Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CCDC27	148870	broad.mit.edu	37	1	3679887	3679887	+	Silent	SNP	G	A	A	rs141116417	byFrequency	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3679887G>A	uc001akv.2	+	7	1251	c.1170G>A	c.(1168-1170)CCG>CCA	p.P390P		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	390	Glu-rich.									skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		gggagctgccggaggaagagg	0.368													37	27	---	---	---	---	PASS
SLC2A5	6518	broad.mit.edu	37	1	9099965	9099965	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9099965G>A	uc001apo.2	-	7	1071	c.779C>T	c.(778-780)GCG>GTG	p.A260V	SLC2A5_uc010nzy.1_Missense_Mutation_p.A201V|SLC2A5_uc010nzz.1_Missense_Mutation_p.A145V|SLC2A5_uc010oaa.1_Missense_Mutation_p.A216V|SLC2A5_uc010oab.1_Missense_Mutation_p.A260V	NM_003039	NP_003030	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated	260	Cytoplasmic (Potential).				carbohydrate metabolic process	integral to membrane|plasma membrane	fructose transmembrane transporter activity|glucose transmembrane transporter activity			pancreas(2)|ovary(1)	3	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GATGAAGCCCGCGGCCTTCTC	0.677													28	47	---	---	---	---	PASS
AHDC1	27245	broad.mit.edu	37	1	27877769	27877769	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27877769C>A	uc009vsy.2	-	6	1827	c.858G>T	c.(856-858)CAG>CAT	p.Q286H	AHDC1_uc009vsz.1_Missense_Mutation_p.Q286H|AHDC1_uc001boh.1_Missense_Mutation_p.Q159H	NM_001029882	NP_001025053	Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	286	Pro-rich.						DNA binding			central_nervous_system(1)	1		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCTCTAGTGCCTGCGGGTCCA	0.716													36	62	---	---	---	---	PASS
SPOCD1	90853	broad.mit.edu	37	1	32262312	32262312	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32262312A>G	uc001bts.1	-	10	2208	c.2150T>C	c.(2149-2151)CTG>CCG	p.L717P	SPOCD1_uc001btt.2_Missense_Mutation_p.L23P|SPOCD1_uc001btu.2_Missense_Mutation_p.L717P|SPOCD1_uc001btv.2_Missense_Mutation_p.L210P|SPOCD1_uc001btw.1_Missense_Mutation_p.L61P	NM_144569	NP_653170	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	717	TFIIS central.				transcription, DNA-dependent					ovary(5)|breast(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		AATGATATTCAGGCCCTGAAG	0.567													4	417	---	---	---	---	PASS
SLC1A7	6512	broad.mit.edu	37	1	53555552	53555552	+	Silent	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53555552G>T	uc001cuy.2	-	9	1449	c.1281C>A	c.(1279-1281)CTC>CTA	p.L427L	SLC1A7_uc001cux.2_Silent_p.L80L	NM_006671	NP_006662	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter),	427	Helical; (Potential).					integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)	CCATGGTGACGAGGCCGGCCT	0.627													120	117	---	---	---	---	PASS
SGIP1	84251	broad.mit.edu	37	1	67199524	67199524	+	Silent	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67199524C>A	uc001dcr.2	+	21	2209	c.1992C>A	c.(1990-1992)CCC>CCA	p.P664P	SGIP1_uc010opd.1_Silent_p.P264P|SGIP1_uc001dcs.2_Silent_p.P264P|SGIP1_uc001dct.2_Silent_p.P266P|SGIP1_uc009wat.2_Silent_p.P458P|SGIP1_uc001dcu.2_Silent_p.P169P	NM_032291	NP_115667	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting	664					positive regulation of energy homeostasis|positive regulation of feeding behavior|positive regulation of receptor-mediated endocytosis|response to dietary excess	AP-2 adaptor complex	microtubule binding|phospholipid binding|SH3 domain binding			ovary(3)	3						AACAAAAACCCCAGGCTACAT	0.358													97	118	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75055689	75055689	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75055689C>T	uc001dgg.2	-	12	2021	c.1802G>A	c.(1801-1803)GGG>GAG	p.G601E	uc001dgh.2_Intron|C1orf173_uc001dgi.3_Missense_Mutation_p.G395E	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	601	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						TTCCCTGTCCCCCACTGCAGA	0.433													89	67	---	---	---	---	PASS
SORT1	6272	broad.mit.edu	37	1	109912202	109912202	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109912202C>G	uc001dxm.1	-	2	365	c.316G>C	c.(316-318)GAT>CAT	p.D106H	SORT1_uc010ovi.1_5'UTR|SORT1_uc009wfb.2_5'UTR	NM_002959	NP_002950	Q99523	SORT_HUMAN	sortilin 1 preproprotein	106	Extracellular (Potential).				endocytosis|endosome to lysosome transport|endosome transport via multivesicular body sorting pathway|glucose import|Golgi to endosome transport|induction of apoptosis by extracellular signals|myotube differentiation|negative regulation of apoptosis|negative regulation of lipoprotein lipase activity|neuropeptide signaling pathway|ossification|plasma membrane to endosome transport|regulation of gene expression|response to insulin stimulus|vesicle organization	cell surface|coated pit|early endosome|endoplasmic reticulum membrane|endosome membrane|Golgi cisterna membrane|integral to membrane|lysosomal membrane|microsome|nuclear membrane|perinuclear region of cytoplasm|plasma membrane	enzyme binding|nerve growth factor binding|nerve growth factor receptor activity|neurotensin receptor activity, non-G-protein coupled			ovary(1)	1		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		CTGAGATCATCAAACACATGC	0.378													7	92	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152080892	152080892	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152080892C>T	uc001ezp.2	-	2	4801	c.4801G>A	c.(4801-4803)GAA>AAA	p.E1601K	TCHH_uc009wne.1_Missense_Mutation_p.E1601K	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1601	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCTGCTGTTCGTCCTCCATG	0.562													6	254	---	---	---	---	PASS
ARHGEF2	9181	broad.mit.edu	37	1	155927613	155927613	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155927613T>C	uc001fmt.2	-	13	1724	c.1606A>G	c.(1606-1608)AAA>GAA	p.K536E	ARHGEF2_uc001fmr.2_Missense_Mutation_p.K508E|ARHGEF2_uc001fms.2_Missense_Mutation_p.K535E|ARHGEF2_uc001fmu.2_Missense_Mutation_p.K580E	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2	536	PH.				actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					AACATCCCTTTCTCCTGGTTG	0.552													24	109	---	---	---	---	PASS
INSRR	3645	broad.mit.edu	37	1	156818779	156818779	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156818779C>A	uc010pht.1	-	7	1759	c.1505G>T	c.(1504-1506)CGC>CTC	p.R502L	NTRK1_uc001fqf.1_Intron|NTRK1_uc009wsi.1_Intron	NM_014215	NP_055030	P14616	INSRR_HUMAN	insulin receptor-related receptor precursor	502	Fibronectin type-III 1.				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|insulin receptor substrate binding|metal ion binding|phosphatidylinositol 3-kinase binding|transmembrane receptor protein tyrosine kinase activity			lung(11)|ovary(5)|skin(2)|kidney(1)|central_nervous_system(1)	20	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCGCTCCCAGCGTAGCAGGAT	0.567													10	18	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158646059	158646059	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158646059C>T	uc001fst.1	-	8	1183	c.984G>A	c.(982-984)GAG>GAA	p.E328E		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	328	Spectrin 4.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GTGTCAGCTTCTCTGCTTTAG	0.498													93	411	---	---	---	---	PASS
C1orf114	57821	broad.mit.edu	37	1	169394045	169394045	+	Intron	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169394045A>G	uc001gga.1	-						C1orf114_uc001gfz.1_Intron|C1orf114_uc009wvq.1_Intron|C1orf114_uc001ggb.2_Intron|C1orf114_uc001ggc.1_Intron	NM_021179	NP_067002	Q5TID7	CA114_HUMAN	hypothetical protein LOC57821												0	all_hematologic(923;0.208)					TTGGCAATATATACCTCTATT	0.199													24	131	---	---	---	---	PASS
DNM3	26052	broad.mit.edu	37	1	171958143	171958143	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171958143G>T	uc001gie.2	+	4	620	c.444G>T	c.(442-444)CAG>CAT	p.Q148H	DNM3_uc001gid.3_Missense_Mutation_p.Q148H|DNM3_uc009wwb.2_Missense_Mutation_p.Q148H|DNM3_uc001gif.2_Missense_Mutation_p.Q148H	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a	148					endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						TGGGAGATCAGCCACCAGATA	0.413													18	17	---	---	---	---	PASS
DNM3	26052	broad.mit.edu	37	1	172357850	172357850	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172357850G>A	uc001gie.2	+	20	2599	c.2423G>A	c.(2422-2424)CGT>CAT	p.R808H	DNM3_uc001gif.2_Missense_Mutation_p.R804H|DNM3_uc001gih.1_Missense_Mutation_p.R164H	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a	814					endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						GTCCCATTCCGTCCAGGCCCA	0.647													17	29	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176709266	176709266	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176709266G>A	uc001gkz.2	+	14	5249	c.4085G>A	c.(4084-4086)CGC>CAC	p.R1362H	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1362					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						ACATCCTCCCGCATTGGTCTT	0.507													25	158	---	---	---	---	PASS
LGR6	59352	broad.mit.edu	37	1	202272397	202272397	+	Intron	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202272397C>T	uc001gxu.2	+						LGR6_uc001gxv.2_Intron|LGR6_uc009xab.2_Intron|LGR6_uc001gxw.2_Intron|LGR6_uc009xac.1_Intron	NM_001017403	NP_001017403	Q9HBX8	LGR6_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			large_intestine(4)|ovary(3)|skin(2)|pancreas(1)	10						CTCATTGTCTCTATTTCCAGA	0.522													7	255	---	---	---	---	PASS
IARS2	55699	broad.mit.edu	37	1	220315157	220315157	+	Silent	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220315157A>G	uc001hmc.2	+	20	2531	c.2427A>G	c.(2425-2427)GAA>GAG	p.E809E	IARS2_uc001hmd.2_Silent_p.E145E	NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase	809					isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TCTATTGTGAAAAGGAAAATG	0.413													8	454	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21230881	21230881	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21230881G>A	uc002red.2	-	26	8987	c.8859C>T	c.(8857-8859)CCC>CCT	p.P2953P		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2953					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	AGGAAGTGAGGGGTCCTTCTA	0.423													67	469	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21231883	21231883	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21231883G>A	uc002red.2	-	26	7985	c.7857C>T	c.(7855-7857)GTC>GTT	p.V2619V		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2619					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	CTGTTAGGGGGACTATAAAAT	0.413													84	261	---	---	---	---	PASS
WDR43	23160	broad.mit.edu	37	2	29145784	29145784	+	Splice_Site	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29145784G>A	uc002rmo.2	+	7	882	c.850_splice	c.e7-1	p.P284_splice		NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					TTTTCTTTTAGCCTGTCAAGT	0.363													20	59	---	---	---	---	PASS
WDR43	23160	broad.mit.edu	37	2	29152477	29152477	+	Silent	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29152477T>C	uc002rmo.2	+	11	1370	c.1338T>C	c.(1336-1338)GAT>GAC	p.D446D		NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43	446						nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					GAGCAATGGATATAGACACAC	0.378													38	32	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50463966	50463966	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50463966G>C	uc010fbp.2	-	2	1209	c.402C>G	c.(400-402)GAC>GAG	p.D134E	NRXN1_uc002rxb.3_Missense_Mutation_p.D841E|NRXN1_uc010fbq.2_Missense_Mutation_p.D1209E|NRXN1_uc002rxe.3_Missense_Mutation_p.D1169E|NRXN1_uc002rxc.1_RNA	NM_138735	NP_620072	P58400	NRX1B_HUMAN	neurexin 1 isoform beta precursor	134	Extracellular (Potential).|Laminin G-like.				angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGAAGAACTGTCCACTCGCA	0.418													65	76	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54856622	54856622	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54856622A>T	uc002rxu.2	+	14	2600	c.2351A>T	c.(2350-2352)AAG>ATG	p.K784M	SPTBN1_uc002rxv.1_Missense_Mutation_p.K784M|SPTBN1_uc002rxx.2_Missense_Mutation_p.K771M	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	784	Spectrin 5.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			TCTCTGGTCAAGAAACACAAG	0.567													102	313	---	---	---	---	PASS
C2orf63	130162	broad.mit.edu	37	2	55436644	55436644	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55436644C>G	uc002ryi.2	-	7	1056	c.710G>C	c.(709-711)AGA>ACA	p.R237T	C2orf63_uc002ryh.2_Intron|C2orf63_uc002ryj.2_Missense_Mutation_p.R115T	NM_152385	NP_689598	Q8NHS4	CB063_HUMAN	hypothetical protein LOC130162 isoform 1	237							binding			ovary(2)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(58;0.179)|Lung(47;0.189)			TATCTGCAGTCTTTGATGACT	0.313													6	356	---	---	---	---	PASS
MTHFD2	10797	broad.mit.edu	37	2	74437170	74437170	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74437170C>T	uc002skk.2	+	5	743	c.664C>T	c.(664-666)CCC>TCC	p.P222S	MTHFD2_uc002skj.2_Missense_Mutation_p.P120S|MTHFD2_uc010yro.1_Missense_Mutation_p.P120S|MTHFD2_uc010ffb.2_Missense_Mutation_p.P181S|MTHFD2_uc010yrp.1_Missense_Mutation_p.P58S	NM_006636	NP_006627	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase 2	222					folic acid-containing compound biosynthetic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	magnesium ion binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|phosphate binding|protein binding				0					NADH(DB00157)|Tetrahydrofolic acid(DB00116)	GCATGAACGTCCCGGAGGTAA	0.463													25	62	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80101302	80101302	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80101302G>A	uc010ysh.1	+	5	691	c.686G>A	c.(685-687)CGC>CAC	p.R229H	CTNNA2_uc010yse.1_Missense_Mutation_p.R229H|CTNNA2_uc010ysf.1_Missense_Mutation_p.R229H|CTNNA2_uc010ysg.1_Missense_Mutation_p.R229H	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	229					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GCATTTCTCCGCCACCCAGAT	0.572													13	116	---	---	---	---	PASS
CD8B	926	broad.mit.edu	37	2	87085229	87085229	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87085229G>A	uc002srz.2	-	2	404	c.354C>T	c.(352-354)ATC>ATT	p.I118I	RMND5A_uc002srs.3_Intron|CD8B_uc002srw.2_Silent_p.I118I|CD8B_uc002srx.2_Silent_p.I118I|CD8B_uc002sry.2_Silent_p.I118I|CD8B_uc010fgt.2_Silent_p.I118I|CD8B_uc002ssa.2_Silent_p.I118I|CD8B_uc010yto.1_Silent_p.I118I	NM_004931	NP_004922	P10966	CD8B_HUMAN	CD8b antigen isoform 5 precursor	118	Ig-like V-type.|Extracellular (Potential).				immune response|regulation of defense response to virus by virus|regulation of immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway|viral reproduction	early endosome|extracellular region|integral to plasma membrane|T cell receptor complex	coreceptor activity|MHC class I protein binding			upper_aerodigestive_tract(1)|skin(1)	2						GGCTCCCGACGATCATGCAGA	0.468													23	468	---	---	---	---	PASS
C2orf55	343990	broad.mit.edu	37	2	99449396	99449396	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99449396C>T	uc002szf.1	-	4	598	c.304G>A	c.(304-306)GGA>AGA	p.G102R		NM_207362	NP_997245	Q6NV74	CB055_HUMAN	hypothetical protein LOC343990	102											0						GCGTCCTGTCCGGACTCAGGA	0.547													12	778	---	---	---	---	PASS
EIF5B	9669	broad.mit.edu	37	2	99977788	99977788	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99977788G>A	uc002tab.2	+	4	608	c.424G>A	c.(424-426)GAT>AAT	p.D142N		NM_015904	NP_056988	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	142	Poly-Asp.				regulation of translational initiation	cytosol	GTP binding|GTPase activity|protein binding|translation initiation factor activity			ovary(2)|pancreas(1)	3						TGATGATGATGATTTTAACAA	0.333													14	318	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100170874	100170874	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100170874C>T	uc002tag.2	-	23	3694	c.3458G>A	c.(3457-3459)CGC>CAC	p.R1153H	AFF3_uc002taf.2_Missense_Mutation_p.R1178H	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	1153					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						CTGGTGGATGCGCTGTGGGAT	0.632													5	358	---	---	---	---	PASS
SLC5A7	60482	broad.mit.edu	37	2	108622499	108622499	+	Intron	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108622499G>A	uc002tdv.2	+						SLC5A7_uc010ywm.1_Intron|SLC5A7_uc010fjj.2_Intron|SLC5A7_uc010ywn.1_Intron	NM_021815	NP_068587	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (choline transporter),						acetylcholine biosynthetic process|neurotransmitter secretion	integral to membrane|plasma membrane	choline:sodium symporter activity			ovary(2)|central_nervous_system(1)|skin(1)	4					Choline(DB00122)	TGTGTTTCCCGCACAGATGCT	0.428													43	113	---	---	---	---	PASS
GPR17	2840	broad.mit.edu	37	2	128408404	128408404	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128408404T>C	uc010yzn.1	+	4	790	c.179T>C	c.(178-180)ATG>ACG	p.M60T	LIMS2_uc002tow.2_5'Flank|LIMS2_uc002tox.2_Intron|LIMS2_uc010fmb.2_Intron|LIMS2_uc002toy.2_Intron|LIMS2_uc010yzm.1_Intron|LIMS2_uc002tpa.2_Intron|LIMS2_uc002toz.2_Intron|LIMS2_uc002tpb.2_Intron|GPR17_uc002tpc.2_Missense_Mutation_p.M60T|GPR17_uc010yzo.1_Missense_Mutation_p.M32T|GPR17_uc002tpd.2_Missense_Mutation_p.M32T	NM_001161415	NP_001154887	Q13304	GPR17_HUMAN	G protein-coupled receptor 17 isoform a	60	Extracellular (Potential).					integral to plasma membrane	chemokine receptor activity|purinergic nucleotide receptor activity, G-protein coupled				0	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		ctggagaacatgctgttcgcc	0.154											OREG0014966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	111	185	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136555660	136555660	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136555660T>C	uc002tuu.1	-	13	4926	c.4915A>G	c.(4915-4917)AAT>GAT	p.N1639D		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1639	Extracellular (Potential).|4.|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		ATCACCTCATTGTAATCTCCA	0.582											OREG0014998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	97	145	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141526894	141526894	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141526894C>A	uc002tvj.1	-	35	6618	c.5646G>T	c.(5644-5646)ATG>ATT	p.M1882I		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1882	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GAACAGAGTACATAAGAAATG	0.383										TSP Lung(27;0.18)			35	50	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141625227	141625227	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141625227C>G	uc002tvj.1	-	27	5483	c.4511G>C	c.(4510-4512)AGT>ACT	p.S1504T	LRP1B_uc010fnl.1_Missense_Mutation_p.S686T	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1504	Extracellular (Potential).|LDL-receptor class B 13.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGAATCACACTGACATTCTG	0.478										TSP Lung(27;0.18)			29	258	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141751623	141751623	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141751623C>A	uc002tvj.1	-	16	3557	c.2585G>T	c.(2584-2586)TGG>TTG	p.W862L	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	862	Extracellular (Potential).|LDL-receptor class A 3.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATCACATTTCCACCGAGCTTG	0.428										TSP Lung(27;0.18)			52	135	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152500339	152500339	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152500339T>A	uc010fnx.2	-	57	8140	c.7949A>T	c.(7948-7950)CAG>CTG	p.Q2650L		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	2650	Nebulin 71.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CACATCGCTCTGGAGGTCATA	0.478													89	162	---	---	---	---	PASS
CACNB4	785	broad.mit.edu	37	2	152727093	152727093	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152727093C>T	uc002tya.2	-	8	719	c.651G>A	c.(649-651)CCG>CCA	p.P217P	CACNB4_uc002txy.2_Silent_p.P183P|CACNB4_uc002txz.2_Silent_p.P199P|CACNB4_uc010fnz.2_Silent_p.P217P|CACNB4_uc002tyb.2_Silent_p.P183P	NM_000726	NP_000717	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4	217					axon guidance|membrane depolarization|synaptic transmission	cytosol|internal side of plasma membrane|plasma membrane|synapse|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.156)	Verapamil(DB00661)	GACGCATTGACGGTACAACAT	0.498													11	38	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	154996876	154996876	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:154996876C>A	uc002tyr.3	+	4	736	c.169C>A	c.(169-171)CCA>ACA	p.P57T	GALNT13_uc002tyt.3_Missense_Mutation_p.P57T|GALNT13_uc010foc.1_5'UTR	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	57	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						CCAAGAAGGGCCAGGAGAAAT	0.358													6	108	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162661006	162661006	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162661006A>G	uc002ubx.3	+	3	362	c.178A>G	c.(178-180)AAA>GAA	p.K60E	SLC4A10_uc010fpa.1_Missense_Mutation_p.K72E|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Missense_Mutation_p.K60E|SLC4A10_uc010zcs.1_Missense_Mutation_p.K71E	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	60	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						GGGAGGAAGAAAAAGCCATCG	0.438													10	48	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170062966	170062966	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170062966T>G	uc002ues.2	-	39	7477	c.7264A>C	c.(7264-7266)ATG>CTG	p.M2422L		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	2422	Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TCTAGAGACATGACAGTTCTT	0.413													74	128	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179474028	179474028	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179474028G>A	uc010zfg.1	-	222	44529	c.44305C>T	c.(44305-44307)CGA>TGA	p.R14769*	uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.R8464*|TTN_uc010zfi.1_Nonsense_Mutation_p.R8397*|TTN_uc010zfj.1_Nonsense_Mutation_p.R8272*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	15696							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAGAATCTCGGACGCGTAGC	0.453													21	30	---	---	---	---	PASS
CCDC141	285025	broad.mit.edu	37	2	179736925	179736925	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179736925G>T	uc002unf.1	-	3	346	c.289C>A	c.(289-291)CTT>ATT	p.L97I		NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	97	Potential.						protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			GTGGCTTTAAGCTGCCATGCC	0.443													10	69	---	---	---	---	PASS
DNAJC10	54431	broad.mit.edu	37	2	183608387	183608387	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183608387G>A	uc002uow.1	+	14	1669	c.1254G>A	c.(1252-1254)CCG>CCA	p.P418P	DNAJC10_uc002uox.1_RNA|DNAJC10_uc002uoy.1_RNA|DNAJC10_uc002uoz.1_Silent_p.P372P|DNAJC10_uc010fro.1_RNA	NM_018981	NP_061854	Q8IXB1	DJC10_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 10	418					apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|ER-associated protein catabolic process|glycerol ether metabolic process|negative regulation of protein phosphorylation|protein folding|response to endoplasmic reticulum stress	endoplasmic reticulum chaperone complex|endoplasmic reticulum lumen|extracellular region	ATPase activator activity|ATPase binding|chaperone binding|electron carrier activity|heat shock protein binding|misfolded protein binding|protein disulfide oxidoreductase activity|unfolded protein binding			ovary(1)|large_intestine(1)|breast(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			TTTTTCAGCCGTCTCTAGCAG	0.333													11	233	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196681528	196681528	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196681528C>A	uc002utj.3	-	51	9686	c.9585G>T	c.(9583-9585)AAG>AAT	p.K3195N		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3195					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TGGTGTCAATCTTTTTCTCTG	0.418													16	132	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196729055	196729055	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196729055G>C	uc002utj.3	-	41	7425	c.7324C>G	c.(7324-7326)CGC>GGC	p.R2442G		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2442	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TCCCGCTGGCGATCTAACTGA	0.448													9	121	---	---	---	---	PASS
MDH1B	130752	broad.mit.edu	37	2	207629992	207629992	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207629992C>T	uc002vbs.2	-	1	59	c.4G>A	c.(4-6)GCC>ACC	p.A2T	MDH1B_uc010ziw.1_RNA|MDH1B_uc010fui.2_Missense_Mutation_p.A2T|MDH1B_uc010fuj.2_5'UTR|MDH1B_uc002vbt.2_RNA|FASTKD2_uc002vbu.2_5'Flank|FASTKD2_uc002vbv.2_5'Flank|FASTKD2_uc002vbx.2_5'Flank|FASTKD2_uc002vbw.1_5'Flank	NM_001039845	NP_001034934	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	2					carbohydrate metabolic process|malate metabolic process|tricarboxylic acid cycle		binding|malate dehydrogenase activity			ovary(3)|kidney(1)	4				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		ACGAATTTGGCCATGGTCGAG	0.647													4	150	---	---	---	---	PASS
XRCC5	7520	broad.mit.edu	37	2	216981498	216981498	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216981498G>T	uc002vfy.2	+	3	392	c.252G>T	c.(250-252)ATG>ATT	p.M84I	XRCC5_uc002vfz.2_5'Flank	NM_021141	NP_066964	P13010	XRCC5_HUMAN	ATP-dependent DNA helicase II	84					double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|provirus integration|telomere maintenance|transcription, DNA-dependent	Ku70:Ku80 complex|nonhomologous end joining complex|nuclear telomere cap complex|nucleoplasm	ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|telomeric DNA binding|transcription regulatory region DNA binding			lung(1)|kidney(1)	2		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		GACATCTGATGCTACCAGATT	0.438								Direct_reversal_of_damage|NHEJ					122	227	---	---	---	---	PASS
C2orf62	375307	broad.mit.edu	37	2	219229479	219229479	+	Intron	SNP	A	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219229479A>C	uc002vhr.2	+						C2orf62_uc002vhs.2_Intron	NM_198559	NP_940961	Q7Z7H3	CB062_HUMAN	hypothetical protein LOC375307												0		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCGATGGGTGAGCTGCTGATG	0.587													16	192	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220342650	220342650	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220342650G>A	uc010fwg.2	+	22	4850	c.4850G>A	c.(4849-4851)CGC>CAC	p.R1617H		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	1617	Protein kinase 1.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		TACTTGCGGCGCATAGTGGAG	0.652													6	516	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227967494	227967494	+	Intron	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227967494A>T	uc010zlt.1	-							NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TTAACAGCAAATGATGCTTAC	0.398													26	202	---	---	---	---	PASS
DGKD	8527	broad.mit.edu	37	2	234368837	234368837	+	Intron	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234368837T>C	uc002vui.1	+						DGKD_uc002vuj.1_Intron|DGKD_uc010fyi.1_Intron	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TTCGGGTCCATAGGCATTTGA	0.552													90	132	---	---	---	---	PASS
ANO7	50636	broad.mit.edu	37	2	242149889	242149889	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242149889C>T	uc002wax.2	+	15	1730	c.1627C>T	c.(1627-1629)CGC>TGC	p.R543C		NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	543	Extracellular (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3						TTAGGCCTCTCGCATCGCCAG	0.637													50	104	---	---	---	---	PASS
TADA3	10474	broad.mit.edu	37	3	9831550	9831550	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9831550T>G	uc003bsx.1	-	3	853	c.305A>C	c.(304-306)AAG>ACG	p.K102T	TADA3_uc010hcn.1_Missense_Mutation_p.K102T|TADA3_uc003bsy.2_Missense_Mutation_p.K102T|ARPC4_uc003bsz.1_5'Flank|ARPC4_uc003bta.1_5'Flank|ARPC4_uc003btb.1_5'Flank|ARPC4_uc003btc.1_5'Flank	NM_006354	NP_006345	O75528	TADA3_HUMAN	transcriptional adaptor 3 isoform a	102					estrogen receptor signaling pathway|histone H3 acetylation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex|STAGA complex|transcription factor TFTC complex	ligand-dependent nuclear receptor binding|protein domain specific binding|sequence-specific DNA binding transcription factor activity				0						TTTCTGCTTCTTGGGCTTCCC	0.552													107	141	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38592834	38592834	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38592834C>T	uc003cio.2	-	28	5223	c.5029G>A	c.(5029-5031)GCC>ACC	p.A1677T	SCN5A_uc003cin.2_Missense_Mutation_p.A1676T|SCN5A_uc003cil.3_Missense_Mutation_p.A1677T|SCN5A_uc010hhi.2_Missense_Mutation_p.A1659T|SCN5A_uc010hhk.2_Missense_Mutation_p.A1644T|SCN5A_uc011ayr.1_Missense_Mutation_p.A1623T	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	1677	Helical; Name=S5 of repeat IV; (Potential).				blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	GCGAAGTTGGCCATGCCAAAG	0.552													7	891	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38740051	38740051	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38740051G>A	uc003ciq.2	-	27	4660	c.4660C>T	c.(4660-4662)CTG>TTG	p.L1554L		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	1554	IV.|Helical; Name=S3 of repeat IV; (Potential).				sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	GAAAAAATCAGGCCTTTAAAA	0.443													73	246	---	---	---	---	PASS
