Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRAMEF1	65121	broad.mit.edu	37	1	12853573	12853573	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12853573T>A	uc001auj.1	+	2	300	c.197T>A	c.(196-198)CTG>CAG	p.L66Q		NM_023013	NP_075389	O95521	PRAM1_HUMAN	PRAME family member 1	66											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGCCTCCCTCTGGGATCACTG	0.542													11	209	---	---	---	---	PASS
UROD	7389	broad.mit.edu	37	1	45479354	45479354	+	Missense_Mutation	SNP	G	A	A	rs111369324	byFrequency	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45479354G>A	uc001cna.1	+	5	473	c.365G>A	c.(364-366)CGG>CAG	p.R122Q	HECTD3_uc009vxk.2_5'Flank|HECTD3_uc010olh.1_5'Flank|UROD_uc010oli.1_3'UTR|UROD_uc001cnb.1_Missense_Mutation_p.R87Q|UROD_uc010olj.1_Missense_Mutation_p.R66Q|UROD_uc001cnc.1_Missense_Mutation_p.R27Q	NM_000374	NP_000365	P06132	DCUP_HUMAN	uroporphyrinogen decarboxylase	122						cytosol|microtubule cytoskeleton|nucleus	uroporphyrinogen decarboxylase activity				0	Acute lymphoblastic leukemia(166;0.155)					GAACGCCTACGGGATCCAGAA	0.577									Porphyria_Cutanea_Tarda_Type_II				7	83	---	---	---	---	PASS
UBE2U	148581	broad.mit.edu	37	1	64669744	64669744	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64669744G>A	uc001dbn.1	+	1	255	c.11G>A	c.(10-12)AGA>AAA	p.R4K		NM_152489	NP_689702	Q5VVX9	UBE2U_HUMAN	ubiquitin-conjugating enzyme E2U (putative)	4							ATP binding|protein binding|ubiquitin-protein ligase activity				0						ATGCACGGCAGAGCTTACCTC	0.473													43	63	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70587550	70587550	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70587550C>G	uc001dep.2	+	25	4624	c.4594C>G	c.(4594-4596)CAA>GAA	p.Q1532E	LRRC7_uc009wbg.2_Missense_Mutation_p.Q816E|LRRC7_uc001deq.2_Missense_Mutation_p.Q726E	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1532	PDZ.					centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						CCTAGTTATTCAACGTGAGCT	0.313													25	164	---	---	---	---	PASS
MAGI3	260425	broad.mit.edu	37	1	114184638	114184638	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114184638C>T	uc001edk.2	+	10	1647	c.1466C>T	c.(1465-1467)ACT>ATT	p.T489I	MAGI3_uc001edh.3_Missense_Mutation_p.T514I|MAGI3_uc001edi.3_Missense_Mutation_p.T489I|MAGI3_uc010owm.1_Missense_Mutation_p.T514I|MAGI3_uc001edj.2_Missense_Mutation_p.T210I	NM_001142782	NP_001136254	Q5TCQ9	MAGI3_HUMAN	membrane-associated guanylate kinase-related  3	514	Interaction with PTEN.|PDZ 2.				apoptosis|interspecies interaction between organisms|intracellular signal transduction	nucleus|tight junction	ATP binding|guanylate kinase activity|protein binding			lung(3)|ovary(2)|central_nervous_system(1)	6	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTAAACCTCACTTTATGTCGT	0.438													7	159	---	---	---	---	PASS
ANKRD34A	284615	broad.mit.edu	37	1	145473733	145473733	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145473733G>C	uc001enq.1	+	4	1698	c.405G>C	c.(403-405)AAG>AAC	p.K135N	NBPF10_uc001emp.3_Intron	NM_001039888	NP_001034977	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34	135	ANK 4.										0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ACGCCTGCAAGGCCAAGGGTA	0.647													53	34	---	---	---	---	PASS
FAM63A	55793	broad.mit.edu	37	1	150970185	150970185	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150970185A>T	uc001ewf.2	-	10	2928	c.1244T>A	c.(1243-1245)CTG>CAG	p.L415Q	FAM63A_uc001ewc.2_Missense_Mutation_p.L273Q|FAM63A_uc010pcm.1_Missense_Mutation_p.L320Q|FAM63A_uc001ewd.2_Missense_Mutation_p.L273Q|FAM63A_uc001ewe.2_Missense_Mutation_p.L249Q|FAM63A_uc010pcn.1_Missense_Mutation_p.L463Q|FAM63A_uc001ewg.2_Missense_Mutation_p.L415Q	NM_018379	NP_001156731	Q8N5J2	FA63A_HUMAN	hypothetical protein LOC55793 isoform 1	415	Gln-rich.						protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CTGCTGGGCCAGCTCCAAGTC	0.632													32	32	---	---	---	---	PASS
GBA	2629	broad.mit.edu	37	1	155206051	155206051	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155206051G>C	uc001fjh.2	-	8	1359	c.1209C>G	c.(1207-1209)AGC>AGG	p.S403R	RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Missense_Mutation_p.S290R|GBA_uc010pfx.1_Missense_Mutation_p.S354R|GBA_uc001fji.2_Missense_Mutation_p.S403R|GBA_uc001fjj.2_Missense_Mutation_p.S403R|GBA_uc001fjk.2_Missense_Mutation_p.S403R|GBA_uc001fjl.2_Missense_Mutation_p.S403R|GBA_uc010pfy.1_Missense_Mutation_p.S316R	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor	403			S -> T (in GD; mild).		carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	TGATGCTGTGGCTGTACTGCA	0.562									Gaucher_disease_type_I				36	48	---	---	---	---	PASS
NTRK1	4914	broad.mit.edu	37	1	156845973	156845973	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156845973G>T	uc001fqh.1	+	13	1659	c.1603G>T	c.(1603-1605)GAG>TAG	p.E535*	NTRK1_uc001fqf.1_Nonsense_Mutation_p.E499*|NTRK1_uc009wsi.1_Nonsense_Mutation_p.E234*|NTRK1_uc001fqi.1_Nonsense_Mutation_p.E529*|NTRK1_uc009wsk.1_Nonsense_Mutation_p.E532*	NM_002529	NP_002520	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	535	Cytoplasmic (Potential).|Protein kinase.				activation of adenylate cyclase activity|activation of MAPKK activity|activation of phospholipase C activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development|phosphatidylinositol-mediated signaling|Ras protein signal transduction	endosome|integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein serine/threonine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(9)|ovary(6)|stomach(1)|central_nervous_system(1)	17	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Imatinib(DB00619)	CCTCCTGCCTGAGCAGGACAA	0.627			T	TPM3|TPR|TFG	papillary thyroid					TSP Lung(10;0.080)			40	69	---	---	---	---	PASS
FCRL4	83417	broad.mit.edu	37	1	157555965	157555965	+	Silent	SNP	A	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157555965A>C	uc001fqw.2	-	6	1264	c.1128T>G	c.(1126-1128)ACT>ACG	p.T376T	FCRL4_uc010phy.1_RNA	NM_031282	NP_112572	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4 precursor	376	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(2)|kidney(1)|skin(1)	4	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				CACCTCTCACAGTGACATTCA	0.383													91	155	---	---	---	---	PASS
DARC	2532	broad.mit.edu	37	1	159175595	159175595	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159175595C>A	uc001fto.2	+	2	606	c.366C>A	c.(364-366)AGC>AGA	p.S122R	DARC_uc001ftp.3_Missense_Mutation_p.S124R	NM_002036	NP_002027	Q16570	DUFFY_HUMAN	Duffy blood group antigen isoform b	122	Extracellular (Potential).				defense response	integral to membrane|plasma membrane	C-C chemokine binding|chemokine receptor activity			ovary(1)|lung(1)	2	all_hematologic(112;0.0429)					GGCTAGGTAGCACTCGCAGCT	0.647													55	85	---	---	---	---	PASS
NR1I3	9970	broad.mit.edu	37	1	161201164	161201164	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161201164A>G	uc001fzx.2	-	6	852	c.649T>C	c.(649-651)TTC>CTC	p.F217L	TOMM40L_uc009wuf.1_Intron|NR1I3_uc001fzf.2_Missense_Mutation_p.F217L|NR1I3_uc001fzg.2_Missense_Mutation_p.F188L|NR1I3_uc001fzh.2_Missense_Mutation_p.F188L|NR1I3_uc001fzi.2_Missense_Mutation_p.F188L|NR1I3_uc001fzj.2_Missense_Mutation_p.F188L|NR1I3_uc001fzk.2_Missense_Mutation_p.F188L|NR1I3_uc001fzl.2_Missense_Mutation_p.F188L|NR1I3_uc001fzm.2_Missense_Mutation_p.F142L|NR1I3_uc001fzn.2_Missense_Mutation_p.F50L|NR1I3_uc009wug.2_Missense_Mutation_p.F50L|NR1I3_uc001fzp.2_Missense_Mutation_p.F217L|NR1I3_uc001fzo.2_Missense_Mutation_p.F50L|NR1I3_uc001fzq.2_Silent_p.T113T|NR1I3_uc001fzr.2_Silent_p.T113T|NR1I3_uc001fzs.2_Missense_Mutation_p.F50L|NR1I3_uc001fzt.2_Missense_Mutation_p.F50L|NR1I3_uc001fzu.2_Silent_p.T84T|NR1I3_uc001fzv.2_Silent_p.T84T|NR1I3_uc001fzw.2_Missense_Mutation_p.F217L|NR1I3_uc001fzy.2_Missense_Mutation_p.F217L|NR1I3_uc001fzz.2_Missense_Mutation_p.F217L|NR1I3_uc001gaa.2_Missense_Mutation_p.F217L|NR1I3_uc001gab.2_Missense_Mutation_p.F217L|NR1I3_uc001gac.2_Missense_Mutation_p.F188L|NR1I3_uc010pkm.1_Missense_Mutation_p.F188L|NR1I3_uc010pkn.1_Missense_Mutation_p.F217L	NM_001077480	NP_001070948	Q14994	NR1I3_HUMAN	constitutive androstane receptor isoform 2	217					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	androgen receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(1)|skin(1)	2	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CCGCAGAGGAAGTTTTGTGTT	0.507													78	141	---	---	---	---	PASS
ATF6	22926	broad.mit.edu	37	1	161928428	161928428	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161928428C>A	uc001gbr.2	+	16	2064	c.1997C>A	c.(1996-1998)CCT>CAT	p.P666H	ATF6_uc001gbs.2_RNA	NM_007348	NP_031374	P18850	ATF6A_HUMAN	activating transcription factor 6	666	Lumenal (Potential).				positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response|protein folding	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleoplasm	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|skin(1)	3	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.00953)			AGCACCATCCCTGAGTCATTA	0.547													7	215	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169530011	169530011	+	Intron	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169530011G>A	uc001ggg.1	-						F5_uc010plr.1_Intron	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	GCACCTGGAGGAGTAACAGCC	0.493													68	80	---	---	---	---	PASS
RFWD2	64326	broad.mit.edu	37	1	175956108	175956108	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175956108C>G	uc001gku.1	-	18	2360	c.2104G>C	c.(2104-2106)GCT>CCT	p.A702P	RFWD2_uc001gkv.1_Missense_Mutation_p.A678P|RFWD2_uc001gkw.1_Missense_Mutation_p.A462P|RFWD2_uc009wwv.2_Missense_Mutation_p.A501P|RFWD2_uc001gkt.1_Missense_Mutation_p.A541P	NM_022457	NP_071902	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2 isoform a	702	WD 7.				DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						CAGCACACAGCACTAACAAAT	0.358													14	209	---	---	---	---	PASS
XPR1	9213	broad.mit.edu	37	1	180832869	180832869	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180832869G>T	uc001goi.2	+	12	1719	c.1527G>T	c.(1525-1527)GTG>GTT	p.V509V	XPR1_uc009wxn.2_Silent_p.V444V	NM_004736	NP_004727	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor	509	EXS.|Helical; (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0						ACACTATGGTGTTCTTTTACC	0.373													120	237	---	---	---	---	PASS
FLVCR1	28982	broad.mit.edu	37	1	213056791	213056791	+	Intron	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213056791G>A	uc001hjt.2	+							NM_014053	NP_054772	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular						cell death|cellular iron ion homeostasis|heme export|transmembrane transport	integral to plasma membrane	heme transporter activity|protein binding|receptor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		GTAAGCTTCTGCTTATATCAG	0.323													12	6	---	---	---	---	PASS
ZP4	57829	broad.mit.edu	37	1	238050087	238050087	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238050087G>C	uc001hym.2	-	6	823	c.823C>G	c.(823-825)CGT>GGT	p.R275G	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	275	ZP.|Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			ATGCTGTCACGAGTGACAGAG	0.488													95	44	---	---	---	---	PASS
OR13G1	441933	broad.mit.edu	37	1	247836257	247836257	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247836257G>T	uc001idi.1	-	1	87	c.87C>A	c.(85-87)CTC>CTA	p.L29L		NM_001005487	NP_001005487	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G,	29	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GATAGACAATGAGAAAAAAGA	0.423													65	20	---	---	---	---	PASS
RSAD2	91543	broad.mit.edu	37	2	7027089	7027089	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7027089A>G	uc002qyp.1	+	3	668	c.532A>G	c.(532-534)ATC>GTC	p.I178V		NM_080657	NP_542388	Q8WXG1	RSAD2_HUMAN	radical S-adenosyl methionine domain containing	178					defense response to virus	endoplasmic reticulum membrane|Golgi apparatus	catalytic activity|iron-sulfur cluster binding|metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		CATTCTCGCTATCTCCTGTGA	0.443													33	19	---	---	---	---	PASS
ADCY3	109	broad.mit.edu	37	2	25095475	25095475	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25095475C>T	uc002rfs.3	-	2	988	c.789G>A	c.(787-789)GAG>GAA	p.E263E	ADCY3_uc010ykm.1_Silent_p.E263E	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3	263					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					TCATCTTCACCTCCAGCGACT	0.632													84	127	---	---	---	---	PASS
GPN1	11321	broad.mit.edu	37	2	27854712	27854712	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27854712G>C	uc010ymc.1	+	4	320	c.299G>C	c.(298-300)GGA>GCA	p.G100A	ZNF512_uc010yly.1_RNA|CCDC121_uc010eze.2_5'Flank|CCDC121_uc002rld.2_5'Flank|CCDC121_uc002rle.2_5'Flank|GPN1_uc010ezf.2_Missense_Mutation_p.G74A|GPN1_uc010yma.1_Missense_Mutation_p.G7A|GPN1_uc010ymb.1_Intron|GPN1_uc010ymd.1_Intron|GPN1_uc010yme.1_Missense_Mutation_p.G100A|GPN1_uc010ezg.1_Intron	NM_007266	NP_009197	Q9HCN4	GPN1_HUMAN	GPN-loop GTPase 1 isoform a	86						cytoplasm	GTP binding|nucleoside-triphosphatase activity|protein binding				0						TATGGACTTGGACCCAATGGC	0.368													6	287	---	---	---	---	PASS
GPN1	11321	broad.mit.edu	37	2	27854762	27854762	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27854762G>C	uc010ymc.1	+	4	370	c.349G>C	c.(349-351)GAT>CAT	p.D117H	ZNF512_uc010yly.1_RNA|CCDC121_uc002rle.2_5'Flank|GPN1_uc010ezf.2_Missense_Mutation_p.D91H|GPN1_uc010yma.1_Missense_Mutation_p.D24H|GPN1_uc010ymb.1_Intron|GPN1_uc010ymd.1_Intron|GPN1_uc010yme.1_Missense_Mutation_p.D117H|GPN1_uc010ezg.1_Intron	NM_007266	NP_009197	Q9HCN4	GPN1_HUMAN	GPN-loop GTPase 1 isoform a	103						cytoplasm	GTP binding|nucleoside-triphosphatase activity|protein binding				0						TACCAGATTTGATCAGGTATA	0.378													5	304	---	---	---	---	PASS
GPN1	11321	broad.mit.edu	37	2	27855502	27855502	+	Silent	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27855502G>A	uc010ymc.1	+	5	378	c.357G>A	c.(355-357)GTG>GTA	p.V119V	ZNF512_uc010yly.1_RNA|GPN1_uc010ezf.2_Silent_p.V93V|GPN1_uc010yma.1_Silent_p.V26V|GPN1_uc010ymb.1_Silent_p.V10V|GPN1_uc010ymd.1_5'UTR|GPN1_uc010yme.1_Silent_p.V119V|GPN1_uc010ezg.1_5'UTR	NM_007266	NP_009197	Q9HCN4	GPN1_HUMAN	GPN-loop GTPase 1 isoform a	105						cytoplasm	GTP binding|nucleoside-triphosphatase activity|protein binding				0						TCTTTTAGGTGATGAAATTTA	0.413													8	258	---	---	---	---	PASS
VRK2	7444	broad.mit.edu	37	2	58313518	58313518	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58313518C>G	uc002rzo.2	+	8	1046	c.301C>G	c.(301-303)CCT>GCT	p.P101A	VRK2_uc010fcb.2_Missense_Mutation_p.P101A|VRK2_uc002rzs.2_Missense_Mutation_p.P101A|VRK2_uc002rzr.2_Missense_Mutation_p.P101A|VRK2_uc010fcc.2_5'UTR|VRK2_uc002rzv.2_Missense_Mutation_p.P101A|VRK2_uc010fcd.2_Missense_Mutation_p.P78A|VRK2_uc002rzp.2_Missense_Mutation_p.P101A|VRK2_uc010ypg.1_Missense_Mutation_p.P101A|VRK2_uc002rzq.2_Missense_Mutation_p.P101A|VRK2_uc002rzu.2_Missense_Mutation_p.P101A|VRK2_uc002rzt.2_5'UTR|VRK2_uc010yph.1_5'UTR	NM_001130482	NP_001123954	Q86Y07	VRK2_HUMAN	vaccinia related kinase 2 isoform 2	101	Protein kinase.					integral to membrane	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						TTTAGGAATTCCTCTGTTTTA	0.279													5	351	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80646650	80646650	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80646650C>A	uc010ysh.1	+	8	1219	c.1214C>A	c.(1213-1215)GCT>GAT	p.A405D	CTNNA2_uc010yse.1_Missense_Mutation_p.A405D|CTNNA2_uc010ysf.1_Missense_Mutation_p.A405D|CTNNA2_uc010ysg.1_Missense_Mutation_p.A405D|CTNNA2_uc010ysi.1_Missense_Mutation_p.A37D	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	405					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						CTCATTGAGGCTGCAAAGAGC	0.433													62	32	---	---	---	---	PASS
SNRNP200	23020	broad.mit.edu	37	2	96958793	96958793	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96958793T>G	uc002svu.2	-	16	2163	c.2077A>C	c.(2077-2079)ACA>CCA	p.T693P		NM_014014	NP_054733	O75643	U520_HUMAN	activating signal cointegrator 1 complex subunit	693	Helicase C-terminal 1.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			ovary(5)|skin(4)|large_intestine(1)	10						TTTTTCTCTGTGATACCCACA	0.403													45	59	---	---	---	---	PASS
IL1F9	56300	broad.mit.edu	37	2	113737695	113737695	+	Silent	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113737695G>A	uc002tio.1	+	4	339	c.270G>A	c.(268-270)AAG>AAA	p.K90K	IL1F9_uc010fkr.1_Silent_p.K55K	NM_019618	NP_062564	Q9NZH8	IL36G_HUMAN	interleukin 1 family, member 9	90					cell-cell signaling	extracellular space	cytokine activity|interleukin-1 receptor antagonist activity				0						ATTGTGAGAAGGTTGGAGAAC	0.388													33	44	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168102982	168102982	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168102982C>T	uc002udx.2	+	8	5098	c.5080C>T	c.(5080-5082)CTT>TTT	p.L1694F	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.L1519F|XIRP2_uc010fpq.2_Missense_Mutation_p.L1472F|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1519					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TATCTATTGTCTTCTTCATGA	0.338													35	80	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170055374	170055374	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170055374T>C	uc002ues.2	-	45	8713	c.8500A>G	c.(8500-8502)ATT>GTT	p.I2834V		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	2834	LDL-receptor class A 19.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GGAATACAAATATTTGAATTA	0.348													33	70	---	---	---	---	PASS
PDE11A	50940	broad.mit.edu	37	2	178969195	178969195	+	5'UTR	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178969195C>A	uc002ulr.2	-	2					PDE11A_uc002ult.1_5'UTR	NM_001077197	NP_001070665	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 3						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			CAGCATCTCCCATGTTGCTCT	0.388									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				5	218	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179611917	179611917	+	Silent	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179611917T>C	uc002unb.2	-	46	15434	c.15210A>G	c.(15208-15210)CTA>CTG	p.L5070L	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTATCTCTCTAGAGTCTCTC	0.522													51	141	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179615771	179615771	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179615771A>C	uc002unb.2	-	46	11580	c.11356T>G	c.(11356-11358)TCT>GCT	p.S3786A	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTTCCTCAGATTCTATATTT	0.363													5	483	---	---	---	---	PASS
RPE	6120	broad.mit.edu	37	2	210880974	210880974	+	Intron	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210880974C>A	uc002vdn.2	+						RPE_uc002vdm.2_Intron|RPE_uc002vdo.2_Missense_Mutation_p.P62Q|RPE_uc010zjf.1_Intron|RPE_uc002vdp.2_Missense_Mutation_p.P59Q|RPE_uc010fup.2_Intron|RPE_uc002vdq.2_Missense_Mutation_p.P62Q|RPE_uc002vdr.2_Missense_Mutation_p.P62Q	NM_199229	NP_954699	Q96AT9	RPE_HUMAN	ribulose-5-phosphate-3-epimerase isoform 1						pentose-phosphate shunt	cytosol	metal ion binding|protein homodimerization activity|ribulose-phosphate 3-epimerase activity				0				Epithelial(149;0.00241)|Lung(261;0.041)|all cancers(144;0.0429)|LUSC - Lung squamous cell carcinoma(261;0.0431)		agtcagggcccattgcagGTA	0.234													28	22	---	---	---	---	PASS
DES	1674	broad.mit.edu	37	2	220290422	220290422	+	Silent	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220290422C>G	uc002vll.2	+	8	1412	c.1326C>G	c.(1324-1326)ACC>ACG	p.T442T		NM_001927	NP_001918	P17661	DESM_HUMAN	desmin	442	Tail.		T -> I (in MFM1; reveals a severe disturbance of filament-formation competence and filament-filament interactions, indicating an inherent incompaibility of mutant and wild-type protein to form mixed filaments).		cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton			central_nervous_system(2)	2		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		AGGTCCATACCAAGAAGACGG	0.572													4	3	---	---	---	---	PASS
STK11IP	114790	broad.mit.edu	37	2	220473376	220473376	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220473376C>G	uc002vml.2	+	15	1751	c.1708C>G	c.(1708-1710)CTC>GTC	p.L570V	STK11IP_uc010zll.1_Missense_Mutation_p.L527V|STK11IP_uc002vmm.1_Missense_Mutation_p.L559V	NM_052902	NP_443134	Q8N1F8	S11IP_HUMAN	LKB1 interacting protein	570	Glu-rich.				protein localization	cytoplasm	protein kinase binding			ovary(1)	1		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGAATGCTTTCTCAGGGTCAC	0.607													26	20	---	---	---	---	PASS
KIAA1486	57624	broad.mit.edu	37	2	226273595	226273595	+	5'UTR	SNP	A	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226273595A>T	uc002voe.2	+	2					KIAA1486_uc010fxa.1_5'UTR	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624											ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		GTTCCTCTTTACATGATATCC	0.433													47	24	---	---	---	---	PASS
SP140	11262	broad.mit.edu	37	2	231106201	231106201	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231106201A>C	uc002vql.2	+	4	604	c.489A>C	c.(487-489)CAA>CAC	p.Q163H	SP140_uc010zma.1_RNA|SP140_uc002vqk.2_Missense_Mutation_p.Q163H|SP140_uc002vqn.2_Missense_Mutation_p.Q163H|SP140_uc002vqm.2_Missense_Mutation_p.Q163H|SP140_uc010fxl.2_Missense_Mutation_p.Q163H	NM_007237	NP_009168	Q13342	LY10_HUMAN	SP140 nuclear body protein isoform 1	163					defense response	cytoplasm|nuclear envelope|nucleolus|nucleoplasm	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		ATGGTAAACAAGGTAACTATC	0.378													37	16	---	---	---	---	PASS
