Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CDK11B	984	broad.mit.edu	37	1	1571841	1571841	+	Missense_Mutation	SNP	A	C	C	rs150949339		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1571841A>C	uc001agv.1	-	22	2031	c.1920T>G	c.(1918-1920)GAT>GAG	p.D640E	CDK11B_uc009vkj.2_Missense_Mutation_p.D297E|CDK11B_uc001ags.1_Missense_Mutation_p.D498E|CDK11B_uc001agt.1_Missense_Mutation_p.D423E|CDK11B_uc001aha.1_Missense_Mutation_p.D606E|CDK11B_uc001agw.1_Missense_Mutation_p.D595E|CDK11B_uc001agy.1_Missense_Mutation_p.D638E|CDK11B_uc001agx.1_Missense_Mutation_p.D629E|CDK11B_uc001agz.1_Missense_Mutation_p.D384E	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)	653	Protein kinase.				apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						GGGTCCCCAGATCCTGAAAGA	0.577													4	11	---	---	---	---	PASS
GABRD	2563	broad.mit.edu	37	1	1957004	1957004	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1957004G>A	uc001aip.2	+	4	392	c.297G>A	c.(295-297)AGG>AGA	p.R99R		NM_000815	NP_000806	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	99	Extracellular (Probable).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		GGGACAGCAGGCTCTCCTACA	0.647													58	19	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16264403	16264403	+	Missense_Mutation	SNP	C	G	G	rs61756184		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16264403C>G	uc001axk.1	+	13	10810	c.10606C>G	c.(10606-10608)CGG>GGG	p.R3536G	SPEN_uc010obp.1_Missense_Mutation_p.R3495G	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	3536	SPOC.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCTGGCCCATCGGTCCCTGCC	0.627													57	76	---	---	---	---	PASS
DCDC2B	149069	broad.mit.edu	37	1	32677697	32677697	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32677697G>A	uc001bun.2	+	4	422	c.422G>A	c.(421-423)AGT>AAT	p.S141N		NM_001099434	NP_001092904	A2VCK2	DCD2B_HUMAN	doublecortin domain containing 2B	141	Doublecortin 2.				intracellular signal transduction						0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				GACCTGGTAAGTCCCCCATTT	0.572													46	9	---	---	---	---	PASS
GJA9	81025	broad.mit.edu	37	1	39340741	39340741	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39340741G>C	uc001cct.1	-	2	1311	c.1030C>G	c.(1030-1032)CAA>GAA	p.Q344E	RRAGC_uc001ccr.2_5'Flank|MYCBP_uc001ccs.2_5'Flank	NM_030772	NP_110399	P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	344	Cytoplasmic (Potential).				cell communication	connexon complex|integral to membrane					0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			CTGATGTGTTGAAAATGACTA	0.313													36	104	---	---	---	---	PASS
GJA9	81025	broad.mit.edu	37	1	39341106	39341106	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39341106G>A	uc001cct.1	-	2	946	c.665C>T	c.(664-666)TCA>TTA	p.S222L	RRAGC_uc001ccr.2_5'Flank|MYCBP_uc001ccs.2_5'Flank	NM_030772	NP_110399	P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	222	Helical; (Potential).				cell communication	connexon complex|integral to membrane					0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			TAAGAAAAGTGAAATAGTGGC	0.338													29	90	---	---	---	---	PASS
LEPRE1	64175	broad.mit.edu	37	1	43224593	43224593	+	Silent	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43224593T>A	uc001chv.2	-	4	983	c.870A>T	c.(868-870)CCA>CCT	p.P290P	LEPRE1_uc001chw.2_Silent_p.P290P|LEPRE1_uc001chx.3_Silent_p.P290P	NM_022356	NP_071751	Q32P28	P3H1_HUMAN	leprecan 1 isoform 1	290					negative regulation of cell proliferation	endoplasmic reticulum|proteinaceous extracellular matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			ovary(3)|lung(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TCTCTCGACTTGGGTGGGAAG	0.443													80	61	---	---	---	---	PASS
MUTYH	4595	broad.mit.edu	37	1	45797904	45797904	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45797904C>A	uc001cnm.2	-	10	1074	c.858G>T	c.(856-858)GTG>GTT	p.V286V	MUTYH_uc009vxn.2_Silent_p.V111V|MUTYH_uc001cnf.2_Silent_p.V261V|MUTYH_uc009vxo.2_Silent_p.V261V|MUTYH_uc001cng.2_Silent_p.V272V|MUTYH_uc001cnj.2_Silent_p.V169V|MUTYH_uc001cni.2_Silent_p.V261V|MUTYH_uc001cnh.2_Silent_p.V262V|MUTYH_uc001cno.2_Silent_p.V169V|MUTYH_uc001cnk.2_Silent_p.V146V|MUTYH_uc010oll.1_Intron|MUTYH_uc001cnl.2_Silent_p.V275V|MUTYH_uc009vxp.2_Silent_p.V289V|MUTYH_uc001cnn.2_Silent_p.V276V	NM_012222	NP_036354	Q9UIF7	MUTYH_HUMAN	mutY homolog isoform 1	286					depurination|mismatch repair	nucleoplasm	4 iron, 4 sulfur cluster binding|DNA N-glycosylase activity|endonuclease activity|metal ion binding|MutSalpha complex binding				0	Acute lymphoblastic leukemia(166;0.155)					GTGGGGTACACACTGTGGCCC	0.627			Mis			colorectal		BER_DNA_glycosylases	MUTYH-associated_polyposis				24	31	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75097473	75097473	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75097473T>C	uc001dgg.2	-	7	962	c.743A>G	c.(742-744)AAT>AGT	p.N248S	C1orf173_uc001dgi.3_Missense_Mutation_p.N42S	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	248										ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						TTCAGATCTATTTTCTCTTGT	0.378													59	117	---	---	---	---	PASS
CRYZ	1429	broad.mit.edu	37	1	75185016	75185016	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75185016C>A	uc001dgk.2	-	5	810	c.305G>T	c.(304-306)GGT>GTT	p.G102V	CRYZ_uc001dgj.2_Missense_Mutation_p.G102V|CRYZ_uc001dgl.2_Missense_Mutation_p.G102V|CRYZ_uc001dgm.2_Intron	NM_001130042	NP_001123514	Q08257	QOR_HUMAN	crystallin, zeta isoform a	102					protein homotetramerization|visual perception|xenobiotic catabolic process	cytosol|Golgi apparatus	mRNA 3'-UTR binding|NADPH binding|NADPH:quinone reductase activity|zinc ion binding				0					Dicumarol(DB00266)	CTCTGCATAACCCCCAGAGAT	0.403													36	55	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	75684271	75684271	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75684271G>A	uc001dgu.2	-	17	1577	c.1433C>T	c.(1432-1434)GCC>GTC	p.A478V	SLC44A5_uc001dgt.2_Missense_Mutation_p.A478V|SLC44A5_uc001dgs.2_Missense_Mutation_p.A436V|SLC44A5_uc001dgr.2_Missense_Mutation_p.A436V|SLC44A5_uc010oqz.1_Missense_Mutation_p.A517V|SLC44A5_uc010ora.1_Missense_Mutation_p.A472V|SLC44A5_uc010orb.1_Missense_Mutation_p.A348V	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	478	Helical; (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						ACCAGCAAGGGCGCACTGACC	0.433													82	131	---	---	---	---	PASS
SLC44A5	204962	broad.mit.edu	37	1	75699737	75699737	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75699737G>A	uc001dgu.2	-	12	931	c.787C>T	c.(787-789)CTG>TTG	p.L263L	SLC44A5_uc001dgt.2_Silent_p.L263L|SLC44A5_uc001dgs.2_Silent_p.L221L|SLC44A5_uc001dgr.2_Silent_p.L221L|SLC44A5_uc010oqz.1_Silent_p.L302L|SLC44A5_uc010ora.1_Silent_p.L257L|SLC44A5_uc010orb.1_Silent_p.L133L	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	263	Helical; (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						ATGAACCTCAGAAGTATCAAA	0.398													53	116	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82408659	82408659	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82408659T>C	uc001dit.3	+	6	585	c.404T>C	c.(403-405)GTG>GCG	p.V135A	LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Missense_Mutation_p.V135A|LPHN2_uc001div.2_Missense_Mutation_p.V135A|LPHN2_uc009wcd.2_Missense_Mutation_p.V135A	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	135	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		TTAGTTTTTGTGTGTCCTGGG	0.398													59	120	---	---	---	---	PASS
CLCA4	22802	broad.mit.edu	37	1	87045275	87045275	+	Intron	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:87045275G>T	uc009wcs.2	+						CLCA4_uc009wct.2_Intron|CLCA4_uc009wcu.2_Intron	NM_012128	NP_036260	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4							apical plasma membrane|extracellular region|integral to plasma membrane	chloride channel activity			ovary(2)	2		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		GAAAAGGTAAGGATGAAGTGT	0.408													55	94	---	---	---	---	PASS
GCLM	2730	broad.mit.edu	37	1	94360225	94360225	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94360225C>T	uc001dqg.1	-	6	893	c.600G>A	c.(598-600)TTG>TTA	p.L200L		NM_002061	NP_002052	P48507	GSH0_HUMAN	glutamate-cysteine ligase regulatory protein	200					glutamate metabolic process|glutathione biosynthetic process|regulation of blood vessel size|response to drug|response to oxidative stress|xenobiotic metabolic process	cytosol|soluble fraction	glutamate-cysteine ligase catalytic subunit binding			ovary(1)	1		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)	CAAATGCAGTCAAATCTGGTG	0.323													67	118	---	---	---	---	PASS
ARHGAP29	9411	broad.mit.edu	37	1	94645435	94645435	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94645435C>G	uc001dqj.3	-	20	2695	c.2326G>C	c.(2326-2328)GAA>CAA	p.E776Q	ARHGAP29_uc009wdq.1_RNA|ARHGAP29_uc001dqk.2_Missense_Mutation_p.E342Q	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1	776	Rho-GAP.				Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		GTCTCTTGTTCTTCATTTACA	0.299													44	104	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103400066	103400066	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103400066C>A	uc001dul.2	-	46	3857	c.3539G>T	c.(3538-3540)GGG>GTG	p.G1180V	COL11A1_uc001duk.2_Missense_Mutation_p.G376V|COL11A1_uc001dum.2_Missense_Mutation_p.G1192V|COL11A1_uc001dun.2_Missense_Mutation_p.G1141V|COL11A1_uc009weh.2_Missense_Mutation_p.G1064V	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1180	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ACCTTTTTGCCCAAACATCCC	0.453													24	71	---	---	---	---	PASS
C1orf59	113802	broad.mit.edu	37	1	109198244	109198244	+	Missense_Mutation	SNP	C	A	A	rs141386408		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109198244C>A	uc001dvt.3	-	4	465	c.227G>T	c.(226-228)GGA>GTA	p.G76V	C1orf59_uc001dvu.3_Missense_Mutation_p.G76V|C1orf59_uc009wer.2_Missense_Mutation_p.G76V	NM_001102592	NP_001096062	Q5T8I9	HENMT_HUMAN	hypothetical protein LOC113802	76					gene silencing by RNA|piRNA metabolic process	P granule	metal ion binding|O-methyltransferase activity|RNA binding|RNA methyltransferase activity				0		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0152)|Lung(183;0.0895)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.163)		AATATCTACTCCAACAAGCAA	0.353													14	53	---	---	---	---	PASS
DENND2D	79961	broad.mit.edu	37	1	111739856	111739856	+	Missense_Mutation	SNP	C	T	T	rs140232654	byFrequency	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111739856C>T	uc001eak.1	-	5	646	c.446G>A	c.(445-447)CGC>CAC	p.R149H	DENND2D_uc001eal.1_Missense_Mutation_p.R146H	NM_024901	NP_079177	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	149	DENN.									ovary(1)	1		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		TTTGGGAAGGCGAGGGCCAGG	0.607													7	15	---	---	---	---	PASS
CHI3L2	1117	broad.mit.edu	37	1	111784842	111784842	+	Intron	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111784842C>T	uc001eam.2	+						CHI3L2_uc001ean.2_Intron|CHI3L2_uc001eao.2_Intron|CHI3L2_uc009wga.2_Intron	NM_004000	NP_003991	Q15782	CH3L2_HUMAN	chitinase 3-like 2 isoform a						chitin catabolic process	extracellular space	cation binding|chitinase activity			central_nervous_system(1)	1		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		TTCTGTGTCTCCCATAGGTTC	0.468													47	106	---	---	---	---	PASS
HIPK1	204851	broad.mit.edu	37	1	114505001	114505001	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114505001A>G	uc001eem.2	+	9	2205	c.2044A>G	c.(2044-2046)ATT>GTT	p.I682V	HIPK1_uc001eel.2_Missense_Mutation_p.I682V|HIPK1_uc001een.2_Missense_Mutation_p.I682V|HIPK1_uc001eeo.2_Missense_Mutation_p.I308V|HIPK1_uc001eep.2_Missense_Mutation_p.I288V|HIPK1_uc001eeq.2_5'Flank	NM_198268	NP_938009	Q86Z02	HIPK1_HUMAN	homeodomain-interacting protein kinase 1 isoform	682					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(4)	4	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCTGTACCGATTGTACCCCA	0.443													23	61	---	---	---	---	PASS
SYT6	148281	broad.mit.edu	37	1	114680233	114680233	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114680233A>T	uc001eev.2	-	3	950	c.700T>A	c.(700-702)TTT>ATT	p.F234I		NM_205848	NP_995320	Q5T7P8	SYT6_HUMAN	synaptotagmin VI	319	Cytoplasmic (Potential).|C2 1.	Calcium 1; via carbonyl oxygen (By similarity).			acrosomal vesicle exocytosis	cell junction|cytosol|integral to membrane|perinuclear endoplasmic reticulum|peripheral to membrane of membrane fraction|synaptic vesicle membrane	clathrin binding|metal ion binding|protein homodimerization activity|syntaxin binding|transporter activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGCGGTCAAAGTCGAAGACA	0.552													17	25	---	---	---	---	PASS
SYCP1	6847	broad.mit.edu	37	1	115438085	115438085	+	Silent	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115438085T>C	uc001efr.2	+	16	1484	c.1275T>C	c.(1273-1275)CTT>CTC	p.L425L	SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Silent_p.L425L|SYCP1_uc009wgw.2_Silent_p.L425L	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	425	Potential.				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGACTAAGCTTACAAATAACA	0.279													5	10	---	---	---	---	PASS
NUDT17	200035	broad.mit.edu	37	1	145587438	145587438	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145587438C>T	uc001eoe.2	-	6	650	c.642G>A	c.(640-642)CTG>CTA	p.L214L	NBPF10_uc001emp.3_Intron	NM_001012758	NP_001012776	P0C025	NUD17_HUMAN	nudix (nucleoside diphosphate linked moiety	214	Nudix hydrolase.						hydrolase activity|metal ion binding				0	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CATCTGGTGTCAGCCACATAA	0.597													94	54	---	---	---	---	PASS
HIST2H2BF	440689	broad.mit.edu	37	1	149783853	149783853	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149783853G>A	uc001esr.2	-	1	76	c.26C>T	c.(25-27)CCT>CTT	p.P9L	HIST2H2BF_uc010pbj.1_Missense_Mutation_p.P9L|HIST2H2BF_uc010pbk.1_Missense_Mutation_p.P9L	NM_001024599	NP_001019770	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf isoform a	9					nucleosome assembly	nucleosome|nucleus	DNA binding				0	Breast(34;0.0124)|all_hematologic(923;0.127)					CTTGGGAGCAGGAGCGGATTT	0.512													123	117	---	---	---	---	PASS
LCE3A	353142	broad.mit.edu	37	1	152595380	152595380	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152595380G>C	uc010pdt.1	-	1	200	c.200C>G	c.(199-201)TCC>TGC	p.S67C		NM_178431	NP_848518	Q5TA76	LCE3A_HUMAN	late cornified envelope 3A	67					keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTGTCACAGGAGTTGGAGCT	0.607													56	56	---	---	---	---	PASS
LCE1B	353132	broad.mit.edu	37	1	152784941	152784941	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152784941C>A	uc001faq.2	+	1	495	c.19C>A	c.(19-21)CAG>AAG	p.Q7K		NM_178349	NP_848126	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B	7					keratinization						0	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCAGCAGAACCAGCAGCAGTG	0.483													20	111	---	---	---	---	PASS
LCE1B	353132	broad.mit.edu	37	1	152785258	152785258	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152785258G>T	uc001faq.2	+	1	812	c.336G>T	c.(334-336)CAG>CAT	p.Q112H		NM_178349	NP_848126	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B	112	Gly-rich.				keratinization						0	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGAGTGGCCAGCACTCTGGAG	0.612													37	31	---	---	---	---	PASS
KCNN3	3782	broad.mit.edu	37	1	154841969	154841969	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154841969C>T	uc001ffp.2	-	1	786	c.472G>A	c.(472-474)GCC>ACC	p.A158T	KCNN3_uc009wox.1_Missense_Mutation_p.A158T	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium	163						integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			AGGGGGCTGGCCTGTCGGTGC	0.637													8	20	---	---	---	---	PASS
FCRL2	79368	broad.mit.edu	37	1	157740362	157740362	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157740362C>T	uc001fre.2	-	3	206	c.147G>A	c.(145-147)ATG>ATA	p.M49I	FCRL2_uc001frd.2_5'Flank|FCRL2_uc010phz.1_Missense_Mutation_p.M49I|FCRL2_uc009wsp.2_Missense_Mutation_p.M49I|FCRL2_uc010pia.1_Missense_Mutation_p.M49I	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor	49	Ig-like C2-type 1.|Extracellular (Potential).				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TATGGTAAGCCATCTTCTGAA	0.408													55	78	---	---	---	---	PASS
OR6K3	391114	broad.mit.edu	37	1	158687140	158687140	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158687140G>T	uc010pip.1	-	1	814	c.814C>A	c.(814-816)CTC>ATC	p.L272I		NM_001005327	NP_001005327	Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K,	272	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					AAGTACATGAGTGATACACTG	0.448													50	94	---	---	---	---	PASS
KCNJ9	3765	broad.mit.edu	37	1	160054134	160054134	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160054134A>G	uc001fuy.1	+	2	556	c.314A>G	c.(313-315)AAC>AGC	p.N105S		NM_004983	NP_004974	Q92806	IRK9_HUMAN	potassium inwardly-rectifying channel subfamily	105	Extracellular (By similarity).				synaptic transmission	integral to membrane|plasma membrane	G-protein activated inward rectifier potassium channel activity|protein binding			ovary(1)|skin(1)	2	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AACAACCTCAACGGCTTCGTG	0.667													13	38	---	---	---	---	PASS
IGSF8	93185	broad.mit.edu	37	1	160061685	160061685	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160061685C>A	uc001fva.2	-	6	1815	c.1770G>T	c.(1768-1770)GTG>GTT	p.V590V	IGSF8_uc001fuz.2_Silent_p.V590V|IGSF8_uc009wtf.2_Silent_p.V590V	NM_052868	NP_443100	Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	590	Helical; (Potential).				cell proliferation|cellular component movement|nervous system development|single fertilization|skeletal muscle tissue development	integral to membrane	protein binding				0	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TGACTAGGGCCACCCCTGTAC	0.552													57	53	---	---	---	---	PASS
ADAMTS4	9507	broad.mit.edu	37	1	161167800	161167800	+	Silent	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161167800T>C	uc001fyt.3	-	1	1046	c.618A>G	c.(616-618)AGA>AGG	p.R206R	ADAMTS4_uc001fyu.2_Silent_p.R206R|NDUFS2_uc001fyv.2_5'Flank	NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1	206					proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CTCTTCGGGGTCTGGGGCTGG	0.622													41	44	---	---	---	---	PASS
GPA33	10223	broad.mit.edu	37	1	167059522	167059522	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167059522C>A	uc001gea.1	-	1	347	c.3G>T	c.(1-3)ATG>ATT	p.M1I		NM_005814	NP_005805	Q99795	GPA33_HUMAN	transmembrane glycoprotein A33 precursor	1						integral to plasma membrane	receptor activity				0						TCTTCCCCACCATGGTCTTGC	0.577													13	15	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564468	176564468	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564468C>A	uc001gkz.2	+	3	2892	c.1728C>A	c.(1726-1728)ACC>ACA	p.T576T	PAPPA2_uc001gky.1_Silent_p.T576T|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	576	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						ACAATTCCACCCTGCGACACC	0.577													34	98	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176758968	176758968	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176758968T>A	uc001gkz.2	+	18	5903	c.4739T>A	c.(4738-4740)CTG>CAG	p.L1580Q	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1580	Sushi 3.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						ATACAATGCCTGGAAGGTGGA	0.448													40	30	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181767820	181767820	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181767820C>A	uc001gow.2	+	47	6828	c.6663C>A	c.(6661-6663)AAC>AAA	p.N2221K	CACNA1E_uc009wxs.2_Missense_Mutation_p.N2109K|CACNA1E_uc009wxt.2_Missense_Mutation_p.N1490K	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	2264	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						GCCGTTCCAACACCATCGGCT	0.662													5	5	---	---	---	---	PASS
C1orf26	54823	broad.mit.edu	37	1	185240491	185240491	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:185240491G>C	uc001grg.3	+	17	2592	c.2478G>C	c.(2476-2478)GAG>GAC	p.E826D	C1orf26_uc001grh.3_Missense_Mutation_p.E826D	NM_001105518	NP_001098988	Q5T5J6	SWT1_HUMAN	hypothetical protein LOC54823	826											0						AAGATGTTGAGACCCTCTATA	0.274													22	102	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190250787	190250787	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190250787G>T	uc001gse.1	-	3	562	c.330C>A	c.(328-330)AAC>AAA	p.N110K	FAM5C_uc010pot.1_Intron	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	110						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					AAAGTCTTATGTTGCGGAAGA	0.448													65	85	---	---	---	---	PASS
KIF21B	23046	broad.mit.edu	37	1	200959153	200959153	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200959153C>A	uc001gvs.1	-	21	3366	c.3049G>T	c.(3049-3051)GAC>TAC	p.D1017Y	KIF21B_uc001gvr.1_Missense_Mutation_p.D1017Y|KIF21B_uc009wzl.1_Missense_Mutation_p.D1017Y|KIF21B_uc010ppn.1_Missense_Mutation_p.D1017Y	NM_017596	NP_060066	O75037	KI21B_HUMAN	kinesin family member 21B	1017					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(3)	6						ACGGATGTGTCTGTGGAGTCC	0.642													21	58	---	---	---	---	PASS
IPO9	55705	broad.mit.edu	37	1	201839746	201839746	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201839746G>A	uc001gwz.2	+	18	2219	c.2169G>A	c.(2167-2169)GTG>GTA	p.V723V		NM_018085	NP_060555	Q96P70	IPO9_HUMAN	importin 9	723					protein import into nucleus	cytoplasm|nucleus	histone binding|protein transporter activity			ovary(2)	2						ATGTGTCAGTGACCCTGGAAC	0.582													37	71	---	---	---	---	PASS
