Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
EXTL1	2134	broad.mit.edu	37	1	26360343	26360343	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26360343C>G	uc001blf.2	+	9	2542	c.1675C>G	c.(1675-1677)CAT>GAT	p.H559D		NM_004455	NP_004446	Q92935	EXTL1_HUMAN	exostoses-like 1	559	Lumenal (Potential).				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		CGCCTTCTACCATAGGTACAG	0.493													38	21	---	---	---	---	PASS
THRAP3	9967	broad.mit.edu	37	1	36755344	36755344	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36755344C>G	uc001cae.3	+	5	1948	c.1724C>G	c.(1723-1725)TCT>TGT	p.S575C	THRAP3_uc001caf.3_Missense_Mutation_p.S575C|THRAP3_uc001cag.1_Missense_Mutation_p.S575C	NM_005119	NP_005110	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	575					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(5)|lung(3)|breast(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CGGATGGACTCTTTTGATGAG	0.517			T	USP6	aneurysmal bone cysts								59	46	---	---	---	---	PASS
DMBX1	127343	broad.mit.edu	37	1	46976739	46976739	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46976739C>A	uc001cpx.2	+	3	496	c.481C>A	c.(481-483)CAG>AAG	p.Q161K	DMBX1_uc001cpw.2_Missense_Mutation_p.Q156K	NM_147192	NP_671725	Q8NFW5	DMBX1_HUMAN	diencephalon/mesencephalon homeobox 1 isoform b	161					brain development|developmental growth|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					TCCAGATACCCAGCTGGACAC	0.637													55	52	---	---	---	---	PASS
STIL	6491	broad.mit.edu	37	1	47748137	47748137	+	Intron	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47748137G>C	uc001crc.1	-						TAL1_uc001crb.1_Intron|STIL_uc010omn.1_Intron|STIL_uc010omo.1_Intron|STIL_uc001crd.1_Intron|STIL_uc001cre.1_Intron|STIL_uc001crf.1_5'UTR|STIL_uc001crg.1_Intron	NM_003035	NP_003026	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus isoform 2						cell proliferation|multicellular organismal development	centrosome|cytosol				lung(2)|skin(1)	3		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				AAGACCTAAAGAATAGAAGGG	0.378													59	26	---	---	---	---	PASS
AMY2B	280	broad.mit.edu	37	1	104120396	104120396	+	Nonsense_Mutation	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104120396T>A	uc001duq.2	+	11	1891	c.1275T>A	c.(1273-1275)TAT>TAA	p.Y425*	AMY2B_uc010ouo.1_RNA|LOC648740_uc001dur.2_Nonsense_Mutation_p.Y425*|AMY2B_uc001dus.1_RNA	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	425					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		CAAACTGGTATGATAATGGGA	0.338													35	217	---	---	---	---	PASS
C1orf194	127003	broad.mit.edu	37	1	109656270	109656270	+	5'Flank	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109656270G>T	uc009wev.2	-						KIAA1324_uc001dwq.2_5'Flank|KIAA1324_uc009wex.1_5'Flank|KIAA1324_uc009wey.2_5'Flank|KIAA1324_uc010ovg.1_5'Flank|C1orf194_uc001dwp.3_5'Flank|C1orf194_uc009wew.2_Silent_p.R10R	NM_001122961	NP_001116433	Q5T5A4	CA194_HUMAN	hypothetical protein LOC127003											ovary(1)	1						CCTCTTCCAGGCGACGACGTC	0.542													4	152	---	---	---	---	PASS
ACP6	51205	broad.mit.edu	37	1	147131642	147131642	+	Splice_Site	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147131642C>T	uc001epr.2	-	3	813	c.349_splice	c.e3-1	p.G117_splice	ACP6_uc009wjj.1_Splice_Site_p.G74_splice	NM_016361	NP_057445	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic precursor						lipid metabolic process	extracellular region|mitochondrion	acid phosphatase activity|protein binding			ovary(4)	4	all_hematologic(923;0.0276)					ACATGCCCCCCTAAAGTAGGG	0.507													38	49	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152080826	152080826	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152080826C>T	uc001ezp.2	-	2	4867	c.4867G>A	c.(4867-4869)GAA>AAA	p.E1623K	TCHH_uc009wne.1_Missense_Mutation_p.E1623K	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	1623	23 X 26 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTTCGTCTTCGCGGAATTTT	0.597													10	189	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152325922	152325922	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152325922T>C	uc001ezw.3	-	3	4413	c.4340A>G	c.(4339-4341)CAT>CGT	p.H1447R	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1447							calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGCTTGGCCATGAGTTTGTTC	0.522													262	434	---	---	---	---	PASS
PYGO2	90780	broad.mit.edu	37	1	154931905	154931905	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154931905C>A	uc001fft.2	-	3	777	c.571G>T	c.(571-573)GGT>TGT	p.G191C		NM_138300	NP_612157	Q9BRQ0	PYGO2_HUMAN	pygopus homolog 2	191	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding|zinc ion binding			skin(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ATCATGGGACCAAATCCCCCC	0.592													20	119	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158590100	158590100	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158590100C>A	uc001fst.1	-	44	6476	c.6277G>T	c.(6277-6279)GCT>TCT	p.A2093S		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2093	Spectrin 20.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TGAGCCCTAGCCAGGGAGGCC	0.493													59	77	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158590101	158590101	+	Silent	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158590101C>A	uc001fst.1	-	44	6475	c.6276G>T	c.(6274-6276)CTG>CTT	p.L2092L		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2092	Spectrin 20.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GAGCCCTAGCCAGGGAGGCCA	0.498													59	75	---	---	---	---	PASS
NPHS2	7827	broad.mit.edu	37	1	179528818	179528818	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179528818T>G	uc001gmq.3	-	4	615	c.530A>C	c.(529-531)CAT>CCT	p.H177P	NPHS2_uc009wxi.2_Missense_Mutation_p.H177P	NM_014625	NP_055440	Q9NP85	PODO_HUMAN	podocin	177	Cytoplasmic (Potential).				excretion	integral to plasma membrane	protein binding				0						GCTTACCTCATGAAAAGGTAT	0.373													5	18	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	183086559	183086559	+	Silent	SNP	C	A	A	rs150392886	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183086559C>A	uc001gpy.3	+	9	1926	c.1669C>A	c.(1669-1671)CGG>AGG	p.R557R		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	557	Laminin IV type A.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTACTTTCCTCGGTACTTCAT	0.517													3	76	---	---	---	---	PASS
NR5A2	2494	broad.mit.edu	37	1	200017366	200017366	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200017366C>A	uc001gvb.2	+	5	736	c.530C>A	c.(529-531)GCC>GAC	p.A177D	NR5A2_uc001gvc.2_Missense_Mutation_p.A131D|NR5A2_uc009wzh.2_Missense_Mutation_p.A137D|NR5A2_uc010pph.1_Missense_Mutation_p.A105D	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	177	FTZ-F1 box.				embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)					AGAGACAGGGCCCTGAAGCAA	0.537													87	126	---	---	---	---	PASS
PLEKHA6	22874	broad.mit.edu	37	1	204199696	204199696	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204199696C>T	uc001hau.2	-	18	2745	c.2428G>A	c.(2428-2430)GTG>ATG	p.V810M		NM_014935	NP_055750	Q9Y2H5	PKHA6_HUMAN	phosphoinositol 3-phosphate-binding protein-3	810										ovary(3)|pancreas(1)	4	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			CCAGGAAACACAGCACTCTTG	0.572													11	11	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243328002	243328002	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243328002C>A	uc001hzs.2	-	13	3668	c.3260G>T	c.(3259-3261)AGT>ATT	p.S1087I	CEP170_uc001hzt.2_Missense_Mutation_p.S989I|CEP170_uc001hzu.2_Missense_Mutation_p.S989I|CEP170_uc001hzv.1_Missense_Mutation_p.S465I	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	1087	Targeting to microtubules.					centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GGTTGATTTACTAGATGAACC	0.488													40	82	---	---	---	---	PASS
OR2G2	81470	broad.mit.edu	37	1	247751962	247751962	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247751962T>A	uc010pyy.1	+	1	301	c.301T>A	c.(301-303)TTG>ATG	p.L101M		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	101	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TGGTGGCTGTTTGGTTCACCT	0.552													89	191	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1652640	1652640	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1652640A>G	uc002qxa.2	-	17	2976	c.2912T>C	c.(2911-2913)TTC>TCC	p.F971S		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	971					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CCCGGCCAGGAAGCAGGGGAT	0.697													3	18	---	---	---	---	PASS
ROCK2	9475	broad.mit.edu	37	2	11337440	11337440	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11337440A>G	uc002rbd.1	-	27	3763	c.3314T>C	c.(3313-3315)CTG>CCG	p.L1105P		NM_004850	NP_004841	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein	1105	Potential.				axon guidance|cytokinesis|intracellular signal transduction	cytosol|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|structural molecule activity			stomach(2)|skin(2)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TGTCATCTGCAGTTCAATTCG	0.393													6	183	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25464581	25464581	+	Intron	SNP	A	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25464581A>C	uc002rgc.2	-						DNMT3A_uc002rgd.2_Intron|DNMT3A_uc010eyi.2_Intron|DNMT3A_uc002rgb.2_Intron	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform						regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGAGCCCTGCACCAGCCAGCA	0.632			Mis|F|N|S		AML								6	18	---	---	---	---	PASS
PKDCC	91461	broad.mit.edu	37	2	42281206	42281206	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42281206C>A	uc002rsg.2	+	3	972	c.793C>A	c.(793-795)CAC>AAC	p.H265N		NM_138370	NP_612379	Q504Y2	PKDCC_HUMAN	protein kinase-like protein SgK493	265	Protein kinase.				cell differentiation|embryonic digestive tract development|lung alveolus development|negative regulation of Golgi to plasma membrane protein transport|ossification|palate development|positive regulation of bone mineralization|positive regulation of chondrocyte differentiation|protein transport	Golgi apparatus	ATP binding|protein kinase activity			breast(1)	1						CCTCCTCCACCACCTGGCCCA	0.627													9	130	---	---	---	---	PASS
ANXA4	307	broad.mit.edu	37	2	70015273	70015273	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70015273G>T	uc002sfr.3	+	3	324	c.97G>T	c.(97-99)GGC>TGC	p.G33C	ANXA4_uc010yqn.1_RNA|ANXA4_uc002sfs.3_Missense_Mutation_p.G33C|ANXA4_uc010yqo.1_Intron	NM_001153	NP_001144	P09525	ANXA4_HUMAN	annexin IV	31	Annexin 1.				anti-apoptosis|signal transduction	cytoplasm	calcium ion binding|calcium-dependent phospholipid binding|phospholipase inhibitor activity				0						GAAAGGGCTCGGTATGTGTCC	0.547													35	76	---	---	---	---	PASS
RAB11FIP5	26056	broad.mit.edu	37	2	73303202	73303202	+	Silent	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73303202G>C	uc002siu.3	-	4	1918	c.1677C>G	c.(1675-1677)CTC>CTG	p.L559L	RAB11FIP5_uc002sis.3_5'UTR|RAB11FIP5_uc002sit.3_Silent_p.L481L	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	559					protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0						TGACTGTTTTGAGCTTCTCCA	0.632													204	315	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73718019	73718019	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73718019A>G	uc002sje.1	+	12	9047	c.8936A>G	c.(8935-8937)GAC>GGC	p.D2979G	ALMS1_uc002sjf.1_Missense_Mutation_p.D2935G|ALMS1_uc002sjg.2_Missense_Mutation_p.D2365G|ALMS1_uc002sjh.1_Missense_Mutation_p.D2365G	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2977					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						GGTGTAGATGACCAAATGAAT	0.403													111	213	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90060889	90060889	+	Intron	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90060889C>T	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		GGGGTCCCCTCGAGGTTCAGT	0.502													103	61	---	---	---	---	PASS
TXNDC9	10190	broad.mit.edu	37	2	99938551	99938551	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99938551G>T	uc002szz.2	-	4	621	c.430C>A	c.(430-432)CCC>ACC	p.P144T	MRPL30_uc002szl.1_Intron|TXNDC9_uc010yvp.1_Missense_Mutation_p.P161T|TXNDC9_uc002taa.1_Missense_Mutation_p.P144T	NM_005783	NP_005774	O14530	TXND9_HUMAN	thioredoxin domain containing 9	144	Thioredoxin.				cell redox homeostasis		protein binding				0						GCTAGTGTGGGAATGACTTTG	0.393													96	228	---	---	---	---	PASS
LONRF2	164832	broad.mit.edu	37	2	100915388	100915388	+	Silent	SNP	C	G	G	rs114518866	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100915388C>G	uc002tal.3	-	7	2026	c.1386G>C	c.(1384-1386)ACG>ACC	p.T462T	LONRF2_uc010yvs.1_RNA	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	462	RING-type.|TPR 6.				proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2						GTCCACAGGGCGTAGTGACAG	0.448													44	127	---	---	---	---	PASS
POTEF	728378	broad.mit.edu	37	2	130832979	130832979	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130832979T>C	uc010fmh.2	-	17	2466	c.2066A>G	c.(2065-2067)AAT>AGT	p.N689S		NM_001099771	NP_001093241	A5A3E0	POTEF_HUMAN	prostate, ovary, testis expressed protein on	689	Potential.					cell cortex	ATP binding			skin(3)|ovary(2)	5						CTTTAAAAGATTATCATTCCT	0.433													46	42	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155098615	155098615	+	Nonsense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155098615G>A	uc002tyr.3	+	5	951	c.384G>A	c.(382-384)TGG>TGA	p.W128*	GALNT13_uc002tyt.3_Nonsense_Mutation_p.W128*|GALNT13_uc010foc.1_5'UTR	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	128	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						ATGAAGCTTGGAGCACTCTCC	0.398													55	55	---	---	---	---	PASS
GPD2	2820	broad.mit.edu	37	2	157367439	157367439	+	Intron	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157367439G>C	uc002tzf.3	+						GPD2_uc010zch.1_Intron|GPD2_uc002tzd.3_Intron|GPD2_uc002tze.1_Intron	NM_001083112	NP_001076581	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2,						cellular lipid metabolic process	glycerol-3-phosphate dehydrogenase complex|mitochondrial inner membrane	calcium ion binding|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity			ovary(1)	1						GCAGGTAATTGTGTATGCTGG	0.373													87	100	---	---	---	---	PASS
FAP	2191	broad.mit.edu	37	2	163059394	163059394	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163059394G>A	uc002ucd.2	-	14	1419	c.1211C>T	c.(1210-1212)ACA>ATA	p.T404I	FAP_uc010zct.1_Missense_Mutation_p.T379I|FAP_uc010fpd.2_Intron	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	404	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						TGAATCCTGTGTTACTCTGAA	0.368													43	167	---	---	---	---	PASS
WIPF1	7456	broad.mit.edu	37	2	175436644	175436644	+	Missense_Mutation	SNP	T	C	C	rs146135868		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175436644T>C	uc002uiy.2	-	6	1221	c.889A>G	c.(889-891)ACT>GCT	p.T297A	uc002uiw.2_Intron|uc002uix.1_Intron|WIPF1_uc002uja.2_Missense_Mutation_p.T297A|WIPF1_uc010fqt.1_Missense_Mutation_p.T297A|WIPF1_uc002ujc.1_Missense_Mutation_p.T297A|WIPF1_uc002uiz.2_Missense_Mutation_p.T297A|WIPF1_uc002ujb.1_Missense_Mutation_p.T297A|WIPF1_uc010zep.1_Missense_Mutation_p.T297A	NM_003387	NP_003378	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	297	Pro-rich.				actin polymerization or depolymerization|protein complex assembly	cytoplasmic membrane-bounded vesicle	actin binding|profilin binding			ovary(1)|skin(1)	2						GGCCGCGGAGTGGAAGGCACT	0.682													21	11	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098957	178098957	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098957G>A	uc002ulh.3	-	2	643	c.88C>T	c.(88-90)CTT>TTT	p.L30F	NFE2L2_uc002ulg.3_Missense_Mutation_p.L14F|NFE2L2_uc010zfa.1_Missense_Mutation_p.L14F|NFE2L2_uc002uli.3_Missense_Mutation_p.L14F|NFE2L2_uc010fra.2_Missense_Mutation_p.L14F|NFE2L2_uc010frb.2_Missense_Mutation_p.L14F	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	30					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			CTTACTCCAAGATCTATATCT	0.368			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			40	30	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179489294	179489294	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179489294T>C	uc010zfg.1	-	191	37233	c.37009A>G	c.(37009-37011)AGG>GGG	p.R12337G	TTN_uc010zfh.1_Missense_Mutation_p.R6032G|TTN_uc010zfi.1_Missense_Mutation_p.R5965G|TTN_uc010zfj.1_Missense_Mutation_p.R5840G	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13264							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTGACCCTGCCATCAGCA	0.393													63	43	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179579804	179579804	+	Silent	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179579804C>A	uc010zfg.1	-	87	22601	c.22377G>T	c.(22375-22377)CTG>CTT	p.L7459L	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Silent_p.L4120L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8386							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATCGACATTCAGGATGTGGA	0.448													207	99	---	---	---	---	PASS
SATB2	23314	broad.mit.edu	37	2	200298128	200298128	+	Silent	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200298128A>G	uc002uuy.1	-	3	1096	c.279T>C	c.(277-279)TTT>TTC	p.F93F	SATB2_uc010fsq.1_Silent_p.F93F|SATB2_uc002uuz.1_Silent_p.F93F|SATB2_uc002uva.1_Silent_p.F93F	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	93						cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						CCAGCTGGCTAAAAAGCACAT	0.547													3	119	---	---	---	---	PASS
CHPF	79586	broad.mit.edu	37	2	220405116	220405116	+	Silent	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220405116C>T	uc002vmc.3	-	4	1544	c.1317G>A	c.(1315-1317)CCG>CCA	p.P439P	CHPF_uc010zlh.1_Silent_p.P277P	NM_024536	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	439	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity|protein binding				0		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GCCGCAAGGCCGGGTGGTAGC	0.647													15	9	---	---	---	---	PASS
TTC21A	199223	broad.mit.edu	37	3	39176662	39176662	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39176662C>A	uc003cjc.2	+	22	3139	c.2962C>A	c.(2962-2964)CCA>ACA	p.P988T	TTC21A_uc003cje.2_Missense_Mutation_p.P989T|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.P940T|TTC21A_uc003cjf.2_Missense_Mutation_p.P109T	NM_145755	NP_665698	Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A isoform 2	988	TPR 15.						binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GGAGAAAGCGCCAGGTAATTC	0.517													61	27	---	---	---	---	PASS
TTC21A	199223	broad.mit.edu	37	3	39176663	39176663	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39176663C>A	uc003cjc.2	+	22	3140	c.2963C>A	c.(2962-2964)CCA>CAA	p.P988Q	TTC21A_uc003cje.2_Missense_Mutation_p.P989Q|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.P940Q|TTC21A_uc003cjf.2_Missense_Mutation_p.P109Q	NM_145755	NP_665698	Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A isoform 2	988	TPR 15.						binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		GAGAAAGCGCCAGGTAATTCT	0.517													58	27	---	---	---	---	PASS
XIRP1	165904	broad.mit.edu	37	3	39229489	39229489	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39229489A>G	uc003cjk.1	-	2	1669	c.1448T>C	c.(1447-1449)GTG>GCG	p.V483A	XIRP1_uc003cji.2_Missense_Mutation_p.V483A|XIRP1_uc003cjj.2_Intron	NM_194293	NP_919269	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	483							actin binding			ovary(4)|breast(2)|central_nervous_system(1)|pancreas(1)	8				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CATGGCATACACTGGGGACCC	0.577													17	193	---	---	---	---	PASS
