397L	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	1356					axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TCAGGTGGCAGAGAATGTGCT	0.607													4	169	---	---	---	---	PASS
AP3M2	10947	broad.mit.edu	37	8	42023010	42023010	+	Silent	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42023010G>A	uc003xop.2	+	7	1026	c.735G>A	c.(733-735)GAG>GAA	p.E245E	AP3M2_uc003xoo.2_Silent_p.E245E|AP3M2_uc010lxe.2_RNA|AP3M2_uc003xoq.1_Silent_p.E130E|AP3M2_uc003xor.1_Silent_p.E245E	NM_001134296	NP_001127768	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	245	MHD.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|Golgi apparatus					0	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			GGGAATCTGAGCGCATCCTCT	0.478													16	376	---	---	---	---	PASS
TERF1	7013	broad.mit.edu	37	8	73932953	73932953	+	Silent	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73932953C>T	uc003xzd.2	+	3	475	c.450C>T	c.(448-450)CCC>CCT	p.P150P	TERF1_uc003xzc.2_RNA|TERF1_uc003xze.2_Silent_p.P150P	NM_017489	NP_059523	P54274	TERF1_HUMAN	telomeric repeat binding factor 1 isoform 1	150	TRFH dimerization.				age-dependent telomere shortening|cell division|G2/M transition of mitotic cell cycle|induction of apoptosis|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of telomere maintenance via semi-conservative replication|negative regulation of telomere maintenance via telomerase|positive regulation of microtubule polymerization|positive regulation of mitosis|positive regulation of mitotic cell cycle|protein homooligomerization|regulation of transcription, DNA-dependent|telomere maintenance via telomerase|telomere maintenance via telomerase|telomere maintenance via telomere shortening	chromosome, telomeric region|cytoplasm|nuclear telomere cap complex|nucleoplasm|nucleus|spindle	caspase activator activity|DNA bending activity|double-stranded telomeric DNA binding|identical protein binding|microtubule binding|protein heterodimerization activity|protein homodimerization activity|telomerase inhibitor activity|telomeric DNA binding	p.P150S(1)		ovary(1)|lung(1)|skin(1)	3	Breast(64;0.218)		Epithelial(68;0.0984)			GAATTACACCCTTGGAATCAG	0.294													11	53	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77765924	77765924	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77765924T>C	uc003yav.2	+	10	7019	c.6632T>C	c.(6631-6633)ATA>ACA	p.I2211T	ZFHX4_uc003yau.1_Missense_Mutation_p.I2256T|ZFHX4_uc003yaw.1_Missense_Mutation_p.I2211T	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2211	Homeobox 2.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GATGATGAAATAGAACAACTC	0.408										HNSCC(33;0.089)			5	35	---	---	---	---	PASS
HAS2	3037	broad.mit.edu	37	8	122640991	122640991	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122640991G>A	uc003yph.2	-	2	1128	c.590C>T	c.(589-591)GCC>GTC	p.A197V		NM_005328	NP_005319	Q92819	HAS2_HUMAN	hyaluronan synthase 2	197	Cytoplasmic (Potential).					integral to plasma membrane	hyaluronan synthase activity		HAS2/PLAG1(10)	soft_tissue(10)|ovary(5)	15	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			TGCTCTGAAGGCTGTGTACAT	0.433													52	297	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	125072483	125072483	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125072483C>A	uc003yqw.2	+	23	3143	c.2937C>A	c.(2935-2937)TAC>TAA	p.Y979*	uc003yqy.1_RNA	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	979	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CCCAGATCTACCCGGTTCCTG	0.582													54	238	---	---	---	---	PASS
DMRT1	1761	broad.mit.edu	37	9	968063	968063	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:968063A>G	uc003zgv.2	+	5	1195	c.1046A>G	c.(1045-1047)AAG>AGG	p.K349R		NM_021951	NP_068770	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor	349					cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		AAGAGCACAAAGGCAGTGCTT	0.547													15	67	---	---	---	---	PASS
BNC2	54796	broad.mit.edu	37	9	16552593	16552593	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16552593C>A	uc003zml.2	-	5	744	c.604G>T	c.(604-606)GTA>TTA	p.V202L	BNC2_uc011lmw.1_Missense_Mutation_p.V107L|BNC2_uc003zmm.2_Missense_Mutation_p.V160L|BNC2_uc003zmq.1_Missense_Mutation_p.V216L|BNC2_uc003zmr.1_Missense_Mutation_p.V239L|BNC2_uc003zmp.1_Missense_Mutation_p.V230L|BNC2_uc010mij.1_Missense_Mutation_p.V124L|BNC2_uc011lmv.1_Missense_Mutation_p.V28L|BNC2_uc003zmo.1_Missense_Mutation_p.V124L	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2	202					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		ATGTGCAGTACCTCCTCTTGC	0.577													38	96	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32633383	32633383	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32633383C>A	uc003zrg.1	-	1	2285	c.2195G>T	c.(2194-2196)GGA>GTA	p.G732V	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	732					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		ATCTGGTGCTCCAGGATCTTT	0.438													60	180	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79270405	79270405	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79270405C>A	uc010mpk.2	-	10	8414	c.8290G>T	c.(8290-8292)GAT>TAT	p.D2764Y	PRUNE2_uc011lsk.1_Missense_Mutation_p.D13Y|PRUNE2_uc011lsl.1_Missense_Mutation_p.D28Y|PRUNE2_uc011lsm.1_Missense_Mutation_p.D28Y|PRUNE2_uc004akj.3_Missense_Mutation_p.D217Y|PRUNE2_uc010mpl.1_Missense_Mutation_p.D217Y	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	2764					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						ATTCCTACATCCTCTGACAGT	0.468													5	24	---	---	---	---	PASS
RASEF	158158	broad.mit.edu	37	9	85615900	85615900	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85615900C>A	uc004amo.1	-	10	1609	c.1348G>T	c.(1348-1350)GAC>TAC	p.D450Y		NM_152573	NP_689786	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	450					protein transport|small GTPase mediated signal transduction	perinuclear region of cytoplasm	calcium ion binding|GTP binding			upper_aerodigestive_tract(1)|lung(1)|breast(1)	3						ACTTCTGAGTCATACTCATTG	0.517													18	85	---	---	---	---	PASS
FANCC	2176	broad.mit.edu	37	9	98011585	98011585	+	5'UTR	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98011585C>A	uc004avh.2	-	2					FANCC_uc004avi.3_5'UTR|FANCC_uc010mrm.1_RNA|FANCC_uc011lul.1_RNA	NM_000136	NP_000127	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C						protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)				TTGGAAAAAGCGAAAAGGTGA	0.418			D|Mis|N|F|S			AML|leukemia		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				19	63	---	---	---	---	PASS
PAPPA	5069	broad.mit.edu	37	9	119158849	119158849	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119158849C>A	uc004bjn.2	+	22	5219	c.4838C>A	c.(4837-4839)GCC>GAC	p.A1613D	PAPPA_uc011lxq.1_Missense_Mutation_p.A988D	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	1613					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						GACCCCCAGGCCCAAGAACAC	0.522													54	286	---	---	---	---	PASS
KIAA0649	9858	broad.mit.edu	37	9	138378128	138378128	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138378128G>T	uc004cfr.1	+	4	2321	c.1772G>T	c.(1771-1773)GGC>GTC	p.G591V		NM_014811	NP_055626	Q5T8A7	K0649_HUMAN	1A6/DRIM (down-regulated in metastasis)	591						nucleolus	protein binding			ovary(2)|central_nervous_system(1)	3				OV - Ovarian serous cystadenocarcinoma(145;6.91e-08)|Epithelial(140;4.69e-07)|all cancers(34;9.33e-06)		CCACTGCTGGGCTGCAAAAGG	0.617													27	110	---	---	---	---	PASS
FAM166A	401565	broad.mit.edu	37	9	140138750	140138750	+	Intron	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140138750C>T	uc004cmi.1	-							NM_001001710	NP_001001710	Q6J272	F166A_HUMAN	hypothetical protein LOC401565											ovary(1)	1						ACTGGGGAGACAGGAAGGTGC	0.612													5	81	---	---	---	---	PASS
MTPAP	55149	broad.mit.edu	37	10	30604932	30604932	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30604932C>A	uc001iva.3	-	8	1409	c.1346G>T	c.(1345-1347)GGC>GTC	p.G449V	MTPAP_uc001ivb.3_Missense_Mutation_p.G579V	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN	PAP associated domain containing 1 precursor	449	PAP-associated.				cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1						AGCAAAATTGCCAAAATACTC	0.289													3	45	---	---	---	---	PASS
ITGB1	3688	broad.mit.edu	37	10	33217124	33217124	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33217124T>C	uc001iws.3	-	5	581	c.445A>G	c.(445-447)ATG>GTG	p.M149V	ITGB1_uc001iwp.3_Missense_Mutation_p.M149V|ITGB1_uc001iwq.3_Missense_Mutation_p.M149V|ITGB1_uc001iwr.3_Missense_Mutation_p.M149V|ITGB1_uc001iwt.3_Missense_Mutation_p.M149V|ITGB1_uc001iwu.1_Missense_Mutation_p.M149V	NM_133376	NP_596867	P05556	ITB1_HUMAN	integrin beta 1 isoform 1A precursor	149	Extracellular (Potential).|VWFA.				axon guidance|blood coagulation|cell-cell adhesion mediated by integrin|cell-matrix adhesion|cellular defense response|homophilic cell adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|leukocyte migration|positive regulation of apoptosis|regulation of immune response	cell surface|cleavage furrow|focal adhesion|melanosome|neuromuscular junction|ruffle|sarcolemma	identical protein binding|protein heterodimerization activity|receptor activity			upper_aerodigestive_tract(1)|ovary(1)	2		Ovarian(717;1.34e-05)|Breast(68;0.0634)				GACAGGTCCATAAGGTAGTAG	0.368													47	230	---	---	---	---	PASS
RBP3	5949	broad.mit.edu	37	10	48390601	48390601	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48390601G>A	uc001jez.2	-	1	391	c.277C>T	c.(277-279)CCC>TCC	p.P93S		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	93	4 X approximate tandem repeats.|1.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	GGGGTGCTGGGCTCATAGGAG	0.622													37	173	---	---	---	---	PASS
BICC1	80114	broad.mit.edu	37	10	60573693	60573693	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60573693A>G	uc001jki.1	+	18	2480	c.2480A>G	c.(2479-2481)CAT>CGT	p.H827R	BICC1_uc001jkj.1_Missense_Mutation_p.H468R	NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1	827					multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						CCTGGAAGTCATAGTGAATTT	0.448													39	184	---	---	---	---	PASS
RTKN2	219790	broad.mit.edu	37	10	63999436	63999436	+	Silent	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63999436T>A	uc001jlw.2	-	5	556	c.459A>T	c.(457-459)ACA>ACT	p.T153T	RTKN2_uc001jlx.2_Silent_p.T153T	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2	153					signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)					AACATATATCTGTGATTGTTT	0.269													4	12	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68979521	68979521	+	Silent	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68979521A>G	uc009xpn.1	-	6	810	c.687T>C	c.(685-687)TCT>TCC	p.S229S	CTNNA3_uc001jmw.2_Silent_p.S229S|CTNNA3_uc001jmx.3_Silent_p.S229S|CTNNA3_uc009xpo.1_Silent_p.S89S|CTNNA3_uc001jna.2_Silent_p.S241S	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	229					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						AAGCAACATCAGAATGCTCCA	0.418													43	172	---	---	---	---	PASS
LGI1	9211	broad.mit.edu	37	10	95518045	95518045	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95518045T>A	uc001kjc.3	+	1	480	c.144T>A	c.(142-144)TGT>TGA	p.C48*	LGI1_uc010qnv.1_Nonsense_Mutation_p.C48*|LGI1_uc001kjd.3_Nonsense_Mutation_p.C48*|LGI1_uc009xui.2_RNA|LGI1_uc001kje.2_RNA	NM_005097	NP_005088	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1 precursor	48	LRRNT.				axon guidance|cell proliferation|positive regulation of cell growth|positive regulation of synaptic transmission	cell junction|extracellular space|synapse	receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4		Colorectal(252;0.124)				TGTGTACTTGTACCAAAGATA	0.438													37	181	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	96006091	96006091	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96006091G>T	uc001kjk.2	+	8	3443	c.2809G>T	c.(2809-2811)GAT>TAT	p.D937Y	PLCE1_uc010qnx.1_Missense_Mutation_p.D937Y|PLCE1_uc001kjm.2_Missense_Mutation_p.D629Y	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	937					activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				AGGGGTCTTGGATCTTTTTGC	0.458													40	174	---	---	---	---	PASS
COL17A1	1308	broad.mit.edu	37	10	105815545	105815545	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105815545T>C	uc001kxr.2	-	18	1851	c.1682A>G	c.(1681-1683)GAA>GGA	p.E561G	COL17A1_uc010qqv.1_Missense_Mutation_p.E545G	NM_000494	NP_000485	Q9UMD9	COHA1_HUMAN	alpha 1 type XVII collagen	561	Extracellular (Potential).|Nonhelical region (NC16).				cell-matrix adhesion|epidermis development|hemidesmosome assembly	basement membrane|cell-cell junction|collagen|hemidesmosome|integral to plasma membrane	protein binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CTCACCATTTTCCTGTTCCAT	0.557													16	76	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	127737858	127737858	+	Silent	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127737858C>T	uc001ljk.2	-	16	2303	c.1890G>A	c.(1888-1890)GGG>GGA	p.G630G	ADAM12_uc010qul.1_Silent_p.G581G|ADAM12_uc001ljm.2_Silent_p.G630G|ADAM12_uc001ljn.2_Silent_p.G627G|ADAM12_uc001ljl.3_Silent_p.G627G	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	630	Extracellular (Potential).|Cys-rich.				cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CAAGCACAAGCCCTGGGTCCG	0.517													79	514	---	---	---	---	PASS