EFHB	151651	broad.mit.edu	37	3	19961433	19961433	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19961433G>T	uc003cbl.3	-	3	1084	c.888C>A	c.(886-888)AAC>AAA	p.N296K	EFHB_uc003cbm.2_Missense_Mutation_p.N166K	NM_144715	NP_653316	Q8N7U6	EFHB_HUMAN	EF hand domain family, member B	296					signal transduction	proteinaceous extracellular matrix	calcium ion binding				0						GATATCTGAAGTTGAAATACT	0.343													60	47	---	---	---	---	PASS
STAC	6769	broad.mit.edu	37	3	36570437	36570437	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36570437G>T	uc003cgh.1	+	10	1109	c.1070G>T	c.(1069-1071)GGG>GTG	p.G357V	STAC_uc011aya.1_Missense_Mutation_p.G296V	NM_003149	NP_003140	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	357					intracellular signal transduction	cytoplasm|soluble fraction	metal ion binding			skin(2)|ovary(1)|pancreas(1)	4						ACCTTCATTGGGTGTAAGGAA	0.383													21	14	---	---	---	---	PASS
HYAL1	3373	broad.mit.edu	37	3	50340387	50340387	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50340387T>C	uc003czp.2	-	2	133	c.1A>G	c.(1-3)ATG>GTG	p.M1V	HYAL1_uc003czm.2_Intron|HYAL1_uc003czo.2_Intron|HYAL1_uc003czq.2_Missense_Mutation_p.M1V|HYAL1_uc003czr.2_Missense_Mutation_p.M1V|HYAL1_uc003czn.2_Intron|HYAL1_uc003czs.2_Missense_Mutation_p.M1V|HYAL1_uc003czt.2_Missense_Mutation_p.M1V	NM_033159	NP_149349	Q12794	HYAL1_HUMAN	hyaluronoglucosaminidase 1 isoform 1	1						extracellular space|lysosome	hyalurononglucosaminidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)	Hyaluronidase(DB00070)	TGGGCTGCCATGGCACGGGAC	0.632													31	4	---	---	---	---	PASS
CADPS	8618	broad.mit.edu	37	3	62451077	62451077	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62451077C>T	uc003dll.2	-	26	3961	c.3601G>A	c.(3601-3603)GAA>AAA	p.E1201K	CADPS_uc003dlj.1_Missense_Mutation_p.E156K|CADPS_uc003dlk.1_Missense_Mutation_p.E649K|CADPS_uc003dlm.2_Missense_Mutation_p.E1162K|CADPS_uc003dln.2_Missense_Mutation_p.E1122K	NM_003716	NP_003707	Q9ULU8	CAPS1_HUMAN	Ca2+-dependent secretion activator isoform 1	1201	Mediates targeting and association with DCVs (By similarity).				exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|cytosol|synapse	lipid binding|metal ion binding			central_nervous_system(2)|ovary(1)	3		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		AAAGTCCCTTCGTCATATCTG	0.333													5	133	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89391048	89391048	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89391048C>T	uc003dqy.2	+	5	1339	c.1114C>T	c.(1114-1116)CAG>TAG	p.Q372*	EPHA3_uc003dqx.1_Nonsense_Mutation_p.Q372*|EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	372	Extracellular (Potential).|Fibronectin type-III 1.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GAATATAAAACAGTGTGAGCC	0.493										TSP Lung(6;0.00050)			55	23	---	---	---	---	PASS
CD96	10225	broad.mit.edu	37	3	111286386	111286386	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111286386G>T	uc003dxw.2	+	3	605	c.435G>T	c.(433-435)TGG>TGT	p.W145C	CD96_uc003dxv.2_Missense_Mutation_p.W145C|CD96_uc003dxx.2_Missense_Mutation_p.W145C|CD96_uc010hpy.1_Missense_Mutation_p.W145C	NM_198196	NP_937839	P40200	TACT_HUMAN	CD96 antigen isoform 1 precursor	145	Extracellular (Potential).				cell adhesion|immune response|regulation of immune response	integral to plasma membrane				skin(2)|central_nervous_system(1)	3						CAGATGAATGGAACAGCAACC	0.328									Opitz_Trigonocephaly_syndrome				4	199	---	---	---	---	PASS
CCDC52	152185	broad.mit.edu	37	3	113169255	113169255	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113169255G>A	uc003eag.3	-	15	2542	c.2251C>T	c.(2251-2253)CAG>TAG	p.Q751*	CCDC52_uc003eaf.3_RNA|CCDC52_uc003eah.1_Nonsense_Mutation_p.Q647*	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52	751	Potential.				cell division|mitosis	centriole|spindle	protein binding				0						AGTTTCTGCTGCTCTATCAAC	0.428													259	79	---	---	---	---	PASS
FNDC3B	64778	broad.mit.edu	37	3	172096201	172096201	+	Silent	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172096201C>G	uc003fhy.2	+	24	3322	c.3150C>G	c.(3148-3150)ACC>ACG	p.T1050T	FNDC3B_uc003fhz.3_Silent_p.T1050T	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	1050						endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TCAGCACAACCAAAAGTGTCC	0.478													6	270	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	183056620	183056620	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183056620A>T	uc003fli.1	-	5	544	c.454T>A	c.(454-456)TAC>AAC	p.Y152N	MCF2L2_uc003flj.1_Missense_Mutation_p.Y152N|MCF2L2_uc003flp.1_Missense_Mutation_p.Y187N	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	152	CRAL-TRIO.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TTTCGATAGTATTTAATGCCA	0.343													12	340	---	---	---	---	PASS
RFC4	5984	broad.mit.edu	37	3	186510376	186510376	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186510376C>A	uc003fqz.2	-	7	801	c.578G>T	c.(577-579)AGA>ATA	p.R193I	RFC4_uc011bsc.1_Missense_Mutation_p.R193I|RFC4_uc011bsd.1_Missense_Mutation_p.R193I	NM_002916	NP_002907	P35249	RFC4_HUMAN	replication factor C 4	193					cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|phosphatidylinositol-mediated signaling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|large_intestine(1)	5	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		TTTTGAACATCTAGAGGTCAG	0.363													63	153	---	---	---	---	PASS
CRMP1	1400	broad.mit.edu	37	4	5853143	5853143	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5853143C>T	uc003gip.2	-	6	633	c.532G>A	c.(532-534)GAC>AAC	p.D178N	CRMP1_uc003gin.1_Missense_Mutation_p.D90N|CRMP1_uc003giq.2_Missense_Mutation_p.D178N|CRMP1_uc003gir.2_Missense_Mutation_p.D173N|CRMP1_uc003gis.2_Missense_Mutation_p.D292N	NM_001313	NP_001304	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1 isoform 2	178					axon guidance|pyrimidine base catabolic process	cytosol|microtubule organizing center|spindle	dihydropyrimidinase activity|protein binding			ovary(2)	2				Colorectal(103;0.0721)		ACCTGGCTGTCGGACATTTGG	0.408													10	261	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62679560	62679560	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62679560C>T	uc010ihh.2	+	6	1402	c.1229C>T	c.(1228-1230)TCT>TTT	p.S410F	LPHN3_uc003hcq.3_Missense_Mutation_p.S410F|LPHN3_uc003hcs.1_Missense_Mutation_p.S239F	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	410	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						tcatacatttctccgccaatt	0.124													3	61	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114276009	114276009	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114276009G>T	uc003ibe.3	+	38	6335	c.6235G>T	c.(6235-6237)GAT>TAT	p.D2079Y	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Missense_Mutation_p.D2094Y	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	2046					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TAAGAAAGAAGATGCAGCTGG	0.483													6	184	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169195106	169195106	+	Silent	SNP	G	A	A	rs138638907		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169195106G>A	uc003irp.2	-	17	2725	c.2433C>T	c.(2431-2433)GTC>GTT	p.V811V		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	811	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CAACGTACACGACCACCCCGT	0.453													13	146	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183676285	183676285	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183676285A>G	uc003ivd.1	+	21	4802	c.4765A>G	c.(4765-4767)ATA>GTA	p.I1589V	ODZ3_uc003ive.1_Missense_Mutation_p.I1002V	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1589	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		ATGGTTGACAATAGGAACAAA	0.428													28	42	---	---	---	---	PASS
IRX2	153572	broad.mit.edu	37	5	2749025	2749025	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2749025T>A	uc003jda.2	-	3	1039	c.797A>T	c.(796-798)GAC>GTC	p.D266V	IRX2_uc003jdb.2_Missense_Mutation_p.D266V	NM_001134222	NP_001127694	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	266						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1				GBM - Glioblastoma multiforme(108;0.204)		GTCGTCCTCGTCGTCCTCCAG	0.682													9	30	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19473828	19473828	+	Intron	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19473828G>T	uc003jgc.2	-						CDH18_uc003jgd.2_Intron|CDH18_uc011cnm.1_Intron	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CACAATTGCTGAGGAAGAATG	0.398													103	147	---	---	---	---	PASS
UGT3A1	133688	broad.mit.edu	37	5	35955751	35955751	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35955751T>C	uc003jjv.1	-	6	1448	c.1291A>G	c.(1291-1293)AAG>GAG	p.K431E	UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Missense_Mutation_p.K431E|UGT3A1_uc011cor.1_Missense_Mutation_p.K397E	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	431	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACATACCTCTTGTCTTCTATG	0.408													34	79	---	---	---	---	PASS
UGT3A1	133688	broad.mit.edu	37	5	35966003	35966003	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35966003G>A	uc003jjv.1	-	4	485	c.328C>T	c.(328-330)CTT>TTT	p.L110F	UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Missense_Mutation_p.L110F|UGT3A1_uc011cor.1_Missense_Mutation_p.L76F|UGT3A1_uc003jjy.1_Missense_Mutation_p.L56F	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	110	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGCTTTACAAGGGCTTCAGAT	0.274													33	58	---	---	---	---	PASS
FBXO4	26272	broad.mit.edu	37	5	41941379	41941379	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41941379G>A	uc003jmq.2	+	7	1216	c.1160G>A	c.(1159-1161)AGA>AAA	p.R387K	FBXO4_uc003jmr.2_3'UTR	NM_012176	NP_036308	Q9UKT5	FBX4_HUMAN	F-box only protein 4 isoform 1	387					positive regulation of protein ubiquitination|protein polyubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|telomere maintenance|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	protein binding|protein homodimerization activity|ubiquitin-protein ligase activity			liver(1)	1		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				AAGCGTGCAAGATGATTCTCT	0.413													6	104	---	---	---	---	PASS
PDE4D	5144	broad.mit.edu	37	5	59284455	59284455	+	Silent	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:59284455G>A	uc003jsb.2	-	3	345	c.132C>T	c.(130-132)CGC>CGT	p.R44R	PDE4D_uc010iwj.1_Silent_p.R44R|PDE4D_uc003jse.1_Silent_p.R56R	NM_006203	NP_006194	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 2	Error:Variant_position_missing_in_Q08499_after_alignment					signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	GCTGAATATTGCGACATGAAA	0.483													87	36	---	---	---	---	PASS
RHOBTB3	22836	broad.mit.edu	37	5	95087983	95087983	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:95087983G>A	uc003klm.2	+	5	1148	c.611G>A	c.(610-612)AGT>AAT	p.S204N	RHOBTB3_uc003klk.1_Translation_Start_Site	NM_014899	NP_055714	O94955	RHBT3_HUMAN	rho-related BTB domain containing 3	204					retrograde transport, endosome to Golgi	Golgi apparatus	ATP binding|ATPase activity|Rab GTPase binding			lung(1)|skin(1)	2		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		CAGAAGACAAGTGAAAAAATG	0.318													59	27	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140572692	140572692	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140572692G>A	uc003lix.2	+	1	741	c.567G>A	c.(565-567)ATG>ATA	p.M189I		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	189	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGAAGGCATGATATATCCAG	0.502													15	178	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140710767	140710767	+	Silent	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140710767C>A	uc003lji.1	+	1	516	c.516C>A	c.(514-516)CTC>CTA	p.L172L	PCDHGA1_uc011dan.1_Silent_p.L172L	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	172	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTACCAACTCAGCTCTAACC	0.483													95	59	---	---	---	---	PASS
SH3RF2	153769	broad.mit.edu	37	5	145383666	145383666	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145383666G>A	uc003lnt.2	+	4	932	c.694G>A	c.(694-696)GAA>AAA	p.E232K	SH3RF2_uc011dbl.1_Missense_Mutation_p.E232K	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	232	SH3 2.						ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAACTGGGCAGAAGGCAAGTT	0.418													7	123	---	---	---	---	PASS
ATP10B	23120	broad.mit.edu	37	5	159996670	159996670	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159996670C>T	uc003lym.1	-	25	4618	c.3771G>A	c.(3769-3771)GTG>GTA	p.V1257V	ATP10B_uc010jit.1_Silent_p.V507V	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1257	Helical; (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGCCGAGGAGCACGACTCCGT	0.488													47	31	---	---	---	---	PASS
GABRB2	2561	broad.mit.edu	37	5	160721318	160721318	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160721318A>G	uc003lys.1	-	11	1527	c.1309T>C	c.(1309-1311)TCC>CCC	p.S437P	GABRB2_uc011deh.1_Missense_Mutation_p.S238P|GABRB2_uc003lyr.1_Missense_Mutation_p.S399P|GABRB2_uc003lyt.1_Missense_Mutation_p.S399P|GABRB2_uc010jiu.1_Missense_Mutation_p.S336P	NM_021911	NP_068711	P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	437	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|GABA-A receptor activity				0	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TGGATGCTGGAGGCATCATAG	0.507													7	66	---	---	---	---	PASS
NRN1	51299	broad.mit.edu	37	6	6002585	6002585	+	Splice_Site	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6002585C>G	uc003mwu.2	-	2	851	c.200_splice	c.e2+1	p.T67_splice	NRN1_uc003mwt.2_Splice_Site_p.T93_splice	NM_016588	NP_057672	Q9NPD7	NRN1_HUMAN	neuritin precursor							anchored to membrane|plasma membrane					0	Ovarian(93;0.0816)	all_hematologic(90;0.151)		OV - Ovarian serous cystadenocarcinoma(45;0.00415)		AGGACACTTACGTGCACACGG	0.622													64	164	---	---	---	---	PASS
OR2J3	442186	broad.mit.edu	37	6	29080597	29080597	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29080597G>T	uc011dll.1	+	1	930	c.930G>T	c.(928-930)TGG>TGT	p.W310C		NM_001005216	NP_001005216	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J,	310	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TAATGGGGTGGGAATGAGCCT	0.373													17	51	---	---	---	---	PASS
PNPLA1	285848	broad.mit.edu	37	6	36274163	36274163	+	Intron	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36274163C>T	uc010jwf.2	+						PNPLA1_uc003olw.1_Intron|PNPLA1_uc010jwe.1_Intron	NM_001145717	NP_001139189	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1						lipid catabolic process		hydrolase activity			large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4						CGTAAGTTTCCCCTTCGTGGA	0.498													63	175	---	---	---	---	PASS
RPL7L1	285855	broad.mit.edu	37	6	42851356	42851356	+	Intron	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42851356A>G	uc003osq.1	+						RPL7L1_uc011dux.1_Intron|RPL7L1_uc010jxw.1_Intron|RPL7L1_uc003osr.1_Intron|RPL7L1_uc011duy.1_Intron|RPL7L1_uc003oss.1_Intron|RPL7L1_uc003ost.2_Intron|RPL7L1_uc003osu.2_Intron	NM_198486	NP_940888	Q6DKI1	RL7L_HUMAN	ribosomal protein L7-like 1						translation	large ribosomal subunit	protein binding|structural constituent of ribosome				0	Colorectal(47;0.196)		Colorectal(64;0.00237)|all cancers(41;0.00288)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.088)			TCGAAAGGTAAGGAACTGGTG	0.468													5	85	---	---	---	---	PASS
OPN5	221391	broad.mit.edu	37	6	47754339	47754339	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47754339C>T	uc003ozc.2	+	2	224	c.219C>T	c.(217-219)ATC>ATT	p.I73I	OPN5_uc003ozd.2_5'Flank	NM_181744	NP_859528	Q6U736	OPN5_HUMAN	opsin 5 isoform 1	73	Cytoplasmic (Potential).				phototransduction|protein-chromophore linkage|visual perception	integral to membrane	G-protein coupled receptor activity|photoreceptor activity			ovary(1)	1						TAATGACTATCAATTTAGCAG	0.403													11	152	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	70049312	70049312	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70049312C>T	uc003pev.3	+	26	3823	c.3375C>T	c.(3373-3375)TCC>TCT	p.S1125S	BAI3_uc010kak.2_Silent_p.S1125S|BAI3_uc011dxx.1_Silent_p.S331S|BAI3_uc003pex.1_Silent_p.S255S	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1125	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				ATAAACGCTCCATATTGTTTC	0.468													136	201	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87968709	87968709	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87968709C>G	uc003plm.3	+	8	5403	c.5362C>G	c.(5362-5364)CAA>GAA	p.Q1788E		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	1788					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		ACAAAATGCTCAAATAAATTA	0.343													3	37	---	---	---	---	PASS
GRIK2	2898	broad.mit.edu	37	6	102247544	102247544	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102247544G>A	uc003pqp.3	+	7	1222	c.973G>A	c.(973-975)GAT>AAT	p.D325N	GRIK2_uc003pqn.2_Missense_Mutation_p.D325N|GRIK2_uc003pqo.3_Missense_Mutation_p.D325N|GRIK2_uc010kcw.2_Missense_Mutation_p.D325N	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	325	Extracellular (Potential).				glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	TCTAATGTATGATGCTGTGCA	0.463													74	52	---	---	---	---	PASS
ARMC2	84071	broad.mit.edu	37	6	109225492	109225492	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109225492G>A	uc003pss.3	+	8	1081	c.907G>A	c.(907-909)GGA>AGA	p.G303R	ARMC2_uc011eao.1_Missense_Mutation_p.G138R	NM_032131	NP_115507	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2	303							binding				0		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		TTTAGAGGAAGGAAACATGCT	0.393													114	58	---	---	---	---	PASS
EPB41L2	2037	broad.mit.edu	37	6	131222122	131222122	+	Silent	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131222122T>A	uc003qch.2	-	7	1310	c.1128A>T	c.(1126-1128)GCA>GCT	p.A376A	EPB41L2_uc003qcg.1_Silent_p.A376A|EPB41L2_uc011eby.1_Silent_p.A376A|EPB41L2_uc003qci.2_Silent_p.A376A|EPB41L2_uc010kfk.2_Silent_p.A376A|EPB41L2_uc010kfl.1_Silent_p.A376A	NM_001431	NP_001422	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	376	FERM.				cortical actin cytoskeleton organization	extrinsic to membrane|plasma membrane|spectrin	actin binding|structural molecule activity			central_nervous_system(1)|skin(1)	2	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		TGTGCAGCTCTGCCACCTTCT	0.478													159	69	---	---	---	---	PASS
KIAA1244	57221	broad.mit.edu	37	6	138607837	138607837	+	Splice_Site	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138607837G>C	uc003qhu.2	+	16	2570	c.2570_splice	c.e16-1	p.G857_splice		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine						regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		CCATGTTCCAGGCGTGGCATT	0.478													5	115	---	---	---	---	PASS
TMEM196	256130	broad.mit.edu	37	7	19765275	19765275	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19765275G>T	uc011jyg.1	-	3	406	c.321C>A	c.(319-321)TCC>TCA	p.S107S	TMEM196_uc003sur.2_RNA	NM_152774	NP_689987	Q5HYL7	TM196_HUMAN	transmembrane protein 196	113	Helical; (Potential).					integral to membrane					0						CGAGAGACATGGAGGCAAGGT	0.527													36	30	---	---	---	---	PASS
CREB5	9586	broad.mit.edu	37	7	28857735	28857735	+	Silent	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28857735G>A	uc003szq.2	+	10	1692	c.1302G>A	c.(1300-1302)TTG>TTA	p.L434L	CREB5_uc003szo.2_Silent_p.L401L|CREB5_uc003szr.2_Silent_p.L427L|CREB5_uc003szs.2_Silent_p.L295L	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	434					positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						TGAAACAGTTGTTGTTAACAC	0.378													25	82	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55268990	55268990	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55268990C>T	uc003tqk.2	+	25	3302	c.3056C>T	c.(3055-3057)CCA>CTA	p.P1019L	EGFR_uc010kzg.1_Missense_Mutation_p.P974L|EGFR_uc011kco.1_Missense_Mutation_p.P966L	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	1019	Cytoplasmic (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	TACCTCATCCCACAGCAGGGC	0.537		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			64	37	---	---	---	---	PASS
EPHB4	2050	broad.mit.edu	37	7	100404160	100404160	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100404160G>A	uc003uwn.1	-	14	2857	c.2366C>T	c.(2365-2367)CCG>CTG	p.P789L	EPHB4_uc003uwm.1_Missense_Mutation_p.P696L|EPHB4_uc010lhj.1_Missense_Mutation_p.P789L	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor	789	Cytoplasmic (Potential).|Protein kinase.				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					AATGGCCTCCGGGGCAGTCCA	0.577													4	128	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103124226	103124226	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103124226G>A	uc003vca.2	-	62	10215	c.10055C>T	c.(10054-10056)CCC>CTC	p.P3352L	RELN_uc010liz.2_Missense_Mutation_p.P3352L	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	3352					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CACAGCGTGGGGGCCACTCAG	0.507													63	86	---	---	---	---	PASS
GPR37	2861	broad.mit.edu	37	7	124386657	124386657	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124386657G>T	uc003vli.2	-	2	2415	c.1764C>A	c.(1762-1764)ACC>ACA	p.T588T		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	588	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3						CGAGTTCCGTGGTGTACTCGT	0.502													4	194	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142111515	142111515	+	Intron	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142111515C>G	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		TCCTCTTCCTCTCTCTTCTTT	0.512													6	94	---	---	---	---	PASS