ELF3	1999	broad.mit.edu	37	1	201980363	201980363	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201980363C>T	uc001gxg.3	+	1	3291	c.99C>T	c.(97-99)GCC>GCT	p.A33A	ELF3_uc001gxi.3_Silent_p.A33A|ELF3_uc001gxh.3_Silent_p.A33A	NM_004433	NP_004424	P78545	ELF3_HUMAN	E74-like factor 3 (ets domain transcription	33					epidermis development|epithelial cell differentiation|inflammatory response|mammary gland involution|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi apparatus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity				0						CCCCTGCTGCCACCTTTGGGG	0.577													119	102	---	---	---	---	PASS
SPATA17	128153	broad.mit.edu	37	1	217947719	217947719	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217947719C>T	uc001hlh.1	+	7	589	c.563C>T	c.(562-564)CCA>CTA	p.P188L	SPATA17_uc009xdr.1_RNA|SPATA17_uc001hli.2_Missense_Mutation_p.P188L	NM_138796	NP_620151	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	188						cytoplasm	calmodulin binding			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		GAGCCTGATCCATGGGAGCTG	0.383													81	81	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220152953	220152953	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220152953C>G	uc001hly.1	-	27	3986	c.3716G>C	c.(3715-3717)GGA>GCA	p.G1239A		NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	1239	Prolyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	ATGTGATGTTCCTCCCTAAAA	0.328													36	102	---	---	---	---	PASS
SNAP47	116841	broad.mit.edu	37	1	227947172	227947172	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227947172C>G	uc001hrf.2	+	3	1523	c.1109C>G	c.(1108-1110)TCA>TGA	p.S370*	SNAP47_uc001hqz.2_Nonsense_Mutation_p.S325*|SNAP47_uc001hra.2_Nonsense_Mutation_p.S128*|SNAP47_uc001hrd.2_Nonsense_Mutation_p.S370*|SNAP47_uc001hre.2_Nonsense_Mutation_p.S128*|SNAP47_uc001hrg.1_Nonsense_Mutation_p.S325*	NM_053052	NP_444280	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa	370						endomembrane system|membrane|perinuclear region of cytoplasm		p.S370*(1)		ovary(1)	1						AAGAGCTGCTCAGTCTGGCAT	0.517													55	195	---	---	---	---	PASS
TTC13	79573	broad.mit.edu	37	1	231079575	231079575	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231079575C>G	uc001huf.3	-	6	680	c.649G>C	c.(649-651)GAG>CAG	p.E217Q	TTC13_uc009xfi.2_Intron|TTC13_uc009xfj.2_RNA|TTC13_uc001hug.3_Intron|TTC13_uc009xfk.1_Intron	NM_024525	NP_078801	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13 isoform a	217	TPR 2.						binding			ovary(1)|skin(1)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		TCAAATACCTCTGGACGATCT	0.388													66	192	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237551473	237551473	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237551473G>C	uc001hyl.1	+	10	883	c.763G>C	c.(763-765)GAG>CAG	p.E255Q		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	255	Cytoplasmic (By similarity).|MIR 3.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACATGGTGAAGAGCAGCGGAG	0.453													19	50	---	---	---	---	PASS
FH	2271	broad.mit.edu	37	1	241667398	241667398	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241667398G>T	uc001hyx.2	-	7	1084	c.1052C>A	c.(1051-1053)TCA>TAA	p.S351*		NM_000143	NP_000134	P07954	FUMH_HUMAN	fumarate hydratase precursor	351					fumarate metabolic process|tricarboxylic acid cycle	cell junction|mitochondrial matrix|tricarboxylic acid cycle enzyme complex	fumarate hydratase activity			lung(3)|ovary(1)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		TCCCAGACCTGACCGAGGACC	0.303			Mis|N|F			lieomyomatosis|renal			Hereditary_Leiomyomatosis_and_Renal_Cell_Cancer				24	41	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247024468	247024468	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247024468G>C	uc001ibu.1	-	28	3872	c.3865C>G	c.(3865-3867)CAA>GAA	p.Q1289E	AHCTF1_uc001ibv.1_Missense_Mutation_p.Q1298E|AHCTF1_uc009xgs.1_Missense_Mutation_p.Q150E|AHCTF1_uc001ibw.1_RNA	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	1289	Necessary for nuclear localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TCCATTTCTTGATGCTCCTTT	0.418													36	130	---	---	---	---	PASS
OR2T27	403239	broad.mit.edu	37	1	248813788	248813788	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248813788G>T	uc010pzo.1	-	1	398	c.398C>A	c.(397-399)CCT>CAT	p.P133H		NM_001001824	NP_001001824	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T,	133	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CATGAGGACAGGATAGTGCAG	0.547													13	71	---	---	---	---	PASS
ALLC	55821	broad.mit.edu	37	2	3749950	3749950	+	Intron	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3749950C>A	uc010ewt.2	+						ALLC_uc002qyf.2_Intron	NM_018436	NP_060906	Q8N6M5	ALLC_HUMAN	allantoicase isoform a								allantoicase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		GCTTGCTTTTCAGTTGTCTCC	0.547										HNSCC(21;0.051)			4	19	---	---	---	---	PASS
GEN1	348654	broad.mit.edu	37	2	17952508	17952508	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17952508G>T	uc002rct.2	+	7	829	c.756G>T	c.(754-756)CTG>CTT	p.L252L	SMC6_uc010exo.2_Intron|GEN1_uc010yjs.1_Silent_p.L252L|GEN1_uc002rcu.2_Silent_p.L252L	NM_182625	NP_872431	Q17RS7	GEN_HUMAN	Gen homolog 1, endonuclease	252					DNA repair	nucleus	DNA binding|endonuclease activity|metal ion binding			breast(5)|kidney(1)|central_nervous_system(1)|skin(1)	8	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GTCCACAACTGCTAGTCACTA	0.353								Homologous_recombination					49	32	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40655902	40655902	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40655902C>A	uc002rrx.2	-	1	1543	c.1519G>T	c.(1519-1521)GAT>TAT	p.D507Y	SLC8A1_uc002rry.2_Missense_Mutation_p.D507Y|SLC8A1_uc002rrz.2_Missense_Mutation_p.D507Y|SLC8A1_uc002rsa.2_Missense_Mutation_p.D507Y|SLC8A1_uc002rsd.3_Missense_Mutation_p.D507Y|SLC8A1_uc002rsb.1_Missense_Mutation_p.D507Y|SLC8A1_uc010fan.1_Missense_Mutation_p.D507Y|SLC8A1_uc002rsc.1_Missense_Mutation_p.D507Y	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	507	Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	AGTATGCCATCTTCTGAAGCT	0.423													151	108	---	---	---	---	PASS
ZFP36L2	678	broad.mit.edu	37	2	43452889	43452889	+	Silent	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43452889T>A	uc002rsv.3	-	2	345	c.54A>T	c.(52-54)ACA>ACT	p.T18T	LOC100129726_uc010ynx.1_5'Flank	NM_006887	NP_008818	P47974	TISD_HUMAN	zinc finger protein 36, C3H type-like 2	18					cell proliferation	nucleus	DNA binding|RNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				GGGATTTCTCTGTCTGCCAAA	0.622													44	33	---	---	---	---	PASS
PSME4	23198	broad.mit.edu	37	2	54164584	54164584	+	Silent	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54164584A>G	uc002rxp.2	-	5	695	c.639T>C	c.(637-639)TAT>TAC	p.Y213Y	PSME4_uc010yop.1_Silent_p.Y99Y|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_5'UTR|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	213					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			ATATTTCAAAATAAGTGATGG	0.368													180	135	---	---	---	---	PASS
CCDC85A	114800	broad.mit.edu	37	2	56420271	56420271	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:56420271G>T	uc002rzn.2	+	2	1438	c.936G>T	c.(934-936)GGG>GGT	p.G312G		NM_001080433	NP_001073902	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	312	His-rich.									breast(3)|ovary(2)	5			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TGCTGAGTGGGAGCCCGGAAC	0.642													25	182	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61439041	61439041	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61439041C>A	uc002sbe.2	-	69	8728	c.8706G>T	c.(8704-8706)CTG>CTT	p.L2902L		NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	2902					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			ACAGCTGCATCAGGTTAAACA	0.348													22	181	---	---	---	---	PASS
FBXO41	150726	broad.mit.edu	37	2	73487572	73487572	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73487572C>T	uc002sjb.1	-	11	2577	c.2577G>A	c.(2575-2577)GAG>GAA	p.E859E		NM_001080410	NP_001073879	Q8TF61	FBX41_HUMAN	F-box protein 41	798						intracellular	protein binding|zinc ion binding			breast(2)|pancreas(1)	3						GCACCAGCATCTCCAGTCCCT	0.617													8	16	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	76975851	76975851	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:76975851C>T	uc002snr.2	-	4	2158	c.1743G>A	c.(1741-1743)CCG>CCA	p.P581P	LRRTM4_uc002snq.2_Silent_p.P581P	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	581	Cytoplasmic (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		GGTAGATGGCCGGTGCTGCCG	0.597													94	117	---	---	---	---	PASS
REG1A	5967	broad.mit.edu	37	2	79349207	79349207	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79349207A>C	uc002snz.2	+	4	380	c.277A>C	c.(277-279)ACT>CCT	p.T93P	REG1A_uc010ffx.1_3'UTR|REG1A_uc010ysd.1_Missense_Mutation_p.T93P	NM_002909	NP_002900	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha precursor	93	C-type lectin.				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding				0						GGAGAGTGGCACTGATGACTT	0.507													42	131	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89278031	89278031	+	RNA	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89278031C>A	uc010ytr.1	-	88		c.7353G>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GCAAAATCTTCAGGCTGCAGG	0.478													21	51	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89309597	89309597	+	RNA	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89309597C>A	uc010ytr.1	-	74		c.6750G>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TGGGACCCCACTTTGCAAAGT	0.498													164	126	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100210742	100210742	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100210742C>T	uc002tag.2	-	14	1617	c.1381G>A	c.(1381-1383)GCA>ACA	p.A461T	AFF3_uc002taf.2_Missense_Mutation_p.A486T|AFF3_uc010fiq.1_Missense_Mutation_p.A461T|AFF3_uc010yvr.1_Missense_Mutation_p.A614T|AFF3_uc002tah.1_Missense_Mutation_p.A486T	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	461					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						TTAGAGGATGCCGGTTCAGCC	0.443													5	347	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100623800	100623800	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100623800C>A	uc002tag.2	-	5	533	c.297G>T	c.(295-297)GGG>GGT	p.G99G	AFF3_uc002taf.2_Silent_p.G124G|AFF3_uc010fiq.1_Silent_p.G99G|AFF3_uc010yvr.1_Silent_p.G253G|AFF3_uc002tah.1_Silent_p.G124G|AFF3_uc010fir.1_Silent_p.G176G|AFF3_uc002tai.2_Silent_p.G21G	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	99					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						TCTGAGGAACCCCAGGTTTGG	0.443													93	129	---	---	---	---	PASS
GPR45	11250	broad.mit.edu	37	2	105859164	105859164	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105859164C>A	uc002tco.1	+	1	965	c.849C>A	c.(847-849)CAC>CAA	p.H283Q		NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	283	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3						GGCTGCCCCACTCCGTCTACA	0.582													199	244	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109347290	109347290	+	Silent	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109347290T>C	uc002tem.3	+	3	327	c.201T>C	c.(199-201)GGT>GGC	p.G67G		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	67	TPR.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						GATTTCTGGGTCTTCTTTATG	0.338													113	505	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131521188	131521188	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131521188G>A	uc002trw.2	+	2	1733	c.1543G>A	c.(1543-1545)GGC>AGC	p.G515S	FAM123C_uc010fmv.2_Missense_Mutation_p.G515S|FAM123C_uc010fms.1_Missense_Mutation_p.G515S|FAM123C_uc010fmt.1_Missense_Mutation_p.G515S|FAM123C_uc010fmu.1_Missense_Mutation_p.G515S	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	515										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		GCTGCGCCGAGGCCCCACGCC	0.682													6	8	---	---	---	---	PASS
ARHGEF4	50649	broad.mit.edu	37	2	131801050	131801050	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131801050C>G	uc002tsa.1	+	11	2013	c.1493C>G	c.(1492-1494)TCA>TGA	p.S498*	ARHGEF4_uc010fmw.1_Intron|ARHGEF4_uc002tsb.1_Nonsense_Mutation_p.S498*|ARHGEF4_uc010fmx.1_Nonsense_Mutation_p.S438*|ARHGEF4_uc002tsc.1_Nonsense_Mutation_p.S41*	NM_015320	NP_056135	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor 4 isoform	498					apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity			breast(3)|ovary(2)|skin(1)	6		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		GTCAGGAGCTCAGAACTCATC	0.542													33	105	---	---	---	---	PASS
UBXN4	23190	broad.mit.edu	37	2	136537796	136537796	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136537796A>C	uc002tur.2	+	12	1540	c.1229A>C	c.(1228-1230)GAC>GCC	p.D410A	UBXN4_uc002tus.2_Missense_Mutation_p.D176A|UBXN4_uc002tut.2_Missense_Mutation_p.D46A	NM_014607	NP_055422	Q92575	UBXN4_HUMAN	UBX domain containing 2	410	Cytoplasmic (Potential).				response to unfolded protein	endoplasmic reticulum membrane|nuclear envelope	protein binding			skin(2)	2						TCCAGCGGAGACATTTGGACC	0.423													128	103	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	137852569	137852569	+	Silent	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137852569A>G	uc002tva.1	+	3	984	c.984A>G	c.(982-984)CCA>CCG	p.P328P	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_Silent_p.P218P	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GTCTCTTGCCAGGATTTAGGA	0.537													74	42	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141264380	141264380	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141264380C>T	uc002tvj.1	-	53	9478	c.8506G>A	c.(8506-8508)GAG>AAG	p.E2836K		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2836	Extracellular (Potential).|LDL-receptor class A 18.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGCGGTGACTCATCAGAGCCA	0.368										TSP Lung(27;0.18)			101	259	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141625764	141625764	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141625764C>G	uc002tvj.1	-	26	5210	c.4238G>C	c.(4237-4239)GGG>GCG	p.G1413A	LRP1B_uc010fnl.1_Missense_Mutation_p.G595A	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1413	Extracellular (Potential).|LDL-receptor class B 11.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGTTTTTCTCCCAGCACCACT	0.383										TSP Lung(27;0.18)			94	91	---	---	---	---	PASS
KYNU	8942	broad.mit.edu	37	2	143676175	143676175	+	Intron	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143676175C>T	uc002tvl.2	+						KYNU_uc002tvk.2_Intron|KYNU_uc010fnm.2_Intron	NM_003937	NP_003928	Q16719	KYNU_HUMAN	kynureninase (L-kynurenine hydrolase) isoform a						anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)	TCTTCTGTTTCAGTTGATTTA	0.274													26	16	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160206824	160206824	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160206824C>T	uc002uao.2	-	28	4610	c.4258G>A	c.(4258-4260)GAA>AAA	p.E1420K	BAZ2B_uc002uap.2_Missense_Mutation_p.E1384K	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1420					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						TGGACACTTTCTGCCTTTTTC	0.328													9	48	---	---	---	---	PASS
MARCH7	64844	broad.mit.edu	37	2	160605213	160605213	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160605213G>A	uc002uax.2	+	5	1534	c.1412G>A	c.(1411-1413)AGA>AAA	p.R471K	MARCH7_uc010foq.2_Missense_Mutation_p.R471K|MARCH7_uc010zcn.1_Missense_Mutation_p.R415K|MARCH7_uc010for.2_Missense_Mutation_p.R433K|MARCH7_uc002uay.2_RNA	NM_022826	NP_073737	Q9H992	MARH7_HUMAN	axotrophin	471							ligase activity|zinc ion binding				0						CAAGGTGGAAGAAATACAGGA	0.483													143	357	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166847808	166847808	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166847808T>C	uc010zcz.1	-	26	5962	c.5944A>G	c.(5944-5946)ATT>GTT	p.I1982V		NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1993						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TTTTCCACAATTGGCTTTGTC	0.353													53	84	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166915146	166915146	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166915146G>A	uc010zcz.1	-	2	335	c.317C>T	c.(316-318)TCT>TTT	p.S106F	SCN1A_uc002udo.3_5'Flank|SCN1A_uc010fpk.2_5'Flank	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	106						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	GTACAGGGCAGAGGTGGCACT	0.338													62	100	---	---	---	---	PASS
B3GALT1	8708	broad.mit.edu	37	2	168726259	168726259	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168726259C>T	uc002udz.1	+	2	1061	c.710C>T	c.(709-711)TCG>TTG	p.S237L		NM_020981	NP_066191	Q9Y5Z6	B3GT1_HUMAN	UDP-Gal:betaGlcNAc beta	237	Lumenal (Potential).				lipid glycosylation|protein glycosylation	Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(2)|pancreas(1)|skin(1)	4						CCTTTCTGTTCGGGGACTGGC	0.488													26	135	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170070280	170070280	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170070280G>T	uc002ues.2	-	36	6140	c.5927C>A	c.(5926-5928)ACT>AAT	p.T1976N		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1976	LDL-receptor class B 19.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CTGTTCATCAGTATAATAAAG	0.428													132	181	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170135900	170135900	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170135900G>A	uc002ues.2	-	12	1760	c.1547C>T	c.(1546-1548)GCC>GTC	p.A516V	LRP2_uc010zdf.1_Missense_Mutation_p.A516V	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	516	LDL-receptor class B 2.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TGGGTCCACGGCAATTCCTCT	0.403													5	229	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098953	178098953	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098953C>G	uc002ulh.3	-	2	647	c.92G>C	c.(91-93)GGA>GCA	p.G31A	NFE2L2_uc002ulg.3_Missense_Mutation_p.G15A|NFE2L2_uc010zfa.1_Missense_Mutation_p.G15A|NFE2L2_uc002uli.3_Missense_Mutation_p.G15A|NFE2L2_uc010fra.2_Missense_Mutation_p.G15A|NFE2L2_uc010frb.2_Missense_Mutation_p.G15A	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	31					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	p.G31R(1)		central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCGACTTACTCCAAGATCTAT	0.363			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			50	42	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179438157	179438157	+	Silent	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179438157A>T	uc010zfg.1	-	275	65222	c.64998T>A	c.(64996-64998)ATT>ATA	p.I21666I	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.I15361I|TTN_uc010zfi.1_Silent_p.I15294I|TTN_uc010zfj.1_Silent_p.I15169I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	22593							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATCTTTAGTAATAGTTGTCA	0.463													102	125	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179574553	179574553	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179574553C>G	uc010zfg.1	-	96	24985	c.24761G>C	c.(24760-24762)AGA>ACA	p.R8254T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R4915T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9181							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCTGAGAGTCTTTTAGTGAA	0.388													38	136	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179590299	179590299	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179590299C>G	uc010zfg.1	-	68	17124	c.16900G>C	c.(16900-16902)GAA>CAA	p.E5634Q	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.E2295Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6561							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGGCGCCTTCTATGGATGCT	0.433													54	67	---	---	---	---	PASS
UBE2E3	10477	broad.mit.edu	37	2	181846838	181846838	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181846838C>A	uc002unq.1	+	3	288	c.69C>A	c.(67-69)GAC>GAA	p.D23E	UBE2E3_uc002unr.1_Missense_Mutation_p.D23E|UBE2E3_uc010fri.1_Missense_Mutation_p.D23E	NM_182678	NP_872619	Q969T4	UB2E3_HUMAN	ubiquitin-conjugating enzyme E2E 3	23					protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|regulation of growth	cytoplasm|nucleolus	ATP binding|protein binding|ubiquitin-protein ligase activity			ovary(1)	1						CAGATGCGGACCAGCGAGACC	0.498													32	49	---	---	---	---	PASS
UBE2E3	10477	broad.mit.edu	37	2	181927582	181927582	+	Silent	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181927582A>T	uc002unq.1	+	7	810	c.591A>T	c.(589-591)ATA>ATT	p.I197I	UBE2E3_uc002unr.1_Silent_p.I197I|UBE2E3_uc010fri.1_Silent_p.I197I	NM_182678	NP_872619	Q969T4	UB2E3_HUMAN	ubiquitin-conjugating enzyme E2E 3	197					protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|regulation of growth	cytoplasm|nucleolus	ATP binding|protein binding|ubiquitin-protein ligase activity			ovary(1)	1						ACGACAGGATAGCCAGACAGT	0.423													21	37	---	---	---	---	PASS
NCKAP1	10787	broad.mit.edu	37	2	183822189	183822189	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183822189T>C	uc002upc.2	-	19	2419	c.2017A>G	c.(2017-2019)ACC>GCC	p.T673A	NCKAP1_uc002upb.2_Missense_Mutation_p.T679A	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1	673					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			ACTTACTTGGTCACAACCAGC	0.353													159	212	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186697939	186697939	+	RNA	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186697939C>A	uc002upm.2	+	7		c.3792C>A			uc010zfu.1_Missense_Mutation_p.Q1402K					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		ACCAGCTCACCAGGATGAACA	0.333													62	95	---	---	---	---	PASS