ULK4	54986	broad.mit.edu	37	3	41439615	41439615	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41439615C>A	uc003ckv.3	-	35	3834	c.3633G>T	c.(3631-3633)GAG>GAT	p.E1211D		NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4	1211							ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		CCTTTGGGTCCTCCTTGGATG	0.493													222	188	---	---	---	---	PASS
RTP3	83597	broad.mit.edu	37	3	46542119	46542119	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46542119C>G	uc003cps.1	+	2	497	c.429C>G	c.(427-429)ATC>ATG	p.I143M		NM_031440	NP_113628	Q9BQQ7	RTP3_HUMAN	transmembrane protein 7	143	Cytoplasmic (Potential).				detection of chemical stimulus involved in sensory perception of bitter taste|protein targeting to membrane	cytoplasm|integral to membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		TCAAGGACATCTCTCTTGAAG	0.483													117	324	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53787697	53787697	+	Silent	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53787697A>T	uc003dgv.3	+	29	3937	c.3774A>T	c.(3772-3774)GCA>GCT	p.A1258A	CACNA1D_uc003dgu.3_Silent_p.A1278A|CACNA1D_uc003dgy.3_Silent_p.A1258A|CACNA1D_uc003dgw.3_Silent_p.A925A|CACNA1D_uc003dgx.1_Silent_p.A406A	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	1258	IV.|Helical; Name=S2 of repeat IV; (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	AAGTCATCGCATTTAAGCCTA	0.458													45	89	---	---	---	---	PASS
ZBTB11	27107	broad.mit.edu	37	3	101390001	101390001	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101390001T>A	uc003dve.3	-	3	981	c.751A>T	c.(751-753)AGT>TGT	p.S251C	ZBTB11_uc003dvf.2_3'UTR	NM_014415	NP_055230	O95625	ZBT11_HUMAN	zinc finger protein ZNF-U69274	251	BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						GCCTCATGACTGGAAACAGCT	0.368													26	143	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108124257	108124257	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108124257A>T	uc003dxa.1	-	34	4781	c.4724T>A	c.(4723-4725)CTT>CAT	p.L1575H		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	1575	Potential.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						CAAGAGTTCAAGCTGGAAATG	0.318													26	59	---	---	---	---	PASS
KIAA2018	205717	broad.mit.edu	37	3	113374483	113374483	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113374483G>A	uc003eam.2	-	7	6457	c.6046C>T	c.(6046-6048)CTC>TTC	p.L2016F	KIAA2018_uc003eal.2_Missense_Mutation_p.L1960F	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717	2016					regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						CCAGTAGAGAGAGGAAGATGG	0.463													28	91	---	---	---	---	PASS
PRKCI	5584	broad.mit.edu	37	3	170016900	170016900	+	Splice_Site	SNP	T	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170016900T>G	uc003fgs.2	+	17	1941	c.1703_splice	c.e17+2	p.D568_splice	PRKCI_uc003fgt.2_Splice_Site_p.D123_splice	NM_002740	NP_002731	P41743	KPCI_HUMAN	protein kinase C, iota						anti-apoptosis|cellular membrane organization|cellular response to insulin stimulus|establishment or maintenance of epithelial cell apical/basal polarity|intracellular signal transduction|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|protein targeting to membrane|secretion|tight junction assembly|vesicle-mediated transport	cytosol|endosome|nucleus|polarisome	ATP binding|phospholipid binding|protein binding|protein kinase C activity|zinc ion binding			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			AGATGACGAGTAAGTAATTCT	0.323													18	197	---	---	---	---	PASS
SPATA16	83893	broad.mit.edu	37	3	172642018	172642018	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172642018T>C	uc003fin.3	-	8	1476	c.1318A>G	c.(1318-1320)ATT>GTT	p.I440V		NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	440					cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			GTGCTTCTAATAAAATCCAAT	0.348													11	440	---	---	---	---	PASS
CCDC39	339829	broad.mit.edu	37	3	180366114	180366114	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180366114C>A	uc010hxe.2	-	10	1316	c.1201G>T	c.(1201-1203)GTG>TTG	p.V401L	CCDC39_uc003fkn.2_RNA	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	401	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TTAAACAGCACACCTTTTATG	0.313													28	455	---	---	---	---	PASS
ATP11B	23200	broad.mit.edu	37	3	182605445	182605445	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182605445T>A	uc003flb.2	+	24	3044	c.2787T>A	c.(2785-2787)AGT>AGA	p.S929R	ATP11B_uc003flc.2_Missense_Mutation_p.S513R|ATP11B_uc011bqm.1_Missense_Mutation_p.S210T|ATP11B_uc010hxf.1_Missense_Mutation_p.S91R	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	929	Helical; (Potential).				aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			TGATATATAGTCTTTTGGAAC	0.343													27	517	---	---	---	---	PASS
EIF4G1	1981	broad.mit.edu	37	3	184039421	184039421	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184039421C>T	uc003fnp.2	+	10	1247	c.1049C>T	c.(1048-1050)CCT>CTT	p.P350L	EIF4G1_uc003fno.1_Missense_Mutation_p.P291L|EIF4G1_uc010hxw.1_Missense_Mutation_p.P186L|EIF4G1_uc003fnt.2_Missense_Mutation_p.P61L|EIF4G1_uc003fnq.2_Missense_Mutation_p.P263L|EIF4G1_uc003fnr.2_Missense_Mutation_p.P186L|EIF4G1_uc010hxx.2_Missense_Mutation_p.P357L|EIF4G1_uc003fns.2_Missense_Mutation_p.P310L|EIF4G1_uc010hxy.2_Missense_Mutation_p.P357L|EIF4G1_uc003fnv.3_Missense_Mutation_p.P350L|EIF4G1_uc003fnu.3_Missense_Mutation_p.P350L|EIF4G1_uc003fnw.2_Missense_Mutation_p.P357L|EIF4G1_uc003fnx.2_Missense_Mutation_p.P154L|EIF4G1_uc003fny.3_Missense_Mutation_p.P154L	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	350					insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCTCCCACCCCTTTGGCATCT	0.532													77	832	---	---	---	---	PASS
MASP1	5648	broad.mit.edu	37	3	186954193	186954193	+	Intron	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186954193G>T	uc003frh.1	-						MASP1_uc003fri.2_Missense_Mutation_p.A489E|MASP1_uc003frj.2_Missense_Mutation_p.A458E	NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform						complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		GATCCAGGACGCAGAGAGCAG	0.602													18	397	---	---	---	---	PASS
ATP13A4	84239	broad.mit.edu	37	3	193185167	193185167	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193185167G>T	uc003ftd.2	-	10	1160	c.1052C>A	c.(1051-1053)ACA>AAA	p.T351K	ATP13A4_uc003fte.1_Missense_Mutation_p.T351K|ATP13A4_uc011bsr.1_5'UTR|ATP13A4_uc010hzi.2_RNA|ATP13A4_uc003ftf.3_Missense_Mutation_p.T57K	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	351	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		GATAACCTCTGTTCCACAGAA	0.493													29	324	---	---	---	---	PASS
CLNK	116449	broad.mit.edu	37	4	10509582	10509582	+	Splice_Site	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10509582C>T	uc003gmo.3	-	17	1121	c.984_splice	c.e17+1	p.K328_splice		NM_052964	NP_443196	Q7Z7G1	CLNK_HUMAN	mast cell immunoreceptor signal transducer						immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity			ovary(1)	1						GAAGGCATTACCTTGTTCTCC	0.433													12	24	---	---	---	---	PASS
BOD1L	259282	broad.mit.edu	37	4	13603126	13603126	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13603126C>A	uc003gmz.1	-	10	5515	c.5398G>T	c.(5398-5400)GGA>TGA	p.G1800*	BOD1L_uc010idr.1_Nonsense_Mutation_p.G1137*	NM_148894	NP_683692	Q8NFC6	BOD1L_HUMAN	biorientation of chromosomes in cell division	1800							DNA binding			ovary(5)|breast(1)	6						GGCCCCTCTCCATCTTCTGTT	0.502													207	317	---	---	---	---	PASS
SHISA3	152573	broad.mit.edu	37	4	42403074	42403074	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42403074C>A	uc003gwp.2	+	2	541	c.323C>A	c.(322-324)GCG>GAG	p.A108E		NM_001080505	NP_001073974	A0PJX4	SHSA3_HUMAN	shisa homolog 3 precursor	108	Helical; (Potential).				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane				ovary(1)|skin(1)	2						ATCTTCATTGCGTTCATCATC	0.498													221	314	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47527587	47527587	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47527587A>C	uc003gxk.1	+	5	868	c.704A>C	c.(703-705)GAT>GCT	p.D235A	ATP10D_uc003gxj.3_Missense_Mutation_p.D235A	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	235	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						TCTGAAGTTGATCCTGAGAAG	0.338													38	49	---	---	---	---	PASS
SRD5A3	79644	broad.mit.edu	37	4	56225538	56225538	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56225538T>C	uc003hau.2	+	2	342	c.247T>C	c.(247-249)TCA>CCA	p.S83P		NM_024592	NP_078868	Q9H8P0	PORED_HUMAN	steroid 5 alpha-reductase 3	83	Helical; (Potential).				androgen biosynthetic process|dolichol metabolic process|dolichol-linked oligosaccharide biosynthetic process|polyprenol catabolic process	endoplasmic reticulum membrane|integral to membrane	3-oxo-5-alpha-steroid 4-dehydrogenase activity|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor				0	all_cancers(7;0.0308)|all_lung(4;0.00195)|Lung NSC(11;0.00431)|all_epithelial(27;0.0425)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.0179)			TTATATCATCTCAGTGCTGTG	0.423													14	840	---	---	---	---	PASS
CLOCK	9575	broad.mit.edu	37	4	56301641	56301641	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56301641G>T	uc003haz.1	-	24	3408	c.2482C>A	c.(2482-2484)CAA>AAA	p.Q828K	CLOCK_uc003hba.1_Missense_Mutation_p.Q828K|CLOCK_uc010igu.1_RNA	NM_004898	NP_004889	O15516	CLOCK_HUMAN	clock	828	Poly-Gln.				circadian rhythm|photoperiodism|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|transcription factor complex	DNA binding|histone acetyltransferase activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(2)|ovary(1)	3	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			CGGCTGAGTTGCTGCTGTTGC	0.527													16	232	---	---	---	---	PASS
POLR2B	5431	broad.mit.edu	37	4	57889495	57889495	+	Splice_Site	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57889495G>A	uc003hcl.1	+	19	2559	c.2516_splice	c.e19-1	p.G839_splice	POLR2B_uc011cae.1_Splice_Site_p.G832_splice|POLR2B_uc011caf.1_Splice_Site_p.G764_splice|POLR2B_uc003hcm.1_Splice_Site_p.G332_splice	NM_000938	NP_000929	P30876	RPB2_HUMAN	DNA directed RNA polymerase II polypeptide B						mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity|metal ion binding|protein binding|ribonucleoside binding			ovary(2)	2	Glioma(25;0.08)|all_neural(26;0.181)					TTTCCTCACAGGCATGAGGCA	0.438													44	113	---	---	---	---	PASS
FAM175A	84142	broad.mit.edu	37	4	84391519	84391519	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84391519G>A	uc003hou.2	-	5	378	c.313C>T	c.(313-315)CAT>TAT	p.H105Y	FAM175A_uc003hot.2_5'Flank|FAM175A_uc003hov.2_5'UTR	NM_139076	NP_620775	Q6UWZ7	F175A_HUMAN	coiled-coil domain containing 98	105	MPN-like.				chromatin modification|double-strand break repair|G2/M transition DNA damage checkpoint|positive regulation of DNA repair|response to ionizing radiation	BRCA1-A complex	polyubiquitin binding			kidney(1)	1						TGATCTGAATGACGACGGAAT	0.333													139	360	---	---	---	---	PASS
TRAM1L1	133022	broad.mit.edu	37	4	118005478	118005478	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118005478C>A	uc003ibv.3	-	1	1259	c.1072G>T	c.(1072-1074)GTA>TTA	p.V358L		NM_152402	NP_689615	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like	358	Cytoplasmic (Potential).				protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane				central_nervous_system(1)	1						GGACAGTCTACTCTATTTGAA	0.383													191	334	---	---	---	---	PASS
TRAM1L1	133022	broad.mit.edu	37	4	118005532	118005532	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118005532T>A	uc003ibv.3	-	1	1205	c.1018A>T	c.(1018-1020)AGA>TGA	p.R340*		NM_152402	NP_689615	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like	340	Cytoplasmic (Potential).				protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane				central_nervous_system(1)	1						TTAGAAGATCTCGACCGTTTC	0.398													216	320	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153247252	153247252	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247252C>T	uc003ims.2	-	10	1699	c.1550G>A	c.(1549-1551)GGA>GAA	p.G517E	FBXW7_uc011cii.1_Missense_Mutation_p.G517E|FBXW7_uc003imt.2_Missense_Mutation_p.G517E|FBXW7_uc011cih.1_Missense_Mutation_p.G341E|FBXW7_uc003imq.2_Missense_Mutation_p.G437E|FBXW7_uc003imr.2_Missense_Mutation_p.G399E	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	517	WD 4.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding			haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATCATATGCTCCACTAACAAC	0.443			Mis|N|D|F		colorectal|endometrial|T-ALL								99	145	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1441537	1441537	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1441537C>A	uc003jck.2	-	3	476	c.355G>T	c.(355-357)GCC>TCC	p.A119S		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	119					cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	TGGCCGAGGGCCAGCTCCATG	0.582													15	115	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11411724	11411724	+	Silent	SNP	G	T	T	rs143717087		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11411724G>T	uc003jfa.1	-	5	508	c.363C>A	c.(361-363)CTC>CTA	p.L121L	CTNND2_uc010itt.2_Silent_p.L30L|CTNND2_uc011cmy.1_Silent_p.L30L|CTNND2_uc011cmz.1_5'UTR|CTNND2_uc010itu.1_RNA	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	121					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						CCACCAGCTCGAGACCTGTTG	0.368													25	139	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21783478	21783478	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21783478G>A	uc010iuc.2	-	8	1840	c.1382C>T	c.(1381-1383)GCG>GTG	p.A461V	CDH12_uc011cno.1_Missense_Mutation_p.A421V|CDH12_uc003jgk.2_Missense_Mutation_p.A461V	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	461	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						AACTTTACTCGCAATTATGGA	0.378										HNSCC(59;0.17)			32	295	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23522525	23522525	+	Intron	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23522525C>A	uc003jgo.2	+							NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9						meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						GTAAGTGACACTTTTGGCCAC	0.433										HNSCC(3;0.000094)			179	159	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262532	45262532	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262532G>A	uc003jok.2	-	8	2189	c.2164C>T	c.(2164-2166)CCC>TCC	p.P722S		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	722	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GAGGCGGTGGGGGAGGCATAG	0.453													36	55	---	---	---	---	PASS
IPO11	51194	broad.mit.edu	37	5	61802098	61802098	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61802098C>T	uc003jtc.2	+	19	1886	c.1696C>T	c.(1696-1698)CAG>TAG	p.Q566*	IPO11_uc011cqr.1_Nonsense_Mutation_p.Q606*|IPO11_uc003jtd.1_RNA	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2	566	HEAT 7.					cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		ACTACTTTTTCAGTTACTGCA	0.333													18	67	---	---	---	---	PASS
SCAMP1	9522	broad.mit.edu	37	5	77771402	77771402	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77771402A>T	uc003kfl.2	+	11	1085	c.928A>T	c.(928-930)AAC>TAC	p.N310Y	SCAMP1_uc010jaa.2_RNA|SCAMP1_uc011ctc.1_RNA|SCAMP1_uc011ctd.1_RNA|SCAMP1_uc003kfm.2_RNA|SCAMP1_uc003kfn.2_Missense_Mutation_p.N48Y	NM_004866	NP_004857	O15126	SCAM1_HUMAN	secretory carrier membrane protein 1	310	Cytoplasmic (Potential).				post-Golgi vesicle-mediated transport|protein transport	integral to membrane|recycling endosome membrane|trans-Golgi network	protein binding				0		all_lung(232;0.000397)|Lung NSC(167;0.00105)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.9e-46)|Epithelial(54;9.4e-43)|all cancers(79;1.12e-37)		TGTGATGTCCAACAAAACTGT	0.458													4	21	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89968522	89968522	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89968522C>A	uc003kju.2	+	22	5008	c.4912C>A	c.(4912-4914)CCT>ACT	p.P1638T	GPR98_uc003kjt.2_5'UTR|GPR98_uc010jba.1_RNA	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	1638	Calx-beta 11.|Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TACATTCCTTCCTTGGCAGAG	0.378													81	194	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89989705	89989705	+	Splice_Site	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89989705A>T	uc003kju.2	+	33	7230	c.7134_splice	c.e33-2	p.S2378_splice	GPR98_uc003kjt.2_Splice_Site_p.S84_splice|GPR98_uc003kjv.2_5'Flank	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TCCACATTTTAGCGGAGGGCA	0.398													10	21	---	---	---	---	PASS
LNPEP	4012	broad.mit.edu	37	5	96358154	96358154	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:96358154T>C	uc003kmv.1	+	14	3041	c.2527T>C	c.(2527-2529)TTT>CTT	p.F843L	LNPEP_uc003kmw.1_Missense_Mutation_p.F829L	NM_005575	NP_005566	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase isoform 1	843	Extracellular (Potential).				cell-cell signaling|female pregnancy|proteolysis	extracellular region|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CATGAAACTGTTTGATGACTG	0.443													4	81	---	---	---	---	PASS
SLC22A4	6583	broad.mit.edu	37	5	131676399	131676399	+	Intron	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131676399T>A	uc003kwq.2	+						uc003kwr.3_Intron	NM_003059	NP_003050	Q9H015	S22A4_HUMAN	solute carrier family 22 member 4						body fluid secretion|sodium ion transport	apical plasma membrane|integral to plasma membrane|mitochondrion	ATP binding|carnitine transporter activity|cation:cation antiporter activity|PDZ domain binding|secondary active organic cation transmembrane transporter activity|symporter activity				0		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Carnitine(DB00583)	AAATGGTAAGTAGGACTTTTA	0.388													67	241	---	---	---	---	PASS
PCDHGA5	56110	broad.mit.edu	37	5	140744389	140744389	+	Silent	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140744389G>T	uc003lju.1	+	1	492	c.492G>T	c.(490-492)GTG>GTT	p.V164V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc011das.1_Silent_p.V164V	NM_018918	NP_061741	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5 isoform 1	164	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGTGGGTGTGAACTCTCTCC	0.517													21	67	---	---	---	---	PASS
PCDHGB3	56102	broad.mit.edu	37	5	140751506	140751506	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140751506C>T	uc003ljw.1	+	1	1545	c.1545C>T	c.(1543-1545)TTC>TTT	p.F515F	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGA6_uc003ljy.1_5'Flank|PCDHGB3_uc011dat.1_Silent_p.F515F|PCDHGA6_uc011dau.1_5'Flank	NM_018924	NP_061747	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3 isoform 1	515	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGTGGTGTTCGCGCAGCGAG	0.672													37	100	---	---	---	---	PASS
PCDHGC4	56098	broad.mit.edu	37	5	140865131	140865131	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140865131C>T	uc003lky.1	+	1	391	c.391C>T	c.(391-393)CCC>TCC	p.P131S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lkv.1_Intron|PCDHGC3_uc003lkw.1_Intron|PCDHGC4_uc011dbb.1_Missense_Mutation_p.P131S	NM_018928	NP_061751	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4 isoform 1	131	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGATCACGCCCCCCGTTTTCC	0.572													44	217	---	---	---	---	PASS
RELL2	285613	broad.mit.edu	37	5	141019991	141019991	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141019991C>A	uc003lli.2	+	7	1740	c.892C>A	c.(892-894)CAG>AAG	p.Q298K	RELL2_uc003llh.2_Missense_Mutation_p.Q298K|RELL2_uc003llg.2_Missense_Mutation_p.Q232K|RELL2_uc010jgf.2_Intron|FCHSD1_uc010jgg.2_3'UTR|FCHSD1_uc003llj.2_RNA|FCHSD1_uc003llk.2_3'UTR	NM_001130029	NP_001123501	Q8NC24	RELL2_HUMAN	RELT-like 2	298						integral to membrane|plasma membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCTCTACCACAGGGAGCAGG	0.517													39	180	---	---	---	---	PASS
FAM71B	153745	broad.mit.edu	37	5	156592781	156592781	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156592781G>C	uc003lwn.2	-	1	499	c.399C>G	c.(397-399)CAC>CAG	p.H133Q		NM_130899	NP_570969	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	133						nucleus				ovary(4)|pancreas(1)|skin(1)	6	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCTCATGATCGTGGATGGAGA	0.527													26	100	---	---	---	---	PASS
EBF1	1879	broad.mit.edu	37	5	158250303	158250303	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158250303T>C	uc010jip.2	-	8	961	c.659A>G	c.(658-660)AAT>AGT	p.N220S	EBF1_uc011ddw.1_Missense_Mutation_p.N87S|EBF1_uc011ddx.1_Missense_Mutation_p.N220S|EBF1_uc003lxl.3_Missense_Mutation_p.N197S	NM_024007	NP_076870	Q9UH73	COE1_HUMAN	early B-cell factor	220					multicellular organismal development	nucleus	DNA binding|metal ion binding		HMGA2/EBF1(2)	soft_tissue(2)|ovary(1)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCCATCCACATTGACTGTCGT	0.433			T	HMGA2	lipoma								15	61	---	---	---	---	PASS
PFN3	345456	broad.mit.edu	37	5	176827199	176827199	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176827199C>A	uc003mgl.2	-	1	439	c.379G>T	c.(379-381)GAA>TAA	p.E127*		NM_001029886	NP_001025057	P60673	PROF3_HUMAN	profilin 3	127					actin cytoskeleton organization	actin cytoskeleton|cytoplasm	actin binding				0	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGTATGAGTTCGTGCACCGTC	0.711													5	48	---	---	---	---	PASS
TBC1D9B	23061	broad.mit.edu	37	5	179297373	179297373	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179297373G>A	uc003mlh.2	-	16	2644	c.2607C>T	c.(2605-2607)GCC>GCT	p.A869A	TBC1D9B_uc003mli.2_Silent_p.A869A|TBC1D9B_uc003mlj.2_Silent_p.A869A|TBC1D9B_uc003mlg.2_Silent_p.A45A|TBC1D9B_uc011dgv.1_Silent_p.A45A|TBC1D9B_uc011dgw.1_Silent_p.A45A|TBC1D9B_uc003mlk.1_Silent_p.A27A	NM_198868	NP_942568	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	869						integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity			breast(1)|skin(1)	2	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGTCAGGCTGGCAAAGAGTT	0.632													71	234	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	9900633	9900633	+	Intron	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9900633T>A	uc003myg.1	-						uc010jog.1_Intron|uc003myh.1_Intron|uc003myi.2_RNA|uc003myj.1_Intron|uc003myk.1_RNA|uc003myn.2_Missense_Mutation_p.T168S|uc010joi.1_Missense_Mutation_p.T213S|uc010joh.1_RNA|uc011dif.1_Missense_Mutation_p.T172S|uc011dig.1_Missense_Mutation_p.T168S					Homo sapiens clone 958LR MRDS1 protein (MRDS1) mRNA, complete cds.																		TGAGCAGTGGTGGCTTCGCTG	0.453													59	70	---	---	---	---	PASS
CDKAL1	54901	broad.mit.edu	37	6	20955785	20955785	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20955785C>T	uc003ndc.1	+	10	1052	c.878C>T	c.(877-879)ACA>ATA	p.T293I	CDKAL1_uc003ndd.1_Missense_Mutation_p.T293I|CDKAL1_uc003nde.1_Missense_Mutation_p.T223I	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein	293					RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			CTTGGCATGACAAATCCGCCC	0.498													6	280	---	---	---	---	PASS
DCDC2	51473	broad.mit.edu	37	6	24357739	24357739	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24357739G>C	uc003ndx.2	-	1	542	c.240C>G	c.(238-240)ATC>ATG	p.I80M	DCDC2_uc003ndy.2_Missense_Mutation_p.I80M|KAAG1_uc003ndz.1_5'UTR	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	80	Doublecortin 1.				cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)				CCCCGCTCTGGATCTGGTCTA	0.612													5	183	---	---	---	---	PASS
LRRC16A	55604	broad.mit.edu	37	6	25500470	25500470	+	Intron	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25500470A>G	uc011djw.1	+						LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Intron	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						TGAGGTAAGAACACCCTTAGA	0.418													12	72	---	---	---	---	PASS
OR2B6	26212	broad.mit.edu	37	6	27925954	27925954	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27925954G>A	uc011dkx.1	+	1	936	c.936G>A	c.(934-936)AAG>AAA	p.K312K		NM_012367	NP_036499	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B,	312	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TCTTAATCAAGAAATAAGAAA	0.343													20	123	---	---	---	---	PASS
MUC21	394263	broad.mit.edu	37	6	30955025	30955025	+	Missense_Mutation	SNP	G	A	A	rs55763085		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30955025G>A	uc003nsh.2	+	2	1324	c.1073G>A	c.(1072-1074)AGC>AAC	p.S358N	MUC21_uc003nsi.1_RNA	NM_001010909	NP_001010909	Q5SSG8	MUC21_HUMAN	mucin 21 precursor	358	Ser-rich.|28 X 15 AA approximate tandem repeats.|22.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(1)|skin(1)	2						AGTGGGGCCAGCACAGCCACC	0.642													5	443	---	---	---	---	PASS
HLA-DPA1	3113	broad.mit.edu	37	6	33041352	33041352	+	5'UTR	SNP	T	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33041352T>G	uc003ocs.1	-	1					HLA-DPA1_uc010juk.2_5'UTR|HLA-DPA1_uc003oct.1_5'UTR|HLA-DPB1_uc011dqn.1_5'Flank|HLA-DPB1_uc003ocu.1_5'Flank|HLA-DPB1_uc011dqo.1_5'Flank|HLA-DPB1_uc011dqp.1_5'Flank	NM_033554	NP_291032	P20036	DPA1_HUMAN	major histocompatibility complex, class II, DP						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity			skin(1)	1						GCGCATGTTGTGGGGTCTATA	0.532													8	268	---	---	---	---	PASS
UHRF1BP1	54887	broad.mit.edu	37	6	34789719	34789719	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34789719A>T	uc003oju.3	+	3	467	c.233A>T	c.(232-234)CAC>CTC	p.H78L	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	78										ovary(3)	3						TTGAAGACACACCCTATTTGC	0.463													50	289	---	---	---	---	PASS
DEF6	50619	broad.mit.edu	37	6	35277562	35277562	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35277562A>G	uc003okk.2	+	2	251	c.212A>G	c.(211-213)TAC>TGC	p.Y71C	DEF6_uc010jvs.2_Missense_Mutation_p.Y71C|DEF6_uc010jvt.2_5'UTR	NM_022047	NP_071330	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog	71						cytoplasm|nucleus|plasma membrane					0						TACATGCCCTACCTCAACAAG	0.582													44	94	---	---	---	---	PASS
PPARD	5467	broad.mit.edu	37	6	35393786	35393786	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35393786G>A	uc003okm.2	+	8	1565	c.1256G>A	c.(1255-1257)CGG>CAG	p.R419Q	PPARD_uc003okn.2_Missense_Mutation_p.R419Q|PPARD_uc011dtb.1_Missense_Mutation_p.R380Q|PPARD_uc011dtc.1_Missense_Mutation_p.R321Q	NM_006238	NP_006229	Q03181	PPARD_HUMAN	peroxisome proliferative activated receptor,	419	Ligand-binding.				apoptosis|axon ensheathment|cholesterol metabolic process|decidualization|embryo implantation|fatty acid beta-oxidation|fatty acid transport|generation of precursor metabolites and energy|glucose metabolic process|glucose transport|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fat cell differentiation|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|linoleic acid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1					Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	ATGATGCAGCGGATCAAGAAG	0.607													13	170	---	---	---	---	PASS
C6orf64	55776	broad.mit.edu	37	6	39073367	39073367	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39073367G>C	uc003ook.1	-	2	393	c.393C>G	c.(391-393)TTC>TTG	p.F131L	C6orf64_uc011dty.1_RNA|C6orf64_uc003oom.1_RNA	NM_018322	NP_060792	Q9NPB0	CF064_HUMAN	hypothetical protein LOC55776	131						integral to membrane					0						ACATCCAATAGAACAAGGACA	0.502													78	525	---	---	---	---	PASS