C3orf23	285343	broad.mit.edu	37	3	44438258	44438258	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44438258C>G	uc010him.2	+	8	1062	c.817C>G	c.(817-819)CGT>GGT	p.R273G	C3orf23_uc003cnd.3_Missense_Mutation_p.R273G|C3orf23_uc003cne.3_Missense_Mutation_p.R129G	NM_173826	NP_776187	Q8N3R3	CC023_HUMAN	hypothetical protein LOC285343 isoform 1	273						mitochondrion				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)		ATTTACAGACCGTTCTGGCAT	0.408													7	104	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48607725	48607725	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48607725C>T	uc003ctz.2	-	97	7424	c.7423G>A	c.(7423-7425)GGG>AGG	p.G2475R		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2475	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CCTGGCTCCCCACGCTCGCCT	0.607													65	39	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48614306	48614306	+	Intron	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48614306C>G	uc003ctz.2	-							NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor						cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCAGAAAACTCCAATACTCAC	0.537													60	35	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48668745	48668745	+	Intron	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48668745G>C	uc003cuf.1	-						SLC26A6_uc003cug.2_Intron|SLC26A6_uc003cuh.2_Intron|SLC26A6_uc010hke.2_Intron|SLC26A6_uc003cuk.2_Intron|SLC26A6_uc003cui.2_Intron|SLC26A6_uc003cuj.2_Intron|SLC26A6_uc011bbp.1_Intron	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3						homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ATGAGCTGTGGGAGAGGACAG	0.572													11	3	---	---	---	---	PASS
FEZF2	55079	broad.mit.edu	37	3	62357315	62357315	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:62357315G>C	uc003dlh.2	-	2	1087	c.880C>G	c.(880-882)CGC>GGC	p.R294G	FEZF2_uc003dli.2_Missense_Mutation_p.R294G	NM_018008	NP_060478	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	294	C2H2-type 1.				transcription, DNA-dependent	nucleus	zinc ion binding			lung(1)	1		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		GGCATGTGGCGGGTGAGATTA	0.597													54	29	---	---	---	---	PASS
KIAA2018	205717	broad.mit.edu	37	3	113379185	113379185	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113379185C>G	uc003eam.2	-	7	1755	c.1344G>C	c.(1342-1344)CAG>CAC	p.Q448H	KIAA2018_uc003eal.2_Missense_Mutation_p.Q392H	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717	448					regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						AAGATGGTGTCTGGCTTAAGG	0.438													65	195	---	---	---	---	PASS
GTF2E1	2960	broad.mit.edu	37	3	120469462	120469462	+	Silent	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120469462G>A	uc003edz.3	+	2	177	c.63G>A	c.(61-63)GTG>GTA	p.V21V	GTF2E1_uc003edy.2_Silent_p.V21V	NM_005513	NP_005504	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1,	21	HTH TFE/IIEalpha-type.				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.159)		CCAAGTATGTGATCCGGGGAT	0.463													208	144	---	---	---	---	PASS
OSBPL11	114885	broad.mit.edu	37	3	125271293	125271293	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125271293C>A	uc003eic.2	-	9	2123	c.1386G>T	c.(1384-1386)AAG>AAT	p.K462N		NM_022776	NP_073613	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	462					lipid transport		lipid binding			ovary(3)|breast(1)|kidney(1)	5						TTTTTGGCATCTTCCAGGAAC	0.453													69	187	---	---	---	---	PASS
PODXL2	50512	broad.mit.edu	37	3	127379841	127379841	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127379841G>T	uc003ejq.2	+	3	994	c.970G>T	c.(970-972)GAT>TAT	p.D324Y		NM_015720	NP_056535	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2 precursor	324	Extracellular (Potential).				leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding			ovary(1)|central_nervous_system(1)	2						CCCAGATGAAGATCCCCTTGG	0.587													16	224	---	---	---	---	PASS
ATP2C1	27032	broad.mit.edu	37	3	130685990	130685990	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130685990T>G	uc003enl.2	+	15	1346	c.1124T>G	c.(1123-1125)GTT>GGT	p.V375G	ATP2C1_uc011blg.1_Missense_Mutation_p.V409G|ATP2C1_uc011blh.1_Missense_Mutation_p.V370G|ATP2C1_uc011bli.1_Missense_Mutation_p.V409G|ATP2C1_uc003enk.2_Missense_Mutation_p.V359G|ATP2C1_uc003enm.2_Missense_Mutation_p.V375G|ATP2C1_uc003enn.2_Missense_Mutation_p.V359G|ATP2C1_uc003eno.2_Missense_Mutation_p.V375G|ATP2C1_uc003enp.2_Missense_Mutation_p.V375G|ATP2C1_uc003enq.2_Missense_Mutation_p.V375G|ATP2C1_uc003enr.2_Missense_Mutation_p.V375G|ATP2C1_uc003ens.2_Missense_Mutation_p.V375G|ATP2C1_uc003ent.2_Missense_Mutation_p.V375G|ATP2C1_uc003enu.2_Missense_Mutation_p.V53G	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a	375	Cytoplasmic (By similarity).				actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	GATCTTTAGGTTACTGGAGTT	0.358									Hailey-Hailey_disease				185	488	---	---	---	---	PASS
SLC33A1	9197	broad.mit.edu	37	3	155571667	155571667	+	Silent	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155571667C>T	uc003fan.3	-	1	501	c.120G>A	c.(118-120)TTG>TTA	p.L40L	SLC33A1_uc003fao.1_Silent_p.L40L	NM_004733	NP_004724	O00400	ACATN_HUMAN	acetyl-coenzyme A transporter	40	Cytoplasmic (Potential).				cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity			ovary(2)|large_intestine(1)|pancreas(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CCGCTGAGTCCAAATGACTGT	0.602													22	154	---	---	---	---	PASS
GMPS	8833	broad.mit.edu	37	3	155654155	155654155	+	Silent	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155654155G>T	uc003faq.2	+	15	2171	c.1836G>T	c.(1834-1836)CCG>CCT	p.P612P	GMPS_uc011bom.1_Silent_p.P513P	NM_003875	NP_003866	P49915	GUAA_HUMAN	guanine monophosphate synthetase	612					glutamine metabolic process|purine base biosynthetic process	cytosol	ATP binding|GMP synthase (glutamine-hydrolyzing) activity|GMP synthase activity			ovary(2)|lung(1)	3			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	GCCAGATGCCGGTGATTTTGA	0.413			T	MLL	AML								87	225	---	---	---	---	PASS
VEPH1	79674	broad.mit.edu	37	3	156979090	156979090	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156979090G>A	uc003fbj.1	-	14	2652	c.2335C>T	c.(2335-2337)CGC>TGC	p.R779C	VEPH1_uc003fbk.1_Missense_Mutation_p.R779C|VEPH1_uc010hvu.1_Missense_Mutation_p.R734C	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1	779	PH.					plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			CGGTCCCTGCGTTTCTTGGCC	0.488													8	271	---	---	---	---	PASS
MLF1	4291	broad.mit.edu	37	3	158317959	158317959	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158317959G>T	uc003fcb.2	+	5	702	c.565G>T	c.(565-567)GAA>TAA	p.E189*	MLF1_uc003fbz.2_Nonsense_Mutation_p.E164*|MLF1_uc003fca.2_Nonsense_Mutation_p.E164*|MLF1_uc003fbx.2_Nonsense_Mutation_p.E179*|MLF1_uc003fcc.2_Nonsense_Mutation_p.E220*|MLF1_uc003fby.2_Nonsense_Mutation_p.E115*|MLF1_uc010hvx.2_Nonsense_Mutation_p.E121*	NM_022443	NP_071888	P58340	MLF1_HUMAN	myeloid leukemia factor 1 isoform 1	189					cell cycle arrest|myeloid progenitor cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein domain specific binding				0		Melanoma(1037;0.000458)|Prostate(884;0.0235)|all_neural(597;0.0299)	Lung(72;0.00199)|LUSC - Lung squamous cell carcinoma(72;0.00256)			CAATATGAATGAAAGTAAGTT	0.289			T	NPM1	AML								86	66	---	---	---	---	PASS
TNFSF10	8743	broad.mit.edu	37	3	172227050	172227050	+	Silent	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172227050G>A	uc003fid.2	-	4	470	c.375C>T	c.(373-375)CAC>CAT	p.H125H	TNFSF10_uc003fie.2_Intron	NM_003810	NP_003801	P50591	TNF10_HUMAN	tumor necrosis factor (ligand) superfamily,	125	Extracellular (Potential).				activation of caspase activity|activation of pro-apoptotic gene products|cell-cell signaling|immune response|induction of apoptosis by extracellular signals|positive regulation of I-kappaB kinase/NF-kappaB cascade|signal transduction	extracellular space|integral to plasma membrane|soluble fraction	cytokine activity|metal ion binding|tumor necrosis factor receptor binding			skin(4)|lung(1)	5	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.67e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			TCCCAGTTATGTGAGCTGCTA	0.398													15	233	---	---	---	---	PASS
PARL	55486	broad.mit.edu	37	3	183585724	183585724	+	Nonsense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183585724C>A	uc003fmd.2	-	2	309	c.250G>T	c.(250-252)GAA>TAA	p.E84*	PARL_uc003fme.2_Nonsense_Mutation_p.E84*	NM_018622	NP_061092	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like isoform 1	84	Mitochondrial matrix (Potential).				proteolysis	integral to membrane|mitochondrial inner membrane|nucleus	serine-type endopeptidase activity				0	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ACTGTTTCTTCCACAGGAGGA	0.433													98	247	---	---	---	---	PASS
SLC34A2	10568	broad.mit.edu	37	4	25665869	25665869	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25665869G>T	uc003grr.2	+	4	377	c.296G>T	c.(295-297)GGG>GTG	p.G99V	SLC34A2_uc003grs.2_Missense_Mutation_p.G98V|SLC34A2_uc010iev.2_Missense_Mutation_p.G98V	NM_006424	NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (sodium phosphate),	99	Cytoplasmic (Potential).				cellular phosphate ion homeostasis	apical plasma membrane|brush border membrane|integral to plasma membrane	phosphate binding|sodium ion binding|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			skin(3)|ovary(1)|kidney(1)	5		Breast(46;0.0503)				CAAGGGATTGGGAGATTGATT	0.473													19	175	---	---	---	---	PASS
CCKAR	886	broad.mit.edu	37	4	26483565	26483565	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26483565G>C	uc003gse.1	-	5	1135	c.982C>G	c.(982-984)CCC>GCC	p.P328A		NM_000730	NP_000721	P32238	CCKAR_HUMAN	cholecystokinin A receptor	328	Helical; Name=6; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|elevation of cytosolic calcium ion concentration|response to nutrient	integral to plasma membrane	cholecystokinin receptor activity			lung(3)|pancreas(1)	4		Breast(46;0.0503)			Ceruletide(DB00403)	CTGAAGATGGGCATCCAGCAC	0.612													11	126	---	---	---	---	PASS
KCTD8	386617	broad.mit.edu	37	4	44450422	44450422	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44450422G>A	uc003gwu.2	-	1	403	c.119C>T	c.(118-120)TCG>TTG	p.S40L		NM_198353	NP_938167	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerisation domain	40						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			central_nervous_system(2)|ovary(1)	3						AGGGAAGGGCGAGGGTGCGCA	0.507										HNSCC(17;0.042)			14	8	---	---	---	---	PASS
SPATA18	132671	broad.mit.edu	37	4	52942956	52942956	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52942956G>A	uc003gzl.2	+	7	1048	c.770G>A	c.(769-771)AGC>AAC	p.S257N	SPATA18_uc010igl.1_RNA|SPATA18_uc011bzq.1_Missense_Mutation_p.S225N|SPATA18_uc003gzk.1_Missense_Mutation_p.S257N	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog	257	Ser-rich.				mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TCCTCCAGGAGCCGGTCTCCC	0.498													16	61	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56890686	56890686	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56890686A>T	uc003hbi.2	+	25	3574	c.3340A>T	c.(3340-3342)ATG>TTG	p.M1114L	CEP135_uc003hbj.2_Missense_Mutation_p.M820L	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	1114	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					AATCCAAGAGATGCGTCGACA	0.388													80	360	---	---	---	---	PASS
UGT2B28	54490	broad.mit.edu	37	4	70146679	70146679	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70146679T>G	uc003hej.2	+	1	463	c.461T>G	c.(460-462)TTT>TGT	p.F154C	UGT2B28_uc010ihr.2_Missense_Mutation_p.F154C	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	154					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	GATGCTTTTTTTCCTTGTGGT	0.388													5	190	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113524783	113524783	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113524783G>A	uc003iau.2	-	10	3084	c.2873C>T	c.(2872-2874)TCA>TTA	p.S958L	C4orf21_uc003iaw.2_Missense_Mutation_p.S958L	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	Error:Variant_position_missing_in_Q6ZU11_after_alignment						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TCCTAGCTGTGAGCTGTGTCC	0.408													48	76	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113524786	113524786	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113524786C>T	uc003iau.2	-	10	3081	c.2870G>A	c.(2869-2871)AGC>AAC	p.S957N	C4orf21_uc003iaw.2_Missense_Mutation_p.S957N	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	Error:Variant_position_missing_in_Q6ZU11_after_alignment						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TAGCTGTGAGCTGTGTCCTCT	0.408													48	77	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134071539	134071539	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134071539G>A	uc003iha.2	+	1	1070	c.244G>A	c.(244-246)GAA>AAA	p.E82K	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Missense_Mutation_p.E82K	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	82	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		AATAGACCGCGAACAAATCTG	0.562													29	91	---	---	---	---	PASS
CCRN4L	25819	broad.mit.edu	37	4	139966421	139966421	+	Silent	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:139966421C>T	uc003ihl.2	+	3	1282	c.1089C>T	c.(1087-1089)ACC>ACT	p.T363T		NM_012118	NP_036250	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like	363					rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)	1	all_hematologic(180;0.162)					CATACACTACCTGGAAGATCC	0.517													37	80	---	---	---	---	PASS
TBC1D9	23158	broad.mit.edu	37	4	141543385	141543385	+	Silent	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141543385C>A	uc010ioj.2	-	21	4037	c.3765G>T	c.(3763-3765)TCG>TCT	p.S1255S		NM_015130	NP_055945	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	1255						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(1)	1	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				AGTCACTGGCCGAGGTGAGGG	0.572													4	109	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153247367	153247367	+	Nonsense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153247367G>A	uc003ims.2	-	10	1584	c.1435C>T	c.(1435-1437)CGA>TGA	p.R479*	FBXW7_uc011cii.1_Nonsense_Mutation_p.R479*|FBXW7_uc003imt.2_Nonsense_Mutation_p.R479*|FBXW7_uc011cih.1_Nonsense_Mutation_p.R303*|FBXW7_uc003imq.2_Nonsense_Mutation_p.R399*|FBXW7_uc003imr.2_Nonsense_Mutation_p.R361*	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	479	WD 3.				interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.R479Q(31)|p.R479L(6)|p.R479G(3)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				GTGGCATCTCGAGAACCGCTA	0.398			Mis|N|D|F		colorectal|endometrial|T-ALL								32	58	---	---	---	---	PASS
NPY5R	4889	broad.mit.edu	37	4	164272519	164272519	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164272519G>T	uc003iqn.2	+	4	1276	c.1094G>T	c.(1093-1095)AGT>ATT	p.S365I		NM_006174	NP_006165	Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	365	Cytoplasmic (Potential).				cardiac left ventricle morphogenesis|outflow tract morphogenesis	integral to plasma membrane				lung(6)|skin(1)	7	all_hematologic(180;0.166)	Prostate(90;0.109)				AGATCTCGAAGTGTTTTCTAC	0.353													45	100	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177032751	177032751	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177032751T>A	uc003iuj.2	+	3	248	c.92T>A	c.(91-93)GTG>GAG	p.V31E	WDR17_uc003iuk.2_Missense_Mutation_p.V7E|WDR17_uc003ium.3_Missense_Mutation_p.V7E|WDR17_uc003iul.1_Missense_Mutation_p.V7E	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	31										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GTAAGGCAAGTGGGATTGCTG	0.408													33	66	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177098633	177098633	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177098633A>T	uc003iuj.2	+	30	3833	c.3677A>T	c.(3676-3678)GAC>GTC	p.D1226V	WDR17_uc003iuk.2_Missense_Mutation_p.D1202V|WDR17_uc003ium.3_Missense_Mutation_p.D1187V|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Missense_Mutation_p.D437V	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	1226										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TCATTAGAAGACTCTCCGTAT	0.299													29	138	---	---	---	---	PASS
SPATA4	132851	broad.mit.edu	37	4	177113789	177113789	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177113789T>C	uc003iuo.1	-	4	786	c.677A>G	c.(676-678)AAA>AGA	p.K226R		NM_144644	NP_653245	Q8NEY3	SPAT4_HUMAN	spermatogenesis associated 4	226					apoptosis|spermatogenesis						0		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.9e-20)|Epithelial(43;1.99e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.58e-09)|GBM - Glioblastoma multiforme(59;0.000162)|STAD - Stomach adenocarcinoma(60;0.000543)|LUSC - Lung squamous cell carcinoma(193;0.096)		TGGATTCAATTTTCTGCCTAA	0.398													28	57	---	---	---	---	PASS
NKD2	85409	broad.mit.edu	37	5	1038076	1038076	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1038076G>C	uc003jbt.1	+	10	949	c.944G>C	c.(943-945)CGG>CCG	p.R315P	NKD2_uc010itf.1_3'UTR	NM_033120	NP_149111	Q969F2	NKD2_HUMAN	naked cuticle homolog 2	315	Interaction with TGFA.				exocytosis|Wnt receptor signaling pathway	cytoplasmic membrane-bounded vesicle|plasma membrane	calcium ion binding|ubiquitin protein ligase binding				0	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			CCTGCTGCCCGGGCCCTGGAC	0.701													12	21	---	---	---	---	PASS
IRX1	79192	broad.mit.edu	37	5	3601130	3601130	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3601130C>G	uc003jde.2	+	4	1471	c.1419C>G	c.(1417-1419)ATC>ATG	p.I473M		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	473						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						CGCCGCGGATCCTAGCAGCCC	0.627													42	111	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7706904	7706904	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7706904T>C	uc003jdz.1	+	8	1224	c.1157T>C	c.(1156-1158)GTG>GCG	p.V386A	ADCY2_uc011cmo.1_Missense_Mutation_p.V206A	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	386	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						CGCGTGGGCGTGCATTCTGGG	0.473													81	300	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41181646	41181646	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41181646C>A	uc003jmk.2	-	7	952	c.742G>T	c.(742-744)GAT>TAT	p.D248Y	C6_uc003jml.1_Missense_Mutation_p.D248Y	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	248	MACPF.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				TTCAAGTCATCTTCTGCAGTT	0.348													34	109	---	---	---	---	PASS
GHR	2690	broad.mit.edu	37	5	42719278	42719278	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42719278C>G	uc003jmt.2	+	10	1712	c.1669C>G	c.(1669-1671)CAG>GAG	p.Q557E	GHR_uc011cpq.1_Missense_Mutation_p.Q370E	NM_000163	NP_000154	P10912	GHR_HUMAN	growth hormone receptor precursor	557	Cytoplasmic (Potential).				2-oxoglutarate metabolic process|activation of JAK2 kinase activity|activation of MAPK activity|allantoin metabolic process|citrate metabolic process|creatine metabolic process|creatinine metabolic process|endocytosis|fatty acid metabolic process|growth hormone receptor signaling pathway|insulin-like growth factor receptor signaling pathway|isoleucine metabolic process|JAK-STAT cascade|multicellular organismal metabolic process|oxaloacetate metabolic process|positive regulation of multicellular organism growth|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|receptor internalization|response to cycloheximide|response to estradiol stimulus|succinate metabolic process|taurine metabolic process|valine metabolic process	cell surface|extracellular space|growth hormone receptor complex|integral to plasma membrane	growth factor binding|peptide hormone binding|proline-rich region binding|protein homodimerization activity|protein kinase binding			lung(4)|kidney(1)|skin(1)	6		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	ATCACACATACAGCCAAGCTT	0.483													59	42	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262556	45262556	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262556C>A	uc003jok.2	-	8	2165	c.2140G>T	c.(2140-2142)GCT>TCT	p.A714S		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	714	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						AAAGTTCGAGCGGCCAGAGGG	0.483													38	38	---	---	---	---	PASS
DIMT1L	27292	broad.mit.edu	37	5	61690317	61690317	+	Silent	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61690317T>A	uc003jta.2	-	7	693	c.564A>T	c.(562-564)CTA>CTT	p.L188L	DIMT1L_uc011cqq.1_Silent_p.L188L	NM_014473	NP_055288	Q9UNQ2	DIMT1_HUMAN	dimethyladenosine transferase	188						nucleolus	RNA binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			central_nervous_system(1)	1		Lung NSC(810;8.94e-06)|Prostate(74;0.0235)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.122)		TTACTTTCATTAGATGGTCCA	0.239													63	34	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140475948	140475948	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140475948C>T	uc003lil.2	+	1	1712	c.1574C>T	c.(1573-1575)GCC>GTC	p.A525V	PCDHB2_uc003lim.1_Missense_Mutation_p.A186V	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	525	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACTACGAGGCCCTGCAGGCG	0.716													79	37	---	---	---	---	PASS