CLK1	1195	broad.mit.edu	37	2	201726069	201726069	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201726069T>G	uc002uwe.2	-	3	463	c.282A>C	c.(280-282)GAA>GAC	p.E94D	CLK1_uc010zhi.1_Missense_Mutation_p.E136D|CLK1_uc002uwf.2_5'UTR|CLK1_uc002uwg.2_5'UTR|CLK1_uc010fsv.2_RNA	NM_004071	NP_004062	P49759	CLK1_HUMAN	CDC-like kinase 1 isoform 1	94					cell proliferation	nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			pancreas(2)	2						GATACCGGCTTTCATGGTCTC	0.408													206	264	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209168915	209168915	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209168915G>A	uc002vcz.2	+	11	1499	c.1341G>A	c.(1339-1341)ACG>ACA	p.T447T	PIKFYVE_uc010fun.1_Silent_p.T128T|PIKFYVE_uc002vcy.1_Silent_p.T447T|PIKFYVE_uc002vcv.2_Silent_p.T350T|PIKFYVE_uc002vcw.2_Silent_p.T447T|PIKFYVE_uc002vcx.2_Silent_p.T361T	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	447					cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						TTTCTGAGACGCCTTCTCCCG	0.433													57	157	---	---	---	---	PASS
SPAG16	79582	broad.mit.edu	37	2	214204974	214204974	+	Silent	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:214204974A>G	uc002veq.2	+	6	716	c.624A>G	c.(622-624)AAA>AAG	p.K208K	SPAG16_uc010fuz.1_Silent_p.K59K|SPAG16_uc002ver.2_Silent_p.K154K|SPAG16_uc010zjk.1_Silent_p.K114K|SPAG16_uc002vep.1_Intron|SPAG16_uc002ves.1_Silent_p.K177K	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1	208	Potential.				cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		AAAAAAACAAATTAATTAATG	0.279													45	18	---	---	---	---	PASS
ITM2C	81618	broad.mit.edu	37	2	231742277	231742277	+	Intron	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231742277G>T	uc002vqz.2	+						ITM2C_uc002vra.2_Intron|ITM2C_uc002vrb.2_Intron|ITM2C_uc002vrc.2_Intron|ITM2C_uc002vrd.2_Intron	NM_030926	NP_112188	Q9NQX7	ITM2C_HUMAN	integral membrane protein 2C isoform 1						negative regulation of neuron projection development|neuron differentiation	Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	beta-amyloid binding				0		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;8.47e-12)|all cancers(144;3.44e-09)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		TGAGTGGCTGGCTTCACCCAC	0.597													36	17	---	---	---	---	PASS
EDEM1	9695	broad.mit.edu	37	3	5243501	5243501	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5243501C>T	uc003bqi.2	+	4	882	c.750C>T	c.(748-750)GAC>GAT	p.D250D	EDEM1_uc011asz.1_Silent_p.D28D|EDEM1_uc003bqh.2_Silent_p.D250D	NM_014674	NP_055489	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like	250	Lumenal (Potential).				ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			ovary(2)|breast(1)	3				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		CCTTTGGTGACATGACAATTA	0.453													160	199	---	---	---	---	PASS
ATP2B2	491	broad.mit.edu	37	3	10442733	10442733	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10442733T>A	uc003bvt.2	-	5	1124	c.685A>T	c.(685-687)ATC>TTC	p.I229F	ATP2B2_uc003bvv.2_Missense_Mutation_p.I229F|ATP2B2_uc003bvw.2_Missense_Mutation_p.I229F|ATP2B2_uc010hdp.2_Missense_Mutation_p.I229F|ATP2B2_uc010hdo.2_5'UTR	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	229	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						TTGCCCTGGATGAAGAGGCCG	0.577													65	76	---	---	---	---	PASS
PLCL2	23228	broad.mit.edu	37	3	17051265	17051265	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17051265A>G	uc011awc.1	+	5	508	c.403A>G	c.(403-405)ATG>GTG	p.M135V	PLCL2_uc010het.1_Missense_Mutation_p.M17V|PLCL2_uc011awd.1_Missense_Mutation_p.M17V	NM_001144382	NP_001137854	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2 isoform 1	143	PH.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(2)|ovary(1)|lung(1)	4						TATTAATTCAATGGTTGAGGG	0.433													66	84	---	---	---	---	PASS
GOLGA4	2803	broad.mit.edu	37	3	37388761	37388761	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37388761G>C	uc003cgv.2	+	21	6854	c.6550G>C	c.(6550-6552)GAG>CAG	p.E2184Q	GOLGA4_uc003cgw.2_Missense_Mutation_p.E2199Q|GOLGA4_uc010hgs.2_Intron|GOLGA4_uc003cgx.2_Missense_Mutation_p.E2065Q	NM_002078	NP_002069	Q13439	GOGA4_HUMAN	golgi autoantigen, golgin subfamily a, 4	2184	GRIP.|Potential.				Golgi to plasma membrane protein transport	Golgi membrane|trans-Golgi network	protein binding			ovary(2)|breast(1)|central_nervous_system(1)	4						AGTGCTTTTTGAGTATATGAT	0.353													5	155	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38647446	38647446	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38647446T>G	uc003cio.2	-	10	1528	c.1334A>C	c.(1333-1335)CAC>CCC	p.H445P	SCN5A_uc003cin.2_Missense_Mutation_p.H445P|SCN5A_uc003cil.3_Missense_Mutation_p.H445P|SCN5A_uc010hhi.2_Missense_Mutation_p.H445P|SCN5A_uc010hhk.2_Missense_Mutation_p.H445P|SCN5A_uc011ayr.1_Missense_Mutation_p.H445P|SCN5A_uc010hhj.1_Missense_Mutation_p.H56P	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	445			H -> D (found in patients with atrial fibrillation).		blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	ACCCACCTCGTGTTCTTTCTT	0.557													52	13	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38739751	38739751	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38739751G>C	uc003ciq.2	-	27	4960	c.4960C>G	c.(4960-4962)CTC>GTC	p.L1654V		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	1654	IV.				sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	ATCTGGAAGAGGCACAGCATG	0.582													114	46	---	---	---	---	PASS
ZNF445	353274	broad.mit.edu	37	3	44496716	44496716	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44496716C>G	uc003cnf.2	-	3	674	c.326G>C	c.(325-327)GGG>GCG	p.G109A	ZNF445_uc011azv.1_Missense_Mutation_p.G109A|ZNF445_uc011azw.1_Missense_Mutation_p.G109A	NM_181489	NP_852466	P59923	ZN445_HUMAN	zinc finger protein 445	109	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		CCGGAGCTCCCCAGGCAGGAT	0.612													52	21	---	---	---	---	PASS
EPHA6	285220	broad.mit.edu	37	3	96706267	96706267	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96706267C>T	uc010how.1	+	3	587	c.544C>T	c.(544-546)CGT>TGT	p.R182C	EPHA6_uc003drp.1_Missense_Mutation_p.R182C	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	87	Ephrin-binding.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						CAACTGGCTTCGTACAAACTG	0.428													386	135	---	---	---	---	PASS
TBC1D23	55773	broad.mit.edu	37	3	100029275	100029275	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100029275G>C	uc003dtt.2	+	14	1619	c.1442G>C	c.(1441-1443)AGA>ACA	p.R481T	TBC1D23_uc003dts.2_Missense_Mutation_p.R481T	NM_018309	NP_060779	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	481						intracellular	Rab GTPase activator activity			ovary(1)|liver(1)	2						TCAAGTGATAGAGGAATGAAA	0.333													55	244	---	---	---	---	PASS
ZNF80	7634	broad.mit.edu	37	3	113955287	113955287	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113955287G>A	uc010hqo.2	-	1	1139	c.635C>T	c.(634-636)ACT>ATT	p.T212I	ZNF80_uc003ebf.2_RNA	NM_007136	NP_009067	P51504	ZNF80_HUMAN	zinc finger protein 80	212						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Lung NSC(201;0.0233)|all_neural(597;0.0837)				CTTTCCTGCAGTGTGGGTCAT	0.483													260	53	---	---	---	---	PASS
GAP43	2596	broad.mit.edu	37	3	115395334	115395334	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115395334G>T	uc003ebq.2	+	2	891	c.505G>T	c.(505-507)GAT>TAT	p.D169Y	GAP43_uc003ebr.2_Missense_Mutation_p.D205Y	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2	169					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		TAAACAAGCCGATGTGCctgc	0.423													17	7	---	---	---	---	PASS
IGSF11	152404	broad.mit.edu	37	3	118623603	118623603	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118623603G>T	uc003ebw.2	-	6	993	c.746C>A	c.(745-747)ACT>AAT	p.T249N	IGSF11_uc011biv.1_Intron|IGSF11_uc003ebx.2_Missense_Mutation_p.T225N|IGSF11_uc003eby.2_Missense_Mutation_p.T248N|IGSF11_uc003ebz.2_Missense_Mutation_p.T224N|IGSF11_uc010hqs.2_Missense_Mutation_p.T248N	NM_001015887	NP_001015887	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11 isoform b	249	Helical; (Potential).				cell adhesion|regulation of growth	integral to membrane|plasma membrane	receptor activity				0						AACTGCACCAGTGCCAATGGC	0.348													367	95	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121190857	121190857	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121190857G>A	uc003eee.3	-	22	6827	c.6698C>T	c.(6697-6699)TCA>TTA	p.S2233L	POLQ_uc003eed.2_Missense_Mutation_p.S1405L	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	2233					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		GTGCGACTGTGATACAGGATA	0.358								DNA_polymerases_(catalytic_subunits)					89	115	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121217337	121217337	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121217337C>A	uc003eee.3	-	13	2269	c.2140G>T	c.(2140-2142)GCC>TCC	p.A714S		NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	714					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		TTATGGATGGCCATTTGTCGA	0.373								DNA_polymerases_(catalytic_subunits)					165	57	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121217338	121217338	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121217338C>T	uc003eee.3	-	13	2268	c.2139G>A	c.(2137-2139)ATG>ATA	p.M713I		NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	713					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		TATGGATGGCCATTTGTCGAT	0.373								DNA_polymerases_(catalytic_subunits)					167	57	---	---	---	---	PASS
DTX3L	151636	broad.mit.edu	37	3	122284753	122284753	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122284753G>A	uc003efk.2	+	2	324	c.235G>A	c.(235-237)GAA>AAA	p.E79K	DTX3L_uc010hrj.2_Missense_Mutation_p.E79K|PARP9_uc003eff.3_5'Flank|PARP9_uc010hri.2_5'Flank|PARP9_uc011bjs.1_5'Flank|PARP9_uc003efg.2_5'Flank|PARP9_uc003efi.2_5'Flank|PARP9_uc003efh.2_5'Flank|PARP9_uc003efj.2_5'Flank	NM_138287	NP_612144	Q8TDB6	DTX3L_HUMAN	deltex 3-like	79					histone monoubiquitination|response to DNA damage stimulus	cytoplasm|nucleus	histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)	4				GBM - Glioblastoma multiforme(114;0.0459)		ACTTGTTGACGAAAAACCTGT	0.393													122	72	---	---	---	---	PASS
PODXL2	50512	broad.mit.edu	37	3	127379755	127379755	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127379755G>T	uc003ejq.2	+	3	908	c.884G>T	c.(883-885)GGT>GTT	p.G295V		NM_015720	NP_056535	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2 precursor	295	Extracellular (Potential).				leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding			ovary(1)|central_nervous_system(1)	2						GGAGCAGCTGGTTTGTCTGGC	0.622													64	9	---	---	---	---	PASS
ZIC4	84107	broad.mit.edu	37	3	147113820	147113820	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147113820G>T	uc003ewd.1	-	3	780	c.507C>A	c.(505-507)GCC>GCA	p.A169A	ZIC4_uc003ewc.1_Silent_p.A99A|ZIC4_uc011bno.1_Silent_p.A219A	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	169						nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						AAATGTGGTTGGCCTGTTCCG	0.602													202	193	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128490	147128490	+	Nonsense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128490C>G	uc003ewe.2	+	1	1310	c.591C>G	c.(589-591)TAC>TAG	p.Y197*		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	197					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TGCACGGCTACGGGCCCATGA	0.657													21	105	---	---	---	---	PASS
P2RY13	53829	broad.mit.edu	37	3	151046740	151046740	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151046740C>G	uc003eyv.2	-	2	125	c.104G>C	c.(103-105)CGG>CCG	p.R35P	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron	NM_176894	NP_795713	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	35	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(3)|lung(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			TCTGGGGCACCGCTCAGATCT	0.468													78	607	---	---	---	---	PASS
IGSF10	285313	broad.mit.edu	37	3	151161095	151161095	+	Silent	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151161095A>G	uc011bod.1	-	5	5640	c.5640T>C	c.(5638-5640)GAT>GAC	p.D1880D	IGSF10_uc011bob.1_5'Flank|IGSF10_uc011boc.1_5'Flank	NM_178822	NP_849144	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10 precursor	1880	Ig-like C2-type 5.				cell differentiation|multicellular organismal development|ossification	extracellular region				skin(7)|ovary(5)|central_nervous_system(1)	13			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CTTCAGTGCCATCAGAGAGGA	0.438													45	286	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			68	217	---	---	---	---	PASS
YEATS2	55689	broad.mit.edu	37	3	183433028	183433028	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183433028G>A	uc003fly.2	+	2	273	c.78G>A	c.(76-78)CGG>CGA	p.R26R		NM_018023	NP_060493	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	26					histone H3 acetylation|negative regulation of transcription from RNA polymerase II promoter	Ada2/Gcn5/Ada3 transcription activator complex	TBP-class protein binding			ovary(3)|large_intestine(1)	4	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CAAATAAGCGGCATAAAGCAA	0.398													6	402	---	---	---	---	PASS
HTR3E	285242	broad.mit.edu	37	3	183823570	183823570	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183823570G>A	uc010hxq.2	+	7	1204	c.738G>A	c.(736-738)AGG>AGA	p.R246R	HTR3E_uc003fml.3_Silent_p.R231R|HTR3E_uc003fmm.2_Silent_p.R261R|HTR3E_uc010hxr.2_Silent_p.R272R|HTR3E_uc003fmn.2_Silent_p.R246R	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	246	Extracellular (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			TCAGGCGCAGGCCCAGTCTCT	0.532													84	124	---	---	---	---	PASS
LPP	4026	broad.mit.edu	37	3	188584086	188584086	+	Silent	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188584086G>C	uc003frs.1	+	9	1755	c.1509G>C	c.(1507-1509)GTG>GTC	p.V503V	LPP_uc011bsg.1_Silent_p.V356V|LPP_uc011bsi.1_Silent_p.V503V|LPP_uc011bsj.1_Silent_p.V340V	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation	503	LIM zinc-binding 2.				cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TCACCTGCGTGATGTGCCACC	0.552			T	HMGA2|MLL|C12orf9	lipoma|leukemia								41	245	---	---	---	---	PASS
CLDN16	10686	broad.mit.edu	37	3	190122607	190122607	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190122607G>T	uc003fsi.2	+	3	552	c.484G>T	c.(484-486)GGA>TGA	p.G162*	CLDN16_uc010hze.2_Intron	NM_006580	NP_006571	Q9Y5I7	CLD16_HUMAN	claudin 16	162	Helical; (Potential).				calcium-independent cell-cell adhesion|cellular metal ion homeostasis|excretion	integral to membrane|tight junction	identical protein binding|magnesium ion transmembrane transporter activity|structural molecule activity			ovary(1)	1	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		AGCTGGGTTTGGATTTCTCAC	0.483													157	249	---	---	---	---	PASS
OPA1	4976	broad.mit.edu	37	3	193335603	193335603	+	Intron	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193335603C>T	uc003ftm.2	+						OPA1_uc003ftg.2_Missense_Mutation_p.A196V|OPA1_uc003fth.2_Missense_Mutation_p.A160V|OPA1_uc003fti.2_Intron|OPA1_uc003ftj.2_Missense_Mutation_p.A196V|OPA1_uc003ftk.2_Intron|OPA1_uc003ftl.2_Missense_Mutation_p.A160V|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GTCATAGGAGCTTCTGACCTA	0.338													20	205	---	---	---	---	PASS
DLG1	1739	broad.mit.edu	37	3	196921445	196921445	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196921445C>T	uc003fxo.3	-	5	524	c.334G>A	c.(334-336)GAT>AAT	p.D112N	DLG1_uc011bud.1_5'UTR|DLG1_uc003fxn.3_Missense_Mutation_p.D112N|DLG1_uc011bue.1_Missense_Mutation_p.D112N|DLG1_uc010ial.2_Missense_Mutation_p.D112N|DLG1_uc011buf.1_RNA|DLG1_uc003fxp.2_RNA|DLG1_uc010iam.1_Missense_Mutation_p.D112N	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1	112					actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		GTATCTTCATCCTGATACCTG	0.358													101	128	---	---	---	---	PASS
GPR78	27201	broad.mit.edu	37	4	8582963	8582963	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8582963T>A	uc003glk.2	+	1	673	c.254T>A	c.(253-255)CTG>CAG	p.L85Q	CPZ_uc003gll.2_RNA	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	85	Helical; Name=3; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						ATTGGCTTCCTGGACACCTTC	0.706													7	3	---	---	---	---	PASS
PACRGL	133015	broad.mit.edu	37	4	20706339	20706339	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20706339C>T	uc010iek.2	+	3	500	c.109C>T	c.(109-111)CAG>TAG	p.Q37*	PACRGL_uc003gpu.2_RNA|PACRGL_uc010iei.1_Nonsense_Mutation_p.Q85*|PACRGL_uc003gpz.2_Nonsense_Mutation_p.Q37*|PACRGL_uc011bxm.1_Nonsense_Mutation_p.Q37*|PACRGL_uc003gqa.2_Nonsense_Mutation_p.Q37*|PACRGL_uc003gpx.3_RNA|PACRGL_uc003gpv.2_Nonsense_Mutation_p.Q37*|PACRGL_uc003gpw.2_RNA|PACRGL_uc010iej.1_RNA|PACRGL_uc011bxn.1_Nonsense_Mutation_p.Q37*|PACRGL_uc003gpy.2_Nonsense_Mutation_p.Q37*	NM_145048	NP_659485	Q8N7B6	PACRL_HUMAN	PARK2 co-regulated-like isoform 1	37							binding				0						GAATGCAGTTCAGGGAAGCAA	0.388													46	87	---	---	---	---	PASS
PPARGC1A	10891	broad.mit.edu	37	4	23816007	23816007	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23816007C>A	uc003gqs.2	-	8	1219	c.1099G>T	c.(1099-1101)GGA>TGA	p.G367*	PPARGC1A_uc003gqt.2_RNA|PPARGC1A_uc011bxp.1_RNA|PPARGC1A_uc010ier.1_RNA	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor	367					androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding			ovary(2)|lung(2)|kidney(2)|skin(2)	8		Breast(46;0.0503)				TCCTCGTGTCCACCAGTGAGG	0.478													134	36	---	---	---	---	PASS
C4orf19	55286	broad.mit.edu	37	4	37592264	37592264	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:37592264G>A	uc003gsw.3	+	4	770	c.587G>A	c.(586-588)GGA>GAA	p.G196E	C4orf19_uc003gsy.3_Missense_Mutation_p.G196E	NM_001104629	NP_001098099	Q8IY42	CD019_HUMAN	hypothetical protein LOC55286	196											0						GGCCCAGCTGGAGACAACGTT	0.493													32	81	---	---	---	---	PASS
TBC1D1	23216	broad.mit.edu	37	4	38117547	38117547	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38117547A>T	uc003gtb.2	+	16	3117	c.2774A>T	c.(2773-2775)CAG>CTG	p.Q925L	TBC1D1_uc011byd.1_Missense_Mutation_p.Q1019L|TBC1D1_uc010ifd.2_Missense_Mutation_p.Q712L	NM_015173	NP_055988	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family,	925	Rab-GAP TBC.					nucleus	Rab GTPase activator activity			ovary(1)	1						CTGCGGAAACAGTATCGGCCA	0.408													42	110	---	---	---	---	PASS
TLR6	10333	broad.mit.edu	37	4	38828694	38828694	+	3'UTR	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38828694C>T	uc003gtm.2	-	1					TLR6_uc010ifg.1_3'UTR	NM_006068	NP_006059	Q9Y2C9	TLR6_HUMAN	toll-like receptor 6 precursor						activation of NF-kappaB-inducing kinase activity|cellular response to diacyl bacterial lipopeptide|defense response to bacterium|detection of diacyl bacterial lipopeptide|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-6 biosynthetic process|positive regulation of JUN kinase activity|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	integral to plasma membrane|phagocytic vesicle membrane	lipopeptide binding|transmembrane receptor activity			ovary(2)	2						GTTGAATTTCCTAAATTTTTT	0.363													19	23	---	---	---	---	PASS
KLB	152831	broad.mit.edu	37	4	39409024	39409024	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39409024C>T	uc003gua.2	+	1	552	c.455C>T	c.(454-456)TCA>TTA	p.S152L	KLB_uc011byj.1_Missense_Mutation_p.S152L	NM_175737	NP_783864	Q86Z14	KLOTB_HUMAN	klotho beta	152	Extracellular (Potential).|Glycosyl hydrolase-1 1.				carbohydrate metabolic process	integral to membrane|plasma membrane	cation binding|fibroblast growth factor binding|hydrolase activity, hydrolyzing O-glycosyl compounds			skin(1)	1						TATCAATTTTCAATTTCCTGG	0.403													79	268	---	---	---	---	PASS
SLC30A9	10463	broad.mit.edu	37	4	42088152	42088152	+	3'UTR	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42088152G>A	uc003gwl.2	+	18					SLC30A9_uc011byx.1_3'UTR	NM_006345	NP_006336	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter),						nucleotide-excision repair|zinc ion transport	cytoskeleton|integral to membrane|nucleus	cation transmembrane transporter activity|nucleotide binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3						GAGTTTGATGGAATGAATCAC	0.418													44	153	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47538480	47538480	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47538480G>A	uc003gxk.1	+	8	1206	c.1042G>A	c.(1042-1044)GAA>AAA	p.E348K	ATP10D_uc003gxl.1_5'UTR|ATP10D_uc003gxj.3_Missense_Mutation_p.E348K	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	348	Extracellular (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						GAGCAGGTATGAAAAGATGCA	0.353													125	350	---	---	---	---	PASS
MUC7	4589	broad.mit.edu	37	4	71346520	71346520	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71346520G>T	uc011cat.1	+	4	347	c.59G>T	c.(58-60)AGT>ATT	p.S20I	MUC7_uc011cau.1_Missense_Mutation_p.S20I|MUC7_uc003hfj.2_Missense_Mutation_p.S20I	NM_001145006	NP_001138478	Q8TAX7	MUC7_HUMAN	mucin 7, secreted precursor	20						extracellular region	protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4			Lung(101;0.211)			ctgcagTTCAGTGAAGGTCGA	0.229													62	151	---	---	---	---	PASS
DCK	1633	broad.mit.edu	37	4	71895091	71895091	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71895091T>G	uc003hfx.2	+	7	1067	c.779T>G	c.(778-780)TTG>TGG	p.L260W	DCK_uc011cbb.1_Missense_Mutation_p.L188W	NM_000788	NP_000779	P27707	DCK_HUMAN	deoxycytidine kinase	260					purine base metabolic process|purine-containing compound salvage|pyrimidine base metabolic process|pyrimidine nucleoside salvage|pyrimidine nucleotide metabolic process	cytosol|nucleus	ATP binding|deoxycytidine kinase activity|drug binding|phosphotransferase activity, alcohol group as acceptor|protein homodimerization activity			ovary(1)	1			Lung(101;0.235)		Cladribine(DB00242)|Clofarabine(DB00631)|Decitabine(DB01262)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Pemetrexed(DB00642)|Zalcitabine(DB00943)	TTGAGTACTTTGTGATCTTGC	0.323													33	109	---	---	---	---	PASS