CYP2E1	1571	broad.mit.edu	37	10	135342029	135342029	+	Silent	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135342029G>T	uc001lnj.1	+	2	255	c.222G>T	c.(220-222)TCG>TCT	p.S74S	CYP2E1_uc001lnk.1_Intron|CYP2E1_uc009ybl.1_Intron|CYP2E1_uc009ybm.1_Intron	NM_000773	NP_000764	P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E,	74					drug metabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding			central_nervous_system(3)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Dacarbazine(DB00851)|Dapsone(DB00250)|Enflurane(DB00228)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethosuximide(DB00593)|Fomepizole(DB01213)|Glutathione(DB00143)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Isoniazid(DB00951)|Menadione(DB00170)|Mephenytoin(DB00532)|Methoxyflurane(DB01028)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitrofurantoin(DB00698)|Orphenadrine(DB01173)|Phenelzine(DB00780)|Quinidine(DB00908)|S-Adenosylmethionine(DB00118)|Sevoflurane(DB01236)|Theophylline(DB00277)|Tolbutamide(DB01124)	ACGTGGGCTCGCAGCGCATGG	0.682									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				21	71	---	---	---	---	PASS
LRDD	55367	broad.mit.edu	37	11	804285	804285	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:804285C>T	uc001lro.1	-	2	246	c.104G>A	c.(103-105)GGC>GAC	p.G35D	LRDD_uc009yck.1_5'Flank|LRDD_uc001lrk.1_Missense_Mutation_p.G35D|LRDD_uc001lrl.1_5'UTR|LRDD_uc001lrm.1_5'UTR|LRDD_uc001lrn.1_5'UTR|LRDD_uc001lrp.1_5'UTR	NM_145886	NP_665893	Q9HB75	PIDD_HUMAN	leucine rich repeat and death domain containing	35					apoptosis|signal transduction	cytoplasm|nucleus	death receptor binding				0		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGCCGGTTGCCGCCCAGGAA	0.662													3	50	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1276684	1276684	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1276684G>A	uc009ycr.1	+	59	17099	c.16973G>A	c.(16972-16974)AGG>AAG	p.R5658K	MUC5B_uc001ltb.2_Missense_Mutation_p.R5324K	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	5321					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GACCACTGCAGGGGCCGCCTT	0.667													3	10	---	---	---	---	PASS
OR52B4	143496	broad.mit.edu	37	11	4388864	4388864	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4388864A>C	uc010qye.1	-	1	662	c.662T>G	c.(661-663)ATG>AGG	p.M221R		NM_001005161	NP_001005161	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B,	221	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAGAATCAGCATATAGGAAAT	0.388													27	91	---	---	---	---	PASS
OR52J3	119679	broad.mit.edu	37	11	5068293	5068293	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5068293T>C	uc010qyv.1	+	1	538	c.538T>C	c.(538-540)TAC>CAC	p.Y180H		NM_001001916	NP_001001916	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J,	180	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|lung(1)|skin(1)	3		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCCCATTCCTACTGTGAGCA	0.418													13	192	---	---	---	---	PASS
TPP1	1200	broad.mit.edu	37	11	6637572	6637572	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6637572C>T	uc001mel.1	-	8	1110	c.1049G>A	c.(1048-1050)CGG>CAG	p.R350Q	TPP1_uc001mek.1_Missense_Mutation_p.R107Q	NM_000391	NP_000382	O14773	TPP1_HUMAN	tripeptidyl-peptidase I preproprotein	350					bone resorption|cell death|lipid metabolic process|lysosome organization|nervous system development|neuromuscular process controlling balance|peptide catabolic process|protein catabolic process|proteolysis	lysosome|melanosome|soluble fraction	metal ion binding|peptide binding|protein binding|serine-type endopeptidase activity|tripeptidyl-peptidase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)		GGTGAGACCCCGAGCGGCAGC	0.562													9	180	---	---	---	---	PASS
HTATIP2	10553	broad.mit.edu	37	11	20404575	20404575	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20404575A>G	uc009yia.1	+	6	619	c.553A>G	c.(553-555)AGA>GGA	p.R185G	HTATIP2_uc009yib.1_Missense_Mutation_p.R185G|HTATIP2_uc001mpx.2_Missense_Mutation_p.R219G|HTATIP2_uc001mpz.2_Missense_Mutation_p.R185G	NM_006410	NP_006401	Q9BUP3	HTAI2_HUMAN	HIV-1 Tat interactive protein 2, 30kDa isoform	185					angiogenesis|anti-apoptosis|apoptosis|cell differentiation|cellular amino acid metabolic process|induction of apoptosis|interspecies interaction between organisms|nuclear import|regulation of angiogenesis|regulation of transcription from RNA polymerase II promoter	cytoplasm|nuclear envelope	NAD binding|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor|protein binding|transcription coactivator activity				0						ATGGCTGGTTAGAAAGTTCTT	0.428													11	61	---	---	---	---	PASS
OR4B1	119765	broad.mit.edu	37	11	48238463	48238463	+	Silent	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48238463T>C	uc010rhs.1	+	1	102	c.102T>C	c.(100-102)CTT>CTC	p.L34L		NM_001005470	NP_001005470	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B,	34	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|pancreas(1)	4						CCGTGTACCTTGCCACGGTGG	0.512													32	243	---	---	---	---	PASS
OR4C3	256144	broad.mit.edu	37	11	48346728	48346728	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48346728C>A	uc010rhv.1	+	1	236	c.236C>A	c.(235-237)ACG>AAG	p.T79K		NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C,	52	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TCCAGCCCCACGCTGGCTTCC	0.448													5	188	---	---	---	---	PASS
OR4C13	283092	broad.mit.edu	37	11	49974694	49974694	+	Silent	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974694C>A	uc010rhz.1	+	1	720	c.720C>A	c.(718-720)TCC>TCA	p.S240S		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	240	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						CCTGTGTCTCCCACATCACAG	0.458													56	265	---	---	---	---	PASS
APLNR	187	broad.mit.edu	37	11	57003922	57003922	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57003922G>C	uc001njo.2	-	1	1006	c.557C>G	c.(556-558)TCC>TGC	p.S186C	APLNR_uc001njn.3_RNA	NM_005161	NP_005152	P35414	APJ_HUMAN	apelin receptor	186	Extracellular (Potential).					integral to plasma membrane	G-protein coupled receptor activity			lung(5)|ovary(1)	6						GGCCACCATGGAGTAGTCCAT	0.617													7	77	---	---	---	---	PASS
RTN4RL2	349667	broad.mit.edu	37	11	57235245	57235245	+	Silent	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57235245C>T	uc010rjt.1	+	2	195	c.195C>T	c.(193-195)CTC>CTT	p.L65L		NM_178570	NP_848665	Q86UN3	R4RL2_HUMAN	reticulon 4 receptor-like 2 precursor	65	LRR 1.				axon regeneration	anchored to plasma membrane	receptor activity				0						CTCAGCGACTCTTCCTGCAGA	0.617													9	227	---	---	---	---	PASS
OR5B3	441608	broad.mit.edu	37	11	58170406	58170406	+	Silent	SNP	C	A	A	rs141530938		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58170406C>A	uc010rkf.1	-	1	477	c.477G>T	c.(475-477)GGG>GGT	p.G159G		NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B,	159	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TAAATGTGTCCCCAGTGTGGA	0.453													18	143	---	---	---	---	PASS
OR10V1	390201	broad.mit.edu	37	11	59481095	59481095	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59481095G>T	uc001nof.1	-	1	224	c.224C>A	c.(223-225)TCT>TAT	p.S75Y		NM_001005324	NP_001005324	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V,	75	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GGTGATGGAAGATGTATAGAA	0.443													13	53	---	---	---	---	PASS
LRRC32	2615	broad.mit.edu	37	11	76371859	76371859	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76371859C>A	uc001oxq.3	-	3	1021	c.778G>T	c.(778-780)GAC>TAC	p.D260Y	LRRC32_uc001oxr.3_Missense_Mutation_p.D260Y|LRRC32_uc010rsf.1_Missense_Mutation_p.D260Y	NM_005512	NP_005503	Q14392	LRC32_HUMAN	leucine rich repeat containing 32 precursor	260	LRR 9.|Extracellular (Potential).					integral to plasma membrane					0						GCGGCCAGGTCGGGGAAATGG	0.627													17	122	---	---	---	---	PASS
APOA4	337	broad.mit.edu	37	11	116692448	116692448	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116692448A>T	uc001pps.1	-	3	430	c.326T>A	c.(325-327)CTG>CAG	p.L109Q		NM_000482	NP_000473			apolipoprotein A-IV precursor												0	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		ccgggccctcagctcctccag	0.050													10	43	---	---	---	---	PASS
OR6X1	390260	broad.mit.edu	37	11	123624487	123624487	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123624487G>T	uc010rzy.1	-	1	740	c.740C>A	c.(739-741)TCC>TAC	p.S247Y		NM_001005188	NP_001005188	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X,	247	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GTAGAGCAGGGAGACAACTGT	0.468													29	107	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124765025	124765025	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124765025C>A	uc001qbg.2	-	7	1241	c.1101G>T	c.(1099-1101)TGG>TGT	p.W367C	ROBO4_uc010sas.1_Missense_Mutation_p.W222C|ROBO4_uc001qbh.2_Missense_Mutation_p.W257C|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'UTR	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	367	Fibronectin type-III 2.				angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GTGGTGGGACCCAGCTCACAA	0.562													6	101	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9020640	9020640	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9020640G>T	uc001quz.3	+	30	4018	c.3920G>T	c.(3919-3921)TGT>TTT	p.C1307F	A2ML1_uc001qva.1_Missense_Mutation_p.C887F|A2ML1_uc010sgm.1_Missense_Mutation_p.C807F|A2ML1_uc001qvb.1_RNA	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	1151						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						GGCCAGGGCTGTGTCTATGTG	0.498													16	111	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9313081	9313081	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9313081T>C	uc001qvl.2	-	24	2907	c.2878A>G	c.(2878-2880)ATA>GTA	p.I960V	PZP_uc009zgl.2_Missense_Mutation_p.I746V|PZP_uc010sgo.1_RNA	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						GAACCTAATATGTCACCTGGG	0.353													21	137	---	---	---	---	PASS
CAPZA3	93661	broad.mit.edu	37	12	18891942	18891942	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18891942T>A	uc001rdy.2	+	1	898	c.740T>A	c.(739-741)TTA>TAA	p.L247*	PLCZ1_uc001rdv.3_5'Flank|PLCZ1_uc001rdw.3_5'Flank|PLCZ1_uc010sid.1_5'Flank	NM_033328	NP_201585	Q96KX2	CAZA3_HUMAN	capping protein alpha 3	247					actin cytoskeleton organization|actin filament capping	F-actin capping protein complex	actin binding			ovary(1)|central_nervous_system(1)	2	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				TTACAGGAGTTATCCAATGAA	0.433													17	84	---	---	---	---	PASS
SLCO1B3	28234	broad.mit.edu	37	12	21028260	21028260	+	Silent	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21028260C>A	uc001rek.2	+	8	945	c.819C>A	c.(817-819)TCC>TCA	p.S273S	SLCO1B3_uc001rel.2_Silent_p.S273S|SLCO1B3_uc010sil.1_Silent_p.S273S|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Silent_p.S98S	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	273	Helical; Name=6; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					TTATTTCTTCCATACCATTTT	0.363													28	157	---	---	---	---	PASS
SLCO1B3	28234	broad.mit.edu	37	12	21028261	21028261	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21028261A>T	uc001rek.2	+	8	946	c.820A>T	c.(820-822)ATA>TTA	p.I274L	SLCO1B3_uc001rel.2_Missense_Mutation_p.I274L|SLCO1B3_uc010sil.1_Missense_Mutation_p.I274L|LST-3TM12_uc010sim.1_Intron|SLCO1B3_uc001reo.2_Missense_Mutation_p.I99L	NM_019844	NP_062818	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family,	274	Helical; Name=6; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|cytoplasm|integral to plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(2)|ovary(1)|skin(1)	4	Esophageal squamous(101;0.149)					TATTTCTTCCATACCATTTTT	0.363													27	156	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49420213	49420213	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49420213C>A	uc001rta.3	-	48	15536	c.15536G>T	c.(15535-15537)CGT>CTT	p.R5179L		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	5179	FYR N-terminal.		R -> H (in KABS).		chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GCCCCCCACACGGAACATGTG	0.592			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			8	54	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49441830	49441830	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49441830C>A	uc001rta.3	-	14	4154	c.4154G>T	c.(4153-4155)AGC>ATC	p.S1385I		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1385	PHD-type 3.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CCGGCCAAAGCTGCCACATAC	0.547			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			28	86	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49448204	49448204	+	Intron	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49448204A>G	uc001rta.3	-							NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2						chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						AGGACCCTTTACAGGTGGGAA	0.537			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	14	---	---	---	---	PASS
OR10A7	121364	broad.mit.edu	37	12	55615657	55615657	+	Silent	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55615657T>A	uc010spf.1	+	1	849	c.849T>A	c.(847-849)CCT>CCA	p.P283P		NM_001005280	NP_001005280	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)	4						TCATCACACCTATGCTAAACC	0.468													25	108	---	---	---	---	PASS
METTL7B	196410	broad.mit.edu	37	12	56077825	56077825	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56077825G>T	uc010spr.1	+	2	936	c.727G>T	c.(727-729)GTC>TTC	p.V243F		NM_152637	NP_689850	Q6UX53	MET7B_HUMAN	methyltransferase like 7B precursor	243							methyltransferase activity				0						GGGAAAGGCTGTCAAATAATC	0.522													52	143	---	---	---	---	PASS