PCDHB13	56123	broad.mit.edu	37	5	140594268	140594268	+	Silent	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140594268A>G	uc003lja.1	+	1	760	c.573A>G	c.(571-573)AAA>AAG	p.K191K		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	191	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATGGCAGGAAATACCCAGAGC	0.517													45	34	---	---	---	---	PASS
PCDHGA6	56109	broad.mit.edu	37	5	140755620	140755620	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140755620C>A	uc003ljy.1	+	1	1970	c.1970C>A	c.(1969-1971)ACT>AAT	p.T657N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc011dau.1_Missense_Mutation_p.T657N	NM_018919	NP_061742	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6 isoform 1	657	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTCCGCCACTGTCACGCTC	0.701													21	8	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169502994	169502994	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169502994T>A	uc003maf.2	+	47	4852	c.4772T>A	c.(4771-4773)GTG>GAG	p.V1591E	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.V1083E|DOCK2_uc003mah.2_Missense_Mutation_p.V147E	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1591	DHR-2.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAGAAAAGGGTGTCAGATAAC	0.517													144	71	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51524724	51524724	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51524724C>A	uc003pah.1	-	61	10476	c.10200G>T	c.(10198-10200)ATG>ATT	p.M3400I		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3400	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TGAATCCTTGCATCAGAAATT	0.343													38	29	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51524725	51524725	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51524725A>G	uc003pah.1	-	61	10475	c.10199T>C	c.(10198-10200)ATG>ACG	p.M3400T		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	3400	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GAATCCTTGCATCAGAAATTG	0.343													38	29	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76580384	76580384	+	Silent	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76580384G>C	uc003pih.1	+	19	2244	c.1965G>C	c.(1963-1965)CTG>CTC	p.L655L	MYO6_uc003pig.1_Silent_p.L655L|MYO6_uc003pii.1_Silent_p.L655L	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	655	Myosin head-like.				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		ATTTGCTTCTGGATAAACTTC	0.318													28	29	---	---	---	---	PASS
EPHA7	2045	broad.mit.edu	37	6	93955175	93955175	+	Intron	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93955175G>C	uc003poe.2	-						EPHA7_uc003pof.2_Intron|EPHA7_uc011eac.1_Intron	NM_004440	NP_004431	Q15375	EPHA7_HUMAN	ephrin receptor EphA7 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TATTGGCCTAGATAAAAATGA	0.323													65	90	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112537599	112537599	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112537599G>C	uc003pvu.2	-	3	576	c.267C>G	c.(265-267)AAC>AAG	p.N89K	LAMA4_uc003pvv.2_Missense_Mutation_p.N89K|LAMA4_uc003pvt.2_Missense_Mutation_p.N89K|LAMA4_uc003pvw.2_Missense_Mutation_p.N89K	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	89	Laminin EGF-like 1.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CCAAACACTCGTTGGAATTGC	0.458													53	78	---	---	---	---	PASS
C6orf170	221322	broad.mit.edu	37	6	121481233	121481233	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121481233G>C	uc003pyo.1	-	24	2764	c.2696C>G	c.(2695-2697)CCT>CGT	p.P899R	C6orf170_uc003pyq.1_RNA|C6orf170_uc010kej.1_5'UTR|C6orf170_uc003pyp.1_Missense_Mutation_p.P459R	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	899					multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		CATTGGCCAAGGATATGGATT	0.308													38	142	---	---	---	---	PASS
GPR126	57211	broad.mit.edu	37	6	142691627	142691627	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:142691627G>T	uc010khc.2	+	4	1177	c.766G>T	c.(766-768)GTT>TTT	p.V256F	GPR126_uc010khd.2_Missense_Mutation_p.V256F|GPR126_uc010khe.2_Missense_Mutation_p.V256F|GPR126_uc010khf.2_Missense_Mutation_p.V256F|GPR126_uc003qix.2_Missense_Mutation_p.V256F	NM_020455	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126 alpha 1	256	Pentaxin.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		GCTCTGCCTTGTTTGGAATAA	0.333													4	137	---	---	---	---	PASS
RAET1G	353091	broad.mit.edu	37	6	150239492	150239492	+	Silent	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150239492G>T	uc010kii.1	-	4	728	c.660C>A	c.(658-660)GCC>GCA	p.A220A	uc003qni.1_Intron|RAET1G_uc003qnm.2_Intron	NM_001001788	NP_001001788	Q6H3X3	RET1G_HUMAN	retinoic acid early transcript 1G precursor	220	Extracellular (Potential).				antigen processing and presentation|immune response	integral to membrane|MHC class I protein complex	protein binding				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		CCCTGGGTTGGGCTGTGCCTG	0.587													25	69	---	---	---	---	PASS
MTHFD1L	25902	broad.mit.edu	37	6	151331065	151331065	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151331065G>A	uc003qob.2	+	21	2504	c.2236G>A	c.(2236-2238)GCT>ACT	p.A746T	MTHFD1L_uc011een.1_RNA|MTHFD1L_uc011eeo.1_Missense_Mutation_p.A747T|MTHFD1L_uc003qoc.2_Missense_Mutation_p.A694T	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+	746	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		AACGGTGCGAGCTCTGAAGAT	0.478													8	114	---	---	---	---	PASS
ESR1	2099	broad.mit.edu	37	6	152163791	152163791	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152163791A>T	uc003qom.3	+	4	882	c.512A>T	c.(511-513)AAG>ATG	p.K171M	ESR1_uc010kin.2_Missense_Mutation_p.K171M|ESR1_uc010kio.2_Missense_Mutation_p.K171M|ESR1_uc010kip.2_Missense_Mutation_p.K171M|ESR1_uc003qon.3_Missense_Mutation_p.K171M|ESR1_uc003qoo.3_Missense_Mutation_p.K171M|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_RNA|ESR1_uc011eeu.1_RNA|ESR1_uc011eev.1_Translation_Start_Site|ESR1_uc011eew.1_Missense_Mutation_p.R3W	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	171	Modulating; mediates interaction with MACROD1.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	ACCAATGACAAGGGAAGTATG	0.473													36	37	---	---	---	---	PASS
ESR1	2099	broad.mit.edu	37	6	152163792	152163792	+	Silent	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152163792G>A	uc003qom.3	+	4	883	c.513G>A	c.(511-513)AAG>AAA	p.K171K	ESR1_uc010kin.2_Silent_p.K171K|ESR1_uc010kio.2_Silent_p.K171K|ESR1_uc010kip.2_Silent_p.K171K|ESR1_uc003qon.3_Silent_p.K171K|ESR1_uc003qoo.3_Silent_p.K171K|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_RNA|ESR1_uc011eeu.1_RNA|ESR1_uc011eev.1_5'UTR|ESR1_uc011eew.1_Missense_Mutation_p.R3K	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	171	Modulating; mediates interaction with MACROD1.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	CCAATGACAAGGGAAGTATGG	0.468													34	37	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152674504	152674504	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152674504G>A	uc010kiw.2	-	69	11749	c.11147C>T	c.(11146-11148)TCC>TTC	p.S3716F	SYNE1_uc003qot.3_Missense_Mutation_p.S3701F|SYNE1_uc003qou.3_Missense_Mutation_p.S3716F|SYNE1_uc010kja.1_Missense_Mutation_p.S421F	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3716	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ATCAGAATAGGAACTGAGGGA	0.368										HNSCC(10;0.0054)			50	178	---	---	---	---	PASS
RBM16	22828	broad.mit.edu	37	6	155153569	155153569	+	Silent	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155153569C>T	uc003qqa.2	+	21	3088	c.2856C>T	c.(2854-2856)ATC>ATT	p.I952I	TIAM2_uc003qqb.2_5'Flank|RBM16_uc011efj.1_Silent_p.I1018I|RBM16_uc011efk.1_Silent_p.I997I|RBM16_uc003qpz.2_Silent_p.I952I|RBM16_uc010kji.2_Intron	NM_014892	NP_055707	Q9UPN6	SCAF8_HUMAN	RNA-binding motif protein 16	952	Pro-rich.				mRNA processing|RNA splicing	nuclear matrix|spliceosomal complex	nucleotide binding|RNA binding|RNA polymerase core enzyme binding				0		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;2.33e-15)|BRCA - Breast invasive adenocarcinoma(81;0.00524)		AACGGGGAATCCCACCCCCAT	0.498													164	234	---	---	---	---	PASS
WDR27	253769	broad.mit.edu	37	6	170058390	170058390	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170058390C>G	uc003qwx.2	-	13	1904	c.1384G>C	c.(1384-1386)GCT>CCT	p.A462P	WDR27_uc003qwv.1_RNA|WDR27_uc010kkw.1_Missense_Mutation_p.A462P|WDR27_uc003qwy.2_Missense_Mutation_p.A335P|WDR27_uc003qwz.1_Missense_Mutation_p.A195P			A2RRH5	WDR27_HUMAN	RecName: Full=WD repeat-containing protein 27;	432										pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		TGTTCACTAGCAGCCTTGGTA	0.512													2	10	---	---	---	---	PASS
HEATR2	54919	broad.mit.edu	37	7	796505	796505	+	Silent	SNP	C	A	A	rs141887568		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:796505C>A	uc010krz.1	+	6	1364	c.1344C>A	c.(1342-1344)CCC>CCA	p.P448P	HEATR2_uc003siz.2_Silent_p.P316P	NM_017802	NP_060272	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	448							protein binding	p.P448P(1)		skin(1)	1		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		AGAAGACGCCCTCTGCCTCCG	0.627													67	107	---	---	---	---	PASS
MMD2	221938	broad.mit.edu	37	7	4947205	4947205	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4947205A>G	uc003sno.3	-	7	831	c.635T>C	c.(634-636)CTG>CCG	p.L212P	MMD2_uc003snl.1_RNA|MMD2_uc003snn.3_Missense_Mutation_p.L188P|MMD2_uc010ksq.2_3'UTR	NM_001100600	NP_001094070	Q8IY49	PAQRA_HUMAN	monocyte to macrophage	212	Helical; (Potential).					integral to membrane	receptor activity			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		TCCGGTCACCAGCTCCCAGAT	0.602													43	99	---	---	---	---	PASS
AUTS2	26053	broad.mit.edu	37	7	70255532	70255532	+	Silent	SNP	C	T	T	rs141714268		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70255532C>T	uc003tvw.3	+	19	4073	c.3330C>T	c.(3328-3330)TAC>TAT	p.Y1110Y	AUTS2_uc003tvx.3_Silent_p.Y1086Y|AUTS2_uc011keg.1_Silent_p.Y562Y	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1	1110										ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CCCGGCTGTACGAAGCCGACC	0.562													6	9	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	70597840	70597840	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70597840G>T	uc003tvy.2	+	1	52	c.52G>T	c.(52-54)GTA>TTA	p.V18L		NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	18	Helical; Signal-anchor for type II membrane protein; (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CTTGATCGCGGTAGCCGGCTT	0.677													29	32	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	70885948	70885948	+	Silent	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70885948C>G	uc003tvy.2	+	5	819	c.819C>G	c.(817-819)CCC>CCG	p.P273P	WBSCR17_uc003tvz.2_5'UTR	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	273	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TGATCCTCCCCTCCATTGACA	0.542													118	265	---	---	---	---	PASS
CROT	54677	broad.mit.edu	37	7	87005147	87005147	+	Nonsense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87005147C>T	uc003uit.2	+	9	999	c.754C>T	c.(754-756)CGA>TGA	p.R252*	CROT_uc003uiu.2_Nonsense_Mutation_p.R280*	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN	peroxisomal carnitine O-octanoyltransferase	252					fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity			ovary(2)|lung(1)	3	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	CCTTTAGGCACGAGAATATCT	0.353													7	173	---	---	---	---	PASS
C7orf63	79846	broad.mit.edu	37	7	89937162	89937162	+	Silent	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89937162G>T	uc010lep.2	+	21	2795	c.2544G>T	c.(2542-2544)ACG>ACT	p.T848T	C7orf63_uc011khj.1_Silent_p.T830T|C7orf63_uc011khk.1_Silent_p.T364T	NM_001039706	NP_001034795	A5D8W1	CG063_HUMAN	hypothetical protein LOC79846 isoform 1	848							binding			ovary(1)	1						ACGCTAAAACGTTAAAGGTAG	0.343													12	28	---	---	---	---	PASS
DLX5	1749	broad.mit.edu	37	7	96650141	96650141	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96650141C>G	uc003uon.2	-	3	985	c.777G>C	c.(775-777)TGG>TGC	p.W259C		NM_005221	NP_005212	P56178	DLX5_HUMAN	distal-less homeobox 5	259					cell proliferation|endochondral ossification|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					CACTTGTGTACCAGGATGCAG	0.647													39	80	---	---	---	---	PASS
MCM7	4176	broad.mit.edu	37	7	99695279	99695279	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99695279C>A	uc003usw.1	-	9	1585	c.1075G>T	c.(1075-1077)GTC>TTC	p.V359F	MCM7_uc003usv.1_Missense_Mutation_p.V183F|MCM7_uc003usx.1_Missense_Mutation_p.V183F	NM_005916	NP_005907	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	359	MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of phosphorylation|response to DNA damage stimulus|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|protein binding				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)				Atorvastatin(DB01076)	ACACCCCCGACTAGCAGGAGC	0.507													230	357	---	---	---	---	PASS
EPHB4	2050	broad.mit.edu	37	7	100403230	100403230	+	Nonsense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100403230C>T	uc003uwn.1	-	15	3062	c.2571G>A	c.(2569-2571)TGG>TGA	p.W857*	EPHB4_uc003uwm.1_Nonsense_Mutation_p.W764*|EPHB4_uc010lhj.1_Nonsense_Mutation_p.W857*	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor	857	Cytoplasmic (Potential).|Protein kinase.				cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					GGTCTTTCTGCCAACAGTCCA	0.637													10	266	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100607832	100607832	+	RNA	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100607832C>A	uc003uxk.1	+	4		c.2363C>A			uc003uxl.1_Missense_Mutation_p.T560N|uc003uxm.1_RNA|uc003uxn.1_RNA|uc010lhn.1_5'Flank					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		CAGGTGAAGACCACGCTGAAG	0.647													7	155	---	---	---	---	PASS
C7orf60	154743	broad.mit.edu	37	7	112579794	112579794	+	Silent	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112579794C>A	uc003vgo.1	-	1	139	c.12G>T	c.(10-12)GGG>GGT	p.G4G	C7orf60_uc011kms.1_Silent_p.G4G	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743	4										ovary(2)|skin(1)	3						GGCCGCCGGCCCCTGGCTCCA	0.612													4	10	---	---	---	---	PASS
AKR1B15	441282	broad.mit.edu	37	7	134253073	134253073	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134253073G>T	uc011kpr.1	+	4	613	c.314G>T	c.(313-315)AGC>ATC	p.S105I	AKR1B15_uc003vrt.2_Missense_Mutation_p.S77I|AKR1B15_uc011kps.1_Missense_Mutation_p.S77I	NM_001080538	NP_001074007	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	105							oxidoreductase activity			ovary(1)	1						TTCATCGTCAGCAAGGTGCAC	0.527													8	244	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135309982	135309982	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135309982C>G	uc003vsw.2	+	32	4581	c.4550C>G	c.(4549-4551)TCT>TGT	p.S1517C	NUP205_uc003vsx.2_RNA	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1517					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						TTGTATCTTTCTAACAGTGGC	0.448													10	246	---	---	---	---	PASS
TAS2R60	338398	broad.mit.edu	37	7	143141036	143141036	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143141036A>T	uc011ktg.1	+	1	491	c.491A>T	c.(490-492)CAC>CTC	p.H164L	uc003wda.2_Intron	NM_177437	NP_803186	P59551	T2R60_HUMAN	taste receptor, type 2, member 60	164	Extracellular (Potential).				sensory perception of bitter taste	integral to membrane	G-protein coupled receptor activity			skin(6)	6	Melanoma(164;0.172)					ATAGGCAACCACAGAATGTAT	0.448													108	215	---	---	---	---	PASS
ARHGEF5	7984	broad.mit.edu	37	7	144062298	144062298	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144062298G>A	uc003wel.2	+	2	2654	c.2536G>A	c.(2536-2538)GAC>AAC	p.D846N	ARHGEF5_uc003wek.2_Missense_Mutation_p.D846N|ARHGEF5_uc003wem.2_5'Flank	NM_005435	NP_005426	Q12774	ARHG5_HUMAN	rho guanine nucleotide exchange factor 5	846					intracellular signal transduction|regulation of Rho protein signal transduction	intracellular	GTP binding|protein binding|Rho guanyl-nucleotide exchange factor activity			skin(2)	2	Melanoma(164;0.14)					ACCCATCATAGACCCTCCCAC	0.597													17	36	---	---	---	---	PASS
INSIG1	3638	broad.mit.edu	37	7	155090172	155090172	+	Silent	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155090172G>T	uc003wly.2	+	2	388	c.177G>T	c.(175-177)GCG>GCT	p.A59A	INSIG1_uc011kvu.1_Intron|INSIG1_uc003wlz.2_Silent_p.A59A	NM_005542	NP_005533	O15503	INSI1_HUMAN	insulin induced gene 1 isoform 1	59	Cytoplasmic.				cell proliferation|ER-nuclear sterol response pathway	endoplasmic reticulum membrane|integral to membrane	protein binding				0	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGACCCCGCGCCCAGGGGCC	0.721													8	8	---	---	---	---	PASS
ARHGEF10	9639	broad.mit.edu	37	8	1808301	1808301	+	Silent	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1808301C>T	uc003wpr.2	+	4	610	c.432C>T	c.(430-432)CCC>CCT	p.P144P	ARHGEF10_uc003wpq.1_Silent_p.P168P|ARHGEF10_uc003wps.2_Silent_p.P144P|ARHGEF10_uc003wpt.2_Silent_p.P58P|ARHGEF10_uc010lrd.1_Silent_p.P58P|ARHGEF10_uc003wpu.2_Silent_p.P58P	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	168					centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		TCCTGCTGCCCGCCTACTCCA	0.652													27	81	---	---	---	---	PASS
RHOBTB2	23221	broad.mit.edu	37	8	22861981	22861981	+	Missense_Mutation	SNP	G	A	A	rs144645186		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22861981G>A	uc003xcq.2	+	2	571	c.34G>A	c.(34-36)GTA>ATA	p.V12I	RHOBTB2_uc003xcp.2_Missense_Mutation_p.V34I|RHOBTB2_uc011kzp.1_Missense_Mutation_p.V19I	NM_015178	NP_055993	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2 isoform 3	12	Rho-like.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding			ovary(1)|lung(1)	2		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		AAGGCCAAACGTAGAGACCAT	0.597											OREG0018628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	26	83	---	---	---	---	PASS
RAB11FIP1	80223	broad.mit.edu	37	8	37756795	37756795	+	Silent	SNP	G	T	T	rs78017237	byFrequency	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37756795G>T	uc003xkm.1	-	1	209	c.165C>A	c.(163-165)TCC>TCA	p.S55S	RAB11FIP1_uc010lvz.1_Intron|RAB11FIP1_uc003xkn.1_Silent_p.S55S	NM_001002814	NP_001002814	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 isoform 3	55	C2.				protein transport	centrosome|phagocytic vesicle membrane|recycling endosome	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			GCTCCGACACGGAGGTGGCGT	0.751													9	23	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53074075	53074075	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53074075G>T	uc003xqz.2	-	9	1610	c.1454C>A	c.(1453-1455)TCT>TAT	p.S485Y	ST18_uc011ldq.1_Missense_Mutation_p.S132Y|ST18_uc011ldr.1_Missense_Mutation_p.S450Y|ST18_uc011lds.1_Missense_Mutation_p.S390Y|ST18_uc003xra.2_Missense_Mutation_p.S485Y|ST18_uc003xrb.2_Missense_Mutation_p.S485Y	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	485						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				GGCTCTGGGAGAGGTGATGGC	0.423													60	124	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55537321	55537321	+	Silent	SNP	T	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55537321T>G	uc003xsd.1	+	4	1027	c.879T>G	c.(877-879)TCT>TCG	p.S293S	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	293					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TAGACTATTCTTTTGTTCCTG	0.303													9	165	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72968009	72968009	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72968009G>T	uc003xza.2	-	11	1451	c.1276C>A	c.(1276-1278)CCT>ACT	p.P426T		NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1	426	ANK 10.|Cytoplasmic (Potential).					integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	ACAGAACCAGGGCCCCCCTGT	0.408													46	70	---	---	---	---	PASS