PRKG2	5593	broad.mit.edu	37	4	82096031	82096031	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:82096031C>A	uc003hmh.2	-	2	558	c.544G>T	c.(544-546)GAA>TAA	p.E182*	PRKG2_uc011cch.1_Nonsense_Mutation_p.E182*	NM_006259	NP_006250	Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	182	cGMP 1.				platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			breast(3)|central_nervous_system(2)|ovary(1)|large_intestine(1)	7						TACATGCATTCCACCATGTCT	0.403													91	246	---	---	---	---	PASS
FAM190A	401145	broad.mit.edu	37	4	91389426	91389426	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91389426G>C	uc003hsv.3	+	5	1985	c.1645G>C	c.(1645-1647)GCA>CCA	p.A549P	FAM190A_uc010ikv.2_RNA|FAM190A_uc003hsw.2_Missense_Mutation_p.A549P	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1	549										large_intestine(1)|ovary(1)	2						CTCATGTGCCGCAGTAGTTCT	0.373													17	44	---	---	---	---	PASS
C4orf31	79625	broad.mit.edu	37	4	121957411	121957411	+	3'UTR	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121957411G>C	uc003idq.1	-	4						NM_024574	NP_078850	Q8TB73	CD031_HUMAN	hypothetical protein LOC79625 precursor												0						ATCTCTATAAGAAGGTAACTA	0.378													157	67	---	---	---	---	PASS
MAP9	79884	broad.mit.edu	37	4	156294374	156294374	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156294374G>T	uc003ios.2	-	4	659	c.395C>A	c.(394-396)TCT>TAT	p.S132Y	MAP9_uc011cin.1_Missense_Mutation_p.S132Y|MAP9_uc010iqa.1_RNA|MAP9_uc003iot.1_Missense_Mutation_p.S132Y|MAP9_uc010iqb.1_Missense_Mutation_p.S60Y	NM_001039580	NP_001034669	Q49MG5	MAP9_HUMAN	aster-associated protein	132					cell division|mitosis	cytoplasm|microtubule|spindle				ovary(1)|central_nervous_system(1)	2	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		CTTATTTTGAGATTCAGAGAA	0.343													4	214	---	---	---	---	PASS
GLRA3	8001	broad.mit.edu	37	4	175565062	175565062	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175565062G>C	uc003ity.1	-	10	1773	c.1270C>G	c.(1270-1272)CGG>GGG	p.R424G	GLRA3_uc003itz.1_Missense_Mutation_p.R409G	NM_006529	NP_006520	O75311	GLRA3_HUMAN	glycine receptor, alpha 3 isoform a	424	Cytoplasmic (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)	TTCTTGGCCCGGTCGATAAAG	0.428													125	37	---	---	---	---	PASS
ASB5	140458	broad.mit.edu	37	4	177138037	177138037	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177138037T>A	uc003iuq.1	-	6	810	c.794A>T	c.(793-795)GAG>GTG	p.E265V	ASB5_uc003iup.1_Missense_Mutation_p.E212V	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	265					intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		TCGCAGAAGCTCTGTATTTTT	0.378													159	49	---	---	---	---	PASS
CCDC111	201973	broad.mit.edu	37	4	185578371	185578371	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185578371C>T	uc003iwk.2	+	3	510	c.77C>T	c.(76-78)TCA>TTA	p.S26L	CCDC111_uc010isd.1_RNA|CCDC111_uc003iwj.2_Missense_Mutation_p.S26L|CCDC111_uc003iwl.2_Missense_Mutation_p.S26L|CCDC111_uc003iwm.2_Intron|CCDC111_uc003iwn.2_5'UTR	NM_152683	NP_689896	Q96LW4	CC111_HUMAN	coiled-coil domain containing 111	26					DNA replication, synthesis of RNA primer		DNA primase activity			central_nervous_system(1)	1		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.00531)|Hepatocellular(41;0.00932)|Renal(120;0.0246)|Prostate(90;0.0283)|all_hematologic(60;0.0749)|all_neural(102;0.131)		all cancers(43;5.84e-27)|Epithelial(43;2.2e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.28e-11)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.03e-05)|Colorectal(24;7.57e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000249)|COAD - Colon adenocarcinoma(29;0.000502)|LUSC - Lung squamous cell carcinoma(40;0.00995)|READ - Rectum adenocarcinoma(43;0.173)		CCGTTGTCCTCAGTGTATAGA	0.393													93	31	---	---	---	---	PASS
PLEKHG4B	153478	broad.mit.edu	37	5	171336	171336	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171336A>G	uc003jak.2	+	14	2809	c.2759A>G	c.(2758-2760)CAG>CGG	p.Q920R		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	920	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		CAGGACAAGCAGCGGGAGCTA	0.677													14	31	---	---	---	---	PASS
FASTKD3	79072	broad.mit.edu	37	5	7867395	7867395	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7867395C>T	uc003jeb.2	-	2	939	c.802G>A	c.(802-804)GAA>AAA	p.E268K	FASTKD3_uc011cmp.1_5'UTR|FASTKD3_uc003jec.2_Intron|MTRR_uc010itn.1_5'Flank|MTRR_uc003jee.3_5'Flank|MTRR_uc003jed.2_5'Flank|MTRR_uc003jef.3_5'Flank|MTRR_uc003jeg.3_5'Flank|MTRR_uc010ito.2_5'Flank	NM_024091	NP_076996	Q14CZ7	FAKD3_HUMAN	FAST kinase domains 3	268					apoptosis|cellular respiration	mitochondrion	ATP binding|protein kinase activity			ovary(2)|breast(1)|pancreas(1)	4						TCCACTTTTTCAGTACATGCC	0.353													44	306	---	---	---	---	PASS
DNAJC21	134218	broad.mit.edu	37	5	34941281	34941281	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34941281G>C	uc003jjc.2	+	7	1203	c.976G>C	c.(976-978)GAA>CAA	p.E326Q	DNAJC21_uc003jjb.2_Missense_Mutation_p.E326Q|DNAJC21_uc010iuu.1_Missense_Mutation_p.E210Q	NM_001012339	NP_001012339	Q5F1R6	DJC21_HUMAN	DnaJ homology subfamily A member 5 isoform 2	326	Glu-rich.|C2H2-type 1.				protein folding	ribosome	heat shock protein binding|nucleic acid binding|unfolded protein binding|zinc ion binding			breast(1)|skin(1)	2	all_lung(31;7.08e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)			GTTCAAGACAGAAAAGGCGTA	0.274													69	131	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41010115	41010115	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41010115G>A	uc003jmj.3	-	31	3692	c.3202C>T	c.(3202-3204)CAG>TAG	p.Q1068*	HEATR7B2_uc003jmi.3_Nonsense_Mutation_p.Q623*	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1068							binding			ovary(6)|central_nervous_system(2)	8						AGAATGAACTGAAAACTTTCT	0.403													25	189	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41061737	41061737	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41061737C>T	uc003jmj.3	-	6	1040	c.550G>A	c.(550-552)GAC>AAC	p.D184N		NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	184							binding			ovary(6)|central_nervous_system(2)	8						AAGATCTTGTCAGACAGTCGG	0.488													176	218	---	---	---	---	PASS
ADAMTS6	11174	broad.mit.edu	37	5	64468801	64468801	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64468801C>T	uc003jtp.2	-	23	3759	c.2945G>A	c.(2944-2946)CGG>CAG	p.R982Q	ADAMTS6_uc003jto.2_RNA|ADAMTS6_uc003jtq.2_RNA	NM_197941	NP_922932	Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1	982	TSP type-1 4.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CAGAACAATCCGATGCTTGAA	0.438													95	44	---	---	---	---	PASS
MCCC2	64087	broad.mit.edu	37	5	70895597	70895597	+	Intron	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70895597C>T	uc003kbs.3	+						MCCC2_uc010iyv.1_Intron|MCCC2_uc003kbt.3_Intron|MCCC2_uc003kbu.1_5'Flank	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)						leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	GGTGAGTATTCTACTTGTGCT	0.423													69	26	---	---	---	---	PASS
BHMT	635	broad.mit.edu	37	5	78423587	78423587	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78423587C>T	uc003kfu.3	+	7	923	c.818C>T	c.(817-819)CCC>CTC	p.P273L	BHMT_uc011cti.1_Missense_Mutation_p.P120L	NM_001713	NP_001704	Q93088	BHMT1_HUMAN	betaine-homocysteine methyltransferase	273	Hcy-binding.				protein methylation|regulation of homocysteine metabolic process	cytoplasm	betaine-homocysteine S-methyltransferase activity|homocysteine S-methyltransferase activity|zinc ion binding			ovary(1)	1		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	GGACTGGAACCCAGAGTTGCC	0.418													50	14	---	---	---	---	PASS
DMXL1	1657	broad.mit.edu	37	5	118485540	118485540	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118485540C>A	uc003ksd.2	+	18	4199	c.4018C>A	c.(4018-4020)CGG>AGG	p.R1340R	DMXL1_uc010jcl.1_Silent_p.R1340R	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1340										ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TGGTAAAGTTCGGAGAGCCAA	0.473													4	116	---	---	---	---	PASS
ZNF608	57507	broad.mit.edu	37	5	123983395	123983395	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:123983395G>A	uc003ktq.1	-	4	2805	c.2682C>T	c.(2680-2682)CCC>CCT	p.P894P	ZNF608_uc003ktr.1_Intron|ZNF608_uc003kts.1_Silent_p.P894P|ZNF608_uc003ktt.1_Silent_p.P894P	NM_020747	NP_065798	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	894						intracellular	zinc ion binding			skin(3)|ovary(2)|lung(1)	6		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TGGAAGGGCTGGGAGCGTTGT	0.567													73	28	---	---	---	---	PASS
NRG2	9542	broad.mit.edu	37	5	139231387	139231387	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139231387C>A	uc003lex.1	-	9	1799	c.1574G>T	c.(1573-1575)CGT>CTT	p.R525L	NRG2_uc003lev.1_Missense_Mutation_p.R533L|NRG2_uc003lew.1_Missense_Mutation_p.R527L|NRG2_uc003ley.1_Missense_Mutation_p.R519L	NM_004883	NP_004874	O14511	NRG2_HUMAN	neuregulin 2 isoform 1	525	Cytoplasmic (Potential).				embryo development	extracellular region|integral to membrane|plasma membrane	growth factor activity			pancreas(2)|breast(2)|ovary(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCTCAGAACGTTCCAGGCT	0.622													36	6	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140516585	140516585	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140516585G>A	uc003liq.2	+	1	1786	c.1569G>A	c.(1567-1569)CTG>CTA	p.L523L		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	523	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACGAGGCCCTGCAGGCGTTCG	0.692													52	20	---	---	---	---	PASS
PCDHB6	56130	broad.mit.edu	37	5	140530216	140530216	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140530216T>A	uc003lir.2	+	1	378	c.378T>A	c.(376-378)AAT>AAA	p.N126K	PCDHB6_uc011dah.1_5'UTR	NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	126	Extracellular (Potential).|Cadherin 1.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGATATAAATGACCACGCCC	0.453													42	142	---	---	---	---	PASS
PCDHGA12	26025	broad.mit.edu	37	5	140811280	140811280	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140811280A>T	uc003lkt.1	+	1	1123	c.954A>T	c.(952-954)GAA>GAT	p.E318D	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc011dba.1_Missense_Mutation_p.E318D	NM_003735	NP_003726	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12 isoform 1	318	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCAGATGGAAGTGCAAGCAA	0.488													150	46	---	---	---	---	PASS
MIR1294	100302181	broad.mit.edu	37	5	153726779	153726779	+	RNA	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153726779G>A	hsa-mir-1294|MI0006356	+			c.114G>A			GALNT10_uc003lvg.1_Intron|GALNT10_uc003lvh.2_Intron|GALNT10_uc010jic.2_Intron|GALNT10_uc010jid.2_Intron																	0						aggactcagtgaggtgaaact	0.015													27	70	---	---	---	---	PASS
FARS2	10667	broad.mit.edu	37	6	5613522	5613522	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:5613522G>T	uc010jnv.1	+	6	1522	c.1186G>T	c.(1186-1188)GTT>TTT	p.V396F	FARS2_uc003mwr.2_Missense_Mutation_p.V396F	NM_006567	NP_006558	O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2 precursor	396	FDX-ACB.				phenylalanyl-tRNA aminoacylation|tRNA processing	mitochondrial matrix|soluble fraction	ATP binding|magnesium ion binding|phenylalanine-tRNA ligase activity|tRNA binding				0	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	GGTGGAAAAGGTTGATCTCAT	0.378													105	134	---	---	---	---	PASS
LY86	9450	broad.mit.edu	37	6	6654803	6654803	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6654803G>A	uc003mwy.1	+	5	466	c.432G>A	c.(430-432)CTG>CTA	p.L144L	LY86_uc003mwz.1_RNA	NM_004271	NP_004262	O95711	LY86_HUMAN	MD-1, RP105-associated precursor	144					apoptosis|cell proliferation|humoral immune response|inflammatory response|innate immune response	extracellular space|plasma membrane					0	Ovarian(93;0.0377)					TGCTGGAACTGTACACTGAAA	0.453													28	61	---	---	---	---	PASS
RREB1	6239	broad.mit.edu	37	6	7231394	7231394	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7231394C>T	uc003mxc.2	+	10	3452	c.3062C>T	c.(3061-3063)TCA>TTA	p.S1021L	RREB1_uc003mxb.2_Missense_Mutation_p.S1021L|RREB1_uc010jnx.2_Missense_Mutation_p.S1021L	NM_001003698	NP_001003698	Q92766	RREB1_HUMAN	ras responsive element binding protein 1 isoform	1021	Pro-rich.				multicellular organismal development|positive regulation of transcription, DNA-dependent|Ras protein signal transduction|transcription from RNA polymerase II promoter	cytoplasm|nuclear speck	DNA binding|zinc ion binding			ovary(4)|large_intestine(2)|pancreas(2)|skin(2)|breast(1)	11	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				ATCTACTCCTCAGCCCTGGTC	0.687													23	60	---	---	---	---	PASS
CDKAL1	54901	broad.mit.edu	37	6	20548873	20548873	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20548873C>T	uc003ndc.1	+	4	397	c.223C>T	c.(223-225)CAT>TAT	p.H75Y	CDKAL1_uc003ndd.1_Missense_Mutation_p.H75Y|CDKAL1_uc003nde.1_Intron|CDKAL1_uc010jpo.1_Missense_Mutation_p.H75Y|CDKAL1_uc003ndb.1_Missense_Mutation_p.H75Y	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein	75	MTTase N-terminal.				RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			GGGTTGTTCTCATAATAATTC	0.289													37	159	---	---	---	---	PASS
CDKAL1	54901	broad.mit.edu	37	6	20758859	20758859	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20758859G>A	uc003ndc.1	+	7	676	c.502G>A	c.(502-504)GAG>AAG	p.E168K	CDKAL1_uc003ndd.1_Missense_Mutation_p.E168K|CDKAL1_uc003nde.1_Missense_Mutation_p.E98K	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein	168	MTTase N-terminal.				RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			AGAAGTTGTGGAGGAGACAAT	0.343													48	78	---	---	---	---	PASS
SLC17A4	10050	broad.mit.edu	37	6	25771236	25771236	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25771236C>A	uc003nfe.2	+	6	821	c.702C>A	c.(700-702)ATC>ATA	p.I234I	SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Intron|SLC17A4_uc003nfg.2_Silent_p.I171I|SLC17A4_uc010jqa.2_5'Flank	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN	solute carrier family 17 (sodium phosphate),	234	Helical; (Potential).				phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			skin(1)	1						TCTTCTATATCTTTGGTGAGT	0.413													132	206	---	---	---	---	PASS
HIST1H4E	8367	broad.mit.edu	37	6	26205150	26205150	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26205150G>C	uc003ngy.2	+	1	278	c.278G>C	c.(277-279)AGA>ACA	p.R93T		NM_003545	NP_003536	P62805	H4_HUMAN	histone cluster 1, H4e	93					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1		all_hematologic(11;0.196)				GCGCTGAAGAGACAGGGACGC	0.537													40	47	---	---	---	---	PASS
SCAND3	114821	broad.mit.edu	37	6	28543072	28543072	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28543072C>T	uc003nlo.2	-	3	2028	c.1410G>A	c.(1408-1410)CAG>CAA	p.Q470Q		NM_052923	NP_443155	Q6R2W3	SCND3_HUMAN	SCAN domain containing 3	470	Integrase catalytic.				DNA integration|viral reproduction	nucleus	DNA binding|protein dimerization activity|sequence-specific DNA binding transcription factor activity			ovary(1)	1						CTGCAGAACTCTGGCTTTGGC	0.423													105	128	---	---	---	---	PASS
CCHCR1	54535	broad.mit.edu	37	6	31112995	31112995	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31112995C>T	uc003nsr.3	-	13	1680	c.1557G>A	c.(1555-1557)CTG>CTA	p.L519L	CCHCR1_uc011dne.1_Silent_p.L519L|CCHCR1_uc003nsq.3_Silent_p.L572L|CCHCR1_uc003nsp.3_Silent_p.L608L|CCHCR1_uc010jsk.1_Silent_p.L519L	NM_019052	NP_061925	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1 isoform	519	Potential.				cell differentiation|multicellular organismal development	cytoplasm|nucleus	protein binding			skin(1)	1						CACTCAGCTGCAGTTCTGCAT	0.632													50	49	---	---	---	---	PASS
MDGA1	266727	broad.mit.edu	37	6	37622620	37622620	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37622620C>T	uc003onu.1	-	5	1847	c.668G>A	c.(667-669)GGC>GAC	p.G223D	MDGA1_uc003onw.3_5'Flank	NM_153487	NP_705691	Q8NFP4	MDGA1_HUMAN	MAM domain containing	223	Ig-like 2.				brain development|neuron migration|spinal cord association neuron differentiation	anchored to plasma membrane				central_nervous_system(2)	2						GTCTGGGATGCCGCACACGTT	0.597													5	322	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43403605	43403605	+	Silent	SNP	C	G	G	rs148989774	byFrequency	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43403605C>G	uc003ouy.1	+	5	1940	c.1725C>G	c.(1723-1725)CTC>CTG	p.L575L	ABCC10_uc003ouz.1_Silent_p.L532L|ABCC10_uc010jyo.1_5'UTR	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	575						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			AGCTTTTCCTCGACCTTCCAA	0.557													58	132	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43403612	43403612	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43403612C>T	uc003ouy.1	+	5	1947	c.1732C>T	c.(1732-1734)CCA>TCA	p.P578S	ABCC10_uc003ouz.1_Missense_Mutation_p.P535S|ABCC10_uc010jyo.1_5'UTR	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	578						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CCTCGACCTTCCAAACCACAA	0.562													59	140	---	---	---	---	PASS
XPO5	57510	broad.mit.edu	37	6	43538265	43538265	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43538265C>T	uc003ovp.2	-	5	806	c.595G>A	c.(595-597)GAA>AAA	p.E199K		NM_020750	NP_065801	Q9HAV4	XPO5_HUMAN	exportin 5	199					gene silencing by RNA	cytosol|nucleoplasm	protein binding|tRNA binding			skin(2)|breast(1)|kidney(1)	4	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			TTTACATTTTCTTGAAGTGTG	0.373													304	421	---	---	---	---	PASS
TDRD6	221400	broad.mit.edu	37	6	46657768	46657768	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46657768G>C	uc003oyj.2	+	1	1903	c.1903G>C	c.(1903-1905)GAT>CAT	p.D635H	TDRD6_uc010jze.2_Missense_Mutation_p.D629H	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	635					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)|skin(1)	6			Lung(136;0.192)			CCATATTCTTGATAAACAGGA	0.388													30	134	---	---	---	---	PASS
C6orf138	442213	broad.mit.edu	37	6	47847084	47847084	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47847084G>A	uc011dwm.1	-	3	1530	c.1445C>T	c.(1444-1446)TCG>TTG	p.S482L	C6orf138_uc011dwn.1_Missense_Mutation_p.S246L	NM_001013732	NP_001013754	Q6ZW05	CF138_HUMAN	hypothetical protein LOC442213	499						integral to membrane	hedgehog receptor activity			central_nervous_system(1)	1						AACACTTGGCGAATCACTGGC	0.453													12	44	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51890805	51890805	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51890805G>T	uc003pah.1	-	32	4079	c.3803C>A	c.(3802-3804)GCC>GAC	p.A1268D	PKHD1_uc003pai.2_Missense_Mutation_p.A1268D	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	1268	Extracellular (Potential).|IPT/TIG 7.				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GACCTCCACGGCAGCTGGAAC	0.597													64	63	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57467211	57467211	+	Intron	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57467211G>T	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ATCATGGTAAGTGCCTCCACT	0.438													36	228	---	---	---	---	PASS
SMAP1	60682	broad.mit.edu	37	6	71501383	71501383	+	Intron	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71501383A>G	uc003pfr.2	+						SMAP1_uc011dxy.1_Intron|SMAP1_uc003pfs.2_Intron|SMAP1_uc010kao.2_Intron|SMAP1_uc010kap.2_Intron	NM_001044305	NP_001037770	Q8IYB5	SMAP1_HUMAN	stromal membrane-associated GTPase-activating						regulation of ARF GTPase activity	plasma membrane	ARF GTPase activator activity|zinc ion binding				0						TTTCACCTGTACTCCACAGAT	0.398													143	112	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72960793	72960793	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72960793G>T	uc003pga.2	+	14	2619	c.2542G>T	c.(2542-2544)GAG>TAG	p.E848*	RIMS1_uc011dyb.1_Nonsense_Mutation_p.E474*|RIMS1_uc003pgc.2_Nonsense_Mutation_p.E474*|RIMS1_uc010kaq.2_Nonsense_Mutation_p.E322*|RIMS1_uc011dyc.1_Nonsense_Mutation_p.E322*|RIMS1_uc010kar.2_Nonsense_Mutation_p.E241*|RIMS1_uc011dyd.1_Nonsense_Mutation_p.E307*|RIMS1_uc003pgf.2_Nonsense_Mutation_p.E65*|RIMS1_uc003pgg.2_Nonsense_Mutation_p.E65*|RIMS1_uc003pgi.2_Nonsense_Mutation_p.E65*|RIMS1_uc003pgh.2_Nonsense_Mutation_p.E65*|RIMS1_uc003pgd.2_Nonsense_Mutation_p.E65*|RIMS1_uc003pge.2_Nonsense_Mutation_p.E65*|RIMS1_uc011dye.1_5'Flank|RIMS1_uc003pgb.3_Nonsense_Mutation_p.E474*|RIMS1_uc010kas.1_Nonsense_Mutation_p.E307*	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	848	C2 1.				calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				ATTTCTTGGAGAGGTGATGTA	0.294													11	12	---	---	---	---	PASS
KCNQ5	56479	broad.mit.edu	37	6	73904271	73904271	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73904271C>A	uc003pgk.2	+	14	2280	c.1933C>A	c.(1933-1935)CAG>AAG	p.Q645K	KCNQ5_uc011dyh.1_Missense_Mutation_p.Q664K|KCNQ5_uc011dyi.1_Missense_Mutation_p.Q655K|KCNQ5_uc010kat.2_Missense_Mutation_p.Q636K|KCNQ5_uc011dyj.1_Missense_Mutation_p.Q535K|KCNQ5_uc011dyk.1_Missense_Mutation_p.Q395K	NM_019842	NP_062816	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like	645					protein complex assembly|synaptic transmission	voltage-gated potassium channel complex	inward rectifier potassium channel activity			ovary(4)|large_intestine(2)|skin(1)	7		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)		GGCTTCATTCCAGATCCCACC	0.488													54	111	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75893640	75893640	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75893640G>A	uc003phs.2	-	9	1384	c.1218C>T	c.(1216-1218)GCC>GCT	p.A406A	COL12A1_uc003pht.2_Intron|COL12A1_uc003phu.1_Silent_p.A64A	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	406	Fibronectin type-III 2.				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						TTCCCTTCATGGCGGAAACAC	0.493													105	309	---	---	---	---	PASS