MEP1A	4224	broad.mit.edu	37	6	46800830	46800830	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46800830G>C	uc010jzh.1	+	11	1206	c.1164G>C	c.(1162-1164)TGG>TGC	p.W388C	MEP1A_uc011dwg.1_Missense_Mutation_p.W110C|MEP1A_uc011dwh.1_Missense_Mutation_p.W416C|MEP1A_uc011dwi.1_Missense_Mutation_p.W288C	NM_005588	NP_005579	Q16819	MEP1A_HUMAN	meprin A alpha precursor	388	Extracellular (Potential).|MAM.				digestion|proteolysis	extracellular space|integral to plasma membrane|soluble fraction	metalloendopeptidase activity|zinc ion binding			pancreas(2)|ovary(1)	3			Lung(136;0.192)			ACCACAATTGGAAAATTGCCC	0.368													43	299	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56469410	56469410	+	Intron	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56469410T>C	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Missense_Mutation_p.E2802G	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AACCTCCTTTTCTTGGGATCT	0.353													12	367	---	---	---	---	PASS
LGSN	51557	broad.mit.edu	37	6	63990933	63990933	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63990933C>T	uc003peh.2	-	4	557	c.523G>A	c.(523-525)GTG>ATG	p.V175M	LGSN_uc003pei.2_Missense_Mutation_p.V175M	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	175					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	TCACCAGTCACAGTGAAGGTA	0.458													47	100	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	73000538	73000538	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73000538G>A	uc003pga.2	+	25	3788	c.3711G>A	c.(3709-3711)TCG>TCA	p.S1237S	RIMS1_uc011dyb.1_Intron|RIMS1_uc003pgc.2_Intron|RIMS1_uc010kaq.2_Intron|RIMS1_uc011dyc.1_Intron|RIMS1_uc010kar.2_Intron|RIMS1_uc011dyd.1_Intron|RIMS1_uc003pgf.2_Intron|RIMS1_uc003pgg.2_Intron|RIMS1_uc003pgi.2_Intron|RIMS1_uc003pgh.2_Intron|RIMS1_uc003pgd.2_Intron|RIMS1_uc003pge.2_Intron|RIMS1_uc011dye.1_Intron|RIMS1_uc011dyf.1_Intron	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1237					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CTGGAGGGTCGGCGCCACCTT	0.552													15	39	---	---	---	---	PASS
SCML4	256380	broad.mit.edu	37	6	108066209	108066209	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108066209C>T	uc010kdf.2	-	5	877	c.626G>A	c.(625-627)AGG>AAG	p.R209K	SCML4_uc003prz.3_Missense_Mutation_p.R151K|SCML4_uc011eam.1_Missense_Mutation_p.R209K|SCML4_uc003psa.3_Missense_Mutation_p.R180K	NM_198081	NP_932347	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4	209					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		ACTGCAGCCCCTGGGGAAGGG	0.612													83	150	---	---	---	---	PASS
HS3ST5	222537	broad.mit.edu	37	6	114378471	114378471	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114378471A>G	uc003pwg.3	-	2	1023	c.991T>C	c.(991-993)TTT>CTT	p.F331L	uc003pwf.2_Intron|HS3ST5_uc003pwh.3_Missense_Mutation_p.F331L	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)	331	Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		TTTTGATTAAAAGGATGAAAG	0.413													44	239	---	---	---	---	PASS
LATS1	9113	broad.mit.edu	37	6	150001043	150001043	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150001043C>T	uc003qmu.1	-	5	3109	c.2561G>A	c.(2560-2562)AGA>AAA	p.R854K	LATS1_uc010kif.1_Missense_Mutation_p.R749K|LATS1_uc003qmv.1_Missense_Mutation_p.R854K	NM_004690	NP_004681	O95835	LATS1_HUMAN	LATS homolog 1	854	Protein kinase.				cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		GTGTGTCCATCTGAAGCCAGT	0.289													29	130	---	---	---	---	PASS
SLC22A1	6580	broad.mit.edu	37	6	160557378	160557378	+	Intron	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160557378G>T	uc003qtc.2	+						SLC22A1_uc003qtd.2_Intron	NM_003057	NP_003048	O15245	S22A1_HUMAN	solute carrier family 22 member 1 isoform a							basolateral plasma membrane|integral to plasma membrane|membrane fraction	organic cation transmembrane transporter activity|protein binding				0		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)		TGAAATCTAGGAAGGGGTATC	0.473													33	55	---	---	---	---	PASS
SLC29A4	222962	broad.mit.edu	37	7	5331402	5331402	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5331402C>T	uc003sod.2	+	5	655	c.494C>T	c.(493-495)GCC>GTC	p.A165V	SLC29A4_uc011jwg.1_RNA|SLC29A4_uc003soc.2_Missense_Mutation_p.A165V|SLC29A4_uc003soe.2_Missense_Mutation_p.P153S	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside	165	Cytoplasmic (Potential).				nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)		CGGGACCAGGCCTACGCCATC	0.637													49	159	---	---	---	---	PASS
DGKB	1607	broad.mit.edu	37	7	14661004	14661004	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14661004T>C	uc003ssz.2	-	14	1473	c.1286A>G	c.(1285-1287)CAG>CGG	p.Q429R	DGKB_uc011jxt.1_Missense_Mutation_p.Q410R|DGKB_uc003sta.2_Missense_Mutation_p.Q429R|DGKB_uc011jxu.1_Missense_Mutation_p.Q428R	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1	429					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	AAATCATACCTGCAGGCCTTG	0.363													17	29	---	---	---	---	PASS
SNX13	23161	broad.mit.edu	37	7	17879631	17879631	+	Intron	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17879631T>A	uc003stw.1	-						SNX13_uc003stv.2_Intron|SNX13_uc010kuc.2_Intron			Q9Y5W8	SNX13_HUMAN	SubName: Full=Putative uncharacterized protein SNX13; SubName: Full=Sorting nexin 13, isoform CRA_g;						cell communication|intracellular protein transport|negative regulation of signal transduction|positive regulation of GTPase activity	early endosome membrane	phosphatidylinositol binding|signal transducer activity			central_nervous_system(2)|kidney(1)	3	Lung NSC(10;0.0261)|all_lung(11;0.0521)					AATCTAGCAATCAAAAATCCA	0.368													15	54	---	---	---	---	PASS
CPVL	54504	broad.mit.edu	37	7	29152388	29152388	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29152388A>T	uc003szv.2	-	3	339	c.220T>A	c.(220-222)TAT>AAT	p.Y74N	CPVL_uc003szw.2_Missense_Mutation_p.Y74N|CPVL_uc003szx.2_Missense_Mutation_p.Y74N	NM_031311	NP_112601	Q9H3G5	CPVL_HUMAN	serine carboxypeptidase vitellogenic-like	74					proteolysis		protein binding|serine-type carboxypeptidase activity			ovary(2)	2						AAGCCGGCATAACTCTTCATG	0.453													41	125	---	---	---	---	PASS
FAM188B	84182	broad.mit.edu	37	7	30868295	30868295	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30868295G>A	uc003tbt.2	+	6	1151	c.1074G>A	c.(1072-1074)AGG>AGA	p.R358R	FAM188B_uc010kwe.2_Silent_p.R329R	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	358											0						TATTTTCCAGGAAAAATCAGT	0.408													135	404	---	---	---	---	PASS
BMPER	168667	broad.mit.edu	37	7	34086026	34086026	+	Intron	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34086026C>T	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						GGGTGAGTTACTATTTTCAGG	0.438													78	177	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48522715	48522715	+	Silent	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48522715T>A	uc003toq.2	+	47	13162	c.13137T>A	c.(13135-13137)GCT>GCA	p.A4379A	ABCA13_uc010kys.1_Silent_p.A1454A|ABCA13_uc010kyt.1_RNA|ABCA13_uc010kyu.1_Silent_p.A109A	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	4379					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						CCAGTGAAGCTGGAGGTGCAA	0.373													15	36	---	---	---	---	PASS
HGF	3082	broad.mit.edu	37	7	81392130	81392130	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81392130G>A	uc003uhl.2	-	2	312	c.147C>T	c.(145-147)ACC>ACT	p.T49T	HGF_uc003uhm.2_Silent_p.T49T|HGF_uc003uhn.1_Silent_p.T49T|HGF_uc003uho.1_Silent_p.T49T|HGF_uc003uhp.2_Silent_p.T49T	NM_000601	NP_000592	P14210	HGF_HUMAN	hepatocyte growth factor isoform 1	49	PAN.				epithelial to mesenchymal transition|mitosis|platelet activation|platelet degranulation|proteolysis|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling	platelet alpha granule lumen	growth factor activity|serine-type endopeptidase activity			ovary(2)|central_nervous_system(2)	4						TTTTGATTAGGGTAGTCTTTG	0.299													33	97	---	---	---	---	PASS
SLC25A40	55972	broad.mit.edu	37	7	87477196	87477196	+	Silent	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87477196T>A	uc003uje.2	-	7	780	c.429A>T	c.(427-429)ATA>ATT	p.I143I		NM_018843	NP_061331	Q8TBP6	S2540_HUMAN	mitochondrial carrier family protein	143	Helical; Name=3; (Potential).|Solcar 2.				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding			haematopoietic_and_lymphoid_tissue(1)	1	Esophageal squamous(14;0.00202)					CAACAATTGGTATGCAGGTTT	0.348													31	80	---	---	---	---	PASS
TFPI2	7980	broad.mit.edu	37	7	93519463	93519463	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93519463C>T	uc003umy.1	-	2	332	c.257G>A	c.(256-258)TGC>TAC	p.C86Y	GNGT1_uc003umx.1_Intron|TFPI2_uc003umz.1_Missense_Mutation_p.C86Y|TFPI2_uc003una.1_Missense_Mutation_p.C75Y|TFPI2_uc003unb.1_Missense_Mutation_p.C86Y|TFPI2_uc010lfg.1_Intron	NM_006528	NP_006519	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2 precursor	86	BPTI/Kunitz inhibitor 1.				blood coagulation	proteinaceous extracellular matrix	extracellular matrix structural constituent|serine-type endopeptidase inhibitor activity			pancreas(1)	1	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			TATCCTCCAGCAAGCATCGTC	0.612													32	99	---	---	---	---	PASS
SGCE	8910	broad.mit.edu	37	7	94257675	94257675	+	Intron	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94257675G>C	uc003unl.2	-						SGCE_uc003unm.2_Intron|SGCE_uc003unn.2_Intron|SGCE_uc011kic.1_Intron|SGCE_uc011kid.1_Intron	NM_003919	NP_003910	O43556	SGCE_HUMAN	sarcoglycan, epsilon isoform 2						cell-matrix adhesion|muscle organ development	cytoplasm|cytoskeleton|integral to plasma membrane|sarcoglycan complex|sarcolemma	calcium ion binding			ovary(1)	1	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ATCTCGCCTAGATAAGAAACA	0.328													16	37	---	---	---	---	PASS
COPS6	10980	broad.mit.edu	37	7	99688910	99688910	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99688910C>T	uc003usu.2	+	8	730	c.699C>T	c.(697-699)AGC>AGT	p.S233S		NM_006833	NP_006824	Q7L5N1	CSN6_HUMAN	COP9 signalosome subunit 6	233	Interaction with Vpr.				cullin deneddylation|interspecies interaction between organisms	cytoplasm|signalosome	protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TGCTGCACAGCCGCGTCAAGC	0.587													6	727	---	---	---	---	PASS
ACHE	43	broad.mit.edu	37	7	100491082	100491082	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100491082G>T	uc003uxd.2	-	1	928	c.772C>A	c.(772-774)CTG>ATG	p.L258M	ACHE_uc003uxe.2_Missense_Mutation_p.L258M|ACHE_uc003uxf.2_Missense_Mutation_p.L258M|ACHE_uc003uxg.2_Missense_Mutation_p.L258M|ACHE_uc003uxh.2_Missense_Mutation_p.L258M|ACHE_uc003uxi.2_Missense_Mutation_p.L258M|ACHE_uc003uxj.1_Missense_Mutation_p.L377M	NM_000665	NP_000656	P22303	ACES_HUMAN	acetylcholinesterase isoform E4-E6 precursor	258					acetylcholine catabolic process in synaptic cleft|amyloid precursor protein metabolic process|cell adhesion|cell proliferation|choline metabolic process|DNA replication|muscle organ development|neurotransmitter biosynthetic process|osteoblast development|positive regulation of protein secretion|regulation of axonogenesis|regulation of dendrite morphogenesis|response to wounding|synapse assembly	anchored to membrane|axon|basal lamina|cell junction|cell surface|dendrite|endoplasmic reticulum lumen|extracellular space|Golgi apparatus|neuromuscular junction|nucleus|perinuclear region of cytoplasm|postsynaptic membrane|presynaptic membrane|synaptic cleft	acetylcholine binding|acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|collagen binding|laminin-1 binding|protein homodimerization activity|serine hydrolase activity			skin(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Atropine(DB00572)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium bromide(DB00944)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tacrine(DB00382)|Tubocurarine(DB01199)	CCGCTCTGCAGCACGGCCCTG	0.721													27	100	---	---	---	---	PASS
PRKAR2B	5577	broad.mit.edu	37	7	106781375	106781375	+	Silent	SNP	T	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106781375T>G	uc003vdx.2	+	5	739	c.564T>G	c.(562-564)GGT>GGG	p.G188G		NM_002736	NP_002727	P31323	KAP3_HUMAN	cAMP-dependent protein kinase, regulatory	188	cAMP 1.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|G2/M transition of mitotic cell cycle|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1						GTGACGATGGTGACAACTTTT	0.338													66	151	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111638559	111638559	+	Splice_Site	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111638559C>T	uc003vfx.2	-	4	432	c.163_splice	c.e4-1	p.G55_splice	DOCK4_uc003vfy.2_Splice_Site_p.G55_splice|DOCK4_uc003vga.1_Splice_Site|DOCK4_uc010ljt.1_Splice_Site_p.G55_splice|DOCK4_uc003vgb.1_Splice_Site	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				GAAATATACCCTGGAAAAGAA	0.393													5	5	---	---	---	---	PASS
PDIA4	9601	broad.mit.edu	37	7	148702263	148702263	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148702263G>C	uc003wff.2	-	9	1774	c.1492C>G	c.(1492-1494)CTC>GTC	p.L498V		NM_004911	NP_004902	P13667	PDIA4_HUMAN	protein disulfide isomerase A4 precursor	498					cell redox homeostasis|glycerol ether metabolic process|protein secretion	endoplasmic reticulum lumen|melanosome	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			lung(5)|ovary(1)	6	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			AACTCGCGGAGGGTGTCAGAG	0.602													194	588	---	---	---	---	PASS
AGAP3	116988	broad.mit.edu	37	7	150815341	150815341	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150815341G>T	uc003wjg.1	+	6	754	c.751G>T	c.(751-753)GCC>TCC	p.A251S	AGAP3_uc003wje.1_Missense_Mutation_p.A23S|AGAP3_uc003wjf.1_Missense_Mutation_p.A251S|AGAP3_uc010lpy.1_Missense_Mutation_p.A251S|AGAP3_uc003wjh.1_Missense_Mutation_p.A431S	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN	centaurin, gamma 3 isoform a	215	Small GTPase-like.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3						CGACAGCAGAGCCCGCAAGCT	0.597													104	287	---	---	---	---	PASS
SH2D4A	63898	broad.mit.edu	37	8	19218777	19218777	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19218777A>C	uc003wzb.2	+	6	994	c.658A>C	c.(658-660)AAG>CAG	p.K220Q	SH2D4A_uc011kym.1_Missense_Mutation_p.K175Q|SH2D4A_uc003wzc.2_Missense_Mutation_p.K220Q	NM_022071	NP_071354	Q9H788	SH24A_HUMAN	SH2 domain containing 4A	220						cytoplasm|nucleus	protein binding				0				Colorectal(111;0.0732)		AGAGAGAACGAAGCAGATTTG	0.348													22	35	---	---	---	---	PASS
ENTPD4	9583	broad.mit.edu	37	8	23305380	23305380	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23305380G>A	uc003xdl.2	-	4	389	c.225C>T	c.(223-225)ACC>ACT	p.T75T	ENTPD4_uc011kzu.1_Silent_p.T75T|ENTPD4_uc003xdm.2_Silent_p.T75T|ENTPD4_uc011kzv.1_Silent_p.T75T|ENTPD4_uc011kzw.1_Silent_p.T41T	NM_004901	NP_004892	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	75	Lumenal (Potential).				UDP catabolic process	autophagic vacuole membrane|cytoplasmic vesicle|integral to Golgi membrane	uridine-diphosphatase activity			ovary(1)|kidney(1)	2		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		CTTCAATGTCGGTAACTCGTG	0.433													6	225	---	---	---	---	PASS
ESCO2	157570	broad.mit.edu	37	8	27657189	27657189	+	Silent	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27657189G>T	uc003xgg.2	+	10	1712	c.1629G>T	c.(1627-1629)CTG>CTT	p.L543L	ESCO2_uc010luy.1_RNA	NM_001017420	NP_001017420	Q56NI9	ESCO2_HUMAN	establishment of cohesion 1 homolog 2	543					cell cycle|post-translational protein acetylation|regulation of DNA replication	chromatin|nucleus	acyltransferase activity|metal ion binding			central_nervous_system(1)	1		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|KIRC - Kidney renal clear cell carcinoma(542;0.0955)|Kidney(114;0.115)|Colorectal(74;0.132)		TTTTCAGACTGAAGAGAAGAA	0.448									SC_Phocomelia_syndrome				5	332	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32616829	32616829	+	Silent	SNP	C	T	T	rs79631951		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32616829C>T	uc003xiv.2	+	10	1453	c.936C>T	c.(934-936)TAC>TAT	p.Y312Y	NRG1_uc011lbf.1_Silent_p.Y309Y|NRG1_uc010lvo.2_Silent_p.Y309Y|NRG1_uc003xiu.2_Silent_p.Y317Y|NRG1_uc003xiw.2_Silent_p.Y309Y|NRG1_uc003xit.2_Silent_p.Y312Y|NRG1_uc010lvr.2_Silent_p.Y54Y|NRG1_uc010lvs.2_Silent_p.Y54Y|NRG1_uc010lvp.2_Silent_p.Y266Y|NRG1_uc010lvq.2_Silent_p.Y249Y|NRG1_uc011lbg.1_Silent_p.Y158Y|NRG1_uc011lbh.1_Silent_p.Y155Y|NRG1_uc003xja.2_Silent_p.Y123Y	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha	312	Cytoplasmic (Potential).				activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TCCAGCAATACGTATCTAAAA	0.383													34	116	---	---	---	---	PASS
LETM2	137994	broad.mit.edu	37	8	38257893	38257893	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38257893A>T	uc003xlm.1	+	5	779	c.608A>T	c.(607-609)GAT>GTT	p.D203V	LETM2_uc011lbn.1_Missense_Mutation_p.D47V|LETM2_uc003xll.1_Missense_Mutation_p.D155V|LETM2_uc003xln.1_Missense_Mutation_p.D47V|LETM2_uc003xlo.1_Missense_Mutation_p.D47V	NM_144652	NP_653253	Q2VYF4	LETM2_HUMAN	leucine zipper-EF-hand containing transmembrane	250	LETM1.|Mitochondrial matrix (Potential).					integral to membrane|mitochondrial inner membrane					0	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)			AAGATGGGCGATGCCTCTACA	0.438													95	316	---	---	---	---	PASS
MCM4	4173	broad.mit.edu	37	8	48883428	48883428	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48883428A>T	uc003xqk.1	+	12	1887	c.1792A>T	c.(1792-1794)ATT>TTT	p.I598F	MCM4_uc003xql.1_Missense_Mutation_p.I598F|MCM4_uc011ldi.1_Missense_Mutation_p.I585F	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	598	MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				GACTCTGTCCATTGCAAAGGT	0.473													64	146	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53084631	53084631	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53084631C>G	uc003xqz.2	-	5	946	c.790G>C	c.(790-792)GCA>CCA	p.A264P	ST18_uc011ldq.1_5'UTR|ST18_uc011ldr.1_Missense_Mutation_p.A229P|ST18_uc011lds.1_Missense_Mutation_p.A169P|ST18_uc003xra.2_Missense_Mutation_p.A264P|ST18_uc003xrb.2_Missense_Mutation_p.A264P	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	264						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				AGGGGTTCTGCGAGAGCATTC	0.488													76	238	---	---	---	---	PASS
XKR4	114786	broad.mit.edu	37	8	56270299	56270299	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56270299A>G	uc003xsf.2	+	2	900	c.868A>G	c.(868-870)AGG>GGG	p.R290G		NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related	290						integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)			TGACAGATGGAGGTTTTACTG	0.433													60	170	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	68934349	68934349	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68934349A>G	uc003xxv.1	+	4	442	c.415A>G	c.(415-417)ATA>GTA	p.I139V	PREX2_uc003xxu.1_Missense_Mutation_p.I139V|PREX2_uc011lez.1_Missense_Mutation_p.I74V	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	139	DH.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						ACTCAACAAAATAAGAACAAT	0.328													20	65	---	---	---	---	PASS
CA3	761	broad.mit.edu	37	8	86354334	86354334	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86354334C>T	uc003ydj.2	+	3	348	c.265C>T	c.(265-267)CGA>TGA	p.R89*	CA3_uc011lfv.1_RNA	NM_005181	NP_005172	P07451	CAH3_HUMAN	carbonic anhydrase III	89					one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0						TGGACCCTACCGACTTCGCCA	0.507													68	152	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	101014595	101014595	+	Intron	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101014595A>T	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron|RGS22_uc011lgz.1_Intron	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			GATCCATGCTAAAATGAAAAC	0.338													6	107	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105361645	105361645	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105361645G>C	uc003ylx.1	+	2	914	c.865G>C	c.(865-867)GAA>CAA	p.E289Q		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	289					osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GACTCCTAAAGAAAGGAAAAA	0.483													17	433	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113246591	113246591	+	Intron	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113246591T>A	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TAACTATACTTACAAAGCCAT	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			16	313	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113318395	113318395	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113318395G>T	uc003ynu.2	-	51	8071	c.7912C>A	c.(7912-7914)CCA>ACA	p.P2638T	CSMD3_uc003yns.2_Missense_Mutation_p.P1840T|CSMD3_uc003ynt.2_Missense_Mutation_p.P2598T|CSMD3_uc011lhx.1_Missense_Mutation_p.P2534T	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2638	Extracellular (Potential).|Sushi 15.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CCATTTGTTGGAGCTTTAGGA	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			54	111	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113649179	113649179	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113649179G>C	uc003ynu.2	-	22	3741	c.3582C>G	c.(3580-3582)ATC>ATG	p.I1194M	CSMD3_uc003yns.2_Missense_Mutation_p.I466M|CSMD3_uc003ynt.2_Missense_Mutation_p.I1154M|CSMD3_uc011lhx.1_Missense_Mutation_p.I1090M	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1194	Sushi 6.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AGTTGAACCCGATTCGACTAC	0.468										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			90	210	---	---	---	---	PASS
WDR67	93594	broad.mit.edu	37	8	124157029	124157029	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124157029A>G	uc003ypp.1	+	20	2998	c.2908A>G	c.(2908-2910)AGA>GGA	p.R970G	WDR67_uc011lig.1_Missense_Mutation_p.R874G|WDR67_uc011lih.1_Missense_Mutation_p.R860G|WDR67_uc003ypq.1_RNA|WDR67_uc003yps.1_Missense_Mutation_p.R604G|WDR67_uc003ypt.1_Missense_Mutation_p.R362G|WDR67_uc003ypu.1_Missense_Mutation_p.R362G	NM_145647	NP_663622	Q96DN5	WDR67_HUMAN	WD repeat domain 67 isoform 1	970						centrosome	Rab GTPase activator activity			skin(1)	1	Lung NSC(37;7e-10)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			AGATGCGTCTAGAAAGTGGTT	0.388													62	129	---	---	---	---	PASS
ATAD2	29028	broad.mit.edu	37	8	124369834	124369834	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124369834A>T	uc003yqh.3	-	12	1633	c.1525T>A	c.(1525-1527)TCT>ACT	p.S509T	ATAD2_uc011lii.1_Missense_Mutation_p.S300T|ATAD2_uc003yqi.3_RNA|ATAD2_uc003yqj.2_Missense_Mutation_p.S509T	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	509					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TGTCTTTCAGATTCTCCTACC	0.393													69	129	---	---	---	---	PASS
ASAP1	50807	broad.mit.edu	37	8	131179778	131179778	+	Intron	SNP	T	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131179778T>G	uc003yta.1	-						ASAP1_uc003ysz.1_Intron|ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						TGTAAACCACTTACTTCTTTC	0.383													6	808	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139263206	139263206	+	Silent	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139263206C>A	uc003yuy.2	-	6	591	c.420G>T	c.(418-420)CTG>CTT	p.L140L	FAM135B_uc003yux.2_Silent_p.L41L|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	140										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GGTGGAAGTGCAGGCCAAGCG	0.602										HNSCC(54;0.14)			145	361	---	---	---	---	PASS
ZNF623	9831	broad.mit.edu	37	8	144732305	144732305	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144732305T>G	uc003yzd.2	+	1	352	c.263T>G	c.(262-264)ATC>AGC	p.I88S	ZNF623_uc011lkp.1_Missense_Mutation_p.I48S|ZNF623_uc003yzc.2_Missense_Mutation_p.I48S	NM_014789	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623 isoform 1	88					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CATTGGAAGATCCAGACAGGA	0.522													8	383	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144946303	144946303	+	Silent	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144946303G>T	uc003zaa.1	-	1	1132	c.1119C>A	c.(1117-1119)TCC>TCA	p.S373S		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	373	Plectin 8.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGGGGATTTGGGAGCCACTGA	0.662													5	18	---	---	---	---	PASS
RFX3	5991	broad.mit.edu	37	9	3330505	3330505	+	Silent	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3330505C>A	uc003zhr.2	-	5	540	c.228G>T	c.(226-228)ACG>ACT	p.T76T	RFX3_uc010mhd.2_Silent_p.T76T|RFX3_uc003zhs.1_Silent_p.T76T|RFX3_uc003zht.1_Silent_p.T76T|RFX3_uc010mhe.1_Silent_p.T76T	NM_134428	NP_602304	P48380	RFX3_HUMAN	regulatory factor X3 isoform b	76					cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		TGTAAGGATACGTTGTTGTTC	0.353													141	93	---	---	---	---	PASS
TESK1	7016	broad.mit.edu	37	9	35609289	35609289	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35609289G>A	uc003zxa.2	+	10	1767	c.1431G>A	c.(1429-1431)CCG>CCA	p.P477P	TESK1_uc003zwz.1_RNA|TESK1_uc010mks.2_Silent_p.P317P	NM_006285	NP_006276	Q15569	TESK1_HUMAN	testis-specific protein kinase 1	477					cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GCCCTGAGCCGGAACCTCCAG	0.667													25	234	---	---	---	---	PASS
NPR2	4882	broad.mit.edu	37	9	35802240	35802240	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35802240G>A	uc003zyd.2	+	10	1670	c.1670G>A	c.(1669-1671)CGC>CAC	p.R557H	NPR2_uc010mlb.2_Missense_Mutation_p.R557H	NM_003995	NP_003986	P20594	ANPRB_HUMAN	natriuretic peptide receptor B precursor	557	Protein kinase.|Cytoplasmic (Potential).				intracellular signal transduction|ossification|receptor guanylyl cyclase signaling pathway|regulation of blood pressure	integral to membrane|plasma membrane	GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|protein kinase activity|transmembrane receptor activity			ovary(2)|stomach(1)	3	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	AATAAGAAGCGCATTGAGCTG	0.433													79	240	---	---	---	---	PASS
FOXB2	442425	broad.mit.edu	37	9	79634612	79634612	+	Silent	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79634612G>T	uc004ako.1	+	1	42	c.42G>T	c.(40-42)CCG>CCT	p.P14P		NM_001013735	NP_001013757	Q5VYV0	FOXB2_HUMAN	forkhead box B2	14	Fork-head.				brain development|embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0						ACCAAAAACCGCCCTACTCTT	0.632													8	33	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109689781	109689781	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109689781G>A	uc004bcz.2	+	3	3877	c.3588G>A	c.(3586-3588)CAG>CAA	p.Q1196Q	ZNF462_uc010mto.2_Silent_p.Q1044Q|ZNF462_uc004bda.2_Silent_p.Q1044Q	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	1196					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						TCTTTTGCCAGCACTGTGATT	0.547													6	901	---	---	---	---	PASS
IKBKAP	8518	broad.mit.edu	37	9	111656244	111656244	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111656244T>C	uc004bdm.3	-	26	3359	c.2839A>G	c.(2839-2841)ATT>GTT	p.I947V	IKBKAP_uc004bdl.2_Missense_Mutation_p.I598V|IKBKAP_uc011lwc.1_Missense_Mutation_p.I833V|IKBKAP_uc010mtq.2_Missense_Mutation_p.I598V|IKBKAP_uc004bdk.2_5'Flank|IKBKAP_uc010mtp.2_5'Flank	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	947					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						AGGTGGCCAATGGCTTTTTCA	0.269													118	75	---	---	---	---	PASS
TNC	3371	broad.mit.edu	37	9	117853217	117853217	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117853217T>A	uc004bjj.3	-	2	443	c.81A>T	c.(79-81)AAA>AAT	p.K27N	TNC_uc010mvf.2_Missense_Mutation_p.K27N	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	27					cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7						GCCGGATGACTTTCTTGAGGA	0.567													80	67	---	---	---	---	PASS
OLFML2A	169611	broad.mit.edu	37	9	127572626	127572626	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127572626G>C	uc004bov.2	+	8	2007	c.1894G>C	c.(1894-1896)GAG>CAG	p.E632Q	OLFML2A_uc004bow.2_Missense_Mutation_p.E418Q	NM_182487	NP_872293	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A precursor	632	Olfactomedin-like.										0						CAACCCCAAGGAGCGGGTGCT	0.647													4	203	---	---	---	---	PASS
C10orf18	54906	broad.mit.edu	37	10	5799602	5799602	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5799602A>G	uc001iij.2	+	17	7477	c.6852A>G	c.(6850-6852)ATA>ATG	p.I2284M	C10orf18_uc001iik.2_Missense_Mutation_p.I1128M	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	2284										ovary(1)|central_nervous_system(1)	2						GCTTTGTGATATCAGATGACA	0.418													11	624	---	---	---	---	PASS
FRMD4A	55691	broad.mit.edu	37	10	13712537	13712537	+	Intron	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13712537G>C	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						TCCTGCATATGTGAAATGGCA	0.438													88	228	---	---	---	---	PASS