HNF4G	3174	broad.mit.edu	37	8	76463627	76463627	+	Silent	SNP	A	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76463627A>T	uc003yaq.2	+	5	516	c.246A>T	c.(244-246)GTA>GTT	p.V82V	HNF4G_uc003yar.2_Silent_p.V119V	NM_004133	NP_004124	Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	82	Nuclear receptor.				endocrine pancreas development|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)	1	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			CCCTAGCTGTACAAAATGAAC	0.378													35	49	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	101117606	101117606	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101117606T>A	uc003yjb.1	-	2	245	c.50A>T	c.(49-51)GAA>GTA	p.E17V	RGS22_uc003yja.1_5'UTR|RGS22_uc003yjc.1_Missense_Mutation_p.E17V|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	17					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			ACTTACAAATTCTTCTTCTGT	0.328													5	193	---	---	---	---	PASS
EIF3H	8667	broad.mit.edu	37	8	117671117	117671117	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117671117C>A	uc003yoa.2	-	3	418	c.392G>T	c.(391-393)CGG>CTG	p.R131L	EIF3H_uc003yob.2_Missense_Mutation_p.R145L|EIF3H_uc011lhz.1_Missense_Mutation_p.R131L	NM_003756	NP_003747	O15372	EIF3H_HUMAN	eukaryotic translation initiation factor 3,	131	MPN.				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			lung(3)	3	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)					CAGGAGTGCCCGGGTAACGAA	0.428													75	99	---	---	---	---	PASS
RAD21	5885	broad.mit.edu	37	8	117878815	117878815	+	Intron	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117878815T>A	uc003yod.2	-							NM_006265	NP_006256	O60216	RAD21_HUMAN	RAD21 homolog						apoptosis|cell division|chromosome segregation|double-strand break repair|mitotic metaphase/anaphase transition|mitotic prometaphase|protein localization to chromatin|reciprocal meiotic recombination|regulation of transcription from RNA polymerase II promoter	chromosome, centromeric region|cohesin complex|nuclear chromosome|nucleoplasm	protein binding			lung(1)|skin(1)	2	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					AATGTCAACATCAAACATACC	0.383													49	67	---	---	---	---	PASS
KCNQ3	3786	broad.mit.edu	37	8	133144497	133144497	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133144497A>T	uc003ytj.2	-	14	2039	c.1814T>A	c.(1813-1815)GTA>GAA	p.V605E	KCNQ3_uc010mdt.2_Missense_Mutation_p.V593E	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein	605					axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TGGTCTGGCTACATATGGTTC	0.398													39	81	---	---	---	---	PASS
LRRC6	23639	broad.mit.edu	37	8	133644981	133644981	+	Intron	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133644981C>T	uc003ytk.2	-						LRRC6_uc003ytl.2_Intron	NM_012472	NP_036604	Q86X45	LRRC6_HUMAN	leucine rich repeat containing 6							cytoplasm				ovary(1)|kidney(1)	2	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TAATAATTTACATACAGAGTA	0.353													9	346	---	---	---	---	PASS
TRAPPC9	83696	broad.mit.edu	37	8	140744269	140744269	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140744269G>A	uc003yvj.2	-	22	3366	c.3232C>T	c.(3232-3234)CAC>TAC	p.H1078Y	TRAPPC9_uc003yvh.2_Missense_Mutation_p.H1176Y	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform	1078					cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						ACGGTGTCGTGCAGGTCGTAG	0.657													12	10	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144995111	144995111	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144995111T>G	uc003zaf.1	-	32	9459	c.9289A>C	c.(9289-9291)ATC>CTC	p.I3097L	PLEC_uc003zab.1_Missense_Mutation_p.I2960L|PLEC_uc003zac.1_Missense_Mutation_p.I2964L|PLEC_uc003zad.2_Missense_Mutation_p.I2960L|PLEC_uc003zae.1_Missense_Mutation_p.I2928L|PLEC_uc003zag.1_Missense_Mutation_p.I2938L|PLEC_uc003zah.2_Missense_Mutation_p.I2946L|PLEC_uc003zaj.2_Missense_Mutation_p.I2987L	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	3097	Globular 2.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						ACCACCGTGATGATGATCTTG	0.622													9	81	---	---	---	---	PASS
RANBP6	26953	broad.mit.edu	37	9	6012658	6012658	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6012658T>G	uc003zjr.2	-	1	2961	c.2950A>C	c.(2950-2952)ATA>CTA	p.I984L	RANBP6_uc011lmf.1_Missense_Mutation_p.I632L|RANBP6_uc003zjs.2_Missense_Mutation_p.I572L	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	984	HEAT 7.				protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		ATCTTCCCTATTGCTGAGATA	0.363													3	109	---	---	---	---	PASS
MURC	347273	broad.mit.edu	37	9	103348698	103348698	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103348698G>T	uc004bba.2	+	2	1150	c.1060G>T	c.(1060-1062)GAA>TAA	p.E354*		NM_001018116	NP_001018126	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	354					cell differentiation|muscle organ development|transcription, DNA-dependent					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0461)				AGAGGATGATGAATCTCTTTT	0.398													23	91	---	---	---	---	PASS
ZNF618	114991	broad.mit.edu	37	9	116769663	116769663	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116769663A>G	uc004bid.2	+	7	683	c.584A>G	c.(583-585)AAG>AGG	p.K195R	ZNF618_uc004bib.1_Missense_Mutation_p.K163R|ZNF618_uc004bic.2_Missense_Mutation_p.K163R|ZNF618_uc011lxi.1_Missense_Mutation_p.K163R|ZNF618_uc011lxj.1_Missense_Mutation_p.K163R	NM_133374	NP_588615	Q5T7W0	ZN618_HUMAN	zinc finger protein 618	195	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ATCTGCGGGAAGAAGTACAAA	0.532													28	28	---	---	---	---	PASS
AKNA	80709	broad.mit.edu	37	9	117139707	117139707	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117139707C>T	uc004biq.3	-	2	515	c.380G>A	c.(379-381)GGG>GAG	p.G127E	AKNA_uc004bio.3_5'Flank|AKNA_uc004bip.3_Missense_Mutation_p.G46E|AKNA_uc004bir.3_Missense_Mutation_p.G127E|AKNA_uc004bis.3_Missense_Mutation_p.G127E|AKNA_uc010mve.2_Missense_Mutation_p.G8E|AKNA_uc004biu.1_Intron|AKNA_uc004biv.1_Missense_Mutation_p.G127E|AKNA_uc004biw.1_Missense_Mutation_p.G127E	NM_030767	NP_110394	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	127					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(4)|central_nervous_system(2)	6						TCCGAGGGTCCCATCTGGCTC	0.607													59	49	---	---	---	---	PASS
DFNB31	25861	broad.mit.edu	37	9	117188587	117188587	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117188587T>C	uc004biz.3	-	4	1719	c.1070A>G	c.(1069-1071)AAG>AGG	p.K357R	DFNB31_uc004bix.2_5'Flank|DFNB31_uc004biy.3_5'UTR|DFNB31_uc004bja.3_Missense_Mutation_p.K357R	NM_015404	NP_056219	Q9P202	WHRN_HUMAN	CASK-interacting protein CIP98 isoform 1	357	PDZ 2.				inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6						CCCGACGTCCTTCACTGTCAG	0.592													17	68	---	---	---	---	PASS
NEK6	10783	broad.mit.edu	37	9	127088623	127088623	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127088623G>C	uc004bog.2	+	6	569	c.420G>C	c.(418-420)CAG>CAC	p.Q140H	NEK6_uc004bof.2_Missense_Mutation_p.Q158H|NEK6_uc004boh.2_Missense_Mutation_p.Q174H|NEK6_uc010mwj.2_Missense_Mutation_p.Q93H|NEK6_uc010mwk.2_Missense_Mutation_p.Q140H|NEK6_uc004boi.2_Missense_Mutation_p.Q140H	NM_014397	NP_055212	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6 isoform 2	140	Protein kinase.				apoptosis|cell division|chromosome segregation|mitosis|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of mitotic metaphase/anaphase transition	cytoplasm|nucleus	ATP binding|kinesin binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|kidney(1)	3						TTAAGAAGCAGAAGCGGCTCA	0.602													46	41	---	---	---	---	PASS
FCN2	2220	broad.mit.edu	37	9	137774436	137774436	+	Silent	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137774436G>T	uc004cfg.1	+	2	175	c.165G>T	c.(163-165)CTG>CTT	p.L55L	FCN2_uc004cfh.1_Intron	NM_004108	NP_004099	Q15485	FCN2_HUMAN	ficolin 2 isoform a precursor	55	Collagen-like.				complement activation, lectin pathway|opsonization|signal transduction	collagen|extracellular space	antigen binding|calcium ion binding|calcium-dependent protein binding|receptor binding|sugar binding			large_intestine(1)	1		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)		GTCCGGGGCTGCCTGGGGCCC	0.607													35	149	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139909524	139909524	+	Silent	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139909524T>A	uc011mem.1	-	24	3868	c.3720A>T	c.(3718-3720)CCA>CCT	p.P1240P	ABCA2_uc011mel.1_Silent_p.P1241P|ABCA2_uc004ckl.1_Silent_p.P1171P|ABCA2_uc004ckm.1_Silent_p.P1271P|ABCA2_uc004ckn.1_RNA	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	1240					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GGGCCCGACCTGGGGGGCTGG	0.662													33	68	---	---	---	---	PASS
USP6NL	9712	broad.mit.edu	37	10	11504618	11504618	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11504618G>A	uc001ikt.3	-	15	2630	c.2309C>T	c.(2308-2310)GCA>GTA	p.A770V	USP6NL_uc001iks.1_Missense_Mutation_p.A787V	NM_014688	NP_055503	Q92738	US6NL_HUMAN	USP6 N-terminal like isoform 1	770						intracellular	Rab GTPase activator activity				0						CTGAAAGGGTGCGAGTTGAAA	0.493													141	84	---	---	---	---	PASS
NMT2	9397	broad.mit.edu	37	10	15154953	15154953	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15154953C>T	uc001inz.1	-	10	1264	c.1180G>A	c.(1180-1182)GGT>AGT	p.G394S	NMT2_uc001ioa.1_Missense_Mutation_p.G381S|NMT2_uc009xjo.1_Missense_Mutation_p.G394S|NMT2_uc010qbz.1_Missense_Mutation_p.G206S	NM_004808	NP_004799	O60551	NMT2_HUMAN	N-myristoyltransferase 2	394					N-terminal protein myristoylation|protein lipoylation	Golgi apparatus|plasma membrane	glycylpeptide N-tetradecanoyltransferase activity			ovary(1)	1						GTCAGTTTACCGTTGGGGCTC	0.512													27	126	---	---	---	---	PASS
MASTL	84930	broad.mit.edu	37	10	27459555	27459555	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27459555C>G	uc001itm.2	+	8	2306	c.1667C>G	c.(1666-1668)TCT>TGT	p.S556C	MASTL_uc001itl.2_Missense_Mutation_p.S556C|MASTL_uc009xkw.1_Missense_Mutation_p.S556C|MASTL_uc009xkx.1_RNA	NM_032844	NP_116233	Q96GX5	GWL_HUMAN	microtubule associated serine/threonine	556	Protein kinase.				cell division|G2/M transition of mitotic cell cycle|mitosis|negative regulation of protein phosphatase type 2A activity|regulation of cell cycle|response to DNA damage stimulus	centrosome|cleavage furrow|nucleus	ATP binding|protein phosphatase 2A binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						TTTCTATGTTCTGATGATGAT	0.328													4	138	---	---	---	---	PASS
FZD8	8325	broad.mit.edu	37	10	35929155	35929155	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35929155C>A	uc001iyz.1	-	1	1208	c.1203G>T	c.(1201-1203)TTG>TTT	p.L401F		NM_031866	NP_114072	Q9H461	FZD8_HUMAN	frizzled 8 precursor	401	Helical; Name=3; (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|embryo development|gonad development|T cell differentiation in thymus|vasculature development	cell projection|Golgi apparatus|integral to membrane|plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding				0						AGTAGACCAGCAAGAAGACCA	0.567													23	25	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37508589	37508589	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37508589G>C	uc001iza.1	+	34	3880	c.3781G>C	c.(3781-3783)GAG>CAG	p.E1261Q		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1317	Potential.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						TGAACAGCAGGAGTCTCTAGA	0.368													4	45	---	---	---	---	PASS
OGDHL	55753	broad.mit.edu	37	10	50960229	50960229	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50960229C>T	uc001jie.2	-	5	686	c.544G>A	c.(544-546)GGG>AGG	p.G182R	OGDHL_uc009xog.2_Missense_Mutation_p.G209R|OGDHL_uc010qgt.1_Missense_Mutation_p.G125R|OGDHL_uc010qgu.1_5'UTR|OGDHL_uc009xoh.2_5'UTR	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	182					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						TCAGAGCCCCCAATGAAGGTG	0.607													20	13	---	---	---	---	PASS
MYOZ1	58529	broad.mit.edu	37	10	75393825	75393825	+	Splice_Site	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75393825T>A	uc001jur.2	-	5	868	c.503_splice	c.e5-1	p.G168_splice		NM_021245	NP_067068	Q9NP98	MYOZ1_HUMAN	myozenin 1						myofibril assembly	nucleus|pseudopodium	FATZ binding			ovary(2)	2	Prostate(51;0.0112)					CCTGGTCTCCTGGTAGCCATG	0.488													3	31	---	---	---	---	PASS
ZNF518A	9849	broad.mit.edu	37	10	97919827	97919827	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97919827A>G	uc001klp.2	+	6	4605	c.3748A>G	c.(3748-3750)ACT>GCT	p.T1250A	ZNF518A_uc001klo.1_Missense_Mutation_p.T720A|ZNF518A_uc001klq.2_Missense_Mutation_p.T1250A|ZNF518A_uc001klr.2_Missense_Mutation_p.T1250A	NM_014803	NP_055618	Q6AHZ1	Z518A_HUMAN	zinc finger protein 518	1250					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		TAGAAAAAAGACTTCCAAAAA	0.338													5	69	---	---	---	---	PASS
KCNK18	338567	broad.mit.edu	37	10	118969568	118969568	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118969568G>T	uc010qsr.1	+	3	913	c.913G>T	c.(913-915)GAG>TAG	p.E305*		NM_181840	NP_862823	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	305						integral to membrane|plasma membrane				upper_aerodigestive_tract(1)	1		Colorectal(252;0.19)		all cancers(201;0.0211)		CCCCTTCTGGGAGACACAGTT	0.488													7	244	---	---	---	---	PASS
DMBT1	1755	broad.mit.edu	37	10	124390004	124390004	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124390004G>A	uc001lgk.1	+	45	5742	c.5636G>A	c.(5635-5637)AGC>AAC	p.S1879N	DMBT1_uc001lgl.1_Missense_Mutation_p.S1869N|DMBT1_uc001lgm.1_Missense_Mutation_p.S1251N|DMBT1_uc009xzz.1_Missense_Mutation_p.S1879N|DMBT1_uc010qtx.1_Missense_Mutation_p.S599N|DMBT1_uc009yab.1_Missense_Mutation_p.S582N|DMBT1_uc009yac.1_Missense_Mutation_p.S173N	NM_007329	NP_015568	Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1 isoform b	1879					epithelial cell differentiation|induction of bacterial agglutination|innate immune response|interspecies interaction between organisms|protein transport|response to virus	extrinsic to membrane|phagocytic vesicle membrane|zymogen granule membrane	calcium-dependent protein binding|Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|pattern recognition receptor activity|scavenger receptor activity|zymogen binding			central_nervous_system(7)	7		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TCCTTCCCAAGCGGTAAGTGC	0.463													10	47	---	---	---	---	PASS
DEAF1	10522	broad.mit.edu	37	11	674723	674723	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:674723G>A	uc001lqq.1	-	10	2009	c.1316C>T	c.(1315-1317)CCC>CTC	p.P439L	DEAF1_uc009ycf.1_RNA	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1	439	Pro-rich.				embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		GACCAACGCGGGAGGTGCCGC	0.562													88	133	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1264922	1264922	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1264922C>A	uc009ycr.1	+	48	8852	c.8726C>A	c.(8725-8727)ACC>AAC	p.T2909N	MUC5B_uc001ltb.2_Missense_Mutation_p.T2274N	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	2271	7 X Cys-rich subdomain repeats.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCAGGGACGACCACCCCGGGC	0.682													34	196	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1267380	1267380	+	Silent	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1267380C>A	uc009ycr.1	+	49	11145	c.11019C>A	c.(11017-11019)ACC>ACA	p.T3673T	MUC5B_uc001ltb.2_Silent_p.T3093T	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	3090	7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCATGGCCACCATGTCCACAA	0.612													37	56	---	---	---	---	PASS
STIM1	6786	broad.mit.edu	37	11	3877612	3877612	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3877612G>A	uc001lyv.2	+	1	680	c.112G>A	c.(112-114)GCC>ACC	p.A38T	STIM1_uc009yef.2_Missense_Mutation_p.A38T	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor	38	Extracellular (Potential).				activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		CAGCTCGGGGGCCAACTCTGA	0.637													6	144	---	---	---	---	PASS
DCHS1	8642	broad.mit.edu	37	11	6646574	6646574	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6646574G>A	uc001mem.1	-	19	7411	c.7001C>T	c.(7000-7002)ACG>ATG	p.T2334M		NM_003737	NP_003728	Q96JQ0	PCD16_HUMAN	dachsous 1 precursor	2334	Cadherin 22.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|large_intestine(1)|pancreas(1)	5		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGGGGCCCCGTGAGGGAGAC	0.612													23	39	---	---	---	---	PASS
OR10A5	144124	broad.mit.edu	37	11	6867073	6867073	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6867073C>A	uc001met.1	+	1	160	c.160C>A	c.(160-162)CCC>ACC	p.P54T		NM_178168	NP_835462	Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A,	54	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CCTAGCTGACCCCATGCTACA	0.453													157	335	---	---	---	---	PASS
OR4A47	403253	broad.mit.edu	37	11	48510836	48510836	+	Silent	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48510836C>A	uc010rhx.1	+	1	492	c.492C>A	c.(490-492)CTC>CTA	p.L164L		NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A,	164	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TTTATGGGCTCCCATTCTGTG	0.448													153	226	---	---	---	---	PASS
HNRNPUL2	221092	broad.mit.edu	37	11	62482965	62482965	+	Intron	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62482965T>C	uc001nuw.2	-						HNRNPUL2_uc001nuu.1_Intron	NM_001079559	NP_001073027	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like						cell killing	nucleus	ATP binding|nucleic acid binding				0						CCCAAGAAGATACTCACATCC	0.473													55	120	---	---	---	---	PASS
CTTN	2017	broad.mit.edu	37	11	70260667	70260667	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70260667A>G	uc001opv.3	+	6	517	c.311A>G	c.(310-312)TAT>TGT	p.Y104C	CTTN_uc001opu.2_Missense_Mutation_p.Y104C|CTTN_uc001opw.3_Missense_Mutation_p.Y104C	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a	104	Cortactin 1.					cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GGCCACGAATATCAGTCGAAA	0.547													34	92	---	---	---	---	PASS
C2CD3	26005	broad.mit.edu	37	11	73753101	73753101	+	Silent	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73753101G>C	uc001ouu.2	-	29	5885	c.5658C>G	c.(5656-5658)CTC>CTG	p.L1886L	C2CD3_uc001out.2_RNA	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1886						centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					AGCCTCACCTGAGAGAAGTCA	0.488													3	108	---	---	---	---	PASS
MYO7A	4647	broad.mit.edu	37	11	76922973	76922973	+	Silent	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76922973C>T	uc001oyb.2	+	46	6617	c.6345C>T	c.(6343-6345)TTC>TTT	p.F2115F	MYO7A_uc001oyc.2_Silent_p.F2077F|MYO7A_uc001oye.2_RNA	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1	2115	FERM 2.				actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						CAGCCTTCTTCGAGGTGAAGG	0.557													3	58	---	---	---	---	PASS
CWF19L2	143884	broad.mit.edu	37	11	107299903	107299903	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107299903T>A	uc010rvp.1	-	8	1085	c.1055A>T	c.(1054-1056)AAC>ATC	p.N352I	CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control	352							catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		TTGCCTTGGGTTAGATTCTCT	0.358													59	117	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	120998686	120998686	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120998686C>A	uc010rzo.1	+	8	2000	c.2000C>A	c.(1999-2001)GCC>GAC	p.A667D		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	667					cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TTCTTCTGGGCCACGGCCAAC	0.642													5	98	---	---	---	---	PASS
OR6M1	390261	broad.mit.edu	37	11	123676802	123676802	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123676802C>T	uc010rzz.1	-	1	256	c.256G>A	c.(256-258)GAA>AAA	p.E86K		NM_001005325	NP_001005325	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M,	86	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		GTTTTCTCTTCTCCTAGGAGG	0.433													13	139	---	---	---	---	PASS
KDM5A	5927	broad.mit.edu	37	12	416829	416829	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:416829G>A	uc001qif.1	-	23	4084	c.3721C>T	c.(3721-3723)CCT>TCT	p.P1241S	KDM5A_uc001qie.1_Missense_Mutation_p.P1241S	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	1241					chromatin modification|multicellular organismal development|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|ovary(1)	3						TCTCCTTCAGGCAACCGTACG	0.532			T 	NUP98	AML								91	105	---	---	---	---	PASS