OR2A25	392138	broad.mit.edu	37	7	143771467	143771467	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143771467C>T	uc011ktx.1	+	1	155	c.155C>T	c.(154-156)TCC>TTC	p.S52F		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	52	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					TCACTGGACTCCAGACTCCAC	0.572													42	77	---	---	---	---	PASS
OR2A25	392138	broad.mit.edu	37	7	143771729	143771729	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143771729C>T	uc011ktx.1	+	1	417	c.417C>T	c.(415-417)GTC>GTT	p.V139V		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	139	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					CCTGGAAAGTCTGCATCACTT	0.488													67	119	---	---	---	---	PASS
OR2A25	392138	broad.mit.edu	37	7	143771835	143771835	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143771835C>T	uc011ktx.1	+	1	523	c.523C>T	c.(523-525)CAC>TAC	p.H175Y		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	175	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					GAAACTTAATCACTTTTTCTG	0.463													56	146	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154595609	154595609	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154595609C>T	uc003wlk.2	+	14	1572	c.1443C>T	c.(1441-1443)ACC>ACT	p.T481T	DPP6_uc003wli.2_Silent_p.T417T|DPP6_uc003wlm.2_Silent_p.T419T|DPP6_uc011kvq.1_Silent_p.T374T	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	481	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			AGTCCATCACCTCCGGGGACT	0.572													11	9	---	---	---	---	PASS
RAB11FIP1	80223	broad.mit.edu	37	8	37729089	37729089	+	Silent	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37729089C>A	uc003xkm.1	-	4	3275	c.3231G>T	c.(3229-3231)CCG>CCT	p.P1077P	RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Intron|RAB11FIP1_uc003xkl.1_Silent_p.P406P|RAB11FIP1_uc003xko.1_Silent_p.P406P|RAB11FIP1_uc003xkp.1_Intron	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	1077					protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CATTTCCCATCGGTTTTTCTT	0.542											OREG0018713	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	729	---	---	---	---	PASS
AGPAT6	137964	broad.mit.edu	37	8	41471965	41471965	+	Intron	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41471965G>C	uc003xnz.2	+							NM_178819	NP_848934	Q86UL3	GPAT4_HUMAN	lysophosphatidic acid acyltransferase zeta						acyl-CoA metabolic process|lactation|phosphatidylcholine biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	glycerol-3-phosphate O-acyltransferase activity				0	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			cagaaggtaagaaggggttGG	0.303													38	23	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61707586	61707586	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61707586A>C	uc003xue.2	+	4	2615	c.2138A>C	c.(2137-2139)AAG>ACG	p.K713T		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	713	Lys-rich.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity	p.556_871dup(1)		ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TTGAAGAAAAAGGTCAACAAG	0.408													35	66	---	---	---	---	PASS
PAG1	55824	broad.mit.edu	37	8	81897619	81897619	+	Intron	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81897619C>T	uc003ybz.2	-							NM_018440	NP_060910	Q9NWQ8	PAG1_HUMAN	phosphoprotein associated with glycosphingolipid						epidermal growth factor receptor signaling pathway|intracellular signal transduction|T cell receptor signaling pathway	integral to membrane|intracellular|membrane raft|plasma membrane	SH2 domain binding|SH3/SH2 adaptor activity				0	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			AGAACTAAAGCAGCACACACA	0.433													17	29	---	---	---	---	PASS
ATP6V1C1	528	broad.mit.edu	37	8	104054576	104054576	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104054576G>T	uc003ykz.3	+	3	386	c.141G>T	c.(139-141)ACG>ACT	p.T47T	ATP6V1C1_uc010mbz.2_5'UTR|ATP6V1C1_uc003yla.2_Silent_p.T47T|ATP6V1C1_uc011lhl.1_Intron	NM_001695	NP_001686	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit	47					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism				0	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)			AGGTTGGCACGTTGGATGTCT	0.358													47	131	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113871362	113871362	+	Intron	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113871362G>A	uc003ynu.2	-						CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATCACAGATGGTGTTCTCTTA	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			69	88	---	---	---	---	PASS
ADAMTSL1	92949	broad.mit.edu	37	9	18826299	18826299	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18826299G>T	uc003zne.3	+	22	4079	c.3952G>T	c.(3952-3954)GTC>TTC	p.V1318F	ADAMTSL1_uc003znf.3_Missense_Mutation_p.V19F	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	1318	Ig-like C2-type 3.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		TGAAGCTGAAGTCACTTGGTT	0.483													15	5	---	---	---	---	PASS
ADAMTSL1	92949	broad.mit.edu	37	9	18826395	18826395	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:18826395C>A	uc003zne.3	+	22	4175	c.4048C>A	c.(4048-4050)CTG>ATG	p.L1350M	ADAMTSL1_uc003znf.3_Missense_Mutation_p.L51M	NM_001040272	NP_001035362	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1 isoform 4 precursor	1350	Ig-like C2-type 3.					proteinaceous extracellular matrix	metallopeptidase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)	5				GBM - Glioblastoma multiforme(50;1.29e-17)		GGATCAGGGCCTGTACTCCTG	0.557													3	30	---	---	---	---	PASS
PPP3R2	5535	broad.mit.edu	37	9	104356829	104356829	+	Silent	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104356829C>G	uc004bbr.2	-	1	455	c.384G>C	c.(382-384)ACG>ACC	p.T128T	GRIN3A_uc004bbp.1_Intron|GRIN3A_uc004bbq.1_Intron|PPP3R2_uc010mtf.1_RNA	NM_147180	NP_671709	Q96LZ3	CANB2_HUMAN	protein phosphatase 3 regulatory subunit B, beta	125							calcium ion binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)			Cyclosporine(DB00091)	GCTGCCAGTCCGTCAGGTTGT	0.507													68	37	---	---	---	---	PASS
TLR4	7099	broad.mit.edu	37	9	120475813	120475813	+	Silent	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120475813C>A	uc004bjz.2	+	3	1698	c.1407C>A	c.(1405-1407)GGC>GGA	p.G469G	TLR4_uc004bka.2_Silent_p.G429G|TLR4_uc004bkb.2_Silent_p.G269G	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	469	Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16						TCTTCAATGGCTTGTCCAGTC	0.418													61	124	---	---	---	---	PASS
TUBAL3	79861	broad.mit.edu	37	10	5435992	5435992	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5435992T>C	uc001ihy.2	-	4	869	c.829A>G	c.(829-831)ACA>GCA	p.T277A	TUBAL3_uc001ihz.2_Missense_Mutation_p.T237A	NM_024803	NP_079079	A6NHL2	TBAL3_HUMAN	tubulin, alpha-like 3	277					microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			skin(1)	1						GCGAAGGCTGTCATGGGGAAA	0.517													84	107	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17130187	17130187	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17130187A>T	uc001ioo.2	-	15	1975	c.1923T>A	c.(1921-1923)GAT>GAA	p.D641E		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	641	CUB 2.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGTTGCAGTCATCATGGTGCT	0.418													19	52	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21112199	21112199	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21112199T>C	uc001iqi.2	-	19	2297	c.1900A>G	c.(1900-1902)ACA>GCA	p.T634A	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_RNA	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	634	Nebulin 17.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						GAAATGGCTGTTGCATGTTTA	0.274													33	45	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25878045	25878045	+	Silent	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25878045C>A	uc001isj.2	+	8	1923	c.1863C>A	c.(1861-1863)CTC>CTA	p.L621L		NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	621	Helical; Name=6; (Potential).			ELIISAIFHTI -> SWIVNSMNSHF (in Ref. 3).		integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						ACAATGAGCTCATCATCTCTG	0.398													35	55	---	---	---	---	PASS
LYZL1	84569	broad.mit.edu	37	10	29581497	29581497	+	Silent	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29581497G>C	uc001iul.2	+	3	384	c.327G>C	c.(325-327)ACG>ACC	p.T109T		NM_032517	NP_115906	Q6UWQ5	LYZL1_HUMAN	lysozyme-like 1	63					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Breast(68;0.203)				CAGCCCAGACGGTCCTGGATG	0.552													10	50	---	---	---	---	PASS
PGBD3	267004	broad.mit.edu	37	10	50725112	50725112	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50725112C>A	uc001jht.2	-	2	304	c.49G>T	c.(49-51)GAT>TAT	p.D17Y	ERCC6_uc001jhs.3_Intron|PGBD3_uc009xoe.2_Missense_Mutation_p.D485Y|PGBD3_uc001jhu.2_Missense_Mutation_p.D485Y	NM_170753	NP_736609	Q8N328	PGBD3_HUMAN	hypothetical protein LOC267004	17										pancreas(1)|breast(1)|skin(1)	3						ATGCTGTCATCTGTCTCTAAA	0.393													67	129	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	61932103	61932103	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61932103G>A	uc001jky.2	-	21	2633	c.2441C>T	c.(2440-2442)ACC>ATC	p.T814I	ANK3_uc001jkx.2_5'UTR|ANK3_uc010qih.1_Missense_Mutation_p.T797I|ANK3_uc001jkz.3_Missense_Mutation_p.T808I|ANK3_uc001jlb.1_Missense_Mutation_p.T343I|ANK3_uc001jlc.1_Missense_Mutation_p.T475I	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	814	ANK 23.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						TATCTTCAGGGTGTCCACTAC	0.488													33	54	---	---	---	---	PASS
CDK1	983	broad.mit.edu	37	10	62553719	62553719	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62553719A>G	uc001jld.2	+	8	1014	c.880A>G	c.(880-882)ATT>GTT	p.I294V	CDK1_uc001jle.2_RNA|CDK1_uc001jlf.2_Missense_Mutation_p.I294V|CDK1_uc001jlg.2_Missense_Mutation_p.I237V	NM_001786	NP_001777	P06493	CDK1_HUMAN	cell division cycle 2 isoform 1	294					activation of MAPK activity|activation of MAPKK activity|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|anti-apoptosis|axon guidance|cell division|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|mitosis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein localization to kinetochore|Ras protein signal transduction|regulation of transcription involved in G1/S phase of mitotic cell cycle|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|midbody|nucleoplasm|spindle microtubule	ATP binding|cyclin-dependent protein kinase activity|RNA polymerase II carboxy-terminal domain kinase activity			ovary(1)	1						GGACAATCAGATTAAGAAGAT	0.294													10	121	---	---	---	---	PASS
ANKRD1	27063	broad.mit.edu	37	10	92675931	92675931	+	Silent	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92675931A>G	uc001khe.1	-	6	896	c.648T>C	c.(646-648)GAT>GAC	p.D216D		NM_014391	NP_055206	Q15327	ANKR1_HUMAN	cardiac ankyrin repeat protein	216					cellular lipid metabolic process|defense response|signal transduction		DNA binding				0		Colorectal(252;0.0475)				GGAATACCTTATCTCGGGCGC	0.294													34	59	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	95987096	95987096	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95987096G>A	uc001kjk.2	+	5	2477	c.1843G>A	c.(1843-1845)GCA>ACA	p.A615T	PLCE1_uc010qnx.1_Missense_Mutation_p.A615T|PLCE1_uc001kjm.2_Missense_Mutation_p.A307T	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	615	Ras-GEF.				activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				GATCCTCACGGCAGGCTCCAT	0.473													4	70	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108432749	108432749	+	Intron	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108432749G>A	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		ACACTCTACAGAGTTCATGGT	0.294													11	22	---	---	---	---	PASS
PNLIPRP3	119548	broad.mit.edu	37	10	118220511	118220511	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118220511C>A	uc001lcl.3	+	6	700	c.599C>A	c.(598-600)ACT>AAT	p.T200N		NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3 precursor	200					lipid catabolic process	extracellular region	triglyceride lipase activity			ovary(1)	1				all cancers(201;0.0131)		TTCCACAACACTCCAAAGGAA	0.443													35	104	---	---	---	---	PASS
CUZD1	50624	broad.mit.edu	37	10	124596492	124596492	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124596492C>T	uc001lgq.2	-	5	1004	c.672G>A	c.(670-672)CTG>CTA	p.L224L	CUZD1_uc001lgp.2_5'UTR|CUZD1_uc009yad.2_5'UTR|CUZD1_uc009yaf.2_Intron|CUZD1_uc001lgr.2_5'UTR|CUZD1_uc010qty.1_Intron|CUZD1_uc009yae.2_Intron|CUZD1_uc001lgs.2_Silent_p.L224L|CUZD1_uc010qtz.1_Silent_p.L224L	NM_022034	NP_071317	Q86UP6	CUZD1_HUMAN	CUB and zona pellucida-like domains 1 precursor	224	Extracellular (Potential).|CUB 2.				cell cycle|cell division|cell proliferation|substrate-dependent cell migration, cell attachment to substrate|trypsinogen activation	integral to membrane|transport vesicle membrane|zymogen granule membrane				ovary(1)|skin(1)	2		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		CTTGTCCAATCAGGCCAGAGT	0.468													4	71	---	---	---	---	PASS
CYP2E1	1571	broad.mit.edu	37	10	135345141	135345141	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135345141G>T	uc001lnj.1	+	3	423	c.390G>T	c.(388-390)CTG>CTT	p.L130L	CYP2E1_uc001lnk.1_5'UTR|CYP2E1_uc009ybl.1_Intron|CYP2E1_uc009ybm.1_5'UTR|CYP2E1_uc001lnl.1_5'UTR	NM_000773	NP_000764	P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E,	130					drug metabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NADH or NADPH as one donor, and incorporation of one atom of oxygen|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding			central_nervous_system(3)	3		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Clofibrate(DB00636)|Dacarbazine(DB00851)|Dapsone(DB00250)|Enflurane(DB00228)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethosuximide(DB00593)|Fomepizole(DB01213)|Glutathione(DB00143)|Halothane(DB01159)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Isoniazid(DB00951)|Menadione(DB00170)|Mephenytoin(DB00532)|Methoxyflurane(DB01028)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitrofurantoin(DB00698)|Orphenadrine(DB01173)|Phenelzine(DB00780)|Quinidine(DB00908)|S-Adenosylmethionine(DB00118)|Sevoflurane(DB01236)|Theophylline(DB00277)|Tolbutamide(DB01124)	GGTTTTCCCTGACCACCCTCC	0.532									Naso-/Oropharyngeal/Laryngeal_Cancer_Familial_Clustering_of				63	85	---	---	---	---	PASS
CARS	833	broad.mit.edu	37	11	3078590	3078590	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3078590T>C	uc001lxh.2	-	1	82	c.8A>G	c.(7-9)GAT>GGT	p.D3G	CARS_uc001lxe.2_5'UTR|CARS_uc001lxf.2_Missense_Mutation_p.D3G|CARS_uc001lxg.2_Missense_Mutation_p.D3G|CARS_uc010qxo.1_Missense_Mutation_p.D3G|CARS_uc010qxp.1_5'UTR	NM_001751	NP_001742	P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase isoform b	3					cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding		CARS/ALK(5)	soft_tissue(5)|ovary(2)	7		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	CCCGGAGGAATCTGCCATGGC	0.726			T	ALK	ALCL								4	3	---	---	---	---	PASS
MRGPRE	116534	broad.mit.edu	37	11	3249739	3249739	+	Silent	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3249739G>C	uc001lxq.3	-	2	598	c.288C>G	c.(286-288)ACC>ACG	p.T96T		NM_001039165	NP_001034254	Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	96	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(1)|ovary(1)	2		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTGCCAGGCTGGTCTGCACGA	0.662													6	31	---	---	---	---	PASS
OR51M1	390059	broad.mit.edu	37	11	5411481	5411481	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5411481C>G	uc010qzc.1	+	1	853	c.853C>G	c.(853-855)CAT>GAT	p.H285D	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004756	NP_001004756	B2RNI9	B2RNI9_HUMAN	olfactory receptor, family 51, subfamily M,	285						integral to membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCTGCTATTCATCTTCTTAT	0.493													18	21	---	---	---	---	PASS
OR52B6	340980	broad.mit.edu	37	11	5602719	5602719	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5602719C>A	uc010qzi.1	+	1	613	c.613C>A	c.(613-615)CAT>AAT	p.H205N	HBG2_uc001mak.1_Intron	NM_001005162	NP_001005162	Q8NGF0	O52B6_HUMAN	olfactory receptor, family 52, subfamily B,	205	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGCATTGCCCATCTGTCCTG	0.443													76	191	---	---	---	---	PASS
OR52N1	79473	broad.mit.edu	37	11	5809819	5809819	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5809819G>T	uc010qzo.1	-	1	228	c.228C>A	c.(226-228)TGC>TGA	p.C76*	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron	NM_001001913	NP_001001913	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N,	76	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		GGGTGCTGGTGCACATGAGCA	0.463													34	72	---	---	---	---	PASS
OLFML1	283298	broad.mit.edu	37	11	7509427	7509427	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7509427A>G	uc001mfi.2	+	2	551	c.199A>G	c.(199-201)ATA>GTA	p.I67V	uc001mff.1_Intron|OLFML1_uc001mfh.1_Missense_Mutation_p.I67V|OLFML1_uc010raz.1_Intron|OLFML1_uc010rba.1_Missense_Mutation_p.I67V	NM_198474	NP_940876	Q6UWY5	OLFL1_HUMAN	olfactomedin-like 1 precursor	67						extracellular region				ovary(2)	2				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		CTCAAAAAATATATCTGTCAT	0.418													32	37	---	---	---	---	PASS
OR5P2	120065	broad.mit.edu	37	11	7817568	7817568	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7817568G>A	uc001mfp.1	-	1	922	c.922C>T	c.(922-924)CAT>TAT	p.H308Y		NM_153444	NP_703145	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P,	308	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CAAGCATCATGAGAAAGTATT	0.388													92	111	---	---	---	---	PASS
SOX6	55553	broad.mit.edu	37	11	15994598	15994598	+	Silent	SNP	A	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15994598A>C	uc001mme.2	-	16	2316	c.2283T>G	c.(2281-2283)ACT>ACG	p.T761T	SOX6_uc001mmd.2_Silent_p.T724T|SOX6_uc001mmf.2_Silent_p.T721T|SOX6_uc001mmg.2_Silent_p.T728T	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	748					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						TAGTTGCCATAGTGATAGCAC	0.502													24	56	---	---	---	---	PASS
OR5L1	219437	broad.mit.edu	37	11	55579262	55579262	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55579262G>A	uc001nhw.1	+	1	320	c.320G>A	c.(319-321)TGT>TAT	p.C107Y		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	107	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)				TTTTGCACTTGTGTGGTCACT	0.463													67	138	---	---	---	---	PASS
OR5B2	390190	broad.mit.edu	37	11	58189942	58189942	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58189942A>T	uc010rkg.1	-	1	793	c.793T>A	c.(793-795)TCC>ACC	p.S265T		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	265	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GTGTCCATGGAGTGGCTGGAG	0.498													37	59	---	---	---	---	PASS
NAALADL1	10004	broad.mit.edu	37	11	64825641	64825641	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64825641G>T	uc001ocn.2	-	2	283	c.267C>A	c.(265-267)GAC>GAA	p.D89E	NAALADL1_uc010rnw.1_5'UTR	NM_005468	NP_005459	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic	89	Extracellular (Potential).				proteolysis	apical plasma membrane|integral to membrane	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity				0						CTGACTCTGGGTCCTTCCAGC	0.662													20	21	---	---	---	---	PASS
LTBP3	4054	broad.mit.edu	37	11	65325130	65325130	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65325130C>A	uc001oej.2	-	1	570	c.301G>T	c.(301-303)GAC>TAC	p.D101Y	LTBP3_uc010roi.1_5'UTR|LTBP3_uc001oei.2_Missense_Mutation_p.D101Y|LTBP3_uc010roj.1_Missense_Mutation_p.D87Y|LTBP3_uc010rok.1_Missense_Mutation_p.D12Y	NM_001130144	NP_001123616	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding	101	Gly-rich.					extracellular region	calcium ion binding|growth factor binding			central_nervous_system(2)|lung(1)	3						GTGAGCGTGTCTGTGCTGTGG	0.682													25	40	---	---	---	---	PASS
KRTAP5-7	440050	broad.mit.edu	37	11	71238460	71238460	+	Silent	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71238460C>A	uc001oqq.1	+	1	148	c.114C>A	c.(112-114)CCC>CCA	p.P38P		NM_001012503	NP_001012521	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	38	1.|7 X 4 AA repeats of C-C-X-P.					keratin filament					0						GCTGTGTGCCCGTCTGCTGCT	0.687													55	87	---	---	---	---	PASS
C2CD3	26005	broad.mit.edu	37	11	73811639	73811639	+	Missense_Mutation	SNP	C	T	T	rs143196767	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73811639C>T	uc001ouu.2	-	15	2890	c.2663G>A	c.(2662-2664)CGG>CAG	p.R888Q		NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	888						centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					TCCTGGGCTCCGCACCTTATT	0.438													7	111	---	---	---	---	PASS
C2CD3	26005	broad.mit.edu	37	11	73825470	73825470	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73825470G>C	uc001ouu.2	-	10	1916	c.1689C>G	c.(1687-1689)AGC>AGG	p.S563R	C2CD3_uc001ouv.2_Missense_Mutation_p.S563R	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	563						centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					GACCAGCATAGCTTTTTTTGC	0.433													30	44	---	---	---	---	PASS
KDM4D	55693	broad.mit.edu	37	11	94731717	94731717	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94731717G>A	uc001pfe.2	+	3	2013	c.1181G>A	c.(1180-1182)GGG>GAG	p.G394E		NM_018039	NP_060509	Q6B0I6	KDM4D_HUMAN	jumonji domain containing 2D	394					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GCCCGCAGTGGGACACGGTGC	0.632													10	41	---	---	---	---	PASS