CACNB2	783	broad.mit.edu	37	10	18828262	18828262	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18828262G>A	uc001ipr.2	+	14	1652	c.1592G>A	c.(1591-1593)CGC>CAC	p.R531H	CACNB2_uc009xjz.1_Missense_Mutation_p.R281H|CACNB2_uc001ips.2_Missense_Mutation_p.R507H|CACNB2_uc001ipt.2_Missense_Mutation_p.R493H|CACNB2_uc001ipu.2_Missense_Mutation_p.R503H|CACNB2_uc001ipv.2_Missense_Mutation_p.R479H|CACNB2_uc009xka.1_Missense_Mutation_p.R465H|CACNB2_uc001ipw.2_Missense_Mutation_p.R438H|CACNB2_uc001ipx.2_Missense_Mutation_p.R476H|CACNB2_uc001ipz.2_Missense_Mutation_p.R453H|CACNB2_uc001ipy.2_Missense_Mutation_p.R477H|CACNB2_uc010qco.1_Missense_Mutation_p.R445H|CACNB2_uc001iqa.2_Missense_Mutation_p.R483H|NSUN6_uc001iqb.2_Intron	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2	531					axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	TCCCAGCACCGCTCTTCCTCC	0.557													53	135	---	---	---	---	PASS
MLLT10	8028	broad.mit.edu	37	10	22021982	22021982	+	Silent	SNP	G	C	C	rs150645153		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22021982G>C	uc001iqs.2	+	19	2769	c.2421G>C	c.(2419-2421)CCG>CCC	p.P807P	MLLT10_uc001iqt.2_Silent_p.P791P|MLLT10_uc001iqv.2_RNA|MLLT10_uc001iqy.2_Silent_p.P791P|MLLT10_uc001ira.2_Silent_p.P248P|MLLT10_uc001irb.2_RNA	NM_004641	NP_004632	P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	807					positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(1)|skin(1)	2						ATCCTAGTCCGTCTCATCAAA	0.338			T	MLL|PICALM|CDK6	AL								4	161	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25886855	25886855	+	Missense_Mutation	SNP	G	T	T	rs145808794	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25886855G>T	uc001isj.2	+	11	2360	c.2300G>T	c.(2299-2301)CGG>CTG	p.R767L	GPR158_uc001isk.2_Missense_Mutation_p.R142L	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	767	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						ACAGTCAGCCGGCAGTGCTCT	0.572													62	181	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26581459	26581459	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26581459C>T	uc001isp.2	+	14	1955	c.1452C>T	c.(1450-1452)ATC>ATT	p.I484I	GAD2_uc001isq.2_Silent_p.I484I	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	484					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	TATACAACATCATAAAAAACC	0.403													95	185	---	---	---	---	PASS
PARG	8505	broad.mit.edu	37	10	51631713	51631713	+	Intron	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51631713G>A	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|uc010qhh.1_Intron|uc009xop.2_Missense_Mutation_p.R343K	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		AAACCTTCAAGGTTCCAAGCA	0.413													11	64	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	67680123	67680123	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67680123C>A	uc009xpn.1	-	18	2776	c.2653G>T	c.(2653-2655)GTC>TTC	p.V885F	CTNNA3_uc001jmw.2_Missense_Mutation_p.V885F	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	885					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						TCACTCATGACTTGCAATGGA	0.403													41	156	---	---	---	---	PASS
ADAMTS14	140766	broad.mit.edu	37	10	72518000	72518000	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72518000C>T	uc001jrh.2	+	21	3137	c.3137C>T	c.(3136-3138)CCA>CTA	p.P1046L	ADAMTS14_uc001jrg.2_Missense_Mutation_p.P1049L	NM_080722	NP_542453	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1046					collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|upper_aerodigestive_tract(1)	6						CAGTGGGTGCCACAATCTGAA	0.517													47	183	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	107022249	107022249	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107022249G>A	uc001kyi.1	+	26	3831	c.3604G>A	c.(3604-3606)GGA>AGA	p.G1202R		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	1202	Cytoplasmic (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GCGGGTCATAGGTACATGCTC	0.547													22	61	---	---	---	---	PASS
TECTB	6975	broad.mit.edu	37	10	114063031	114063031	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114063031C>G	uc001kzr.1	+	10	951	c.951C>G	c.(949-951)CAC>CAG	p.H317Q		NM_058222	NP_478129	Q96PL2	TECTB_HUMAN	tectorin beta precursor	317						anchored to membrane|plasma membrane|proteinaceous extracellular matrix					0		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		ATGTTCTCCACCACCTCATCA	0.512													11	226	---	---	---	---	PASS
CHST15	51363	broad.mit.edu	37	10	125804267	125804267	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125804267G>T	uc001lhl.2	-	2	1228	c.715C>A	c.(715-717)CAC>AAC	p.H239N	CHST15_uc001lhm.2_Missense_Mutation_p.H239N|CHST15_uc001lhn.2_Missense_Mutation_p.H239N|CHST15_uc010que.1_Missense_Mutation_p.H239N|CHST15_uc001lho.2_Missense_Mutation_p.H239N	NM_015892	NP_056976	Q7LFX5	CHSTF_HUMAN	B cell RAG associated protein	239	Lumenal (Potential).				hexose biosynthetic process	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity			ovary(1)	1						TGCGCCAGGTGGCCCCAGAAG	0.652													7	83	---	---	---	---	PASS
FAM53B	9679	broad.mit.edu	37	10	126384723	126384723	+	Intron	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126384723T>A	uc001lhv.1	-						FAM53B_uc001lhu.1_Intron|FAM53B_uc001lhw.2_Intron	NM_014661	NP_055476	Q14153	FA53B_HUMAN	hypothetical protein LOC9679											ovary(1)|pancreas(1)	2		all_lung(145;0.0191)|Lung NSC(174;0.0301)|Colorectal(57;0.106)|all_neural(114;0.117)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.15)		CCTTGAGTACTTACCCATAAT	0.463													143	282	---	---	---	---	PASS
OR51F2	119694	broad.mit.edu	37	11	4842752	4842752	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4842752G>C	uc010qyn.1	+	1	137	c.137G>C	c.(136-138)TGT>TCT	p.C46S		NM_001004753	NP_001004753	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F,	46	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATCCCTTTTTGTCTCCTATAT	0.478													178	485	---	---	---	---	PASS
OR51M1	390059	broad.mit.edu	37	11	5411101	5411101	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5411101T>C	uc010qzc.1	+	1	473	c.473T>C	c.(472-474)CTA>CCA	p.L158P	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004756	NP_001004756	B2RNI9	B2RNI9_HUMAN	olfactory receptor, family 51, subfamily M,	158						integral to membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAGCAGGCCTAATTGTCATC	0.537													5	631	---	---	---	---	PASS
OR51I1	390063	broad.mit.edu	37	11	5462437	5462437	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5462437A>T	uc010qze.1	-	1	308	c.308T>A	c.(307-309)ATG>AAG	p.M103K	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005288	NP_001005288	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GATGAAGAACATCTGGACCAG	0.448													38	91	---	---	---	---	PASS
OR51I1	390063	broad.mit.edu	37	11	5462447	5462447	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5462447G>A	uc010qze.1	-	1	298	c.298C>T	c.(298-300)CTG>TTG	p.L100L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005288	NP_001005288	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I,	100	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCTGGACCAGGCAAGCATTA	0.453													48	85	---	---	---	---	PASS
LDHC	3948	broad.mit.edu	37	11	18467792	18467792	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18467792C>T	uc001mon.3	+	7	858	c.746C>T	c.(745-747)TCT>TTT	p.S249F	LDHC_uc001mom.3_Missense_Mutation_p.S249F|LDHC_uc009yhp.2_Intron|LDHC_uc001moo.3_Missense_Mutation_p.S133F|LDHC_uc009yhq.2_RNA|LDHC_uc009yhr.2_Intron	NM_017448	NP_059144	P07864	LDHC_HUMAN	L-lactate dehydrogenase C	249					glycolysis	cytoplasm	binding|L-lactate dehydrogenase activity				0					NADH(DB00157)	GGGTATACCTCTTGGGCTATT	0.373													96	282	---	---	---	---	PASS
OR5D13	390142	broad.mit.edu	37	11	55541396	55541396	+	Silent	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55541396C>A	uc010ril.1	+	1	483	c.483C>A	c.(481-483)CTC>CTA	p.L161L		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	161	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)				CCCTGATACTCACATATTTTC	0.413													102	271	---	---	---	---	PASS
OR5L2	26338	broad.mit.edu	37	11	55594807	55594807	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55594807C>T	uc001nhy.1	+	1	113	c.113C>T	c.(112-114)ACG>ATG	p.T38M		NM_001004739	NP_001004739	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L,	38	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.208)				TATGGAGTCACGTTGTTAGCC	0.502										HNSCC(27;0.073)			165	431	---	---	---	---	PASS
OR8H2	390151	broad.mit.edu	37	11	55873016	55873016	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55873016G>T	uc010riy.1	+	1	498	c.498G>T	c.(496-498)TTG>TTT	p.L166F		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	166	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					TGAGCAGATTGCATTTCTACG	0.423										HNSCC(53;0.14)			5	320	---	---	---	---	PASS
OR5R1	219479	broad.mit.edu	37	11	56185240	56185240	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56185240G>A	uc010rji.1	-	1	469	c.469C>T	c.(469-471)CTC>TTC	p.L157F		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	157	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					GTGTGGAAGAGGGCAACCAGG	0.458													59	179	---	---	---	---	PASS
OR10W1	81341	broad.mit.edu	37	11	58035120	58035120	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58035120G>T	uc001nmq.1	-	1	613	c.211C>A	c.(211-213)CAT>AAT	p.H71N		NM_207374	NP_997257	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W,	71	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(21;0.0589)				GCCAGGATATGGGGCACCACC	0.512													42	123	---	---	---	---	PASS
OR5B21	219968	broad.mit.edu	37	11	58274929	58274929	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58274929A>T	uc010rki.1	-	1	650	c.650T>A	c.(649-651)TTC>TAC	p.F217Y		NM_001005218	NP_001005218	A6NL26	OR5BL_HUMAN	olfactory receptor, family 5, subfamily B,	217	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GATGCATATGAAGAAGTAAGA	0.478													25	69	---	---	---	---	PASS
OR10V1	390201	broad.mit.edu	37	11	59480685	59480685	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59480685G>A	uc001nof.1	-	1	634	c.634C>T	c.(634-636)CTC>TTC	p.L212F		NM_001005324	NP_001005324	Q8NGI7	O10V1_HUMAN	olfactory receptor, family 10, subfamily V,	212	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATCAATGAGAGGGGGATGCTA	0.522													39	117	---	---	---	---	PASS
TCN1	6947	broad.mit.edu	37	11	59631502	59631502	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59631502G>T	uc001noj.2	-	2	235	c.137C>A	c.(136-138)TCA>TAA	p.S46*		NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor	46					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GTTATAGTTTGACTGGATCAT	0.413													41	410	---	---	---	---	PASS
MS4A14	84689	broad.mit.edu	37	11	60164080	60164080	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60164080C>A	uc001npj.2	+	1	594	c.29C>A	c.(28-30)GCA>GAA	p.A10E	MS4A14_uc001npi.2_Intron|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Missense_Mutation_p.A10E|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	10						integral to membrane	receptor activity			breast(1)	1						GACAGAAGGGCAACTCACGTC	0.458													21	65	---	---	---	---	PASS
MS4A14	84689	broad.mit.edu	37	11	60164081	60164081	+	Silent	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60164081A>T	uc001npj.2	+	1	595	c.30A>T	c.(28-30)GCA>GCT	p.A10A	MS4A14_uc001npi.2_Intron|MS4A14_uc001npn.2_5'UTR|MS4A14_uc001npk.2_Silent_p.A10A|MS4A14_uc001npl.2_5'UTR|MS4A14_uc001npm.2_5'UTR	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	10						integral to membrane	receptor activity			breast(1)	1						ACAGAAGGGCAACTCACGTCA	0.458													21	66	---	---	---	---	PASS
SLC3A2	6520	broad.mit.edu	37	11	62656110	62656110	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62656110G>C	uc001nwd.2	+	12	2062	c.1838G>C	c.(1837-1839)CGC>CCC	p.R613P	SLC3A2_uc001nwb.2_Missense_Mutation_p.R644P|SLC3A2_uc001nwc.2_Missense_Mutation_p.R614P|SLC3A2_uc001nwe.2_Missense_Mutation_p.R582P|SLC3A2_uc001nwf.2_Missense_Mutation_p.R551P|SLC3A2_uc001nwg.2_Missense_Mutation_p.R512P	NM_002394	NP_002385	P08195	4F2_HUMAN	solute carrier family 3, member 2 isoform c	613	Extracellular (Potential).				blood coagulation|carbohydrate metabolic process|cell growth|cellular nitrogen compound metabolic process|leucine import|leukocyte migration|tryptophan transport	apical plasma membrane|cell surface|integral to membrane|melanosome	calcium:sodium antiporter activity|catalytic activity|cation binding|neutral amino acid transmembrane transporter activity|protein binding				0						GAGCTGGAACGCCTGAAACTG	0.657													66	187	---	---	---	---	PASS
KAT5	10524	broad.mit.edu	37	11	65482308	65482308	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65482308G>T	uc001ofi.2	+	9	1107	c.857G>T	c.(856-858)CGA>CTA	p.R286L	KAT5_uc001ofj.2_Missense_Mutation_p.R234L|KAT5_uc001ofk.2_Missense_Mutation_p.R319L|KAT5_uc010roo.1_Missense_Mutation_p.R267L|KAT5_uc001ofl.2_Missense_Mutation_p.R75L	NM_006388	NP_006379	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5 isoform 2	286					androgen receptor signaling pathway|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|double-strand break repair|interspecies interaction between organisms|negative regulation of interleukin-2 production|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|regulation of growth|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nucleolus|perinuclear region of cytoplasm|Piccolo NuA4 histone acetyltransferase complex	androgen receptor binding|histone acetyltransferase activity|metal ion binding|repressing transcription factor binding|transcription coactivator activity				0						TGTGACCTACGACATCCTCCA	0.542													121	320	---	---	---	---	PASS
CTSF	8722	broad.mit.edu	37	11	66333633	66333633	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66333633C>T	uc001oip.2	-	6	817	c.727G>A	c.(727-729)GAG>AAG	p.E243K		NM_003793	NP_003784	Q9UBX1	CATF_HUMAN	cathepsin F precursor	243					proteolysis	lysosome	cysteine-type endopeptidase activity				0						GTGCGGAACTCCTCCTCTGCG	0.567													20	448	---	---	---	---	PASS
CTTN	2017	broad.mit.edu	37	11	70281197	70281197	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70281197G>C	uc001opv.3	+	18	1788	c.1582G>C	c.(1582-1584)GGC>CGC	p.G528R	CTTN_uc001opu.2_Missense_Mutation_p.G491R|CTTN_uc001opw.3_Missense_Mutation_p.G491R|CTTN_uc010rqm.1_Missense_Mutation_p.G212R|CTTN_uc001opx.2_Missense_Mutation_p.G212R	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a	528	SH3.					cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GATTGACGACGGCTGGTGGCG	0.612													63	195	---	---	---	---	PASS
UCP3	7352	broad.mit.edu	37	11	73716885	73716885	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73716885A>C	uc001our.2	-	4	786	c.431T>G	c.(430-432)TTT>TGT	p.F144C	UCP3_uc001ous.2_Missense_Mutation_p.F144C	NM_003356	NP_003347	P55916	UCP3_HUMAN	uncoupling protein 3 isoform UCP3L	144	Solcar 2.				mitochondrial transport|respiratory electron transport chain|respiratory gaseous exchange	integral to membrane|mitochondrial inner membrane	binding			pancreas(1)	1	Breast(11;2.08e-05)					GCTGGCCTGAAATCGGACCTT	0.612													50	174	---	---	---	---	PASS
PRKRIR	5612	broad.mit.edu	37	11	76062405	76062405	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76062405G>T	uc001oxh.1	-	5	1789	c.1789C>A	c.(1789-1791)CAG>AAG	p.Q597K	PRKRIR_uc010rrz.1_Missense_Mutation_p.Q422K	NM_004705	NP_004696	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double	597					negative regulation of cell proliferation|response to stress|signal transduction		DNA binding|metal ion binding|protein dimerization activity			ovary(2)|pancreas(1)	3						TTGAGGTGCTGTTCTGAGAAT	0.413													80	210	---	---	---	---	PASS
ME3	10873	broad.mit.edu	37	11	86157526	86157526	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86157526G>C	uc001pbz.2	-	12	1638	c.1384C>G	c.(1384-1386)CGA>GGA	p.R462G	ME3_uc001pca.2_Missense_Mutation_p.R462G|ME3_uc009yvk.2_Missense_Mutation_p.R462G	NM_001014811	NP_001014811	Q16798	MAON_HUMAN	mitochondrial malic enzyme 3 precursor	462					aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)	AAAATCCCTCGGCCCTGGAGG	0.473													10	69	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	120983873	120983873	+	Silent	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120983873G>T	uc010rzo.1	+	4	579	c.579G>T	c.(577-579)GCG>GCT	p.A193A		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	193	NIDO.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		CGGGGACGGCGAGTGGCGGCG	0.572											OREG0021430	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	36	86	---	---	---	---	PASS
OR10S1	219873	broad.mit.edu	37	11	123847930	123847930	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123847930C>A	uc001pzm.1	-	1	469	c.469G>T	c.(469-471)GAA>TAA	p.E157*		NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S,	157	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CCAGCCATTTCTGCACACATC	0.562													43	101	---	---	---	---	PASS
ADAMTS8	11095	broad.mit.edu	37	11	130297558	130297558	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130297558C>T	uc001qgg.3	-	1	982	c.624G>A	c.(622-624)ACG>ACA	p.T208T		NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1	208					negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		TGGTCCTACTCGTGGCCCCCA	0.662													6	16	---	---	---	---	PASS
DCP1B	196513	broad.mit.edu	37	12	2061719	2061719	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2061719G>T	uc001qjx.1	-	7	1467	c.1387C>A	c.(1387-1389)CAG>AAG	p.Q463K	DCP1B_uc010sdy.1_Missense_Mutation_p.Q361K	NM_152640	NP_689853	Q8IZD4	DCP1B_HUMAN	decapping enzyme Dcp1b	463					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	hydrolase activity|protein binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			TGCAGCTGCTGCTCCTGCTGT	0.537													5	252	---	---	---	---	PASS
NCAPD2	9918	broad.mit.edu	37	12	6637954	6637954	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6637954C>T	uc001qoo.2	+	26	3455	c.3409C>T	c.(3409-3411)CTG>TTG	p.L1137L	NCAPD2_uc010sfd.1_Silent_p.L1092L	NM_014865	NP_055680	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	1137					cell division|mitotic chromosome condensation	condensin core heterodimer|cytoplasm	histone binding			ovary(2)|lung(1)|breast(1)|kidney(1)	5						GATGGCGGTGCTGCTCATCGA	0.602													50	96	---	---	---	---	PASS
KLRF1	51348	broad.mit.edu	37	12	9984949	9984949	+	Silent	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9984949G>T	uc010sgw.1	+	2	187	c.123G>T	c.(121-123)CTG>CTT	p.L41L	KLRF1_uc009zgw.2_Silent_p.L41L|KLRF1_uc009zgx.2_RNA|KLRF1_uc001qwm.2_RNA|KLRF1_uc009zgy.2_RNA|KLRF1_uc009zgz.2_Silent_p.L41L|KLRF1_uc009zha.2_RNA	NM_016523	NP_057607	Q9NZS2	KLRF1_HUMAN	killer cell lectin-like receptor subfamily F,	41	Helical; Signal-anchor for type II membrane protein; (Potential).				cell surface receptor linked signaling pathway	integral to plasma membrane	MHC class I receptor activity|sugar binding			large_intestine(1)	1						AAATCTTACTGGGAATATCTG	0.328													57	97	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13769390	13769390	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13769390C>T	uc001rbt.2	-	5	1506	c.1327G>A	c.(1327-1329)GAG>AAG	p.E443K		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	443	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	ATGCCATACTCAGTGACTATG	0.527													34	96	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26775339	26775339	+	Splice_Site	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26775339C>T	uc001rhg.2	-	25	3540	c.3123_splice	c.e25-1	p.R1041_splice		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2						activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TTTTTCTTTTCTATAAAACCA	0.358													17	38	---	---	---	---	PASS
PRPH	5630	broad.mit.edu	37	12	49690694	49690694	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49690694G>C	uc001rtu.2	+	4	800	c.725G>C	c.(724-726)AGT>ACT	p.S242T		NM_006262	NP_006253	P41219	PERI_HUMAN	peripherin	242	Linker 2.|Rod.						structural molecule activity				0						CTGCAGGTGAGTGTGGAGAGC	0.647											OREG0021790	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	47	---	---	---	---	PASS
KRT84	3890	broad.mit.edu	37	12	52775270	52775270	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52775270C>G	uc001sah.1	-	5	1000	c.952G>C	c.(952-954)GTC>CTC	p.V318L		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	318	Rod.|Linker 12.					keratin filament	structural constituent of epidermis			skin(1)	1	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TTCACAATGACCGACGTCTCT	0.542													186	540	---	---	---	---	PASS
WIF1	11197	broad.mit.edu	37	12	65456338	65456338	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65456338C>G	uc001ssk.2	-	7	894	c.749G>C	c.(748-750)TGC>TCC	p.C250S		NM_007191	NP_009122	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1 precursor	250	EGF-like 3.				multicellular organismal development|Wnt receptor signaling pathway	extracellular region	protein tyrosine kinase activity			ovary(2)|lung(1)|skin(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		TCCATTAAAGCAGGTGGTTGA	0.423			T	HMGA2	pleomorphic salivary gland adenoma								7	18	---	---	---	---	PASS
LEMD3	23592	broad.mit.edu	37	12	65632364	65632364	+	Intron	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65632364A>T	uc001ssl.1	+						LEMD3_uc009zqo.1_Intron	NM_014319	NP_055134	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3						negative regulation of activin receptor signaling pathway|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway	integral to nuclear inner membrane|membrane fraction	DNA binding|nucleotide binding|protein binding			central_nervous_system(3)|ovary(1)	4			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		GGAATAAGGTAAAGGATCTGA	0.328													33	55	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78598727	78598727	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78598727C>T	uc001syp.2	+	39	7020	c.6847C>T	c.(6847-6849)CGC>TGC	p.R2283C	NAV3_uc001syo.2_Missense_Mutation_p.R2261C|NAV3_uc010sub.1_Missense_Mutation_p.R1740C|NAV3_uc009zsf.2_Missense_Mutation_p.R1092C	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	2283						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						GTATGGGAAACGCACACCATG	0.448										HNSCC(70;0.22)			33	78	---	---	---	---	PASS
ACSS3	79611	broad.mit.edu	37	12	81647378	81647378	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81647378C>T	uc001szl.1	+	15	2015	c.1924C>T	c.(1924-1926)CTA>TTA	p.L642L	ACSS3_uc001szm.1_Silent_p.L641L|ACSS3_uc001szn.1_Silent_p.L324L	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	642						mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						TGTCAAACAGCTACCCAAAAC	0.423													55	137	---	---	---	---	PASS
UBE2N	7334	broad.mit.edu	37	12	93835624	93835624	+	Intron	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93835624C>T	uc001tcp.2	-							NM_003348	NP_003339	P61088	UBE2N_HUMAN	ubiquitin-conjugating enzyme E2N						DNA double-strand break processing|double-strand break repair via homologous recombination|histone ubiquitination|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of DNA repair|positive regulation of histone modification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity|postreplication repair|protein K63-linked ubiquitination|proteolysis|regulation of histone ubiquitination|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|UBC13-MMS2 complex|UBC13-UEV1A complex|ubiquitin ligase complex	ATP binding|ubiquitin binding|ubiquitin-protein ligase activity				0						CCGGCCTGGGCGGTTACCTTG	0.701								Direct_reversal_of_damage|Rad6_pathway					19	31	---	---	---	---	PASS
ALDH1L2	160428	broad.mit.edu	37	12	105464489	105464489	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105464489C>A	uc001tlc.2	-	3	414	c.287G>T	c.(286-288)AGA>ATA	p.R96I	ALDH1L2_uc009zup.2_RNA	NM_001034173	NP_001029345	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	96	GART.				10-formyltetrahydrofolate catabolic process|biosynthetic process	mitochondrion	acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity|phosphopantetheine binding			skin(1)	1						ACCCACGGATCTGTAGGCTTC	0.483													31	232	---	---	---	---	PASS
PTPN11	5781	broad.mit.edu	37	12	112915507	112915507	+	Silent	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112915507A>G	uc001ttx.2	+	8	1286	c.906A>G	c.(904-906)TCA>TCG	p.S302S	PTPN11_uc001ttw.1_Silent_p.S302S	NM_002834	NP_002825	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type	302	Tyrosine-protein phosphatase.				axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding			haematopoietic_and_lymphoid_tissue(375)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|skin(1)|ovary(1)|NS(1)|kidney(1)	392						AGCCTGTTTCAGATTACATCA	0.398			Mis		JMML|AML|MDS		Noonan Syndrome		Noonan_syndrome				4	340	---	---	---	---	PASS
TPCN1	53373	broad.mit.edu	37	12	113710465	113710465	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113710465T>G	uc001tuw.2	+	8	1048	c.751T>G	c.(751-753)TTC>GTC	p.F251V	TPCN1_uc001tux.2_Missense_Mutation_p.F323V|TPCN1_uc010syt.1_Missense_Mutation_p.F183V	NM_017901	NP_060371	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1 isoform 2	251	Helical; Name=S5 of repeat I; (Potential).					endosome membrane|integral to membrane|lysosomal membrane	NAADP-sensitive calcium-release channel activity|voltage-gated ion channel activity			skin(2)|ovary(1)	3						ACTTCTAGGTTTCTACTTGTT	0.468													168	702	---	---	---	---	PASS
PITPNM2	57605	broad.mit.edu	37	12	123481956	123481956	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123481956T>C	uc001uej.1	-	10	1527	c.1388A>G	c.(1387-1389)CAC>CGC	p.H463R	PITPNM2_uc001uek.1_Missense_Mutation_p.H463R	NM_020845	NP_065896	Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein,	463					metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		GCTGGGGTAGTGCACGCGCAT	0.672													51	259	---	---	---	---	PASS
ZNF10	7556	broad.mit.edu	37	12	133733022	133733022	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133733022G>A	uc009zzb.2	+	5	1637	c.1190G>A	c.(1189-1191)AGA>AAA	p.R397K	ZNF268_uc010tbv.1_Intron|ZNF10_uc001ulq.2_Missense_Mutation_p.R397K	NM_015394	NP_056209	P21506	ZNF10_HUMAN	zinc finger protein 10	397	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CTGCATCAGAGAACCCATGTG	0.438													192	292	---	---	---	---	PASS
C1QTNF9B	387911	broad.mit.edu	37	13	24466031	24466031	+	Silent	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24466031A>G	uc010tcw.1	-	3	399	c.399T>C	c.(397-399)ACT>ACC	p.T133T	MIPEP_uc001uox.3_5'Flank|PCOTH_uc001uoy.2_Silent_p.P95P|PCOTH_uc009zzx.2_Silent_p.P104P|C1QTNF9B_uc010tcv.1_Intron|C1QTNF9B_uc001uoz.1_Intron|C1QTNF9B_uc010tcx.1_Silent_p.T133T	NM_001007537	NP_001007538	B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B	133	Collagen-like 2.					collagen					0						CCTCAGGACCAGTGGGACCCA	0.637													19	62	---	---	---	---	PASS
GTF3A	2971	broad.mit.edu	37	13	28009633	28009633	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28009633A>G	uc001ure.2	+	9	1191	c.997A>G	c.(997-999)AGG>GGG	p.R333G	GTF3A_uc001urf.2_Missense_Mutation_p.R151G|GTF3A_uc001urg.2_RNA	NM_002097	NP_002088	Q92664	TF3A_HUMAN	transcription factor IIIA	333					regulation of transcription, DNA-dependent|rRNA transcription|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding|protein binding|RNA binding|zinc ion binding				0		Lung SC(185;0.0156)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.11)|OV - Ovarian serous cystadenocarcinoma(117;0.158)		CCCTCCCAAAAGGAAACAAGG	0.438													24	24	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58207462	58207462	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58207462T>A	uc001vhq.1	+	1	1674	c.782T>A	c.(781-783)GTG>GAG	p.V261E	PCDH17_uc010aec.1_Missense_Mutation_p.V261E	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	261	Extracellular (Potential).|Cadherin 3.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		CTGGGTACAGTGGTCATCGAT	0.582													70	141	---	---	---	---	PASS
LTB4R2	56413	broad.mit.edu	37	14	24780888	24780888	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24780888C>T	uc001woq.1	+	1	2728	c.1111C>T	c.(1111-1113)CGC>TGC	p.R371C	CIDEB_uc001woo.2_5'Flank|CIDEB_uc001wop.2_5'Flank|LTB4R2_uc001wor.2_Missense_Mutation_p.R340C|LTB4R_uc001wos.2_5'UTR|LTB4R_uc010alp.2_5'Flank	NM_019839	NP_062813	Q9NPC1	LT4R2_HUMAN	leukotriene B4 receptor 2	371	Cytoplasmic (Potential).				chemotaxis|negative regulation of adenylate cyclase activity	integral to plasma membrane					0				GBM - Glioblastoma multiforme(265;0.018)		GGGGCAGGGCCGCGGCAATGG	0.657													166	113	---	---	---	---	PASS
ABHD12B	145447	broad.mit.edu	37	14	51352480	51352480	+	Intron	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51352480C>A	uc001wys.2	+						ABHD12B_uc001wyq.2_Intron|ABHD12B_uc001wyr.2_Intron|ABHD12B_uc010any.2_Intron	NM_181533	NP_853511	Q7Z5M8	AB12B_HUMAN	abhydrolase domain containing 12B isoform b								hydrolase activity			breast(1)	1	all_epithelial(31;0.00481)|Breast(41;0.148)					TTTCTTGCTGCCAGGATTTGG	0.493													45	324	---	---	---	---	PASS