PRH2	5555	broad.mit.edu	37	12	11082904	11082904	+	Splice_Site	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11082904G>A	uc009zhr.2	+	2	138	c.100_splice	c.e2+1	p.D34_splice	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH2_uc001qzh.2_Splice_Site_p.D34_splice|PRH2_uc001qzi.3_Splice_Site_p.D34_splice	NM_001110213	NP_001103683	P02810	PRPC_HUMAN	proline-rich protein HaeIII subfamily 2							extracellular space	protein binding				0						GTAATATCAGGTAAATCCCAA	0.383													69	132	---	---	---	---	PASS
SPRYD3	84926	broad.mit.edu	37	12	53473103	53473103	+	Silent	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53473103C>G	uc001sbt.1	-	1	36	c.15G>C	c.(13-15)CGG>CGC	p.R5R	SPRYD3_uc010snw.1_5'UTR	NM_032840	NP_116229	Q8NCJ5	SPRY3_HUMAN	SPRY domain containing 3	5										central_nervous_system(1)	1						ACCGGGGCCGCCGCGTCCTCC	0.716													10	4	---	---	---	---	PASS
NCKAP1L	3071	broad.mit.edu	37	12	54912482	54912482	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54912482C>A	uc001sgc.3	+	14	1465	c.1386C>A	c.(1384-1386)TTC>TTA	p.F462L	NCKAP1L_uc010sox.1_Missense_Mutation_p.F4L|NCKAP1L_uc010soy.1_Missense_Mutation_p.F412L	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	462					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						TGTCCTCATTCGTCAGTATCC	0.473													89	75	---	---	---	---	PASS
IL23A	51561	broad.mit.edu	37	12	56733895	56733895	+	3'UTR	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56733895C>T	uc001sla.2	+	4						NM_016584	NP_057668	Q9NPF7	IL23A_HUMAN	interleukin 23, alpha subunit p19 precursor						defense response to Gram-negative bacterium|inflammatory response|innate immune response|negative regulation of interleukin-10 production|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to virus|tissue remodeling	interleukin-23 complex	cytokine activity				0						CTAAAGGCAGCAGCTCAAGGA	0.547													18	125	---	---	---	---	PASS
ZDHHC17	23390	broad.mit.edu	37	12	77220766	77220766	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77220766G>C	uc001syk.1	+	9	1139	c.976G>C	c.(976-978)GAT>CAT	p.D326H	ZDHHC17_uc001syj.2_RNA	NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14	326	Helical; (Potential).				lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						CCTAAATATTGATTCTTGGCT	0.338													10	170	---	---	---	---	PASS
SLC6A15	55117	broad.mit.edu	37	12	85257356	85257356	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85257356C>A	uc001szv.2	-	11	2173	c.1680G>T	c.(1678-1680)ATG>ATT	p.M560I	SLC6A15_uc010sul.1_Missense_Mutation_p.M453I|SLC6A15_uc001szw.1_Missense_Mutation_p.M268I	NM_182767	NP_877499	Q9H2J7	S6A15_HUMAN	solute carrier family 6, member 15 isoform 1	560					cellular nitrogen compound metabolic process|leucine transport|proline transport	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			pancreas(2)|ovary(1)	3						CAAAGCCCAGCATATCTTTTA	0.289													91	74	---	---	---	---	PASS
FAM71C	196472	broad.mit.edu	37	12	100042517	100042517	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100042517G>A	uc001tgn.2	+	1	987	c.565G>A	c.(565-567)GGG>AGG	p.G189R	ANKS1B_uc001tge.1_Intron|ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron	NM_153364	NP_699195	Q8NEG0	FA71C_HUMAN	hypothetical protein LOC196472	189											0				OV - Ovarian serous cystadenocarcinoma(2;0.00733)|Epithelial(2;0.0385)|all cancers(2;0.19)		TATCCTAGCTGGGAACACATT	0.512													15	40	---	---	---	---	PASS
TCHP	84260	broad.mit.edu	37	12	110340868	110340868	+	Nonsense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110340868C>T	uc001tpn.2	+	2	190	c.37C>T	c.(37-39)CAG>TAG	p.Q13*	TCHP_uc001tpo.1_RNA|TCHP_uc001tpp.2_Nonsense_Mutation_p.Q13*	NM_001143852	NP_001137324	Q9BT92	TCHP_HUMAN	trichoplein	13	Potential.				apoptosis|negative regulation of cell growth	apical cortex|centrosome|keratin filament|mitochondrion|plasma membrane	protein binding			skin(1)	1						CTGGTGCAGCCAGCAGCGCCT	0.607													20	89	---	---	---	---	PASS
ABCB9	23457	broad.mit.edu	37	12	123444664	123444664	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123444664T>A	uc001udm.3	-	2	429	c.119A>T	c.(118-120)CAC>CTC	p.H40L	ABCB9_uc009zxr.2_Missense_Mutation_p.H40L|ABCB9_uc001udo.3_Missense_Mutation_p.H40L|ABCB9_uc010taj.1_Missense_Mutation_p.H40L|ABCB9_uc001udp.2_Missense_Mutation_p.H40L|ABCB9_uc001udq.2_5'UTR|ABCB9_uc001udr.2_Missense_Mutation_p.H40L	NM_019625	NP_062571	Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	40					positive regulation of T cell mediated cytotoxicity|protein transport	lysosomal membrane|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		GATGTTGAAGTGGCGGATGTC	0.597													24	106	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26343289	26343289	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26343289G>T	uc001uqk.2	+	26	2632	c.2490G>T	c.(2488-2490)CAG>CAT	p.Q830H	ATP8A2_uc010tdi.1_Missense_Mutation_p.Q790H|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.Q380H	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	790	Cytoplasmic (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GGATGATCCAGACAGCCCACG	0.592													5	185	---	---	---	---	PASS
B3GALTL	145173	broad.mit.edu	37	13	31860853	31860853	+	Intron	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31860853C>T	uc010aaz.2	+						B3GALTL_uc001utn.3_Intron	NM_194318	NP_919299	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like						fucose metabolic process	endoplasmic reticulum membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)		CTTGCCTTTTCTAGGTCATTG	0.308													37	63	---	---	---	---	PASS
STARD13	90627	broad.mit.edu	37	13	33704002	33704002	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33704002G>T	uc001uuw.2	-	5	938	c.812C>A	c.(811-813)GCC>GAC	p.A271D	STARD13_uc001uuu.2_Missense_Mutation_p.A263D|STARD13_uc001uuv.2_Missense_Mutation_p.A153D|STARD13_uc001uux.2_Missense_Mutation_p.A236D|STARD13_uc010tec.1_RNA|STARD13_uc010abh.1_Missense_Mutation_p.A256D	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain	271					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		CCTCCCGTGGGCTCCCTTCCC	0.577													73	134	---	---	---	---	PASS
DIAPH3	81624	broad.mit.edu	37	13	60566683	60566683	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60566683G>A	uc001vht.2	-	10	1268	c.1049C>T	c.(1048-1050)ACA>ATA	p.T350I	DIAPH3_uc001vhu.2_Missense_Mutation_p.T87I|DIAPH3_uc001vhv.2_5'Flank|DIAPH3_uc001vhw.1_Missense_Mutation_p.T339I|DIAPH3_uc010aed.1_Missense_Mutation_p.T304I|DIAPH3_uc010aee.1_Missense_Mutation_p.T280I	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	350	GBD/FH3.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		ATCAGGAGATGTAACCAGGGC	0.403													9	67	---	---	---	---	PASS
OR4N5	390437	broad.mit.edu	37	14	20612368	20612368	+	Silent	SNP	A	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20612368A>T	uc010tla.1	+	1	474	c.474A>T	c.(472-474)GTA>GTT	p.V158V		NM_001004724	NP_001004724	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N,	158	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		ATTCCATTGTACAAGTAGCCC	0.488													115	262	---	---	---	---	PASS
OR11G2	390439	broad.mit.edu	37	14	20665821	20665821	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20665821A>G	uc010tlb.1	+	1	327	c.327A>G	c.(325-327)ATA>ATG	p.I109M		NM_001005503	NP_001005503	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G,	109	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TCTTGGAGATATGTTATGTCA	0.522													44	94	---	---	---	---	PASS
RNASE3	6037	broad.mit.edu	37	14	21360032	21360032	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21360032C>A	uc001vyj.2	+	2	241	c.187C>A	c.(187-189)CGT>AGT	p.R63S		NM_002935	NP_002926	P12724	ECP_HUMAN	ribonuclease, RNase A family, 3 (eosinophil	63					defense response to bacterium|RNA catabolic process	extracellular region|soluble fraction	nucleic acid binding|pancreatic ribonuclease activity				0	all_cancers(95;0.00453)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	Pranlukast(DB01411)	TTATCGATGGCGTTGCAAAAA	0.438													126	145	---	---	---	---	PASS
TOX4	9878	broad.mit.edu	37	14	21960829	21960829	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21960829G>A	uc001waz.2	+	7	1157	c.1054G>A	c.(1054-1056)GCA>ACA	p.A352T	TOX4_uc001way.2_Missense_Mutation_p.A222T|TOX4_uc001wba.2_RNA|TOX4_uc010tlu.1_Missense_Mutation_p.A329T|TOX4_uc010tlv.1_Missense_Mutation_p.A222T	NM_014828	NP_055643	O94842	TOX4_HUMAN	epidermal Langerhans cell protein LCP1	352						chromatin|nucleus|PTW/PP1 phosphatase complex	DNA binding|protein binding			ovary(1)	1	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		ATCCTATGTGGCAAACCAGGC	0.488													5	326	---	---	---	---	PASS
LRP10	26020	broad.mit.edu	37	14	23342656	23342656	+	Splice_Site	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23342656G>T	uc001whd.2	+	3	768	c.215_splice	c.e3+1	p.R72_splice	LRP10_uc001whe.2_5'Flank	NM_014045	NP_054764	Q7Z4F1	LRP10_HUMAN	low density lipoprotein receptor-related protein						endocytosis	coated pit|integral to membrane				central_nervous_system(1)	1	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.00549)		TCACCATCAGGTGAGAAGCAG	0.522													36	75	---	---	---	---	PASS
LRRC16B	90668	broad.mit.edu	37	14	24524479	24524479	+	Silent	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24524479C>A	uc001wlj.2	+	8	722	c.565C>A	c.(565-567)CGG>AGG	p.R189R		NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	189										ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)		TGAAGATAACCGGGAGTTCAA	0.552													42	315	---	---	---	---	PASS
JKAMP	51528	broad.mit.edu	37	14	59970688	59970688	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59970688G>T	uc001xei.3	+	7	1378	c.876G>T	c.(874-876)TTG>TTT	p.L292F	JKAMP_uc001xef.3_Missense_Mutation_p.L278F|JKAMP_uc001xeh.3_Missense_Mutation_p.L272F|JKAMP_uc001xeg.3_Missense_Mutation_p.L286F|JKAMP_uc010try.1_Missense_Mutation_p.L215F|JKAMP_uc001xej.3_Missense_Mutation_p.L215F	NM_001098625	NP_001092095	Q9P055	JKAMP_HUMAN	JNK1-associated membrane protein isoform 2	293	Helical; (Potential).				ER-associated protein catabolic process|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane	ubiquitin protein ligase binding			breast(1)	1						AGCAAGATTTGCCCCTTTTGG	0.418													75	132	---	---	---	---	PASS
PSEN1	5663	broad.mit.edu	37	14	73659524	73659524	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73659524C>T	uc001xnr.2	+	7	1005	c.721C>T	c.(721-723)CTC>TTC	p.L241F	PSEN1_uc001xnv.2_Missense_Mutation_p.L237F|PSEN1_uc010ark.2_Missense_Mutation_p.L237F|PSEN1_uc001xnt.1_RNA|PSEN1_uc001xnu.2_RNA	NM_000021	NP_000012	P49768	PSN1_HUMAN	presenilin 1 isoform I-467	241	Helical; (Potential).				amyloid precursor protein catabolic process|anti-apoptosis|beta-amyloid metabolic process|cell-cell adhesion|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|smooth endoplasmic reticulum calcium ion homeostasis	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|gamma-secretase complex|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum|smooth endoplasmic reticulum|Z disc	aspartic-type endopeptidase activity|beta-catenin binding|cadherin binding|calcium channel activity|PDZ domain binding			breast(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		TATCAAGTACCTCCCTGAATG	0.468													155	182	---	---	---	---	PASS
TMEM90A	646658	broad.mit.edu	37	14	74874667	74874667	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74874667T>C	uc001xpx.2	-	3	691	c.443A>G	c.(442-444)GAA>GGA	p.E148G		NM_001105579	NP_001099049	A6NDD5	SYN1L_HUMAN	transmembrane protein 90A	148					response to biotic stimulus	Golgi apparatus|integral to membrane					0				BRCA - Breast invasive adenocarcinoma(234;0.00159)		GTCTTCACTTTCACTCTCCGT	0.488													7	76	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	78710064	78710064	+	RNA	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78710064G>T	uc001xum.1	+	2		c.1421G>T						Q9Y4C0	NRX3A_HUMAN	Homo sapiens mRNA for KIAA0743 protein, partial cds.						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CTGTGAAAATGGTGGGATCTG	0.587													45	124	---	---	---	---	PASS
SLC24A4	123041	broad.mit.edu	37	14	92922946	92922946	+	Missense_Mutation	SNP	G	A	A	rs138624260		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92922946G>A	uc001yak.2	+	12	1222	c.1198G>A	c.(1198-1200)GTG>ATG	p.V400M	SLC24A4_uc001yai.2_Missense_Mutation_p.V353M|SLC24A4_uc010twm.1_Missense_Mutation_p.V398M|SLC24A4_uc001yaj.2_Missense_Mutation_p.V381M|SLC24A4_uc010auj.2_Missense_Mutation_p.V289M|SLC24A4_uc010twn.1_Missense_Mutation_p.V173M|SLC24A4_uc001yan.2_Missense_Mutation_p.V111M	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	417	Extracellular (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		CCCCTTCTCCGTGCCGGGTGA	0.622											OREG0022876	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	47	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105406002	105406002	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105406002G>T	uc010axc.1	-	7	15906	c.15786C>A	c.(15784-15786)AGC>AGA	p.S5262R	AHNAK2_uc001ypx.2_Missense_Mutation_p.S5162R	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5262						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGGATGATTTGCTCTCAGAAG	0.502													153	291	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	22482980	22482980	+	IGR	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22482980C>T								OR4N3P (68595 upstream) : MIR1268 (30249 downstream)																							CAGCATTGATCCATCCCATCC	0.517													135	552	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	25427554	25427554	+	Intron	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25427554G>T	uc001yyy.1	+						uc001yza.1_5'Flank|SNORD115-7_uc001yyw.1_RNA|SNORD115-7_uc001yyz.2_RNA					Homo sapiens clone Rt-7 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																		ACCTTATATTGTCCTGAAGAG	0.512													93	186	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25940142	25940142	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25940142C>T	uc010ayu.2	-	14	3018	c.2912G>A	c.(2911-2913)AGC>AAC	p.S971N		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	971	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GATCACGAGGCTGGGTCTGCG	0.602													44	87	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28377918	28377918	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28377918C>T	uc001zbj.2	-	80	12395	c.12289G>A	c.(12289-12291)GCT>ACT	p.A4097T		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	4097	RCC1 15.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCGCCAGCAGCAACATCGACC	0.557													7	192	---	---	---	---	PASS
SEMA6D	80031	broad.mit.edu	37	15	48058151	48058151	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48058151A>G	uc010bek.2	+	14	1873	c.1513A>G	c.(1513-1515)AGC>GGC	p.S505G	SEMA6D_uc001zvw.2_Missense_Mutation_p.S505G|SEMA6D_uc001zvy.2_Missense_Mutation_p.S505G|SEMA6D_uc001zvz.2_Missense_Mutation_p.S505G|SEMA6D_uc001zwa.2_Missense_Mutation_p.S505G|SEMA6D_uc001zwb.2_Missense_Mutation_p.S505G|SEMA6D_uc001zwc.2_Missense_Mutation_p.S505G	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	505	Sema.|Extracellular (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GGCGTTCTCTAGCTGCATTAT	0.438													73	141	---	---	---	---	PASS
TRPM7	54822	broad.mit.edu	37	15	50904852	50904852	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50904852T>C	uc001zyt.3	-	16	2209	c.1945A>G	c.(1945-1947)ATG>GTG	p.M649V	TRPM7_uc010bew.1_Missense_Mutation_p.M649V|TRPM7_uc001zyu.2_Missense_Mutation_p.M207V	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,	649	Cytoplasmic (Potential).				cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		GCTTTAGCCATTGATTCTTCA	0.403													74	112	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54307273	54307273	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54307273G>A	uc002ack.2	+	1	2173	c.2173G>A	c.(2173-2175)GGC>AGC	p.G725S		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	725					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TCCATGCCCTGGCTTGGATAA	0.418													22	30	---	---	---	---	PASS
RPL4	6124	broad.mit.edu	37	15	66793358	66793358	+	Silent	SNP	T	C	C	rs143921047	byFrequency	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66793358T>C	uc002apv.2	-	7	818	c.762A>G	c.(760-762)GAA>GAG	p.E254E	RPL4_uc010bhr.2_Silent_p.E160E|RPL4_uc002apw.2_Silent_p.E160E|RPL4_uc002apx.2_Silent_p.E160E|RPL4_uc010ujq.1_3'UTR	NM_000968	NP_000959	P36578	RL4_HUMAN	ribosomal protein L4	254					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						GGAAAGCACTTTCAGTCCAAA	0.423													59	129	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79058102	79058102	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79058102T>C	uc002bej.3	-	19	4362	c.4151A>G	c.(4150-4152)AAC>AGC	p.N1384S	ADAMTS7_uc010und.1_3'UTR	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1384					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						TCTGTGGCTGTTGGCGGGGCT	0.692													3	61	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89401084	89401084	+	Silent	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89401084C>T	uc010upo.1	+	12	5642	c.5268C>T	c.(5266-5268)AGC>AGT	p.S1756S	ACAN_uc010upp.1_Silent_p.S1756S|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	1756					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CTGAGCTTAGCGGGCTGTCCT	0.493													8	213	---	---	---	---	PASS
ANPEP	290	broad.mit.edu	37	15	90347586	90347586	+	Silent	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90347586C>T	uc002bop.3	-	6	1369	c.1077G>A	c.(1075-1077)CTG>CTA	p.L359L		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	359	Extracellular.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	GGTAGGTCACCAGTCCCCAGT	0.627													65	89	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1391391	1391391	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1391391A>C	uc002clk.1	+	8	737	c.737A>C	c.(736-738)AAG>ACG	p.K246T	BAIAP3_uc002clj.2_Missense_Mutation_p.K228T|BAIAP3_uc010uuz.1_Missense_Mutation_p.K211T|BAIAP3_uc010uva.1_Missense_Mutation_p.K183T|BAIAP3_uc010uvb.1_Missense_Mutation_p.K263T|BAIAP3_uc010uvc.1_Missense_Mutation_p.K211T	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	246	C2 1.				G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				GGCTTCCGCAAGGGCAGCAAG	0.657													50	78	---	---	---	---	PASS
ZNF423	23090	broad.mit.edu	37	16	49557637	49557637	+	Silent	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49557637G>T	uc002efs.2	-	8	4021	c.3723C>A	c.(3721-3723)GCC>GCA	p.A1241A	ZNF423_uc010vgn.1_Silent_p.A1124A	NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	1241	C2H2-type 29.				cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				GCAACTTGTTGGCCTGGACGA	0.602													8	54	---	---	---	---	PASS
IRX6	79190	broad.mit.edu	37	16	55364220	55364220	+	3'UTR	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55364220C>A	uc002ehy.2	+	6					IRX6_uc002ehx.2_3'UTR	NM_024335	NP_077311	P78412	IRX6_HUMAN	iroquois homeobox protein 6							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(1)	6						CAGGTTAGCGCAATGGCTGCG	0.498													54	72	---	---	---	---	PASS
PITPNA	5306	broad.mit.edu	37	17	1438589	1438589	+	Intron	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1438589G>A	uc002fst.3	-						PITPNA_uc010cjt.2_Intron|PITPNA_uc010cju.2_Intron	NM_006224	NP_006215	Q00169	PIPNA_HUMAN	phosphatidylinositol transfer protein, alpha						axon guidance|lipid metabolic process|visual perception	cytoplasm	phosphatidylcholine transmembrane transporter activity|phosphatidylinositol transporter activity|protein binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)		AGCTCTTGCTGCATTAGAAAC	0.552													34	54	---	---	---	---	PASS
PITPNA	5306	broad.mit.edu	37	17	1438590	1438590	+	Intron	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1438590C>A	uc002fst.3	-						PITPNA_uc010cjt.2_Intron|PITPNA_uc010cju.2_Intron	NM_006224	NP_006215	Q00169	PIPNA_HUMAN	phosphatidylinositol transfer protein, alpha						axon guidance|lipid metabolic process|visual perception	cytoplasm	phosphatidylcholine transmembrane transporter activity|phosphatidylinositol transporter activity|protein binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)		GCTCTTGCTGCATTAGAAACA	0.557													33	51	---	---	---	---	PASS