BCKDHB	594	broad.mit.edu	37	6	80877385	80877385	+	Intron	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80877385C>G	uc003pjd.2	+						BCKDHB_uc003pje.2_Intron	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		TTTTTCTTTTCTATTTTAAGG	0.343													3	136	---	---	---	---	PASS
ORC3L	23595	broad.mit.edu	37	6	88331736	88331736	+	Intron	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88331736G>A	uc003pmh.2	+						ORC3L_uc011dzl.1_Intron|ORC3L_uc011dzm.1_Intron|ORC3L_uc011dzn.1_Intron|ORC3L_uc003pmg.2_Intron|ORC3L_uc003pmi.2_Intron|ORC3L_uc011dzo.1_Intron|ORC3L_uc011dzp.1_Intron	NM_012381	NP_036513	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3 isoform 2						cell cycle checkpoint|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	nuclear origin of replication recognition complex|nucleoplasm	DNA replication origin binding|protein binding				0		all_cancers(76;9.05e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;5.29e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.0469)		TTGAAGGTAGGAATGTGAATG	0.318													26	130	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90442303	90442303	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90442303G>C	uc003pnn.1	-	34	5031	c.4915C>G	c.(4915-4917)CTG>GTG	p.L1639V		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	1639					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ATGTACACCAGGCATGCAGCA	0.507													53	153	---	---	---	---	PASS
MCHR2	84539	broad.mit.edu	37	6	100390984	100390984	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100390984C>T	uc003pqh.1	-	4	743	c.428G>A	c.(427-429)CGT>CAT	p.R143H	MCHR2_uc003pqi.1_Missense_Mutation_p.R143H	NM_001040179	NP_001035269	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	143	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		TGTTCTCCAACGTGTCAGTCG	0.478													101	115	---	---	---	---	PASS
SIM1	6492	broad.mit.edu	37	6	100838429	100838429	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100838429C>T	uc003pqj.3	-	11	2316	c.2109G>A	c.(2107-2109)CGG>CGA	p.R703R	SIM1_uc010kcu.2_Silent_p.R703R	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	703	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		CAAAATACTGCCGGTGAGAGC	0.448													4	214	---	---	---	---	PASS
GPR6	2830	broad.mit.edu	37	6	110301089	110301089	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110301089G>A	uc011eaw.1	+	2	954	c.774G>A	c.(772-774)CAG>CAA	p.Q258Q	GPR6_uc011eav.1_Silent_p.Q273Q|GPR6_uc003ptu.2_Silent_p.Q258Q	NM_005284	NP_005275	P46095	GPR6_HUMAN	G protein-coupled receptor 6	258	Cytoplasmic (Potential).					integral to plasma membrane					0		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		ACGCGCACCAGATCGCGCTGC	0.657													14	43	---	---	---	---	PASS
RNF146	81847	broad.mit.edu	37	6	127608136	127608136	+	Silent	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127608136A>G	uc003qav.2	+	3	537	c.378A>G	c.(376-378)GAA>GAG	p.E126E	RNF146_uc003qat.2_Silent_p.E125E|RNF146_uc003qau.2_Silent_p.E125E|RNF146_uc003qaw.2_Silent_p.E125E	NM_030963	NP_112225	Q9NTX7	RN146_HUMAN	ring finger protein 146	126	WWE.				positive regulation of canonical Wnt receptor signaling pathway|protein autoubiquitination|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol	poly-ADP-D-ribose binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(1)	1				GBM - Glioblastoma multiforme(226;0.0407)|all cancers(137;0.2)		GAGAGCTGGAAGATGCTTTTT	0.403													35	113	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129612773	129612773	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129612773G>T	uc003qbn.2	+	20	2869	c.2764G>T	c.(2764-2766)GCC>TCC	p.A922S	LAMA2_uc003qbo.2_Missense_Mutation_p.A922S	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	922	Laminin EGF-like 9.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TCGCTGTAATGCCGGTGGCTC	0.448													20	73	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136600997	136600997	+	Missense_Mutation	SNP	C	T	T	rs148729378	byFrequency	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136600997C>T	uc003qgx.1	-	3	261	c.8G>A	c.(7-9)CGC>CAC	p.R3H	BCLAF1_uc003qgw.1_Missense_Mutation_p.R3H|BCLAF1_uc003qgy.1_Missense_Mutation_p.R3H|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R3H	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	3					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		AGAATTGGAGCGACCCATTTC	0.308													57	78	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152540135	152540135	+	Intron	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152540135T>A	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGGAGCTCTGTACCTGTAATG	0.438										HNSCC(10;0.0054)			56	141	---	---	---	---	PASS
PLG	5340	broad.mit.edu	37	6	161132158	161132158	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161132158G>T	uc003qtm.3	+	4	405	c.342G>T	c.(340-342)ACG>ACT	p.T114T		NM_000301	NP_000292	P00747	PLMN_HUMAN	plasminogen	114	Kringle 1.				extracellular matrix disassembly|fibrinolysis|negative regulation of cell proliferation|negative regulation of cell-substrate adhesion|negative regulation of fibrinolysis|platelet activation|platelet degranulation|positive regulation of fibrinolysis|proteolysis|tissue remodeling	extracellular space|extrinsic to external side of plasma membrane|platelet alpha granule lumen	apolipoprotein binding|cell surface binding|serine-type endopeptidase activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Aminocaproic Acid(DB00513)|Streptokinase(DB00086)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ACAGAGGGACGATGTCCAAAA	0.443													49	48	---	---	---	---	PASS
PHF10	55274	broad.mit.edu	37	6	170105257	170105257	+	Silent	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170105257A>G	uc011egy.1	-	11	1462	c.1383T>C	c.(1381-1383)TTT>TTC	p.F461F	C6orf120_uc003qxb.2_3'UTR|PHF10_uc011egz.1_Silent_p.F459F	NM_018288	NP_060758	Q8WUB8	PHF10_HUMAN	PHD finger protein 10 isoform a	461	PHD-type 2; degenerate.				nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	npBAF complex	zinc ion binding			urinary_tract(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		GGCCCACACAAAAAGTATGAT	0.403													29	116	---	---	---	---	PASS
RADIL	55698	broad.mit.edu	37	7	4841590	4841590	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4841590C>A	uc003snj.1	-	12	2709	c.2536G>T	c.(2536-2538)GCC>TCC	p.A846S	RADIL_uc003sng.1_RNA|RADIL_uc003sni.1_Missense_Mutation_p.A351S|RADIL_uc011jwc.1_Missense_Mutation_p.A606S|RADIL_uc011jwd.1_RNA|RADIL_uc003snh.1_Missense_Mutation_p.A142S	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor	846					cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		CAGCTCGGGGCCTCCAGGTGC	0.687													3	3	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11416260	11416260	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11416260T>C	uc003ssf.3	-	26	5078	c.4826A>G	c.(4825-4827)TAC>TGC	p.Y1609C	uc003ssb.2_Intron|THSD7A_uc003ssd.3_Missense_Mutation_p.Y113C	NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1609	Helical; (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TGCTACACCGTAAACCCAGGT	0.348										HNSCC(18;0.044)			5	7	---	---	---	---	PASS
SCIN	85477	broad.mit.edu	37	7	12692275	12692275	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12692275A>T	uc003ssn.3	+	16	2293	c.2083A>T	c.(2083-2085)AAA>TAA	p.K695*	SCIN_uc010ktt.2_RNA|SCIN_uc003sso.3_Nonsense_Mutation_p.K448*	NM_001112706	NP_001106177	Q9Y6U3	ADSV_HUMAN	scinderin isoform 1	695	Ca(2+)-dependent actin binding.				actin filament capping|actin filament severing|actin nucleation|calcium ion-dependent exocytosis|negative regulation of cell proliferation|positive regulation of apoptosis|positive regulation of megakaryocyte differentiation|positive regulation of secretion|regulation of chondrocyte differentiation	cell cortex|cytoskeleton	1-phosphatidylinositol binding|actin filament binding|calcium ion binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding			ovary(2)	2				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TGTCATCATAAAACAGGGCCA	0.403													50	82	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21847576	21847576	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21847576C>T	uc003svc.2	+	64	10293	c.10262C>T	c.(10261-10263)ACG>ATG	p.T3421M		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3421					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GTTCTTCTCACGGCGGCATTT	0.478									Kartagener_syndrome				10	16	---	---	---	---	PASS
NUPL2	11097	broad.mit.edu	37	7	23224737	23224737	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23224737T>G	uc003svu.2	+	2	429	c.170T>G	c.(169-171)GTC>GGC	p.V57G	NUPL2_uc003svv.2_RNA|NUPL2_uc003svw.2_Intron|NUPL2_uc011jyw.1_RNA|NUPL2_uc003svx.2_5'UTR	NM_007342	NP_031368	O15504	NUPL2_HUMAN	nucleoporin like 2	57					carbohydrate metabolic process|glucose transport|mRNA transport|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nuclear pore	nuclear export signal receptor activity|nucleic acid binding|zinc ion binding			skin(2)|ovary(1)	3						TATTCCAATGTCATCCAGCCA	0.353													40	70	---	---	---	---	PASS
DFNA5	1687	broad.mit.edu	37	7	24749940	24749940	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:24749940C>A	uc010kus.1	-	6	853	c.765G>T	c.(763-765)CTG>CTT	p.L255L	DFNA5_uc003swz.2_Silent_p.L91L|DFNA5_uc003sxa.1_Silent_p.L255L|DFNA5_uc010kut.1_Silent_p.L91L	NM_001127453	NP_001120925	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5 protein isoform	255					sensory perception of sound					ovary(1)	1						CCAGGGGGTCCAGGTAGACAG	0.473													66	87	---	---	---	---	PASS
ANLN	54443	broad.mit.edu	37	7	36450708	36450708	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36450708A>G	uc003tff.2	+	7	1532	c.1328A>G	c.(1327-1329)GAC>GGC	p.D443G	ANLN_uc011kaz.1_Missense_Mutation_p.D355G|ANLN_uc003tfg.2_Missense_Mutation_p.D443G|ANLN_uc010kxe.2_Missense_Mutation_p.D443G	NM_018685	NP_061155	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	443	Interaction with F-actin.				cytokinesis|mitosis|regulation of exit from mitosis|septin ring assembly	actomyosin contractile ring|nucleus	actin binding			ovary(2)|skin(1)	3						GGCCGATTTGACAAGGGCAAT	0.378													26	53	---	---	---	---	PASS
INHBA	3624	broad.mit.edu	37	7	41729530	41729530	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41729530G>A	uc003thq.2	-	2	1234	c.999C>T	c.(997-999)ATC>ATT	p.I333I	INHBA_uc003thr.2_Silent_p.I333I	NM_002192	NP_002183	P08476	INHBA_HUMAN	inhibin beta A precursor	333					cell cycle arrest|cell surface receptor linked signaling pathway|defense response|erythrocyte differentiation|eyelid development in camera-type eye|G1/S transition of mitotic cell cycle|growth|hair follicle development|hemoglobin biosynthetic process|hemopoietic progenitor cell differentiation|induction of apoptosis|male gonad development|negative regulation of B cell differentiation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|odontogenesis|ovarian follicle development|palate development|positive regulation of erythrocyte differentiation|positive regulation of follicle-stimulating hormone secretion|positive regulation of ovulation|positive regulation of transcription from RNA polymerase II promoter|progesterone secretion|regulation of activin receptor signaling pathway	activin A complex|inhibin A complex	cytokine activity|follistatin binding|growth factor activity|hormone activity|identical protein binding|signal transducer activity			lung(5)|ovary(1)	6						CATTCCAGCCGATGTCCTTGA	0.557										TSP Lung(11;0.080)			47	84	---	---	---	---	PASS
URGCP	55665	broad.mit.edu	37	7	43917524	43917524	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43917524T>A	uc003tiw.2	-	6	1595	c.1538A>T	c.(1537-1539)CAG>CTG	p.Q513L	URGCP_uc003tiu.2_Missense_Mutation_p.Q470L|URGCP_uc003tiv.2_Missense_Mutation_p.Q438L|URGCP_uc003tix.2_Missense_Mutation_p.Q504L|URGCP_uc003tiy.2_Missense_Mutation_p.Q470L|URGCP_uc003tiz.2_Missense_Mutation_p.Q470L|URGCP_uc011kbj.1_Missense_Mutation_p.Q470L	NM_001077663	NP_001071131	Q8TCY9	URGCP_HUMAN	up-regulated gene 4 isoform 3	513					cell cycle	centrosome|nucleus	GTP binding			ovary(2)|liver(1)|skin(1)	4						CCACTGGAGCTGGCAGAACTC	0.612													37	61	---	---	---	---	PASS
FIGNL1	63979	broad.mit.edu	37	7	50514445	50514445	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50514445G>T	uc003tpc.2	-	4	918	c.541C>A	c.(541-543)CGT>AGT	p.R181S	FIGNL1_uc003tpb.2_Missense_Mutation_p.R70S|FIGNL1_uc003tpd.2_Missense_Mutation_p.R181S|FIGNL1_uc003tpe.2_Missense_Mutation_p.R181S|FIGNL1_uc010kyy.2_Missense_Mutation_p.R181S	NM_001042762	NP_001036227	Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	181					ATP metabolic process|negative regulation of apoptosis|osteoblast differentiation|osteoblast proliferation|regulation of cell cycle	cytoplasm|nucleus	ATP binding|magnesium ion binding|nucleoside-triphosphatase activity			ovary(3)	3	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				AGTTTCAAACGATTGCTCTCC	0.468													70	158	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88965897	88965897	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88965897C>T	uc011khi.1	+	4	4139	c.3601C>T	c.(3601-3603)CAC>TAC	p.H1201Y		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1201						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AGTTCCAGTTCACCAGCACAC	0.502										HNSCC(36;0.09)			52	211	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88966053	88966053	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88966053C>G	uc011khi.1	+	4	4295	c.3757C>G	c.(3757-3759)CCA>GCA	p.P1253A		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1253						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GACTCTGACTCCAACCATTAT	0.468										HNSCC(36;0.09)			80	301	---	---	---	---	PASS
GTPBP10	85865	broad.mit.edu	37	7	89976052	89976052	+	5'UTR	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89976052A>G	uc003ukm.1	+	1					GTPBP10_uc003uki.1_Intron|GTPBP10_uc003ukj.1_Intron|GTPBP10_uc003ukk.1_Intron|GTPBP10_uc003ukl.1_Intron|GTPBP10_uc003ukn.1_5'UTR|GTPBP10_uc003uko.1_5'UTR	NM_033107	NP_149098	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 isoform 2						ribosome biogenesis	chromosome|nucleolus	GTP binding|GTPase activity|magnesium ion binding				0						GGCCTGTTGCAGCCATGGTGC	0.607											OREG0018158	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	76	157	---	---	---	---	PASS
GNGT1	2792	broad.mit.edu	37	7	93536070	93536070	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93536070C>T	uc003unc.1	+	2	160	c.12C>T	c.(10-12)ATC>ATT	p.I4I	GNGT1_uc003umx.1_RNA	NM_021955	NP_068774	P63211	GBG1_HUMAN	guanine nucleotide binding protein (G protein),	4					G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	GTPase activity|signal transducer activity				0	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			TGCCAGTAATCAATATTGAGG	0.408													39	155	---	---	---	---	PASS
GPC2	221914	broad.mit.edu	37	7	99774750	99774750	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99774750C>A	uc003utv.2	-	1	241	c.73G>T	c.(73-75)GAG>TAG	p.E25*	GPC2_uc010lgr.2_RNA|GPC2_uc003utw.1_Nonsense_Mutation_p.E25*|STAG3_uc010lgs.1_5'Flank|STAG3_uc003utx.1_5'Flank|STAG3_uc011kjk.1_5'Flank	NM_152742	NP_689955	Q8N158	GPC2_HUMAN	glypican 2 precursor	25						anchored to membrane|endoplasmic reticulum|extracellular space|plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			breast(1)|pancreas(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACCTTTGCCTCGCTCCCGGGT	0.642													8	41	---	---	---	---	PASS
PILRA	29992	broad.mit.edu	37	7	99971996	99971996	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99971996C>T	uc003uuo.1	+	2	606	c.394C>T	c.(394-396)CGG>TGG	p.R132W	PILRA_uc011kjn.1_Missense_Mutation_p.R132W|PILRA_uc011kjo.1_Missense_Mutation_p.R132W|PILRA_uc003uup.1_Missense_Mutation_p.R132W|PILRA_uc003uuq.1_Missense_Mutation_p.R132W	NM_013439	NP_038467	Q9UKJ1	PILRA_HUMAN	paired immunoglobulin-like type 2 receptor alpha	132	Extracellular (Potential).|Ig-like V-type.				interspecies interaction between organisms	extracellular region|integral to membrane|plasma membrane	protein binding|receptor activity			skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCTGGACACACGGAGCTCAGG	0.602													8	267	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101918593	101918593	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101918593G>C	uc003uyt.2	+	17	1545	c.1526G>C	c.(1525-1527)AGG>ACG	p.R509T	CUX1_uc011kkn.1_Missense_Mutation_p.R470T|CUX1_uc003uyw.2_Missense_Mutation_p.R463T|CUX1_uc003uyv.2_Missense_Mutation_p.R493T|CUX1_uc003uyu.2_Missense_Mutation_p.R507T|CUX1_uc003uyz.2_RNA	NM_001913	NP_001904	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform b	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						TCCAGCCAGAGGGAGCGCTTC	0.617													51	102	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126173012	126173012	+	Silent	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126173012T>A	uc003vlr.2	-	8	2735	c.2424A>T	c.(2422-2424)GCA>GCT	p.A808A	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Silent_p.A808A|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	808	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane		p.A808E(1)		lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	TTACCTTTTCTGCTGACTGGG	0.368										HNSCC(24;0.065)			45	82	---	---	---	---	PASS
GRM8	2918	broad.mit.edu	37	7	126173262	126173262	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126173262T>C	uc003vlr.2	-	8	2485	c.2174A>G	c.(2173-2175)TAT>TGT	p.Y725C	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.Y725C|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	725	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	CTGCTCTCCATAGTCAATGAT	0.507										HNSCC(24;0.065)			33	45	---	---	---	---	PASS
CCDC136	64753	broad.mit.edu	37	7	128446913	128446913	+	Splice_Site	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128446913G>T	uc003vnv.1	+	9	1786	c.1419_splice	c.e9+1	p.K473_splice	CCDC136_uc003vnu.1_Intron|CCDC136_uc003vnw.1_Splice_Site_p.K420_splice|CCDC136_uc003vnx.1_Splice_Site_p.K289_splice|CCDC136_uc010llq.1_Splice_Site|CCDC136_uc003vny.1_Splice_Site_p.K83_splice	NM_022742	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136							integral to membrane	protein binding			ovary(2)	2						CAATGAGAAGGTAAAAGAAGC	0.572													11	26	---	---	---	---	PASS
CPA4	51200	broad.mit.edu	37	7	129939246	129939246	+	Splice_Site	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129939246T>C	uc003vpr.2	+	3	332	c.285_splice	c.e3+2	p.Q95_splice	CPA4_uc011kpd.1_Splice_Site_p.Q95_splice|CPA4_uc011kpe.1_Intron	NM_016352	NP_057436	Q9UI42	CBPA4_HUMAN	carboxypeptidase A4 preproprotein						histone acetylation|proteolysis	extracellular region	metallocarboxypeptidase activity|zinc ion binding			ovary(1)	1	Melanoma(18;0.0435)					GACCTGCAGGTAGGTAGACTA	0.512													43	64	---	---	---	---	PASS
HIPK2	28996	broad.mit.edu	37	7	139299139	139299139	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139299139G>A	uc003vvf.3	-	8	2057	c.1883C>T	c.(1882-1884)GCT>GTT	p.A628V	HIPK2_uc003vvd.3_Missense_Mutation_p.A601V	NM_022740	NP_073577	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2 isoform	628	Interaction with SKI and SMAD1.				apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|negative regulation of BMP signaling pathway|positive regulation of JNK cascade|positive regulation of transforming growth factor beta receptor signaling pathway|SMAD protein signal transduction|transcription, DNA-dependent|virus-host interaction	centrosome|nuclear membrane|PML body	ATP binding|protein serine/threonine kinase activity|SMAD binding|transcription corepressor activity|virion binding			ovary(3)|central_nervous_system(3)|skin(1)	7	Melanoma(164;0.205)					GGCCACTGCAGCCATGGATGC	0.597													21	20	---	---	---	---	PASS
SLC37A3	84255	broad.mit.edu	37	7	140035283	140035283	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140035283T>C	uc003vvo.2	-	15	1580	c.1414A>G	c.(1414-1416)ATC>GTC	p.I472V	SLC37A3_uc003vvn.2_Missense_Mutation_p.I50V|SLC37A3_uc003vvp.2_Missense_Mutation_p.Y371C|SLC37A3_uc010lnh.2_Missense_Mutation_p.I456V	NM_207113	NP_996996	Q8NCC5	SPX3_HUMAN	solute carrier family 37 (glycerol-3-phosphate	472	Helical; (Potential).				carbohydrate transport|transmembrane transport	integral to membrane				ovary(3)	3	Melanoma(164;0.0142)					AATGGCGAGATAAACACAATT	0.388													70	127	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142148961	142148961	+	Intron	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142148961C>A	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc010lnw.1_Missense_Mutation_p.D104Y					SubName: Full=V_segment translation product; Flags: Fragment;																		AGGGCCGAGTCCCCCAGCAAC	0.507													87	204	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142148962	142148962	+	Intron	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142148962C>A	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc010lnw.1_Silent_p.G103G					SubName: Full=V_segment translation product; Flags: Fragment;																		GGGCCGAGTCCCCCAGCAACA	0.502													87	199	---	---	---	---	PASS
TRPV5	56302	broad.mit.edu	37	7	142605794	142605794	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142605794C>T	uc003wby.1	-	15	2340	c.2076G>A	c.(2074-2076)GCG>GCA	p.A692A		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	692	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					TGCTCTGGGACGCGGTCCGGG	0.587													69	107	---	---	---	---	PASS