SMARCC2	6601	broad.mit.edu	37	12	56572240	56572240	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56572240G>A	uc001skb.2	-	14	1364	c.1258C>T	c.(1258-1260)CAG>TAG	p.Q420*	SMARCC2_uc001skd.2_Nonsense_Mutation_p.Q420*|SMARCC2_uc001ska.2_Nonsense_Mutation_p.Q420*|SMARCC2_uc001skc.2_Nonsense_Mutation_p.Q420*|SMARCC2_uc010sqf.1_Nonsense_Mutation_p.Q309*	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated	420					chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TGGTGGGTCTGTTCAGTCACA	0.512													36	159	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	81693080	81693080	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81693080C>A	uc001szo.1	-	23	2885	c.2724G>T	c.(2722-2724)GAG>GAT	p.E908D	PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA|PPFIA2_uc010suf.1_RNA|PPFIA2_uc009zsh.2_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	834										ovary(3)|lung(2)|pancreas(1)	6						ATTCTCTTACCTCTAGCCATG	0.438													4	23	---	---	---	---	PASS
SLC5A8	160728	broad.mit.edu	37	12	101603442	101603442	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101603442G>T	uc001thz.3	-	1	575	c.185C>A	c.(184-186)ACC>AAC	p.T62N		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	62	Helical; (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						GAAGCTAGCGGTGAGGGACAG	0.607													13	62	---	---	---	---	PASS
RNF10	9921	broad.mit.edu	37	12	121001268	121001268	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121001268C>G	uc001typ.3	+	9	1856	c.1373C>G	c.(1372-1374)CCA>CGA	p.P458R	RNF10_uc010szk.1_RNA|RNF10_uc001tyq.3_Missense_Mutation_p.P369R	NM_014868	NP_055683	Q8N5U6	RNF10_HUMAN	ring finger protein 10	458					negative regulation of Schwann cell proliferation|positive regulation of myelination|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GTGTCTGAACCAGAGCCTGAG	0.522													19	103	---	---	---	---	PASS
LNX2	222484	broad.mit.edu	37	13	28143222	28143222	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28143222C>A	uc001url.3	-	3	908	c.599G>T	c.(598-600)TGG>TTG	p.W200L	LNX2_uc001urm.1_Missense_Mutation_p.W200L	NM_153371	NP_699202	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	200							zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)|central_nervous_system(1)	6		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		CTCCTCACTCCATGTGGAAAG	0.527													64	324	---	---	---	---	PASS
SLC10A2	6555	broad.mit.edu	37	13	103718501	103718501	+	Silent	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103718501G>T	uc001vpy.3	-	1	696	c.99C>A	c.(97-99)GTC>GTA	p.V33V		NM_000452	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid	33	Helical; (Potential).				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(3)|skin(1)	4	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CCGTACTTAGGACCACACTTA	0.483													44	179	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108862691	108862691	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108862691C>A	uc001vqn.2	-	2	1199	c.926G>T	c.(925-927)GGT>GTT	p.G309V	LIG4_uc001vqo.2_Missense_Mutation_p.G309V|LIG4_uc010agg.1_Missense_Mutation_p.G242V|LIG4_uc010agf.2_Missense_Mutation_p.G309V|LIG4_uc001vqp.2_Missense_Mutation_p.G309V	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	309					cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					GGTAAGAGAACCTTCAGTAGG	0.363								NHEJ					15	184	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22204549	22204549	+	Intron	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22204549T>C	uc010aio.1	+						uc001wbp.2_Intron|uc010aip.1_Intron					Homo sapiens mRNA for T cell receptor alpha variable 4, partial cds, clone: SEB 72.																		GAGTGAGTTATTTTGGGATGA	0.483													13	35	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22386462	22386462	+	Intron	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22386462C>A	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aiy.2_RNA|uc001wch.2_Nonsense_Mutation_p.Y11*					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TATTTATGTACTTGTGGCTGC	0.418													28	152	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23884662	23884662	+	Silent	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23884662G>T	uc001wjx.2	-	36	5317	c.5211C>A	c.(5209-5211)CTC>CTA	p.L1737L		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1737	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTTCAGTCTGGAGCTGGGACA	0.567													27	174	---	---	---	---	PASS
NYNRIN	57523	broad.mit.edu	37	14	24886215	24886215	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24886215G>T	uc001wpf.3	+	9	5578	c.5260G>T	c.(5260-5262)GAT>TAT	p.D1754Y		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	1754	Integrase catalytic.				DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						CTCCTCCACTGATGCCACACC	0.597													8	64	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30066964	30066964	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30066964C>A	uc001wqh.2	-	16	2348	c.2167G>T	c.(2167-2169)GTG>TTG	p.V723L		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	723	Protein kinase.				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		CAAAGTTTCACCTGTTGATGA	0.433													14	80	---	---	---	---	PASS
DCAF5	8816	broad.mit.edu	37	14	69522303	69522303	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69522303C>A	uc001xkp.2	-	9	1319	c.1100G>T	c.(1099-1101)GGA>GTA	p.G367V	DCAF5_uc001xkq.2_Missense_Mutation_p.G366V	NM_003861	NP_003852	Q96JK2	DCAF5_HUMAN	WD repeat domain 22	367	WD 6.					CUL4 RING ubiquitin ligase complex				ovary(1)|central_nervous_system(1)	2						TCCAGTACATCCTGGCTGCTT	0.478													64	310	---	---	---	---	PASS
C14orf166B	145497	broad.mit.edu	37	14	77294668	77294668	+	Silent	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77294668C>T	uc001xsx.2	+	2	237	c.123C>T	c.(121-123)AGC>AGT	p.S41S	C14orf166B_uc010asn.1_5'UTR|C14orf166B_uc001xsw.2_RNA|C14orf166B_uc010aso.1_RNA|C14orf166B_uc010tvg.1_RNA|C14orf166B_uc010tvh.1_5'Flank	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497	41											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		GACAGAGCAGCGATAAAATGC	0.488													3	64	---	---	---	---	PASS
SETD3	84193	broad.mit.edu	37	14	99872935	99872935	+	Intron	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99872935G>A	uc001ygc.2	-							NM_032233	NP_115609	Q86TU7	SETD3_HUMAN	SET domain containing 3 isoform a						peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|peptidyl-lysine trimethylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone methyltransferase activity (H3-K36 specific)|transcription coactivator activity				0		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				GATCTAGCCCGGGGAGGAGGA	0.517													16	79	---	---	---	---	PASS
MKRN3	7681	broad.mit.edu	37	15	23810970	23810970	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23810970C>A	uc001ywh.3	+	1	517	c.41C>A	c.(40-42)GCC>GAC	p.A14D	MKRN3_uc001ywi.2_Missense_Mutation_p.A14D|MKRN3_uc010ayi.1_Missense_Mutation_p.A14D	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	14						ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		CACGAGGCAGCCGGGGCCCAG	0.622													8	29	---	---	---	---	PASS
MAGEL2	54551	broad.mit.edu	37	15	23890424	23890424	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23890424C>A	uc001ywj.3	-	1	752	c.657G>T	c.(655-657)CAG>CAT	p.Q219H		NM_019066	NP_061939			MAGE-like protein 2												0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CAAAGGGATCCTGCAGAGCAT	0.567													36	121	---	---	---	---	PASS
PAR4	347745	broad.mit.edu	37	15	25451412	25451412	+	Intron	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25451412T>A	uc001yzk.1	+						PAR4_uc010ayo.1_Intron|SNORD115-20_uc001yzq.1_RNA					Homo sapiens clone Rt-13I SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CTAGGTTGGGTCGATGATGAG	0.507													72	332	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26793204	26793204	+	Silent	SNP	G	T	T	rs147235962		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26793204G>T	uc001zaz.2	-	9	1300	c.1158C>A	c.(1156-1158)GGC>GGA	p.G386G	GABRB3_uc010uae.1_Silent_p.G301G|GABRB3_uc001zba.2_Silent_p.G386G|GABRB3_uc001zbb.2_Silent_p.G442G	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	386	Cytoplasmic (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TCCTGGTATCGCCAATGCCGC	0.473													21	226	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29346771	29346771	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29346771G>T	uc001zck.2	+	3	891	c.684G>T	c.(682-684)CAG>CAT	p.Q228H	APBA2_uc010azj.2_Missense_Mutation_p.Q228H|APBA2_uc010uat.1_Missense_Mutation_p.Q228H|APBA2_uc001zcl.2_Missense_Mutation_p.Q228H|APBA2_uc010uas.1_Missense_Mutation_p.Q228H	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	228	STXBP1-binding.				nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		ACATTGACCAGATCGTGGCAG	0.647													4	32	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34130031	34130031	+	Silent	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34130031G>A	uc001zhi.2	+	89	11920	c.11850G>A	c.(11848-11850)GGG>GGA	p.G3950G	RYR3_uc010bar.2_Silent_p.G3945G	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	3950	EF-hand.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCATGGAAGGGCAAAAACAGT	0.408													4	170	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48782195	48782195	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48782195C>A	uc001zwx.1	-	25	3263	c.2935G>T	c.(2935-2937)GCC>TCC	p.A979S		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	979	TB 5.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CAGCAGCAGGCGTCCATGCGG	0.607													23	100	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79298689	79298689	+	Silent	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79298689G>T	uc002beq.2	-	15	2328	c.1953C>A	c.(1951-1953)GCC>GCA	p.A651A	RASGRF1_uc002bep.2_Silent_p.A638A|RASGRF1_uc010blm.1_Silent_p.A560A|RASGRF1_uc002ber.3_Silent_p.A638A|RASGRF1_uc010unh.1_Silent_p.A46A	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	651	N-terminal Ras-GEF.				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						GCTCCACACTGGCGTAGCGGA	0.572													15	64	---	---	---	---	PASS
AP3B2	8120	broad.mit.edu	37	15	83349700	83349700	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83349700G>T	uc010uoh.1	-	7	837	c.660C>A	c.(658-660)AAC>AAA	p.N220K	AP3B2_uc010uoi.1_Missense_Mutation_p.N220K|AP3B2_uc010uoj.1_Missense_Mutation_p.N188K|AP3B2_uc010uog.1_5'Flank	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2	220					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			GTTTCCGGTAGTTTTTGTGAA	0.592													12	47	---	---	---	---	PASS
FSD2	123722	broad.mit.edu	37	15	83428314	83428314	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83428314T>C	uc002bjd.2	-	13	2203	c.2036A>G	c.(2035-2037)GAT>GGT	p.D679G	FSD2_uc010uol.1_Missense_Mutation_p.D634G|FSD2_uc010uom.1_Missense_Mutation_p.D634G	NM_001007122	NP_001007123	A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing	679	B30.2/SPRY.									central_nervous_system(1)	1						TATTCTTATATCTGGAGTTGT	0.299													3	22	---	---	---	---	PASS
RHBDF1	64285	broad.mit.edu	37	16	111619	111619	+	Silent	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:111619C>A	uc002cfl.3	-	12	1432	c.1284G>T	c.(1282-1284)GCG>GCT	p.A428A	RHBDF1_uc010uty.1_Silent_p.A451A|RHBDF1_uc010utz.1_Silent_p.A428A|RHBDF1_uc010bqo.1_RNA	NM_022450	NP_071895	Q96CC6	RHDF1_HUMAN	rhomboid family 1	428	Helical; (Potential).				cell migration|cell proliferation|negative regulation of protein secretion|protein transport|proteolysis|regulation of epidermal growth factor receptor signaling pathway|regulation of proteasomal protein catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity			ovary(1)|pancreas(1)	2		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				AGCCCACGGGCGCGATGCCAT	0.667													17	70	---	---	---	---	PASS
CLCN7	1186	broad.mit.edu	37	16	1501634	1501634	+	Silent	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1501634G>A	uc002clv.2	-	16	1547	c.1437C>T	c.(1435-1437)CAC>CAT	p.H479H	CLCN7_uc002clu.2_5'Flank|CLCN7_uc002clw.2_Silent_p.H455H	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a	479						integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				CTGGCGGGTCGTGGAAGAGGC	0.637													7	36	---	---	---	---	PASS
ZNF75A	7627	broad.mit.edu	37	16	3367355	3367355	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3367355A>T	uc002cut.3	+	6	903	c.377A>T	c.(376-378)CAC>CTC	p.H126L	ZNF75A_uc002cuv.3_RNA	NM_153028	NP_694573	Q96N20	ZN75A_HUMAN	zinc finger protein 75a	126					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1						GGAAAATGGCACCAAGATTTT	0.403													8	70	---	---	---	---	PASS
A2BP1	54715	broad.mit.edu	37	16	7680645	7680645	+	Silent	SNP	C	A	A	rs147636119	by1000genomes	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:7680645C>A	uc002cys.2	+	11	1705	c.717C>A	c.(715-717)TCC>TCA	p.S239S	A2BP1_uc010buf.1_Silent_p.S239S|A2BP1_uc002cyr.1_Silent_p.S238S|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Silent_p.S282S|A2BP1_uc010uya.1_Silent_p.S196S|A2BP1_uc002cyv.1_Silent_p.S239S|A2BP1_uc010uyb.1_Silent_p.S239S|A2BP1_uc002cyw.2_Silent_p.S259S|A2BP1_uc002cyy.2_Silent_p.S259S|A2BP1_uc002cyx.2_Silent_p.S259S|A2BP1_uc010uyc.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4	239					mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		AGGGATCTTCCATGTACAGTG	0.483													21	102	---	---	---	---	PASS