TRPV3	162514	broad.mit.edu	37	17	3417227	3417227	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3417227G>A	uc002fvt.1	-	18	2679	c.2357C>T	c.(2356-2358)CCG>CTG	p.P786L	SPATA22_uc010vrg.1_5'Flank|TRPV3_uc002fvs.1_RNA|TRPV3_uc010vrh.1_Missense_Mutation_p.P770L|TRPV3_uc010vri.1_Missense_Mutation_p.P741L|TRPV3_uc010vrj.1_Missense_Mutation_p.P770L|TRPV3_uc010vrk.1_RNA|TRPV3_uc010vrl.1_Missense_Mutation_p.P771L|TRPV3_uc010vrm.1_RNA|TRPV3_uc002fvr.2_Missense_Mutation_p.P787L	NM_145068	NP_659505	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel,	786	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(4)	4					Menthol(DB00825)	CGAGGTTTCCGGGAATTCCTC	0.488													69	96	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	A	A	rs28934576	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577120C>A	uc002gim.2	-	8	1012	c.818G>T	c.(817-819)CGT>CTT	p.R273L	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.R273L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141L|TP53_uc010cng.1_Missense_Mutation_p.R141L|TP53_uc002gii.1_Missense_Mutation_p.R141L|TP53_uc010cnh.1_Missense_Mutation_p.R273L|TP53_uc010cni.1_Missense_Mutation_p.R273L|TP53_uc002gij.2_Missense_Mutation_p.R273L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R273H(469)|p.R273C(394)|p.R273L(83)|p.R273P(24)|p.R273S(11)|p.R273G(9)|p.0?(7)|p.R273fs*72(3)|p.?(2)|p.R273fs*33(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273R(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCACAAACACGCACCTCAAA	0.542	R273H(NCIH1793_LUNG)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PANC1_PANCREAS)|R273H(NCIH508_LARGE_INTESTINE)|R273H(NCIH1975_LUNG)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(NCIH2405_LUNG)|R273H(HEC59_ENDOMETRIUM)|R273H(NCIH1155_LUNG)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(EN_ENDOMETRIUM)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(MDAMB468_BREAST)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW620_LARGE_INTESTINE)|R273H(SUIT2_PANCREAS)|R273H(SW480_LARGE_INTESTINE)|R273H(SKMEL30_SKIN)|R273H(OC314_OVARY)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			23	37	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578469	7578469	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578469C>A	uc002gim.2	-	5	655	c.461G>T	c.(460-462)GGC>GTC	p.G154V	TP53_uc002gig.1_Missense_Mutation_p.G154V|TP53_uc002gih.2_Missense_Mutation_p.G154V|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G22V|TP53_uc010cng.1_Missense_Mutation_p.G22V|TP53_uc002gii.1_Missense_Mutation_p.G22V|TP53_uc010cnh.1_Missense_Mutation_p.G154V|TP53_uc010cni.1_Missense_Mutation_p.G154V|TP53_uc002gij.2_Missense_Mutation_p.G154V|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.G61V|TP53_uc002gio.2_Missense_Mutation_p.G22V|TP53_uc010vug.1_Missense_Mutation_p.G115V	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	154	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		G -> D (in sporadic cancers; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).|G -> A (in sporadic cancers; somatic mutation).|G -> V (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|G -> I (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> C (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G154V(36)|p.G154G(12)|p.G154S(9)|p.0?(7)|p.G154D(6)|p.P152fs*14(4)|p.G154I(3)|p.G154fs*27(3)|p.G154fs*16(2)|p.G154fs*14(2)|p.P153fs*26(2)|p.P153fs*22(2)|p.P151_V173del23(1)|p.G154_R156delGTR(1)|p.G154C(1)|p.Q144_G154del11(1)|p.D148_T155delDSTPPPGT(1)|p.G154A(1)|p.S149fs*72(1)|p.G154fs*22(1)|p.D148fs*23(1)|p.P153_G154insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GACGCGGGTGCCGGGCGGGGG	0.607		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			55	76	---	---	---	---	PASS
GAS7	8522	broad.mit.edu	37	17	9823009	9823009	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9823009C>T	uc002gmg.1	-	12	1313	c.1152G>A	c.(1150-1152)ATG>ATA	p.M384I	GAS7_uc010vvc.1_Missense_Mutation_p.M198I|GAS7_uc002gmh.1_Missense_Mutation_p.M244I|GAS7_uc010vvd.1_Missense_Mutation_p.M336I|GAS7_uc002gmi.2_Missense_Mutation_p.M320I|GAS7_uc002gmj.1_Missense_Mutation_p.M324I|GAS7_uc010coh.1_Missense_Mutation_p.M324I	NM_201433	NP_958839	O60861	GAS7_HUMAN	growth arrest-specific 7 isoform c	384	Potential.				cell cycle arrest	cytoplasm	sequence-specific DNA binding transcription factor activity			lung(1)|pancreas(1)	2						CCACACAGCGCATGAGGTCGT	0.547			T	MLL	AML*								20	141	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10433387	10433387	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10433387G>T	uc010coi.2	-	23	2830	c.2702C>A	c.(2701-2703)GCC>GAC	p.A901D	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.A901D|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	901	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						CAAGCCTTCGGCTTCCTTAAG	0.398													121	155	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11583141	11583141	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11583141G>A	uc002gne.2	+	18	3489	c.3421G>A	c.(3421-3423)GAT>AAT	p.D1141N	DNAH9_uc010coo.2_Missense_Mutation_p.D435N	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	1141	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGAAAAAGGAGATTTCCAAGG	0.423													8	168	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	25783907	25783907	+	IGR	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25783907G>A								WSB1 (143262 upstream) : KSR1 (15129 downstream)																							GGAGGTAAGTGGGTCGGGGAC	0.692													20	17	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29556400	29556400	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29556400C>G	uc002hgg.2	+	21	3100	c.2767C>G	c.(2767-2769)CTA>GTA	p.L923V	NF1_uc002hgh.2_Missense_Mutation_p.L923V|NF1_uc010csn.1_Missense_Mutation_p.L783V|NF1_uc002hgi.1_5'UTR	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	923					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TCTGGTGGGTCTAGAATTGAG	0.403			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			118	172	---	---	---	---	PASS
AARSD1	80755	broad.mit.edu	37	17	41113248	41113248	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41113248C>G	uc002icc.2	-	3	295	c.292G>C	c.(292-294)GAT>CAT	p.D98H	AARSD1_uc002icd.2_Missense_Mutation_p.D211H|AARSD1_uc002ice.2_Missense_Mutation_p.D181H|AARSD1_uc002icf.2_Missense_Mutation_p.D272H|AARSD1_uc010whg.1_Missense_Mutation_p.D272H|AARSD1_uc010cyu.1_Missense_Mutation_p.D98H	NM_025267	NP_079543	Q9BTE6	AASD1_HUMAN	alanyl-tRNA synthetase domain containing 1	98					alanyl-tRNA aminoacylation	cytoplasm	alanine-tRNA ligase activity|ATP binding|metal ion binding|nucleic acid binding				0		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		CGCTCCCAATCTACCCGGACC	0.498													175	301	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51901248	51901248	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51901248A>T	uc002iua.2	+	1	1010	c.854A>T	c.(853-855)CAG>CTG	p.Q285L	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	285	Kinesin-motor.				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						TTCACCGCCCAGCCACTGGTG	0.567													38	66	---	---	---	---	PASS
TLK2	11011	broad.mit.edu	37	17	60642414	60642414	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60642414G>A	uc010ddp.2	+	11	1152	c.884G>A	c.(883-885)AGA>AAA	p.R295K	TLK2_uc002izx.3_Missense_Mutation_p.R143K|TLK2_uc002izz.3_Missense_Mutation_p.R295K|TLK2_uc002jaa.3_Missense_Mutation_p.R263K|TLK2_uc010wpd.1_Missense_Mutation_p.R263K	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A	295					cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						GACCGCTTGAGACTGGGCCAC	0.408													74	122	---	---	---	---	PASS
CD79B	974	broad.mit.edu	37	17	62007148	62007148	+	Silent	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62007148G>T	uc002jdq.1	-	4	614	c.531C>A	c.(529-531)ATC>ATA	p.I177I	CD79B_uc002jdo.1_Silent_p.I151I|CD79B_uc002jdp.1_Silent_p.I178I|CD79B_uc002jdr.1_Silent_p.I73I	NM_000626	NP_000617	P40259	CD79B_HUMAN	CD79B antigen isoform 1 precursor	177	Helical; (Potential).				cell surface receptor linked signaling pathway|immune response	Golgi apparatus|integral to plasma membrane|nucleus	transmembrane receptor activity				0						GCAGCAGGAAGATAGGCACGA	0.572			Mis|O		DLBCL								31	43	---	---	---	---	PASS
CDC42EP4	23580	broad.mit.edu	37	17	71281750	71281750	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71281750C>A	uc002jjn.2	-	2	1037	c.890G>T	c.(889-891)CGC>CTC	p.R297L	CDC42EP4_uc002jjo.2_Missense_Mutation_p.R297L|CDC42EP4_uc002jjp.1_Missense_Mutation_p.R227L	NM_012121	NP_036253	Q9H3Q1	BORG4_HUMAN	Cdc42 effector protein 4	297					positive regulation of pseudopodium assembly|regulation of cell shape	actin cytoskeleton|cytoplasm|endomembrane system|membrane|microtubule cytoskeleton	GTP-Rho binding				0			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			GCCCATGCTGCGGGCTGAGCC	0.711													12	36	---	---	---	---	PASS
CANT1	124583	broad.mit.edu	37	17	76989728	76989728	+	Silent	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76989728G>T	uc002jwn.2	-	6	1549	c.1110C>A	c.(1108-1110)GTC>GTA	p.V370V	CANT1_uc002jwk.2_Silent_p.V370V|CANT1_uc002jwj.2_Silent_p.V370V|CANT1_uc002jwl.2_Intron|CANT1_uc002jwm.1_RNA	NM_001159772	NP_001153244	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	370	Lumenal (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to membrane	calcium ion binding|nucleoside-diphosphatase activity|signal transducer activity				0			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			TGTAGGAGGCGACTCTGCCGC	0.567			T	ETV4	prostate						OREG0024788	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	47	75	---	---	---	---	PASS
MC5R	4161	broad.mit.edu	37	18	13826522	13826522	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13826522C>T	uc010xaf.1	+	1	758	c.758C>T	c.(757-759)CCG>CTG	p.P253L		NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor	253	Helical; Name=6; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)|lung(2)|breast(1)	6						TGCTGGGCCCCGTTCTTCCTT	0.572													13	233	---	---	---	---	PASS
DSC2	1824	broad.mit.edu	37	18	28659823	28659823	+	Silent	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28659823T>C	uc002kwl.3	-	11	2107	c.1653A>G	c.(1651-1653)GCA>GCG	p.A551A	DSC2_uc002kwk.3_Silent_p.A551A	NM_024422	NP_077740	Q02487	DSC2_HUMAN	desmocollin 2 isoform Dsc2a preproprotein	551	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	desmosome|integral to membrane	calcium ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			CTTGGTCTGATGCAAGGACTG	0.368													113	215	---	---	---	---	PASS
LIPG	9388	broad.mit.edu	37	18	47107935	47107935	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47107935G>A	uc002ldv.2	+	6	1196	c.944G>A	c.(943-945)CGT>CAT	p.R315H	LIPG_uc002ldu.1_Missense_Mutation_p.R315H|LIPG_uc010xdh.1_Missense_Mutation_p.R241H	NM_006033	NP_006024	Q9Y5X9	LIPE_HUMAN	endothelial lipase precursor	315					cholesterol homeostasis|high-density lipoprotein particle remodeling|phospholipid catabolic process|phospholipid homeostasis|positive regulation of cholesterol transport|positive regulation of high-density lipoprotein particle clearance|reverse cholesterol transport	extracellular space	heparin binding|lipoprotein lipase activity|phospholipase A1 activity|protein binding|triglyceride lipase activity			ovary(1)|skin(1)	2						CGCAAGAACCGTTGTAATAGC	0.478													85	118	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50278668	50278668	+	Silent	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50278668G>A	uc002lfe.1	+	2	923	c.336G>A	c.(334-336)GAG>GAA	p.E112E	DCC_uc010xdr.1_5'UTR	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	112	Extracellular (Potential).|Ig-like C2-type 1.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AGCCAGATGAGGGACTTTACC	0.413													47	109	---	---	---	---	PASS
SERPINB8	5271	broad.mit.edu	37	18	61654442	61654442	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61654442C>A	uc002ljv.2	+	7	1224	c.1055C>A	c.(1054-1056)CCT>CAT	p.P352H	SERPINB8_uc002lju.2_Missense_Mutation_p.P352H|SERPINB8_uc010xex.1_Missense_Mutation_p.P170H	NM_198833	NP_942130	P50452	SPB8_HUMAN	serine (or cysteine) proteinase inhibitor, clade	352					regulation of proteolysis	cytosol	protein binding|serine-type endopeptidase inhibitor activity			skin(1)	1		Esophageal squamous(42;0.129)				GCAGACCACCCTTTTCTTTTC	0.517													19	229	---	---	---	---	PASS
VAV1	7409	broad.mit.edu	37	19	6836984	6836984	+	Intron	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6836984C>T	uc002mfu.1	+						VAV1_uc010xjh.1_Intron|VAV1_uc010dva.1_Intron|VAV1_uc002mfv.1_Intron	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						TTTTTGTCTCCTGGGTGTTTA	0.458													59	134	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10602326	10602326	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10602326C>A	uc002moq.1	-	3	1408	c.1252G>T	c.(1252-1254)GTG>TTG	p.V418L	KEAP1_uc002mop.1_Missense_Mutation_p.V136L|KEAP1_uc002mor.1_Missense_Mutation_p.V418L	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	418	Kelch 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding	p.V418M(1)		lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			ATGACCCCCACCCCGATGCGG	0.662													12	28	---	---	---	---	PASS
LPHN1	22859	broad.mit.edu	37	19	14273821	14273821	+	Silent	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14273821G>A	uc010xnn.1	-	6	1103	c.807C>T	c.(805-807)GAC>GAT	p.D269D	LPHN1_uc010xno.1_Silent_p.D264D|uc002myf.2_Intron	NM_001008701	NP_001008701	O94910	LPHN1_HUMAN	latrophilin 1 isoform 1 precursor	269	Olfactomedin-like.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			ovary(2)|lung(2)|central_nervous_system(1)	5						CCACCGCCAGGTCAATGTCGG	0.617													30	42	---	---	---	---	PASS
DNAJB1	3337	broad.mit.edu	37	19	14627629	14627629	+	Silent	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14627629G>A	uc002myz.1	-	2	481	c.441C>T	c.(439-441)GGC>GGT	p.G147G	DNAJB1_uc010xnr.1_Silent_p.G47G	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	147					chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)		AGCGGGAGCGGCCAAAGTTCA	0.582													5	203	---	---	---	---	PASS
ZNF486	90649	broad.mit.edu	37	19	20278150	20278150	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20278150C>A	uc002nou.2	+	1	68	c.11C>A	c.(10-12)CCC>CAC	p.P4H		NM_052852	NP_443084	Q96H40	ZN486_HUMAN	zinc finger protein 486	4					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						ATGCCGGGACCCCTTAGAAGC	0.592													17	45	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30936608	30936608	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30936608C>G	uc002nsu.1	+	2	2277	c.2139C>G	c.(2137-2139)GAC>GAG	p.D713E	ZNF536_uc010edd.1_Missense_Mutation_p.D713E	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	713					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CCCAGGAGGACAGCCCGCACC	0.677													17	47	---	---	---	---	PASS
GPI	2821	broad.mit.edu	37	19	34884949	34884949	+	Missense_Mutation	SNP	G	A	A	rs137853583		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34884949G>A	uc002nvg.1	+	12	1143	c.1040G>A	c.(1039-1041)CGC>CAC	p.R347H	GPI_uc002nvf.2_Missense_Mutation_p.R386H|GPI_uc010xrv.1_Missense_Mutation_p.R358H|GPI_uc010xrw.1_Missense_Mutation_p.R319H|GPI_uc010edl.1_Missense_Mutation_p.R347H|GPI_uc002nvi.1_Missense_Mutation_p.R10H	NM_000175	NP_000166	P06744	G6PI_HUMAN	glucose phosphate isomerase	347			R -> H (in HA-GPID).|R -> C (in HA-GPID; GPI Mount Scopus).		angiogenesis|gluconeogenesis|glycolysis|hemostasis|humoral immune response	cytosol|extracellular space|nucleus|plasma membrane	cytokine activity|glucose-6-phosphate isomerase activity|growth factor activity			ovary(1)|kidney(1)	2	Esophageal squamous(110;0.162)					TACCTGCACCGCTTTGCTGCG	0.582													9	47	---	---	---	---	PASS
KIRREL2	84063	broad.mit.edu	37	19	36357069	36357069	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36357069A>G	uc002ocb.3	+	15	2014	c.1802A>G	c.(1801-1803)AAC>AGC	p.N601S	KIRREL2_uc002obz.3_Missense_Mutation_p.N601S|KIRREL2_uc002oca.3_Missense_Mutation_p.N551S|KIRREL2_uc002occ.3_Missense_Mutation_p.N548S|KIRREL2_uc002ocd.3_Missense_Mutation_p.N563S|APLP1_uc010xsz.1_5'Flank|APLP1_uc002oce.2_5'Flank|APLP1_uc002ocf.2_5'Flank|APLP1_uc002ocg.2_5'Flank	NM_199180	NP_954649	Q6UWL6	KIRR2_HUMAN	kin of IRRE-like 2 isoform c	601	Cytoplasmic (Potential).				cell adhesion	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GACCCAACCAACGGTTACTAC	0.592													82	183	---	---	---	---	PASS
CYP2F1	1572	broad.mit.edu	37	19	41627406	41627406	+	Silent	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41627406C>A	uc002opu.1	+	5	584	c.528C>A	c.(526-528)TCC>TCA	p.S176S	CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_Silent_p.S176S|CYP2F1_uc002opv.1_RNA	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,	176					naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						GCTCAGTGTCCAACATTATCT	0.522													70	151	---	---	---	---	PASS
GRIK5	2901	broad.mit.edu	37	19	42560809	42560809	+	Intron	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42560809C>T	uc002osj.1	-						GRIK5_uc010eib.1_Intron	NM_002088	NP_002079	Q16478	GRIK5_HUMAN	glutamate receptor KA2 precursor							cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity				0		Prostate(69;0.059)			L-Glutamic Acid(DB00142)	TATCTGTGTGCTCACCGCAGG	0.373													40	49	---	---	---	---	PASS
VRK3	51231	broad.mit.edu	37	19	50512642	50512642	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50512642C>G	uc002prg.2	-	4	238	c.140G>C	c.(139-141)GGC>GCC	p.G47A	VRK3_uc002prh.1_Missense_Mutation_p.G47A|VRK3_uc002pri.1_Intron|VRK3_uc010ens.2_Missense_Mutation_p.G47A|VRK3_uc010ybl.1_Intron|VRK3_uc010ybm.1_Intron|VRK3_uc002prj.1_Intron|VRK3_uc002prk.1_Missense_Mutation_p.G47A|VRK3_uc010ent.1_5'UTR|VRK3_uc002prl.2_Missense_Mutation_p.G47A|VRK3_uc010ybn.1_Missense_Mutation_p.G47A	NM_016440	NP_057524	Q8IV63	VRK3_HUMAN	vaccinia related kinase 3 isoform 1	47						nucleus	ATP binding|protein kinase activity			stomach(1)|skin(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		TCTCTTTGAGCCTAAAGAAAG	0.498													66	115	---	---	---	---	PASS
FCAR	2204	broad.mit.edu	37	19	55399650	55399650	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55399650T>A	uc002qhr.1	+	4	835	c.638T>A	c.(637-639)CTT>CAT	p.L213H	FCAR_uc002qhq.2_Missense_Mutation_p.L213H|FCAR_uc002qhs.1_Intron|FCAR_uc002qht.1_Intron|FCAR_uc010esi.1_Intron|FCAR_uc002qhu.1_Intron|FCAR_uc002qhv.1_Intron|FCAR_uc002qhw.1_Missense_Mutation_p.L201H|FCAR_uc002qhx.1_Intron|FCAR_uc002qhy.1_Intron|FCAR_uc002qhz.1_Intron|FCAR_uc002qia.1_Missense_Mutation_p.L104H	NM_002000	NP_001991	P24071	FCAR_HUMAN	Fc alpha receptor isoform a precursor	213	Extracellular (Potential).				immune response	extracellular region|integral to plasma membrane	IgA binding|receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0443)		GCCTTGGAGCTTGTGGTCACA	0.582													18	37	---	---	---	---	PASS
ZIM2	23619	broad.mit.edu	37	19	57286632	57286632	+	Silent	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57286632G>A	uc002qnr.2	-	11	1390	c.1008C>T	c.(1006-1008)ACC>ACT	p.T336T	uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_Silent_p.T132T|ZIM2_uc010ygr.1_Silent_p.T132T|ZIM2_uc002qnq.2_Silent_p.T336T|ZIM2_uc010etp.2_Silent_p.T336T|ZIM2_uc010ygs.1_Silent_p.T336T	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	336	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		GCGTACTAAAGGTTCGTTTGC	0.473													64	83	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57640572	57640572	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57640572G>T	uc002qny.2	+	4	885	c.529G>T	c.(529-531)GTA>TTA	p.V177L		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	177					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATCATCTGATGTACAGACAAA	0.368													81	117	---	---	---	---	PASS
NOP56	10528	broad.mit.edu	37	20	2638918	2638918	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2638918A>G	uc002wgh.2	+	12	1816	c.1763A>G	c.(1762-1764)CAT>CGT	p.H588R	NOP56_uc010zpy.1_RNA|NOP56_uc002wgi.2_Missense_Mutation_p.H422R|NOP56_uc002wgm.1_3'UTR	NM_006392	NP_006383	O00567	NOP56_HUMAN	nucleolar protein 5A	588	Lys-rich.				rRNA processing	box C/D snoRNP complex|pre-snoRNP complex	protein binding|snoRNA binding			ovary(1)|pancreas(1)	2						AAAAAGTTCCATAAAGCATCC	0.517													5	10	---	---	---	---	PASS