OR2F2	135948	broad.mit.edu	37	7	143632691	143632691	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143632691C>A	uc011ktv.1	+	1	366	c.366C>A	c.(364-366)CGC>CGA	p.R122R		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	122	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)					CCTATGACCGCCATGTGGCTG	0.552													84	108	---	---	---	---	PASS
OR2F2	135948	broad.mit.edu	37	7	143632692	143632692	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143632692C>T	uc011ktv.1	+	1	367	c.367C>T	c.(367-369)CAT>TAT	p.H123Y		NM_001004685	NP_001004685	O95006	OR2F2_HUMAN	olfactory receptor, family 2, subfamily F,	123	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|skin(1)	4	Melanoma(164;0.0903)					CTATGACCGCCATGTGGCTGT	0.557													83	106	---	---	---	---	PASS
ZNF777	27153	broad.mit.edu	37	7	149130003	149130003	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149130003C>T	uc003wfv.2	-	6	1523	c.1360G>A	c.(1360-1362)GAG>AAG	p.E454K		NM_015694	NP_056509	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	454	Glu-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			TCTTGTTCCTCTGTCTTGATC	0.483													5	7	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149492326	149492326	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149492326C>T	uc010lpk.2	+	43	6215	c.6215C>T	c.(6214-6216)GCC>GTC	p.A2072V		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	2072	F5/8 type C.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CTGGGGCTGGCCGGACTGGCT	0.682													4	95	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151945252	151945252	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151945252C>G	uc003wla.2	-	14	2486	c.2267G>C	c.(2266-2268)GGA>GCA	p.G756A		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	756					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		AGATTTGCCTCCTTGGTATGA	0.393			N		medulloblastoma								9	427	---	---	---	---	PASS
MYOM2	9172	broad.mit.edu	37	8	2056633	2056633	+	Intron	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2056633T>A	uc003wpx.3	+						MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2						muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TAAGTAAGCCTCCAGCCCTTC	0.478													85	25	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3256999	3256999	+	Silent	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3256999T>C	uc011kwk.1	-	16	2712	c.2322A>G	c.(2320-2322)GGA>GGG	p.G774G	CSMD1_uc011kwj.1_Silent_p.G166G	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	774	Extracellular (Potential).|CUB 5.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ATCCTGGCCATCCAGGAGGCA	0.388													14	55	---	---	---	---	PASS
DEFA6	1671	broad.mit.edu	37	8	6782451	6782451	+	Intron	SNP	T	C	C	rs141214756		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6782451T>C	uc003wqt.2	-							NM_001926	NP_001917	Q01524	DEF6_HUMAN	defensin, alpha 6 preproprotein						defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space					0			STAD - Stomach adenocarcinoma(24;0.0322)	COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		TTGTTGAGCCTGGGGACAGAG	0.473													50	17	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	16026196	16026196	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16026196T>A	uc003wwz.2	-	4	599	c.401A>T	c.(400-402)AAC>ATC	p.N134I	MSR1_uc010lsu.2_Missense_Mutation_p.N152I|MSR1_uc003wxa.2_Missense_Mutation_p.N134I|MSR1_uc003wxb.2_Missense_Mutation_p.N134I|MSR1_uc011kxz.1_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	134	Extracellular (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		GTCCATGAGGTTGGCTTCCAT	0.398													223	79	---	---	---	---	PASS
PSD3	23362	broad.mit.edu	37	8	18729986	18729986	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18729986G>C	uc003wza.2	-	3	491	c.388C>G	c.(388-390)CCC>GCC	p.P130A		NM_015310	NP_056125	Q9NYI0	PSD3_HUMAN	ADP-ribosylation factor guanine nucleotide	130					regulation of ARF protein signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	ARF guanyl-nucleotide exchange factor activity			ovary(3)	3				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		GAGTCAATGGGCTGTAAACTT	0.468													159	69	---	---	---	---	PASS
TEX15	56154	broad.mit.edu	37	8	30704887	30704887	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30704887C>T	uc003xil.2	-	1	1647	c.1647G>A	c.(1645-1647)GTG>GTA	p.V549V		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	549										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TTGCTGCTGACACTGCATTAT	0.333													157	52	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35406884	35406884	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35406884C>A	uc003xjr.1	+	2	506	c.178C>A	c.(178-180)CCA>ACA	p.P60T	UNC5D_uc003xjs.1_Missense_Mutation_p.P55T	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	60	Extracellular (Potential).|Ig-like.				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CATAGAGGAGCCAGATGATGC	0.483													76	32	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48869797	48869797	+	Silent	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48869797T>C	uc003xqi.2	-	3	315	c.258A>G	c.(256-258)CTA>CTG	p.L86L	PRKDC_uc003xqj.2_Silent_p.L86L|PRKDC_uc011ldh.1_Silent_p.L86L	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	86					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				ATAAAAACTTTAGGATTTCTT	0.303								NHEJ					33	8	---	---	---	---	PASS
SNTG1	54212	broad.mit.edu	37	8	51363290	51363290	+	Splice_Site	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51363290G>T	uc010lxy.1	+	9	734	c.363_splice	c.e9+1	p.V121_splice	SNTG1_uc003xqs.1_Splice_Site_p.V121_splice|SNTG1_uc010lxz.1_Splice_Site_p.V121_splice|SNTG1_uc011ldl.1_Splice_Site	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TGAAGAAGTGGTGAGTTTACT	0.328													36	14	---	---	---	---	PASS
NSMAF	8439	broad.mit.edu	37	8	59510091	59510091	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59510091C>T	uc003xtt.2	-	21	1861	c.1647G>A	c.(1645-1647)GAG>GAA	p.E549E	NSMAF_uc011lee.1_Silent_p.E580E	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation	549	BEACH.				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				TGGCTACCTTCTCATCAGGAT	0.423													4	184	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71069449	71069449	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71069449G>A	uc003xyn.1	-	11	1313	c.1151C>T	c.(1150-1152)CCG>CTG	p.P384L		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	384					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			AGTCAGATCCGGATTCATCAC	0.413			T	RUNXBP2	AML								38	14	---	---	---	---	PASS
DCAF4L2	138009	broad.mit.edu	37	8	88885511	88885511	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88885511T>C	uc003ydz.2	-	1	786	c.689A>G	c.(688-690)CAG>CGG	p.Q230R		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	230										ovary(1)	1						TGCAAACTGCTGGGCCAAGAC	0.517													100	51	---	---	---	---	PASS
TMEM74	157753	broad.mit.edu	37	8	109796805	109796805	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109796805C>T	uc003ymy.1	-	2	628	c.523G>A	c.(523-525)GAC>AAC	p.D175N	TMEM74_uc003ymx.2_Intron	NM_153015	NP_694560	Q96NL1	TMM74_HUMAN	transmembrane protein 74	175					autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			AAACCATAGTCTATAGACTTC	0.483													9	149	---	---	---	---	PASS
TMEM74	157753	broad.mit.edu	37	8	109796815	109796815	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109796815C>A	uc003ymy.1	-	2	618	c.513G>T	c.(511-513)GGG>GGT	p.G171G	TMEM74_uc003ymx.2_Intron	NM_153015	NP_694560	Q96NL1	TMM74_HUMAN	transmembrane protein 74	171					autophagy	autophagic vacuole membrane|cytoplasmic vesicle|integral to membrane|lysosomal membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			CTATAGACTTCCCTGAAGACG	0.483													6	156	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110476533	110476533	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110476533G>C	uc003yne.2	+	49	7576	c.7472G>C	c.(7471-7473)AGA>ACA	p.R2491T		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	2491	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCTTATGTAAGAGGCTGTGCA	0.428										HNSCC(38;0.096)			57	29	---	---	---	---	PASS
COL14A1	7373	broad.mit.edu	37	8	121228694	121228694	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121228694G>A	uc003yox.2	+	14	1967	c.1702G>A	c.(1702-1704)GTA>ATA	p.V568I	COL14A1_uc003yoy.2_Missense_Mutation_p.V246I|COL14A1_uc010mde.1_Missense_Mutation_p.V246I	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	568	Fibronectin type-III 4.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TTATCGAATTGTATATAACAA	0.348													58	222	---	---	---	---	PASS
ZFAT	57623	broad.mit.edu	37	8	135669838	135669838	+	Silent	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135669838T>A	uc003yup.2	-	2	337	c.162A>T	c.(160-162)ACA>ACT	p.T54T	ZFAT_uc003yun.2_Silent_p.T42T|ZFAT_uc003yuo.2_Silent_p.T42T|ZFAT_uc010meh.2_Silent_p.T42T|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Silent_p.T42T|ZFAT_uc010mej.2_Silent_p.T54T|ZFAT_uc003yur.2_Silent_p.T42T	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1	54					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			GGGGTTCAGGTGTACTCAGAG	0.512													71	44	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139164883	139164883	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139164883A>T	uc003yuy.2	-	13	2006	c.1835T>A	c.(1834-1836)CTC>CAC	p.L612H	FAM135B_uc003yux.2_Missense_Mutation_p.L513H|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.L174H|FAM135B_uc003yvb.2_Missense_Mutation_p.L174H	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	612										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TAATTCATGGAGAGTTGTTTT	0.458										HNSCC(54;0.14)			255	140	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143961094	143961094	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143961094C>T	uc003yxi.2	-	1	143	c.136G>A	c.(136-138)GGC>AGC	p.G46S	CYP11B1_uc003yxj.2_Missense_Mutation_p.G46S|CYP11B1_uc010mey.2_Missense_Mutation_p.G46S	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	46					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	CACCTGTTGCCTGGACGCCGG	0.632									Familial_Hyperaldosteronism_type_I				77	40	---	---	---	---	PASS
SH3GL2	6456	broad.mit.edu	37	9	17789429	17789429	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17789429G>A	uc003zna.2	+	6	793	c.505G>A	c.(505-507)GAT>AAT	p.D169N	SH3GL2_uc011lmx.1_Missense_Mutation_p.D134N|SH3GL2_uc011lmy.1_Missense_Mutation_p.D122N	NM_003026	NP_003017	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	169	BAR.				axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding			skin(1)	1				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		CCTGGATTTTGATTATAAGAA	0.423													68	38	---	---	---	---	PASS
SLC24A2	25769	broad.mit.edu	37	9	19786693	19786693	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19786693C>A	uc003zoa.1	-	1	234	c.172G>T	c.(172-174)GCC>TCC	p.A58S	SLC24A2_uc003zob.1_Missense_Mutation_p.A58S	NM_020344	NP_065077	Q9UI40	NCKX2_HUMAN	solute carrier family 24	58					visual perception	integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(3)	3				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		TCAGAAAAGGCACTGATTGAA	0.428													116	49	---	---	---	---	PASS
TLN1	7094	broad.mit.edu	37	9	35699040	35699040	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35699040C>G	uc003zxt.2	-	52	7342	c.6988G>C	c.(6988-6990)GCC>CCC	p.A2330P		NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	talin 1	2330	I/LWEQ.				axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding			lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTGGGTTTGGCCCGGGGCTTC	0.562													31	48	---	---	---	---	PASS
GNE	10020	broad.mit.edu	37	9	36223384	36223384	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36223384C>T	uc010mlh.2	-	8	1612	c.1397G>A	c.(1396-1398)AGA>AAA	p.R466K	CLTA_uc003zzf.1_Intron|GNE_uc010mlg.2_Missense_Mutation_p.R466K|GNE_uc011lpl.1_Missense_Mutation_p.R356K|GNE_uc010mli.2_Missense_Mutation_p.R497K|GNE_uc010mlj.2_Missense_Mutation_p.R461K	NM_005476	NP_005467	Q9Y223	GLCNE_HUMAN	UDP-N-acetylglucosamine-2-epimerase/N-	466	UDP-N-acetylglucosamine 2-epimerase.|N-acetylmannosamine kinase.				cell adhesion|lipopolysaccharide biosynthetic process|N-acetylneuraminate metabolic process|UDP-N-acetylglucosamine metabolic process		ATP binding|N-acylmannosamine kinase activity|UDP-N-acetylglucosamine 2-epimerase activity				0			STAD - Stomach adenocarcinoma(86;0.228)			TCCCAAAATTCTGCAGTTCAG	0.348													95	40	---	---	---	---	PASS
TRPM6	140803	broad.mit.edu	37	9	77397632	77397632	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77397632C>A	uc004ajl.1	-	22	3295	c.3057G>T	c.(3055-3057)TGG>TGT	p.W1019C	TRPM6_uc004ajk.1_Missense_Mutation_p.W1014C|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_Missense_Mutation_p.W305C	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	1019					response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						CGTATATCATCCAGTATGGCT	0.438													4	188	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79325074	79325074	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79325074T>G	uc010mpk.2	-	8	2240	c.2116A>C	c.(2116-2118)AAG>CAG	p.K706Q		NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	706					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						TCGAGGCTCTTTGGTTGAAAT	0.443													25	46	---	---	---	---	PASS
SYK	6850	broad.mit.edu	37	9	93636955	93636955	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93636955C>A	uc004aqz.2	+	9	1210	c.1005C>A	c.(1003-1005)GGC>GGA	p.G335G	SYK_uc004ara.2_Silent_p.G312G|SYK_uc004arb.2_Silent_p.G312G|SYK_uc004arc.2_Silent_p.G335G|SYK_uc011ltr.1_RNA|SYK_uc011lts.1_RNA|SYK_uc011ltt.1_RNA	NM_003177	NP_003168	P43405	KSYK_HUMAN	spleen tyrosine kinase isoform 1	335	Linker.				cell proliferation|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte cell-cell adhesion|neutrophil chemotaxis|organ morphogenesis|platelet activation|protein complex assembly	cytosol|T cell receptor complex	ATP binding|integrin binding|non-membrane spanning protein tyrosine kinase activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						GCATTGCAGGCCCCCAGAGAG	0.552			T	ETV6|ITK	MDS|peripheral T-cell lymphoma								6	410	---	---	---	---	PASS
ALDOB	229	broad.mit.edu	37	9	104192152	104192152	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104192152A>G	uc004bbk.2	-	3	291	c.209T>C	c.(208-210)ATC>ACC	p.I70T		NM_000035	NP_000026	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	70					fructose 1,6-bisphosphate metabolic process|fructose catabolic process|gluconeogenesis|glycolysis|NADH oxidation|positive regulation of ATPase activity|vacuolar proton-transporting V-type ATPase complex assembly	centriolar satellite|cytosol	ATPase binding|cytoskeletal protein binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding			skin(1)	1		Acute lymphoblastic leukemia(62;0.0559)				GCTCTGGTTGATGGAACTGTC	0.527													84	265	---	---	---	---	PASS
FKTN	2218	broad.mit.edu	37	9	108397528	108397528	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108397528G>A	uc004bcr.2	+	11	1585	c.1369G>A	c.(1369-1371)GTT>ATT	p.V457I	FKTN_uc011lvx.1_Intron|FKTN_uc004bcs.2_Missense_Mutation_p.V457I|FKTN_uc011lvy.1_3'UTR|FKTN_uc010mtm.2_Missense_Mutation_p.V325I	NM_001079802	NP_001073270	O75072	FKTN_HUMAN	fukutin	457	Lumenal (Potential).				muscle organ development|negative regulation of cell proliferation|negative regulation of JNK cascade|nervous system development|regulation of protein glycosylation	cis-Golgi network|endoplasmic reticulum|extracellular space|Golgi membrane|integral to membrane|nucleus	transferase activity			breast(2)|ovary(1)	3						GTGGGATGAGGTTATCCAGTT	0.398													142	40	---	---	---	---	PASS
KIAA1958	158405	broad.mit.edu	37	9	115421967	115421967	+	Missense_Mutation	SNP	A	G	G	rs143861651		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115421967A>G	uc004bgf.1	+	4	1944	c.1769A>G	c.(1768-1770)CAA>CGA	p.Q590R	KIAA1958_uc011lwx.1_Missense_Mutation_p.Q618R	NM_133465	NP_597722	Q8N8K9	K1958_HUMAN	hypothetical protein LOC158405	590										skin(1)	1						AAAGACCCCCAAAACCAGCCC	0.577													13	54	---	---	---	---	PASS
ZBTB6	10773	broad.mit.edu	37	9	125673735	125673735	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125673735G>C	uc004bnh.2	-	2	706	c.617C>G	c.(616-618)TCT>TGT	p.S206C		NM_006626	NP_006617	Q15916	ZBTB6_HUMAN	zinc finger and BTB domain containing 6	206					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTCTACTGTAGACAGCTCTGG	0.393													101	100	---	---	---	---	PASS
GARNL3	84253	broad.mit.edu	37	9	130147294	130147294	+	Intron	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130147294G>A	uc011mae.1	+						GARNL3_uc011mad.1_Intron|GARNL3_uc010mxi.2_Intron	NM_032293	NP_115669	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity|small GTPase regulator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						TGACACTCCCGTTCCCTTGCA	0.572													6	195	---	---	---	---	PASS
SURF4	6836	broad.mit.edu	37	9	136234304	136234304	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136234304C>T	uc004cdj.2	-	2	196	c.66G>A	c.(64-66)AAG>AAA	p.K22K	SURF4_uc011mda.1_Silent_p.K13K|SURF4_uc010nal.2_Silent_p.K54K|SURF4_uc011mdb.1_5'UTR|SURF4_uc011mdc.1_5'UTR|SURF4_uc011mdd.1_Silent_p.K22K	NM_033161	NP_149351	O15260	SURF4_HUMAN	surfeit 4	22						endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		GCAGGTACTGCTTTGTGACAC	0.657													21	81	---	---	---	---	PASS
SLC2A6	11182	broad.mit.edu	37	9	136338552	136338552	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136338552T>C	uc004cee.2	-	8	1302	c.1207A>G	c.(1207-1209)ATG>GTG	p.M403V	SLC2A6_uc004cef.2_Intron|SLC2A6_uc004ceg.2_Missense_Mutation_p.M380V	NM_017585	NP_060055	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose	403	Helical; Name=10; (Potential).					integral to membrane|plasma membrane	D-glucose transmembrane transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		ATGAAGAGCATGGTGGCCAGC	0.652													11	7	---	---	---	---	PASS
SARDH	1757	broad.mit.edu	37	9	136573495	136573495	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136573495C>G	uc004cep.3	-	11	1518	c.1384G>C	c.(1384-1386)GAG>CAG	p.E462Q	SARDH_uc004ceo.2_Missense_Mutation_p.E462Q|SARDH_uc011mdn.1_Missense_Mutation_p.E462Q|SARDH_uc011mdo.1_Missense_Mutation_p.E294Q	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	462					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GCGTAGGACTCATGGCTTCGC	0.652													62	39	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137657551	137657551	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137657551A>C	uc004cfe.2	+	21	2441	c.2059A>C	c.(2059-2061)AAG>CAG	p.K687Q		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	687	Triple-helical region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GCTTGGGCCGAAGGGGCCCCC	0.622													13	226	---	---	---	---	PASS
C9orf172	389813	broad.mit.edu	37	9	139739830	139739830	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139739830C>A	uc011meh.1	+	1	964	c.964C>A	c.(964-966)CGC>AGC	p.R322S	PHPT1_uc004cjp.2_5'Flank	NM_001080482	NP_001073951	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	322	Pro-rich.										0						CAGTCCAAGGCGCATGGGCGG	0.677													3	53	---	---	---	---	PASS
ZNF438	220929	broad.mit.edu	37	10	31133898	31133898	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31133898C>T	uc010qdz.1	-	8	2914	c.2479G>A	c.(2479-2481)GAG>AAG	p.E827K	ZNF438_uc001ivn.2_Missense_Mutation_p.E778K|ZNF438_uc010qdy.1_Missense_Mutation_p.E817K|ZNF438_uc001ivo.3_Missense_Mutation_p.E391K|ZNF438_uc009xlg.2_Missense_Mutation_p.E827K|ZNF438_uc001ivp.3_Missense_Mutation_p.E817K|ZNF438_uc010qea.1_Missense_Mutation_p.E827K|ZNF438_uc010qeb.1_Missense_Mutation_p.E827K	NM_182755	NP_877432	Q7Z4V0	ZN438_HUMAN	zinc finger protein 438 isoform a	827					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)				TCTCATTTCTCAGCTTCACTG	0.512													104	476	---	---	---	---	PASS
KIF5B	3799	broad.mit.edu	37	10	32309970	32309970	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32309970T>A	uc001iwe.3	-	19	2654	c.2184A>T	c.(2182-2184)AAA>AAT	p.K728N		NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B	728					stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				CAGTAATAAGTTTTGCTTTTG	0.348													131	75	---	---	---	---	PASS
RET	5979	broad.mit.edu	37	10	43606776	43606776	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43606776C>T	uc001jal.2	+	7	1575	c.1385C>T	c.(1384-1386)TCG>TTG	p.S462L	RET_uc001jak.1_Missense_Mutation_p.S462L|RET_uc010qez.1_Missense_Mutation_p.S208L	NM_020975	NP_066124	P07949	RET_HUMAN	ret proto-oncogene isoform a	462	Extracellular (Potential).				homophilic cell adhesion|positive regulation of metanephric glomerulus development|positive regulation of transcription, DNA-dependent|posterior midgut development	integral to membrane	ATP binding|calcium ion binding|transmembrane receptor protein tyrosine kinase activity			thyroid(404)|adrenal_gland(20)|lung(9)|large_intestine(5)|breast(4)|ovary(4)|central_nervous_system(3)|urinary_tract(1)|NS(1)	451		Ovarian(717;0.0423)			Sunitinib(DB01268)	GAGGACACCTCGGGGATCCTG	0.597		1	T|Mis|N|F	H4|PRKAR1A|NCOA4|PCM1|GOLGA5|TRIM33|KTN1|TRIM27|HOOK3	medullary thyroid| papillary thyroid|pheochromocytoma	medullary thyroid| papillary thyroid|pheochromocytoma	Hirschsprung disease		Multiple_Endocrine_Neoplasia_type_2B|Multiple_Endocrine_Neoplasia_type_2A|Familial_Medullary_Thyroid_Carcinoma				62	162	---	---	---	---	PASS