PDILT	204474	broad.mit.edu	37	16	20380837	20380837	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20380837T>A	uc002dhc.1	-	8	1316	c.1093A>T	c.(1093-1095)AGC>TGC	p.S365C		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	365					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						CTCAGGAAGCTGCGGCCAAAT	0.423													63	261	---	---	---	---	PASS
PDILT	204474	broad.mit.edu	37	16	20410427	20410427	+	Missense_Mutation	SNP	G	A	A	rs147993256	byFrequency	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20410427G>A	uc002dhc.1	-	2	419	c.196C>T	c.(196-198)CTT>TTT	p.L66F		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	66					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						TCACGGAAAAGCACCATGAGG	0.542													4	73	---	---	---	---	PASS
ITGAD	3681	broad.mit.edu	37	16	31422791	31422791	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31422791C>G	uc002ebv.1	+	14	1709	c.1660C>G	c.(1660-1662)CTG>GTG	p.L554V	ITGAD_uc010cap.1_Missense_Mutation_p.L555V	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor	554	FG-GAP 6.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						TGCTGTCTACCTGTTTCACGG	0.607													26	152	---	---	---	---	PASS
CX3CL1	6376	broad.mit.edu	37	16	57416881	57416881	+	Silent	SNP	G	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57416881G>C	uc002eli.2	+	3	1198	c.1131G>C	c.(1129-1131)GCG>GCC	p.A377A		NM_002996	NP_002987	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1 precursor	377	Cytoplasmic (Potential).				cell adhesion|cytokine-mediated signaling pathway|defense response|immune response|leukocyte adhesive activation|positive regulation of calcium-independent cell-cell adhesion|positive regulation of inflammatory response	cell surface|extracellular space|integral to membrane|plasma membrane	chemokine activity				0						GAGAGATGGCGGAGGGCCTTC	0.587													28	113	---	---	---	---	PASS
CDH16	1014	broad.mit.edu	37	16	66950228	66950228	+	Silent	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66950228C>A	uc002eql.2	-	4	307	c.234G>T	c.(232-234)CTG>CTT	p.L78L	CDH16_uc010cdy.2_Silent_p.L78L|CDH16_uc002eqm.2_Silent_p.L78L	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	78	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		TGGTCACCAGCAGGAAGCCAG	0.632													4	155	---	---	---	---	PASS
SLC9A5	6553	broad.mit.edu	37	16	67289821	67289821	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67289821C>A	uc002esm.2	+	5	962	c.899C>A	c.(898-900)TCC>TAC	p.S300Y	SLC9A5_uc010cee.2_Missense_Mutation_p.S5Y|SLC9A5_uc010vji.1_5'UTR	NM_004594	NP_004585	Q14940	SL9A5_HUMAN	solute carrier family 9 (sodium/hydrogen	300					regulation of pH	integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			ovary(1)|pancreas(1)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)		GCCTCGCTCTCCGCCATTCTT	0.617													4	94	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	70902522	70902522	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70902522C>T	uc002ezr.2	-	66	11386	c.11258G>A	c.(11257-11259)TGG>TAG	p.W3753*	HYDIN_uc010cfy.2_5'Flank	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	3754										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				TACGTCCACCCACTTGACTGT	0.517													16	61	---	---	---	---	PASS
CLEC3A	10143	broad.mit.edu	37	16	78062080	78062080	+	Silent	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:78062080G>T	uc002ffh.3	+	2	273	c.192G>T	c.(190-192)CTG>CTT	p.L64L		NM_005752	NP_005743	O75596	CLC3A_HUMAN	C-type lectin domain family 3 member A	64					skeletal system development	extracellular region	sugar binding				0						TTCAAGCCCTGCAGACAGGTA	0.443													22	49	---	---	---	---	PASS
ABR	29	broad.mit.edu	37	17	916363	916363	+	Missense_Mutation	SNP	G	C	C	rs147397030	by1000genomes	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:916363G>C	uc002fsd.2	-	17	1943	c.1833C>G	c.(1831-1833)GAC>GAG	p.D611E	ABR_uc002fse.2_Missense_Mutation_p.D565E|ABR_uc010vqf.1_Missense_Mutation_p.D62E|ABR_uc010vqg.1_Missense_Mutation_p.D393E|ABR_uc002fsg.2_Missense_Mutation_p.D574E|ABR_uc002fsh.1_Intron|ABR_uc002fsf.2_5'Flank	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related	611					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		TCTCAATCACGTCCGTGTGCC	0.622													7	114	---	---	---	---	PASS
SMG6	23293	broad.mit.edu	37	17	2202345	2202345	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2202345C>T	uc002fub.1	-	2	1757	c.1702G>A	c.(1702-1704)GAG>AAG	p.E568K	SMG6_uc002fud.1_Missense_Mutation_p.E537K	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay	568	Potential.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4						TGCTCTACCTCCTCGGGACTC	0.582													61	506	---	---	---	---	PASS
SHPK	23729	broad.mit.edu	37	17	3524666	3524666	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3524666T>C	uc002fvz.1	-	5	791	c.688A>G	c.(688-690)ATC>GTC	p.I230V		NM_013276	NP_037408	Q9UHJ6	SHPK_HUMAN	carbohydrate kinase-like	230					carbohydrate metabolic process	cytoplasm	ATP binding|sedoheptulokinase activity			ovary(1)	1				COAD - Colon adenocarcinoma(5;0.0828)		GGCTCGGCGATGTCTGGGAGC	0.557													6	146	---	---	---	---	PASS
ANKFY1	51479	broad.mit.edu	37	17	4088199	4088199	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4088199G>A	uc002fxq.1	-	12	1651	c.1613C>T	c.(1612-1614)GCG>GTG	p.A538V	ANKFY1_uc002fxn.2_Missense_Mutation_p.A580V|ANKFY1_uc002fxo.2_Missense_Mutation_p.A538V|ANKFY1_uc002fxp.2_Missense_Mutation_p.A537V|ANKFY1_uc010ckp.2_Missense_Mutation_p.A479V	NM_016376	NP_057460	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	538						endosome membrane	metal ion binding|protein binding			ovary(2)|skin(1)	3						GACGCTGTCCGCCAAGCTGGT	0.592													6	112	---	---	---	---	PASS
ALOX15	246	broad.mit.edu	37	17	4542273	4542273	+	Intron	SNP	G	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4542273G>C	uc002fyh.2	-						ALOX15_uc010vsd.1_Intron|ALOX15_uc010vse.1_Intron	NM_001140	NP_001131	P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase						inflammatory response|leukotriene biosynthetic process	nucleus	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			skin(3)|ovary(1)|lung(1)	5				READ - Rectum adenocarcinoma(115;0.0327)	Ciclopirox(DB01188)|Masoprocol(DB00179)|Zileuton(DB00744)	CCCACCTGTGGGGCAGGAAGG	0.537													37	144	---	---	---	---	PASS
MYH3	4621	broad.mit.edu	37	17	10535885	10535885	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10535885C>T	uc002gmq.1	-	33	4941	c.4864G>A	c.(4864-4866)GAC>AAC	p.D1622N		NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,	1622	Potential.		D -> A (in DA2B).		muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						TCATTCAGGTCCCCCTCCATC	0.587													117	447	---	---	---	---	PASS
ULK2	9706	broad.mit.edu	37	17	19687111	19687111	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19687111C>A	uc002gwm.3	-	22	2868	c.2359G>T	c.(2359-2361)GCT>TCT	p.A787S	ULK2_uc002gwn.2_Missense_Mutation_p.A787S	NM_001142610	NP_001136082	Q8IYT8	ULK2_HUMAN	unc-51-like kinase 2	787					signal transduction		ATP binding|protein binding|protein serine/threonine kinase activity			skin(2)|large_intestine(1)|stomach(1)	4	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					AGGCTGGGAGCTGCCTCTGCT	0.652													38	91	---	---	---	---	PASS
NOS2	4843	broad.mit.edu	37	17	26110067	26110067	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26110067G>A	uc002gzu.2	-	6	797	c.533C>T	c.(532-534)ACC>ATC	p.T178I	NOS2_uc010crh.1_Missense_Mutation_p.T178I|NOS2_uc010wab.1_Missense_Mutation_p.T178I	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	178					arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	CAGTTGGTAGGTTCCTGTTGT	0.547													36	186	---	---	---	---	PASS
NLK	51701	broad.mit.edu	37	17	26370294	26370294	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26370294C>T	uc010crj.2	+	1	607	c.395C>T	c.(394-396)CCA>CTA	p.P132L	NLK_uc010cri.1_RNA	NM_016231	NP_057315	Q9UBE8	NLK_HUMAN	nemo like kinase	132					intracellular protein kinase cascade|negative regulation of Wnt receptor signaling pathway|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|serine phosphorylation of STAT3 protein|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|MAP kinase activity|SH2 domain binding|transcription factor binding|ubiquitin protein ligase binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		TCGCATCATCCACAGCAGCAG	0.547													42	187	---	---	---	---	PASS
POLDIP2	26073	broad.mit.edu	37	17	26680782	26680782	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26680782A>G	uc002haz.2	-	7	509	c.377T>C	c.(376-378)GTG>GCG	p.V126A	POLDIP2_uc010wag.1_RNA	NM_015584	NP_056399	Q9Y2S7	PDIP2_HUMAN	DNA polymerase delta interacting protein 2	126						mitochondrial nucleoid|nucleus					0	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		TTTGCCTTTCACCTCCTTGGA	0.537													13	391	---	---	---	---	PASS
CCL4	6351	broad.mit.edu	37	17	34431319	34431319	+	Silent	SNP	C	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34431319C>G	uc002hkw.1	+	1	100	c.21C>G	c.(19-21)GTC>GTG	p.V7V	CCL4_uc002hkx.1_RNA	NM_002984	NP_002975	P13236	CCL4_HUMAN	chemokine C-C motif ligand 4 isoform 1	7					cell adhesion|cell-cell signaling|cellular component movement|chemotaxis|establishment or maintenance of cell polarity|immune response|inflammatory response|response to virus|viral genome replication	extracellular space	chemokine activity|receptor signaling protein tyrosine kinase activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GCGTGACTGTCCTGTCTCTCC	0.517													142	693	---	---	---	---	PASS
FBXO47	494188	broad.mit.edu	37	17	37107844	37107844	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37107844G>C	uc002hrc.2	-	6	806	c.606C>G	c.(604-606)TGC>TGG	p.C202W		NM_001008777	NP_001008777	Q5MNV8	FBX47_HUMAN	F-box protein 47	202											0						CTGGTTTGCTGCAGACAGCCA	0.318													21	125	---	---	---	---	PASS
KCNH4	23415	broad.mit.edu	37	17	40330146	40330146	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40330146C>T	uc002hzb.2	-	4	890	c.557G>A	c.(556-558)CGG>CAG	p.R186Q		NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,	186	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCCCTGGCCCCGGCGGCCAAA	0.592													33	187	---	---	---	---	PASS
UBTF	7343	broad.mit.edu	37	17	42289030	42289030	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42289030G>A	uc002igb.2	-	9	1058	c.991C>T	c.(991-993)CAG>TAG	p.Q331*	UBTF_uc002igc.2_Nonsense_Mutation_p.Q294*|UBTF_uc010czs.2_Nonsense_Mutation_p.Q331*|UBTF_uc002igd.2_Nonsense_Mutation_p.Q294*|UBTF_uc010czt.2_Nonsense_Mutation_p.Q331*|UBTF_uc002ige.2_Nonsense_Mutation_p.Q294*	NM_014233	NP_055048	P17480	UBF1_HUMAN	upstream binding transcription factor, RNA	331	HMG box 3.				positive regulation of transcription from RNA polymerase I promoter|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	nucleolus|nucleoplasm	DNA binding|protein binding				0		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		AGCTTCCACTGCTGGCTGCAC	0.587													35	169	---	---	---	---	PASS
KIF18B	146909	broad.mit.edu	37	17	43010134	43010134	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43010134G>T	uc010wji.1	-	9	1246	c.1145C>A	c.(1144-1146)GCT>GAT	p.A382D	KIF18B_uc002iht.2_Missense_Mutation_p.A382D|KIF18B_uc010wjh.1_Missense_Mutation_p.A382D	NM_001080443	NP_001073912			kinesin family member 18B											ovary(2)	2		Prostate(33;0.155)				CTTCCTCAGAGCGGCTACCTG	0.642													26	135	---	---	---	---	PASS
KIF18B	146909	broad.mit.edu	37	17	43013655	43013655	+	Silent	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43013655G>T	uc010wji.1	-	2	159	c.58C>A	c.(58-60)CGG>AGG	p.R20R	KIF18B_uc002iht.2_Silent_p.R20R|KIF18B_uc010wjh.1_Silent_p.R20R	NM_001080443	NP_001073912			kinesin family member 18B											ovary(2)	2		Prostate(33;0.155)				TCCAGCTCCCGAGGGGTGGGG	0.647													4	14	---	---	---	---	PASS
OSBPL7	114881	broad.mit.edu	37	17	45897348	45897348	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45897348C>G	uc002ilx.1	-	3	393	c.190G>C	c.(190-192)GGC>CGC	p.G64R	OSBPL7_uc002ilw.1_5'Flank	NM_145798	NP_665741	Q9BZF2	OSBL7_HUMAN	oxysterol-binding protein-like protein 7	64	PH.				lipid transport		lipid binding				0						TTGTGCCAGCCCTTCAGAGGC	0.637													8	41	---	---	---	---	PASS
BZRAP1	9256	broad.mit.edu	37	17	56393786	56393786	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56393786C>T	uc002ivx.3	-	15	2859	c.1988G>A	c.(1987-1989)AGC>AAC	p.S663N	BZRAP1_uc010dcs.2_Missense_Mutation_p.S603N|BZRAP1_uc010wnt.1_Missense_Mutation_p.S663N	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	663	SH3 1.					mitochondrion	benzodiazepine receptor binding			upper_aerodigestive_tract(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGGACCCACCTATAACGTGC	0.657													4	168	---	---	---	---	PASS
BCAS3	54828	broad.mit.edu	37	17	59147334	59147334	+	Intron	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59147334C>A	uc002iyv.3	+						BCAS3_uc002iyu.3_Intron|BCAS3_uc002iyw.3_Intron|BCAS3_uc002iyy.3_Intron|BCAS3_uc002iyz.3_Intron|BCAS3_uc002iza.3_Intron	NM_001099432	NP_001092902	Q9H6U6	BCAS3_HUMAN	breast carcinoma amplified sequence 3 isoform 1							nucleus				ovary(2)|central_nervous_system(2)|skin(1)	5			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TGTCCACAGCCACAAAAAGAA	0.567													44	114	---	---	---	---	PASS
TBX4	9496	broad.mit.edu	37	17	59557523	59557523	+	Silent	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59557523G>A	uc002izi.2	+	7	909	c.864G>A	c.(862-864)CCG>CCA	p.P288P	TBX4_uc010ddo.2_Silent_p.P288P|TBX4_uc010woy.1_Silent_p.P288P	NM_018488	NP_060958	P57082	TBX4_HUMAN	T-box 4	288					leg morphogenesis|skeletal system morphogenesis	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						CAGCCACACCGGACGTGGGCC	0.637													22	198	---	---	---	---	PASS