GRIA4	2893	broad.mit.edu	37	11	105732909	105732909	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105732909A>C	uc001pix.2	+	5	1093	c.647A>C	c.(646-648)GAG>GCG	p.E216A	GRIA4_uc001piu.1_Missense_Mutation_p.E216A|GRIA4_uc001piw.2_Missense_Mutation_p.E216A|GRIA4_uc001piv.2_Missense_Mutation_p.E216A|GRIA4_uc009yxk.1_Missense_Mutation_p.E216A	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	216	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)	TGTGAGATAGAGAGACTTCAA	0.333													26	38	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117329603	117329603	+	Missense_Mutation	SNP	G	C	C	rs150002652		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117329603G>C	uc001prh.1	-	19	3617	c.3615C>G	c.(3613-3615)ATC>ATG	p.I1205M		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1145	Fibronectin type-III 3.|Extracellular (Potential).				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GCGTGGTGGTGATGTTCTGCA	0.657													48	124	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124121094	124121094	+	IGR	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124121094C>A								OR8G2 (24784 upstream) : OR8D1 (58643 downstream)																							TTATTGCCAGCATCCTCCACA	0.448													41	93	---	---	---	---	PASS
FOXM1	2305	broad.mit.edu	37	12	2968732	2968732	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2968732G>A	uc001qlf.2	-	9	1629	c.1364C>T	c.(1363-1365)CCA>CTA	p.P455L	uc001qld.2_RNA|FOXM1_uc001qle.2_Missense_Mutation_p.P493L|FOXM1_uc001qlg.2_Missense_Mutation_p.P440L|FOXM1_uc009zea.2_Missense_Mutation_p.P440L|FOXM1_uc009zeb.2_Missense_Mutation_p.P439L	NM_021953	NP_068772	Q08050	FOXM1_HUMAN	forkhead box M1 isoform 2	455					cell cycle|embryo development|liver development|negative regulation of cell aging|negative regulation of stress-activated MAPK cascade|negative regulation of transcription from RNA polymerase II promoter|pattern specification process|positive regulation of cell proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of cell growth|regulation of cell proliferation|regulation of oxygen and reactive oxygen species metabolic process|regulation of Ras protein signal transduction|regulation of reactive oxygen species metabolic process|regulation of sequence-specific DNA binding transcription factor activity|tissue development|transcription from RNA polymerase II promoter|vasculogenesis	cytoplasm|transcription factor complex	DNA bending activity|DNA binding|DNA binding|double-stranded DNA binding|promoter binding|protein binding|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|transcription factor binding			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			AGTCTGAACTGGAAGCAAAGG	0.532													16	142	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6182863	6182863	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6182863G>A	uc001qnn.1	-	8	1169	c.919C>T	c.(919-921)CCT>TCT	p.P307S	VWF_uc010set.1_Missense_Mutation_p.P307S	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	307	TIL 1.				blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	CTGGCGCAAGGGGACACACAC	0.557													47	78	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7635988	7635988	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7635988C>T	uc001qsz.3	-	12	3191	c.3063G>A	c.(3061-3063)AAG>AAA	p.K1021K	CD163_uc001qta.3_Silent_p.K1021K|CD163_uc009zfw.2_Silent_p.K1054K	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	1021	SRCR 9.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						CAGCGTCTTCCTTGTGCCCAC	0.527													23	30	---	---	---	---	PASS
RIMKLB	57494	broad.mit.edu	37	12	8906535	8906535	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8906535C>A	uc001quu.2	+	5	794	c.543C>A	c.(541-543)AGC>AGA	p.S181R	RIMKLB_uc009zgf.1_RNA|RIMKLB_uc001qux.2_Missense_Mutation_p.S181R|RIMKLB_uc010sgl.1_Missense_Mutation_p.S181R|RIMKLB_uc001quw.2_Missense_Mutation_p.S181R	NM_020734	NP_065785	Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family	181	ATP-grasp.|ATP (By similarity).				protein modification process	cytoplasm	acid-amino acid ligase activity|ATP binding|metal ion binding				0						CTGATCTAAGCCATCTTATTC	0.433													4	118	---	---	---	---	PASS
SLCO1C1	53919	broad.mit.edu	37	12	20876025	20876025	+	Silent	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20876025T>C	uc001rej.3	+	10	1378	c.1023T>C	c.(1021-1023)GAT>GAC	p.D341D	SLCO1C1_uc010sii.1_Silent_p.D341D|SLCO1C1_uc010sij.1_Silent_p.D292D|SLCO1C1_uc009zip.2_Silent_p.D175D|SLCO1C1_uc001rei.2_Silent_p.D341D|SLCO1C1_uc010sik.1_Silent_p.D223D	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	341	Cytoplasmic (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)					GTTTTACAGATTTTCTTCCAT	0.413													45	85	---	---	---	---	PASS
SLCO1A2	6579	broad.mit.edu	37	12	21457502	21457502	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21457502T>C	uc001rer.2	-	5	699	c.448A>G	c.(448-450)ACA>GCA	p.T150A	SLCO1A2_uc001res.2_Missense_Mutation_p.T150A|SLCO1A2_uc010siq.1_Missense_Mutation_p.T18A|SLCO1A2_uc010sio.1_Missense_Mutation_p.T18A|SLCO1A2_uc010sip.1_Missense_Mutation_p.T18A|SLCO1A2_uc001ret.2_Missense_Mutation_p.T148A|SLCO1A2_uc001reu.2_Missense_Mutation_p.T130A	NM_021094	NP_066580	P46721	SO1A2_HUMAN	organic anion transporting polypeptide A	150	Extracellular (Potential).				bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						ACTTCCTTTGTACACTCTGCA	0.348													55	93	---	---	---	---	PASS
SLC2A13	114134	broad.mit.edu	37	12	40422284	40422284	+	Silent	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40422284C>G	uc010skm.1	-	3	795	c.744G>C	c.(742-744)CCG>CCC	p.P248P	SLC2A13_uc001rmf.2_Silent_p.P248P	NM_052885	NP_443117	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose	248	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)				GTATAACCGCCGGAACTGCTG	0.413										HNSCC(50;0.14)			6	117	---	---	---	---	PASS
PDZRN4	29951	broad.mit.edu	37	12	41585353	41585353	+	Intron	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41585353C>G	uc010skn.1	+							NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2								ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				TCAGGTAAAACACCTTGTTAA	0.318													35	39	---	---	---	---	PASS
KRT76	51350	broad.mit.edu	37	12	53170493	53170493	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53170493C>A	uc001sax.2	-	1	637	c.583G>T	c.(583-585)GCC>TCC	p.A195S		NM_015848	NP_056932	Q01546	K22O_HUMAN	keratin 76	195	Coil 1A.|Rod.				cytoskeleton organization	keratin filament	structural molecule activity			breast(1)|skin(1)	2						ATGAAGGAGGCAAACTTGTTG	0.502													34	81	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57573260	57573260	+	Silent	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57573260G>A	uc001snd.2	+	29	5353	c.4887G>A	c.(4885-4887)GTG>GTA	p.V1629V		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	1629	LDL-receptor class B 13.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGCAGCGTGTGTACTGGTCTG	0.587													22	43	---	---	---	---	PASS
MON2	23041	broad.mit.edu	37	12	62960174	62960174	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62960174A>G	uc001sre.2	+	29	4658	c.4267A>G	c.(4267-4269)AAA>GAA	p.K1423E	MON2_uc009zqj.2_Missense_Mutation_p.K1423E|MON2_uc010ssl.1_Missense_Mutation_p.K1351E|MON2_uc010ssm.1_Missense_Mutation_p.K1394E|MON2_uc010ssn.1_Missense_Mutation_p.K1417E|MON2_uc001srf.2_Missense_Mutation_p.K1186E|MON2_uc001srg.2_Missense_Mutation_p.K292E	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog	1424					Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTTATACCAAAAAACAGCGTG	0.363													83	112	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	100166842	100166842	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100166842G>A	uc001tge.1	-	8	1403	c.986C>T	c.(985-987)TCA>TTA	p.S329L	ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Missense_Mutation_p.S295L	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	329						Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CAAGAGTTTTGATAATTCTCC	0.313													5	116	---	---	---	---	PASS
TCHP	84260	broad.mit.edu	37	12	110342594	110342594	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110342594G>T	uc001tpn.2	+	4	605	c.452G>T	c.(451-453)CGA>CTA	p.R151L	TCHP_uc001tpo.1_RNA|TCHP_uc001tpp.2_Missense_Mutation_p.R151L	NM_001143852	NP_001137324	Q9BT92	TCHP_HUMAN	trichoplein	151	Glu-rich.|Interaction with keratin proteins.				apoptosis|negative regulation of cell growth	apical cortex|centrosome|keratin filament|mitochondrion|plasma membrane	protein binding			skin(1)	1						CCGAAACTTCGAGAGGTGAAA	0.353													32	71	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112687950	112687950	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112687950T>C	uc009zwc.2	-	18	2700	c.2682A>G	c.(2680-2682)ATA>ATG	p.I894M	C12orf51_uc010syk.1_Missense_Mutation_p.I716M|C12orf51_uc001tts.2_Missense_Mutation_p.I707M|C12orf51_uc001ttt.3_Missense_Mutation_p.I705M	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						CAACATACTTTATACTTGGTC	0.373													23	20	---	---	---	---	PASS
KDM2B	84678	broad.mit.edu	37	12	121958790	121958790	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121958790G>T	uc001uat.2	-	9	1149	c.1045C>A	c.(1045-1047)CGG>AGG	p.R349R	KDM2B_uc001uas.2_Silent_p.R318R|KDM2B_uc001uau.2_Silent_p.R232R|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	349					embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						CTCCTTACCCGCGTCCTGTCC	0.597													3	73	---	---	---	---	PASS
CCDC122	160857	broad.mit.edu	37	13	44433997	44433997	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:44433997C>A	uc010acf.2	-	5	625	c.366G>T	c.(364-366)ATG>ATT	p.M122I	CCDC122_uc010tfn.1_Missense_Mutation_p.M122I	NM_144974	NP_659411	Q5T0U0	CC122_HUMAN	coiled-coil domain containing 122	122											0		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)		TATATTTTATCATGTGTTCCT	0.318													81	34	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58208864	58208864	+	Silent	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58208864C>G	uc001vhq.1	+	1	3076	c.2184C>G	c.(2182-2184)GTC>GTG	p.V728V	PCDH17_uc010aec.1_Silent_p.V728V	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	728	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CCATCGCCGTCAAGTGCAAGC	0.587													42	25	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42357009	42357009	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42357009C>T	uc001wvm.2	+	3	2379	c.1181C>T	c.(1180-1182)TCT>TTT	p.S394F	LRFN5_uc010ana.2_Missense_Mutation_p.S394F	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	394	Extracellular (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GATCCTGGTTCTTCAGATATC	0.383										HNSCC(30;0.082)			43	26	---	---	---	---	PASS
GALNTL1	57452	broad.mit.edu	37	14	69787482	69787482	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69787482C>G	uc010aqu.1	+	2	325	c.232C>G	c.(232-234)CAG>GAG	p.Q78E	GALNTL1_uc001xla.1_Missense_Mutation_p.Q78E|GALNTL1_uc001xlb.1_Missense_Mutation_p.Q78E	NM_020692	NP_065743	Q8N428	GLTL1_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	78	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)		GTCGGCCAAGCAGCTGAAGGC	0.597													50	28	---	---	---	---	PASS
PCNX	22990	broad.mit.edu	37	14	71444635	71444635	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71444635C>T	uc001xmo.2	+	6	2027	c.1581C>T	c.(1579-1581)TCC>TCT	p.S527S	PCNX_uc001xmn.3_Silent_p.S527S|PCNX_uc010are.1_Silent_p.S527S	NM_014982	NP_055797	Q96RV3	PCX1_HUMAN	pecanex-like 1	527						integral to membrane				ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		CTGTGGATTCCAAAGTGCGTA	0.463													9	142	---	---	---	---	PASS
ISM2	145501	broad.mit.edu	37	14	77948969	77948969	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77948969C>T	uc001xtz.2	-	4	743	c.669G>A	c.(667-669)TCG>TCA	p.S223S	ISM2_uc001xua.2_Intron|ISM2_uc001xty.2_Silent_p.S135S|ISM2_uc010tvl.1_Silent_p.S142S	NM_199296	NP_954993	Q6H9L7	ISM2_HUMAN	isthmin 2 homolog isoform 1	223						extracellular region				skin(1)	1						ACAGGTCTATCGACACCTCGG	0.622													44	143	---	---	---	---	PASS
ATG2B	55102	broad.mit.edu	37	14	96779474	96779474	+	Missense_Mutation	SNP	C	A	A	rs149230704	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96779474C>A	uc001yfi.2	-	25	4135	c.3770G>T	c.(3769-3771)CGA>CTA	p.R1257L		NM_018036	NP_060506	Q96BY7	ATG2B_HUMAN	ATG2 autophagy related 2 homolog B	1257										ovary(1)|kidney(1)|skin(1)	3		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AAGAAGAGATCGGATTGGCAA	0.348													4	112	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28211971	28211971	+	Intron	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28211971G>T	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TCCAGGCCCTGGAAATAAACA	0.323									Oculocutaneous_Albinism				8	18	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31329971	31329971	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31329971G>T	uc001zfm.2	-	19	2576	c.2448C>A	c.(2446-2448)ATC>ATA	p.I816I	TRPM1_uc010azy.2_Silent_p.I723I|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	816	Extracellular (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		TCTTTGTTCCGATGGGAATAC	0.438													44	69	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35166938	35166938	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35166938C>T	uc001ziv.2	-	29	3546	c.3365G>A	c.(3364-3366)CGC>CAC	p.R1122H		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	1122						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GCGAACAAAGCGAGTGAAGAG	0.433													5	146	---	---	---	---	PASS
VPS39	23339	broad.mit.edu	37	15	42453875	42453875	+	Intron	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42453875C>A	uc001zpd.2	-						VPS39_uc001zpc.2_Intron|VPS39_uc001zpb.2_Intron	NM_015289	NP_056104	Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39						protein transport	HOPS complex|late endosome membrane|lysosomal membrane	small GTPase regulator activity			ovary(1)|pancreas(1)|skin(1)	3		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		GTGAAGGAGGCTCACCTGTTC	0.522													90	220	---	---	---	---	PASS
CKMT1A	548596	broad.mit.edu	37	15	43991166	43991166	+	Intron	SNP	T	C	C	rs2467431		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43991166T>C	uc001zsn.2	+						CKMT1A_uc010uea.1_Intron|CKMT1A_uc001zso.3_Intron	NM_001015001	NP_001015001	P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1A precursor						creatine metabolic process	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	ATTAGTGTCCTTCAGGTGGAG	0.478													56	212	---	---	---	---	PASS
CKMT1A	548596	broad.mit.edu	37	15	43991168	43991168	+	Intron	SNP	C	T	T	rs2467432		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43991168C>T	uc001zsn.2	+						CKMT1A_uc010uea.1_Intron|CKMT1A_uc001zso.3_Intron	NM_001015001	NP_001015001	P12532	KCRU_HUMAN	creatine kinase, mitochondrial 1A precursor						creatine metabolic process	mitochondrial inner membrane	ATP binding|creatine kinase activity				0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)	Creatine(DB00148)	TAGTGTCCTTCAGGTGGAGCT	0.483													54	217	---	---	---	---	PASS
C15orf21	283651	broad.mit.edu	37	15	45848168	45848168	+	RNA	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45848168G>C	uc010beg.1	+	6		c.1163G>C			C15orf21_uc010beh.1_RNA|C15orf21_uc010bei.1_RNA|C15orf21_uc010bej.1_RNA|C15orf21_uc001zvm.1_RNA|C15orf21_uc001zvn.1_RNA					Homo sapiens cDNA FLJ39426 fis, clone PROST2000505.												0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;3.03e-17)|GBM - Glioblastoma multiforme(94;7.36e-07)		TACTTCTGGTGACTGTACAGT	0.323			T	ETV1	prostate								26	58	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50212548	50212548	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50212548C>A	uc001zxu.2	-	18	1960	c.1818G>T	c.(1816-1818)AAG>AAT	p.K606N	ATP8B4_uc010ber.2_Missense_Mutation_p.K479N|ATP8B4_uc010ufd.1_Missense_Mutation_p.K416N|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	606	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CTTTAAAGTACTTGTCATCCA	0.448													38	75	---	---	---	---	PASS
HDC	3067	broad.mit.edu	37	15	50549709	50549709	+	Silent	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50549709G>A	uc001zxz.2	-	4	460	c.354C>T	c.(352-354)AAC>AAT	p.N118N	HDC_uc010uff.1_Silent_p.N118N|HDC_uc010bet.1_Intron|HDC_uc010beu.1_Silent_p.N118N	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	118				N -> M (in Ref. 3; no nucleotide entry).	catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	AGTCCATGACGTTCATCTCCA	0.597													45	81	---	---	---	---	PASS
MYO5A	4644	broad.mit.edu	37	15	52718104	52718104	+	Silent	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52718104T>A	uc002aby.2	-	4	622	c.378A>T	c.(376-378)GCA>GCT	p.A126A	MYO5A_uc002abx.3_Silent_p.A126A|MYO5A_uc010uge.1_5'UTR	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1	126	Myosin head-like.				actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GACCACTGTATGCATTAATAA	0.398													38	82	---	---	---	---	PASS
PPIB	5479	broad.mit.edu	37	15	64449012	64449012	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64449012G>C	uc002and.2	-	4	609	c.440C>G	c.(439-441)ACC>AGC	p.T147S	SNX22_uc002anc.1_3'UTR	NM_000942	NP_000933	P23284	PPIB_HUMAN	peptidylprolyl isomerase B precursor	147	PPIase cyclophilin-type.				protein folding	endoplasmic reticulum lumen|melanosome	peptide binding|peptidyl-prolyl cis-trans isomerase activity|unfolded protein binding				0					L-Proline(DB00172)	GGAGCCGTTGGTGTCTTTGCC	0.547													5	140	---	---	---	---	PASS
TLE3	7090	broad.mit.edu	37	15	70351006	70351006	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70351006C>G	uc002asm.2	-	11	2033	c.914G>C	c.(913-915)GGT>GCT	p.G305A	TLE3_uc002ask.2_Missense_Mutation_p.G249A|TLE3_uc002asl.2_Missense_Mutation_p.G310A|TLE3_uc010ukd.1_Missense_Mutation_p.G298A|TLE3_uc010bik.1_Intron|TLE3_uc010bil.1_Missense_Mutation_p.G305A|TLE3_uc002asn.2_Missense_Mutation_p.G305A|TLE3_uc002asp.2_Missense_Mutation_p.G305A|TLE3_uc002aso.2_Missense_Mutation_p.G305A	NM_005078	NP_005069	Q04726	TLE3_HUMAN	transducin-like enhancer protein 3 isoform a	305	Pro/Ser-rich.				organ morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|protein binding			lung(2)	2						ACATACATGACCAAGGTCTTT	0.498													3	7	---	---	---	---	PASS
IQGAP1	8826	broad.mit.edu	37	15	90996157	90996157	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90996157G>A	uc002bpl.1	+	12	1414	c.1313G>A	c.(1312-1314)CGA>CAA	p.R438Q		NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	438					energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			ACCCTGCAGCGACAAAGTCCT	0.502													3	47	---	---	---	---	PASS
ZNF200	7752	broad.mit.edu	37	16	3274470	3274470	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3274470G>A	uc002cuj.2	-	5	1242	c.610C>T	c.(610-612)CGA>TGA	p.R204*	ZNF200_uc002cum.3_Nonsense_Mutation_p.R203*|ZNF200_uc010bti.2_Nonsense_Mutation_p.R203*|ZNF200_uc002cuk.2_Nonsense_Mutation_p.R204*|ZNF200_uc002cui.2_Nonsense_Mutation_p.R203*|ZNF200_uc002cul.3_Nonsense_Mutation_p.R203*	NM_003454	NP_003445	P98182	ZN200_HUMAN	zinc finger protein 200 isoform 1	204					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						GTATTTAGTCGTTCCTTTTCC	0.368													72	107	---	---	---	---	PASS
SYT17	51760	broad.mit.edu	37	16	19236095	19236095	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19236095A>G	uc002dfw.2	+	7	1494	c.1163A>G	c.(1162-1164)TAC>TGC	p.Y388C	SYT17_uc002dfx.2_Missense_Mutation_p.Y327C|SYT17_uc002dfy.2_Missense_Mutation_p.Y384C|SYT17_uc002dfv.1_Missense_Mutation_p.Y327C	NM_016524	NP_057608	Q9BSW7	SYT17_HUMAN	B/K protein	388	C2 2.					membrane|synaptic vesicle	transporter activity			ovary(1)	1						GATCCTTTCTACAATGAATCC	0.433													74	100	---	---	---	---	PASS
RPGRIP1L	23322	broad.mit.edu	37	16	53636053	53636053	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53636053T>C	uc002ehp.2	-	27	3947	c.3883A>G	c.(3883-3885)ACA>GCA	p.T1295A	RPGRIP1L_uc002eho.3_Missense_Mutation_p.T1215A|RPGRIP1L_uc010vgy.1_Missense_Mutation_p.T1249A|RPGRIP1L_uc010cbx.2_Missense_Mutation_p.T1261A	NM_015272	NP_056087	Q68CZ1	FTM_HUMAN	RPGRIP1-like isoform a	1295					negative regulation of G-protein coupled receptor protein signaling pathway	cell-cell junction|centrosome|cilium axoneme|microtubule basal body	thromboxane A2 receptor binding			ovary(1)	1		all_cancers(37;0.0973)				GCTTCGACTGTTACCCTGAGC	0.453													41	76	---	---	---	---	PASS
CMTM2	146225	broad.mit.edu	37	16	66620911	66620911	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66620911C>T	uc002ept.2	+	3	616	c.456C>T	c.(454-456)AAC>AAT	p.N152N	CMTM2_uc010cdu.2_Silent_p.N99N	NM_144673	NP_653274	Q8TAZ6	CKLF2_HUMAN	chemokine-like factor superfamily 2	152	MARVEL.|Helical; (Potential).				chemotaxis	extracellular space|integral to membrane	cytokine activity			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		ACCTCTTCAACGACCTGATTG	0.527													51	74	---	---	---	---	PASS
PDP2	57546	broad.mit.edu	37	16	66918558	66918558	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66918558G>C	uc002eqk.1	+	2	533	c.371G>C	c.(370-372)CGA>CCA	p.R124P		NM_020786	NP_065837	Q9P2J9	PDP2_HUMAN	pyruvate dehydrogenase phosphatase isoenzyme 2	124					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity|metal ion binding			ovary(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.088)|Epithelial(162;0.204)		GAGGACCGGCGAGGTGTAGCC	0.537													20	57	---	---	---	---	PASS
NOB1	28987	broad.mit.edu	37	16	69782814	69782814	+	Intron	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69782814T>A	uc002exs.2	-							NM_014062	NP_054781	Q9ULX3	NOB1_HUMAN	nin one binding protein							nucleus	metal ion binding|protein binding				0						AGGCCCACCCTACCCACCTGC	0.602													6	16	---	---	---	---	PASS