C14orf166	51637	broad.mit.edu	37	14	52471216	52471216	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52471216G>A	uc010aod.2	+	8	847	c.717G>A	c.(715-717)CTG>CTA	p.L239L	C14orf166_uc001wzm.3_Silent_p.L105L|C14orf166_uc001wzn.3_Silent_p.L101L	NM_016039	NP_057123	Q9Y224	CN166_HUMAN	homeobox prox 1	239						microtubule organizing center|nucleus|perinuclear region of cytoplasm|tRNA-splicing ligase complex	identical protein binding				0	Breast(41;0.0639)|all_epithelial(31;0.101)					ACCACAGACTGGGAAAAGTTG	0.433													53	112	---	---	---	---	PASS
CGRRF1	10668	broad.mit.edu	37	14	54997721	54997721	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54997721G>T	uc001xay.2	+	4	614	c.523G>T	c.(523-525)GCG>TCG	p.A175S	CGRRF1_uc010tra.1_Missense_Mutation_p.A175S|CGRRF1_uc001xaz.2_RNA	NM_006568	NP_006559	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1	175					cell cycle arrest|negative regulation of cell proliferation|response to stress		zinc ion binding			ovary(1)	1						TCCATTGGTAGCGCTATTGAC	0.343													28	43	---	---	---	---	PASS
RGS6	9628	broad.mit.edu	37	14	72943476	72943476	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72943476C>T	uc001xna.3	+	11	1243	c.720C>T	c.(718-720)TCC>TCT	p.S240S	RGS6_uc010ttn.1_Silent_p.S240S|RGS6_uc001xmx.3_Silent_p.S240S|RGS6_uc010tto.1_RNA|RGS6_uc001xmy.3_Silent_p.S240S|RGS6_uc010ttp.1_Silent_p.S171S|RGS6_uc001xmz.1_Silent_p.S101S	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6	240					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		CTGAAGAGTCCCAGGCACAGA	0.373													8	87	---	---	---	---	PASS
LTBP2	4053	broad.mit.edu	37	14	74972770	74972770	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74972770G>A	uc001xqa.2	-	28	4545	c.4158C>T	c.(4156-4158)TGC>TGT	p.C1386C		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	1386	EGF-like 16; calcium-binding (Potential).				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CCCGTGGGCGGCAGTGCCCCT	0.627													6	357	---	---	---	---	PASS
PROX2	283571	broad.mit.edu	37	14	75330330	75330330	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75330330T>C	uc001xqr.1	-	1	208	c.208A>G	c.(208-210)ACC>GCC	p.T70A	PROX2_uc001xqq.1_5'UTR	NM_001080408	NP_001073877	Q3B8N5	PROX2_HUMAN	prospero homeobox 2	70					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		CGGACAATGGTCTCCACTCTG	0.607													12	41	---	---	---	---	PASS
ADCK1	57143	broad.mit.edu	37	14	78399617	78399617	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78399617C>T	uc001xui.2	+	11	1554	c.1455C>T	c.(1453-1455)AGC>AGT	p.S485S	ADCK1_uc001xuj.2_Silent_p.S417S|ADCK1_uc001xul.2_Silent_p.S192S	NM_020421	NP_065154	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1 isoform a	492						extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		TCTCTTTCAGCGAGGCCTTCA	0.408													49	229	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	79933711	79933711	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79933711C>G	uc001xun.2	+	13	2782	c.2291C>G	c.(2290-2292)GCT>GGT	p.A764G	NRXN3_uc001xum.1_RNA|NRXN3_uc001xup.2_RNA|NRXN3_uc001xuq.2_Missense_Mutation_p.A132G|NRXN3_uc010asw.2_Missense_Mutation_p.A132G|NRXN3_uc001xur.3_Missense_Mutation_p.A132G	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	1137	Extracellular (Potential).|Laminin G-like 6.				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		ATCGACAGTGCTCCAGGACTT	0.557													75	123	---	---	---	---	PASS
DIO2	1734	broad.mit.edu	37	14	80669493	80669493	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80669493C>A	uc010tvq.1	-	3	763	c.361G>T	c.(361-363)GAG>TAG	p.E121*	DIO2_uc010tvp.1_Nonsense_Mutation_p.E157*|DIO2_uc001xut.2_RNA|DIO2_uc010asx.2_3'UTR|DIO2_uc010tvr.1_Nonsense_Mutation_p.E121*|DIO2_uc010asy.2_Nonsense_Mutation_p.E121*	NM_000793	NP_000784	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II isoform a	121					hormone biosynthetic process|selenocysteine incorporation|thyroid hormone generation	integral to membrane|plasma membrane	thyroxine 5'-deiodinase activity|ubiquitin protein ligase binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0281)		AGTGGGCGCTCAGGGCTGGCA	0.562											OREG0022848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	36	---	---	---	---	PASS
FLRT2	23768	broad.mit.edu	37	14	86089404	86089404	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86089404G>A	uc001xvr.2	+	2	2313	c.1546G>A	c.(1546-1548)GCC>ACC	p.A516T	FLRT2_uc010atd.2_Missense_Mutation_p.A516T	NM_013231	NP_037363	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	516	Extracellular (Potential).				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			ovary(3)|haematopoietic_and_lymphoid_tissue(1)	4				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CACCACCCATGCCTCCTATCT	0.572													68	154	---	---	---	---	PASS
KCNK10	54207	broad.mit.edu	37	14	88651981	88651981	+	Silent	SNP	C	T	T	rs141080520	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88651981C>T	uc001xwo.2	-	7	1972	c.1515G>A	c.(1513-1515)ACG>ACA	p.T505T	KCNK10_uc001xwm.2_Silent_p.T510T|KCNK10_uc001xwn.2_Silent_p.T510T	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	505	Cytoplasmic (Potential).				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						GGATACAGTCCGTCAGCATGG	0.507													54	275	---	---	---	---	PASS
GPR68	8111	broad.mit.edu	37	14	91700654	91700654	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91700654C>T	uc001xzg.2	-	2	1082	c.741G>A	c.(739-741)TTG>TTA	p.L247L	GPR68_uc001xzh.2_Silent_p.L257L	NM_003485	NP_003476	Q15743	OGR1_HUMAN	G protein-coupled receptor 68	247	Helical; Name=6; (Potential).				inflammatory response	integral to plasma membrane	G-protein coupled receptor activity			kidney(1)	1		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		GCACCAGCAGCAACACGTGGT	0.637													4	11	---	---	---	---	PASS
CATSPERB	79820	broad.mit.edu	37	14	92105440	92105440	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92105440C>T	uc001xzs.1	-	16	1727	c.1587G>A	c.(1585-1587)CAG>CAA	p.Q529Q	CATSPERB_uc010aub.1_Silent_p.Q51Q	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta	529					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				ATATACTGACCTGTCCAAAAA	0.383													19	85	---	---	---	---	PASS
TRIP11	9321	broad.mit.edu	37	14	92482168	92482168	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92482168T>C	uc001xzy.2	-	6	1483	c.695A>G	c.(694-696)CAT>CGT	p.H232R	TRIP11_uc010auf.1_5'UTR	NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	232	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		TTCATGTTGATGGTCATCAAT	0.303			T	PDGFRB	AML								11	65	---	---	---	---	PASS
SERPINA3	12	broad.mit.edu	37	14	95080939	95080939	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95080939T>G	uc001ydp.2	+	2	240	c.161T>G	c.(160-162)GTG>GGG	p.V54G	SERPINA3_uc001ydo.3_Missense_Mutation_p.V79G|SERPINA3_uc010avf.1_RNA|SERPINA3_uc001ydr.2_RNA|SERPINA3_uc001ydq.2_Missense_Mutation_p.V54G|SERPINA3_uc001yds.2_Missense_Mutation_p.V54G|SERPINA3_uc010avg.2_Missense_Mutation_p.V54G	NM_001085	NP_001076	P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A, member 3	54					acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		TCCGCCAACGTGGACTTCGCT	0.567													83	217	---	---	---	---	PASS
PPP2R5C	5527	broad.mit.edu	37	14	102378761	102378761	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102378761G>A	uc001yko.2	+	12	1417	c.1277G>A	c.(1276-1278)CGG>CAG	p.R426Q	PPP2R5C_uc010txr.1_Missense_Mutation_p.R457Q|PPP2R5C_uc001ykk.2_Missense_Mutation_p.R481Q|PPP2R5C_uc001ykn.2_Missense_Mutation_p.R426Q|PPP2R5C_uc001ykp.2_Missense_Mutation_p.R426Q|PPP2R5C_uc001ykq.2_3'UTR	NM_002719	NP_002710	Q13362	2A5G_HUMAN	gamma isoform of regulatory subunit B56, protein	426					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|negative regulation of cell proliferation|proteasomal ubiquitin-dependent protein catabolic process|signal transduction	chromosome, centromeric region|nucleus|protein phosphatase type 2A complex	protein binding|protein binding|protein phosphatase type 2A regulator activity|protein phosphatase type 2A regulator activity			ovary(1)|breast(1)	2						ATGAAAGAACGGGAAGAAGCA	0.393													7	226	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106207942	106207942	+	RNA	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106207942G>T	uc010tyt.1	-	3628		c.59175C>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Missense_Mutation_p.F153L|uc001ysf.2_Missense_Mutation_p.F153L					Parts of antibodies, mostly variable regions.												0						TGTAGAGGAAGAAGGAGCCGT	0.592													182	356	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106926231	106926231	+	RNA	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106926231C>A	uc010tyt.1	-	235		c.10324G>T			uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						AGTTCTCAGACTGTTCATTTG	0.493													98	467	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20643996	20643996	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20643996C>A	uc001ytg.2	-	23	3483	c.2774G>T	c.(2773-2775)GGC>GTC	p.G925V	uc010tyx.1_RNA|uc001yth.3_Missense_Mutation_p.G925V					RecName: Full=Putative HERC2-like protein 3;																		ACCATCGATGCCTCCAACCAC	0.582													19	55	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22482835	22482835	+	IGR	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22482835C>T								OR4N3P (68450 upstream) : MIR1268 (30394 downstream)																							CACTCTGTGTCTCTCGCACAG	0.532													87	805	---	---	---	---	PASS
C15orf2	23742	broad.mit.edu	37	15	24921807	24921807	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24921807C>A	uc001ywo.2	+	1	1267	c.793C>A	c.(793-795)CCA>ACA	p.P265T		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	265					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		GCCCCCTGAGCCAGCCGTTGG	0.637													15	110	---	---	---	---	PASS
C15orf41	84529	broad.mit.edu	37	15	36946308	36946308	+	Silent	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36946308T>C	uc001zje.3	+	4	472	c.222T>C	c.(220-222)AAT>AAC	p.N74N	C15orf41_uc001zjd.2_Silent_p.N74N|C15orf41_uc010bbb.1_5'UTR|C15orf41_uc001zjf.2_5'UTR|C15orf41_uc010uci.1_5'UTR	NM_001130010	NP_001123482	Q9Y2V0	CO041_HUMAN	hypothetical protein LOC84529 isoform 1	74							protein binding			pancreas(1)	1		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		GGTACCTGAATGGAGTGGTGA	0.453													4	24	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40898654	40898654	+	Intron	SNP	A	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40898654A>C	uc010bbs.1	+						CASC5_uc010ucq.1_Intron|CASC5_uc001zme.2_Intron|CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AGTTCAGGTAAGTCTTTTGTG	0.343													4	114	---	---	---	---	PASS
SLC28A2	9153	broad.mit.edu	37	15	45556870	45556870	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45556870G>A	uc001zva.2	+	7	671	c.606G>A	c.(604-606)GTG>GTA	p.V202V		NM_004212	NP_004203	O43868	S28A2_HUMAN	solute carrier family 28 (sodium-coupled	202	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)		GGAGGACAGTGTTTTCGGGCC	0.433													89	172	---	---	---	---	PASS
COPS2	9318	broad.mit.edu	37	15	49425984	49425984	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49425984C>G	uc001zxf.2	-	9	998	c.919G>C	c.(919-921)GAA>CAA	p.E307Q	COPS2_uc001zxh.2_Missense_Mutation_p.E314Q|COPS2_uc010ufa.1_Missense_Mutation_p.E243Q	NM_004236	NP_004227	P61201	CSN2_HUMAN	COP9 constitutive photomorphogenic homolog	307	PCI.				cullin deneddylation|transcription from RNA polymerase II promoter	cytoplasm|signalosome	protein binding|signal transducer activity			lung(1)	1		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		GCTAAAATTTCTGGATCATTT	0.259													6	52	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50366359	50366359	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50366359T>A	uc001zxu.2	-	3	194	c.52A>T	c.(52-54)AAT>TAT	p.N18Y	ATP8B4_uc010ber.2_5'UTR|ATP8B4_uc010ufd.1_5'UTR|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	18	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TCACGGTCATTGGCTTTCACT	0.363													100	148	---	---	---	---	PASS
MYO1E	4643	broad.mit.edu	37	15	59519708	59519708	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59519708T>C	uc002aga.2	-	7	964	c.592A>G	c.(592-594)AGG>GGG	p.R198G		NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE	198	Myosin head-like.				actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)		ATCACCACCCTAGATTTTTCC	0.438													97	133	---	---	---	---	PASS
CELF6	60677	broad.mit.edu	37	15	72582591	72582591	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72582591G>A	uc002auh.2	-	4	710	c.400C>T	c.(400-402)CGA>TGA	p.R134*	uc002aug.2_Intron|CELF6_uc002auk.3_RNA|CELF6_uc010biv.1_RNA|CELF6_uc010biw.2_Nonsense_Mutation_p.R21*|CELF6_uc010ukl.1_Nonsense_Mutation_p.R19*|CELF6_uc010ukm.1_Nonsense_Mutation_p.R134*|CELF6_uc002aui.2_Nonsense_Mutation_p.R240*|CELF6_uc002auj.2_Nonsense_Mutation_p.R21*	NM_052840	NP_443072	Q96J87	CELF6_HUMAN	bruno-like 6, RNA binding protein	134	RRM 2.				mRNA processing|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	nucleotide binding|RNA binding	p.R134*(1)		large_intestine(1)|central_nervous_system(1)|skin(1)	3						AACAGCTTTCGGTCCTCTGGG	0.602													10	61	---	---	---	---	PASS
TARSL2	123283	broad.mit.edu	37	15	102261359	102261359	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102261359G>A	uc002bxm.2	-	3	591	c.536C>T	c.(535-537)ACA>ATA	p.T179I	TARSL2_uc010usi.1_RNA	NM_152334	NP_689547	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	179					threonyl-tRNA aminoacylation	cytoplasm	ATP binding|threonine-tRNA ligase activity			ovary(2)	2	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTAAGGCGTTGTTTTCCAGAC	0.413													299	409	---	---	---	---	PASS
PDZD9	255762	broad.mit.edu	37	16	21995838	21995838	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21995838A>G	uc002dka.1	-	5	676	c.359T>C	c.(358-360)ATC>ACC	p.I120T		NM_173806	NP_776167	Q8IXQ8	PDZD9_HUMAN	hypothetical protein LOC255762	182										pancreas(1)	1						GTCTCTGGAGATGGATATTGG	0.368													8	282	---	---	---	---	PASS
PALB2	79728	broad.mit.edu	37	16	23619309	23619309	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23619309G>C	uc002dlx.1	-	12	3426	c.3226C>G	c.(3226-3228)CAT>GAT	p.H1076D		NM_024675	NP_078951	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	1076	Interaction with RAD51 and BRCA2.|WD 5.				double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding			lung(3)|breast(3)|ovary(2)|skin(1)|kidney(1)|pancreas(1)	11				GBM - Glioblastoma multiforme(48;0.0167)		GCACAGGGATGACTCAGGACA	0.443			F|N|Mis			Wilms tumor|medulloblastoma|AML ,breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia_type_N|Fanconi_Anemia|PALB2-associated_Familial_Breast_and_Pancreatic_Cancer|Pancreatic_Cancer_Familial_Clustering_of				20	111	---	---	---	---	PASS
ATP2A1	487	broad.mit.edu	37	16	28905575	28905575	+	Intron	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28905575C>T	uc002dro.1	+						uc010vct.1_Intron|ATP2A1_uc002drn.1_Intron|ATP2A1_uc002drp.1_Intron	NM_173201	NP_775293	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, fast twitch 1 isoform						apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GTAAGTCACCCAGGCATCTTC	0.567													12	69	---	---	---	---	PASS
MAPK3	5595	broad.mit.edu	37	16	30128291	30128291	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30128291T>A	uc002dws.2	-	7	1041	c.941A>T	c.(940-942)AAC>ATC	p.N314I	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|MAPK3_uc002dwr.2_Missense_Mutation_p.N200I|MAPK3_uc002dwv.3_Missense_Mutation_p.N270I|MAPK3_uc002dwt.2_Missense_Mutation_p.N314I|MAPK3_uc002dwu.2_RNA|MAPK3_uc010bzp.2_RNA	NM_002746	NP_002737	P27361	MK03_HUMAN	mitogen-activated protein kinase 3 isoform 1	314	Protein kinase.				activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle|cellular response to mechanical stimulus|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|interleukin-1-mediated signaling pathway|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription initiation from RNA polymerase I promoter	cytosol|nucleoplasm	ATP binding|MAP kinase activity|phosphatase binding				0					Arsenic trioxide(DB01169)|Isoproterenol(DB01064)|Simvastatin(DB00641)|Sulindac(DB00605)	TTTATTGGGGTTAAAGGTTAA	0.582													102	537	---	---	---	---	PASS
STX4	6810	broad.mit.edu	37	16	31049975	31049975	+	Intron	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31049975G>A	uc002eal.2	+						STX4_uc002eak.2_Intron|STX4_uc002eam.2_Intron	NM_004604	NP_004595	Q12846	STX4_HUMAN	syntaxin 4						intracellular protein transport|platelet activation|post-Golgi vesicle-mediated transport	basolateral plasma membrane|cell surface|cytosol|integral to membrane|plasma membrane enriched fraction|specific granule|vacuole	SNAP receptor activity				0						GCAGGTGGGTGCCCCGCGCAG	0.582													5	68	---	---	---	---	PASS
ZNF668	79759	broad.mit.edu	37	16	31073463	31073463	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31073463C>T	uc010caf.2	-	3	1143	c.786G>A	c.(784-786)ACG>ACA	p.T262T	ZNF668_uc002eao.2_Silent_p.T262T	NM_024706	NP_078982	Q96K58	ZN668_HUMAN	zinc finger protein 668	262	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(4)	4						AACTGAGCTGCGTGAAGCCCT	0.687													22	142	---	---	---	---	PASS
ZNF646	9726	broad.mit.edu	37	16	31092149	31092149	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31092149G>A	uc002eap.2	+	2	4793	c.4504G>A	c.(4504-4506)GAC>AAC	p.D1502N		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	1502					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2						CCACGCTGGTGACTGCCAGCT	0.572													6	148	---	---	---	---	PASS
VPS35	55737	broad.mit.edu	37	16	46712999	46712999	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46712999C>A	uc002eef.3	-	6	675	c.576G>T	c.(574-576)AAG>AAT	p.K192N	VPS35_uc002eed.2_Missense_Mutation_p.K13N|VPS35_uc002eee.2_Missense_Mutation_p.K153N	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35	192					protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				GCACCCAGAGCTTGTTCATTT	0.408													17	78	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49671045	49671045	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49671045G>A	uc002efs.2	-	5	2316	c.2018C>T	c.(2017-2019)TCC>TTC	p.S673F	ZNF423_uc010vgn.1_Missense_Mutation_p.S556F	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	673	C2H2-type 15.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				GGACTCCTGGGAGTCAAAGTC	0.562													33	201	---	---	---	---	PASS
CDH16	1014	broad.mit.edu	37	16	66947036	66947036	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66947036G>A	uc002eql.2	-	9	1125	c.1052C>T	c.(1051-1053)CCA>CTA	p.P351L	CDH16_uc010cdy.2_Missense_Mutation_p.P351L|CDH16_uc002eqm.2_Missense_Mutation_p.P254L	NM_004062	NP_004053	O75309	CAD16_HUMAN	cadherin 16 precursor	351	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|upper_aerodigestive_tract(1)	3		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		TAGCTCACCTGGTGGACTGAG	0.577													29	737	---	---	---	---	PASS
TRADD	8717	broad.mit.edu	37	16	67188649	67188649	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67188649G>A	uc002eri.1	-	5	922	c.842C>T	c.(841-843)ACG>ATG	p.T281M	TRADD_uc002erh.1_Missense_Mutation_p.T221M	NM_003789	NP_003780	Q15628	TRADD_HUMAN	TNFRSF1A-associated via death domain	281	Interaction with KRT14 and KRT18.|Death.				activation of caspase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|tumor necrosis factor-mediated signaling pathway	cytoskeleton|cytosol|receptor complex	binding, bridging|death domain binding|identical protein binding|kinase binding|signal transducer activity			lung(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		GCGCTGCAGCGTGGCGCGGCG	0.697													5	39	---	---	---	---	PASS
FUK	197258	broad.mit.edu	37	16	70508827	70508827	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70508827G>T	uc002eyy.2	+	18	2348	c.2290G>T	c.(2290-2292)GTG>TTG	p.V764L	FUK_uc010cft.2_Missense_Mutation_p.V796L|FUK_uc002eyz.2_Missense_Mutation_p.V255L	NM_145059	NP_659496	Q8N0W3	FUK_HUMAN	fucokinase	764						cytoplasm	ATP binding|fucokinase activity			ovary(1)	1		Ovarian(137;0.0694)				GTGGCTGGCGGTGGGGCCTCG	0.701													9	7	---	---	---	---	PASS
ZNF821	55565	broad.mit.edu	37	16	71913854	71913854	+	5'UTR	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71913854C>A	uc010vmj.1	-	2					ATXN1L_uc010vmi.1_Intron|ZNF821_uc002fbe.2_5'UTR|ZNF821_uc002fbf.2_5'UTR|ZNF821_uc002fbg.3_5'UTR|ZNF821_uc002fbh.3_5'UTR|ZNF821_uc002fbi.3_5'UTR	NM_017530	NP_060000	O75541	ZN821_HUMAN	zinc finger protein 821						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GGACATGTTTCCCTGATGCAA	0.448													74	507	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76528905	76528905	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76528905G>C	uc002feu.1	+	16	2564	c.2179G>C	c.(2179-2181)GAG>CAG	p.E727Q	CNTNAP4_uc002fev.1_Missense_Mutation_p.E591Q|CNTNAP4_uc010chb.1_Missense_Mutation_p.E654Q|CNTNAP4_uc002fex.1_Missense_Mutation_p.E730Q|CNTNAP4_uc002few.2_Missense_Mutation_p.E702Q	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	727	Extracellular (Potential).|Fibrinogen C-terminal.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TTGTGGATTAGAGGGAAACTG	0.408													5	251	---	---	---	---	PASS
MBTPS1	8720	broad.mit.edu	37	16	84132744	84132744	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84132744G>A	uc002fhi.2	-	3	837	c.335C>T	c.(334-336)GCG>GTG	p.A112V		NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1	112					cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2						TAGCAGCCCCGCTTTCTGTTT	0.423													24	372	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578263G>A	uc002gim.2	-	6	780	c.586C>T	c.(586-588)CGA>TGA	p.R196*	TP53_uc002gig.1_Nonsense_Mutation_p.R196*|TP53_uc002gih.2_Nonsense_Mutation_p.R196*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R64*|TP53_uc010cng.1_Nonsense_Mutation_p.R64*|TP53_uc002gii.1_Nonsense_Mutation_p.R64*|TP53_uc010cnh.1_Nonsense_Mutation_p.R196*|TP53_uc010cni.1_Nonsense_Mutation_p.R196*|TP53_uc002gij.2_Nonsense_Mutation_p.R196*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.R103*|TP53_uc002gio.2_Nonsense_Mutation_p.R64*|TP53_uc010vug.1_Nonsense_Mutation_p.R157*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	196	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R196*(125)|p.R196P(12)|p.0?(7)|p.R196R(5)|p.R196fs*51(4)|p.A189_V197delAPPQHLIRV(4)|p.R196Q(3)|p.K164_P219del(1)|p.R196L(1)|p.I195fs*50(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.R64*(1)|p.I195fs*12(1)|p.R103*(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CCTTCCACTCGGATAAGATGC	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			55	71	---	---	---	---	PASS
GUCY2D	3000	broad.mit.edu	37	17	7915934	7915934	+	Intron	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7915934C>T	uc002gjt.2	+							NM_000180	NP_000171	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)						intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			skin(1)	1		Prostate(122;0.157)				GGTAAGAGTCCCCTGTGCAGA	0.592													7	164	---	---	---	---	PASS
NCOR1	9611	broad.mit.edu	37	17	16068475	16068475	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16068475C>A	uc002gpo.2	-	5	676	c.436G>T	c.(436-438)GAT>TAT	p.D146Y	NCOR1_uc002gpn.2_Missense_Mutation_p.D146Y|NCOR1_uc002gpp.1_Missense_Mutation_p.D37Y|NCOR1_uc002gpr.2_Missense_Mutation_p.D37Y|NCOR1_uc002gps.1_Missense_Mutation_p.D146Y|NCOR1_uc010coz.1_5'UTR|NCOR1_uc010cpb.1_Missense_Mutation_p.D146Y|NCOR1_uc010cpa.1_Missense_Mutation_p.D146Y|NCOR1_uc002gpu.2_Missense_Mutation_p.D146Y	NM_006311	NP_006302	O75376	NCOR1_HUMAN	nuclear receptor co-repressor 1	146	Interaction with ZBTB33 and HEXIM1.				cellular lipid metabolic process|chromatin modification|negative regulation of JNK cascade|regulation of glycolysis by negative regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by negative regulation of transcription from an RNA polymerase II promoter|spindle assembly|transcription from RNA polymerase II promoter	nuclear chromatin|spindle microtubule|transcriptional repressor complex	histone deacetylase binding|transcription corepressor activity|transcription regulatory region DNA binding			upper_aerodigestive_tract(2)|ovary(1)|central_nervous_system(1)|kidney(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AATGCTGGATCCTTTAGAGAA	0.393													45	266	---	---	---	---	PASS
ZNF624	57547	broad.mit.edu	37	17	16526936	16526936	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16526936C>A	uc010cpi.1	-	6	1347	c.1264G>T	c.(1264-1266)GGG>TGG	p.G422W		NM_020787	NP_065838	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	422	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		AAGGCTTTCCCACAATCATCA	0.388													63	96	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29661984	29661984	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29661984A>G	uc002hgg.2	+	40	6274	c.5941A>G	c.(5941-5943)ATG>GTG	p.M1981V	NF1_uc002hgh.2_Missense_Mutation_p.M1960V|NF1_uc010cso.2_Missense_Mutation_p.M169V|NF1_uc010wbt.1_5'Flank|NF1_uc010wbu.1_5'Flank	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	1981					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GCTGATAACAATGACCATCAA	0.373			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			46	110	---	---	---	---	PASS
KRT13	3860	broad.mit.edu	37	17	39658985	39658985	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39658985C>T	uc002hwu.1	-	5	1040	c.977G>A	c.(976-978)CGC>CAC	p.R326H	KRT13_uc002hwv.1_Missense_Mutation_p.R326H|KRT13_uc002hww.2_Missense_Mutation_p.R219H|KRT13_uc010wfr.1_Missense_Mutation_p.R219H|KRT13_uc010cxo.2_Missense_Mutation_p.R326H|KRT13_uc002hwx.1_Missense_Mutation_p.R314H	NM_153490	NP_705694	P13646	K1C13_HUMAN	keratin 13 isoform a	326	Rod.|Coil 2.				epidermis development	intermediate filament	structural molecule activity			ovary(2)|skin(2)|pancreas(1)	5		Breast(137;0.000286)				TTGGAGCGTGCGCCTGAGCTC	0.577													7	850	---	---	---	---	PASS
GFAP	2670	broad.mit.edu	37	17	42987519	42987519	+	Intron	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42987519C>G	uc002ihq.2	-						GFAP_uc002ihr.2_Silent_p.P427P	NM_002055	NP_002046	P14136	GFAP_HUMAN	glial fibrillary acidic protein isoform 1							cytoplasm|intermediate filament	structural constituent of cytoskeleton			ovary(1)|pancreas(1)	2		Prostate(33;0.0959)				CGCGAGCCGGCGGCGTTCCAT	0.547													72	170	---	---	---	---	PASS
HOXB8	3218	broad.mit.edu	37	17	46690838	46690838	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46690838T>C	uc002inw.2	-	2	693	c.458A>G	c.(457-459)TAC>TGC	p.Y153C	HOXB7_uc002inv.2_5'Flank	NM_024016	NP_076921	P17481	HXB8_HUMAN	homeobox B8	153	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GTAGCGGCTGTAGGTCTGTCG	0.532													60	118	---	---	---	---	PASS
GNA13	10672	broad.mit.edu	37	17	63010730	63010730	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63010730C>T	uc002jfc.2	-	4	988	c.779G>A	c.(778-780)CGA>CAA	p.R260Q	GNA13_uc010wqh.1_Missense_Mutation_p.R165Q	NM_006572	NP_006563	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein),	260					activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase D activity|cellular component movement|platelet activation|Rho protein signal transduction	brush border membrane|heterotrimeric G-protein complex|melanosome	D5 dopamine receptor binding|G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|signal transducer activity|type 1 angiotensin receptor binding				0						ATTGGTCAGTCGATCTTCCAT	0.388													16	248	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67145042	67145042	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67145042G>T	uc010dfa.1	-	40	5437	c.4558C>A	c.(4558-4560)CAG>AAG	p.Q1520K	ABCA10_uc002jhz.2_RNA|ABCA10_uc010wqs.1_Missense_Mutation_p.Q512K|ABCA10_uc010wqt.1_RNA	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	1520					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					CCCAGCTCCTGCTCTTTACAG	0.363													51	120	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67145043	67145043	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67145043C>A	uc010dfa.1	-	40	5436	c.4557G>T	c.(4555-4557)GAG>GAT	p.E1519D	ABCA10_uc002jhz.2_RNA|ABCA10_uc010wqs.1_Missense_Mutation_p.E511D|ABCA10_uc010wqt.1_RNA	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	1519					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					CCAGCTCCTGCTCTTTACAGA	0.368													50	120	---	---	---	---	PASS