UBE2O	63893	broad.mit.edu	37	17	74394577	74394577	+	Silent	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74394577C>A	uc002jrm.3	-	11	1937	c.1872G>T	c.(1870-1872)CTG>CTT	p.L624L	UBE2O_uc002jrn.3_Silent_p.L624L|UBE2O_uc002jrl.3_Silent_p.L227L	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	624							ATP binding|ubiquitin-protein ligase activity			breast(2)|skin(2)|lung(1)	5						CACTCGGCCTCAGCTTGAACC	0.602											OREG0024751	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	185	---	---	---	---	PASS
PGS1	9489	broad.mit.edu	37	17	76388642	76388642	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76388642G>A	uc002jvm.2	+	2	241	c.229G>A	c.(229-231)GTG>ATG	p.V77M	PGS1_uc010wtt.1_RNA	NM_024419	NP_077733	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	77					phospholipid biosynthetic process	endoplasmic reticulum|mitochondrion	ATP binding|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity				0			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			TCCAGAAGGCGTGCACCGGTT	0.537													29	117	---	---	---	---	PASS
CSNK1D	1453	broad.mit.edu	37	17	80210985	80210985	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80210985C>A	uc002kej.2	-	4	788	c.472G>T	c.(472-474)GAT>TAT	p.D158Y	SLC16A3_uc002kee.2_Intron|CSNK1D_uc002kef.2_Missense_Mutation_p.D158Y|CSNK1D_uc002kei.2_Missense_Mutation_p.D158Y|CSNK1D_uc010wvj.1_Intron|CSNK1D_uc010dil.2_5'Flank|CSNK1D_uc002keh.2_Missense_Mutation_p.D23Y|CSNK1D_uc010dim.1_5'Flank	NM_001893	NP_001884	P48730	KC1D_HUMAN	casein kinase 1, delta isoform 1	158	Protein kinase.				circadian regulation of gene expression|DNA repair|G2/M transition of mitotic cell cycle|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|regulation of circadian rhythm|Wnt receptor signaling pathway	centrosome|cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			breast(2)	2	Breast(20;0.00136)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0155)			GTGCGTGCATCCCGGTACTTC	0.592													64	224	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5416197	5416197	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5416197T>A	uc002kmt.1	-	13	1773	c.1687A>T	c.(1687-1689)AGG>TGG	p.R563W	EPB41L3_uc010wzh.1_Intron|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc002kms.1_Intron|EPB41L3_uc010wze.1_Intron|EPB41L3_uc010wzf.1_Intron|EPB41L3_uc010wzg.1_Intron|EPB41L3_uc010dkr.2_Intron	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	563	Spectrin--actin-binding (Potential).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						AGGTAAGGCCTCCCTGGGCCA	0.557													47	192	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5416198	5416198	+	Silent	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5416198C>A	uc002kmt.1	-	13	1772	c.1686G>T	c.(1684-1686)GGG>GGT	p.G562G	EPB41L3_uc010wzh.1_Intron|EPB41L3_uc002kmu.1_Intron|EPB41L3_uc010dkq.1_Intron|EPB41L3_uc002kms.1_Intron|EPB41L3_uc010wze.1_Intron|EPB41L3_uc010wzf.1_Intron|EPB41L3_uc010wzg.1_Intron|EPB41L3_uc010dkr.2_Intron	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	562	Spectrin--actin-binding (Potential).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						GGTAAGGCCTCCCTGGGCCAT	0.562													48	189	---	---	---	---	PASS
SYT4	6860	broad.mit.edu	37	18	40850570	40850570	+	Silent	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40850570G>T	uc002law.2	-	4	1383	c.1014C>A	c.(1012-1014)ATC>ATA	p.I338I	SYT4_uc010dng.2_RNA|SYT4_uc010xcm.1_Silent_p.I320I|SYT4_uc010dnh.2_Intron	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	338	C2 2.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			skin(5)	5						TCTTCTTGGAGATTCTCTTTT	0.433													27	165	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50985835	50985835	+	Intron	SNP	A	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50985835A>T	uc002lfe.1	+						DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TCAGGTAATTATCTTTTCACT	0.438													34	133	---	---	---	---	PASS
ZNF532	55205	broad.mit.edu	37	18	56648807	56648807	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56648807T>A	uc002lho.2	+	10	3916	c.3369T>A	c.(3367-3369)GAT>GAA	p.D1123E	ZNF532_uc002lhp.2_Missense_Mutation_p.D1121E|ZNF532_uc010xeg.1_Missense_Mutation_p.D1121E|ZNF532_uc002lhr.2_Missense_Mutation_p.D1121E|ZNF532_uc002lhs.2_Missense_Mutation_p.D1121E|ZNF532_uc010xeh.1_Missense_Mutation_p.D211E	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	1123					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						AAATGACAGATGCCACCAATG	0.443													30	143	---	---	---	---	PASS
SERPINB8	5271	broad.mit.edu	37	18	61649041	61649041	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61649041T>A	uc002ljv.2	+	4	562	c.393T>A	c.(391-393)CAT>CAA	p.H131Q	SERPINB8_uc002ljs.1_Missense_Mutation_p.H131Q|SERPINB8_uc002ljt.2_Missense_Mutation_p.H131Q|SERPINB8_uc002lju.2_Missense_Mutation_p.H131Q|SERPINB8_uc010xex.1_5'UTR	NM_198833	NP_942130	P50452	SPB8_HUMAN	serine (or cysteine) proteinase inhibitor, clade	131					regulation of proteolysis	cytosol	protein binding|serine-type endopeptidase inhibitor activity			skin(1)	1		Esophageal squamous(42;0.129)				GCAGGAAGCATATAAATGACT	0.428													55	252	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67672496	67672496	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67672496G>A	uc002lkp.2	-	48	6601	c.6533C>T	c.(6532-6534)ACA>ATA	p.T2178I	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Missense_Mutation_p.T1266I|RTTN_uc002lkn.2_Missense_Mutation_p.T168I|RTTN_uc010dqp.2_Missense_Mutation_p.T430I	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	2178							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				TTTCAAAGCTGTTTTTGCCTA	0.343													6	125	---	---	---	---	PASS
TSHZ1	10194	broad.mit.edu	37	18	72998468	72998468	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72998468G>T	uc002lly.2	+	2	1534	c.971G>T	c.(970-972)GGA>GTA	p.G324V		NM_005786	NP_005777	Q6ZSZ6	TSH1_HUMAN	teashirt family zinc finger 1	369						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GAGCCAGCAGGAATGGCCGCA	0.627													29	87	---	---	---	---	PASS
TJP3	27134	broad.mit.edu	37	19	3728466	3728466	+	Silent	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3728466C>T	uc010xhv.1	+	1	93	c.93C>T	c.(91-93)GCC>GCT	p.A31A	TJP3_uc010xhs.1_Silent_p.A12A|TJP3_uc010xht.1_Intron|TJP3_uc010xhu.1_Silent_p.A21A|TJP3_uc010xhw.1_Silent_p.A31A	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3	12	PDZ 1.					tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCACACGGCCACACTGTCCA	0.597													11	37	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8206868	8206868	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8206868C>A	uc002mjf.2	-	6	716	c.695G>T	c.(694-696)TGC>TTC	p.C232F		NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	232	TB 1.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GCCGCGGCGGCAGGGGTGTGG	0.637													11	50	---	---	---	---	PASS
HNRNPM	4670	broad.mit.edu	37	19	8550681	8550681	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8550681A>G	uc010dwe.2	+	14	1449	c.1369A>G	c.(1369-1371)ATG>GTG	p.M457V	HNRNPM_uc010xke.1_Missense_Mutation_p.M403V|HNRNPM_uc010dwd.2_Missense_Mutation_p.M418V|HNRNPM_uc002mka.2_Missense_Mutation_p.M322V|HNRNPM_uc002mkb.1_5'Flank	NM_005968	NP_005959	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	457	8.|27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding				0						CATTGAGCGCATGGGCCCGCT	0.687													27	133	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9068728	9068728	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9068728A>T	uc002mkp.2	-	3	18922	c.18718T>A	c.(18718-18720)TTG>ATG	p.L6240M		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6242	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGCTCTTGCAATGTGGAAGTT	0.493													18	125	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9070944	9070944	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9070944G>T	uc002mkp.2	-	3	16706	c.16502C>A	c.(16501-16503)ACA>AAA	p.T5501K		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5503	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TGTCTCTGTTGTTGAGCTGGT	0.473													13	111	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9071179	9071179	+	Missense_Mutation	SNP	C	T	T	rs138208562	by1000genomes	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9071179C>T	uc002mkp.2	-	3	16471	c.16267G>A	c.(16267-16269)GCA>ACA	p.A5423T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5425	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTGGTCACTGCGGTGTTTGTG	0.502													68	640	---	---	---	---	PASS
DOCK6	57572	broad.mit.edu	37	19	11314989	11314989	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11314989C>A	uc002mqs.3	-	40	5148	c.5107G>T	c.(5107-5109)GTG>TTG	p.V1703L	DOCK6_uc002mqr.3_Missense_Mutation_p.V101L|DOCK6_uc010xlq.1_Missense_Mutation_p.V1042L	NM_020812	NP_065863	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1703	DHR-2.				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						ACCTCATTCACCGCCTCGTAG	0.592											OREG0025251	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	47	---	---	---	---	PASS
ILVBL	10994	broad.mit.edu	37	19	15234201	15234201	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15234201T>C	uc002nam.2	-	3	443	c.322A>G	c.(322-324)ATG>GTG	p.M108V	ILVBL_uc010dzw.2_Missense_Mutation_p.M1V|ILVBL_uc010dzx.1_Missense_Mutation_p.M108V	NM_006844	NP_006835	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	108						integral to membrane	magnesium ion binding|thiamine pyrophosphate binding|transferase activity			ovary(2)	2						AGGCGGGCCATAGCATCAGCA	0.612													16	63	---	---	---	---	PASS
KIAA1683	80726	broad.mit.edu	37	19	18376717	18376717	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18376717C>A	uc002nin.2	-	3	1849	c.1633G>T	c.(1633-1635)GGC>TGC	p.G545C	KIAA1683_uc010ebn.2_Missense_Mutation_p.G545C|KIAA1683_uc010xqe.1_Missense_Mutation_p.G499C	NM_025249	NP_079525	Q9H0B3	K1683_HUMAN	KIAA1683 isoform b	545						mitochondrion				ovary(2)	2						TGGATGGAGCCTGAGGTGTTG	0.587													7	71	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22940611	22940611	+	Silent	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940611A>G	uc010xrh.1	-	5	1827	c.1827T>C	c.(1825-1827)ACT>ACC	p.T609T		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTCTTTCCAGTATGAATTA	0.363													11	99	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22941338	22941338	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22941338C>T	uc010xrh.1	-	5	1100	c.1100G>A	c.(1099-1101)TGC>TAC	p.C367Y		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AGCTTTGCTGCATTCTTCACA	0.358													12	91	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22952122	22952122	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22952122G>C	uc010xrh.1	-	2	71	c.71C>G	c.(70-72)TCG>TGG	p.S24W		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AAATGTCAACGATCCCTGAAA	0.388													15	97	---	---	---	---	PASS
LSM14A	26065	broad.mit.edu	37	19	34712450	34712450	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34712450A>G	uc002nvb.3	+	9	1371	c.1175A>G	c.(1174-1176)AAT>AGT	p.N392S	LSM14A_uc002nva.3_Missense_Mutation_p.N392S|LSM14A_uc010xru.1_Missense_Mutation_p.N351S|LSM14A_uc002nvc.3_Missense_Mutation_p.N198S	NM_001114093	NP_001107565	Q8ND56	LS14A_HUMAN	LSM14 homolog A isoform a	392	TFG box.				cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule				skin(1)	1	Esophageal squamous(110;0.162)					AGAAGATTAAATGCTGAAACA	0.463													12	65	---	---	---	---	PASS
ARHGAP33	115703	broad.mit.edu	37	19	36273406	36273406	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36273406A>G	uc002obr.1	+	13	1302	c.1217A>G	c.(1216-1218)TAT>TGT	p.Y406C	ARHGAP33_uc002obs.1_Missense_Mutation_p.Y406C|ARHGAP33_uc002obt.1_Missense_Mutation_p.Y270C|ARHGAP33_uc010eel.2_5'UTR|ARHGAP33_uc002obv.1_5'Flank	NM_052948	NP_443180	O14559	RHG33_HUMAN	sorting nexin 26	406	Rho-GAP.				cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding			skin(2)|ovary(1)|pancreas(1)	4						TACCAGCTCTATGGGAAGTTC	0.617													16	65	---	---	---	---	PASS
ARHGAP33	115703	broad.mit.edu	37	19	36276001	36276001	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36276001G>A	uc002obr.1	+	17	1799	c.1714G>A	c.(1714-1716)GCG>ACG	p.A572T	ARHGAP33_uc002obs.1_Missense_Mutation_p.A572T|ARHGAP33_uc002obt.1_Missense_Mutation_p.A436T|ARHGAP33_uc010eel.2_Missense_Mutation_p.A160T|ARHGAP33_uc002obv.1_Missense_Mutation_p.A160T	NM_052948	NP_443180	O14559	RHG33_HUMAN	sorting nexin 26	572					cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding			skin(2)|ovary(1)|pancreas(1)	4						GGCCTCACCTGCGGAAAGGTG	0.701													5	9	---	---	---	---	PASS
ZNF585A	199704	broad.mit.edu	37	19	37644466	37644466	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37644466C>T	uc002ofo.1	-	5	566	c.335G>A	c.(334-336)AGT>AAT	p.S112N	ZNF585A_uc002ofm.1_Missense_Mutation_p.S57N|ZNF585A_uc002ofn.1_Missense_Mutation_p.S57N	NM_199126	NP_954577	Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	112					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTGTTTATAACTGAGGATTTT	0.353													18	331	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38948696	38948696	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38948696G>T	uc002oit.2	+	18	2061	c.1931G>T	c.(1930-1932)CGC>CTC	p.R644L	RYR1_uc002oiu.2_Missense_Mutation_p.R644L	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	644	Cytoplasmic.|B30.2/SPRY 1.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	TGCAGCATCCGCCCCAACATC	0.557													49	176	---	---	---	---	PASS