KCNG4	93107	broad.mit.edu	37	16	84271000	84271000	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84271000A>G	uc010voc.1	-	2	213	c.92T>C	c.(91-93)ATG>ACG	p.M31T	KCNG4_uc002fhu.1_Missense_Mutation_p.M31T	NM_172347	NP_758857	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G,	31	Cytoplasmic (Potential).					voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(3)	3						CGGCGTCTCCATGGGGCTGGA	0.612													36	60	---	---	---	---	PASS
ABR	29	broad.mit.edu	37	17	910478	910478	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:910478C>A	uc002fsd.2	-	22	2527	c.2417G>T	c.(2416-2418)AGA>ATA	p.R806I	ABR_uc002fse.2_Missense_Mutation_p.R760I|ABR_uc010vqf.1_Missense_Mutation_p.R257I|ABR_uc010vqg.1_Missense_Mutation_p.R588I|ABR_uc002fsg.2_Missense_Mutation_p.R769I|ABR_uc002fsf.2_Missense_Mutation_p.R343I	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related	806	Rho-GAP.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		TTCTGAGGGTCTCAGTAACGT	0.582													4	94	---	---	---	---	PASS
NLRP1	22861	broad.mit.edu	37	17	5433898	5433898	+	Silent	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5433898T>C	uc002gci.2	-	12	3978	c.3423A>G	c.(3421-3423)CCA>CCG	p.P1141P	NLRP1_uc002gcg.1_Silent_p.P1145P|NLRP1_uc002gck.2_Silent_p.P1141P|NLRP1_uc002gcj.2_Silent_p.P1111P|NLRP1_uc002gcl.2_Silent_p.P1111P|NLRP1_uc002gch.3_Silent_p.P1141P|NLRP1_uc010clh.2_Silent_p.P1141P	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	1141					defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				AGCTGTGCTGTGGGTTGATCT	0.572													33	76	---	---	---	---	PASS
ZBTB4	57659	broad.mit.edu	37	17	7367112	7367112	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7367112T>A	uc002ghc.3	-	4	1439	c.1189A>T	c.(1189-1191)AGT>TGT	p.S397C	ZBTB4_uc002ghd.3_Missense_Mutation_p.S397C	NM_001128833	NP_001122305	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	397					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		GTCTTCTCACTGGCAAGGAGG	0.567													143	57	---	---	---	---	PASS
ZBTB4	57659	broad.mit.edu	37	17	7367123	7367123	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7367123C>A	uc002ghc.3	-	4	1428	c.1178G>T	c.(1177-1179)GGC>GTC	p.G393V	ZBTB4_uc002ghd.3_Missense_Mutation_p.G393V	NM_001128833	NP_001122305	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	393					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		GGCAAGGAGGCCCGGGCTAAT	0.582													142	55	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	A	A	rs121913343		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577121G>A	uc002gim.2	-	8	1011	c.817C>T	c.(817-819)CGT>TGT	p.R273C	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141C|TP53_uc010cng.1_Missense_Mutation_p.R141C|TP53_uc002gii.1_Missense_Mutation_p.R141C|TP53_uc010cnh.1_Missense_Mutation_p.R273C|TP53_uc010cni.1_Missense_Mutation_p.R273C|TP53_uc002gij.2_Missense_Mutation_p.R273C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R273H(467)|p.R273C(396)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCACAAACACGCACCTCAAAG	0.542	R273C(SH10TC_STOMACH)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(RH30_SOFT_TISSUE)|R273C(PANC0213_PANCREAS)|R273C(SJRH30_SOFT_TISSUE)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(TT2609C02_THYROID)|R273C(MFE319_ENDOMETRIUM)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(NCIH1048_LUNG)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			45	16	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7667312	7667312	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7667312C>T	uc002giu.1	+	18	3156	c.3142C>T	c.(3142-3144)CTG>TTG	p.L1048L		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1048	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGGGCGCCTCCTGGAGCTGCA	0.627													36	61	---	---	---	---	PASS
GAS7	8522	broad.mit.edu	37	17	9923208	9923208	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9923208C>T	uc002gmg.1	-	2	351	c.190G>A	c.(190-192)GGA>AGA	p.G64R	GAS7_uc010vvd.1_Missense_Mutation_p.G16R|GAS7_uc002gmi.2_5'UTR|GAS7_uc002gmj.1_Missense_Mutation_p.G4R|GAS7_uc010coh.1_Missense_Mutation_p.G4R	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c	64					cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						GGGACCATTCCAGGCTTCTGT	0.527			T	MLL	AML*								39	59	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10406242	10406242	+	Intron	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10406242G>C	uc002gmo.2	-						uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult							muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						CTACAAAGGTGAAGAAAGCAG	0.463													194	255	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10441034	10441034	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10441034G>T	uc010coi.2	-	15	1663	c.1535C>A	c.(1534-1536)ACG>AAG	p.T512K	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.T512K|MYH2_uc010coj.2_Missense_Mutation_p.T512K	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	512	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						GTCGATGAACGTCCACTCGAT	0.473													86	177	---	---	---	---	PASS
COPS3	8533	broad.mit.edu	37	17	17168116	17168116	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17168116C>A	uc002grd.2	-	6	712	c.621G>T	c.(619-621)CAG>CAT	p.Q207H	COPS3_uc010vwv.1_Missense_Mutation_p.Q187H|COPS3_uc010vww.1_Missense_Mutation_p.Q77H	NM_003653	NP_003644	Q9UNS2	CSN3_HUMAN	COP9 constitutive photomorphogenic homolog	207	PCI.				cullin deneddylation|response to light stimulus|signal transduction	cytoplasm|signalosome	protein binding			skin(1)	1						GAGAGATTACCTGTTCATAAA	0.403													4	133	---	---	---	---	PASS
KCNJ12	3768	broad.mit.edu	37	17	21318885	21318885	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21318885C>G	uc002gyv.1	+	3	936	c.231C>G	c.(229-231)GAC>GAG	p.D77E		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	77	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	CCTGTGTGGACATCCGCTGGC	0.572										Prostate(3;0.18)			3	69	---	---	---	---	PASS
KCNJ12	3768	broad.mit.edu	37	17	21319631	21319631	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21319631G>T	uc002gyv.1	+	3	1682	c.977G>T	c.(976-978)CGC>CTC	p.R326L		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	326	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	TGGGGTCACCGCTTTGAGCCC	0.587										Prostate(3;0.18)			23	212	---	---	---	---	PASS
MYO18A	399687	broad.mit.edu	37	17	27447713	27447713	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27447713T>C	uc002hdt.1	-	7	1807	c.1649A>G	c.(1648-1650)AAT>AGT	p.N550S	MYO18A_uc010wbc.1_Missense_Mutation_p.N92S|MYO18A_uc002hds.2_Missense_Mutation_p.N92S|MYO18A_uc010csa.1_Missense_Mutation_p.N550S|MYO18A_uc002hdu.1_Missense_Mutation_p.N550S|MYO18A_uc010wbd.1_Missense_Mutation_p.N219S	NM_078471	NP_510880	Q92614	MY18A_HUMAN	myosin 18A isoform a	550	Myosin head-like.				anti-apoptosis|DNA metabolic process	ER-Golgi intermediate compartment|myosin complex	ATP binding|DNA binding|DNA-dependent ATPase activity|identical protein binding|motor activity				0			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GGCATTGCCATTAATGATGGT	0.577													6	85	---	---	---	---	PASS
SSH2	85464	broad.mit.edu	37	17	27958425	27958425	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27958425T>C	uc002heo.1	-	15	3706	c.3706A>G	c.(3706-3708)AAA>GAA	p.K1236E	SSH2_uc010wbh.1_Missense_Mutation_p.K1263E	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	1236					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						TCGATTTCTTTAGCACGCTCC	0.517													43	79	---	---	---	---	PASS
SLFN11	91607	broad.mit.edu	37	17	33679610	33679610	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33679610T>A	uc010ctp.2	-	7	2913	c.2471A>T	c.(2470-2472)TAT>TTT	p.Y824F	SLFN11_uc010ctq.2_Missense_Mutation_p.Y824F|SLFN11_uc002hjh.3_Missense_Mutation_p.Y824F|SLFN11_uc002hjg.3_Missense_Mutation_p.Y824F|SLFN11_uc010ctr.2_Missense_Mutation_p.Y824F	NM_001104588	NP_001098058	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	824						nucleus	ATP binding			large_intestine(1)|ovary(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CAAGAGCTCATACTTATAGTG	0.483													39	79	---	---	---	---	PASS
GAS2L2	246176	broad.mit.edu	37	17	34079872	34079872	+	5'UTR	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34079872C>T	uc002hjv.1	-	1						NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2						cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TGGGACATGGCTGGACCCCAG	0.657													3	54	---	---	---	---	PASS
GPATCH8	23131	broad.mit.edu	37	17	42478442	42478442	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42478442C>A	uc002igw.1	-	8	1067	c.1003G>T	c.(1003-1005)GAT>TAT	p.D335Y	GPATCH8_uc002igv.1_Missense_Mutation_p.D257Y|GPATCH8_uc010wiz.1_Missense_Mutation_p.D257Y	NM_001002909	NP_001002909	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	335						intracellular	nucleic acid binding|zinc ion binding			ovary(2)|kidney(1)|skin(1)	4		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		CTCTTCTCATCGGGTTTTGTT	0.458											OREG0024461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	100	155	---	---	---	---	PASS
FZD2	2535	broad.mit.edu	37	17	42635963	42635963	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42635963C>T	uc002igx.1	+	1	1039	c.907C>T	c.(907-909)CGC>TGC	p.R303C		NM_001466	NP_001457	Q14332	FZD2_HUMAN	frizzled 2 precursor	303	Extracellular (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|epithelial cell differentiation|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|positive regulation of cGMP metabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)	3		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GCTCCAGGAGCGCGTGGTGTG	0.607													25	47	---	---	---	---	PASS
CLTC	1213	broad.mit.edu	37	17	57724840	57724840	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57724840G>T	uc002ixq.1	+	3	775	c.332G>T	c.(331-333)TGG>TTG	p.W111L	CLTC_uc002ixp.2_Missense_Mutation_p.W111L|CLTC_uc002ixr.1_Missense_Mutation_p.W115L	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	111	Globular terminal domain.				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GTCACCTTTTGGAAATGGATC	0.368			T	ALK|TFE3	ALCL|renal 								4	187	---	---	---	---	PASS
NACA2	342538	broad.mit.edu	37	17	59668102	59668102	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59668102C>G	uc002izj.2	-	1	466	c.440G>C	c.(439-441)GGT>GCT	p.G147A		NM_199290	NP_954984	Q9H009	NACA2_HUMAN	nascent-polypeptide-associated complex alpha	147					protein transport	cytoplasm|nucleus				ovary(1)	1	all_epithelial(1;3.12e-14)					GACAGCTTCACCTTGAACTCT	0.453													142	224	---	---	---	---	PASS
CCDC57	284001	broad.mit.edu	37	17	80059581	80059581	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80059581G>C	uc002kdx.1	-	17	2762	c.2725C>G	c.(2725-2727)CGT>GGT	p.R909G		NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	910										ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			TTGTAGTTACGGATCTTGGGG	0.602													70	152	---	---	---	---	PASS
MIB1	57534	broad.mit.edu	37	18	19433189	19433189	+	Intron	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19433189C>A	uc002ktq.2	+						MIB1_uc002ktp.2_Intron	NM_020774	NP_065825	Q86YT6	MIB1_HUMAN	mindbomb homolog 1						Notch signaling pathway	centrosome|nuclear membrane|plasma membrane	ubiquitin-protein ligase activity|zinc ion binding			ovary(4)	4			STAD - Stomach adenocarcinoma(5;0.212)			AGTAAGTAGCCTATGCAGAGT	0.328													6	137	---	---	---	---	PASS
MYO1F	4542	broad.mit.edu	37	19	8601932	8601932	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8601932G>T	uc002mkg.2	-	17	1814	c.1700C>A	c.(1699-1701)GCC>GAC	p.A567D		NM_012335	NP_036467	O00160	MYO1F_HUMAN	myosin IF	567	Myosin head-like.					unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3						caggtcgttggcttgtttctg	0.244													16	6	---	---	---	---	PASS
OLFM2	93145	broad.mit.edu	37	19	9968059	9968059	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9968059T>A	uc002mmp.2	-	4	488	c.460A>T	c.(460-462)AGG>TGG	p.R154W	OLFM2_uc002mmo.2_Missense_Mutation_p.R76W	NM_058164	NP_477512	O95897	NOE2_HUMAN	olfactomedin 2 precursor	154	Potential.					extracellular region				large_intestine(1)|skin(1)	2						GAGAGATTCCTCACCTCCTCC	0.627													49	18	---	---	---	---	PASS
ZNF490	57474	broad.mit.edu	37	19	12691342	12691342	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12691342G>A	uc002mtz.2	-	5	1676	c.1547C>T	c.(1546-1548)TCT>TTT	p.S516F		NM_020714	NP_065765	Q9ULM2	ZN490_HUMAN	zinc finger protein 490	516	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CACGTGCAAAGACTTTGAGTA	0.388													124	54	---	---	---	---	PASS
SLC1A6	6511	broad.mit.edu	37	19	15061013	15061013	+	Silent	SNP	A	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15061013A>T	uc002naa.1	-	9	1697	c.1689T>A	c.(1687-1689)GCT>GCA	p.A563A	SLC1A6_uc010dzu.1_Silent_p.A485A|SLC1A6_uc010xod.1_Silent_p.A499A	NM_005071	NP_005062	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity	563					synaptic transmission	integral to plasma membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|L-aspartate transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(3)|ovary(2)|skin(1)	6					L-Glutamic Acid(DB00142)	CCCCTCACATAGCACTCTCGT	0.647													19	9	---	---	---	---	PASS
EIF3K	27335	broad.mit.edu	37	19	39114783	39114783	+	Silent	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39114783C>T	uc002oiz.1	+	3	412	c.225C>T	c.(223-225)ACC>ACT	p.T75T	EIF3K_uc010xuh.1_Silent_p.T75T|EIF3K_uc010xui.1_5'UTR	NM_013234	NP_037366	Q9UBQ5	EIF3K_HUMAN	eukaryotic translation initiation factor 3,	75					regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex|nucleus	protein binding|ribosome binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGGCCCTCACCAACTTGCCGC	0.577													58	63	---	---	---	---	PASS
LIG1	3978	broad.mit.edu	37	19	48643270	48643270	+	Missense_Mutation	SNP	C	G	G	rs3730947	byFrequency	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48643270C>G	uc002pia.1	-	12	1165	c.1045G>C	c.(1045-1047)GTG>CTG	p.V349L	LIG1_uc010xze.1_Missense_Mutation_p.V42L|LIG1_uc002phz.1_RNA|LIG1_uc002pib.1_RNA|LIG1_uc010xzf.1_Missense_Mutation_p.V281L|LIG1_uc010xzg.1_Missense_Mutation_p.V318L|LIG1_uc010xzh.1_RNA	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I	349					anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	CCATCACCCACGCCAAGCTCC	0.642								NER					57	132	---	---	---	---	PASS
KLK6	5653	broad.mit.edu	37	19	51471320	51471320	+	Splice_Site	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51471320C>A	uc002pui.2	-	3	300	c.40_splice	c.e3+1	p.A14_splice	KLK6_uc010eoj.2_Intron|KLK6_uc002puh.2_Intron|KLK6_uc002puj.2_Intron|KLK6_uc010ycn.1_Splice_Site|KLK6_uc002pul.2_Splice_Site_p.A14_splice|KLK6_uc002pum.2_Splice_Site	NM_001012964	NP_001012982	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6 isoform A						amyloid precursor protein metabolic process|central nervous system development|collagen catabolic process|hormone metabolic process|myelination|positive regulation of G-protein coupled receptor protein signaling pathway|protein autoprocessing|proteolysis|regulation of cell differentiation|tissue regeneration	endoplasmic reticulum|extracellular region|microsome|mitochondrion|nucleolus	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		CCTTTCCCCACCTGCAGCAAT	0.423													37	90	---	---	---	---	PASS
ZNF528	84436	broad.mit.edu	37	19	52919741	52919741	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52919741G>T	uc002pzh.2	+	7	2062	c.1636G>T	c.(1636-1638)GAG>TAG	p.E546*	ZNF528_uc002pzi.2_Nonsense_Mutation_p.E313*	NM_032423	NP_115799	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	546					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		TCATACTGGAGAGAGGCCTTA	0.388													32	60	---	---	---	---	PASS
ZNF761	388561	broad.mit.edu	37	19	53959562	53959562	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53959562A>G	uc010eqp.2	+	7	2259	c.1801A>G	c.(1801-1803)ACT>GCT	p.T601A	ZNF761_uc010ydy.1_Missense_Mutation_p.T547A|ZNF761_uc002qbt.1_Missense_Mutation_p.T547A	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761	601					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		GAAAATTCATACTGAAGAGAA	0.403													76	90	---	---	---	---	PASS
ZSCAN5B	342933	broad.mit.edu	37	19	56701255	56701255	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56701255G>T	uc010ygh.1	-	4	1429	c.1429C>A	c.(1429-1431)CGT>AGT	p.R477S		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	477	C2H2-type 5.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						CCCAGCTGACGGAAGGCCTTT	0.557													30	47	---	---	---	---	PASS
CDC25B	994	broad.mit.edu	37	20	3778334	3778334	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3778334C>A	uc002wjn.2	+	2	1044	c.266C>A	c.(265-267)TCC>TAC	p.S89Y	CDC25B_uc010zqk.1_Missense_Mutation_p.S25Y|CDC25B_uc010zql.1_Missense_Mutation_p.S11Y|CDC25B_uc010zqm.1_Missense_Mutation_p.S25Y|CDC25B_uc002wjl.2_5'UTR|CDC25B_uc002wjm.2_5'UTR|CDC25B_uc002wjo.2_Missense_Mutation_p.S75Y|CDC25B_uc002wjp.2_Missense_Mutation_p.S89Y|CDC25B_uc002wjq.2_5'Flank	NM_021873	NP_068659	P30305	MPIP2_HUMAN	cell division cycle 25B isoform 1	89					cell division|G2/M transition of mitotic cell cycle|mitosis|positive regulation of cell proliferation	cytosol|microtubule organizing center|nucleoplasm	protein binding|protein tyrosine phosphatase activity			lung(3)|ovary(2)	5						ACGCACCTATCCCTGTCTCGA	0.617													23	106	---	---	---	---	PASS
PLCB1	23236	broad.mit.edu	37	20	8769379	8769379	+	Intron	SNP	A	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8769379A>T	uc002wnb.2	+						PLCB1_uc002wna.2_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						AGTAAGTCAAAAGTGTCCCCT	0.373													6	13	---	---	---	---	PASS
PAX1	5075	broad.mit.edu	37	20	21689252	21689252	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21689252G>A	uc002wsj.2	+	3	1027	c.973G>A	c.(973-975)GGC>AGC	p.G325S	PAX1_uc010zsl.1_Missense_Mutation_p.G325S|PAX1_uc010zsm.1_Missense_Mutation_p.G301S	NM_006192	NP_006183	P15863	PAX1_HUMAN	paired box 1	325					regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding			upper_aerodigestive_tract(1)|kidney(1)	2						AGACTGGGCCGGCGTGAACCG	0.597													47	65	---	---	---	---	PASS
RBL1	5933	broad.mit.edu	37	20	35684596	35684596	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35684596C>T	uc002xgi.2	-	10	1395	c.1316G>A	c.(1315-1317)TGT>TAT	p.C439Y	RBL1_uc010zvt.1_RNA|RBL1_uc002xgj.1_Missense_Mutation_p.C439Y|RBL1_uc010gfv.1_RNA	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a	439	Domain A.|Pocket; binds T and E1A.				cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				ATAGTGTTGACAGAAAGTCTC	0.363													15	62	---	---	---	---	PASS
DHX35	60625	broad.mit.edu	37	20	37620141	37620141	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37620141G>T	uc002xjh.2	+	6	506	c.495G>T	c.(493-495)CCG>CCT	p.P165P	DHX35_uc010zwa.1_Silent_p.P10P|DHX35_uc010zwb.1_Silent_p.P10P|DHX35_uc010zwc.1_Silent_p.P134P	NM_021931	NP_068750	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	165	Helicase ATP-binding.					catalytic step 2 spliceosome	ATP binding|ATP-dependent helicase activity|nucleic acid binding			lung(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				TGGTTGATCCGTTGTTAACAA	0.353													28	67	---	---	---	---	PASS
RIMS4	140730	broad.mit.edu	37	20	43386757	43386757	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43386757G>T	uc002xms.2	-	3	305	c.305C>A	c.(304-306)CCG>CAG	p.P102Q	RIMS4_uc010ggu.2_Missense_Mutation_p.P103Q	NM_182970	NP_892015	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4	102					exocytosis|neurotransmitter transport	cell junction|synapse				ovary(4)|central_nervous_system(1)	5		Myeloproliferative disorder(115;0.0122)				AAACTGTGCCGGCCCCATGCT	0.582													25	67	---	---	---	---	PASS
EYA2	2139	broad.mit.edu	37	20	45801445	45801445	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45801445G>T	uc002xsm.2	+	12	1502	c.1128G>T	c.(1126-1128)TGG>TGT	p.W376C	EYA2_uc010ghp.2_Missense_Mutation_p.W376C|EYA2_uc002xsn.2_Missense_Mutation_p.W381C|EYA2_uc002xso.2_Missense_Mutation_p.W376C|EYA2_uc002xsp.2_Missense_Mutation_p.W376C|EYA2_uc002xsq.2_Missense_Mutation_p.W346C	NM_005244	NP_005235	O00167	EYA2_HUMAN	eyes absent 2 isoform a	376					DNA repair|histone dephosphorylation|mesodermal cell fate specification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	magnesium ion binding|protein binding|protein tyrosine phosphatase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0241)				GCGTGGACTGGATGAGGAAGC	0.612													41	48	---	---	---	---	PASS
KRTAP13-4	284827	broad.mit.edu	37	21	31802908	31802908	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31802908G>T	uc011acw.1	+	1	315	c.315G>T	c.(313-315)CTG>CTT	p.L105L		NM_181600	NP_853631	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	105						intermediate filament					0						GCTACTCGCTGGGAAATGGAT	0.527													22	31	---	---	---	---	PASS
SYNJ1	8867	broad.mit.edu	37	21	34025600	34025600	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34025600C>G	uc002yqh.2	-	22	2989	c.2989G>C	c.(2989-2991)GAG>CAG	p.E997Q	SYNJ1_uc011ads.1_Missense_Mutation_p.E953Q|SYNJ1_uc002yqf.2_Missense_Mutation_p.E958Q|SYNJ1_uc002yqg.2_Missense_Mutation_p.E953Q|SYNJ1_uc002yqi.2_Missense_Mutation_p.E997Q	NM_003895	NP_003886	O43426	SYNJ1_HUMAN	synaptojanin 1 isoform a	958	RRM.|Pro-rich.						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			ovary(4)|skin(1)	5						TACCTTACCTCTTTACCATTT	0.323													39	81	---	---	---	---	PASS