UNC13D	201294	broad.mit.edu	37	17	73838700	73838700	+	Intron	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73838700G>A	uc002jpp.2	-						UNC13D_uc010wsk.1_Intron|UNC13D_uc002jpq.1_Intron|UNC13D_uc010dgq.1_Intron	NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D						positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding			upper_aerodigestive_tract(1)|skin(1)	2			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			GAACCCTGTGGAGGAGTGGGG	0.706									Familial_Hemophagocytic_Lymphohistiocytosis				62	116	---	---	---	---	PASS
RPTOR	57521	broad.mit.edu	37	17	78796099	78796099	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78796099G>A	uc002jyt.1	+	8	1794	c.989G>A	c.(988-990)CGG>CAG	p.R330Q	RPTOR_uc002jys.2_Missense_Mutation_p.R330Q|RPTOR_uc010wuf.1_Missense_Mutation_p.R145Q|RPTOR_uc010wug.1_Missense_Mutation_p.R330Q	NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor isoform 1	330					cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)|ovary(1)	6						GTGCTCCCCCGGGGTGAGGCG	0.647													178	312	---	---	---	---	PASS
TBCD	6904	broad.mit.edu	37	17	80828207	80828207	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80828207C>T	uc002kfz.2	+	14	1556	c.1426C>T	c.(1426-1428)CGT>TGT	p.R476C	TBCD_uc002kfx.1_Missense_Mutation_p.R459C|TBCD_uc002kfy.1_Missense_Mutation_p.R476C	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D	476					'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GGCCTTCGCGCGTGCCTATGA	0.652													39	73	---	---	---	---	PASS
TXNL1	9352	broad.mit.edu	37	18	54291628	54291628	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:54291628C>G	uc002lgg.2	-	3	509	c.260G>C	c.(259-261)AGA>ACA	p.R87T	TXNL1_uc010xdz.1_RNA|TXNL1_uc002lgh.2_RNA|TXNL1_uc002lgi.2_Missense_Mutation_p.R87T|TXNL1_uc002lgj.1_Missense_Mutation_p.R87T	NM_004786	NP_004777	O43396	TXNL1_HUMAN	thioredoxin-like 1	87	Thioredoxin.				cell redox homeostasis|electron transport chain|glycerol ether metabolic process|transport	cytoplasm	electron carrier activity|protein disulfide oxidoreductase activity				0				READ - Rectum adenocarcinoma(59;0.193)|Colorectal(16;0.211)		TTGATCAATTCTCACTTTGTT	0.378													4	626	---	---	---	---	PASS
SPPL2B	56928	broad.mit.edu	37	19	2269646	2269646	+	5'UTR	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2269646A>T	uc010dsw.1	+	1					OAZ1_uc002lvl.2_RNA|OAZ1_uc002lvm.2_RNA			Q8TCT7	PSL1_HUMAN	SubName: Full=Putative uncharacterized protein ENSP00000371624;							Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCTTCGCCAGAGAGAAGGA	0.642													6	10	---	---	---	---	PASS
TMIGD2	126259	broad.mit.edu	37	19	4294666	4294666	+	Missense_Mutation	SNP	C	A	A	rs143069562	byFrequency	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4294666C>A	uc002lzx.1	-	4	506	c.460G>T	c.(460-462)GTG>TTG	p.V154L	TMIGD2_uc010dtv.1_Missense_Mutation_p.V154L	NM_144615	NP_653216	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain	154	Helical; (Potential).					integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCAGCAGCACGAAGAGGAAT	0.642													26	618	---	---	---	---	PASS
FSD1	79187	broad.mit.edu	37	19	4317224	4317224	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4317224G>A	uc002lzy.2	+	8	899	c.746G>A	c.(745-747)TGT>TAT	p.C249Y	FSD1_uc002lzz.2_Missense_Mutation_p.C249Y|FSD1_uc002maa.2_Missense_Mutation_p.C62Y	NM_024333	NP_077309	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing	249	Fibronectin type-III.				cell division|mitosis	cleavage furrow|microtubule|microtubule organizing center|nucleus				skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGAAGGCCTGTAACAAGGCA	0.502													6	367	---	---	---	---	PASS
DPP9	91039	broad.mit.edu	37	19	4694679	4694679	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4694679C>A	uc002mba.2	-	13	1768	c.1510G>T	c.(1510-1512)GGG>TGG	p.G504W	DPP9_uc002mbb.2_Missense_Mutation_p.G504W|DPP9_uc002mbc.2_3'UTR	NM_139159	NP_631898	Q86TI2	DPP9_HUMAN	dipeptidylpeptidase 9	475					proteolysis	cytosol|membrane	aminopeptidase activity|serine-type peptidase activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		TCACCTTCCCCGGGGCTGAAG	0.552													11	37	---	---	---	---	PASS
FEM1A	55527	broad.mit.edu	37	19	4792611	4792611	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4792611G>T	uc002mbf.2	+	1	884	c.745G>T	c.(745-747)GCT>TCT	p.A249S	uc002mbg.1_RNA	NM_018708	NP_061178	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a	249					regulation of ubiquitin-protein ligase activity	cytoplasm	binding|ubiquitin-protein ligase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		AGGGGGAGAGGCTCAGCCTGG	0.687													47	103	---	---	---	---	PASS
FUT6	2528	broad.mit.edu	37	19	5831575	5831575	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5831575G>T	uc002mdf.1	-	4	1530	c.1004C>A	c.(1003-1005)GCT>GAT	p.A335D	FUT6_uc002mdg.1_Missense_Mutation_p.A335D|FUT6_uc002mdh.1_Missense_Mutation_p.A335D|FUT6_uc010dul.1_Missense_Mutation_p.A335D	NM_001040701	NP_001035791	P51993	FUT6_HUMAN	fucosyltransferase 6	335	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						CTTGCAGAAAGCGAGTGCCCA	0.647													56	206	---	---	---	---	PASS
FUT3	2525	broad.mit.edu	37	19	5843815	5843815	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5843815G>C	uc002mdk.2	-	2	1133	c.1036C>G	c.(1036-1038)CAG>GAG	p.Q346E	FUT3_uc002mdm.2_Missense_Mutation_p.Q346E|FUT3_uc002mdj.2_Missense_Mutation_p.Q346E|FUT3_uc002mdl.2_Missense_Mutation_p.Q346E	NM_001097641	NP_001091110	P21217	FUT3_HUMAN	fucosyltransferase 3	346	Lumenal (Potential).				protein glycosylation	Golgi cisterna membrane|integral to membrane|membrane fraction	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity				0						CTGGATTCCTGCTGCAGTTTC	0.647													16	246	---	---	---	---	PASS
INSR	3643	broad.mit.edu	37	19	7168106	7168106	+	Splice_Site	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7168106C>A	uc002mgd.1	-	7	1593	c.1484_splice	c.e7-1	p.C495_splice	INSR_uc002mge.1_Splice_Site_p.C495_splice|INSR_uc002mgf.2_Splice_Site_p.C495_splice	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TCATTTTCACCTGGAAAAGTT	0.383													22	68	---	---	---	---	PASS
STXBP2	6813	broad.mit.edu	37	19	7708047	7708047	+	Intron	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7708047G>C	uc002mha.3	+						STXBP2_uc002mhb.3_Intron|STXBP2_uc010dvj.2_Intron|STXBP2_uc010xjr.1_Intron|STXBP2_uc010dvk.2_Intron|STXBP2_uc002mhc.3_Intron|STXBP2_uc002mhe.1_5'Flank	NM_006949	NP_008880	Q15833	STXB2_HUMAN	syntaxin binding protein 2 isoform a						leukocyte mediated cytotoxicity|neutrophil degranulation|protein transport|regulation of mast cell degranulation|vesicle docking involved in exocytosis	azurophil granule|cytolytic granule|cytosol|specific granule|tertiary granule	syntaxin-3 binding			central_nervous_system(1)	1						CCTGCACCCTGCAGTATTCTA	0.597													44	95	---	---	---	---	PASS
RFX1	5989	broad.mit.edu	37	19	14104451	14104451	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14104451C>T	uc002mxv.2	-	2	477	c.205G>A	c.(205-207)GGT>AGT	p.G69S	RFX1_uc010dzi.2_Missense_Mutation_p.G69S	NM_002918	NP_002909	P22670	RFX1_HUMAN	regulatory factor X1	69					immune response	nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			lung(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			TTCTGGCCACCCGGTggctgt	0.353													35	49	---	---	---	---	PASS
FAM129C	199786	broad.mit.edu	37	19	17662641	17662641	+	Intron	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17662641G>A	uc010xpr.1	+						FAM129C_uc010xpq.1_Silent_p.Q630Q|FAM129C_uc010xpu.1_Silent_p.Q328Q|FAM129C_uc002ngz.3_RNA|FAM129C_uc010eaw.2_Silent_p.Q320Q	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a												0						gtcccaggCAGCCAGACTCTG	0.169													45	41	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17758177	17758177	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17758177C>A	uc002nhd.2	-	17	2205	c.2205G>T	c.(2203-2205)GAG>GAT	p.E735D		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	647					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						CCGCGAAGATCTCCTGGATGA	0.602													37	67	---	---	---	---	PASS
ARRDC2	27106	broad.mit.edu	37	19	18121409	18121409	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18121409C>T	uc002nhv.2	+	7	1184	c.1041C>T	c.(1039-1041)GCC>GCT	p.A347A	ARRDC2_uc002nhu.2_Silent_p.A342A	NM_015683	NP_056498	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2 isoform 1	347										pancreas(1)	1						AGGTGGTAGCCGACACTGAGG	0.642													6	225	---	---	---	---	PASS
PIK3R2	5296	broad.mit.edu	37	19	18278092	18278092	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18278092G>T	uc002nia.1	+	13	2224	c.1712G>T	c.(1711-1713)CGC>CTC	p.R571L	PIK3R2_uc002nib.1_RNA|PIK3R2_uc010ebi.1_RNA	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	571					fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	6						ATGCAGCTGCGCAAGATCCGA	0.617													44	115	---	---	---	---	PASS
GMIP	51291	broad.mit.edu	37	19	19749075	19749075	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19749075G>A	uc002nnd.2	-	9	799	c.682C>T	c.(682-684)CGG>TGG	p.R228W	GMIP_uc010xrb.1_Missense_Mutation_p.R228W|GMIP_uc010xrc.1_Missense_Mutation_p.R228W	NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein	228					negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1						GAGCGTGCCCGCAGGTCCTCG	0.716													8	60	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22363001	22363001	+	Silent	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22363001T>C	uc002nqs.1	-	3	1836	c.1518A>G	c.(1516-1518)AAA>AAG	p.K506K		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	506	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				ATTCTTCACATTTGTAGCGTT	0.388													5	232	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22363757	22363757	+	Silent	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22363757T>C	uc002nqs.1	-	3	1080	c.762A>G	c.(760-762)AAA>AAG	p.K254K		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	254	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				ATTCTTCACATTTGTAGGGTT	0.383													12	275	---	---	---	---	PASS
UBA2	10054	broad.mit.edu	37	19	34945384	34945384	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34945384A>T	uc002nvk.2	+	12	1238	c.1168A>T	c.(1168-1170)ACT>TCT	p.T390S	UBA2_uc010xrx.1_Missense_Mutation_p.T263S|UBA2_uc002nvl.2_Missense_Mutation_p.T294S	NM_005499	NP_005490	Q9UBT2	SAE2_HUMAN	SUMO-1 activating enzyme subunit 2	390					protein sumoylation	nucleus	ATP binding|enzyme activator activity|ligase activity|metal ion binding|protein heterodimerization activity|SUMO activating enzyme activity			ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			TATTGCTACTACTAATGCAGT	0.343													14	45	---	---	---	---	PASS
ZNF569	148266	broad.mit.edu	37	19	37904971	37904971	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37904971G>T	uc002ogi.2	-	6	1147	c.589C>A	c.(589-591)CAG>AAG	p.Q197K	ZNF569_uc002ogh.2_Missense_Mutation_p.Q38K|ZNF569_uc002ogj.2_Missense_Mutation_p.Q221K	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	197	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCCAAAGTCTGATTGAAGCCT	0.373													7	173	---	---	---	---	PASS
SNRPA	6626	broad.mit.edu	37	19	41268920	41268920	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41268920C>T	uc002ooz.2	+	4	1076	c.541C>T	c.(541-543)CCA>TCA	p.P181S	SNRPA_uc002opa.2_Missense_Mutation_p.P131S	NM_004596	NP_004587	P09012	SNRPA_HUMAN	small nuclear ribonucleoprotein polypeptide A	181	Pro-rich.					nucleoplasm|spliceosomal complex	nucleotide binding|protein binding|RNA binding			skin(2)|ovary(1)|central_nervous_system(1)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			TGGCCAGATCCCACCAGGGGC	0.642													9	106	---	---	---	---	PASS
PSG5	5673	broad.mit.edu	37	19	43680143	43680143	+	Silent	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43680143G>A	uc002ovu.2	-	3	719	c.588C>T	c.(586-588)CCC>CCT	p.P196P	PSG6_uc010xwk.1_Intron|PSG5_uc010eir.2_Intron|PSG5_uc002ovx.2_Silent_p.P196P|PSG5_uc002ovv.2_Silent_p.P289P|PSG5_uc002ovw.2_Intron	NM_002781	NP_002772	Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5	196	Ig-like C2-type 1.				female pregnancy	extracellular region				skin(3)	3		Prostate(69;0.00899)				TGTTTTCAATGGGTCGCTTTA	0.498													144	283	---	---	---	---	PASS
ZNF222	7673	broad.mit.edu	37	19	44537128	44537128	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44537128A>G	uc002oyc.2	+	4	1484	c.1301A>G	c.(1300-1302)TAC>TGC	p.Y434C	ZNF284_uc010ejd.2_Intron|ZNF222_uc002oye.2_Missense_Mutation_p.Y474C|ZNF222_uc002oyd.2_Missense_Mutation_p.Y380C	NM_013360	NP_037492	Q9UK12	ZN222_HUMAN	zinc finger protein 222 isoform 2	434					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Prostate(69;0.0435)				GGGAAGCGCTACAAGAGGCGC	0.303													54	106	---	---	---	---	PASS
ZNF234	10780	broad.mit.edu	37	19	44661176	44661176	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44661176G>A	uc002oym.2	+	6	1314	c.1007G>A	c.(1006-1008)AGG>AAG	p.R336K	ZNF234_uc002oyl.3_Missense_Mutation_p.R336K	NM_006630	NP_006621	Q14588	ZN234_HUMAN	zinc finger protein 234	336	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0435)				ATCCATCAAAGGGTCCACACA	0.438													8	157	---	---	---	---	PASS
DMPK	1760	broad.mit.edu	37	19	46280647	46280647	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46280647T>A	uc002pdd.1	-	7	1658	c.1114A>T	c.(1114-1116)ACC>TCC	p.T372S	DMPK_uc010xxs.1_Missense_Mutation_p.T273S|DMPK_uc002pde.1_Missense_Mutation_p.T372S|DMPK_uc002pdf.1_Missense_Mutation_p.T362S|DMPK_uc002pdg.1_Missense_Mutation_p.T362S|DMPK_uc002pdh.1_Missense_Mutation_p.T362S|DMPK_uc002pdi.1_Missense_Mutation_p.T388S|DMPK_uc010xxt.1_Missense_Mutation_p.T362S	NM_001081563	NP_001075032	Q09013	DMPK_HUMAN	myotonic dystrophy protein kinase isoform 1	372	AGC-kinase C-terminal.				regulation of heart contraction		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)	3		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		CATGTGTCGGTGGCACCTTCG	0.637													59	110	---	---	---	---	PASS
TBC1D17	79735	broad.mit.edu	37	19	50385600	50385600	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50385600C>T	uc002pqo.2	+	7	893	c.741C>T	c.(739-741)TCC>TCT	p.S247S	TBC1D17_uc010enn.1_RNA|TBC1D17_uc010ybg.1_Silent_p.S214S|TBC1D17_uc002pqp.2_5'UTR|TBC1D17_uc002pqq.1_RNA|TBC1D17_uc002pqr.2_5'UTR|TBC1D17_uc002pqs.2_RNA	NM_024682	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	247						intracellular	Rab GTPase activator activity				0		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		GAGCCGCCTCCGACCTTCCCC	0.557													58	169	---	---	---	---	PASS
IL4I1	259307	broad.mit.edu	37	19	50398440	50398440	+	Intron	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50398440G>A	uc002pqt.1	-						IL4I1_uc002pqv.1_Intron|IL4I1_uc010eno.1_Intron|IL4I1_uc002pqw.1_Intron|IL4I1_uc002pqu.1_Intron	NM_152899	NP_690863	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1 isoform 1 precursor							lysosome	L-amino-acid oxidase activity			lung(1)|ovary(1)|prostate(1)	3		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)		ATGGTGACCTGAGGGAGTCCG	0.657													6	65	---	---	---	---	PASS
LRRC4B	94030	broad.mit.edu	37	19	51020877	51020877	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51020877A>G	uc002pss.2	-	3	2230	c.2093T>C	c.(2092-2094)CTG>CCG	p.L698P	ASPDH_uc002psr.3_5'Flank	NM_001080457	NP_001073926	Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B precursor	698	Cytoplasmic (Potential).					cell junction|integral to membrane|presynaptic membrane				central_nervous_system(1)|skin(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CTTGAAGAGCAGAGGTTCGTG	0.592													13	60	---	---	---	---	PASS
ZNF613	79898	broad.mit.edu	37	19	52447996	52447996	+	Nonsense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52447996C>G	uc002pxz.1	+	6	1283	c.860C>G	c.(859-861)TCA>TGA	p.S287*	ZNF613_uc002pya.1_Nonsense_Mutation_p.S251*	NM_001031721	NP_001026891	Q6PF04	ZN613_HUMAN	zinc finger protein 613 isoform 1	287					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		GGAGAGAAGTCATATATATGC	0.433													20	166	---	---	---	---	PASS
VN1R2	317701	broad.mit.edu	37	19	53762720	53762720	+	Silent	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53762720T>C	uc002qbi.2	+	1	1176	c.1092T>C	c.(1090-1092)CCT>CCC	p.P364P		NM_173856	NP_776255	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	364	Helical; Name=7; (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity				0				GBM - Glioblastoma multiforme(134;0.00301)		CTATTAGCCCTTTTGTTCTCA	0.433													4	648	---	---	---	---	PASS
VSTM1	284415	broad.mit.edu	37	19	54567035	54567035	+	Translation_Start_Site	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54567035G>A	uc002qcw.3	-	1	173	c.-3C>T	c.(-5--1)GACGC>GATGC		VSTM1_uc010erb.2_RNA|VSTM1_uc002qcx.3_Translation_Start_Site	NM_198481	NP_940883	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1							integral to membrane					0	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		CGGTCATAGCGTCCCTTCTGC	0.627													17	605	---	---	---	---	PASS
KIR2DL1	3802	broad.mit.edu	37	19	55294926	55294926	+	Intron	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55294926C>T	uc002qhb.1	+						KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DL4_uc010yfl.1_5'Flank|KIR2DL3_uc010erw.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR3DP1_uc010yfi.1_Intron|KIR2DL1_uc010erz.1_Intron	NM_014218	NP_055033	P43626	KI2L1_HUMAN	killer cell immunoglobulin-like receptor, two						immune response|natural killer cell inhibitory signaling pathway	integral to plasma membrane	protein binding|receptor activity				0				GBM - Glioblastoma multiforme(193;0.0192)		TGTTGACTTCCATCTTCTACA	0.527													13	207	---	---	---	---	PASS
NLRP5	126206	broad.mit.edu	37	19	56544122	56544122	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56544122C>A	uc002qmj.2	+	8	2422	c.2422C>A	c.(2422-2424)CCC>ACC	p.P808T	NLRP5_uc002qmi.2_Missense_Mutation_p.P789T	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	808						mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)|central_nervous_system(1)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GCTGAGGCATCCCACCTGCAA	0.617													73	276	---	---	---	---	PASS
ZSCAN5A	79149	broad.mit.edu	37	19	56736422	56736422	+	5'UTR	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56736422T>A	uc002qmq.2	-	2					ZSCAN5A_uc010ygi.1_Intron|ZSCAN5A_uc002qmr.2_Intron|ZSCAN5A_uc002qms.1_Intron	NM_024303	NP_077279	Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3						CCATATCTAGTGGAGAATTTT	0.448													37	93	---	---	---	---	PASS
PEG3	5178	broad.mit.edu	37	19	57328467	57328467	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57328467C>G	uc002qnu.2	-	7	1694	c.1343G>C	c.(1342-1344)GGG>GCG	p.G448A	ZIM2_uc010ygq.1_Intron|ZIM2_uc010ygr.1_Intron|ZIM2_uc002qnr.2_Intron|ZIM2_uc002qnq.2_Intron|ZIM2_uc010etp.2_Intron|ZIM2_uc010ygs.1_Intron|PEG3_uc002qnt.2_Missense_Mutation_p.G419A|PEG3_uc002qnv.2_Missense_Mutation_p.G448A|PEG3_uc002qnw.2_Missense_Mutation_p.G324A|PEG3_uc002qnx.2_Missense_Mutation_p.G322A|PEG3_uc010etr.2_Missense_Mutation_p.G448A	NM_001146186	NP_001139658	Q9GZU2	PEG3_HUMAN	paternally expressed 3 isoform 1	448					apoptosis|viral reproduction	cytoplasm|nucleus	nucleic acid binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TGGCATTGCCCCAAAATCAAT	0.488													114	335	---	---	---	---	PASS
SEC23B	10483	broad.mit.edu	37	20	18506561	18506561	+	Silent	SNP	T	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18506561T>C	uc002wqz.1	+	7	1262	c.819T>C	c.(817-819)GCT>GCC	p.A273A	SEC23B_uc002wra.1_Silent_p.A273A|SEC23B_uc002wrb.1_Silent_p.A273A|SEC23B_uc010zsb.1_Silent_p.A255A|SEC23B_uc002wrc.1_Silent_p.A273A	NM_006363	NP_006354	Q15437	SC23B_HUMAN	Sec23 homolog B	273					ER to Golgi vesicle-mediated transport|intracellular protein transport	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane	zinc ion binding			ovary(1)	1						TGTCCATTGCTGTTGGCTTGC	0.438													4	355	---	---	---	---	PASS
GZF1	64412	broad.mit.edu	37	20	23349405	23349405	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23349405G>C	uc010gdb.2	+	5	1640	c.1466G>C	c.(1465-1467)AGA>ACA	p.R489T	GZF1_uc002wsy.2_Missense_Mutation_p.R489T|GZF1_uc010zsq.1_Missense_Mutation_p.R13T|GZF1_uc010zsr.1_5'UTR|GZF1_uc002wsz.2_Missense_Mutation_p.R489T	NM_022482	NP_071927	Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	489					transcription, DNA-dependent	nucleolus|nucleoplasm	sequence-specific DNA binding|zinc ion binding			kidney(1)	1	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					GTAGGTGAAAGACCTTTTATG	0.358													5	411	---	---	---	---	PASS
CHD6	84181	broad.mit.edu	37	20	40065951	40065951	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40065951T>A	uc002xka.1	-	27	4209	c.4031A>T	c.(4030-4032)AAT>ATT	p.N1344I	CHD6_uc002xkb.1_Missense_Mutation_p.N110I	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1344					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				GTCCTCAGCATTGTCTTCTTT	0.294													59	78	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57429324	57429324	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57429324C>A	uc002xzw.2	+	1	1289	c.1004C>A	c.(1003-1005)CCG>CAG	p.P335Q	GNAS_uc002xzt.2_Intron|GNAS_uc002xzu.3_Intron|GNAS_uc010gjq.2_Intron|GNAS_uc002xzv.2_RNA	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	Error:Variant_position_missing_in_P63092_after_alignment					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTTGACGGCCCGCCCATCAAG	0.647			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			3	35	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60903446	60903446	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60903446C>T	uc002ycq.2	-	35	4570	c.4503G>A	c.(4501-4503)CCG>CCA	p.P1501P		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	1501	Laminin EGF-like 13.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TGGTGCGTGGCGGGCAGATGC	0.682													6	9	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11097628	11097628	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11097628C>A	uc002yit.1	-	2	242	c.34G>T	c.(34-36)GCC>TCC	p.A12S	BAGE_uc002yix.2_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		agcagctgggcagacaatgcc	0.264													10	186	---	---	---	---	PASS
TTC3	7267	broad.mit.edu	37	21	38539931	38539931	+	Intron	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38539931A>G	uc002yvz.2	+						TTC3_uc002ywa.2_Intron|TTC3_uc002ywb.2_Intron|TTC3_uc010gnf.2_Intron|TTC3_uc002ywc.2_Intron|TTC3_uc002ywd.1_Intron	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				AAGTGAGTCAAAATTACATTA	0.308													16	53	---	---	---	---	PASS
MOV10L1	54456	broad.mit.edu	37	22	50552829	50552829	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50552829C>T	uc003bjj.2	+	7	987	c.904C>T	c.(904-906)CAA>TAA	p.Q302*	MOV10L1_uc003bjk.3_Nonsense_Mutation_p.Q302*|MOV10L1_uc011arp.1_Nonsense_Mutation_p.Q282*|MOV10L1_uc011arq.1_Nonsense_Mutation_p.Q63*|MOV10L1_uc010hao.1_RNA	NM_018995	NP_061868	Q9BXT6	M10L1_HUMAN	MOV10-like 1 isoform 1	302					germ cell development|multicellular organismal development|spermatogenesis		ATP binding|ATP-dependent RNA helicase activity|magnesium ion binding|RNA binding			ovary(2)|skin(1)	3		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		AGACATTCCTCAAAACTTAGT	0.358													61	145	---	---	---	---	PASS
PANX2	56666	broad.mit.edu	37	22	50609369	50609369	+	Silent	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50609369C>T	uc003bjn.3	+	1	210	c.210C>T	c.(208-210)TTC>TTT	p.F70F	PANX2_uc003bjp.3_5'UTR|PANX2_uc003bjo.3_Silent_p.F70F	NM_052839	NP_443071	Q96RD6	PANX2_HUMAN	pannexin 2 isoform 1	70	Helical; (Potential).				protein hexamerization|synaptic transmission	gap junction|integral to membrane	gap junction hemi-channel activity|ion channel activity			breast(1)	1		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		CCCTGGTCTTCACCAAGAACT	0.582													9	20	---	---	---	---	PASS
PLCXD1	55344	broad.mit.edu	37	X	215978	215978	+	Silent	SNP	C	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:215978C>G	uc004cpc.2	+	7	1260	c.948C>G	c.(946-948)CTC>CTG	p.L316L	PLCXD1_uc011mgx.1_RNA	NM_018390	NP_060860	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X	316					intracellular signal transduction|lipid metabolic process		phospholipase C activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCATCGCGCTCAATCAGAAGC	0.607													33	102	---	---	---	---	PASS
GPR143	4935	broad.mit.edu	37	X	9728766	9728766	+	Silent	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9728766C>A	uc004cst.1	-	2	411	c.411G>T	c.(409-411)GTG>GTT	p.V137V		NM_000273	NP_000264	P51810	GP143_HUMAN	G protein-coupled receptor 143	117	Extracellular (Potential).				calcium-mediated signaling using intracellular calcium source|eye pigment biosynthetic process|melanosome organization|melanosome transport|phosphatidylinositol-mediated signaling|regulation of calcium-mediated signaling|visual perception	apical plasma membrane|Golgi apparatus|integral to membrane|lysosomal membrane|melanosome membrane|membrane fraction	dopamine binding|L-DOPA receptor activity|protein binding|tyrosine binding			ovary(1)	1		Hepatocellular(5;0.000888)				CCGCACTCCCCACGCAGAAAG	0.408													16	16	---	---	---	---	PASS
ZNF645	158506	broad.mit.edu	37	X	22292376	22292376	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22292376G>C	uc004dai.1	+	1	1317	c.1268G>C	c.(1267-1269)AGA>ACA	p.R423T		NM_152577	NP_689790	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	423						intracellular	zinc ion binding			lung(1)|pancreas(1)	2						AGAAGACATAGACGGTATTAA	0.463													58	42	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67943851	67943851	+	Missense_Mutation	SNP	C	A	A	rs150722287		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67943851C>A	uc004dxa.2	+	13	3214	c.2842C>A	c.(2842-2844)CAA>AAA	p.Q948K	STARD8_uc004dxb.2_Missense_Mutation_p.Q1028K|STARD8_uc004dxc.3_Missense_Mutation_p.Q948K	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	948	START.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						GGATCCGGAACAACCTGTGCC	0.612													78	50	---	---	---	---	PASS
RLIM	51132	broad.mit.edu	37	X	73811938	73811938	+	Silent	SNP	G	C	C	rs61754468	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73811938G>C	uc004ebu.2	-	5	1502	c.1212C>G	c.(1210-1212)ACC>ACG	p.T404T	RLIM_uc004ebw.2_Silent_p.T404T	NM_183353	NP_899196	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	404					random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						GCCTTAACATGGTCTGAATTG	0.413													7	172	---	---	---	---	PASS
POU3F4	5456	broad.mit.edu	37	X	82763523	82763523	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:82763523G>C	uc004eeg.2	+	1	255	c.191G>C	c.(190-192)GGG>GCG	p.G64A		NM_000307	NP_000298	P49335	PO3F4_HUMAN	POU domain, class 3, transcription factor 4	64					sensory perception of sound	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1						CTGAGCGACGGGGGCCCATGG	0.622													4	17	---	---	---	---	PASS
CXorf57	55086	broad.mit.edu	37	X	105855548	105855548	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105855548G>T	uc004emi.3	+	1	389	c.238G>T	c.(238-240)GAG>TAG	p.E80*	CXorf57_uc004emj.3_Nonsense_Mutation_p.E80*|CXorf57_uc004emh.2_Nonsense_Mutation_p.E80*	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN	hypothetical protein LOC55086	80										ovary(1)|lung(1)|breast(1)	3						GTACCTGTTAGAGGATGAGCC	0.567													5	238	---	---	---	---	PASS
CAPN6	827	broad.mit.edu	37	X	110491097	110491097	+	Splice_Site	SNP	A	G	G			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110491097A>G	uc004epc.1	-	11	1774	c.1606_splice	c.e11+1	p.T536_splice	CAPN6_uc011msu.1_Splice_Site_p.T281_splice	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6						microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						TGCCATTCTTACTTTCATTGG	0.368													10	207	---	---	---	---	PASS
GLUD2	2747	broad.mit.edu	37	X	120181839	120181839	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120181839C>T	uc004eto.2	+	1	378	c.301C>T	c.(301-303)CGG>TGG	p.R101W		NM_012084	NP_036216	P49448	DHE4_HUMAN	glutamate dehydrogenase 2 precursor	101					glutamate biosynthetic process|glutamate catabolic process	mitochondrial matrix	ADP binding|glutamate dehydrogenase|glutamate dehydrogenase activity|GTP binding|leucine binding			pancreas(1)	1					L-Glutamic Acid(DB00142)|NADH(DB00157)	GAAGCGGAACCGGGTGCGCGG	0.627													13	150	---	---	---	---	PASS
MAGEC3	139081	broad.mit.edu	37	X	140969321	140969321	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140969321C>A	uc011mwp.1	+	4	648	c.648C>A	c.(646-648)AAC>AAA	p.N216K		NM_138702	NP_619647	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3 isoform 1	216	MAGE 1.									skin(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ATGTCATCAACACATACACGG	0.448													6	277	---	---	---	---	PASS