FBXO17	115290	broad.mit.edu	37	19	39439283	39439283	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39439283T>C	uc002okg.1	-	3	557	c.385A>G	c.(385-387)AAC>GAC	p.N129D	SARS2_uc010xuq.1_5'UTR|FBXO17_uc002okf.1_Missense_Mutation_p.N138D	NM_024907	NP_079183	Q96EF6	FBX17_HUMAN	F-box protein FBG4 isoform 2	129	FBA.				protein catabolic process	SCF ubiquitin ligase complex	glycoprotein binding				0	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GCCCAGCCGTTCCCGCCATGC	0.592													4	105	---	---	---	---	PASS
HIPK4	147746	broad.mit.edu	37	19	40886743	40886743	+	Silent	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40886743G>A	uc002onp.2	-	3	1440	c.1155C>T	c.(1153-1155)GCC>GCT	p.A385A		NM_144685	NP_653286	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	385						cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			CATCTTCTGCGGCCACGACGG	0.662													8	201	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	40978528	40978528	+	5'UTR	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40978528G>A	uc002ony.2	+	2					SPTBN4_uc002onx.2_5'UTR|SPTBN4_uc002onz.2_5'UTR	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CACCTTCCCCGATGGCGCAGG	0.363													4	53	---	---	---	---	PASS
CYP2A6	1548	broad.mit.edu	37	19	41354251	41354251	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41354251C>T	uc002opl.3	-	4	548	c.527G>A	c.(526-528)CGC>CAC	p.R176H	CYP2A6_uc010ehe.1_5'UTR|CYP2A6_uc010ehf.1_RNA	NM_000762	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A,	176					coumarin catabolic process|exogenous drug catabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|enzyme binding|heme binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Chlorzoxazone(DB00356)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Formoterol(DB00983)|Halothane(DB01159)|Letrozole(DB01006)|Methoxsalen(DB00553)|Metyrapone(DB01011)|Nicotine(DB00184)|Pilocarpine(DB01085)|Tolbutamide(DB01124)|Tranylcypromine(DB00752)	GGAGACTGTGCGGCTCAGGAA	0.527													8	228	---	---	---	---	PASS
AXL	558	broad.mit.edu	37	19	41744043	41744043	+	Silent	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41744043G>T	uc010ehj.2	+	7	1168	c.978G>T	c.(976-978)GTG>GTT	p.V326V	CYP2F1_uc010xvw.1_Intron|AXL_uc010ehi.1_Silent_p.V326V|AXL_uc010ehk.2_Silent_p.V326V	NM_021913	NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase isoform 1	326	Extracellular (Potential).|Fibronectin type-III 1.					integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13						GGCTTCCTGTGGAGACGCCGG	0.622													31	210	---	---	---	---	PASS
CIC	23152	broad.mit.edu	37	19	42795618	42795618	+	Missense_Mutation	SNP	G	C	C	rs71336809		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42795618G>C	uc002otf.1	+	10	2738	c.2698G>C	c.(2698-2700)GCC>CCC	p.A900P		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	900	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)|lung(1)|central_nervous_system(1)|skin(1)	11		Prostate(69;0.00682)				ACCCCCCAAAGGTGAGACCTG	0.617			T	DUX4	soft tissue sarcoma								17	167	---	---	---	---	PASS
GRLF1	2909	broad.mit.edu	37	19	47423517	47423517	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47423517C>T	uc010ekv.2	+	1	1585	c.1585C>T	c.(1585-1587)CGA>TGA	p.R529*		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	529	FF 4.				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		AGAGGAACAGCGATTTAAAGC	0.443													51	298	---	---	---	---	PASS
PLA2G4C	8605	broad.mit.edu	37	19	48578136	48578136	+	Intron	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48578136G>A	uc002phx.2	-						PLA2G4C_uc002phw.2_Intron|PLA2G4C_uc010elr.2_Intron|PLA2G4C_uc010xzd.1_Intron	NM_003706	NP_003697	Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC isoform 1 precursor						arachidonic acid metabolic process|glycerophospholipid catabolic process|inflammatory response|intracellular signal transduction|parturition	cytosol|membrane	calcium-independent phospholipase A2 activity|phospholipid binding			ovary(1)|skin(1)	2		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		CTTCATCTACGTCAAGAAATC	0.557													10	207	---	---	---	---	PASS
CA11	770	broad.mit.edu	37	19	49142814	49142814	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49142814G>T	uc002pjz.1	-	6	1194	c.632C>A	c.(631-633)TCC>TAC	p.S211Y	SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|DBP_uc002pjx.3_5'Flank|DBP_uc002pjy.2_5'Flank|DBP_uc010elz.1_5'Flank	NM_001217	NP_001208	O75493	CAH11_HUMAN	carbonic anhydrase XI precursor	211						extracellular region					0		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)		ACTCTTGTAGGAGATGCGAGT	0.577													13	62	---	---	---	---	PASS
KCNC3	3748	broad.mit.edu	37	19	50823879	50823879	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50823879G>A	uc002pru.1	-	3	2436	c.2141C>T	c.(2140-2142)GCC>GTC	p.A714V	KCNC3_uc002prt.1_Missense_Mutation_p.A350V	NM_004977	NP_004968	Q14003	KCNC3_HUMAN	Shaw-related voltage-gated potassium channel	714	Cytoplasmic (Potential).				cell death	voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)		AGGGGAAGGGGCATAGTCGGT	0.662													4	43	---	---	---	---	PASS
KLK3	354	broad.mit.edu	37	19	51363346	51363346	+	3'UTR	SNP	G	A	A	rs149376489		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51363346G>A	uc002pts.1	+	5					KLK3_uc010ycj.1_Missense_Mutation_p.R209Q|KLK3_uc002ptr.1_Missense_Mutation_p.R207Q|KLK3_uc010eof.1_RNA	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3						negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		GTGCATTACCGGAAGTGGATC	0.532													36	153	---	---	---	---	PASS
EPN1	29924	broad.mit.edu	37	19	56203162	56203162	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56203162C>A	uc002qlw.2	+	7	1147	c.805C>A	c.(805-807)CCT>ACT	p.P269T	EPN1_uc002qlv.2_Missense_Mutation_p.P244T|EPN1_uc010etd.2_Missense_Mutation_p.P269T|EPN1_uc002qlx.2_Missense_Mutation_p.P355T	NM_001130072	NP_001123544	Q9Y6I3	EPN1_HUMAN	epsin 1 isoform b	269	Ala/Gly/Pro-rich.				endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|cytoplasm|nucleus|plasma membrane	lipid binding				0		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		GGCCCCAGCTCCTGCCCCGAC	0.697													4	183	---	---	---	---	PASS
C20orf54	113278	broad.mit.edu	37	20	744208	744208	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:744208A>C	uc002wed.3	-	3	1346	c.1007T>G	c.(1006-1008)CTG>CGG	p.L336R	C20orf54_uc002wee.2_Missense_Mutation_p.L336R	NM_033409	NP_212134	Q9NQ40	RFT2_HUMAN	hypothetical protein LOC113278 precursor	336	Helical; (Potential).				sensory perception of sound	integral to plasma membrane	riboflavin transporter activity			ovary(2)	2						GGTGGCAGCCAGGTGGTAGGC	0.587													19	148	---	---	---	---	PASS
IDH3B	3420	broad.mit.edu	37	20	2644400	2644400	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2644400T>C	uc002wgp.2	-	3	131	c.122A>G	c.(121-123)GAG>GGG	p.E41G	IDH3B_uc002wgq.2_Missense_Mutation_p.E41G|IDH3B_uc002wgr.2_5'UTR|IDH3B_uc010zpz.1_Missense_Mutation_p.E41G	NM_006899	NP_008830	O43837	IDH3B_HUMAN	isocitrate dehydrogenase 3, beta subunit isoform	41					isocitrate metabolic process|tricarboxylic acid cycle	mitochondrial matrix	electron carrier activity|isocitrate dehydrogenase (NAD+) activity|magnesium ion binding|NAD binding				0					NADH(DB00157)	CCTCACGTCCTCGGCCTCAAT	0.622													11	106	---	---	---	---	PASS
SLC23A2	9962	broad.mit.edu	37	20	4843520	4843520	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4843520C>A	uc002wlg.1	-	14	1765	c.1390G>T	c.(1390-1392)GCC>TCC	p.A464S	SLC23A2_uc010zqr.1_Missense_Mutation_p.A349S|SLC23A2_uc002wlh.1_Missense_Mutation_p.A464S	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase	464	Helical; (Potential).				L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2						AGCATGAGGGCTGCTCCGCAC	0.572													12	66	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47244106	47244106	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47244106C>A	uc002xtw.1	-	39	4940	c.4917G>T	c.(4915-4917)CAG>CAT	p.Q1639H	PREX1_uc002xtv.1_Missense_Mutation_p.Q936H	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	1639					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			CCTGGGGCATCTGGTCCTTGA	0.647													22	126	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47258756	47258756	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47258756C>A	uc002xtw.1	-	29	3748	c.3725G>T	c.(3724-3726)AGC>ATC	p.S1242I	PREX1_uc002xtv.1_Missense_Mutation_p.S539I	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	1242					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GAAAGCCCGGCTCATGACTGG	0.577													21	64	---	---	---	---	PASS
KRTAP11-1	337880	broad.mit.edu	37	21	32253716	32253716	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32253716G>T	uc002yov.2	-	1	159	c.128C>A	c.(127-129)CCC>CAC	p.P43H		NM_175858	NP_787054	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	43						keratin filament	structural molecule activity			pancreas(1)	1						GAAGGAACTGGGCAAACAGAT	0.577													12	95	---	---	---	---	PASS
TRPM2	7226	broad.mit.edu	37	21	45858950	45858950	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45858950G>T	uc002zet.1	+	31	4381	c.4168G>T	c.(4168-4170)GGC>TGC	p.G1390C	TRPM2_uc002zeu.1_Missense_Mutation_p.G1390C|TRPM2_uc002zew.1_Missense_Mutation_p.G1390C|TRPM2_uc010gpt.1_Missense_Mutation_p.G1440C|TRPM2_uc002zex.1_Missense_Mutation_p.G1176C|TRPM2_uc002zey.1_Missense_Mutation_p.G869C|TRPM2_uc011aff.1_Missense_Mutation_p.G71C	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	1390	NAD.|Nudix hydrolase.|Cytoplasmic (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						GTCTGTCCAGGGCTCCCGGGA	0.657													10	73	---	---	---	---	PASS
KRTAP10-1	386677	broad.mit.edu	37	21	45959294	45959294	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45959294G>T	uc002zfh.1	-	1	785	c.740C>A	c.(739-741)CCT>CAT	p.P247H	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198691	NP_941964	P60331	KR101_HUMAN	keratin associated protein 10-1	247	22.|24 X 5 AA repeats of C-C-X(3).					keratin filament				skin(1)	1						GGAGGAGACAGGCATACAGCA	0.721													10	67	---	---	---	---	PASS
POFUT2	23275	broad.mit.edu	37	21	46702334	46702334	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46702334C>T	uc002zhc.2	-	4	593	c.568G>A	c.(568-570)GTC>ATC	p.V190I	POFUT2_uc002zhb.2_RNA|POFUT2_uc002zhd.2_Missense_Mutation_p.V190I|POFUT2_uc011afp.1_Missense_Mutation_p.V190I	NM_133635	NP_598368	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2 isoform C	190					fucose metabolic process	endoplasmic reticulum	peptide-O-fucosyltransferase activity				0				Colorectal(79;0.243)		AGACAGGAGACGTTTAGACCC	0.557													21	61	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47549345	47549345	+	Intron	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47549345C>T	uc002zia.1	+						COL6A2_uc002zhy.1_3'UTR|COL6A2_uc002zhz.1_Silent_p.T899T|COL6A2_uc002zib.1_Intron|COL6A2_uc002zic.1_Intron|COL6A2_uc010gqe.1_5'Flank	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		TCATTGACACCTTTAAGCTGG	0.687													11	47	---	---	---	---	PASS
GAB4	128954	broad.mit.edu	37	22	17443620	17443620	+	3'UTR	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17443620G>T	uc002zlw.2	-	10						NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member											large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				TTGGTGGCCCGAGTCACAGCT	0.587													7	107	---	---	---	---	PASS
MAPK1	5594	broad.mit.edu	37	22	22160146	22160146	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22160146T>C	uc002zvn.2	-	3	725	c.485A>G	c.(484-486)GAT>GGT	p.D162G	MAPK1_uc002zvo.2_Missense_Mutation_p.D162G|MAPK1_uc010gtk.1_Missense_Mutation_p.D162G	NM_002745	NP_002736	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	162	Protein kinase.				activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|induction of apoptosis|innate immune response|insulin receptor signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription, DNA-dependent	cytosol|nucleoplasm	ATP binding|DNA binding|MAP kinase activity|phosphatase binding|RNA polymerase II carboxy-terminal domain kinase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)	GACCTTGAGATCACAGGTGGT	0.373													38	237	---	---	---	---	PASS
XRCC6	2547	broad.mit.edu	37	22	42024181	42024181	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42024181A>G	uc003bao.1	+	3	212	c.142A>G	c.(142-144)ATG>GTG	p.M48V	XRCC6_uc003bap.1_Missense_Mutation_p.M48V|XRCC6_uc011apc.1_Intron|XRCC6_uc003baq.1_Missense_Mutation_p.M48V|XRCC6_uc003bar.1_Missense_Mutation_p.M48V|XRCC6_uc003bas.1_Intron	NM_001469	NP_001460	P12956	XRCC6_HUMAN	ATP-dependent DNA helicase II, 70 kDa subunit	48	Ser-rich (potentially targets for phosphorylation).				DNA ligation|double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|provirus integration|telomere maintenance|transcription, DNA-dependent	DNA-dependent protein kinase-DNA ligase 4 complex|Ku70:Ku80 complex|membrane fraction|nuclear telomere cap complex|transcription factor complex	5'-deoxyribose-5-phosphate lyase activity|ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|transcription regulatory region DNA binding			skin(2)|ovary(1)|lung(1)|kidney(1)	5						CTCCAAGGCTATGTTTGAATC	0.323								Direct_reversal_of_damage|NHEJ					5	169	---	---	---	---	PASS