LSS	4047	broad.mit.edu	37	21	47627403	47627403	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47627403T>A	uc002zij.2	-	15	1485	c.1406A>T	c.(1405-1407)GAG>GTG	p.E469V	LSS_uc011afv.1_Missense_Mutation_p.E458V|LSS_uc002zil.2_Missense_Mutation_p.E469V|LSS_uc002zik.2_Missense_Mutation_p.E389V	NM_001001438	NP_001001438	P48449	ERG7_HUMAN	lanosterol synthase isoform 1	469					cholesterol biosynthetic process	endoplasmic reticulum membrane	lanosterol synthase activity				0	Breast(49;0.214)					GGGACACTTCTCCTGCAGGAG	0.612													12	16	---	---	---	---	PASS
CABIN1	23523	broad.mit.edu	37	22	24573530	24573530	+	Silent	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24573530G>A	uc002zzi.1	+	36	6391	c.6264G>A	c.(6262-6264)GAG>GAA	p.E2088E	CABIN1_uc002zzj.1_Silent_p.E2009E|CABIN1_uc002zzl.1_Silent_p.E2088E|CABIN1_uc010gul.1_Silent_p.E26E	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	2088					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CTGCGAGTGAGACTCAGCCCC	0.642													19	102	---	---	---	---	PASS
CABIN1	23523	broad.mit.edu	37	22	24574123	24574123	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24574123G>A	uc002zzi.1	+	37	6749	c.6622G>A	c.(6622-6624)GAG>AAG	p.E2208K	CABIN1_uc002zzj.1_Missense_Mutation_p.E2129K|CABIN1_uc002zzl.1_Missense_Mutation_p.E2208K|CABIN1_uc010gul.1_Missense_Mutation_p.E146K	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	2208					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						GTCCTCGCTGGAGAGCGAGAC	0.632													10	105	---	---	---	---	PASS
CABIN1	23523	broad.mit.edu	37	22	24574135	24574135	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24574135G>C	uc002zzi.1	+	37	6761	c.6634G>C	c.(6634-6636)GAC>CAC	p.D2212H	CABIN1_uc002zzj.1_Missense_Mutation_p.D2133H|CABIN1_uc002zzl.1_Missense_Mutation_p.D2212H|CABIN1_uc010gul.1_Missense_Mutation_p.D150H	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	2212					cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						GAGCGAGACAGACGAGGACGA	0.602													9	85	---	---	---	---	PASS
SUSD2	56241	broad.mit.edu	37	22	24580888	24580888	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24580888C>A	uc002zzn.1	+	5	806	c.762C>A	c.(760-762)AGC>AGA	p.S254R		NM_019601	NP_062547	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2 precursor	254	Extracellular (Potential).				immune response	integral to membrane	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						TCATCGACAGCAAAAATTACG	0.592													15	58	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42607579	42607579	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42607579G>T	uc003bcj.1	-	1	3867	c.3733C>A	c.(3733-3735)CAT>AAT	p.H1245N	TCF20_uc003bck.1_Missense_Mutation_p.H1245N|TCF20_uc003bnt.2_Missense_Mutation_p.H1245N	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1245					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						TGAGAAGAATGATCCTCCTGG	0.483													4	126	---	---	---	---	PASS
PARVG	64098	broad.mit.edu	37	22	44585083	44585083	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44585083G>A	uc011aqe.1	+	6	761	c.337G>A	c.(337-339)GTG>ATG	p.V113M	PARVG_uc003bep.2_Missense_Mutation_p.V113M|PARVG_uc011aqf.1_Missense_Mutation_p.V113M|PARVG_uc003beq.2_RNA|PARVG_uc003ber.2_RNA	NM_001137605	NP_001131077	Q9HBI0	PARVG_HUMAN	parvin, gamma	113	CH 1.				cell-matrix adhesion	cytoplasm|cytoskeleton|focal adhesion	actin binding				0		Ovarian(80;0.024)|all_neural(38;0.0299)				GCTGGAGGCCGTGAACCGGAG	0.657													22	50	---	---	---	---	PASS
SHROOM2	357	broad.mit.edu	37	X	9864198	9864198	+	Silent	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9864198C>A	uc004csu.1	+	4	2340	c.2250C>A	c.(2248-2250)GGC>GGA	p.G750G		NM_001649	NP_001640	Q13796	SHRM2_HUMAN	apical protein of Xenopus-like	750	ASD1.				apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|skin(3)|upper_aerodigestive_tract(1)|breast(1)	8		Hepatocellular(5;0.000888)				GCATCGGAGGCCGGAGACGGT	0.637													11	20	---	---	---	---	PASS
NHS	4810	broad.mit.edu	37	X	17739652	17739652	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17739652A>G	uc004cxx.2	+	4	1282	c.944A>G	c.(943-945)CAG>CGG	p.Q315R	NHS_uc011mix.1_Missense_Mutation_p.Q336R|NHS_uc004cxy.2_Missense_Mutation_p.Q159R|NHS_uc004cxz.2_Missense_Mutation_p.Q138R|NHS_uc004cya.2_Missense_Mutation_p.Q38R	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	315						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					CTGGACAAGCAGACCAACTGG	0.473													39	94	---	---	---	---	PASS
APOO	79135	broad.mit.edu	37	X	23886727	23886727	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23886727C>A	uc004dax.2	-	5	602	c.371G>T	c.(370-372)GGA>GTA	p.G124V	APOO_uc004daw.2_RNA|APOO_uc004day.3_RNA	NM_024122	NP_077027	Q9BUR5	APOO_HUMAN	apolipoprotein O precursor	124	Helical; (Potential).				lipid transport	high-density lipoprotein particle|integral to membrane|low-density lipoprotein particle|very-low-density lipoprotein particle					0						CAAAAGGAGTCCAATAAGGCC	0.299													29	54	---	---	---	---	PASS
APOO	79135	broad.mit.edu	37	X	23886748	23886748	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23886748A>C	uc004dax.2	-	5	581	c.350T>G	c.(349-351)ATT>AGT	p.I117S	APOO_uc004daw.2_RNA|APOO_uc004day.3_RNA	NM_024122	NP_077027	Q9BUR5	APOO_HUMAN	apolipoprotein O precursor	117	Helical; (Potential).				lipid transport	high-density lipoprotein particle|integral to membrane|low-density lipoprotein particle|very-low-density lipoprotein particle					0						AGCAAAACCAATAACACCAAG	0.333													30	56	---	---	---	---	PASS
KLHL15	80311	broad.mit.edu	37	X	24006149	24006149	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24006149G>T	uc004dba.3	-	4	1960	c.1704C>A	c.(1702-1704)AAC>AAA	p.N568K		NM_030624	NP_085127	Q96M94	KLH15_HUMAN	kelch-like 15	568	Kelch 5.									ovary(1)|breast(1)	2						CCTTCCACTTGTTTTCATCCG	0.458													99	127	---	---	---	---	PASS
PCYT1B	9468	broad.mit.edu	37	X	24593238	24593238	+	Intron	SNP	A	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24593238A>G	uc004dbi.2	-						PCYT1B_uc004dbk.3_Intron|PCYT1B_uc004dbj.2_Intron	NM_004845	NP_004836	Q9Y5K3	PCY1B_HUMAN	choline phosphate cytidylyltransferase 1 beta							endoplasmic reticulum	choline-phosphate cytidylyltransferase activity				0					Choline(DB00122)	AAGTGAAATCATTACATACCC	0.433													48	103	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	26179177	26179177	+	IGR	SNP	A	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26179177A>T								MAGEB18 (20325 upstream) : MAGEB6 (31380 downstream)																							AGCTTCACCCACTGGCTCGCC	0.507													36	50	---	---	---	---	PASS
DYNLT3	6990	broad.mit.edu	37	X	37699873	37699873	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37699873G>T	uc004dds.2	-	5	432	c.306C>A	c.(304-306)ACC>ACA	p.T102T		NM_006520	NP_006511	P51808	DYLT3_HUMAN	dynein, light chain, Tctex-type 3	102					cell division|mitosis|regulation of mitotic cell cycle|transport	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|nucleus|plasma membrane	motor activity				0						TACAGTTCATGGTCCGGTTCT	0.328													23	27	---	---	---	---	PASS
WAS	7454	broad.mit.edu	37	X	48549500	48549500	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48549500G>A	uc004dkm.3	+	12	1513	c.1456G>A	c.(1456-1458)GAA>AAA	p.E486K		NM_000377	NP_000368	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome protein	486	Asp/Glu-rich (acidic).				blood coagulation|defense response|epidermis development|immune response|T cell receptor signaling pathway	actin cytoskeleton|cytosol	identical protein binding|small GTPase regulator activity			ovary(1)	1		all_lung(315;1.27e-10)				CCCTCCAGACGAAGGGGAGGA	0.582			Mis|N|F|S			lymphoma			Wiskott-Aldrich_syndrome				18	61	---	---	---	---	PASS
GRIPAP1	56850	broad.mit.edu	37	X	48837632	48837632	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48837632C>T	uc004dly.1	-	21	1960	c.1925G>A	c.(1924-1926)CGC>CAC	p.R642H	GRIPAP1_uc004dlz.2_Missense_Mutation_p.R532H|GRIPAP1_uc004dma.2_Missense_Mutation_p.R563H	NM_020137	NP_064522	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1 isoform 1	642						early endosome				breast(2)|kidney(1)	3						CTCACCTGAGCGGCTCTTGCT	0.612													10	23	---	---	---	---	PASS
TFE3	7030	broad.mit.edu	37	X	48891648	48891648	+	Splice_Site	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48891648C>A	uc004dmb.3	-	6	1241	c.1003_splice	c.e6+1	p.E335_splice	TFE3_uc004dmc.3_Splice_Site_p.E230_splice|TFE3_uc004dme.1_Splice_Site	NM_006521	NP_006512	P19532	TFE3_HUMAN	transcription factor E3						humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding		ASPSCR1/TFE3(161)|PRCC/TFE3(25)|SFPQ/TFE3(6)|NONO/TFE3(2)|CLTC/TFE3(2)	soft_tissue(120)|kidney(76)|central_nervous_system(1)	197						CTATCACCTACCAGAGATCTC	0.562			T	SFPQ|ASPSCR1|PRCC|NONO|CLTC	papillary renal|alveolar soft part sarcoma|renal								16	33	---	---	---	---	PASS
TFE3	7030	broad.mit.edu	37	X	48891649	48891649	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48891649C>T	uc004dmb.3	-	6	1241	c.1003G>A	c.(1003-1005)GAG>AAG	p.E335K	TFE3_uc004dmc.3_Missense_Mutation_p.E230K|TFE3_uc004dme.1_RNA	NM_006521	NP_006512	P19532	TFE3_HUMAN	transcription factor E3	335					humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding		ASPSCR1/TFE3(161)|PRCC/TFE3(25)|SFPQ/TFE3(6)|NONO/TFE3(2)|CLTC/TFE3(2)	soft_tissue(120)|kidney(76)|central_nervous_system(1)	197						TATCACCTACCAGAGATCTCC	0.562			T	SFPQ|ASPSCR1|PRCC|NONO|CLTC	papillary renal|alveolar soft part sarcoma|renal								16	35	---	---	---	---	PASS
PLP2	5355	broad.mit.edu	37	X	49029810	49029810	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49029810C>A	uc004dmx.2	+	3	400	c.325C>A	c.(325-327)CAC>AAC	p.H109N		NM_002668	NP_002659	Q04941	PLP2_HUMAN	proteolipid protein 2 (colonic	109	MARVEL.				chemotaxis|cytokine-mediated signaling pathway	endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	chemokine binding|ion transmembrane transporter activity				0						GAGAGGAAACCACTCCAAAAT	0.532													39	64	---	---	---	---	PASS
CACNA1F	778	broad.mit.edu	37	X	49068355	49068355	+	Intron	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49068355C>T	uc004dnb.2	-						CACNA1F_uc010nip.2_Intron	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	GAGTAGATGTCACCTGAACAG	0.547													9	90	---	---	---	---	PASS
KDM5C	8242	broad.mit.edu	37	X	53250047	53250047	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53250047G>T	uc004drz.2	-	2	735	c.202C>A	c.(202-204)CGA>AGA	p.R68R	KDM5C_uc011moc.1_RNA|KDM5C_uc011mod.1_Intron|KDM5C_uc004dsa.2_Silent_p.R68R	NM_004187	NP_004178	P41229	KDM5C_HUMAN	jumonji, AT rich interactive domain 1C isoform	68					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			kidney(9)|ovary(5)|salivary_gland(1)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|oesophagus(1)	18						CTCTGGATTCGGGGGGTAAAC	0.403			N|F|S		clear cell renal carcinoma								3	65	---	---	---	---	PASS
TRO	7216	broad.mit.edu	37	X	54956998	54956998	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54956998G>T	uc004dtq.2	+	12	3948	c.3841G>T	c.(3841-3843)GGT>TGT	p.G1281C	TRO_uc004dts.2_Intron|TRO_uc004dtr.2_Intron|TRO_uc004dtt.2_Intron|TRO_uc004dtu.2_Intron|TRO_uc004dtv.2_Intron|TRO_uc011mok.1_Missense_Mutation_p.G812C|TRO_uc004dtw.2_Missense_Mutation_p.G884C|TRO_uc004dtx.2_Missense_Mutation_p.G664C	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	1281	62 X 10 AA approximate tandem repeats.|48.				embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						TGGCTTTGGTGGTGGACTGGT	0.602													41	68	---	---	---	---	PASS
FAM104B	90736	broad.mit.edu	37	X	55172681	55172681	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55172681G>T	uc004duh.1	-	3	204	c.184C>A	c.(184-186)CCA>ACA	p.P62T	FAM104B_uc004dug.1_Missense_Mutation_p.P63T|FAM104B_uc004dui.3_Missense_Mutation_p.P63T	NM_138362	NP_612371	Q5XKR9	F104B_HUMAN	hypothetical protein LOC90736	62											0						TTGCCTTCTGGTCCACTTGCT	0.443													60	105	---	---	---	---	PASS
ARHGEF9	23229	broad.mit.edu	37	X	62917068	62917068	+	Silent	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62917068C>A	uc004dvl.2	-	4	1337	c.498G>T	c.(496-498)CTG>CTT	p.L166L	ARHGEF9_uc004dvj.1_Silent_p.L55L|ARHGEF9_uc004dvk.1_Silent_p.L28L|ARHGEF9_uc011mos.1_Silent_p.L145L|ARHGEF9_uc004dvm.1_Silent_p.L145L|ARHGEF9_uc011mot.1_Silent_p.L113L|ARHGEF9_uc004dvn.2_Silent_p.L173L	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9	166	DH.				apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						ACTGTTTCTCCAGGTCTCTCA	0.468													28	38	---	---	---	---	PASS
ZC3H12B	340554	broad.mit.edu	37	X	64723017	64723017	+	Silent	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64723017G>A	uc010nko.2	+	5	2415	c.2406G>A	c.(2404-2406)GAG>GAA	p.E802E		NM_001010888	NP_001010888	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	802							endonuclease activity|nucleic acid binding|zinc ion binding			lung(1)|kidney(1)|pancreas(1)	3						CAGTGATGGAGAAGAATCCCC	0.448													19	45	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65417678	65417678	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65417678G>A	uc011moz.1	+	10	1724	c.1664G>A	c.(1663-1665)GGC>GAC	p.G555D	HEPH_uc004dwn.2_Missense_Mutation_p.G555D|HEPH_uc004dwo.2_Missense_Mutation_p.G285D|HEPH_uc010nkr.2_Intron|HEPH_uc011mpa.1_Missense_Mutation_p.G555D	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	552	Extracellular (Potential).|Plastocyanin-like 3.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						ACAAATTCTGGCCTGGTGGGC	0.577													18	29	---	---	---	---	PASS
SLC7A3	84889	broad.mit.edu	37	X	70145715	70145715	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70145715C>G	uc004dyn.2	-	12	1966	c.1808G>C	c.(1807-1809)AGA>ACA	p.R603T	SLC7A3_uc004dyo.2_Missense_Mutation_p.R603T	NM_032803	NP_116192	Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid	603	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process	integral to membrane|plasma membrane				ovary(1)|kidney(1)	2	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	AGTTTTGGCTCTAGACTTGCG	0.498													44	83	---	---	---	---	PASS
ACRC	93953	broad.mit.edu	37	X	70823555	70823555	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70823555G>A	uc004eae.2	+	8	929	c.428G>A	c.(427-429)AGT>AAT	p.S143N	BCYRN1_uc011mpt.1_Intron	NM_052957	NP_443189	Q96QF7	ACRC_HUMAN	ACRC protein	143	Asp/Ser-rich.					nucleus				ovary(3)	3	Renal(35;0.156)					GACGACAACAGTGATGATTCA	0.473													5	349	---	---	---	---	PASS
ZDHHC15	158866	broad.mit.edu	37	X	74742797	74742797	+	Silent	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74742797G>T	uc004ecg.2	-	1	541	c.63C>A	c.(61-63)TCC>TCA	p.S21S	ZDHHC15_uc004ech.2_Silent_p.S21S|ZDHHC15_uc011mqo.1_RNA|ZDHHC15_uc004eci.2_Silent_p.S21S	NM_144969	NP_659406	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15 isoform 1	21	Helical; (Potential).					integral to membrane	zinc ion binding			ovary(2)	2						CTGGCACCCAGGACAGTACCC	0.622													23	48	---	---	---	---	PASS
ZDHHC15	158866	broad.mit.edu	37	X	74742798	74742798	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74742798G>T	uc004ecg.2	-	1	540	c.62C>A	c.(61-63)TCC>TAC	p.S21Y	ZDHHC15_uc004ech.2_Missense_Mutation_p.S21Y|ZDHHC15_uc011mqo.1_RNA|ZDHHC15_uc004eci.2_Missense_Mutation_p.S21Y	NM_144969	NP_659406	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15 isoform 1	21	Helical; (Potential).					integral to membrane	zinc ion binding			ovary(2)	2						TGGCACCCAGGACAGTACCCG	0.622													22	48	---	---	---	---	PASS
TGIF2LX	90316	broad.mit.edu	37	X	89177357	89177357	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89177357T>A	uc004efe.2	+	2	322	c.273T>A	c.(271-273)AAT>AAA	p.N91K		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	91	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						AGAAGACCAATTTGTCTTTGT	0.473													19	282	---	---	---	---	PASS
TGIF2LX	90316	broad.mit.edu	37	X	89177358	89177358	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89177358T>A	uc004efe.2	+	2	323	c.274T>A	c.(274-276)TTG>ATG	p.L92M		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	92	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						GAAGACCAATTTGTCTTTGTT	0.468													18	283	---	---	---	---	PASS
TGIF2LX	90316	broad.mit.edu	37	X	89177376	89177376	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89177376T>A	uc004efe.2	+	2	341	c.292T>A	c.(292-294)TCT>ACT	p.S98T		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	98	Homeobox; TALE-type.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						GTTGCAGATTTCTAACTGGTT	0.473													111	209	---	---	---	---	PASS
RPL36A	6173	broad.mit.edu	37	X	100646732	100646732	+	Intron	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100646732C>A	uc004ehk.2	+						BTK_uc010nno.2_5'Flank|RPL36A_uc004ehj.1_Intron	NM_021029	NP_066357	P83881	RL36A_HUMAN	ribosomal protein L36a						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|ribosome	protein binding|structural constituent of ribosome				0						AATACCAATTCGTTTTCCCAG	0.413													51	112	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105153117	105153117	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105153117C>G	uc004emd.2	+	13	1787	c.1484C>G	c.(1483-1485)TCC>TGC	p.S495C	NRK_uc010npc.1_Missense_Mutation_p.S163C	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	495	Gln-rich.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CAGGTACAGTCCCAGGTATCC	0.542										HNSCC(51;0.14)			32	53	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105178435	105178435	+	Silent	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105178435C>A	uc004emd.2	+	20	3801	c.3498C>A	c.(3496-3498)ATC>ATA	p.I1166I	NRK_uc010npc.1_Silent_p.I834I	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1166							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CCAGTGCCATCTGTGAGTGTG	0.368										HNSCC(51;0.14)			4	138	---	---	---	---	PASS
CXorf57	55086	broad.mit.edu	37	X	105855305	105855305	+	5'UTR	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105855305C>A	uc004emi.3	+	1					CXorf57_uc004emj.3_5'UTR|CXorf57_uc004emh.2_5'UTR	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN	hypothetical protein LOC55086											ovary(1)|lung(1)|breast(1)	3						ACGCAGTTATCCAACAATGTC	0.587													25	65	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107402738	107402738	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107402738C>A	uc004enw.3	-	44	4872	c.4769G>T	c.(4768-4770)TGC>TTC	p.C1590F	COL4A6_uc004env.3_Missense_Mutation_p.C1589F|COL4A6_uc011msn.1_Missense_Mutation_p.C1565F|COL4A6_uc010npk.2_Missense_Mutation_p.C1532F|COL4A6_uc011msm.1_Missense_Mutation_p.C124F|COL4A6_uc010npj.2_Missense_Mutation_p.C69F	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	1590	Collagen IV NC1.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						GCCCAGGGGGCACTGCGGGAT	0.612									Alport_syndrome_with_Diffuse_Leiomyomatosis				28	65	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107431174	107431174	+	Silent	SNP	T	C	C			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107431174T>C	uc004enw.3	-	22	1777	c.1674A>G	c.(1672-1674)GGA>GGG	p.G558G	COL4A6_uc004env.3_Silent_p.G557G|COL4A6_uc011msn.1_Silent_p.G557G|COL4A6_uc010npk.2_Silent_p.G557G	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	558	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						CACCCCGATCTCCTGGCATTC	0.537									Alport_syndrome_with_Diffuse_Leiomyomatosis				77	182	---	---	---	---	PASS
ACSL4	2182	broad.mit.edu	37	X	108921307	108921307	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108921307C>A	uc004eoi.2	-	9	1468	c.963G>T	c.(961-963)TTG>TTT	p.L321F	ACSL4_uc004eoj.2_Missense_Mutation_p.L280F|ACSL4_uc004eok.2_Missense_Mutation_p.L280F|ACSL4_uc010npp.1_Missense_Mutation_p.L321F	NM_022977	NP_075266	O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	321	Cytoplasmic (Potential).				fatty acid metabolic process|learning or memory|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			large_intestine(1)|lung(1)|ovary(1)	3					Icosapent(DB00159)|Troglitazone(DB00197)	GCACATGAGCCAAAGGCAAGT	0.388													36	83	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123787591	123787591	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123787591A>T	uc004euj.2	-	7	1275	c.1211T>A	c.(1210-1212)ATT>AAT	p.I404N	ODZ1_uc011muj.1_Missense_Mutation_p.I403N|ODZ1_uc010nqy.2_Missense_Mutation_p.I404N	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	404	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						CTGTGCACCAATGTCAACTTC	0.388													69	155	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123839017	123839017	+	Silent	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123839017C>A	uc004euj.2	-	5	925	c.861G>T	c.(859-861)GTG>GTT	p.V287V	ODZ1_uc011muj.1_Silent_p.V287V|ODZ1_uc010nqy.2_Silent_p.V287V	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	287	Teneurin N-terminal.|Cytoplasmic (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						GGGGCGAGTACACGGTATTGG	0.507													67	139	---	---	---	---	PASS
GPC3	2719	broad.mit.edu	37	X	132888123	132888123	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132888123G>T	uc004exe.1	-	3	608	c.418C>A	c.(418-420)CAA>AAA	p.Q140K	GPC3_uc004exd.1_Missense_Mutation_p.Q12K|GPC3_uc010nrn.1_Missense_Mutation_p.Q140K|GPC3_uc011mvh.1_Missense_Mutation_p.Q124K|GPC3_uc010nro.1_Missense_Mutation_p.Q86K|GPC3_uc010nrp.1_Missense_Mutation_p.Q12K	NM_004484	NP_004475	P51654	GPC3_HUMAN	glypican 3 isoform 2 precursor	140						extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity			lung(2)|prostate(1)|breast(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					TCAAAAGCTTGTGGAGTCAGG	0.388			T|D|Mis|N|F|S			Wilms tumour			Simpson-Golabi-Behmel_syndrome				82	161	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135474460	135474460	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135474460C>T	uc004ezu.1	+	17	8272	c.7981C>T	c.(7981-7983)CAA>TAA	p.Q2661*	GPR112_uc010nsb.1_Nonsense_Mutation_p.Q2456*	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	2661	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					TATGTTCATTCAAAACTTAGC	0.403													49	104	---	---	---	---	PASS