LRRN4	164312	broad.mit.edu	37	20	6022379	6022379	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6022379G>T	uc002wmo.2	-	5	1736	c.1512C>A	c.(1510-1512)CAC>CAA	p.H504Q		NM_152611	NP_689824	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4 precursor	504	Extracellular (Potential).					integral to membrane				skin(3)	3						GGGGTGTGGCGTGTGTCCTCT	0.647													85	244	---	---	---	---	PASS
NXT1	29107	broad.mit.edu	37	20	23334882	23334882	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23334882C>A	uc002wsx.1	+	2	591	c.204C>A	c.(202-204)AGC>AGA	p.S68R		NM_013248	NP_037380	Q9UKK6	NXT1_HUMAN	NTF2-like export factor 1	68	NTF2.					cytoplasm|nuclear pore				ovary(1)	1	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					TGCCTTCCAGCGAGTTCCAAA	0.507													19	189	---	---	---	---	PASS
TMEM90B	79953	broad.mit.edu	37	20	24523765	24523765	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24523765T>A	uc002wtw.1	+	2	665	c.32T>A	c.(31-33)CTG>CAG	p.L11Q		NM_024893	NP_079169	Q9H7V2	SYNG1_HUMAN	transmembrane protein 90B	11	Cytoplasmic (Potential).				response to biotic stimulus	early endosome membrane|integral to membrane|plasma membrane					0						AAGAGCATGCTGGTGCACAGT	0.507													18	205	---	---	---	---	PASS
ACSS1	84532	broad.mit.edu	37	20	25028754	25028754	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25028754T>G	uc002wub.2	-	2	1276	c.398A>C	c.(397-399)GAT>GCT	p.D133A	ACSS1_uc002wuc.2_Missense_Mutation_p.D133A|ACSS1_uc010gdc.2_Missense_Mutation_p.D133A	NM_032501	NP_115890	Q9NUB1	ACS2L_HUMAN	acyl-CoA synthetase short-chain family member 1	133					acetyl-CoA biosynthetic process|ethanol oxidation|xenobiotic metabolic process	mitochondrial matrix	acetate-CoA ligase activity|AMP binding|ATP binding|protein binding			ovary(1)|skin(1)	2					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	TCCAGGCTCATCGCGCTCCCA	0.562													25	43	---	---	---	---	PASS
SPATA2	9825	broad.mit.edu	37	20	48523097	48523097	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48523097A>C	uc010gie.2	-	3	972	c.622T>G	c.(622-624)TCG>GCG	p.S208A	SPATA2_uc002xuw.2_Missense_Mutation_p.S208A|SPATA2_uc010zyn.1_Missense_Mutation_p.S71A	NM_001135773	NP_001129245	Q9UM82	SPAT2_HUMAN	spermatogenesis associated 2	208					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|nucleus				central_nervous_system(1)|skin(1)	2	Hepatocellular(150;0.133)		BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			AGGGCGTCCGAGCAGCCGCGC	0.652													25	37	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57769016	57769016	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57769016G>T	uc002yan.2	+	1	2942	c.2942G>T	c.(2941-2943)GGG>GTG	p.G981V		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	981						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					TCATTTGTTGGGTCAGGACTG	0.642													61	82	---	---	---	---	PASS
KCNQ2	3785	broad.mit.edu	37	20	62065210	62065210	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62065210T>C	uc002yey.1	-	8	1247	c.1070A>G	c.(1069-1071)CAC>CGC	p.H357R	KCNQ2_uc002yez.1_Missense_Mutation_p.H357R|KCNQ2_uc002yfa.1_Missense_Mutation_p.H357R|KCNQ2_uc002yfb.1_Missense_Mutation_p.H357R|KCNQ2_uc011aax.1_Missense_Mutation_p.H357R|KCNQ2_uc002yfc.1_Missense_Mutation_p.H357R	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein	357	Cytoplasmic (Potential).				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	CCACGTGGAGTGCAGGTCTGT	0.622													57	88	---	---	---	---	PASS
SLC25A18	83733	broad.mit.edu	37	22	18065400	18065400	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18065400C>T	uc002zmp.1	+	6	765	c.271C>T	c.(271-273)CGG>TGG	p.R91W	SLC25A18_uc010gqx.2_Missense_Mutation_p.R91W|SLC25A18_uc002zmq.1_Missense_Mutation_p.R91W	NM_031481	NP_113669	Q9H1K4	GHC2_HUMAN	solute carrier	91	Solcar 1.					integral to membrane|mitochondrial inner membrane	binding|symporter activity				0				Lung(27;0.124)	L-Glutamic Acid(DB00142)	CTTTTTCCGGCGGCTGCTCAT	0.547													5	24	---	---	---	---	PASS
CCDC116	164592	broad.mit.edu	37	22	21989177	21989177	+	Silent	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21989177G>A	uc002zve.2	+	4	918	c.825G>A	c.(823-825)GAG>GAA	p.E275E	CCDC116_uc011aih.1_Silent_p.E275E	NM_152612	NP_689825	Q8IYX3	CC116_HUMAN	coiled-coil domain containing 116	275										ovary(1)|skin(1)	2	Colorectal(54;0.105)					TCAATAAGGAGATCAAGTCAT	0.602													40	232	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23114943	23114943	+	RNA	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23114943G>T	uc011aim.1	+	237		c.11560G>T								Parts of antibodies, mostly variable regions.												0						GATAGCAACCGGCCCTCAGGG	0.562													44	24	---	---	---	---	PASS
C22orf30	253143	broad.mit.edu	37	22	32108241	32108241	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32108241C>T	uc003alp.3	-	4	5777	c.5584G>A	c.(5584-5586)GGG>AGG	p.G1862R	C22orf30_uc003alo.1_Missense_Mutation_p.G1661R|C22orf30_uc010gwj.1_Missense_Mutation_p.G1661R	NM_173566	NP_775837	Q5THK1	PR14L_HUMAN	hypothetical protein LOC253143	1862											0						GACCGTAACCCTTTCAGGCCC	0.532													176	103	---	---	---	---	PASS
XRCC6	2547	broad.mit.edu	37	22	42018068	42018068	+	Silent	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42018068A>G	uc003bao.1	+	2	130	c.60A>G	c.(58-60)CAA>CAG	p.Q20Q	PPPDE2_uc003ban.1_5'Flank|PPPDE2_uc011apb.1_5'Flank|XRCC6_uc003bap.1_Silent_p.Q20Q|XRCC6_uc011apc.1_Missense_Mutation_p.K8R|XRCC6_uc003baq.1_Silent_p.Q20Q|XRCC6_uc003bar.1_Silent_p.Q20Q|XRCC6_uc003bas.1_Missense_Mutation_p.K8R	NM_001469	NP_001460	P12956	XRCC6_HUMAN	ATP-dependent DNA helicase II, 70 kDa subunit	20	Asp/Glu-rich (acidic).|Ser-rich (potentially targets for phosphorylation).			Q -> D (in Ref. 8; AA sequence).	DNA ligation|double-strand break repair via nonhomologous end joining|initiation of viral infection|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|provirus integration|telomere maintenance|transcription, DNA-dependent	DNA-dependent protein kinase-DNA ligase 4 complex|Ku70:Ku80 complex|membrane fraction|nuclear telomere cap complex|transcription factor complex	5'-deoxyribose-5-phosphate lyase activity|ATP binding|ATP-dependent DNA helicase activity|double-stranded DNA binding|protein C-terminus binding|transcription regulatory region DNA binding			skin(2)|ovary(1)|lung(1)|kidney(1)	5						AGGAAGAACAAGAAGAGAACC	0.478								Direct_reversal_of_damage|NHEJ					30	70	---	---	---	---	PASS
MXRA5	25878	broad.mit.edu	37	X	3242456	3242456	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3242456G>T	uc004crg.3	-	5	1427	c.1270C>A	c.(1270-1272)CAG>AAG	p.Q424K		NM_015419	NP_056234	Q9NR99	MXRA5_HUMAN	adlican precursor	424						extracellular region				ovary(5)|lung(1)|central_nervous_system(1)|skin(1)	8		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCAAGAATCTGGGCTCTCACA	0.512													68	35	---	---	---	---	PASS
FTHL17	53940	broad.mit.edu	37	X	31089811	31089811	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31089811C>A	uc004dcl.1	-	1	363	c.260G>T	c.(259-261)AGG>ATG	p.R87M		NM_031894	NP_114100	Q9BXU8	FHL17_HUMAN	ferritin, heavy polypeptide-like 17	87	Ferritin-like diiron.				cellular iron ion homeostasis|iron ion transport		ferric iron binding|oxidoreductase activity				0						CTCTGGCTTCCTGATATCGTG	0.602													56	25	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138680615	138680615	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138680615A>G	uc004fau.2	-	17	2173	c.1879T>C	c.(1879-1881)TAT>CAT	p.Y627H	MCF2_uc004fav.2_Missense_Mutation_p.Y643H|MCF2_uc011mwl.1_Missense_Mutation_p.Y604H|MCF2_uc010nsh.1_Missense_Mutation_p.Y627H|MCF2_uc011mwm.1_Missense_Mutation_p.Y588H|MCF2_uc011mwn.1_Missense_Mutation_p.Y772H|MCF2_uc004faw.2_Missense_Mutation_p.Y687H|MCF2_uc011mwo.1_Missense_Mutation_p.Y703H	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	627	DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					TTGAGTAAATAGGAATCCAGT	0.284													32	11	---	---	---	---	PASS
SLITRK4	139065	broad.mit.edu	37	X	142716936	142716936	+	Silent	SNP	G	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142716936G>T	uc004fbx.2	-	2	2365	c.1989C>A	c.(1987-1989)TCC>TCA	p.S663S	SLITRK4_uc004fby.2_Silent_p.S663S	NM_173078	NP_775101	Q8IW52	SLIK4_HUMAN	slit and trk like 4 protein precursor	663	Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|large_intestine(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					GCAGCTGCATGGAGCCACAGT	0.458													194	55	---	---	---	---	PASS
UBE2NL	389898	broad.mit.edu	37	X	142967583	142967583	+	Silent	SNP	G	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142967583G>A	uc004fca.2	+	1	411	c.381G>A	c.(379-381)GTG>GTA	p.V127V		NM_001012989	NP_001013007	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like	127							acid-amino acid ligase activity				0	Acute lymphoblastic leukemia(192;6.56e-05)					ATGATGTAGTGGAGCAGTGGA	0.448													118	16	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27094433	27094440	+	Frame_Shift_Del	DEL	ACCTCTGG	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27094433_27094440delACCTCTGG	uc001bmv.1	+	11	3514_3521	c.3141_3148delACCTCTGG	c.(3139-3150)AAACCTCTGGACfs	p.K1047fs	ARID1A_uc001bmt.1_Frame_Shift_Del_p.K1047fs|ARID1A_uc001bmu.1_Frame_Shift_Del_p.K1047fs|ARID1A_uc001bmw.1_Frame_Shift_Del_p.K664fs	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1047_1050	ARID.				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding			ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TGGGTAGGAAACCTCTGGACCTCTATCG	0.553			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								77	39	---	---	---	---	
HDAC1	3065	broad.mit.edu	37	1	32768066	32768067	+	Intron	DEL	TC	-	-	rs74064094		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32768066_32768067delTC	uc001bvb.1	+						HDAC1_uc010ohd.1_Intron|HDAC1_uc010ohe.1_Intron|HDAC1_uc010ohf.1_Intron	NM_004964	NP_004955	Q13547	HDAC1_HUMAN	histone deacetylase 1						anti-apoptosis|blood coagulation|embryonic digit morphogenesis|epidermal cell differentiation|eyelid development in camera-type eye|fungiform papilla formation|hair follicle placode formation|histone H3 deacetylation|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of androgen receptor signaling pathway|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|odontogenesis of dentine-containing tooth|positive regulation of cell proliferation|positive regulation of receptor biosynthetic process|positive regulation of transcription from RNA polymerase II promoter	cytosol|NuRD complex|Sin3 complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|identical protein binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|RNA polymerase II transcription corepressor activity|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|breast(1)	3		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	TTTTTTTTTTTCTTTTGGAGTT	0.426													4	2	---	---	---	---	
EIF2B3	8891	broad.mit.edu	37	1	45323200	45323200	+	Intron	DEL	A	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45323200delA	uc001cmt.1	-						EIF2B3_uc001cmu.1_Intron|EIF2B3_uc001cmv.1_Intron	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,						negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					tgaaactccgaaaaaaaaaaa	0.000													9	5	---	---	---	---	
HSD3B2	3284	broad.mit.edu	37	1	119981531	119981532	+	Intron	DEL	TT	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119981531_119981532delTT	uc001ehu.2	+									P26439	3BHS2_HUMAN	RecName: Full=3 beta-hydroxysteroid dehydrogenase/Delta 5-->4-isomerase type 2; AltName: Full=3-beta-HSD II; Includes:   RecName: Full=3-beta-hydroxy-Delta(5)-steroid dehydrogenase;            EC=1.1.1.145;   AltName: Full=3-beta-hydroxy-5-ene steroid dehydrogenase;   AltName: Full=Progesterone reductase; Includes:   RecName: Full=Steroid Delta-isomerase;            EC=5.3.3.1;   AltName: Full=Delta-5-3-ketosteroid isomerase;						androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	NADH(DB00157)|Trilostane(DB01108)	CTGATCTCCCTTTTTAGCCCTC	0.441													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144612481	144612482	+	5'Flank	INS	-	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144612481_144612482insC	uc009wig.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_5'Flank|NBPF9_uc010oyf.1_5'Flank|NBPF9_uc010oyg.1_5'Flank|NBPF9_uc009wii.1_5'Flank|NBPF9_uc009wif.1_Intron|C1orf152_uc001elf.3_RNA	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						TATATTTCTGGCCCCCCAGTGT	0.545													3	3	---	---	---	---	
PRPF3	9129	broad.mit.edu	37	1	150315725	150315728	+	Intron	DEL	ATAT	-	-	rs140838431		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150315725_150315728delATAT	uc001eum.3	+						PRPF3_uc009wlp.2_Intron|PRPF3_uc010pca.1_Intron|PRPF3_uc010pcb.1_Intron|PRPF3_uc009wlq.1_Intron	NM_004698	NP_004689	O43395	PRPF3_HUMAN	PRP3 pre-mRNA processing factor 3 homolog						nuclear mRNA splicing, via spliceosome	Cajal body|cytoplasm|nuclear speck|spliceosomal complex	protein binding			ovary(1)	1	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		aaaaaaaaaaaTATATATATATAT	0.167													6	5	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	154100029	154100029	+	Intron	DEL	C	-	-	rs10531787		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154100029delC	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			AAAGTAGGttctttttttttt	0.149													4	2	---	---	---	---	
DPT	1805	broad.mit.edu	37	1	168694492	168694492	+	Intron	DEL	T	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168694492delT	uc001gfp.2	-							NM_001937	NP_001928	Q07507	DERM_HUMAN	dermatopontin precursor						cell adhesion	extracellular space|proteinaceous extracellular matrix				ovary(1)	1	all_hematologic(923;0.208)					ctttcctttctctttcccttc	0.080													4	3	---	---	---	---	
C1orf124	83932	broad.mit.edu	37	1	231475793	231475794	+	Intron	INS	-	A	A	rs3071954		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231475793_231475794insA	uc001hur.2	+						EXOC8_uc001huq.2_5'Flank|C1orf124_uc001hus.2_Intron|C1orf124_uc001hut.2_Intron	NM_032018	NP_114407	Q9H040	CA124_HUMAN	hypothetical protein LOC83932 isoform a						DNA repair	nuclear speck	DNA binding|metal ion binding				0	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				TGCTTCATAGTAAAAAAAAAAA	0.203													9	4	---	---	---	---	
TARBP1	6894	broad.mit.edu	37	1	234608725	234608726	+	Intron	INS	-	TT	TT	rs141043621	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234608725_234608726insTT	uc001hwd.2	-							NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1						regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TCAGAGGGAGATTTTTTTTTGC	0.257													7	5	---	---	---	---	
CNST	163882	broad.mit.edu	37	1	246797049	246797049	+	Intron	DEL	A	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246797049delA	uc001ibp.2	+						CNST_uc001ibo.3_Intron	NM_152609	NP_689822	Q6PJW8	CNST_HUMAN	hypothetical protein LOC163882 isoform 1						positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0						catctcaaggaaaaaaaaaaa	0.100													4	2	---	---	---	---	
SLC30A6	55676	broad.mit.edu	37	2	32429880	32429881	+	Intron	INS	-	T	T	rs71407425		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32429880_32429881insT	uc002roe.1	+						SLC30A6_uc002rof.1_Intron|SLC30A6_uc010ymw.1_Intron|SLC30A6_uc010ezr.1_Intron|SLC30A6_uc002rog.1_Intron|SLC30A6_uc010ezs.1_Intron|SLC30A6_uc002roh.1_Intron	NM_017964	NP_060434	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter),							Golgi membrane|integral to membrane	zinc ion transmembrane transporter activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					tttaattttaattttttttttt	0.124													4	2	---	---	---	---	
ABCG8	64241	broad.mit.edu	37	2	44101417	44101418	+	Intron	INS	-	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44101417_44101418insA	uc002rtq.2	+						ABCG8_uc010yoa.1_Intron	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8						cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TGTGCCTATTTAAAAAAAAAAA	0.342													35	17	---	---	---	---	
ZAK	51776	broad.mit.edu	37	2	174131512	174131512	+	3'UTR	DEL	A	-	-	rs72218266		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174131512delA	uc002uhz.2	+	20					uc002uib.2_Intron	NM_016653	NP_057737	Q9NYL2	MLTK_HUMAN	MLK-related kinase isoform 1						activation of JUN kinase activity|activation of MAPKK activity|cell cycle arrest|cell death|cell differentiation|cell proliferation|DNA damage checkpoint|positive regulation of apoptosis|response to radiation	cytoplasm|nucleus	ATP binding|identical protein binding|magnesium ion binding|MAP kinase kinase kinase activity|protein binding			lung(3)|stomach(1)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.176)			TAAGCAGGTTAAAAAAAAAAA	0.358													6	3	---	---	---	---	
ACSL3	2181	broad.mit.edu	37	2	223782683	223782684	+	Intron	INS	-	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223782683_223782684insT	uc002vni.2	+						ACSL3_uc002vnj.2_Intron	NM_004457	NP_004448	O95573	ACSL3_HUMAN	acyl-CoA synthetase long-chain family member 3						long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|fatty-acyl-CoA synthase activity|long-chain fatty acid-CoA ligase activity|protein binding			ovary(2)	2		Renal(207;0.0183)		Epithelial(121;1.28e-10)|all cancers(144;8.06e-08)|Lung(261;0.00834)|LUSC - Lung squamous cell carcinoma(224;0.00864)	Icosapent(DB00159)	ATGCGTTATTATGATTCATCTC	0.317			T	ETV1	prostate								25	49	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242433012	242433013	+	Intron	INS	-	T	T	rs113589065		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242433012_242433013insT	uc002wbi.1	+							NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GCAATGCtttgttttttttttt	0.243													3	3	---	---	---	---	
XCR1	2829	broad.mit.edu	37	3	46065706	46065707	+	Intron	INS	-	A	A	rs35174940		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46065706_46065707insA	uc003cpe.2	-						XCR1_uc003cpf.2_Intron	NM_005283	NP_005274	P46094	XCR1_HUMAN	XC chemokine receptor 1						chemotaxis|G-protein signaling, coupled to cyclic nucleotide second messenger|inflammatory response	integral to plasma membrane	chemokine receptor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GTTAATCCAGCAAAAAAAAAAA	0.391													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	83790732	83790733	+	IGR	INS	-	GGAG	GGAG	rs13089076		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:83790732_83790733insGGAG								None (None upstream) : None (None downstream)																							aaggaaggaaaggagggaggga	0.089													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	165975360	165975361	+	IGR	INS	-	GTGTGT	GTGTGT	rs114686737	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165975360_165975361insGTGTGT								BCHE (420107 upstream) : ZBBX (982720 downstream)																							acacACtgtgcgtgtgtgtgtg	0.079													5	3	---	---	---	---	
NSUN2	54888	broad.mit.edu	37	5	6610179	6610179	+	Intron	DEL	T	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6610179delT	uc003jdu.2	-						NSUN2_uc003jdt.2_Intron|NSUN2_uc011cmk.1_Intron|NSUN2_uc003jdv.2_Intron	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2							cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1						TAAACTTAAAttttttttttt	0.164													4	2	---	---	---	---	
TRPC7	57113	broad.mit.edu	37	5	135583575	135583594	+	Intron	DEL	CCCTCTTGGAATGTGCTGGA	-	-	rs75204588	byFrequency	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135583575_135583594delCCCTCTTGGAATGTGCTGGA	uc003lbn.1	-						TRPC7_uc010jef.1_Intron|TRPC7_uc010jeg.1_Intron|TRPC7_uc010jeh.1_Intron|TRPC7_uc010jei.1_Intron|TRPC7_uc010jej.1_Intron	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,						axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTGCCACCCTCCCTcttggaatgtgctggaccatctgcct	0.205													2	5	---	---	---	---	
KCTD16	57528	broad.mit.edu	37	5	143586805	143586806	+	Frame_Shift_Ins	INS	-	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143586805_143586806insT	uc003lnm.1	+	3	1157_1158	c.528_529insT	c.(526-531)TTGGGCfs	p.L176fs	KCTD16_uc003lnn.1_Frame_Shift_Ins_p.L176fs	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	potassium channel tetramerisation domain	176_177						cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(2)|ovary(1)|skin(1)	4		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			CCTGCACCTTGGGCAGAGAGGG	0.530													39	60	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	174170409	174170410	+	IGR	INS	-	CCTT	CCTT			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174170409_174170410insCCTT								MSX2 (12508 upstream) : DRD1 (697266 downstream)																							cccttccttccccttccttcct	0.000													4	2	---	---	---	---	