MIR891B	100126304	broad.mit.edu	37	X	145082638	145082638	+	RNA	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145082638C>A	hsa-mir-891b|MI0005534	-			c.12C>A																				0						AGGTAAGTTGCAAGGATTAAG	0.229													58	42	---	---	---	---	PASS
GABRQ	55879	broad.mit.edu	37	X	151821068	151821068	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151821068T>A	uc004ffp.1	+	9	1243	c.1223T>A	c.(1222-1224)CTG>CAG	p.L408Q		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	408						cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					CAGGCCCCCCTGGCAAGCCCG	0.592													75	51	---	---	---	---	PASS
MAGEA6	4105	broad.mit.edu	37	X	151870031	151870031	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151870031G>T	uc004ffq.1	+	3	915	c.721G>T	c.(721-723)GAT>TAT	p.D241Y	MAGEA6_uc004ffr.1_Missense_Mutation_p.D241Y|MAGEA2_uc010nto.2_Intron	NM_005363	NP_005354	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	241	MAGE.						protein binding				0	Acute lymphoblastic leukemia(192;6.56e-05)					TATCTTCGGGGATCCCAAGAA	0.542													239	192	---	---	---	---	PASS
DUSP9	1852	broad.mit.edu	37	X	152915069	152915069	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152915069C>A	uc004fhx.3	+	3	960	c.756C>A	c.(754-756)TAC>TAA	p.Y252*	DUSP9_uc004fhy.3_Nonsense_Mutation_p.Y252*	NM_001395	NP_001386	Q99956	DUS9_HUMAN	dual specificity phosphatase 9	252	Tyrosine-protein phosphatase.				inactivation of MAPK activity|JNK cascade	cytosol|endoplasmic reticulum|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			ovary(2)	2	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACTTTCACTACAAGCAGATCC	0.557													8	388	---	---	---	---	PASS
F8	2157	broad.mit.edu	37	X	154157066	154157066	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154157066G>A	uc004fmt.2	-	14	5170	c.4999C>T	c.(4999-5001)CGG>TGG	p.R1667W		NM_000132	NP_000123	P00451	FA8_HUMAN	coagulation factor VIII isoform a precursor	1667	B.	Cleavage (activation).			acute-phase response|blood coagulation, intrinsic pathway|cell adhesion|platelet activation|platelet degranulation	extracellular space|plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity|protein binding			ovary(5)|large_intestine(2)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	11	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GTTATTTCCCGTTGATGGCGT	0.413													32	128	---	---	---	---	PASS
AGMAT	79814	broad.mit.edu	37	1	15899935	15899935	+	3'UTR	DEL	T	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15899935delT	uc001awv.1	-	7					DNAJC16_uc001awu.2_Intron	NM_024758	NP_079034	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase) precursor						putrescine biosynthetic process|spermidine biosynthetic process	mitochondrion	agmatinase activity|metal ion binding			skin(1)	1		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		CAAGTACTCCTTTTTTTTTCC	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30196670	30196671	+	IGR	INS	-	ACC	ACC	rs148373610		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30196670_30196671insACC								PTPRU (543355 upstream) : MATN1 (987455 downstream)																							ccaccatcactaccaccaccac	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37568434	37568435	+	IGR	INS	-	AGA	AGA	rs72154778		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37568434_37568435insAGA								GRIK3 (68590 upstream) : ZC3H12A (371684 downstream)																							gaaggaggaggagaagaagaag	0.000													4	2	---	---	---	---	
C1orf177	163747	broad.mit.edu	37	1	55285601	55285602	+	Intron	DEL	AT	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55285601_55285602delAT	uc001cyb.3	+						C1orf177_uc001cya.3_Intron	NM_001110533	NP_001104003	Q3ZCV2	CA177_HUMAN	hypothetical protein LOC163747 isoform 2												0						cctcccccccatatttcttttc	0.000													4	2	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62492153	62492160	+	Intron	DEL	TGTGTGTC	-	-	rs113183177		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62492153_62492160delTGTGTGTC	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						tgtgtgtgtgtgtgtgtctgtgtgtgtg	0.288													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	62655214	62655245	+	IGR	DEL	CTGTAATCTCAGCACTTTGGGAGGCCGAGGCG	-	-	rs71729183		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62655214_62655245delCTGTAATCTCAGCACTTTGGGAGGCCGAGGCG								INADL (10868 upstream) : L1TD1 (5251 downstream)																							tggctcaggcctgtaatctcagcactttgggaggccgaggcgctgtaatctc	0.116													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	78240627	78240627	+	IGR	DEL	T	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78240627delT								USP33 (15090 upstream) : FAM73A (4682 downstream)																							Attcttaacctttttttttta	0.264													4	5	---	---	---	---	
FCRL1	115350	broad.mit.edu	37	1	157774046	157774047	+	Intron	INS	-	A	A	rs12133090		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157774046_157774047insA	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ACCCCCCCCCCAGTGGCCCATG	0.520													7	7	---	---	---	---	
CACNA1E	777	broad.mit.edu	37	1	181477283	181477284	+	Intron	INS	-	TGTG	TGTG	rs141400260	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181477283_181477284insTGTG	uc001gow.2	+						CACNA1E_uc009wxr.2_5'Flank|CACNA1E_uc009wxs.2_5'Flank	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,						energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						cccaaacgccttgtgtgtgtgt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	30879919	30879920	+	IGR	INS	-	TCTT	TCTT	rs140191287	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30879919_30879920insTCTT								LCLAT1 (12829 upstream) : CAPN13 (65720 downstream)																							tcctcttcctctcttTCtttct	0.015													6	3	---	---	---	---	
ALMS1	7840	broad.mit.edu	37	2	73701498	73701499	+	Intron	INS	-	TG	TG	rs72148928		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73701498_73701499insTG	uc002sje.1	+						ALMS1_uc002sjf.1_Intron|ALMS1_uc002sjg.2_Intron|ALMS1_uc002sjh.1_Intron	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1						G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						CTTGTTGACTCtgtgtgtgtgt	0.233													4	2	---	---	---	---	
KCNJ3	3760	broad.mit.edu	37	2	155711609	155711609	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155711609delG	uc002tyv.1	+	3	1485	c.1290delG	c.(1288-1290)TTGfs	p.L430fs	KCNJ3_uc010zce.1_3'UTR	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	430	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	CCTACAGCTTGGGAGACTTGC	0.403													102	60	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	164606328	164606331	+	IGR	DEL	TCCT	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164606328_164606331delTCCT								FIGN (13815 upstream) : GRB14 (743002 downstream)																							TGGGGTATCCtccttccttccttc	0.265													4	3	---	---	---	---	
MYO3B	140469	broad.mit.edu	37	2	171493467	171493468	+	Intron	INS	-	GT	GT	rs146852720	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171493467_171493468insGT	uc002ufy.2	+						MYO3B_uc002ufz.2_Intron|MYO3B_uc002ufw.2_Intron|MYO3B_uc002ufx.2_Intron|MYO3B_uc002ugb.2_Intron	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2						response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						TGCTTTtgtgcgtgtgtgtgtg	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	171650615	171650615	+	Intron	DEL	C	-	-	rs113045300		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171650615delC	uc002ugg.2	+											RecName: Full=Uncharacterized protein LOC285141;																		TCCtttctttctttttttttt	0.060													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	30076048	30076049	+	IGR	INS	-	AG	AG	rs60722393		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30076048_30076049insAG								RBMS3 (29429 upstream) : TGFBR2 (571945 downstream)																							gaaggaaggacagagagagaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	42469248	42469255	+	IGR	DEL	CGCACACA	-	-	rs71776646		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42469248_42469255delCGCACACA								LYZL4 (17183 upstream) : VIPR1 (74849 downstream)																							TGCGCATGCGCGcacacacacacacaca	0.394													6	3	---	---	---	---	
NKTR	4820	broad.mit.edu	37	3	42676570	42676571	+	Intron	DEL	AG	-	-	rs58779310		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42676570_42676571delAG	uc003clo.2	+						NKTR_uc003clm.1_Intron|NKTR_uc003clp.2_Intron|NKTR_uc011azp.1_Intron|NKTR_uc003clq.1_Intron|NKTR_uc003clr.1_Intron|NKTR_uc003cls.2_Intron	NM_005385	NP_005376	P30414	NKTR_HUMAN	natural killer-tumor recognition sequence						protein folding	membrane	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.24)		aaaaaaaaaaagaaCTTTAGAC	0.327													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	104324441	104324441	+	IGR	DEL	A	-	-	rs141046061		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:104324441delA								None (None upstream) : ALCAM (761272 downstream)																							ATCAAAAATGAAAAAaaaaaa	0.010													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	110401053	110401054	+	IGR	INS	-	T	T	rs113398685		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110401053_110401054insT								None (None upstream) : PVRL3 (389811 downstream)																							ACTTTGACTTCTTTTTTTTTTT	0.406													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128164984	128164986	+	IGR	DEL	TGG	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128164984_128164986delTGG								EEFSEC (37496 upstream) : DNAJB8 (16296 downstream)																							gtggtggtgatggtggtggtggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	143967747	143967748	+	IGR	INS	-	TTCC	TTCC			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143967747_143967748insTTCC								C3orf58 (256538 upstream) : None (None downstream)																							tccttctttctttccttccttc	0.134													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148125590	148125591	+	IGR	INS	-	TG	TG	rs10662368		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148125590_148125591insTG								ZIC1 (991086 upstream) : AGTR1 (290067 downstream)																							ATAGTTCCCTCtgtgtgtgtgt	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	155753211	155753219	+	IGR	DEL	CTTCTTCTT	-	-	rs112403424		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155753211_155753219delCTTCTTCTT								GMPS (97693 upstream) : KCNAB1 (85118 downstream)																							cctcctcctccttcttcttcttcttcttc	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	162500644	162500653	+	Intron	DEL	GTGGGTGTGT	-	-	rs56824069		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162500644_162500653delGTGGGTGTGT	uc003feg.2	+											Homo sapiens, clone IMAGE:2905387, mRNA.																		aatatatggggtgggtgtgtgtgtgtgtgt	0.000													3	4	---	---	---	---	
SPATA16	83893	broad.mit.edu	37	3	172678807	172678814	+	Intron	DEL	TTTCTCTC	-	-	rs71906652		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172678807_172678814delTTTCTCTC	uc003fin.3	-							NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16						cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			tttctttctttttctctctttctctctt	0.000													2	8	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	175010382	175010383	+	Intron	INS	-	AC	AC	rs150395131	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175010382_175010383insAC	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron|NAALADL2_uc010hwz.1_Intron	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		TGAGTTGGGATacacacacaca	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189128685	189128686	+	IGR	INS	-	CTCTC	CTCTC			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189128685_189128686insCTCTC								TPRG1 (87415 upstream) : TP63 (220530 downstream)																							tcctctcccctctctcctctcc	0.000													3	3	---	---	---	---	
TP63	8626	broad.mit.edu	37	3	189566030	189566031	+	Intron	INS	-	T	T	rs59468983		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189566030_189566031insT	uc003fry.2	+						TP63_uc003frx.2_Intron|TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron|TP63_uc003fsa.2_Intron|TP63_uc003fsb.2_Intron|TP63_uc003fsc.2_Intron|TP63_uc003fsd.2_Intron|TP63_uc010hzd.1_Intron|TP63_uc003fse.1_Intron	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1						anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		cctcctccttctctctctctct	0.000									Hay-Wells_syndrome	HNSCC(45;0.13)			3	3	---	---	---	---	
LRRC15	131578	broad.mit.edu	37	3	194090921	194090924	+	5'Flank	DEL	TCTT	-	-	rs71963035		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194090921_194090924delTCTT	uc003ftu.2	-						LRRC15_uc003ftt.2_5'Flank	NM_130830	NP_570843	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15 isoform b							integral to membrane				ovary(3)	3	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		ttcattcttctctttctttctttc	0.309													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38734802	38734802	+	IGR	DEL	A	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38734802delA								KLF3 (31674 upstream) : TLR10 (39461 downstream)																							ggtggtgatgatggtggtggt	0.075													6	3	---	---	---	---	
WDR19	57728	broad.mit.edu	37	4	39280429	39280429	+	Intron	DEL	T	-	-	rs5857667		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39280429delT	uc003gtv.2	+						WDR19_uc011byi.1_Intron	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19						cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						TTTTGATGTATTTTTTTTAAT	0.388													5	4	---	---	---	---	
APBB2	323	broad.mit.edu	37	4	40903927	40903928	+	Intron	DEL	TG	-	-	rs72010169		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40903927_40903928delTG	uc003gvl.2	-						APBB2_uc010ifu.2_Intron|APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc011byt.1_Intron	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						tccaaaattatgtgtgtgtgtg	0.089													4	2	---	---	---	---	
NFXL1	152518	broad.mit.edu	37	4	47916234	47916234	+	Intron	DEL	A	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47916234delA	uc010igh.2	-						uc003gxr.1_5'Flank|NFXL1_uc003gxp.2_Intron|NFXL1_uc003gxq.3_Intron|NFXL1_uc010igi.2_Intron	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like							integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						TGCAAAGGAGAAAAAAAAAAA	0.627													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49099749	49099753	+	IGR	DEL	TCCGG	-	-	rs60947727		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49099749_49099753delTCCGG								CWH43 (35656 upstream) : None (None downstream)																							tccattccgttccggtccattccat	0.000													20	9	---	---	---	---	
KIAA1211	57482	broad.mit.edu	37	4	57180576	57180577	+	In_Frame_Ins	INS	-	GGAGCGGAGGGAGCGGAG	GGAGCGGAGGGAGCGGAG	rs138358443	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57180576_57180577insGGAGCGGAGGGAGCGGAG	uc003hbk.2	+	8	1299_1300	c.908_909insGGAGCGGAGGGAGCGGAG	c.(907-909)GCG>GCGGAGCGGAGGGAGCGGAGG	p.303_304insERRERR	KIAA1211_uc010iha.2_In_Frame_Ins_p.296_297insERRERR|KIAA1211_uc011bzz.1_In_Frame_Ins_p.213_214insERRERR|KIAA1211_uc003hbm.1_In_Frame_Ins_p.189_190insERRERR	NM_020722	NP_065773	Q6ZU35	K1211_HUMAN	hypothetical protein LOC57482	303_304	Glu-rich.									ovary(1)|skin(1)	2	Glioma(25;0.08)|all_neural(26;0.101)					TGGGAGGACGCGGAGCGGAGGG	0.733													4	2	---	---	---	---	
MIR1269	100302177	broad.mit.edu	37	4	67142230	67142231	+	5'Flank	INS	-	TAGA	TAGA	rs143986407	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:67142230_67142231insTAGA	hsa-mir-1269|MI0006406	+																							0						taaggaatacttagctggaaaa	0.054													6	3	---	---	---	---	
HERC5	51191	broad.mit.edu	37	4	89425218	89425218	+	Intron	DEL	A	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89425218delA	uc003hrt.2	+						HERC5_uc011cdm.1_Intron	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5						innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		actccgtctcaaaaaaaaaaa	0.015													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	117753969	117753970	+	IGR	INS	-	AC	AC	rs71593926		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:117753969_117753970insAC								MIR1973 (533045 upstream) : TRAM1L1 (250746 downstream)																							gaaggtgatagacacacacaca	0.000													6	3	---	---	---	---	
CYP4V2	285440	broad.mit.edu	37	4	187120238	187120239	+	Splice_Site	INS	-	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187120238_187120239insT	uc003iyw.3	+	6	1105	c.801_splice	c.e6+1	p.S267_splice		NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily v,						response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		TACCAACAGTGTAAGTCCCTGA	0.238													76	42	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1065276	1065277	+	Intron	INS	-	AGGGGACAGTG	AGGGGACAGTG	rs150605410	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1065276_1065277insAGGGGACAGTG	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	tggggacgaaaaggggacagtg	0.020													72	44	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	38824169	38824170	+	Intron	INS	-	AC	AC	rs148327266	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38824169_38824170insAC	uc003jlk.1	-						uc003jll.1_5'Flank					full-length cDNA clone CS0DI053YO12 of Placenta Cot 25-normalized of Homo sapiens (human).																		ctactaaaaatacacacacaca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	53808705	53808708	+	IGR	DEL	CCTT	-	-	rs3958713		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53808705_53808708delCCTT								HSPB3 (56498 upstream) : SNX18 (4881 downstream)																							tccttccttcccttccttccttcc	0.074													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	70963207	70963210	+	IGR	DEL	TTTC	-	-	rs60961356		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70963207_70963210delTTTC								MCCC2 (8679 upstream) : CARTPT (51784 downstream)																							ctttctttcttttctttctttctt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	86923740	86923741	+	IGR	INS	-	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86923740_86923741insA								CCNH (214904 upstream) : TMEM161B (567283 downstream)																							AAACAAAAGCCAAAAAAAACAA	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141771688	141771689	+	IGR	INS	-	T	T	rs111876610		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141771688_141771689insT								SPRY4 (67068 upstream) : FGF1 (200055 downstream)																							tccttccttccttccttccttc	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	17748003	17748004	+	IGR	DEL	AC	-	-	rs111554813		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17748003_17748004delAC								NUP153 (41185 upstream) : KIF13A (12581 downstream)																							AACTCATTTAacacacacacac	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	18566175	18566176	+	Intron	INS	-	CCTC	CCTC	rs144862399	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18566175_18566176insCCTC	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																		cttccttccttcctcccttctt	0.000													3	3	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38893642	38893643	+	Intron	INS	-	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38893642_38893643insT	uc003ooe.1	+						uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TAATAAATTTGTTTTTTTTTAA	0.287													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	43679874	43679879	+	IGR	DEL	TGTGTG	-	-	rs111316897		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43679874_43679879delTGTGTG								MRPS18A (24346 upstream) : VEGFA (58074 downstream)																							ggggttactctgtgtgtgtgtgtgtg	0.112													4	2	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	65522134	65522135	+	Intron	DEL	AC	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65522134_65522135delAC	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						GATTTAAAATacacacacacac	0.213													4	2	---	---	---	---	
LAMA4	3910	broad.mit.edu	37	6	112450389	112450390	+	Intron	DEL	CA	-	-	rs5027514		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112450389_112450390delCA	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		tgtgtgtgtgcatgtgtgtgtg	0.252													4	2	---	---	---	---	
TRDN	10345	broad.mit.edu	37	6	123703272	123703273	+	Frame_Shift_Ins	INS	-	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123703272_123703273insT	uc003pzj.1	-	15	1177_1178	c.1155_1156insA	c.(1153-1158)AAACCTfs	p.K385fs	TRDN_uc003pzk.1_Frame_Shift_Ins_p.K386fs|TRDN_uc003pzl.1_Frame_Shift_Ins_p.K386fs|TRDN_uc010kem.1_5'UTR	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin	385_386	Lumenal.				muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		CCTTCTGCAGGTTTTTTTGTTT	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	139383236	139383251	+	IGR	DEL	AAGGGAGAAAGGAAGC	-	-	rs12665587		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139383236_139383251delAAGGGAGAAAGGAAGC								C6orf115 (18797 upstream) : HECA (72998 downstream)																							gggagggaggaagggagaaaggaagcaaggaaggaa	0.009													3	3	---	---	---	---	
GET4	51608	broad.mit.edu	37	7	932269	932292	+	Intron	DEL	TGGGTGTATGTGCAAGTGTAGACA	-	-	rs66553046	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:932269_932292delTGGGTGTATGTGCAAGTGTAGACA	uc003sjl.1	+						GET4_uc003sjj.1_Intron	NM_015949	NP_057033	Q7L5D6	GET4_HUMAN	hypothetical protein LOC51608						tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	protein binding				0						ggtagctgtgtgggtgtatgtgCAAGTGTAGACATGGCGTGGGG	0.272													4	3	---	---	---	---	
SLC29A4	222962	broad.mit.edu	37	7	5321970	5321970	+	5'Flank	DEL	G	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5321970delG	uc003sod.2	+						SLC29A4_uc011jwg.1_5'Flank|SLC29A4_uc003soc.2_5'Flank|SLC29A4_uc003soe.2_5'Flank	NM_153247	NP_694979	Q7RTT9	S29A4_HUMAN	solute carrier family 29 (nucleoside						nucleobase, nucleoside and nucleotide metabolic process	apical plasma membrane|integral to membrane	nucleoside transmembrane transporter activity			liver(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)		gggagggagagggaggagggg	0.164													5	3	---	---	---	---	
FERD3L	222894	broad.mit.edu	37	7	19184715	19184715	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19184715delG	uc003suo.1	-	1	330	c.271delC	c.(271-273)CGCfs	p.R91fs	uc003sun.1_RNA	NM_152898	NP_690862	Q96RJ6	FER3L_HUMAN	nephew of atonal 3	91					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			large_intestine(1)	1						CTCTTGGGGCGGCCTAATAGG	0.343													73	39	---	---	---	---	
CHN2	1124	broad.mit.edu	37	7	29391966	29391967	+	Intron	INS	-	GT	GT	rs141727908	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29391966_29391967insGT	uc003szz.2	+						CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_Intron|CHN2_uc010kvb.2_Intron|CHN2_uc010kvc.2_Intron|CHN2_uc011jzt.1_Intron|CHN2_uc010kvd.2_Intron|CHN2_uc011jzu.1_Intron	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						TGCAGTCTGTCgtgtgtgtgtg	0.287													4	2	---	---	---	---	
HERPUD2	64224	broad.mit.edu	37	7	35673102	35673102	+	3'UTR	DEL	A	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35673102delA	uc003tet.2	-	8					HERPUD2_uc003tes.3_3'UTR	NM_022373	NP_071768	Q9BSE4	HERP2_HUMAN	HERPUD family member 2						response to unfolded protein	integral to membrane				ovary(3)	3						TAGGATCtttaaaaaaaaaaa	0.308													4	2	---	---	---	---	
CCDC146	57639	broad.mit.edu	37	7	76796901	76796901	+	Intron	DEL	A	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76796901delA	uc003uga.2	+						CCDC146_uc003ufz.1_Intron	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146											ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GTTTATTTTTATTATTTTCCA	0.264													5	3	---	---	---	---	
CDK14	5218	broad.mit.edu	37	7	90742138	90742139	+	Intron	DEL	GT	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90742138_90742139delGT	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4						TGCATTACAGgtgtgtgtgtgt	0.272													6	3	---	---	---	---	
CASD1	64921	broad.mit.edu	37	7	94166563	94166564	+	Intron	INS	-	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94166563_94166564insT	uc003uni.3	+						CASD1_uc003unh.2_Intron|CASD1_uc003unj.3_Intron	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor							integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			tataaaatgaattttgtatttt	0.129													2	4	---	---	---	---	
CUX1	1523	broad.mit.edu	37	7	101748456	101748457	+	Intron	INS	-	ACAC	ACAC	rs148799098	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101748456_101748457insACAC	uc003uyx.3	+						CUX1_uc003uys.3_Intron|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						TATTTAATATTacacacacaca	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	127248053	127248054	+	IGR	DEL	AG	-	-	rs144565736		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127248053_127248054delAG								FSCN3 (6210 upstream) : PAX4 (2292 downstream)																							acacacacacagacacacacac	0.168													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	138387721	138387722	+	IGR	INS	-	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138387721_138387722insC								SVOPL (23931 upstream) : ATP6V0A4 (3318 downstream)																							TCACACAGATGCATCTGGGAGG	0.500													2	5	---	---	---	---	
DLGAP2	9228	broad.mit.edu	37	8	1624759	1624759	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1624759delG	uc003wpl.2	+	8	2120	c.2023delG	c.(2023-2025)GGGfs	p.G675fs	DLGAP2_uc003wpm.2_Frame_Shift_Del_p.G661fs	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	754					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CCACTCTGTCGGGGTGCAAGT	0.542													29	20	---	---	---	---	
RSPO2	340419	broad.mit.edu	37	8	109081429	109081430	+	Intron	DEL	AC	-	-	rs147801093		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109081429_109081430delAC	uc003yms.2	-						RSPO2_uc003ymq.2_Intron|RSPO2_uc003ymr.2_Intron	NM_178565	NP_848660	Q6UXX9	RSPO2_HUMAN	R-spondin family, member 2 precursor						Wnt receptor signaling pathway	extracellular region	heparin binding			skin(3)|ovary(2)|pancreas(1)|lung(1)	7			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			gtatgtgtgaacacacacacac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131768914	131768915	+	IGR	DEL	GC	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131768914_131768915delGC								ASAP1 (354698 upstream) : ADCY8 (23633 downstream)																							gtgtgtgtgtgCGCGCGCGTAG	0.272													6	3	---	---	---	---	
TSNARE1	203062	broad.mit.edu	37	8	143337296	143337296	+	Intron	DEL	C	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143337296delC	uc003ywk.2	-						TSNARE1_uc011lju.1_Intron|TSNARE1_uc003ywj.2_Intron	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1						vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					atcaccatcaccatcaccacc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	11085585	11085586	+	IGR	INS	-	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:11085585_11085586insA								PTPRD (472862 upstream) : None (None downstream)																							tttcaaaagagaaaaaaaaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	15017688	15017689	+	Intron	INS	-	T	T	rs150778914	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15017688_15017689insT	uc003zln.1	-						LOC389705_uc010mid.1_Intron					Homo sapiens cDNA FLJ46077 fis, clone TESTI2003768, weakly  similar to Chloride channel protein 3.																		TTTTGAAGTGATTTTTTTTAAA	0.332													5	6	---	---	---	---	
CNTLN	54875	broad.mit.edu	37	9	17302088	17302089	+	Intron	DEL	AC	-	-	rs141585237		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17302088_17302089delAC	uc003zmz.2	+						CNTLN_uc003zmy.2_Intron|CNTLN_uc010mio.2_Intron	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1							centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		ACATATGTGTacacacacacac	0.243													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	93921744	93921747	+	5'Flank	DEL	AGAA	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93921744_93921747delAGAA	uc004are.1	+											Homo sapiens cDNA FLJ37813 fis, clone BRSSN2002857.																		gagaggaaagagaaagaggaggga	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	117528940	117528941	+	IGR	INS	-	CCTT	CCTT	rs113822880	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117528940_117528941insCCTT								C9orf91 (120244 upstream) : TNFSF15 (22672 downstream)																							tttccttcctaccttccttcct	0.059													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	118904150	118904151	+	IGR	INS	-	GGAAGGAA	GGAAGGAA			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118904150_118904151insGGAAGGAA								C9orf27 (216773 upstream) : PAPPA (11920 downstream)																							AACAGTATGTTggaaggaagga	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132172595	132172600	+	IGR	DEL	CATCAA	-	-	rs1220896		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132172595_132172600delCATCAA								C9orf106 (87713 upstream) : C9orf50 (201906 downstream)																							tcacaaccaccatcaacatcaccacc	0.049													4	3	---	---	---	---	