CERK	64781	broad.mit.edu	37	22	47089397	47089397	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47089397G>T	uc003bia.2	-	10	1160	c.1053C>A	c.(1051-1053)TGC>TGA	p.C351*	CERK_uc010hae.2_Nonsense_Mutation_p.C153*	NM_022766	NP_073603	Q8TCT0	CERK1_HUMAN	ceramide kinase	351					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|ceramide metabolic process	integral to membrane of membrane fraction|membrane|nucleus	ATP binding|ceramide kinase activity|diacylglycerol kinase activity|magnesium ion binding			skin(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGCAAACAAAGCATCTGAAAG	0.433													31	104	---	---	---	---	PASS
P2RY8	286530	broad.mit.edu	37	X	1584630	1584630	+	Silent	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1584630C>A	uc004cpz.2	-	2	1070	c.822G>T	c.(820-822)GTG>GTT	p.V274V		NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8	274	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGAGCTTGTACACGTGGTAGT	0.557			T	CRLF2	B-ALL|Downs associated ALL								15	92	---	---	---	---	PASS
STS	412	broad.mit.edu	37	X	7177621	7177621	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7177621A>G	uc004cry.3	+	5	874	c.629A>G	c.(628-630)CAC>CGC	p.H210R		NM_000351	NP_000342	P08842	STS_HUMAN	steryl-sulfatase precursor	210	Cytoplasmic.				female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)	GGGCTACTCCACGTGCCTCTA	0.557									Ichthyosis				22	51	---	---	---	---	PASS
ZNF182	7569	broad.mit.edu	37	X	47836919	47836919	+	Silent	SNP	T	C	C			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47836919T>C	uc004dir.2	-	7	913	c.567A>G	c.(565-567)AAA>AAG	p.K189K	ZNF182_uc004dis.2_Silent_p.K170K|ZNF182_uc004dit.2_Silent_p.K189K|ZNF182_uc011mlu.1_Silent_p.K169K	NM_006962	NP_008893	P17025	ZN182_HUMAN	zinc finger protein 21 isoform 1	189					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3						GGAAGAACAATTTTGCACATC	0.353													25	50	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53621451	53621451	+	Intron	SNP	A	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53621451A>T	uc004dsp.2	-						HUWE1_uc004dsn.2_5'Flank	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						AAGCAACTTGATCCTTACTCA	0.458													9	16	---	---	---	---	PASS
ARHGEF9	23229	broad.mit.edu	37	X	62917183	62917183	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62917183C>T	uc004dvl.2	-	4	1222	c.383G>A	c.(382-384)GGC>GAC	p.G128D	ARHGEF9_uc004dvj.1_Missense_Mutation_p.G17D|ARHGEF9_uc004dvk.1_5'UTR|ARHGEF9_uc011mos.1_Missense_Mutation_p.G107D|ARHGEF9_uc004dvm.1_Missense_Mutation_p.G107D|ARHGEF9_uc011mot.1_Missense_Mutation_p.G75D|ARHGEF9_uc004dvn.2_Missense_Mutation_p.G135D	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9	128	DH.				apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						CTTCAGATAGCCCTGTAGACA	0.353													14	24	---	---	---	---	PASS
TSIX	9383	broad.mit.edu	37	X	73042638	73042638	+	RNA	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73042638C>A	uc004ebn.2	+	1		c.30599C>A			XIST_uc004ebm.1_RNA	NR_003255				Homo sapiens XIST antisense RNA (non-protein coding) (TSIX), non-coding RNA.												0						AAAGCCCTCTCTTATTCCCAC	0.343													5	44	---	---	---	---	PASS
UPRT	139596	broad.mit.edu	37	X	74516241	74516241	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74516241C>T	uc004ecb.1	+	3	623	c.494C>T	c.(493-495)CCA>CTA	p.P165L	UPRT_uc010nlu.1_Missense_Mutation_p.P165L|UPRT_uc004ecc.1_RNA|UPRT_uc004ecd.1_Missense_Mutation_p.P165L|UPRT_uc004ece.1_Missense_Mutation_p.P29L	NM_145052	NP_659489	Q96BW1	UPP_HUMAN	uracil phosphoribosyltransferase (FUR1) homolog	165					nucleoside metabolic process	cytoplasm|nucleus					0						GTGACCACTCCAACAGGTAAC	0.383													14	76	---	---	---	---	PASS
XIAP	331	broad.mit.edu	37	X	123019959	123019959	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123019959A>G	uc010nqu.2	+	2	573	c.447A>G	c.(445-447)ATA>ATG	p.I149M	XIAP_uc004etx.2_Missense_Mutation_p.I149M|XIAP_uc010nqv.2_Intron	NM_001167	NP_001158	P98170	XIAP_HUMAN	baculoviral IAP repeat-containing protein 4	149	Interaction with caspase-7.			I->A: Reduced inhibition of caspase-3.	anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding			ovary(1)|lung(1)	2						TTGTAGATATATCAGACACCA	0.443									X-linked_Lymphoproliferative_syndrome				41	97	---	---	---	---	PASS
ENOX2	10495	broad.mit.edu	37	X	129804102	129804102	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129804102C>A	uc004evw.2	-	8	1036	c.618G>T	c.(616-618)CAG>CAT	p.Q206H	ENOX2_uc004evx.2_Missense_Mutation_p.Q177H|ENOX2_uc004evy.2_Missense_Mutation_p.Q177H|ENOX2_uc004evv.2_Missense_Mutation_p.Q33H	NM_182314	NP_872114	Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2 isoform b	206	RRM.				cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1						CATCTCGAGCCTGTGCGAAAT	0.488													20	47	---	---	---	---	PASS
ATP11C	286410	broad.mit.edu	37	X	138908947	138908947	+	Silent	SNP	T	A	A			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138908947T>A	uc004faz.2	-	2	171	c.72A>T	c.(70-72)ACA>ACT	p.T24T	ATP11C_uc004fba.2_Silent_p.T24T	NM_173694	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C isoform a	24	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(5)|large_intestine(3)	8	Acute lymphoblastic leukemia(192;0.000127)					CAACAAACACTGTGCGTGTGC	0.388													29	53	---	---	---	---	PASS
AMELY	266	broad.mit.edu	37	Y	6738083	6738083	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:6738083A>T	uc004fra.1	-	2	78	c.66T>A	c.(64-66)CAT>CAA	p.H22Q	AMELY_uc004fqz.2_Missense_Mutation_p.H22Q	NM_001143	NP_001134	Q99218	AMELY_HUMAN	amelogenin, Y-linked precursor	22					biomineral tissue development	proteinaceous extracellular matrix	structural constituent of tooth enamel				0						GGTGCCCAGGATGAGGTGGTA	0.254													18	171	---	---	---	---	PASS
NBPF10	100132406	broad.mit.edu	37	1	145209324	145209332	+	5'UTR	DEL	GGCGGCGGC	-	-	rs72083240	by1000genomes	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145209324_145209332delGGCGGCGGC	uc001emp.3	+	1					NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_5'UTR|NOTCH2NL_uc001emm.3_5'UTR|NOTCH2NL_uc001emo.2_5'UTR|NOTCH2NL_uc010oyh.1_RNA	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GATCTGCCCAggcggcggcggcggcggcg	0.589													3	3	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148023503	148023503	+	Intron	DEL	T	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148023503delT	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_Intron|NBPF14_uc001eqq.2_Intron|NBPF14_uc001eqs.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						CGAATGCGGGTTTTTGGCCCA	0.478													4	2	---	---	---	---	
FAM63A	55793	broad.mit.edu	37	1	150974464	150974465	+	Intron	INS	-	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150974464_150974465insT	uc001ewf.2	-						FAM63A_uc001ewc.2_Intron|FAM63A_uc010pcm.1_Intron|FAM63A_uc001ewd.2_Intron|FAM63A_uc001ewe.2_Intron|FAM63A_uc010pcn.1_Intron|FAM63A_uc001ewg.2_Intron	NM_018379	NP_001156731	Q8N5J2	FA63A_HUMAN	hypothetical protein LOC55793 isoform 1								protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGATCTTCCTCTTTTTTTTTTT	0.391													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11060846	11060847	+	IGR	INS	-	TG	TG	rs149638295	by1000genomes	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11060846_11060847insTG								KCNF1 (6496 upstream) : C2orf50 (212332 downstream)																							gtgcgtgtgcctgtgtgtgtgt	0.386													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	65840281	65840282	+	Intron	DEL	AC	-	-	rs112051677		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65840281_65840282delAC	uc010fcy.1	+											Homo sapiens cDNA FLJ16124 fis, clone BRACE2011677.																		GTGTCCCTGGacacacacacac	0.361													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	110495053	110495053	+	IGR	DEL	T	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110495053delT								ANKRD57 (118490 upstream) : RGPD5 (55282 downstream)																							CAGAACCTGCTTTTTTTTTTG	0.408													6	3	---	---	---	---	
ACVR1	90	broad.mit.edu	37	2	158627189	158627189	+	Intron	DEL	T	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158627189delT	uc002tzm.3	-						ACVR1_uc002tzn.3_Intron|ACVR1_uc010fog.2_Intron	NM_001111067	NP_001104537	Q04771	ACVR1_HUMAN	activin A receptor, type I precursor						BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	TTATTTTTTATTTTTTTTGGC	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	90472137	90472138	+	IGR	DEL	AG	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90472137_90472138delAG								EPHA3 (940855 upstream) : None (None downstream)																							ttctacaaaaagagtgtttcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	162319562	162319564	+	IGR	DEL	AAC	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162319562_162319564delAAC								None (None upstream) : None (None downstream)																							ATAGTAAAGAAACAACAACAACA	0.369													4	2	---	---	---	---	
GNB4	59345	broad.mit.edu	37	3	179119234	179119236	+	Intron	DEL	AAT	-	-	rs74384746		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179119234_179119236delAAT	uc003fjv.3	-						GNB4_uc003fju.3_Intron	NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4						cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			TCAGttaaaaaataataataatt	0.271													1	5	---	---	---	---	
REST	5978	broad.mit.edu	37	4	57785819	57785820	+	Intron	INS	-	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57785819_57785820insT	uc003hch.2	+						REST_uc003hci.2_Intron|REST_uc010ihf.2_Intron	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor						cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)					ATAAATTGATCTTTTTGCCAGA	0.302													5	3	---	---	---	---	
BTN3A3	10384	broad.mit.edu	37	6	26450651	26450651	+	Intron	DEL	C	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26450651delC	uc003nhz.2	+						BTN3A3_uc003nia.2_Intron|BTN3A3_uc011dkn.1_Intron	NM_006994	NP_008925	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3 isoform a							integral to membrane					0						AGTGATACTGCAGGGAGAGTG	0.473													4	2	---	---	---	---	
HCRTR2	3062	broad.mit.edu	37	6	55144319	55144320	+	Intron	DEL	AC	-	-	rs66573018		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55144319_55144320delAC	uc003pcl.2	+						HCRTR2_uc010jzv.2_Intron	NM_001526	NP_001517	O43614	OX2R_HUMAN	orexin receptor 2						feeding behavior	integral to plasma membrane	neuropeptide receptor activity			ovary(2)|lung(2)|upper_aerodigestive_tract(1)|breast(1)	6	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TCTTGCTGTAacacacacacac	0.262													4	2	---	---	---	---	
PRKAR1B	5575	broad.mit.edu	37	7	628079	628084	+	Intron	DEL	TGGTGA	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:628079_628084delTGGTGA	uc003siu.1	-						PRKAR1B_uc003siv.2_Intron|PRKAR1B_uc003siw.1_Intron|PRKAR1B_uc003six.1_Intron	NM_002735	NP_002726	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|protein phosphorylation|regulation of insulin secretion|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity				0		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		atagtgacagtggtgatggtgatggt	0.000													4	2	---	---	---	---	
ICA1	3382	broad.mit.edu	37	7	8196560	8196578	+	Intron	DEL	AAAAAAAAAAAAAAAAAAA	-	-	rs71014766		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8196560_8196578delAAAAAAAAAAAAAAAAAAA	uc003srm.2	-						ICA1_uc010ktr.2_Intron|ICA1_uc003srl.2_Intron|ICA1_uc003srn.3_Intron|ICA1_uc003srp.3_Intron|ICA1_uc010kts.2_Intron|ICA1_uc003srq.2_Intron|ICA1_uc003srr.2_Intron|ICA1_uc003sro.3_Intron	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1						neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		CTGATGCAGTaaaaaaaaaaaaaaaaaaaaaaaaagaaa	0.347													5	4	---	---	---	---	
DPY19L2P1	554236	broad.mit.edu	37	7	35163808	35163808	+	Intron	DEL	T	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35163808delT	uc003teq.1	-						DPY19L2P1_uc003tep.1_Intron|DPY19L2P1_uc010kwz.1_Intron					RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						AATGGTGAAGTTTTTTTAAAA	0.244													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	56231403	56231403	+	IGR	DEL	A	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56231403delA								PSPH (47313 upstream) : DKFZp434L192 (332513 downstream)																							TGCTGCTGCGAAAAAAAAAAA	0.244													4	2	---	---	---	---	
C7orf63	79846	broad.mit.edu	37	7	89929478	89929479	+	Intron	INS	-	T	T	rs35447757		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89929478_89929479insT	uc010lep.2	+						C7orf63_uc003ukf.2_Intron|C7orf63_uc003ukg.2_Intron|C7orf63_uc011khj.1_Intron|C7orf63_uc011khk.1_Intron	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1								binding			ovary(1)	1						TTTGTCTAAAGTTTTTTTTTTT	0.252													4	3	---	---	---	---	
TFR2	7036	broad.mit.edu	37	7	100230356	100230357	+	Intron	DEL	AG	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100230356_100230357delAG	uc003uvv.1	-						TFR2_uc010lhc.1_Intron|TFR2_uc003uvu.1_Intron	NM_003227	NP_003218	Q9UP52	TFR2_HUMAN	transferrin receptor 2						cellular iron ion homeostasis|iron ion transport|proteolysis	cytoplasm|integral to plasma membrane	peptidase activity|transferrin receptor activity			ovary(1)|pancreas(1)	2	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					aaaaaaaaaaagaacctttttt	0.000													4	2	---	---	---	---	
DOCK4	9732	broad.mit.edu	37	7	111474750	111474750	+	Intron	DEL	A	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111474750delA	uc003vfx.2	-						DOCK4_uc003vfw.2_Intron|DOCK4_uc003vfy.2_Intron	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CCCCTAAGTTAAAAAAAAAAA	0.318													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	128210235	128210235	+	IGR	DEL	T	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128210235delT								METTL2B (67258 upstream) : FLJ45340 (71060 downstream)																							gttttagttcttTTTTTTTTT	0.194													9	8	---	---	---	---	