HK1	3098	broad.mit.edu	37	10	71146157	71146157	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71146157G>T	uc001jpl.3	+	13	2019	c.1918G>T	c.(1918-1920)GCG>TCG	p.A640S	HK1_uc001jpg.3_Missense_Mutation_p.A628S|HK1_uc001jph.3_Missense_Mutation_p.A644S|HK1_uc001jpi.3_Missense_Mutation_p.A644S|HK1_uc001jpj.3_Missense_Mutation_p.A675S|HK1_uc001jpk.3_Missense_Mutation_p.A639S|HK1_uc009xqd.2_Missense_Mutation_p.A518S	NM_000188	NP_000179	P19367	HXK1_HUMAN	hexokinase 1 isoform HKI	640	Catalytic.				glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1						ACTAAGGGATGCGATAAAAAG	0.383													20	81	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73437260	73437260	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73437260T>A	uc001jrx.3	+	15	1939	c.1562T>A	c.(1561-1563)CTG>CAG	p.L521Q	CDH23_uc001jry.2_Missense_Mutation_p.L137Q|CDH23_uc001jrz.2_Missense_Mutation_p.L137Q	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	521	Cadherin 5.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						ATTGCCAGGCTGGACTATGAG	0.587													3	15	---	---	---	---	PASS
DLG5	9231	broad.mit.edu	37	10	79584220	79584220	+	Silent	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79584220T>A	uc001jzk.2	-	14	2374	c.2304A>T	c.(2302-2304)GCA>GCT	p.A768A	DLG5_uc001jzj.2_Silent_p.A523A|DLG5_uc009xru.1_RNA|DLG5_uc001jzl.3_Silent_p.A372A	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5	768	PDZ 2.				cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TGTTGTCCAGTGCAATGCCAT	0.567													20	45	---	---	---	---	PASS
POLR3A	11128	broad.mit.edu	37	10	79784336	79784336	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79784336C>G	uc001jzn.2	-	5	710	c.616G>C	c.(616-618)GAA>CAA	p.E206Q		NM_007055	NP_008986	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	206					innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			GGCTCCACTTCTTTATTATGT	0.353													28	84	---	---	---	---	PASS
NRG3	10718	broad.mit.edu	37	10	84118601	84118601	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84118601G>A	uc001kco.2	+	2	957	c.930G>A	c.(928-930)CTG>CTA	p.L310L	NRG3_uc010qlz.1_Silent_p.L310L|NRG3_uc001kcp.2_Silent_p.L89L|NRG3_uc001kcq.2_5'UTR	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1	310	EGF-like.|Extracellular (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TCGAAACCCTGACCGGATCCC	0.567													18	71	---	---	---	---	PASS
MMRN2	79812	broad.mit.edu	37	10	88702234	88702234	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88702234G>A	uc001kea.2	-	6	2434	c.2307C>T	c.(2305-2307)GAC>GAT	p.D769D	MMRN2_uc010qmn.1_Silent_p.D412D|MMRN2_uc009xtb.2_Silent_p.D726D	NM_024756	NP_079032	Q9H8L6	MMRN2_HUMAN	multimerin 2 precursor	769						extracellular space				large_intestine(1)	1						GCTTCCCCAGGTCCAGGCTGA	0.592													51	216	---	---	---	---	PASS
MIR607	693192	broad.mit.edu	37	10	98588498	98588498	+	RNA	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98588498T>C	hsa-mir-607|MI0003620	-			c.24T>C																				0						aatccagatctataacctgtg	0.045													17	8	---	---	---	---	PASS
CUZD1	50624	broad.mit.edu	37	10	124608959	124608959	+	Intron	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124608959G>C	uc001lgs.2	-						CUZD1_uc010qtz.1_Intron|FAM24B_uc001lgt.2_Intron	NM_022034	NP_071317	Q86UP6	CUZD1_HUMAN	CUB and zona pellucida-like domains 1 precursor						cell cycle|cell division|cell proliferation|substrate-dependent cell migration, cell attachment to substrate|trypsinogen activation	integral to membrane|transport vesicle membrane|zymogen granule membrane				ovary(1)|skin(1)	2		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		TGCAGCTCTTGAGAAAAGACA	0.488													63	26	---	---	---	---	PASS
PTDSS2	81490	broad.mit.edu	37	11	490429	490429	+	Silent	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:490429A>G	uc001lpj.2	+	12	1487	c.1311A>G	c.(1309-1311)ACA>ACG	p.T437T		NM_030783	NP_110410	Q9BVG9	PTSS2_HUMAN	phosphatidylserine synthase 2	437	Cytoplasmic (Potential).					integral to membrane					0		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;2.76e-26)|Epithelial(43;2.56e-25)|OV - Ovarian serous cystadenocarcinoma(40;7.54e-20)|BRCA - Breast invasive adenocarcinoma(625;8.76e-05)|Lung(200;0.0407)|LUSC - Lung squamous cell carcinoma(625;0.0735)	Phosphatidylserine(DB00144)	GGGACATCACATTGAGGTACA	0.652													39	13	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1263098	1263098	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1263098C>G	uc009ycr.1	+	47	7193	c.7067C>G	c.(7066-7068)ACA>AGA	p.T2356R	MUC5B_uc001ltb.2_Missense_Mutation_p.T1666R	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	1663	7 X Cys-rich subdomain repeats.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCAGATACACAAGCACCCTT	0.667													11	13	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1264937	1264937	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1264937C>G	uc009ycr.1	+	48	8867	c.8741C>G	c.(8740-8742)ACC>AGC	p.T2914S	MUC5B_uc001ltb.2_Missense_Mutation_p.T2279S	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	2276	7 X Cys-rich subdomain repeats.|Thr-rich.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCGGGCCACACCACGGCCACC	0.682													34	71	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1273698	1273698	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1273698C>T	uc009ycr.1	+	53	16081	c.15955C>T	c.(15955-15957)CCG>TCG	p.P5319S	MUC5B_uc001ltb.2_Missense_Mutation_p.P5000S	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	4997					cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTCCTCCGCCCCGCTGTCCTC	0.692													14	25	---	---	---	---	PASS
ZNF195	7748	broad.mit.edu	37	11	3392296	3392296	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3392296G>A	uc001lxt.2	-	3	313	c.135C>T	c.(133-135)CTC>CTT	p.L45L	ZNF195_uc001lxv.2_Silent_p.L45L|ZNF195_uc001lxs.2_Silent_p.L45L|ZNF195_uc010qxr.1_Silent_p.L49L|ZNF195_uc009ydz.2_Silent_p.L49L|ZNF195_uc001lxu.2_Silent_p.L49L	NM_001130520	NP_001123992	O14628	ZN195_HUMAN	zinc finger protein 195 isoform 1	45	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		TACAGACAGTGAGACCTGTTT	0.448													65	280	---	---	---	---	PASS
OR51B2	79345	broad.mit.edu	37	11	5344605	5344605	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5344605T>C	uc001mao.1	-	1	978	c.923A>G	c.(922-924)CAT>CGT	p.H308R	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033180	NP_149420	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B,	308	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTAAACCTATGTTTAGATAA	0.368													37	85	---	---	---	---	PASS
OR52E8	390079	broad.mit.edu	37	11	5877992	5877992	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5877992T>A	uc010qzr.1	-	1	941	c.941A>T	c.(940-942)AAG>ATG	p.K314M	TRIM5_uc001mbq.1_Intron	NM_001005168	NP_001005168	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E,	314	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGATTGGTCTTGAGAAAAAT	0.433													185	235	---	---	---	---	PASS
OR52B2	255725	broad.mit.edu	37	11	6190650	6190650	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6190650C>T	uc010qzy.1	-	1	907	c.907G>A	c.(907-909)GAG>AAG	p.E303K		NM_001004052	NP_001004052	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B,	303	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCTACACCCTCACGTATCTGC	0.488													71	83	---	---	---	---	PASS
CCKBR	887	broad.mit.edu	37	11	6292780	6292780	+	3'UTR	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6292780G>C	uc001mcp.2	+	5					CCKBR_uc001mcq.2_3'UTR|CCKBR_uc001mcr.2_3'UTR|CCKBR_uc001mcs.2_3'UTR	NM_176875	NP_795344	P32239	GASR_HUMAN	cholecystokinin B receptor						activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|cell proliferation|digestion|elevation of cytosolic calcium ion concentration|feeding behavior|positive regulation of cell proliferation|sensory perception		1-phosphatidylinositol-3-kinase regulator activity|gastrin receptor activity|phosphatidylinositol phospholipase C activity|type B gastrin/cholecystokinin receptor binding			lung(5)|ovary(2)|breast(1)	8		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	CTGAGGAGTAGAGGGGCCGTG	0.577													29	44	---	---	---	---	PASS
PPFIBP2	8495	broad.mit.edu	37	11	7672958	7672958	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7672958C>T	uc001mfj.3	+	23	2707	c.2319C>T	c.(2317-2319)CTC>CTT	p.L773L	PPFIBP2_uc010rbb.1_Silent_p.L696L|PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc010rbc.1_Silent_p.L707L|PPFIBP2_uc010rbe.1_Silent_p.L661L|PPFIBP2_uc001mfl.3_Silent_p.L630L|PPFIBP2_uc009yfj.1_Silent_p.L417L	NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2	773	SAM 3.				cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		AGACGCTCCTCAGGCGCCACC	0.562													86	102	---	---	---	---	PASS
EIF3F	8665	broad.mit.edu	37	11	8016065	8016065	+	Splice_Site	SNP	G	T	T	rs113494623		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8016065G>T	uc001mfw.2	+	5	778	c.745_splice	c.e5+1	p.V249_splice	EIF3F_uc010rbj.1_Splice_Site_p.V100_splice	NM_003754	NP_003745	O00303	EIF3F_HUMAN	eukaryotic translation initiation factor 3,							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			lung(1)	1				Epithelial(150;1.44e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGCATCGGAGGTGAGTAACCT	0.537													26	35	---	---	---	---	PASS
TTC17	55761	broad.mit.edu	37	11	43429001	43429001	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43429001G>C	uc001mxi.2	+	15	1952	c.1938G>C	c.(1936-1938)TTG>TTC	p.L646F	TTC17_uc001mxh.2_Missense_Mutation_p.L646F|TTC17_uc010rfj.1_Missense_Mutation_p.L589F|TTC17_uc001mxj.2_Missense_Mutation_p.L416F	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	646	TPR 2.						binding			ovary(5)	5						AGAGGGCTTTGAATTTAGCTC	0.438													33	170	---	---	---	---	PASS
ARHGAP1	392	broad.mit.edu	37	11	46717598	46717598	+	Silent	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46717598C>G	uc001ndd.2	-	2	129	c.60G>C	c.(58-60)CTG>CTC	p.L20L	ARHGAP1_uc009yle.1_Silent_p.L20L|ARHGAP1_uc009ylf.1_Silent_p.L20L	NM_004308	NP_004299	Q07960	RHG01_HUMAN	Rho GTPase activating protein 1	20					Rho protein signal transduction	cytosol|intracellular membrane-bounded organelle	SH3 domain binding|SH3/SH2 adaptor activity			skin(1)	1		Lung NSC(402;1.76e-12)|all_lung(304;1.3e-11)		GBM - Glioblastoma multiforme(35;5.17e-06)|BRCA - Breast invasive adenocarcinoma(625;0.00112)|Lung(87;0.153)		TCAGCTGGTTCAGAGCCTCGC	0.577													23	31	---	---	---	---	PASS
OR4A15	81328	broad.mit.edu	37	11	55135615	55135615	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55135615C>T	uc010rif.1	+	1	256	c.256C>T	c.(256-258)CCC>TCC	p.P86S		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	86	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CCTGGGTTCCCCCATGTACTT	0.408													124	128	---	---	---	---	PASS
OR5R1	219479	broad.mit.edu	37	11	56184900	56184900	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56184900G>T	uc010rji.1	-	1	809	c.809C>A	c.(808-810)ACA>AAA	p.T270K		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	270	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					CATCTTGTCTGTGTCCAAGGA	0.423													149	154	---	---	---	---	PASS
OR1S1	219959	broad.mit.edu	37	11	57982280	57982280	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57982280A>G	uc010rkc.1	+	1	64	c.64A>G	c.(64-66)ATC>GTC	p.I22V		NM_001004458	NP_001004458	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S,	22	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1		Breast(21;0.0589)				CCAAACCACCATCACTGAATT	0.403													140	126	---	---	---	---	PASS
OR5B17	219965	broad.mit.edu	37	11	58126543	58126543	+	5'Flank	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58126543G>T	uc010rke.1	-							NM_001005489	NP_001005489	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TATTCTCCATGGATGTTATTT	0.388													35	109	---	---	---	---	PASS
OR5B2	390190	broad.mit.edu	37	11	58190240	58190240	+	Silent	SNP	A	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58190240A>C	uc010rkg.1	-	1	495	c.495T>G	c.(493-495)TCT>TCG	p.S165S		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	165	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ATTTACAGAAAGAGAGACTGA	0.473													9	73	---	---	---	---	PASS
OR5A1	219982	broad.mit.edu	37	11	59210735	59210735	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59210735G>C	uc001nnx.1	+	1	94	c.94G>C	c.(94-96)GTG>CTG	p.V32L		NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A,	32	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2						CCTCCTCTTTGTGACCTTCCT	0.522													66	175	---	---	---	---	PASS
PATL1	219988	broad.mit.edu	37	11	59410359	59410359	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59410359C>T	uc001noe.3	-	16	2186	c.2043G>A	c.(2041-2043)CAG>CAA	p.Q681Q	PATL1_uc009yms.1_Silent_p.Q651Q	NM_152716	NP_689929	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog	681	Region C.				cytoplasmic mRNA processing body assembly|deadenylation-dependent decapping of nuclear-transcribed mRNA	cytoplasmic mRNA processing body	protein binding|RNA binding			ovary(1)	1						TCACCTTGTTCTGGAGCACAG	0.438													101	271	---	---	---	---	PASS
TCN1	6947	broad.mit.edu	37	11	59631459	59631459	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59631459G>T	uc001noj.2	-	2	278	c.180C>A	c.(178-180)TCC>TCA	p.S60S		NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor	60					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAAGTTTGAGGGACAACACAA	0.398													206	231	---	---	---	---	PASS
C11orf9	745	broad.mit.edu	37	11	61548730	61548730	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61548730C>T	uc001nsc.1	+	21	2789	c.2693C>T	c.(2692-2694)CCT>CTT	p.P898L	C11orf9_uc001nse.1_Missense_Mutation_p.P863L|C11orf9_uc010rll.1_Missense_Mutation_p.P289L	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2	898					central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						accactggtcctagtcttggc	0.358													75	62	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62294756	62294756	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62294756T>A	uc001ntl.2	-	5	7433	c.7133A>T	c.(7132-7134)GAT>GTT	p.D2378V	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	2378					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				AAAGTGCATATCTGGCATCTT	0.453													245	210	---	---	---	---	PASS
INTS5	80789	broad.mit.edu	37	11	62415255	62415255	+	Nonsense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62415255G>T	uc001nud.2	-	2	2350	c.2297C>A	c.(2296-2298)TCA>TAA	p.S766*	GANAB_uc001nua.2_5'Flank|GANAB_uc001nub.2_5'Flank|GANAB_uc001nuc.2_5'Flank|GANAB_uc010rma.1_5'Flank|GANAB_uc010rmb.1_5'Flank	NM_030628	NP_085131	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	766					snRNA processing	integral to membrane|integrator complex	protein binding			ovary(2)	2						CTGATTTCGTGACTGGACAAA	0.572													35	96	---	---	---	---	PASS
ZBTB3	79842	broad.mit.edu	37	11	62521022	62521022	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62521022G>C	uc001nuz.2	-	2	387	c.265C>G	c.(265-267)CGG>GGG	p.R89G		NM_024784	NP_079060	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	89	BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|ovary(1)	3						AGCACAGCCCGATGGGCCAAG	0.557													43	31	---	---	---	---	PASS
KCNK4	50801	broad.mit.edu	37	11	64065659	64065659	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64065659G>A	uc001nzj.1	+	6	1062	c.739G>A	c.(739-741)GCC>ACC	p.A247T	KCNK4_uc001nzk.1_Missense_Mutation_p.R131H|KCNK4_uc010rnk.1_Missense_Mutation_p.A75T|KCNK4_uc001nzl.1_Missense_Mutation_p.R131H|KCNK4_uc001nzm.3_RNA|KCNK4_uc001nzn.1_Missense_Mutation_p.A247T|KCNK4_uc001nzo.2_Missense_Mutation_p.A247T|KCNK4_uc001nzp.1_Missense_Mutation_p.A133T|C11orf20_uc009ypm.2_5'Flank	NM_033310	NP_201567	Q9NYG8	KCNK4_HUMAN	TRAAK	247	Helical; (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity				0						GGCTTACTTCGCCTCAGTGCT	0.662													29	19	---	---	---	---	PASS
SLC22A11	55867	broad.mit.edu	37	11	64326618	64326618	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64326618G>A	uc001oai.2	+	2	779	c.405G>A	c.(403-405)GTG>GTA	p.V135V	SLC22A11_uc001oah.1_Intron|SLC22A11_uc001oaj.2_Silent_p.V135V|SLC22A11_uc009ypq.2_Silent_p.V135V|SLC22A11_uc001oak.1_5'Flank	NM_018484	NP_060954	Q9NSA0	S22AB_HUMAN	solute carrier family 22 member 11	135	Extracellular (Potential).				urate metabolic process	apical plasma membrane|external side of plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium-independent organic anion transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2					Probenecid(DB01032)	GGGACCTGGTGTGCAGCTCCC	0.632													48	133	---	---	---	---	PASS
CFL1	1072	broad.mit.edu	37	11	65622856	65622856	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65622856T>A	uc001ofs.2	-	4	686	c.452A>T	c.(451-453)GAG>GTG	p.E151V	CFL1_uc001oft.2_Missense_Mutation_p.E151V|CFL1_uc001ofu.2_3'UTR	NM_005507	NP_005498	P23528	COF1_HUMAN	cofilin 1 (non-muscle)	151	ADF-H.				actin cytoskeleton organization|anti-apoptosis|axon guidance|platelet activation|platelet degranulation|response to virus|Rho protein signal transduction	cytoplasm|cytoskeleton|nuclear matrix	actin binding				0				READ - Rectum adenocarcinoma(159;0.169)		CCCCAGCTTCTCTGCCAGGGT	0.592													47	41	---	---	---	---	PASS
CD248	57124	broad.mit.edu	37	11	66082624	66082624	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66082624G>A	uc001ohm.1	-	1	1892	c.1875C>T	c.(1873-1875)AGC>AGT	p.S625S		NM_020404	NP_065137	Q9HCU0	CD248_HUMAN	tumor endothelial marker 1 precursor	625	Pro-rich.|Extracellular (Potential).					integral to membrane|proteinaceous extracellular matrix	calcium ion binding|sugar binding			large_intestine(3)	3					Cefalotin(DB00456)	GGTTAGTGGGGCTCTGAGAGG	0.632													72	49	---	---	---	---	PASS
CHKA	1119	broad.mit.edu	37	11	67842266	67842266	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67842266A>G	uc001onj.2	-	4	762	c.548T>C	c.(547-549)ATG>ACG	p.M183T	CHKA_uc001onk.2_Missense_Mutation_p.M165T	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a	183					lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	AATGGCAAACATAACGCTCTC	0.393													33	89	---	---	---	---	PASS
SHANK2	22941	broad.mit.edu	37	11	70319024	70319024	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70319024C>G	uc001oqc.2	-	22	5578	c.5500G>C	c.(5500-5502)GGG>CGG	p.G1834R	SHANK2_uc010rqn.1_Missense_Mutation_p.G1246R|SHANK2_uc001opz.2_Missense_Mutation_p.G1239R|uc009ysn.1_5'UTR|SHANK2_uc001opy.2_Missense_Mutation_p.G170R	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1455	SAM.				intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			ATTCTGTGCCCGACTCGAGTT	0.498													180	158	---	---	---	---	PASS
C11orf30	56946	broad.mit.edu	37	11	76253386	76253386	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76253386G>C	uc001oxl.2	+	18	2827	c.2684G>C	c.(2683-2685)GGA>GCA	p.G895A	C11orf30_uc001oxm.2_Missense_Mutation_p.G797A|C11orf30_uc010rsb.1_Missense_Mutation_p.G910A|C11orf30_uc010rsc.1_Missense_Mutation_p.G896A|C11orf30_uc001oxn.2_Missense_Mutation_p.G896A|C11orf30_uc010rsd.1_Missense_Mutation_p.G804A|C11orf30_uc001oxo.1_Missense_Mutation_p.G249A|C11orf30_uc010rse.1_Missense_Mutation_p.G142A|C11orf30_uc001oxp.2_5'UTR	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein	895					chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6						TCTTCCCCTGGAGCAATCACC	0.507													123	491	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78369701	78369701	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78369701T>G	uc001ozl.3	-	34	8175	c.7712A>C	c.(7711-7713)AAG>ACG	p.K2571T	ODZ4_uc001ozk.3_Missense_Mutation_p.K796T|ODZ4_uc009yvb.1_Intron	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	2571	Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						CAAGGCAAACTTGACCCCCTT	0.547													17	34	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88780705	88780705	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88780705G>C	uc001pcq.2	-	1	536	c.336C>G	c.(334-336)TTC>TTG	p.F112L	GRM5_uc009yvm.2_Missense_Mutation_p.F112L|GRM5_uc009yvn.1_Missense_Mutation_p.F112L	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	112	Extracellular (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	AATCTCTTATGAACTCAATGC	0.527													30	61	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92600239	92600239	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92600239G>T	uc001pdj.3	+	21	12008	c.11991G>T	c.(11989-11991)CCG>CCT	p.P3997P	FAT3_uc001pdi.3_Silent_p.P437P	NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3997	Laminin G-like.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATGAGCTGCCGCTGCAGAACA	0.642										TCGA Ovarian(4;0.039)			5	0	---	---	---	---	PASS
GPR83	10888	broad.mit.edu	37	11	94113341	94113341	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94113341C>A	uc001pet.2	-	4	1418	c.1246G>T	c.(1246-1248)GTG>TTG	p.V416L		NM_016540	NP_057624	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83 precursor	416	Cytoplasmic (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			central_nervous_system(2)|ovary(1)	3		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				ATGGGTTCCACAGATGACAGG	0.557													45	20	---	---	---	---	PASS
CWC15	51503	broad.mit.edu	37	11	94705278	94705278	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94705278G>T	uc001pfd.3	-	2	195	c.72C>A	c.(70-72)AGC>AGA	p.S24R	CWC15_uc009ywl.1_Missense_Mutation_p.S24R|KDM4D_uc001pfe.2_5'Flank	NM_016403	NP_057487	Q9P013	CWC15_HUMAN	CWC15 homolog	24					nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome	protein binding|RNA binding				0		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TTGAAAGTTGGCTCAAATCAC	0.388													5	228	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	99941169	99941169	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:99941169G>T	uc001pga.2	+	11	1515	c.1176G>T	c.(1174-1176)TGG>TGT	p.W392C	CNTN5_uc009ywv.1_Missense_Mutation_p.W392C|CNTN5_uc001pfz.2_Missense_Mutation_p.W392C|CNTN5_uc001pgb.2_Missense_Mutation_p.W318C	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	392	Ig-like C2-type 4.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ACCCACACTGGGTAGAAAAAC	0.413													24	14	---	---	---	---	PASS