GTPBP4	23560	broad.mit.edu	37	10	1046481	1046481	+	Intron	DEL	T	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1046481delT	uc001ift.2	+						GTPBP4_uc010qac.1_Intron|GTPBP4_uc001ifu.2_Intron|GTPBP4_uc010qad.1_Intron|GTPBP4_uc010qae.1_Intron	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	G protein-binding protein CRFG						negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of DNA replication|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		ccagccCTACTTTTTTTTTTT	0.209													4	2	---	---	---	---	
HERC4	26091	broad.mit.edu	37	10	69797655	69797656	+	Intron	DEL	GT	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69797655_69797656delGT	uc001jng.3	-						HERC4_uc001jnf.3_Intron|HERC4_uc001jnh.3_Intron|HERC4_uc009xpr.2_Intron|HERC4_uc001jni.3_Intron|HERC4_uc001jnj.2_Intron	NM_022079	NP_071362	Q5GLZ8	HERC4_HUMAN	hect domain and RLD 4 isoform a						cell differentiation|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|spermatogenesis	cytosol	ubiquitin-protein ligase activity			ovary(1)|breast(1)|skin(1)	3						attcctagcagtgtgtgtgtgt	0.000													4	2	---	---	---	---	
PSAP	5660	broad.mit.edu	37	10	73583573	73583574	+	Intron	INS	-	A	A	rs68178384		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73583573_73583574insA	uc001jsm.2	-						PSAP_uc001jsl.2_5'Flank	NM_002778	NP_002769	P07602	SAP_HUMAN	prosaposin isoform a preproprotein						glycosphingolipid metabolic process|lipid transport|platelet activation|platelet degranulation	extracellular space|Golgi apparatus|integral to membrane|lysosomal lumen	enzyme activator activity|lipid binding			ovary(1)	1						ATGCCATACCCAAAAAAAAAAA	0.470													4	3	---	---	---	---	
VAX1	11023	broad.mit.edu	37	10	118897632	118897632	+	5'UTR	DEL	C	-	-	rs56950787		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118897632delC	uc009xyx.2	-	1					VAX1_uc001ldb.1_5'UTR	NM_001112704	NP_001106175	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1 isoform a							nucleus	sequence-specific DNA binding			ovary(2)	2				all cancers(201;0.0108)		GGGGGGGGGGCGGAGAAGGAA	0.438													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	126555959	126555959	+	IGR	DEL	A	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126555959delA								FAM175B (30721 upstream) : ZRANB1 (73013 downstream)																							accctgtctcaaaaaaaaaaa	0.214													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206066	134206068	+	IGR	DEL	TGG	-	-	rs72458419		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206066_134206068delTGG								LRRC27 (11056 upstream) : PWWP2B (4634 downstream)																							gtggtggtaatggtgatgatggt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	23315010	23315013	+	IGR	DEL	ACAC	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:23315010_23315013delACAC								SVIP (463628 upstream) : None (None downstream)																							aacaaaaaatacacacacacacac	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49832048	49832048	+	IGR	DEL	T	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49832048delT								LOC440040 (81 upstream) : OR4C13 (141927 downstream)																							ATATTCTCTGTTTTTTTTTTC	0.279													6	4	---	---	---	---	
XRRA1	143570	broad.mit.edu	37	11	74631052	74631052	+	Intron	DEL	A	-	-	rs112064551		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74631052delA	uc009yub.2	-						XRRA1_uc001ovm.2_Intron|XRRA1_uc001ovo.2_Intron|XRRA1_uc001ovq.3_Intron|XRRA1_uc001ovp.3_Intron|XRRA1_uc001ovr.2_Intron	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1						response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1						ATAAAACTGCAAAAAAAAAAA	0.333													5	3	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	84290234	84290235	+	Intron	INS	-	TA	TA	rs144862848	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:84290234_84290235insTA	uc001paj.2	-						DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc001pal.1_Intron	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TTATTCACgtgtgtgtgtgtgt	0.134													6	3	---	---	---	---	
LOC341056	341056	broad.mit.edu	37	11	122889507	122889508	+	RNA	INS	-	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122889507_122889508insA	uc010rzt.1	+	1		c.1234_1235insA				NR_027288				full-length cDNA clone CS0DC021YJ17 of Neuroblastoma Cot 25-normalized of Homo sapiens (human).												0						TTCCTGCGACGAAGGAGGTGGT	0.564													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127336015	127336016	+	IGR	INS	-	G	G	rs77142386		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127336015_127336016insG								KIRREL3 (462660 upstream) : ETS1 (992640 downstream)																							gaaggaaggaagaagaagagag	0.000													4	2	---	---	---	---	
NTM	50863	broad.mit.edu	37	11	131846013	131846014	+	Intron	INS	-	CTTCCTTC	CTTCCTTC			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131846013_131846014insCTTCCTTC	uc001qgp.2	+						NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Intron|NTM_uc001qgq.2_Intron	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						ctccctcattccttccttcctt	0.178													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	10392033	10392033	+	IGR	DEL	T	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10392033delT								GABARAPL1 (16311 upstream) : KLRD1 (65017 downstream)																							ccttccttcctttccttcctt	0.164													4	2	---	---	---	---	
PUS7L	83448	broad.mit.edu	37	12	44131974	44131975	+	Intron	DEL	AA	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44131974_44131975delAA	uc001rnq.3	-						PUS7L_uc001rnr.3_Intron|PUS7L_uc001rns.3_Intron|PUS7L_uc009zkb.2_Intron	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		GTCATGTAATAAAAGTGTTCAG	0.322													2	6	---	---	---	---	
AQP5	362	broad.mit.edu	37	12	50356237	50356238	+	Intron	INS	-	A	A	rs146758293	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50356237_50356238insA	uc001rvo.2	+							NM_001651	NP_001642	P55064	AQP5_HUMAN	aquaporin 5						carbon dioxide transport|excretion|odontogenesis|pancreatic juice secretion	apical plasma membrane|integral to plasma membrane	protein binding|water channel activity				0						ACCCCACCTGGAAAAAAGGGGT	0.668													12	7	---	---	---	---	
COPZ1	22818	broad.mit.edu	37	12	54730803	54730804	+	Intron	INS	-	A	A	rs71874933		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54730803_54730804insA	uc001sfs.1	+						COPZ1_uc001sft.2_Intron|COPZ1_uc009znm.1_Intron|COPZ1_uc010sot.1_Intron|uc010sou.1_5'Flank|MIR148B_hsa-mir-148b|MI0000811_5'Flank	NM_016057	NP_057141	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1						COPI coating of Golgi vesicle|intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol					0						gagactgtcgcaaaaaaaaaaa	0.173													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	57212529	57212530	+	IGR	DEL	GT	-	-	rs35900259		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57212529_57212530delGT								HSD17B6 (30955 upstream) : SDR9C7 (105089 downstream)																							gtgtgtggtggtgtgtgtgtgt	0.297													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	93517697	93517703	+	IGR	DEL	ATCAAAA	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93517697_93517703delATCAAAA								EEA1 (194590 upstream) : NUDT4 (253998 downstream)																							GAACCAAAATATCAAAAATAACAATGC	0.275													16	10	---	---	---	---	
DRAM1	55332	broad.mit.edu	37	12	102283259	102283260	+	Intron	INS	-	GAAG	GAAG	rs146359103	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102283259_102283260insGAAG	uc001tix.2	+						DRAM1_uc010svv.1_Intron	NM_018370	NP_060840	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1						apoptosis|autophagy	integral to membrane|lysosomal membrane				ovary(1)	1						tgagaagagaagaaggaaggaa	0.000													19	11	---	---	---	---	
ACACB	32	broad.mit.edu	37	12	109644233	109644234	+	Intron	INS	-	AAA	AAA	rs35315851		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109644233_109644234insAAA	uc001tob.2	+						ACACB_uc001toc.2_Intron	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	gcgagtgtctcaaaaaaaaaaa	0.213													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	115784293	115784294	+	IGR	INS	-	GAGG	GAGG	rs28508591		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115784293_115784294insGAGG								TBX3 (662324 upstream) : MED13L (612089 downstream)																							aaggaaagaaagagggagggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	120025810	120025811	+	Intron	INS	-	GAAG	GAAG	rs150830914	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120025810_120025811insGAAG	uc001txf.2	-											Homo sapiens full length insert cDNA clone ZD48A05.																		aagaaaggaaagaaggaaggaa	0.094													5	4	---	---	---	---	
ATP6V0A2	23545	broad.mit.edu	37	12	124208920	124208930	+	Intron	DEL	AAAAAATTAGC	-	-	rs74964284		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124208920_124208930delAAAAAATTAGC	uc001ufr.2	+						ATP6V0A2_uc001ufq.1_Intron	NM_012463	NP_036595	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|immune response|insulin receptor signaling pathway|transferrin transport	endosome membrane|integral to membrane|plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		acaatacaaaaaaaaattagctgggcgtggt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	129497863	129497864	+	IGR	INS	-	TT	TT	rs10655206		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129497863_129497864insTT								GLT1D1 (28354 upstream) : TMEM132D (58407 downstream)																							TGGCAGAATCCTTTTTTTTTTT	0.371													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31652513	31652520	+	IGR	DEL	AAGAAAGA	-	-	rs7986217		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31652513_31652520delAAGAAAGA								C13orf26 (103362 upstream) : HSPH1 (58245 downstream)																							ggaaggaaggaagaaagaaagaaagaaa	0.192													12	7	---	---	---	---	
DLEU1	10301	broad.mit.edu	37	13	50705342	50705343	+	Intron	DEL	TG	-	-	rs72282425		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50705342_50705343delTG	uc010adl.1	+						DLEU1_uc001vee.1_Intron|DLEU1_uc010adm.1_Intron|DLEU1_uc010adn.1_Intron|DLEU1_uc001vef.1_Intron|DLEU1_uc001veg.1_Intron|DLEU1_uc010tgn.1_Intron|DLEU1_uc001vei.1_Intron|DLEU1_uc010ado.1_Intron|DLEU1_uc010adp.1_Intron					Homo sapiens XTP6 (XTP6) mRNA, complete cds.												0						GTATCCAGTTtgtgtgtgtgtg	0.421													4	2	---	---	---	---	
NALCN	259232	broad.mit.edu	37	13	101833762	101833763	+	Intron	DEL	TG	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101833762_101833763delTG	uc001vox.1	-						NALCN_uc001voy.2_Intron|NALCN_uc001voz.2_Intron|NALCN_uc001vpa.2_Intron	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1							integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGGGGCTTTTTGTGTGTGTGTT	0.287													28	15	---	---	---	---	
TNFSF13B	10673	broad.mit.edu	37	13	108931014	108931015	+	Intron	INS	-	CTTC	CTTC			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108931014_108931015insCTTC	uc001vqr.2	+						TNFSF13B_uc010agj.2_Intron	NM_006573	NP_006564	Q9Y275	TN13B_HUMAN	tumor necrosis factor superfamily, member 13b						cell proliferation|immune response|signal transduction	extracellular space|integral to membrane|plasma membrane|soluble fraction	cytokine activity|tumor necrosis factor receptor binding				0	all_lung(23;0.000396)|all_neural(89;0.00256)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00902)|Lung SC(71;0.104)		all cancers(43;0.184)|BRCA - Breast invasive adenocarcinoma(86;0.19)			ctcctcctcctctcctcctctc	0.074													4	2	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79217771	79217772	+	Intron	INS	-	T	T	rs149588375	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79217771_79217772insT	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc010asv.1_Intron|uc001xuo.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GCTGCTAATTCTTTTTTTTCTC	0.470													6	5	---	---	---	---	
GPR68	8111	broad.mit.edu	37	14	91710563	91710564	+	Intron	DEL	AC	-	-	rs138684591		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91710563_91710564delAC	uc001xzg.2	-						GPR68_uc001xzh.2_Intron	NM_003485	NP_003476	Q15743	OGR1_HUMAN	G protein-coupled receptor 68						inflammatory response	integral to plasma membrane	G-protein coupled receptor activity			kidney(1)	1		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		cagaacacagacacacacacac	0.015													5	3	---	---	---	---	
KLC1	3831	broad.mit.edu	37	14	104056250	104056251	+	Intron	INS	-	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104056250_104056251insA	uc010tyd.1	+						C14orf153_uc001ynl.3_Intron|C14orf153_uc010tyc.1_Intron	NM_005552	NP_005543	Q07866	KLC1_HUMAN	kinesin light chain 1 isoform 1						blood coagulation|microtubule-based movement|stress granule disassembly	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding				0		Melanoma(154;0.155)|all_epithelial(191;0.19)				gactccgtctcaaaaaaaaaaa	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	32742719	32742720	+	IGR	INS	-	AC	AC			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32742719_32742720insAC								CHRNA7 (281486 upstream) : ARHGAP11A (164625 downstream)																							TCACAGTATGTacacacacaca	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	36749321	36749324	+	IGR	DEL	ACAT	-	-	rs66473257		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36749321_36749324delACAT								ATPBD4 (910917 upstream) : C15orf41 (122488 downstream)																							acacacacacacatacacacacac	0.338													1	5	---	---	---	---	
NUSAP1	51203	broad.mit.edu	37	15	41672441	41672442	+	3'UTR	INS	-	T	T	rs34658531		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41672441_41672442insT	uc001zns.3	+	11					NUSAP1_uc001znq.3_3'UTR|NUSAP1_uc001znr.3_3'UTR|NUSAP1_uc010bce.2_3'UTR|NUSAP1_uc001znt.3_3'UTR|NUSAP1_uc001znv.3_3'UTR|NUSAP1_uc001znu.3_3'UTR|NUSAP1_uc010ucw.1_3'UTR|NUSAP1_uc001znw.3_3'UTR	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1						cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		CCTTTTGTAAATTTTTTTTTTT	0.351													4	2	---	---	---	---	
TRPM7	54822	broad.mit.edu	37	15	50882045	50882046	+	Intron	INS	-	TTTTTTG	TTTTTTG	rs148695282	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50882045_50882046insTTTTTTG	uc001zyt.3	-						TRPM7_uc010bew.1_Intron	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,						cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AGGTTACAGttttttttgtttt	0.178													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	70823833	70823834	+	IGR	INS	-	AAA	AAA			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:70823833_70823834insAAA								TLE3 (433577 upstream) : UACA (123061 downstream)																							agggagggagggaaggaaggaa	0.158													3	6	---	---	---	---	
PSMA4	5685	broad.mit.edu	37	15	78838791	78838792	+	Intron	DEL	AA	-	-	rs11350747		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78838791_78838792delAA	uc002bdu.3	+						PSMA4_uc010blf.2_Intron|PSMA4_uc002bdv.3_Intron|PSMA4_uc002bdw.3_Intron|PSMA4_uc002bdx.3_Intron	NM_002789	NP_002780	P25789	PSA4_HUMAN	proteasome alpha 4 subunit isoform 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex, alpha-subunit complex	identical protein binding|threonine-type endopeptidase activity				0						cccctgtgtcaaaaaaaaaaaa	0.099													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84063020	84063021	+	IGR	INS	-	AGGG	AGGG	rs59433795	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84063020_84063021insAGGG								BNC1 (109552 upstream) : SH3GL3 (53070 downstream)																							gggaggaaggaagggagggagg	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	91190495	91190497	+	IGR	DEL	CCT	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91190495_91190497delCCT								CRTC3 (1919 upstream) : BLM (70082 downstream)																							cctccacacccctcctcctcaat	0.089													8	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	101796008	101796009	+	IGR	INS	-	TGTG	TGTG	rs138803988	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101796008_101796009insTGTG								CHSY1 (3882 upstream) : SELS (15205 downstream)																							GCTTCTCACACtgtgtgtgtgt	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86154419	86154419	+	IGR	DEL	T	-	-	rs59055658		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86154419delT								IRF8 (198210 upstream) : LOC732275 (211037 downstream)																							ctcctcctcctcttcctcctc	0.169													4	3	---	---	---	---	
ALOX12B	242	broad.mit.edu	37	17	7980190	7980200	+	Intron	DEL	CCCCAGATGCC	-	-	rs72152877		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7980190_7980200delCCCCAGATGCC	uc002gjy.1	-						uc010cnq.1_5'Flank	NM_001139	NP_001130	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type						epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity				0						CTCTTGTGGTCCCCAGATGCCCCCCAGGCTG	0.616										Multiple Myeloma(8;0.094)			3	9	---	---	---	---	
MYH13	8735	broad.mit.edu	37	17	10277860	10277861	+	5'Flank	INS	-	TCCC	TCCC	rs147093817		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10277860_10277861insTCCC	uc002gmk.1	-							NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle						muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						ccttccttccttccctccctcc	0.109													3	3	---	---	---	---	
SLC47A1	55244	broad.mit.edu	37	17	19461211	19461211	+	Intron	DEL	A	-	-	rs138104299		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19461211delA	uc002gvy.1	+						SLC47A1_uc010vyy.1_Intron|SLC47A1_uc002gvx.2_Intron|SLC47A1_uc010vyz.1_Intron|SLC47A1_uc010cqp.1_Intron|SLC47A1_uc010cqq.1_Intron|SLC47A1_uc010vza.1_Intron|SLC47A1_uc010vzb.1_Intron|SLC47A1_uc010vzc.1_Intron	NM_018242	NP_060712	Q96FL8	S47A1_HUMAN	solute carrier family 47, member 1							integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)					CTTTCCCTCCAAAAAAAAAAA	0.279													5	3	---	---	---	---	
CYTSB	92521	broad.mit.edu	37	17	20059591	20059592	+	Intron	INS	-	C	C	rs147154728	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20059591_20059592insC	uc002gwq.2	+						CYTSB_uc010cqx.2_Intron|CYTSB_uc002gwr.2_Intron|CYTSB_uc002gws.2_Intron|CYTSB_uc002gwv.2_Intron|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gwt.2_Intron|CYTSB_uc002gwu.2_Intron	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0						CCGCAACCCCACCCCCCCTCCA	0.708													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	35179921	35179924	+	IGR	DEL	TGTG	-	-	rs71368428		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35179921_35179924delTGTG								MRM1 (214515 upstream) : LHX1 (114575 downstream)																							ACTTGGAGTCtgtgtgtgtgtgtg	0.181													6	3	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025826	64025829	+	Intron	DEL	AAAC	-	-	rs67867456		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025826_64025829delAAAC	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gtctctaaataaacaaacaaacaa	0.123													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	65699293	65699296	+	IGR	DEL	TGTG	-	-	rs34652278		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65699293_65699296delTGTG								PITPNC1 (9648 upstream) : NOL11 (14765 downstream)																							tgtgtgtgtttgtgtgtgtgtgtg	0.000													4	2	---	---	---	---	
EIF4A3	9775	broad.mit.edu	37	17	78114113	78114113	+	Intron	DEL	T	-	-	rs34004549		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78114113delT	uc010wuc.1	-						EIF4A3_uc002jxs.2_Intron	NM_014740	NP_055555	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A,						mRNA transport|negative regulation of translation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|rRNA processing	catalytic step 2 spliceosome|cytoplasm|exon-exon junction complex|nuclear speck	ATP binding|ATP-dependent RNA helicase activity|poly(A) RNA binding|protein binding			ovary(1)	1	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			TTAAttttgcttttttttttt	0.164													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	2105780	2105781	+	IGR	DEL	AT	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2105780_2105781delAT								C18orf2 (698599 upstream) : METTL4 (431744 downstream)																							gtattttaaaaTATATAtgtgt	0.094													3	4	---	---	---	---	
L3MBTL4	91133	broad.mit.edu	37	18	6071834	6071841	+	Intron	DEL	AGAGAAAG	-	-	rs7241857	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6071834_6071841delAGAGAAAG	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron|L3MBTL4_uc002kmy.3_Intron	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				aaagaaagaaagagaaagagagagaggg	0.000													4	3	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50554195	50554196	+	Intron	INS	-	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50554195_50554196insT	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AAGAGCAGTTATTTTTTTTTTC	0.381													8	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	72057058	72057059	+	IGR	INS	-	A	A			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72057058_72057059insA								CYB5A (97837 upstream) : FAM69C (45905 downstream)																							ttattattatttttttttGACT	0.178													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77393507	77393518	+	IGR	DEL	TGGTGACGGTGA	-	-	rs71163808		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77393507_77393518delTGGTGACGGTGA								NFATC1 (104185 upstream) : CTDP1 (46283 downstream)																							gtgatggtggtggtgacggtgatgatggtggt	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	10190786	10190789	+	IGR	DEL	GGGA	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10190786_10190789delGGGA								C3P1 (5975 upstream) : C19orf66 (6017 downstream)																							aggaaggaaggggagaaggaagga	0.127													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13955914	13955919	+	IGR	DEL	CACACA	-	-	rs111729007		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13955914_13955919delCACACA								MIR23A (8441 upstream) : MIR181C (29594 downstream)																							AATGGCATGGcacacacacacacaca	0.306													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42675584	42675585	+	IGR	DEL	GT	-	-	rs71336804		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42675584_42675585delGT								POU2F2 (38954 upstream) : DEDD2 (27167 downstream)																							GCTGCGCTTCgtgtgtgtgtgt	0.416													4	2	---	---	---	---	
GP6	51206	broad.mit.edu	37	19	55546084	55546085	+	Intron	INS	-	AC	AC	rs143935276	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55546084_55546085insAC	uc002qik.2	-						GP6_uc002qil.2_Intron|GP6_uc010esq.2_Intron|RDH13_uc010esr.1_Intron	NM_016363	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet) isoform 2						enzyme linked receptor protein signaling pathway|leukocyte migration|platelet activation	integral to plasma membrane	collagen binding|transmembrane receptor activity			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		ccctCATTCTTacacacacaca	0.020													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	58938806	58938807	+	IGR	INS	-	T	T			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58938806_58938807insT								ZNF584 (9116 upstream) : ZNF132 (5375 downstream)																							tccttccttccttcctttcctt	0.000													3	3	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	14833819	14833820	+	Intron	INS	-	TG	TG	rs147348353	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14833819_14833820insTG	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002wox.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				gtgtgtgtgtctgtgtgtgtgt	0.272													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	16755570	16755570	+	IGR	DEL	G	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16755570delG								OTOR (22762 upstream) : PCSK2 (451182 downstream)																							aagaaagaaagaaagaaagaa	0.000													4	2	---	---	---	---	
NFS1	9054	broad.mit.edu	37	20	34284597	34284598	+	Intron	INS	-	A	A	rs142208589	by1000genomes	TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34284597_34284598insA	uc002xdw.1	-						NFS1_uc002xdt.1_Intron|NFS1_uc002xdu.1_Intron|NFS1_uc002xdv.1_Intron|NFS1_uc010zvk.1_Intron|NFS1_uc010zvl.1_Intron|NFS1_uc002xdx.2_Intron|ROMO1_uc002xdy.2_5'Flank|ROMO1_uc010gfm.2_5'Flank	NM_021100	NP_066923	Q9Y697	NFS1_HUMAN	NFS1 nitrogen fixation 1 precursor						cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	TTTTTTTTTTTAATGAACTATT	0.208													1	6	---	---	---	---	
PREX1	57580	broad.mit.edu	37	20	47346951	47346952	+	Intron	DEL	CA	-	-	rs148593835		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47346951_47346952delCA	uc002xtw.1	-							NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,						actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			caaaagccaccacacacacaca	0.158													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	51227780	51227781	+	IGR	INS	-	C	C			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51227780_51227781insC								ZFP64 (419256 upstream) : TSHZ2 (361096 downstream)																							cttctttccttcttccctccct	0.050													3	5	---	---	---	---	
LZTR1	8216	broad.mit.edu	37	22	21341677	21341678	+	Intron	INS	-	A	A	rs149184314		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21341677_21341678insA	uc002zto.2	+						LZTR1_uc002ztn.2_Intron|LZTR1_uc011ahy.1_Intron|LZTR1_uc010gsr.1_5'Flank	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1						anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			gactccgtctcaaaaaaaaaaa	0.257													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	42544516	42544517	+	IGR	DEL	AC	-	-	rs140105017		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42544516_42544517delAC								CYP2D7P1 (3941 upstream) : TCF20 (11502 downstream)																							tctcaagaaaacacacacacac	0.139													4	2	---	---	---	---	
SERHL2	253190	broad.mit.edu	37	22	42951979	42951979	+	Intron	DEL	C	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42951979delC	uc003bcr.2	+						SERHL_uc011apm.1_Intron|SERHL2_uc011apn.1_Intron|SERHL2_uc010gyz.2_Intron|SERHL2_uc010gyy.2_Intron|SERHL2_uc011apo.1_Intron|RRP7B_uc003bcs.2_RNA	NM_014509	NP_055324	Q9H4I8	SEHL2_HUMAN	serine hydrolase-like 2							perinuclear region of cytoplasm|peroxisome	hydrolase activity				0						CCATATGGTGCCCCCCCCCCC	0.592													5	3	---	---	---	---	
LMF2	91289	broad.mit.edu	37	22	50942709	50942710	+	Intron	INS	-	CT	CT	rs61419617		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50942709_50942710insCT	uc003blp.2	-						LMF2_uc010hba.2_Intron|LMF2_uc003blo.2_Intron	NM_033200	NP_149977	Q9BU23	LMF2_HUMAN	lipase maturation factor 2							endoplasmic reticulum membrane|integral to membrane				breast(1)	1		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCACACCCCCCGGTGCCCGGCC	0.421													10	8	---	---	---	---	
ZNF645	158506	broad.mit.edu	37	X	22291349	22291349	+	Frame_Shift_Del	DEL	T	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22291349delT	uc004dai.1	+	1	290	c.241delT	c.(241-243)TGTfs	p.C81fs		NM_152577	NP_689790	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	81	RING-type.					intracellular	zinc ion binding			lung(1)|pancreas(1)	2						TTGCTATCACTGTGCTAATTT	0.388													68	85	---	---	---	---	
BEX1	55859	broad.mit.edu	37	X	102318390	102318393	+	Intron	DEL	GCCC	-	-			TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102318390_102318393delGCCC	uc004ejt.1	-							NM_018476	NP_060946	Q9HBH7	BEX1_HUMAN	brain expressed, X-linked 1						cell differentiation|nervous system development	cytoplasm|nucleus				ovary(1)	1						CCCCATTCGAGCCCGCCCCCCCCC	0.564													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	128740973	128740980	+	IGR	DEL	AAGGAAGT	-	-	rs72146220		TCGA-22-4604-01A-01D-1267-08	TCGA-22-4604-11A-01D-1267-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128740973_128740980delAAGGAAGT								OCRL (14445 upstream) : APLN (38346 downstream)																							ggaaagaaggaaggaagtaaggaaggaa	0.091													5	9	---	---	---	---	