COLEC10	10584	broad.mit.edu	37	8	120103625	120103625	+	Intron	DEL	A	-	-	rs33915063		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120103625delA	uc003yoo.2	+							NM_006438	NP_006429	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 precursor							collagen|cytoplasm	mannose binding			ovary(2)|skin(1)	3	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			aatctctaccaaaaaaaaaaa	0.000													6	3	---	---	---	---	
NSMCE2	286053	broad.mit.edu	37	8	126317202	126317203	+	Intron	INS	-	AAG	AAG	rs35212928		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126317202_126317203insAAG	uc003yrw.2	+							NM_173685	NP_775956	Q96MF7	NSE2_HUMAN	non-SMC element 2, MMS21 homolog						DNA recombination|DNA repair	nucleus	ligase activity|zinc ion binding			breast(1)	1	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)			aggaaggaagaaagaaagaaaa	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66471375	66471375	+	IGR	DEL	G	-	-	rs112936181		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66471375delG								FAM74A4 (976989 upstream) : LOC442421 (25095 downstream)																							gagaacttaaggggcagtcta	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70117457	70117458	+	IGR	INS	-	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70117457_70117458insG								LOC100133920 (452508 upstream) : FOXD4L5 (58251 downstream)																							aagaaagaaaaaGAGAGAGAGA	0.074													5	3	---	---	---	---	
ROD1	9991	broad.mit.edu	37	9	114994275	114994277	+	Intron	DEL	AGA	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114994275_114994277delAGA	uc004bfw.2	-						ROD1_uc004bfv.2_Intron|ROD1_uc004bfx.2_Intron|ROD1_uc011lwu.1_Intron|ROD1_uc004bfy.2_Intron|ROD1_uc004bfz.2_Intron	NM_005156	NP_005147	O95758	ROD1_HUMAN	ROD1 regulator of differentiation 1 isoform 1						anatomical structure morphogenesis|mRNA processing	nucleus	nucleotide binding|RNA binding			skin(1)	1						agaagagaagagaagagaagaga	0.079													6	6	---	---	---	---	
NDUFA8	4702	broad.mit.edu	37	9	124914834	124914835	+	Intron	INS	-	T	T	rs10659040		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124914834_124914835insT	uc004blv.2	-							NM_014222	NP_055037	P51970	NDUA8_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha						mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			breast(1)	1					NADH(DB00157)	CATAATAATAAttttttttttt	0.178													4	3	---	---	---	---	
DDX21	9188	broad.mit.edu	37	10	70730241	70730242	+	Intron	INS	-	T	T	rs35874790		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70730241_70730242insT	uc001jov.1	+						DDX21_uc001jow.1_Intron	NM_004728	NP_004719	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 21							nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)	3						GAGGAAGCTACttttttttttt	0.178													4	2	---	---	---	---	
ANKRD1	27063	broad.mit.edu	37	10	92676188	92676189	+	Intron	DEL	TG	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92676188_92676189delTG	uc001khe.1	-							NM_014391	NP_055206	Q15327	ANKR1_HUMAN	cardiac ankyrin repeat protein						cellular lipid metabolic process|defense response|signal transduction		DNA binding				0		Colorectal(252;0.0475)				CTAAATTACAtgtgtgtgtgtg	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	99068839	99068840	+	IGR	INS	-	T	T			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99068839_99068840insT								ARHGAP19 (16426 upstream) : FRAT1 (10182 downstream)																							AAAAAAGTTTGTTTTTTTTTTT	0.173													5	3	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128836112	128836112	+	Intron	DEL	C	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128836112delC	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CTTTTTGGGTCtttttttttt	0.393													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206019	134206020	+	IGR	INS	-	G	G	rs142843997		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206019_134206020insG								LRRC27 (11009 upstream) : PWWP2B (4682 downstream)																							atgatggtgatgtgataatggt	0.000													6	3	---	---	---	---	
KRTAP5-5	439915	broad.mit.edu	37	11	1651191	1651199	+	In_Frame_Del	DEL	GGCTGTGGA	-	-	rs144216147		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1651191_1651199delGGCTGTGGA	uc001lty.2	+	1	159_167	c.121_129delGGCTGTGGA	c.(121-129)GGCTGTGGAdel	p.GCG47del		NM_001001480	NP_001001480	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	47_49						keratin filament				lung(1)	1		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ctgtggctccggctgtggaggctgtgggg	0.129													18	17	---	---	---	---	
SIK3	23387	broad.mit.edu	37	11	116797735	116797736	+	Intron	INS	-	A	A	rs34416738		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116797735_116797736insA	uc001ppy.2	-						SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK							cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						actcagtctcgaaaaaaaaaaa	0.139													5	3	---	---	---	---	
GLB1L3	112937	broad.mit.edu	37	11	134178316	134178316	+	Intron	DEL	T	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134178316delT	uc009zdf.2	+						GLB1L3_uc010scu.1_Intron|GLB1L3_uc001qho.3_Intron	NM_001080407	NP_001073876	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1 like 3						carbohydrate metabolic process		cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			pancreas(1)	1	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		accaccatcatcaccatcacc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68881564	68881564	+	IGR	DEL	C	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68881564delC								MDM1 (155403 upstream) : RAP1B (123088 downstream)																							TCATTGTCATCATGTCCTCCT	0.597													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	106148185	106148185	+	IGR	DEL	T	-	-	rs12584959	by1000genomes	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:106148185delT								DAOA (4803 upstream) : EFNB2 (993913 downstream)																							ACCCATTTTGTTTTTTTTCCT	0.279													4	2	---	---	---	---	
TBC1D2B	23102	broad.mit.edu	37	15	78316386	78316386	+	Intron	DEL	T	-	-	rs1992470	by1000genomes	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78316386delT	uc002bcy.3	-						TBC1D2B_uc010bla.2_Intron	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a							intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3						GGAAAAAAAATAAGTGTGCAG	0.483													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102299886	102299887	+	5'Flank	INS	-	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102299886_102299887insG	uc002bzh.1	-						uc002bzk.2_5'Flank|uc002bzn.2_5'Flank|uc010uso.1_5'Flank|uc002bzs.2_5'Flank|uc010usv.1_5'Flank|uc002cal.2_5'Flank|uc002cam.2_5'Flank|uc010usx.1_5'Flank|uc002cao.2_5'Flank|uc002cap.2_5'Flank|uc002caq.2_5'Flank|uc010usz.1_5'Flank|uc010uta.1_5'Flank|uc002cas.2_5'Flank|uc002cat.1_5'Flank|uc002cau.2_5'Flank|uc010utb.1_5'Flank|uc002cav.2_5'Flank|uc002caw.2_5'Flank|uc002cax.2_5'Flank|uc010utc.1_5'Flank|uc002cay.2_5'Flank|uc002cbb.2_5'Flank|uc002cbc.1_5'Flank|uc002cbd.2_5'Flank|uc002cbe.2_5'Flank|uc002cbg.2_5'Flank|uc002cbh.2_5'Flank|uc002cbi.2_5'Flank|uc002cbk.2_5'Flank|uc002cbl.2_5'Flank|uc010utd.1_5'Flank					DQ575740																		AACCTGTACTCGCGTCGGAACC	0.589													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	3010024	3010035	+	IGR	DEL	ACCTACCTACCT	-	-	rs111260640		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3010024_3010035delACCTACCTACCT								FLYWCH1 (8816 upstream) : KREMEN2 (4182 downstream)																							caaccaaccaacctacctacctacctacctac	0.009													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45460620	45460621	+	IGR	DEL	AC	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45460620_45460621delAC								SMAD2 (3105 upstream) : ZBTB7C (93127 downstream)																							acatacaaagacacacacacac	0.248													4	2	---	---	---	---	
ZFR2	23217	broad.mit.edu	37	19	3819298	3819299	+	Intron	INS	-	GGGCAGGT	GGGCAGGT	rs146619879	by1000genomes	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3819298_3819299insGGGCAGGT	uc002lyw.2	-							NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1							intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GCTGGGCAGGCGGGCAGGTGGG	0.728													3	3	---	---	---	---	
FBN3	84467	broad.mit.edu	37	19	8136735	8136735	+	Intron	DEL	C	-	-	rs112155120		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8136735delC	uc002mjf.2	-						FBN3_uc002mje.2_Intron	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						CCCCCAGAGACCCCCCCCAAG	0.587													4	3	---	---	---	---	
JAK3	3718	broad.mit.edu	37	19	17950548	17950556	+	Intron	DEL	TTTTTTTTT	-	-	rs71686007	by1000genomes	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17950548_17950556delTTTTTTTTT	uc002nhn.3	-						JAK3_uc010ebh.2_Intron|JAK3_uc002nho.2_Intron|JAK3_uc010xpx.1_Intron	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3						B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						Cttttttttcttttttttttttttttttt	0.234		2	Mis		acute megakaryocytic leukemia|								4	2	---	---	---	---	
KCNN1	3780	broad.mit.edu	37	19	18076833	18076848	+	Intron	DEL	CCTTCCTTCCTTCCTT	-	-	rs7246976		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18076833_18076848delCCTTCCTTCCTTCCTT	uc002nht.2	+						KCNN1_uc010xqa.1_Intron	NM_002248	NP_002239	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance						synaptic transmission	voltage-gated potassium channel complex	calmodulin binding|small conductance calcium-activated potassium channel activity				0						tgcctgcctgccttccttccttccttccttccttcc	0.329													4	2	---	---	---	---	
HNRNPUL1	11100	broad.mit.edu	37	19	41797899	41797899	+	Intron	DEL	C	-	-	rs66916970		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41797899delC	uc002oqb.3	+						CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Intron|HNRNPUL1_uc002oqa.3_Intron|HNRNPUL1_uc010ehm.2_Intron|HNRNPUL1_uc002oqc.3_Intron|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Intron|HNRNPUL1_uc010ehn.2_Intron|HNRNPUL1_uc010eho.2_Intron|HNRNPUL1_uc010xvy.1_Intron|HNRNPUL1_uc010ehp.2_Intron|HNRNPUL1_uc010ehl.1_Intron	NM_007040	NP_008971	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1						nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding			central_nervous_system(1)|skin(1)	2						aaaaaaaaaacaaaaaaaaaa	0.204													5	3	---	---	---	---	
ALDH16A1	126133	broad.mit.edu	37	19	49964403	49964403	+	Intron	DEL	A	-	-	rs12460452	by1000genomes	TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49964403delA	uc002pnt.2	+						ALDH16A1_uc010yar.1_Intron|ALDH16A1_uc010yas.1_Intron|ALDH16A1_uc010yat.1_Intron	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1								oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		gaggggctggagtctggactc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19804031	19804031	+	IGR	DEL	G	-	-	rs35040175		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19804031delG								SLC24A3 (100491 upstream) : RIN2 (66179 downstream)																							TGCTCTGCCTGCTTTTTTTTT	0.393													9	5	---	---	---	---	
TM9SF4	9777	broad.mit.edu	37	20	30734786	30734786	+	Intron	DEL	T	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30734786delT	uc002wxj.2	+						TM9SF4_uc010zts.1_Intron|TM9SF4_uc002wxk.2_Intron|TM9SF4_uc010gdz.2_Intron	NM_014742	NP_055557	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4							integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TTTAGTATACttttttttttt	0.194													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10718801	10718801	+	IGR	DEL	T	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10718801delT								None (None upstream) : TPTE (187942 downstream)																							ttctcagaaattttctgtcta	0.000													3	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11069012	11069013	+	Intron	INS	-	C	C	rs150046862		TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11069012_11069013insC	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		tttttcaacttcaaaaaattaa	0.000													4	4	---	---	---	---	
RFPL3	10738	broad.mit.edu	37	22	32752978	32752979	+	5'Flank	INS	-	G	G			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32752978_32752979insG	uc003amj.2	+						RFPL3_uc010gwn.2_Intron	NM_001098535	NP_001092005	O75679	RFPL3_HUMAN	ret finger protein-like 3 isoform 1								zinc ion binding			ovary(1)	1						GGCTGGCCTGTGGGTGGGCGAG	0.624													17	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	284658	284659	+	IGR	INS	-	GTG	GTG			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:284658_284659insGTG								NCRNA00107 (2606 upstream) : PPP2R3B (10313 downstream)																							CTCAGGGACGTtgtgtgtgtgt	0.480													8	5	---	---	---	---	
SPANXN4	441525	broad.mit.edu	37	X	142113900	142113900	+	Intron	DEL	G	-	-			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142113900delG	uc004fbv.3	+							NM_001009613	NP_001009613	Q5MJ08	SPXN4_HUMAN	SPANX family, member N4											ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					aggttttgaagggaaggtgag	0.179													9	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58978690	58978691	+	IGR	INS	-	TTCTT	TTCTT			TCGA-22-1002-01A-01D-1521-08	TCGA-22-1002-11A-01D-1521-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58978690_58978691insTTCTT								None (None upstream) : None (None downstream)																							agtccactccattccattccat	0.000													4	2	---	---	---	---	