F9	2158	broad.mit.edu	37	X	138630608	138630608	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138630608G>A	uc004fas.1	+	5	507	c.478G>A	c.(478-480)GGA>AGA	p.G160R	F9_uc004fat.1_Missense_Mutation_p.G122R	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein	160	EGF-like 2.		G -> E (in HEMB; mild).		blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)	CTGTACTGAGGGATATCGACT	0.358													17	104	---	---	---	---	PASS
SLITRK4	139065	broad.mit.edu	37	X	142716937	142716937	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142716937G>T	uc004fbx.2	-	2	2364	c.1988C>A	c.(1987-1989)TCC>TAC	p.S663Y	SLITRK4_uc004fby.2_Missense_Mutation_p.S663Y	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	663	Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CAGCTGCATGGAGCCACAGTC	0.458													69	185	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	X	146318424	146318424	+	IGR	SNP	C	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:146318424C>A								MIR507 (5829 upstream) : MIR508 (7 downstream)																							TACACTCACACCCATGGCCAC	0.517													4	23	---	---	---	---	PASS
FAM58A	92002	broad.mit.edu	37	X	152861517	152861517	+	Intron	SNP	C	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152861517C>T	uc010nug.2	-									Q8N1B3	FA58A_HUMAN	RecName: Full=Cyclin-related protein FAM58B;						regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent		protein kinase binding				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCACTTTGCCGGCCAAGTAA	0.527													70	189	---	---	---	---	PASS
WDR47	22911	broad.mit.edu	37	1	109560373	109560373	+	Intron	DEL	T	-	-	rs33990918		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109560373delT	uc001dwj.2	-						WDR47_uc001dwl.2_Intron|WDR47_uc001dwi.2_Intron|WDR47_uc001dwk.2_Intron|WDR47_uc010ovf.1_5'Flank	NM_001142551	NP_001136023	O94967	WDR47_HUMAN	WD repeat domain 47 isoform 3											ovary(1)	1		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		TTTTTCATAAttttttttttt	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	146582209	146582209	+	IGR	DEL	T	-	-	rs149481029		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146582209delT								LOC728989 (67610 upstream) : PRKAB2 (44478 downstream)																							AATATTAATATTGACTAATAA	0.269													3	5	---	---	---	---	
PKLR	5313	broad.mit.edu	37	1	155270541	155270541	+	Intron	DEL	C	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155270541delC	uc001fkb.3	-						RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Intron|PKLR_uc010pga.1_Intron	NM_000298	NP_000289	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC isoform 1						endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity			skin(4)|ovary(1)	5	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	TCCCTTCCAACCCCTGGCTAC	0.582													9	6	---	---	---	---	
HMCN1	83872	broad.mit.edu	37	1	186064776	186064777	+	Intron	INS	-	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186064776_186064777insT	uc001grq.1	+							NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor						response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						tttttattgcattttaattttt	0.248													11	5	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241156414	241156417	+	Intron	DEL	GGAA	-	-	rs71172668	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241156414_241156417delGGAA	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			agggagggagggaaggaaggaagg	0.083													4	2	---	---	---	---	
ATOH8	84913	broad.mit.edu	37	2	85990945	85990946	+	Intron	DEL	GT	-	-	rs111310353		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85990945_85990946delGT	uc002sqn.2	+						ATOH8_uc002sqm.3_Intron	NM_032827	NP_116216	Q96SQ7	ATOH8_HUMAN	atonal homolog 8						cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0						ATGAGCTGACgtgtgtgtgtgt	0.391													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89568253	89568253	+	Intron	DEL	G	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89568253delG	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GGTTGGGACTGACTCCTGCAC	0.572													20	27	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	193594161	193594172	+	IGR	DEL	AGGCAGGCAGGC	-	-	rs11689603		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193594161_193594172delAGGCAGGCAGGC								TMEFF2 (534517 upstream) : PCGEM1 (20399 downstream)																							gaaggaaggaaggcaggcaggcaggaaggaaa	0.175													4	4	---	---	---	---	
PECR	55825	broad.mit.edu	37	2	216939217	216939224	+	Intron	DEL	AAGGAAGG	-	-	rs72274918		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216939217_216939224delAAGGAAGG	uc002vft.2	-						PECR_uc010zjq.1_Intron|PECR_uc002vfu.1_Intron	NM_018441	NP_060911	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase						fatty acid biosynthetic process|regulation of apoptosis	peroxisome	binding|trans-2-enoyl-CoA reductase (NADPH) activity				0		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	gaaagaaaaaaaggaaggaaggaaggaa	0.082													5	3	---	---	---	---	
NT5DC2	64943	broad.mit.edu	37	3	52559168	52559169	+	Intron	DEL	GG	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52559168_52559169delGG	uc003deo.2	-						NT5DC2_uc003dem.2_Intron|NT5DC2_uc003den.2_Intron|NT5DC2_uc010hmi.2_Intron|NT5DC2_uc010hmj.2_Intron	NM_022908	NP_075059	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2 isoform 2								hydrolase activity|metal ion binding				0				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		TGCTGGGGGCGGGGGGGGGGGG	0.708													4	2	---	---	---	---	
SHQ1	55164	broad.mit.edu	37	3	72841935	72841936	+	Intron	INS	-	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72841935_72841936insA	uc003dpf.2	-						SHQ1_uc010hod.2_Intron	NM_018130	NP_060600	Q6PI26	SHQ1_HUMAN	SHQ1 homolog						ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding			ovary(2)|large_intestine(1)	3		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		acctccatctcaaaaaaaaaaa	0.139													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	110401054	110401054	+	IGR	DEL	T	-	-	rs113398685		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110401054delT								None (None upstream) : PVRL3 (389811 downstream)																							CTTTGACTTCTTTTTTTTTTT	0.408													10	5	---	---	---	---	
CCDC52	152185	broad.mit.edu	37	3	113167135	113167135	+	Intron	DEL	T	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113167135delT	uc003eag.3	-						CCDC52_uc003eaf.3_Intron	NM_144718	NP_653319	Q8N0Z3	SPICE_HUMAN	coiled-coil domain containing 52						cell division|mitosis	centriole|spindle	protein binding				0						CTTGAAAGACTTTTTTTTTTT	0.323													11	5	---	---	---	---	
XRN1	54464	broad.mit.edu	37	3	142135859	142135861	+	Intron	DEL	AAA	-	-	rs11291353		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142135859_142135861delAAA	uc003eus.2	-						XRN1_uc003eut.2_Intron|XRN1_uc003euu.2_Intron|XRN1_uc003euv.1_Intron	NM_019001	NP_061874	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1 isoform a						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|histone mRNA catabolic process|nuclear mRNA surveillance|rRNA catabolic process	cytosol|Golgi apparatus|intermediate filament cytoskeleton|plasma membrane	5'-3' exonuclease activity|DNA binding|protein binding|RNA binding			ovary(3)	3						caacagagtgaaaaaaaaaaaaa	0.103													14	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182891812	182891813	+	IGR	DEL	AC	-	-	rs113512540		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182891812_182891813delAC								LAMP3 (11145 upstream) : MCF2L2 (4018 downstream)																							TGACTGAGAAacacacacacac	0.297													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183838191	183838198	+	IGR	DEL	GGAAGGAA	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183838191_183838198delGGAAGGAA								HTR3E (13409 upstream) : EIF2B5 (14612 downstream)																							agggagtgagggaaggaaggaaggaagg	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184339351	184339352	+	IGR	INS	-	CACA	CACA	rs149921533	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184339351_184339352insCACA								EPHB3 (39156 upstream) : MAGEF1 (88804 downstream)																							agtgttttcaccacacacacac	0.000													7	5	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195494493	195494495	+	Intron	DEL	CAC	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195494493_195494495delCAC	uc011bto.1	-						MUC4_uc003fuz.2_Intron|MUC4_uc003fva.2_Intron|MUC4_uc003fvb.2_Intron|MUC4_uc003fvc.2_Intron|MUC4_uc003fvd.2_Intron|MUC4_uc003fve.2_Intron|MUC4_uc010hzr.2_Intron|MUC4_uc011btf.1_Intron|MUC4_uc011btg.1_Intron|MUC4_uc011bth.1_Intron|MUC4_uc011bti.1_Intron|MUC4_uc011btj.1_Intron|MUC4_uc011btk.1_Intron|MUC4_uc011btl.1_Intron|MUC4_uc011btm.1_Intron|MUC4_uc011btn.1_Intron|MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a						cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ccaccaccatcaccaccatcacc	0.000													10	6	---	---	---	---	
SORCS2	57537	broad.mit.edu	37	4	7726610	7726611	+	Intron	INS	-	TGA	TGA			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7726610_7726611insTGA	uc003gkb.3	+						SORCS2_uc011bwi.1_Intron	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor							integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						ggtgatggtggtggtgttggtg	0.000													4	2	---	---	---	---	
GPR125	166647	broad.mit.edu	37	4	22422868	22422868	+	Intron	DEL	A	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22422868delA	uc003gqm.1	-						GPR125_uc010ieo.1_Intron|GPR125_uc003gqn.1_Intron|GPR125_uc003gqo.2_Intron	NM_145290	NP_660333	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125 precursor						neuropeptide signaling pathway	integral to membrane	G-protein coupled receptor activity			skin(1)	1		Breast(46;0.198)				CTGGCAGAATAAAAAAAAAAA	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	76010133	76010136	+	IGR	DEL	AGGG	-	-	rs9991977		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76010133_76010136delAGGG								PARM1 (34810 upstream) : RCHY1 (394219 downstream)																							gaaggaaggaagggaggaaggaag	0.225													9	5	---	---	---	---	
SNCAIP	9627	broad.mit.edu	37	5	121787399	121787400	+	Intron	INS	-	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121787399_121787400insA	uc003ksw.1	+						SNCAIP_uc011cwl.1_Intron|SNCAIP_uc003ksx.1_Intron|SNCAIP_uc003ksy.1_Intron|SNCAIP_uc003ksz.1_Intron|SNCAIP_uc010jcu.2_Intron|uc003ktb.1_Intron|SNCAIP_uc003ktc.1_Intron	NM_005460	NP_005451	Q9Y6H5	SNCAP_HUMAN	synuclein alpha interacting protein						cell death|dopamine metabolic process|regulation of inclusion body assembly|regulation of neurotransmitter secretion	cytoplasm|neuronal cell body|nucleolus|presynaptic membrane	ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GAATCCCCAGGAAAAAAAAAAA	0.376													8	4	---	---	---	---	
NEUROG1	4762	broad.mit.edu	37	5	134871202	134871202	+	Frame_Shift_Del	DEL	T	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134871202delT	uc003lax.2	-	1	438	c.179delA	c.(178-180)GAGfs	p.E60fs		NM_006161	NP_006152	Q92886	NGN1_HUMAN	neurogenin 1	60					positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter	nucleus	chromatin binding|E-box binding|sequence-specific DNA binding transcription factor activity|transcription factor binding transcription factor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCCTGGAACCTCAGACGCCCG	0.582													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172186642	172186645	+	IGR	DEL	GGAA	-	-	rs10603015		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172186642_172186645delGGAA								NEURL1B (68111 upstream) : DUSP1 (8457 downstream)																							gggaggaaagggaaggaAggaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8323263	8323264	+	IGR	INS	-	TTCCTTCT	TTCCTTCT	rs139963481	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8323263_8323264insTTCCTTCT								EEF1E1 (220435 upstream) : SLC35B3 (88469 downstream)																							tctttctttccttccttctttc	0.000													10	6	---	---	---	---	
CAP2	10486	broad.mit.edu	37	6	17436298	17436299	+	Intron	INS	-	TCTT	TCTT			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17436298_17436299insTCTT	uc003ncb.2	+						CAP2_uc010jpk.1_Intron|CAP2_uc011dja.1_Intron|CAP2_uc011djb.1_Intron|CAP2_uc011djc.1_Intron|CAP2_uc011djd.1_Intron	NM_006366	NP_006357	P40123	CAP2_HUMAN	adenylyl cyclase-associated protein 2						activation of adenylate cyclase activity|axon guidance|cytoskeleton organization|establishment or maintenance of cell polarity|signal transduction	plasma membrane	actin binding			ovary(1)	1	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			AAACTAAGGAAtctttctttct	0.203													4	2	---	---	---	---	
SLC17A2	10246	broad.mit.edu	37	6	25925739	25925739	+	Intron	DEL	A	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25925739delA	uc011dkb.1	-						SLC17A2_uc011dkc.1_Intron|SLC17A2_uc003nfl.2_Intron			O00624	NPT3_HUMAN	SubName: Full=Solute carrier family 17 (Sodium phosphate), member 2, isoform CRA_b; SubName: Full=Putative uncharacterized protein SLC17A2;						phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			ovary(1)	1						agactcagtcaaaaaaaaaaa	0.159													5	3	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32548188	32548189	+	Intron	INS	-	AGGAGCAGAG	AGGAGCAGAG	rs144368132	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32548188_32548189insAGGAGCAGAG	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obo.1_Intron|uc010jub.1_5'Flank|HLA-DRB1_uc003obp.3_Intron|HLA-DRB1_uc011dqb.1_Intron|HLA-DRB1_uc011dqc.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						AAGGAGCAGAAACAGACCATGT	0.485													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	36377716	36377717	+	IGR	INS	-	AGAAAGAAAG	AGAAAGAAAG			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36377716_36377717insAGAAAGAAAG								PXT1 (9405 upstream) : KCTD20 (32827 downstream)																							ggacgaaggaaagaaagaaaga	0.089													7	4	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38705890	38705890	+	Intron	DEL	G	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38705890delG	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GCCAATTTTTGGGTCTAGAGC	0.363													5	6	---	---	---	---	
MCM3	4172	broad.mit.edu	37	6	52147953	52147956	+	Intron	DEL	AAAT	-	-	rs68041722		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52147953_52147956delAAAT	uc003pan.1	-						MCM3_uc011dwu.1_Intron	NM_002388	NP_002379	P25205	MCM3_HUMAN	minichromosome maintenance complex component 3						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	alpha DNA polymerase:primase complex|centrosome|MCM complex|perinuclear region of cytoplasm	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)|lung(1)|skin(1)	3	Lung NSC(77;0.0931)					aaaaaaaaaaaaataGGTGCAGGT	0.412													6	3	---	---	---	---	
CNR1	1268	broad.mit.edu	37	6	88854114	88854123	+	Frame_Shift_Del	DEL	ACGCATACAC	-	-	rs35057475		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88854114_88854123delACGCATACAC	uc011dzq.1	-	2	4434_4443	c.871_880delGTGTATGCGT	c.(871-882)GTGTATGCGTACfs	p.V291fs	CNR1_uc010kbz.2_Frame_Shift_Del_p.V291fs|CNR1_uc011dzr.1_Frame_Shift_Del_p.V291fs|CNR1_uc011dzs.1_Frame_Shift_Del_p.V291fs|CNR1_uc003pmq.3_Frame_Shift_Del_p.V291fs|CNR1_uc011dzt.1_Frame_Shift_Del_p.V291fs|CNR1_uc010kca.2_Frame_Shift_Del_p.V258fs	NM_001160260	NP_001153732	P21554	CNR1_HUMAN	cannabinoid receptor 1 isoform a	291_294	Helical; Name=5; (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	cannabinoid receptor activity|protein binding			skin(2)	2		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Marinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	ATATACATGTACGCATACACGATGAACAGA	0.505													48	26	---	---	---	---	
GLI3	2737	broad.mit.edu	37	7	42263043	42263043	+	Intron	DEL	A	-	-	rs35625471		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42263043delA	uc011kbh.1	-							NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3						negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						GTTTTCTGGCAAAAAAAAAAG	0.373									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				3	4	---	---	---	---	
HGF	3082	broad.mit.edu	37	7	81340811	81340811	+	Frame_Shift_Del	DEL	A	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81340811delA	uc003uhl.2	-	12	1595	c.1430delT	c.(1429-1431)ATAfs	p.I477fs	HGF_uc003uhm.2_Frame_Shift_Del_p.I472fs	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	477					epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						TAAATTGACTATTGTAGGTGT	0.264													19	18	---	---	---	---	
TBXAS1	6916	broad.mit.edu	37	7	139565425	139565426	+	Intron	INS	-	GAGGAA	GAGGAA			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139565425_139565426insGAGGAA	uc011kqv.1	+						TBXAS1_uc003vvh.2_Intron|TBXAS1_uc010lne.2_Intron|TBXAS1_uc011kqu.1_Intron|TBXAS1_uc003vvi.2_Intron|TBXAS1_uc003vvj.2_Intron|TBXAS1_uc011kqw.1_Intron|TBXAS1_uc011kqx.1_Intron	NM_001130966	NP_001124438	P24557	THAS_HUMAN	thromboxane A synthase 1, platelet isoform						hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|thromboxane-A synthase activity			ovary(2)|breast(1)	3	Melanoma(164;0.0142)					aggaagaggaggaggaggaaga	0.119													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142448200	142448207	+	Intron	DEL	GGTGGAAA	-	-	rs112413030	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142448200_142448207delGGTGGAAA	uc011krr.1	+						uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|uc011ksl.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		GTTAACACTGGGTGGAAAGGTGGAAAGA	0.457													9	8	---	---	---	---	
CDCA2	157313	broad.mit.edu	37	8	25326048	25326049	+	Intron	INS	-	GTGTGTGTGT	GTGTGTGTGT	rs146491693	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25326048_25326049insGTGTGTGTGT	uc003xep.1	+						PPP2R2A_uc003xek.2_Intron|CDCA2_uc011lae.1_Intron|CDCA2_uc003xeq.1_Intron|CDCA2_uc003xer.1_Intron	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2						cell division|mitosis	cytoplasm|nucleus					0		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		TGGTTCCTGGGgtgtgtgtgtg	0.312													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49826831	49826831	+	IGR	DEL	A	-	-	rs141577976		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49826831delA								EFCAB1 (178961 upstream) : SNAI2 (3408 downstream)																							ggaaaaaggcaaaaaaaAAAa	0.070													5	3	---	---	---	---	
SNAI2	6591	broad.mit.edu	37	8	49832250	49832256	+	Intron	DEL	TGCTGTT	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49832250_49832256delTGCTGTT	uc003xqp.2	-							NM_003068	NP_003059	O43623	SNAI2_HUMAN	snail 2						canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				AAAGTCTACATGCTGTTTGCAGTCCCT	0.425													3	3	---	---	---	---	
EFR3A	23167	broad.mit.edu	37	8	132989164	132989165	+	Intron	INS	-	A	A	rs140944068	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132989164_132989165insA	uc003yte.2	+							NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A							plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			AGCCATGACTTAAACTGTTACA	0.223													9	4	---	---	---	---	
PTENP1	11191	broad.mit.edu	37	9	33676397	33676398	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33676397_33676398delCT	uc003zth.3	-	1	1021_1022	c.150_151delAG	c.(148-153)AGAGTTfs	p.R50fs		NR_023917				SubName: Full=Phosphatase and tensin homolog 2; Flags: Fragment;												0						TATTGCGCAACTCTGTAATTAG	0.366													30	55	---	---	---	---	
NTRK2	4915	broad.mit.edu	37	9	87367035	87367035	+	Intron	DEL	G	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:87367035delG	uc004aoa.1	+						NTRK2_uc004anv.1_Intron|NTRK2_uc004any.1_Intron|NTRK2_uc004anz.1_Intron|NTRK2_uc011lsz.1_Intron|NTRK2_uc011lta.1_Intron|NTRK2_uc004aob.1_Intron|NTRK2_uc011ltb.1_Intron|NTRK2_uc004aoc.2_Intron	NM_001018064	NP_001018074	Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2						activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|nervous system development	integral to plasma membrane	ATP binding|neurotrophin receptor activity|transmembrane receptor protein tyrosine kinase activity			lung(11)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|liver(1)	16						CTTCTTATGTGGATCATTTTT	0.358										TSP Lung(25;0.17)			12	13	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93513725	93513727	+	IGR	DEL	AAC	-	-	rs34140480		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93513725_93513727delAAC								DIRAS2 (108617 upstream) : SYK (50285 downstream)																							AAAATAAGCAAACAACTGCCAGG	0.478													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52467884	52467886	+	IGR	DEL	TCC	-	-	rs57441530		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52467884_52467886delTCC								SGMS1 (82961 upstream) : ASAH2B (31810 downstream)																							CATCTTCACGTCCTTCTCTCACA	0.389													4	2	---	---	---	---	
RUFY2	55680	broad.mit.edu	37	10	70136913	70136913	+	Intron	DEL	T	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70136913delT	uc001job.2	-						RUFY2_uc001jnz.1_Intron|RUFY2_uc001joa.2_5'UTR	NM_017987	NP_060457	Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain-containing 2 isoform a							nucleus	metal ion binding			ovary(1)	1						TGTTTTGTGATTTTTTTTTTT	0.308													6	3	---	---	---	---	