TSPAN17	26262	broad.mit.edu	37	5	176082912	176082912	+	Intron	DEL	C	-	-	rs6897431	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176082912delC	uc003met.2	+						TSPAN17_uc003mes.3_Intron|TSPAN17_uc003meu.2_Intron|TSPAN17_uc003mev.2_Intron|TSPAN17_uc003mew.2_Intron	NM_012171	NP_036303	Q96FV3	TSN17_HUMAN	transmembrane 4 superfamily member 17 isoform a							integral to membrane|ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			aaaaaaaaaacaaaaGCACAT	0.284													7	5	---	---	---	---	
C6orf218	221718	broad.mit.edu	37	6	10430699	10430699	+	Intron	DEL	T	-	-	rs139837855		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10430699delT	uc003myz.2	-							NR_027793				Homo sapiens chromosome 6 open reading frame 218, mRNA (cDNA clone IMAGE:3917693).												0	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.124)				CTCTGACTAGttttttttttt	0.204													8	4	---	---	---	---	
VPS52	6293	broad.mit.edu	37	6	33219118	33219119	+	Intron	INS	-	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33219118_33219119insA	uc003odm.1	-						VPS52_uc003odn.1_Intron	NM_022553	NP_072047	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52						protein transport	endosome membrane|Golgi apparatus				ovary(4)|skin(1)	5						gactctgtctcaaaaaaaaaac	0.158													4	2	---	---	---	---	
SLC26A8	116369	broad.mit.edu	37	6	35928440	35928441	+	Intron	INS	-	A	A	rs68027857		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35928440_35928441insA	uc003olm.2	-						SLC26A8_uc010jwa.2_Intron|SLC26A8_uc003olk.2_Intron|SLC26A8_uc003oln.2_Intron|SLC26A8_uc003oll.2_Intron	NM_052961	NP_443193	Q96RN1	S26A8_HUMAN	solute carrier family 26, member 8 isoform a						cell differentiation|meiosis|multicellular organismal development|spermatogenesis	integral to membrane|plasma membrane	anion:anion antiporter activity|chloride channel activity|oxalate transmembrane transporter activity|protein binding|sulfate transmembrane transporter activity			ovary(2)	2						actctgtctccaaaaaaaaaaa	0.183													7	4	---	---	---	---	
TREML2P1	221438	broad.mit.edu	37	6	41215250	41215250	+	5'Flank	DEL	C	-	-	rs142836532	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41215250delC	uc003oqe.1	+							NR_002794				Homo sapiens TREM-like transcript 5 (TLT5) pseudogene mRNA, partial sequence.												0						CACCCTGGATCCCCCGGGTGC	0.647													4	2	---	---	---	---	
FAM83B	222584	broad.mit.edu	37	6	54792444	54792445	+	Intron	INS	-	T	T			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54792444_54792445insT	uc003pck.2	+							NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584											ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					AGATCATTGTGTTTAACTTCAG	0.267													80	97	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	116774144	116774145	+	IGR	INS	-	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116774144_116774145insA								DSE (14704 upstream) : FAM26F (8411 downstream)																							tttatatatattataaatatat	0.267													3	3	---	---	---	---	
ACAT2	39	broad.mit.edu	37	6	160199454	160199455	+	Intron	DEL	TT	-	-	rs71808548		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160199454_160199455delTT	uc010kjy.2	+						ACAT2_uc011efw.1_Intron	NM_005891	NP_005882	Q9BWD1	THIC_HUMAN	acetyl-Coenzyme A acetyltransferase 2							mitochondrion|nucleolus	acetyl-CoA C-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CTTCCCAAGGTTTaaaaaaaaa	0.317													3	4	---	---	---	---	
AKR1B15	441282	broad.mit.edu	37	7	134256580	134256581	+	Intron	DEL	CT	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134256580_134256581delCT	uc011kpr.1	+						AKR1B15_uc011kps.1_Intron	NM_001080538	NP_001074007	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15								oxidoreductase activity			ovary(1)	1						TCCTCATCACCTTTGGCTTTTG	0.386													23	11	---	---	---	---	
RP1L1	94137	broad.mit.edu	37	8	10479831	10479832	+	Intron	INS	-	A	A	rs139704386	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10479831_10479832insA	uc003wtc.2	-							NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1						intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		actccatctcgaaaaaaacaaa	0.153													5	3	---	---	---	---	
SLC18A1	6570	broad.mit.edu	37	8	20007084	20007087	+	Intron	DEL	TCTC	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20007084_20007087delTCTC	uc011kyq.1	-						SLC18A1_uc003wzl.2_Intron|SLC18A1_uc003wzm.2_Intron|SLC18A1_uc011kyr.1_Intron|SLC18A1_uc003wzn.2_Intron|SLC18A1_uc010ltf.2_Intron|SLC18A1_uc003wzo.2_Intron	NM_001135691	NP_001129163	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine),						neurotransmitter transport	clathrin sculpted monoamine transport vesicle membrane|integral to membrane|membrane fraction	drug transmembrane transporter activity|monoamine transmembrane transporter activity			ovary(2)	2				Colorectal(74;0.0747)		TCTGTGtctttctctctctctctc	0.265													8	4	---	---	---	---	
RGS22	26166	broad.mit.edu	37	8	101084648	101084648	+	Intron	DEL	T	-	-	rs34914779		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101084648delT	uc003yjb.1	-						RGS22_uc003yja.1_Intron|RGS22_uc003yjc.1_Intron|RGS22_uc011lgz.1_5'Flank|RGS22_uc010mbo.1_Intron	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CCCTGGTACGTTtttaattct	0.269													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138016583	138016586	+	IGR	DEL	AAGG	-	-	rs72035885	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138016583_138016586delAAGG								OLFM1 (3552 upstream) : KIAA0649 (355062 downstream)																							gaaagaaagaaaggaaggaaggaa	0.216													4	4	---	---	---	---	
CAMSAP1	157922	broad.mit.edu	37	9	138718041	138718042	+	Intron	DEL	CA	-	-	rs60377963		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138718041_138718042delCA	uc004cgr.3	-						CAMSAP1_uc004cgq.3_Intron|CAMSAP1_uc010nbg.2_Intron	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein							cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CGGGCACCAGcacacacacaca	0.550													3	3	---	---	---	---	
CPN1	1369	broad.mit.edu	37	10	101829238	101829238	+	Intron	DEL	A	-	-	rs72232234		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101829238delA	uc001kql.2	-							NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor						proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		actctgtcttaaaaaaaaaaa	0.164													4	2	---	---	---	---	
RCN1	5954	broad.mit.edu	37	11	32072954	32072957	+	Intron	DEL	AGGG	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32072954_32072957delAGGG	uc010rea.1	+							NM_002901	NP_002892	Q15293	RCN1_HUMAN	reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)					gaaggaaggaagggaaggactata	0.000													4	2	---	---	---	---	
MOGAT2	80168	broad.mit.edu	37	11	75438533	75438533	+	Frame_Shift_Del	DEL	C	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75438533delC	uc010rru.1	+	3	324	c.324delC	c.(322-324)CACfs	p.H108fs	MOGAT2_uc001oww.1_Frame_Shift_Del_p.H108fs|MOGAT2_uc010rrv.1_Frame_Shift_Del_p.H26fs	NM_025098	NP_079374	Q3SYC2	MOGT2_HUMAN	monoacylglycerol O-acyltransferase 2	108	Helical; (Potential).				glycerol metabolic process	endoplasmic reticulum membrane|integral to membrane	2-acylglycerol O-acyltransferase activity			ovary(2)	2	Ovarian(111;0.103)					CGGGCTTCCACCCCCATGGAG	0.527													117	60	---	---	---	---	
PLCZ1	89869	broad.mit.edu	37	12	18892246	18892246	+	5'Flank	DEL	C	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18892246delC	uc010sid.1	-						PLCZ1_uc001rdv.3_5'Flank|PLCZ1_uc001rdw.3_5'Flank	NM_033123	NP_149114	Q86YW0	PLCZ1_HUMAN	phospholipase C, zeta 1						intracellular signal transduction|lipid catabolic process|multicellular organismal development	nucleus|perinuclear region of cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					AGTAATTTTACTTGGGGAATA	0.338													26	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	40842476	40842477	+	IGR	INS	-	C	C			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40842476_40842477insC								LRRK2 (79392 upstream) : CNTN1 (243881 downstream)																							cttccttccttcttctttcctt	0.050													14	10	---	---	---	---	
MON2	23041	broad.mit.edu	37	12	62978905	62978905	+	Intron	DEL	C	-	-	rs7299795		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62978905delC	uc001sre.2	+						MON2_uc009zqj.2_Intron|MON2_uc010ssl.1_Intron|MON2_uc010ssm.1_Intron|MON2_uc010ssn.1_Intron|MON2_uc001srf.2_Intron|MON2_uc001srg.2_Intron	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog						Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		caaaaaaaaacaaaaaaaaaa	0.000													2	4	---	---	---	---	
PSPC1	55269	broad.mit.edu	37	13	20279633	20279634	+	Intron	INS	-	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20279633_20279634insA	uc001uml.2	-						PSPC1_uc001umj.1_Intron|PSPC1_uc001umk.1_Intron	NM_001042414	NP_001035879	Q8WXF1	PSPC1_HUMAN	paraspeckle protein 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleolus	nucleotide binding|protein binding|RNA binding			breast(1)	1		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		ctctctgtctcaaaaaaaaaaa	0.129													9	4	---	---	---	---	
SPATA13	221178	broad.mit.edu	37	13	24853088	24853089	+	Intron	INS	-	TCTT	TCTT	rs150971730	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24853088_24853089insTCTT	uc001upg.1	+						SPATA13_uc001upd.1_Intron|C1QTNF9_uc001upe.2_Intron|SPATA13_uc010tcy.1_Intron|SPATA13_uc010tcz.1_Intron|SPATA13_uc010tda.1_Intron|SPATA13_uc001uph.2_Intron|SPATA13_uc010tdb.1_Intron	NM_153023	NP_694568	Q96N96	SPT13_HUMAN	spermatogenesis associated 13						cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		ccttccttccctccttccttcc	0.040													8	4	---	---	---	---	
LRCH1	23143	broad.mit.edu	37	13	47256071	47256072	+	Intron	INS	-	TGTG	TGTG	rs151080336	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:47256071_47256072insTGTG	uc001vbj.2	+						LRCH1_uc010acp.2_Intron|LRCH1_uc001vbk.2_Intron|LRCH1_uc001vbl.3_Intron	NM_015116	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH)											ovary(1)|central_nervous_system(1)	2		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GGGTCGATCTTtgtgtgtgtgt	0.292													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19408019	19408019	+	IGR	DEL	A	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19408019delA								OR11H12 (29447 upstream) : POTEG (145346 downstream)																							CTGTGGAGCCAAAAAAAAAAT	0.393													6	3	---	---	---	---	
PNN	5411	broad.mit.edu	37	14	39645922	39645922	+	Intron	DEL	C	-	-	rs67767907		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39645922delC	uc001wuw.3	+							NM_002687	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein						cell adhesion|regulation of transcription, DNA-dependent|transcription, DNA-dependent	catalytic step 2 spliceosome|desmosome|intermediate filament|nuclear speck	DNA binding|protein binding|structural molecule activity			ovary(1)	1	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		CCACTCCCTGCCCCCCCCAAG	0.368													3	3	---	---	---	---	
LRFN5	145581	broad.mit.edu	37	14	42373608	42373608	+	3'UTR	DEL	T	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42373608delT	uc001wvm.2	+	6					LRFN5_uc010ana.2_3'UTR	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III							integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CCTACAAGTATTTTTTTTTTA	0.358										HNSCC(30;0.082)			4	2	---	---	---	---	
ATXN3	4287	broad.mit.edu	37	14	92548994	92548996	+	Intron	DEL	TTT	-	-	rs34366039		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92548994_92548996delTTT	uc001yac.3	-						ATXN3_uc010aug.2_Intron|ATXN3_uc001yad.3_Intron|ATXN3_uc010auh.2_Intron|ATXN3_uc001yae.3_Intron|ATXN3_uc010twl.1_Intron	NM_004993	NP_004984	P54252	ATX3_HUMAN	ataxin 3 reference isoform						cell death|nervous system development|nucleotide-excision repair|regulation of transcription, DNA-dependent|synaptic transmission|transcription, DNA-dependent	cytoplasm|nuclear matrix|nucleoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		tttccgtttcttttttttttttt	0.113													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98480465	98480470	+	IGR	DEL	TCTTTC	-	-	rs72290183		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98480465_98480470delTCTTTC								C14orf64 (36004 upstream) : C14orf177 (697480 downstream)																							ttccttcctttctttctctttctttc	0.000													4	2	---	---	---	---	
ZNF609	23060	broad.mit.edu	37	15	64937304	64937305	+	Intron	INS	-	CCTT	CCTT	rs7163358	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64937304_64937305insCCTT	uc002ann.2	+							NM_015042	NP_055857	O15014	ZN609_HUMAN	zinc finger protein 609							nucleus	zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						ctccctccctcccttccttcct	0.000													2	4	---	---	---	---	
BLM	641	broad.mit.edu	37	15	91303187	91303187	+	Intron	DEL	T	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91303187delT	uc002bpr.2	+						BLM_uc010uqh.1_Intron|BLM_uc010uqi.1_Intron|BLM_uc010bnx.2_Intron|BLM_uc002bps.1_5'Flank	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein						double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			ATCTTAAGACttttttttttt	0.040			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97610889	97610896	+	IGR	DEL	TTCCTTCT	-	-	rs72438368		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97610889_97610896delTTCCTTCT								SPATA8 (282045 upstream) : LOC91948 (674950 downstream)																							GGCATCACGAttccttctttccttcctt	0.067													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46409653	46409656	+	IGR	DEL	TTCA	-	-	rs112162925		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46409653_46409656delTTCA								None (None upstream) : ANKRD26P1 (93593 downstream)																							tccattcgatttcattcaatgatt	0.000													6	3	---	---	---	---	
PDPR	55066	broad.mit.edu	37	16	70154770	70154771	+	Intron	INS	-	T	T	rs141843737	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70154770_70154771insT	uc002eyf.1	+						CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Intron	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory						glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		CCTGAATTTTGTTTAAGGATGA	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87255956	87255957	+	Intron	INS	-	CAT	CAT			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87255956_87255957insCAT	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		atcaccaccaccaccatcatca	0.000													4	2	---	---	---	---	
TBX2	6909	broad.mit.edu	37	17	59482166	59482166	+	Intron	DEL	C	-	-	rs66504335		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59482166delC	uc010wox.1	+						TBX2_uc002ize.2_Frame_Shift_Del_p.R353fs|TBX2_uc002izg.2_Intron	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2						cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0						AGGGAGGTGGCGGCGGGGGGT	0.706													3	4	---	---	---	---	
MYOM1	8736	broad.mit.edu	37	18	3085192	3085192	+	Intron	DEL	T	-	-	rs148266515		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3085192delT	uc002klp.2	-						MYOM1_uc002klq.2_Intron	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a							striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5						GTATCTGTGATTTTTTTTTTT	0.294													7	8	---	---	---	---	
VPS4B	9525	broad.mit.edu	37	18	61078577	61078577	+	Intron	DEL	T	-	-	rs76661872		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61078577delT	uc002lix.2	-						VPS4B_uc010dpx.2_Intron|VPS4B_uc010dpy.2_Intron|VPS4B_uc010dpz.1_Intron	NM_004869	NP_004860	O75351	VPS4B_HUMAN	vacuolar protein sorting factor 4B						cell cycle|cell division|cellular membrane organization|endosome to lysosome transport via multivesicular body sorting pathway|intracellular cholesterol transport|protein transport|response to lipid	cytosol|early endosome|late endosome membrane|lysosome|nucleus|vacuolar membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding			ovary(1)	1						AAGTGGAGTATTTTTTTTTTT	0.249													5	3	---	---	---	---	
BIRC7	79444	broad.mit.edu	37	20	61869462	61869463	+	Intron	INS	-	CTT	CTT			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61869462_61869463insCTT	uc002yej.2	+						BIRC7_uc010gkc.1_Intron|BIRC7_uc002yei.2_Intron|hsa-mir-3196|MI0014241_5'Flank	NM_139317	NP_647478	Q96CA5	BIRC7_HUMAN	livin inhibitor of apoptosis isoform alpha						activation of JUN kinase activity|anti-apoptosis|DNA fragmentation involved in apoptotic nuclear change	cytoplasm|nucleus	enzyme binding|zinc ion binding			ovary(1)|lung(1)|kidney(1)	3	all_cancers(38;2.72e-09)					TGGCCCCACAGGGCACTGGGGA	0.678													7	7	---	---	---	---	
RNF160	26046	broad.mit.edu	37	21	30341544	30341545	+	Intron	INS	-	A	A			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30341544_30341545insA	uc002ymr.2	-						RNF160_uc010gll.1_Intron	NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294								ligase activity|zinc ion binding				0						aactttgtctcaaaaaaaaaaG	0.168													2	4	---	---	---	---	
FAM3B	54097	broad.mit.edu	37	21	42720756	42720756	+	Intron	DEL	T	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42720756delT	uc002yzb.1	+						FAM3B_uc002yza.2_Intron|FAM3B_uc002yzc.1_Intron|FAM3B_uc002yzd.1_Intron	NM_058186	NP_478066	P58499	FAM3B_HUMAN	family with sequence similarity 3, member B						apoptosis|insulin secretion	extracellular space	cytokine activity				0		Prostate(19;1.57e-07)|all_epithelial(19;0.0404)				AACATAAGAGTTGTGTCAGCT	0.413													9	22	---	---	---	---	
DNMT3L	29947	broad.mit.edu	37	21	45666582	45666582	+	Intron	DEL	C	-	-	rs72021582		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45666582delC	uc002zeg.1	-						DNMT3L_uc002zeh.1_Intron	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein						DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		GTGCCTAAGACCCCCCCCCCG	0.672													6	4	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26272008	26272013	+	Intron	DEL	TGTGTA	-	-	rs67758673		TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26272008_26272013delTGTGTA	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						tgtgtgtgtgtgtgtatgtgtTTTAA	0.369													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39962238	39962239	+	IGR	INS	-	TGA	TGA			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39962238_39962239insTGA								RPS19BP1 (33378 upstream) : CACNA1I (4519 downstream)																							gataatgatggtgctggtgttg	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	6451611	6451614	+	IGR	DEL	CCCT	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:6451611_6451614delCCCT								NLGN4X (304905 upstream) : VCX3A (46 downstream)																							acctcttcccccctccctccctcc	0.181													1	5	---	---	---	---	
CTPS2	56474	broad.mit.edu	37	X	16711326	16711354	+	Splice_Site	DEL	TTTGTTCTCCGGTAGCACTGAGCTGAAAA	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16711326_16711354delTTTGTTCTCCGGTAGCACTGAGCTGAAAA	uc004cxk.2	-	6	1300	c.556_splice	c.e6-1	p.L186_splice	CTPS2_uc004cxl.2_Splice_Site_p.L186_splice|CTPS2_uc004cxm.2_Splice_Site_p.L186_splice	NM_001144002	NP_001137474	Q9NRF8	PYRG2_HUMAN	cytidine triphosphate synthase II						glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine nucleotide biosynthetic process	cytosol	ATP binding|CTP synthase activity			ovary(1)	1	Hepatocellular(33;0.0997)					GGTTTGGTTTTTTGTTCTCCGGTAGCACTGAGCTGAAAAAAAATGGGGT	0.485													18	23	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	44336190	44336190	+	IGR	DEL	G	-	-			TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44336190delG								EFHC2 (133267 upstream) : FUNDC1 (46696 downstream)																							aaaaaaaaaagaaagaaagaa	0.184													3	3	---	---	---	---	
SHROOM4	57477	broad.mit.edu	37	X	50378792	50378792	+	Intron	DEL	G	-	-	rs5915290	by1000genomes	TCGA-51-4081-01A-01D-1458-08	TCGA-51-4081-11A-01D-1458-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50378792delG	uc004dpe.2	-						SHROOM4_uc004dpd.3_Intron|SHROOM4_uc004dpf.1_Intron	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4						actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					AAAAAAAAAAGGGGGAAGAAA	0.483													6	3	---	---	---	---	