HKDC1	80201	broad.mit.edu	37	10	71003255	71003256	+	Intron	INS	-	T	T	rs5785905		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71003255_71003256insT	uc001jpf.3	+						HKDC1_uc010qje.1_Intron	NM_025130	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1						glycolysis	mitochondrion|nucleus	ATP binding|hexokinase activity			ovary(4)|skin(1)	5						tttctttttccttttttttttt	0.223													6	3	---	---	---	---	
GLUD1	2746	broad.mit.edu	37	10	88820205	88820205	+	Intron	DEL	T	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88820205delT	uc001keh.2	-						GLUD1_uc001keg.2_Intron|GLUD1_uc010qmp.1_Intron	NM_005271	NP_005262	P00367	DHE3_HUMAN	glutamate dehydrogenase 1 precursor						glutamate biosynthetic process|glutamate catabolic process|positive regulation of insulin secretion	mitochondrial matrix	ADP binding|ATP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|identical protein binding|leucine binding|NAD+ binding				0					L-Glutamic Acid(DB00142)|NADH(DB00157)	TGTTTGCTTGTTTTTTTTTTT	0.209													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206019	134206020	+	IGR	INS	-	G	G	rs142843997		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206019_134206020insG								LRRC27 (11009 upstream) : PWWP2B (4682 downstream)																							atgatggtgatgtgataatggt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	41676595	41676596	+	IGR	DEL	TC	-	-	rs142061392		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:41676595_41676596delTC								LRRC4C (195272 upstream) : None (None downstream)																							tttctttctttctctttctttc	0.000													2	5	---	---	---	---	
TTC17	55761	broad.mit.edu	37	11	43401009	43401010	+	Intron	DEL	TG	-	-	rs72448738		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43401009_43401010delTG	uc001mxi.2	+						TTC17_uc001mxh.2_Intron|TTC17_uc010rfj.1_Intron	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17								binding			ovary(5)	5						CTACCTGCAAtgtgtgtgtgtg	0.302													8	4	---	---	---	---	
EEF1G	1937	broad.mit.edu	37	11	62334908	62334908	+	Frame_Shift_Del	DEL	G	-	-	rs1061093	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62334908delG	uc001ntm.1	-	6	761	c.615delC	c.(613-615)GGCfs	p.G205fs	EEF1G_uc010rlw.1_Frame_Shift_Del_p.G255fs|EEF1G_uc001ntn.1_Frame_Shift_Del_p.G85fs	NM_001404	NP_001395	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1	205	GST C-terminal.				response to virus	cytosol|eukaryotic translation elongation factor 1 complex	protein binding|translation elongation factor activity				0						GTTTCACTTCGCCCAAGACAG	0.557													27	12	---	---	---	---	
FIBP	9158	broad.mit.edu	37	11	65653641	65653642	+	Intron	DEL	AA	-	-	rs5792375		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65653641_65653642delAA	uc001ogd.2	-						FIBP_uc009yqu.2_Intron|FIBP_uc001oge.2_Intron	NM_198897	NP_942600	O43427	FIBP_HUMAN	FGF intracellular binding protein isoform a						fibroblast growth factor receptor signaling pathway	endomembrane system|membrane|microsome|mitochondrion|nucleus	fibroblast growth factor binding			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.166)		ccgtctcattaaaaaaaaaaaa	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	70113693	70113696	+	IGR	DEL	AGGA	-	-	rs71974523		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70113693_70113696delAGGA								FADD (60185 upstream) : PPFIA1 (3127 downstream)																							gaaggaagggaggaaggaaggaag	0.118													4	2	---	---	---	---	
KRTAP5-10	387273	broad.mit.edu	37	11	71276657	71276658	+	In_Frame_Ins	INS	-	GGCTGTGGCTCCGGCTGTGGG	GGCTGTGGCTCCGGCTGTGGG			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71276657_71276658insGGCTGTGGCTCCGGCTGTGGG	uc001oqt.1	+	1	49_50	c.24_25insGGCTGTGGCTCCGGCTGTGGG	c.(22-27)insGGCTGTGGCTCCGGCTGTGGG	p.29_30insGCGSGCG		NM_001012710	NP_001012728	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	29_30						keratin filament				skin(1)	1						GCTGCTCCGGAGGCTGTGGCTC	0.668													75	97	---	---	---	---	
TMEM126A	84233	broad.mit.edu	37	11	85365494	85365494	+	Intron	DEL	A	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85365494delA	uc001par.2	+							NM_032273	NP_115649	Q9H061	T126A_HUMAN	transmembrane protein 126A							integral to membrane|mitochondrion				ovary(2)	2		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				CAGCAGTTCTAAATACttttt	0.174													4	2	---	---	---	---	
PRB4	5545	broad.mit.edu	37	12	11338515	11338515	+	Intron	DEL	A	-	-	rs5796429		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11338515delA	uc001qzf.1	-							NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4							extracellular region				ovary(1)	1						AACCCAGTAGAAAAAAAAAAA	0.358										HNSCC(22;0.051)			7	4	---	---	---	---	
LETMD1	25875	broad.mit.edu	37	12	51449448	51449449	+	Intron	INS	-	A	A			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51449448_51449449insA	uc001rxm.2	+						LETMD1_uc010smz.1_Intron|LETMD1_uc010sna.1_Intron|LETMD1_uc001rxl.2_Intron|LETMD1_uc009zlv.2_Intron|LETMD1_uc001rxs.2_Intron|LETMD1_uc009zlw.2_Intron|LETMD1_uc001rxn.2_Intron|LETMD1_uc001rxo.2_Intron|LETMD1_uc001rxp.2_Intron|LETMD1_uc001rxq.2_Intron|LETMD1_uc001rxr.2_Intron|LETMD1_uc001rxt.2_Intron	NM_015416	NP_056231	Q6P1Q0	LTMD1_HUMAN	LETM1 domain containing 1 isoform 1							integral to membrane|mitochondrial outer membrane	protein binding			central_nervous_system(2)	2						ccctgtctcttaaaaaaaaaaa	0.139													6	3	---	---	---	---	
FGD6	55785	broad.mit.edu	37	12	95500974	95500975	+	Intron	INS	-	T	T	rs148392232	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95500974_95500975insT	uc001tdp.3	-						FGD6_uc009zsx.2_Intron|FGD6_uc001tdq.1_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6						actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						TACCCAGAATGTTTATTAGAAT	0.287													7	7	---	---	---	---	
CCDC53	51019	broad.mit.edu	37	12	102444232	102444233	+	Intron	DEL	AC	-	-	rs149773876		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102444232_102444233delAC	uc010svw.1	-						CCDC53_uc010svx.1_Intron|CCDC53_uc010svy.1_Intron|CCDC53_uc010svz.1_Intron	NM_016053	NP_057137	Q9Y3C0	CCD53_HUMAN	coiled-coil domain containing 53							WASH complex	protein binding				0						gccatctctaacacacacacac	0.000													4	2	---	---	---	---	
FZD10	11211	broad.mit.edu	37	12	130649317	130649317	+	3'UTR	DEL	T	-	-	rs112714527		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130649317delT	uc001uii.2	+	1					uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor						brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		cttcttcttcttttttttttt	0.388													7	4	---	---	---	---	
NUFIP1	26747	broad.mit.edu	37	13	45556116	45556116	+	Intron	DEL	A	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45556116delA	uc001uzp.2	-							NM_012345	NP_036477	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein						box C/D snoRNP assembly|positive regulation of transcription from RNA polymerase II promoter|RNA processing	actin cytoskeleton|cytosolic ribosome|nuclear matrix|nucleolus|perichromatin fibrils|pre-snoRNP complex|presynaptic active zone|transcription elongation factor complex	DNA binding|identical protein binding|protein binding, bridging|RNA binding|zinc ion binding				0		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		TAATGGAAGCAAAACACTGAA	0.313													3	4	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	48934227	48934227	+	Frame_Shift_Del	DEL	A	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48934227delA	uc001vcb.2	+	7	848	c.682delA	c.(682-684)AAAfs	p.K228fs	RB1_uc010acs.1_RNA|RB1_uc010act.1_5'UTR	NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1	228					androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(5)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CTATTTTATTAAACTCTCACC	0.259		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			33	47	---	---	---	---	
COL4A2	1284	broad.mit.edu	37	13	111132361	111132362	+	Intron	INS	-	CAAC	CAAC	rs142862148	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111132361_111132362insCAAC	uc001vqx.2	+							NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein						angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CAGCACAGCCTCAACCTCCAGA	0.584													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20081407	20081408	+	IGR	DEL	AC	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20081407_20081408delAC								P704P (61135 upstream) : OR4Q3 (134179 downstream)																							ATATATGTGGacacacacacac	0.257													4	3	---	---	---	---	
SDR39U1	56948	broad.mit.edu	37	14	24909696	24909696	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24909696delC	uc001wpm.2	-	6	507	c.475delG	c.(475-477)GTTfs	p.V159fs	KHNYN_uc010tpc.1_3'UTR|KHNYN_uc001wph.3_3'UTR|KHNYN_uc010alw.2_3'UTR|SDR39U1_uc001wpi.2_Frame_Shift_Del_p.V51fs|SDR39U1_uc001wpj.2_Frame_Shift_Del_p.V77fs|SDR39U1_uc001wpk.2_Frame_Shift_Del_p.V51fs|SDR39U1_uc001wpl.2_Frame_Shift_Del_p.V104fs|SDR39U1_uc001wpn.2_Frame_Shift_Del_p.V34fs|uc001wpo.1_5'Flank	NM_020195	NP_064580	Q9NRG7	D39U1_HUMAN	short chain dehydrogenase/reductase family 39U,	185							binding			pancreas(1)	1						CCCAGCACAACCCCTAGAGCA	0.637													5	5	---	---	---	---	
C14orf115	55237	broad.mit.edu	37	14	74824463	74824463	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74824463delG	uc001xpw.3	+	2	1168	c.977delG	c.(976-978)CGGfs	p.R326fs		NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN	hypothetical protein LOC55237	326					transposition, DNA-mediated		DNA binding|transposase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00147)		AGCTTCCACCGGGGGGGCGTC	0.642													44	71	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98480461	98480462	+	IGR	INS	-	CTTT	CTTT	rs149441117	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98480461_98480462insCTTT								C14orf64 (36000 upstream) : C14orf177 (697488 downstream)																							ttccttccttcctttctttctc	0.000													3	4	---	---	---	---	
TEX9	374618	broad.mit.edu	37	15	56704372	56704373	+	Intron	DEL	GT	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56704372_56704373delGT	uc002adp.2	+						TEX9_uc010ugl.1_Intron	NM_198524	NP_940926	Q8N6V9	TEX9_HUMAN	testis expressed 9												0				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		ACCCCCAAGCgtgtgtgtgtgt	0.307													4	2	---	---	---	---	
AP3S2	10239	broad.mit.edu	37	15	90402597	90402597	+	Intron	DEL	C	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90402597delC	uc002boq.3	-						AP3S2_uc002bos.3_Intron|AP3S2_uc010bns.2_Intron|AP3S2_uc002bor.3_Intron|AP3S2_uc010bnt.2_Intron	NM_005829	NP_005820	P59780	AP3S2_HUMAN	adaptor-related protein complex 3, sigma 2						intracellular protein transport|vesicle-mediated transport	cytoplasmic vesicle membrane|Golgi apparatus|membrane coat	protein transporter activity				0	Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)			tccttcctttccttccttcct	0.000													4	2	---	---	---	---	
DCI	1632	broad.mit.edu	37	16	2289937	2289938	+	3'UTR	INS	-	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2289937_2289938insT	uc002cpr.2	-	7					DCI_uc002cps.2_3'UTR	NM_001919	NP_001910	P42126	ECI1_HUMAN	dodecenoyl-Coenzyme A delta isomerase precursor						fatty acid beta-oxidation	mitochondrial matrix	dodecenoyl-CoA delta-isomerase activity				0						TCCCTGGGACCCACAGGGGCAC	0.480													77	43	---	---	---	---	
XYLT1	64131	broad.mit.edu	37	16	17228803	17228804	+	Intron	INS	-	TGAT	TGAT	rs143063547	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17228803_17228804insTGAT	uc002dfa.2	-							NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I						glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						atctaaagcaatgataggcact	0.119													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32177847	32177850	+	IGR	DEL	TTGA	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32177847_32177850delTTGA								HERC2P4 (13973 upstream) : TP53TG3B (506991 downstream)																							GATGCAATTGTTGACTCACCAAGC	0.368													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	20978234	20978237	+	IGR	DEL	CCTC	-	-	rs75278704		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20978234_20978237delCCTC								USP22 (31161 upstream) : DHRS7B (52021 downstream)																							ttccttctttcctccctccctccc	0.015													3	4	---	---	---	---	
RNFT1	51136	broad.mit.edu	37	17	58037277	58037277	+	Intron	DEL	A	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58037277delA	uc002iya.2	-						RNFT1_uc002iyb.2_Intron|RNFT1_uc002iyc.2_Intron|RNFT1_uc010wop.1_3'UTR	NM_016125	NP_057209	Q5M7Z0	RNFT1_HUMAN	PTD016 protein							integral to membrane	zinc ion binding				0	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			tctcaaaaagaaaaaaaaaaa	0.000													5	3	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025826	64025829	+	Intron	DEL	AAAC	-	-	rs67867456		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025826_64025829delAAAC	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gtctctaaataaacaaacaaacaa	0.123													3	4	---	---	---	---	
KPNA2	3838	broad.mit.edu	37	17	66039800	66039801	+	Intron	DEL	AA	-	-	rs35815075		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66039800_66039801delAA	uc002jgk.2	+						KPNA2_uc002jgl.2_Intron	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2						DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			ccagtctctcaaaaaaaaaaaa	0.139													5	3	---	---	---	---	
ABCA6	23460	broad.mit.edu	37	17	67081660	67081661	+	Intron	INS	-	A	A	rs35438104		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67081660_67081661insA	uc002jhw.1	-							NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6						transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					TATCCAAAGGCaaaaaaaaaaa	0.277													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	74507718	74507719	+	IGR	INS	-	GGAG	GGAG	rs148467176	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74507718_74507719insGGAG								LOC284276 (235935 upstream) : ZNF236 (28397 downstream)																							agggagggaaaggagggaggga	0.035													3	3	---	---	---	---	
C19orf2	8725	broad.mit.edu	37	19	30417141	30417144	+	Intron	DEL	TCCT	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30417141_30417144delTCCT	uc002nsq.2	+							NM_134447	NP_604431	O94763	RMP_HUMAN	RPB5-mediating protein isoform b						protein folding|regulation of transcription from RNA polymerase II promoter|response to virus	DNA-directed RNA polymerase II, core complex|prefoldin complex	transcription corepressor activity|unfolded protein binding			ovary(1)|kidney(1)	2	Ovarian(5;0.000902)|Breast(6;0.0203)|Esophageal squamous(110;0.195)	Hepatocellular(1079;0.137)|Renal(1328;0.228)	STAD - Stomach adenocarcinoma(5;5.36e-06)|Lung(7;0.0144)|LUAD - Lung adenocarcinoma(5;0.115)	STAD - Stomach adenocarcinoma(1328;0.18)		tcttcctctctccttccttccttc	0.000													5	6	---	---	---	---	
ATP5SL	55101	broad.mit.edu	37	19	41938472	41938473	+	Intron	DEL	GC	-	-	rs113571894	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41938472_41938473delGC	uc002oqw.1	-						CYP2F1_uc010xvw.1_Intron|ATP5SL_uc002oqu.1_Intron|ATP5SL_uc002oqv.2_Intron|ATP5SL_uc010xwa.1_Intron|ATP5SL_uc002oqx.1_Intron|ATP5SL_uc002oqy.1_Intron|ATP5SL_uc002oqz.1_Intron|ATP5SL_uc002ora.1_3'UTR|ATP5SL_uc010xwb.1_3'UTR	NM_018035	NP_060505	Q9NW81	AT5SL_HUMAN	ATP5S-like											large_intestine(1)|breast(1)	2						GACAgtgtgtgcgtgtgtgtgt	0.421													4	3	---	---	---	---	
TGM3	7053	broad.mit.edu	37	20	2291706	2291706	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2291706delG	uc002wfx.3	+	4	568	c.471delG	c.(469-471)CAGfs	p.Q157fs		NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor	157					cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)	AGTATGTTCAGGAAGATGCCG	0.458													70	68	---	---	---	---	
PLCB1	23236	broad.mit.edu	37	20	8731631	8731632	+	Intron	INS	-	GAGTGCA	GAGTGCA			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8731631_8731632insGAGTGCA	uc002wnb.2	+						PLCB1_uc010zrb.1_Intron|PLCB1_uc002wna.2_Intron|PLCB1_uc002wnc.1_Intron|PLCB1_uc002wnd.1_Intron	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1						activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12						tgcccaggctggagtgcagagg	0.114													3	3	---	---	---	---	
PDRG1	81572	broad.mit.edu	37	20	30542460	30542461	+	5'Flank	INS	-	AAGG	AAGG	rs34345343		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30542460_30542461insAAGG	uc002wxd.2	-							NM_030815	NP_110442	Q9NUG6	PDRG1_HUMAN	p53 and DNA damage-regulated protein						protein folding	prefoldin complex	unfolded protein binding				0			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			agaaagaaagaaaggaaggaag	0.005													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	42392924	42392943	+	IGR	DEL	AAGAAAGAAAGAAAGAAAGA	-	-	rs9978700		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42392924_42392943delAAGAAAGAAAGAAAGAAAGA								DSCAM (173885 upstream) : C21orf130 (120484 downstream)																							ggaaggaaggaagaaagaaagaaagaaagaaagaaagaaa	0.000													4	2	---	---	---	---	
GGT1	2678	broad.mit.edu	37	22	25016169	25016170	+	Intron	INS	-	T	T	rs28418841	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25016169_25016170insT	uc003aan.1	+						GGT1_uc003aas.1_Intron|GGT1_uc003aat.1_Intron|GGT1_uc003aau.1_Intron|GGT1_uc003aav.1_Intron|GGT1_uc003aaw.1_Intron|GGT1_uc003aax.1_Intron	NM_013430	NP_038347	P19440	GGT1_HUMAN	gamma-glutamyltransferase 1 precursor						glutathione biosynthetic process	integral to membrane	acyltransferase activity|gamma-glutamyltransferase activity|protein binding				0					Glutathione(DB00143)	aaaaaaaaaaaaTCTTTCCTCC	0.277													8	4	---	---	---	---	
MN1	4330	broad.mit.edu	37	22	28192569	28192570	+	Intron	INS	-	G	G			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28192569_28192570insG	uc003adj.2	-							NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1								binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						GCAGTGTGTGTGGGGGGGTCTG	0.540			T	ETV6	AML|meningioma								4	3	---	---	---	---	
RASL10A	10633	broad.mit.edu	37	22	29709663	29709664	+	Intron	INS	-	C	C	rs146834773	by1000genomes	TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29709663_29709664insC	uc003aff.2	-						RASL10A_uc003afg.2_3'UTR	NM_006477	NP_006468	Q92737	RSLAA_HUMAN	RAS-related on chromosome 22 isoform a						small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity				0						CAGAGACACCGCCCCCCCCGCC	0.653													5	4	---	---	---	---	
C22orf42	150297	broad.mit.edu	37	22	32550002	32550003	+	Intron	INS	-	CACA	CACA	rs111234718		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32550002_32550003insCACA	uc003amd.2	-							NM_001010859	NP_001010859	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42											ovary(1)|skin(1)	2						tgagaccttTTcacacacacac	0.099													2	4	---	---	---	---	
HMOX1	3162	broad.mit.edu	37	22	35785369	35785370	+	Intron	INS	-	T	T			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35785369_35785370insT	uc003ant.1	+							NM_002133	NP_002124	P09601	HMOX1_HUMAN	heme oxygenase (decyclizing) 1						angiogenesis|anti-apoptosis|cell death|cellular iron ion homeostasis|endothelial cell proliferation|erythrocyte homeostasis|heme catabolic process|heme oxidation|intracellular protein kinase cascade|low-density lipoprotein particle clearance|negative regulation of leukocyte migration|negative regulation of smooth muscle cell proliferation|positive regulation of chemokine biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of smooth muscle cell proliferation|protein homooligomerization|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hydrogen peroxide|response to nicotine|smooth muscle hyperplasia|transmembrane transport|wound healing involved in inflammatory response	endoplasmic reticulum membrane|extracellular space|microsome	enzyme binding|heme binding|heme oxygenase (decyclizing) activity|protein homodimerization activity|signal transducer activity			ovary(1)	1					NADH(DB00157)	tccttccttccttccttccttc	0.005													4	3	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467599	1467600	+	Intron	INS	-	TTTC	TTTC			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467599_1467600insTTTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ctttctttctgtttctgtttct	0.045													4	3	---	---	---	---	
MTM1	4534	broad.mit.edu	37	X	149734443	149734444	+	5'Flank	INS	-	ACAC	ACAC	rs71960004		TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149734443_149734444insACAC	uc004fef.3	+						MTM1_uc011mxx.1_5'Flank|MTM1_uc011mxy.1_5'Flank|MTM1_uc011mxz.1_5'Flank|MTM1_uc010nte.2_5'Flank	NM_000252	NP_000243	Q13496	MTM1_HUMAN	myotubularin						endosome to lysosome transport|intermediate filament organization|mitochondrion distribution|mitochondrion morphogenesis|phosphatidylinositol dephosphorylation|protein transport|regulation of vacuole organization	filopodium|late endosome|plasma membrane|ruffle	intermediate filament binding|phosphatidylinositol binding|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TGAAGATTCCTacacacacaca	0.455													4	2	---	---	---	---	
ARHGAP4	393	broad.mit.edu	37	X	153178447	153178447	+	Intron	DEL	C	-	-			TCGA-22-4601-01A-01D-1441-08	TCGA-22-4601-11A-01D-1441-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153178447delC	uc004fjk.1	-						ARHGAP4_uc004fjj.1_5'Flank|ARHGAP4_uc011mzf.1_Intron|ARHGAP4_uc004fjl.1_Intron|ARHGAP4_uc010nup.1_Intron	NM_001666	NP_001657	P98171	RHG04_HUMAN	Rho GTPase activating protein 4 isoform 2						apoptosis|cytoskeleton organization|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|Rho protein signal transduction	cytosol|focal adhesion|nucleus	Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			central_nervous_system(1)	1	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGCGGACCGTCGCAGGGCCCC	0.622													4	5	---	---	---	---	