CARD18	59082	broad.mit.edu	37	11	105009724	105009724	+	Nonsense_Mutation	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105009724A>T	uc001pis.2	-	1	89	c.83T>A	c.(82-84)TTA>TAA	p.L28*		NM_021571	NP_067546	P57730	CAR18_HUMAN	ICEBERG caspase-1 inhibitor	30	CARD.				inflammatory response|regulation of apoptosis	intracellular	cysteine-type endopeptidase inhibitor activity			ovary(1)|central_nervous_system(1)	2						TTCATCCTCTAATAGGCAATC	0.408													114	40	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117342716	117342716	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117342716A>T	uc001prh.1	-	15	3003	c.3001T>A	c.(3001-3003)TCC>ACC	p.S1001T		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	941	Extracellular (Potential).|Fibronectin type-III 1.				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		ATGGTGGGGGAGATGTTGCGT	0.537													32	72	---	---	---	---	PASS
RERGL	79785	broad.mit.edu	37	12	18242192	18242192	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18242192T>C	uc001rdq.2	-	2	220	c.26A>G	c.(25-27)TAT>TGT	p.Y9C	RERGL_uc001rdr.2_Intron	NM_024730	NP_079006	Q9H628	RERGL_HUMAN	RERG/RAS-like	9	Small GTPase-like.				signal transduction	membrane	GTP binding|GTPase activity				0						TTTCTCATTATATTTGAGATG	0.338													55	47	---	---	---	---	PASS
C12orf39	80763	broad.mit.edu	37	12	21681971	21681971	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21681971C>T	uc001rfa.1	+	5	396	c.245C>T	c.(244-246)CCG>CTG	p.P82L	C12orf39_uc009ziv.1_RNA|C12orf39_uc009ziw.1_RNA	NM_030572	NP_085049	Q9BT56	SPXN_HUMAN	spexin precursor	82						extracellular region|nucleus|transport vesicle					0						CTAACTATTCCGGAGGCAGCA	0.408													201	163	---	---	---	---	PASS
SOX5	6660	broad.mit.edu	37	12	23818453	23818453	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23818453C>T	uc001rfw.2	-	7	958	c.856G>A	c.(856-858)GAT>AAT	p.D286N	SOX5_uc001rfx.2_Missense_Mutation_p.D273N|SOX5_uc001rfy.2_Missense_Mutation_p.D273N|SOX5_uc010siv.1_Missense_Mutation_p.D273N|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Missense_Mutation_p.D238N	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	286					transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						GTCCGTTGATCAGGAGGGAAT	0.493													54	144	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31242059	31242059	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31242059C>T	uc001rjt.1	+	7	1017	c.766C>T	c.(766-768)CGG>TGG	p.R256W	DDX11_uc010sjw.1_Missense_Mutation_p.R256W|DDX11_uc010sjx.1_RNA|DDX11_uc001rjr.1_Missense_Mutation_p.R256W|DDX11_uc001rjs.1_Missense_Mutation_p.R256W|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Missense_Mutation_p.R256W|DDX11_uc001rjw.1_Missense_Mutation_p.R230W|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_RNA	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	256	Helicase ATP-binding.				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAAGGATGTTCGGCTGGTCTC	0.542										Multiple Myeloma(12;0.14)			4	140	---	---	---	---	PASS
PKP2	5318	broad.mit.edu	37	12	33030864	33030864	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33030864G>A	uc001rlj.3	-	3	1065	c.950C>T	c.(949-951)GCG>GTG	p.A317V	PKP2_uc001rlk.3_Missense_Mutation_p.A317V|PKP2_uc010skj.1_Missense_Mutation_p.A317V	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	317					cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					AGTCAAGTGCGCTCTCCTCCC	0.637													37	36	---	---	---	---	PASS
ABCD2	225	broad.mit.edu	37	12	39947905	39947905	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39947905C>A	uc001rmb.2	-	10	2458	c.2032G>T	c.(2032-2034)GAT>TAT	p.D678Y		NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D, member 2	678	ABC transporter.				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6						CCTTCACCATCAAACTGTAAT	0.328													89	77	---	---	---	---	PASS
ACVRL1	94	broad.mit.edu	37	12	52306925	52306925	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52306925C>A	uc001rzj.2	+	3	387	c.104C>A	c.(103-105)ACG>AAG	p.T35K	ACVRL1_uc001rzk.2_Missense_Mutation_p.T35K|ACVRL1_uc010snm.1_Intron	NM_000020	NP_000011	P37023	ACVL1_HUMAN	activin A receptor type II-like 1 precursor	35	Extracellular (Potential).				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	GTGACCTGCACGTGTGAGAGC	0.687									Hereditary_Hemorrhagic_Telangiectasia				13	9	---	---	---	---	PASS
DNAJC14	85406	broad.mit.edu	37	12	56221176	56221176	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56221176G>T	uc001shx.1	-	2	1471	c.1267C>A	c.(1267-1269)CAG>AAG	p.Q423K	DNAJC14_uc001shu.1_Missense_Mutation_p.Q423K|DNAJC14_uc009zob.1_Missense_Mutation_p.Q423K|DNAJC14_uc001shy.1_Missense_Mutation_p.Q423K	NM_032364	NP_115740	Q6Y2X3	DJC14_HUMAN	dopamine receptor interacting protein	423					protein folding|protein transport	endoplasmic reticulum membrane|integral to membrane	heat shock protein binding|unfolded protein binding			ovary(3)|large_intestine(1)	4						TCTTCAGGCTGGCAGTAGCGC	0.542													54	247	---	---	---	---	PASS
SLC16A7	9194	broad.mit.edu	37	12	60169162	60169162	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:60169162C>T	uc001sqs.2	+	5	1385	c.1086C>T	c.(1084-1086)CTC>CTT	p.L362L	SLC16A7_uc001sqt.2_Silent_p.L362L|SLC16A7_uc001squ.2_Silent_p.L362L|SLC16A7_uc009zqi.2_Silent_p.L263L|SLC16A7_uc010ssi.1_Silent_p.L263L	NM_004731	NP_004722	O60669	MOT2_HUMAN	solute carrier family 16, member 7	362	Cytoplasmic (Potential).					integral to plasma membrane|membrane fraction	pyruvate secondary active transmembrane transporter activity|secondary active monocarboxylate transmembrane transporter activity|symporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(3;0.0303)	Pyruvic acid(DB00119)	TTGAAACTCTCATGGACCTCG	0.493													104	381	---	---	---	---	PASS
FAM19A2	338811	broad.mit.edu	37	12	62148671	62148671	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62148671C>A	uc001sqw.2	-	3	1754	c.241G>T	c.(241-243)GCT>TCT	p.A81S	FAM19A2_uc001sqv.2_RNA|FAM19A2_uc001sqx.2_Missense_Mutation_p.A81S|FAM19A2_uc001sqy.2_RNA	NM_178539	NP_848634	Q8N3H0	F19A2_HUMAN	family with sequence similarity 19 (chemokine	81						cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)		CATGATGGAGCAGCTCGCGTG	0.498													57	88	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72667238	72667238	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72667238C>G	uc001sxa.2	+	1	710	c.680C>G	c.(679-681)GCG>GGG	p.A227G	LOC283392_uc010stv.1_5'UTR	NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	227	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						ACACTGGACGCGCAGAGGAAT	0.567													51	99	---	---	---	---	PASS
ZDHHC17	23390	broad.mit.edu	37	12	77191305	77191305	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77191305T>C	uc001syk.1	+	2	348	c.185T>C	c.(184-186)GTC>GCC	p.V62A	ZDHHC17_uc001syi.1_RNA|ZDHHC17_uc001syj.2_Intron	NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14	62	Cytoplasmic (Potential).				lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						TGGGACATAGTCAAGGCTACA	0.353													15	32	---	---	---	---	PASS
ACSS3	79611	broad.mit.edu	37	12	81545798	81545798	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81545798G>A	uc001szl.1	+	7	1112	c.1021G>A	c.(1021-1023)GAC>AAC	p.D341N	ACSS3_uc001szm.1_Missense_Mutation_p.D340N|ACSS3_uc001szn.1_Missense_Mutation_p.D23N	NM_024560	NP_078836	Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	341						mitochondrion	acetate-CoA ligase activity|ATP binding			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						GGCAGCTTCTGACTTAGGCTG	0.328													43	68	---	---	---	---	PASS
RASSF9	9182	broad.mit.edu	37	12	86199727	86199727	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86199727C>A	uc001taf.1	-	2	400	c.61G>T	c.(61-63)GAC>TAC	p.D21Y		NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family	21					endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1						GAATCCATGTCTTTAGTTGGA	0.393													67	21	---	---	---	---	PASS
MGAT4C	25834	broad.mit.edu	37	12	86373487	86373487	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86373487A>T	uc001tai.3	-	8	2267	c.1017T>A	c.(1015-1017)GAT>GAA	p.D339E	MGAT4C_uc001tal.3_Missense_Mutation_p.D339E|MGAT4C_uc001taj.3_Missense_Mutation_p.D339E|MGAT4C_uc001tak.3_Missense_Mutation_p.D339E|MGAT4C_uc010sum.1_Missense_Mutation_p.D363E|MGAT4C_uc001tah.3_Missense_Mutation_p.D339E	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	339	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						CAGGGGGGTTATCAGGAATGT	0.413													83	30	---	---	---	---	PASS
EEA1	8411	broad.mit.edu	37	12	93258714	93258714	+	Missense_Mutation	SNP	A	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93258714A>C	uc001tck.2	-	3	432	c.167T>G	c.(166-168)CTT>CGT	p.L56R		NM_003566	NP_003557	Q15075	EEA1_HUMAN	early endosome antigen 1, 162kD	56	C2H2-type.				early endosome to late endosome transport|synaptic vesicle to endosome fusion|vesicle fusion	cytosol|early endosome membrane|extrinsic to plasma membrane|membrane fraction	1-phosphatidylinositol binding|calmodulin binding|GTP-dependent protein binding|protein homodimerization activity|zinc ion binding			ovary(2)|skin(1)	3						ATGTTTGAAAAGTTCATCAGC	0.363													4	115	---	---	---	---	PASS
APAF1	317	broad.mit.edu	37	12	99056574	99056574	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99056574A>T	uc001tfz.2	+	7	1522	c.945A>T	c.(943-945)AAA>AAT	p.K315N	APAF1_uc001tfy.2_Missense_Mutation_p.K304N|APAF1_uc001tga.2_Missense_Mutation_p.K304N|APAF1_uc001tgb.2_Missense_Mutation_p.K315N|APAF1_uc001tgc.2_Missense_Mutation_p.K315N	NM_181861	NP_863651	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1 isoform	315	NB-ARC.				activation of caspase activity by cytochrome c|defense response|induction of apoptosis by intracellular signals|nervous system development	cytosol|Golgi apparatus|nucleus	ATP binding|caspase activator activity|protein binding			ovary(2)|lung(1)	3					Adenosine triphosphate(DB00171)	GTATTATAAAAGAATGTAAAG	0.299													49	16	---	---	---	---	PASS
CHST11	50515	broad.mit.edu	37	12	105150991	105150991	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105150991G>T	uc001tkx.1	+	4	760	c.469G>T	c.(469-471)GTC>TTC	p.V157F	CHST11_uc001tky.2_Missense_Mutation_p.V152F|uc001tkz.2_5'Flank	NM_018413	NP_060883	Q9NPF2	CHSTB_HUMAN	carbohydrate sulfotransferase 11	157	Lumenal (Potential).				chondroitin sulfate biosynthetic process	Golgi membrane|integral to membrane	chondroitin 4-sulfotransferase activity|N-acetylgalactosamine 4-O-sulfotransferase activity				0						CGAGGCACACGTCTCCGCCAA	0.592													58	19	---	---	---	---	PASS
APPL2	55198	broad.mit.edu	37	12	105589265	105589265	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105589265T>C	uc001tlf.1	-	13	1328	c.1110A>G	c.(1108-1110)ATA>ATG	p.I370M	APPL2_uc010swt.1_Missense_Mutation_p.I327M|APPL2_uc001tlg.1_Missense_Mutation_p.I124M|APPL2_uc010swu.1_Missense_Mutation_p.I376M|APPL2_uc009zuq.2_Missense_Mutation_p.I327M	NM_018171	NP_060641	Q8NEU8	DP13B_HUMAN	adaptor protein, phosphotyrosine interaction, PH	370	Required for RAB5A binding (By similarity).|PH.				cell cycle|cell proliferation|signal transduction	early endosome membrane|nucleus	protein binding			upper_aerodigestive_tract(1)	1						AGATGTTGTTTATTGCACATA	0.433													36	106	---	---	---	---	PASS
BRAP	8315	broad.mit.edu	37	12	112082156	112082156	+	Silent	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112082156T>A	uc001tsn.3	-	12	1820	c.1626A>T	c.(1624-1626)ACA>ACT	p.T542T	BRAP_uc010syh.1_Silent_p.T363T|BRAP_uc009zvv.2_Silent_p.T512T	NM_006768	NP_006759	Q7Z569	BRAP_HUMAN	BRCA1 associated protein	542					MAPKKK cascade|negative regulation of signal transduction|Ras protein signal transduction	cytoplasm|ubiquitin ligase complex	identical protein binding|nuclear localization sequence binding|nucleotide binding|ubiquitin-protein ligase activity|zinc ion binding			lung(1)	1						TCTTCTGCTGTGTCTCCAGGT	0.577													97	27	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120574544	120574544	+	Intron	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120574544G>A	uc001txo.2	-							NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis						regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCCCTGACAAGAGAACCACAA	0.567													20	27	---	---	---	---	PASS
ACADS	35	broad.mit.edu	37	12	121176366	121176366	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121176366G>C	uc001tza.3	+	7	944	c.826G>C	c.(826-828)GCC>CCC	p.A276P	ACADS_uc010szl.1_Missense_Mutation_p.A272P|ACADS_uc001tzb.3_Intron	NM_000017	NP_000008	P16219	ACADS_HUMAN	short-chain acyl-CoA dehydrogenase precursor	276						mitochondrial matrix	butyryl-CoA dehydrogenase activity			central_nervous_system(2)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)	Lung NSC(355;0.163)			NADH(DB00157)	CATCGGCATCGCCTCCCAGGC	0.697													54	18	---	---	---	---	PASS
OGFOD2	79676	broad.mit.edu	37	12	123463026	123463026	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123463026G>T	uc001uea.1	+	5	462	c.441G>T	c.(439-441)GCG>GCT	p.A147A	OGFOD2_uc001uds.1_5'UTR|OGFOD2_uc001udt.1_5'UTR|OGFOD2_uc001udu.1_5'UTR|OGFOD2_uc001udv.1_5'UTR|OGFOD2_uc009zxs.1_5'UTR|OGFOD2_uc001udw.1_5'UTR|OGFOD2_uc001udx.1_5'UTR|OGFOD2_uc001udy.1_5'UTR|OGFOD2_uc001udz.1_Silent_p.A87A|OGFOD2_uc010tak.1_3'UTR|OGFOD2_uc001ueb.1_5'UTR|ARL6IP4_uc001uec.2_5'Flank|ARL6IP4_uc001ued.2_5'Flank|ARL6IP4_uc001uee.2_5'Flank|ARL6IP4_uc001uef.2_5'Flank|ARL6IP4_uc001ueg.2_5'Flank|ARL6IP4_uc009zxt.2_5'Flank|ARL6IP4_uc001ueh.2_5'Flank|ARL6IP4_uc001uei.2_5'Flank	NM_024623	NP_078899	Q6N063	OGFD2_HUMAN	2-oxoglutarate and iron-dependent oxygenase	147							iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			pancreas(1)	1	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.11e-05)|Epithelial(86;0.000127)|BRCA - Breast invasive adenocarcinoma(302;0.107)	Vitamin C(DB00126)	TTTTCACAGCGCCCTTCTGCC	0.502													74	16	---	---	---	---	PASS
NOC4L	79050	broad.mit.edu	37	12	132636371	132636371	+	Intron	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132636371G>T	uc001ujz.1	+							NM_024078	NP_076983	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog						rRNA processing	integral to membrane|nuclear membrane|nucleolus	protein binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		TTCAGGTGAGGGCGCTGCTGC	0.672													19	1	---	---	---	---	PASS
CDK8	1024	broad.mit.edu	37	13	26956958	26956958	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26956958C>T	uc001uqr.1	+	5	490	c.464C>T	c.(463-465)GCT>GTT	p.A155V	CDK8_uc001uqs.1_Missense_Mutation_p.A155V|CDK8_uc001uqt.1_Intron	NM_001260	NP_001251	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	155	Protein kinase.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|large_intestine(1)|ovary(1)|skin(1)	5	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		CAGAAACCTGCTAATATTTTA	0.313													85	40	---	---	---	---	PASS
MTIF3	219402	broad.mit.edu	37	13	28014513	28014513	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28014513C>A	uc001urh.2	-	1	1297	c.73G>T	c.(73-75)GGT>TGT	p.G25C	MTIF3_uc001uri.2_Missense_Mutation_p.G25C|MTIF3_uc001urj.2_Missense_Mutation_p.G25C|MTIF3_uc001urk.2_Missense_Mutation_p.G25C	NM_152912	NP_690876	Q9H2K0	IF3M_HUMAN	mitochondrial translational initiation factor 3	25					regulation of translational initiation|ribosome disassembly	mitochondrion	ribosomal small subunit binding|translation initiation factor activity			ovary(1)|skin(1)	2		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.108)|OV - Ovarian serous cystadenocarcinoma(117;0.157)		ATGTGTTTACCAAAACATCTA	0.403													83	20	---	---	---	---	PASS
FLT3	2322	broad.mit.edu	37	13	28588631	28588631	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28588631C>A	uc001urw.2	-	23	2899	c.2817G>T	c.(2815-2817)TTG>TTT	p.L939F	FLT3_uc010aao.2_RNA|FLT3_uc010tdn.1_Missense_Mutation_p.L898F	NM_004119	NP_004110	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3 precursor	939	Protein kinase.|Cytoplasmic (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|vascular endothelial growth factor receptor activity			haematopoietic_and_lymphoid_tissue(8536)|lung(7)|ovary(3)|stomach(1)|central_nervous_system(1)|skin(1)	8549	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Sorafenib(DB00398)|Sunitinib(DB01268)	AAAACGAAGTCAAATTAGGGA	0.393			Mis|O		AML|ALL								134	20	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32813925	32813925	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32813925G>A	uc001utx.2	+	46	7090	c.6594G>A	c.(6592-6594)ACG>ACA	p.T2198T	FRY_uc010tdw.1_RNA	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	2198					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ACAGCTACACGAGGGACTGTG	0.398													58	56	---	---	---	---	PASS
TRPC4	7223	broad.mit.edu	37	13	38237841	38237841	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38237841G>A	uc001uws.2	-	6	1635	c.1400C>T	c.(1399-1401)TCA>TTA	p.S467L	TRPC4_uc010abv.2_Missense_Mutation_p.S47L|TRPC4_uc001uwt.2_Missense_Mutation_p.S467L|TRPC4_uc010tey.1_Missense_Mutation_p.S467L|TRPC4_uc010abw.2_Missense_Mutation_p.S294L|TRPC4_uc010abx.2_Missense_Mutation_p.S467L|TRPC4_uc010aby.2_Missense_Mutation_p.S467L	NM_016179	NP_057263	Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel,	467	Extracellular (Potential).				axon guidance|calcium ion import	basolateral plasma membrane|calcium channel complex|cell surface|cortical cytoskeleton	beta-catenin binding|cadherin binding|store-operated calcium channel activity			ovary(3)|skin(2)|breast(1)	6				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CATGTCCCATGATTCTCGTGG	0.423													71	5	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39262581	39262581	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39262581A>G	uc001uwv.2	+	1	1409	c.1100A>G	c.(1099-1101)CAG>CGG	p.Q367R		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	367	CSPG 1.|Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CAGCCTGGCCAGGGCTACTTG	0.582													92	18	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58206787	58206787	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58206787G>T	uc001vhq.1	+	1	999	c.107G>T	c.(106-108)GGG>GTG	p.G36V	PCDH17_uc010aec.1_Missense_Mutation_p.G36V	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	36	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		ACGGTGATCGGGAACATCGGC	0.642													21	9	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70281777	70281777	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70281777G>A	uc001vip.2	-	10	2961	c.2167C>T	c.(2167-2169)CAA>TAA	p.Q723*	KLHL1_uc010thm.1_Nonsense_Mutation_p.Q662*	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	723	Kelch 6.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TCATTAGTTTGTGGGTCATAG	0.413													122	44	---	---	---	---	PASS
SCEL	8796	broad.mit.edu	37	13	78146272	78146272	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78146272C>T	uc001vki.2	+	9	663	c.493C>T	c.(493-495)CCA>TCA	p.P165S	SCEL_uc001vkj.2_Missense_Mutation_p.P165S|SCEL_uc010thx.1_Intron	NM_144777	NP_659001	O95171	SCEL_HUMAN	sciellin isoform 1	165					embryo development|keratinocyte differentiation	cornified envelope|cytoplasm|membrane	protein binding|zinc ion binding			ovary(4)|breast(1)	5		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		GTCCTGGTTTCCACCGCCCCC	0.463													27	34	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	93518529	93518529	+	Intron	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93518529C>T	uc010tif.1	+							NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TTATTTGCCTCTACAGGGATG	0.433													126	57	---	---	---	---	PASS
EFNB2	1948	broad.mit.edu	37	13	107145427	107145427	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107145427C>A	uc001vqi.2	-	5	988	c.963G>T	c.(961-963)ATG>ATT	p.M321I		NM_004093	NP_004084	P52799	EFNB2_HUMAN	ephrin B2 precursor	321	Cytoplasmic (Potential).				cell differentiation|cell-cell signaling|interspecies interaction between organisms|nervous system development	integral to plasma membrane	ephrin receptor binding			ovary(1)	1	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					TCTGCGGGGGCATCTCCTGGA	0.587													113	26	---	---	---	---	PASS
COL4A2	1284	broad.mit.edu	37	13	111111202	111111202	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111111202G>T	uc001vqx.2	+	22	1806	c.1517G>T	c.(1516-1518)GGC>GTC	p.G506V		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	506	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGCTTCGCAGGCATCAACGGG	0.612													31	127	---	---	---	---	PASS
ADCY4	196883	broad.mit.edu	37	14	24788955	24788955	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24788955A>G	uc001wov.2	-	21	2732	c.2726T>C	c.(2725-2727)TTT>TCT	p.F909S	ADCY4_uc001wow.2_Missense_Mutation_p.F909S|ADCY4_uc010toh.1_Missense_Mutation_p.F595S|ADCY4_uc001wox.2_Missense_Mutation_p.F909S|ADCY4_uc001woy.2_Missense_Mutation_p.F909S	NM_139247	NP_640340	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	909	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(265;0.0192)		CACCTCATCAAAATCAGCAAT	0.448													66	21	---	---	---	---	PASS
RPL10L	140801	broad.mit.edu	37	14	47120507	47120507	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47120507C>T	uc001wwg.2	-	1	522	c.433G>A	c.(433-435)GAG>AAG	p.E145K		NM_080746	NP_542784	Q96L21	RL10L_HUMAN	ribosomal protein L10-like protein	145					spermatogenesis|translation	cytosolic large ribosomal subunit|nucleus	structural constituent of ribosome			ovary(1)	1						ACATGCTCCTCGTTCTGAAGC	0.527													33	69	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51239056	51239056	+	Missense_Mutation	SNP	T	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51239056T>G	uc001wym.2	-	9	1135	c.944A>C	c.(943-945)CAG>CCG	p.Q315P	NIN_uc001wyi.2_Missense_Mutation_p.Q315P|NIN_uc001wyj.2_RNA|NIN_uc001wyk.2_Missense_Mutation_p.Q315P|NIN_uc010tqp.1_Missense_Mutation_p.Q321P|NIN_uc001wyo.2_Missense_Mutation_p.Q315P|NIN_uc001wyp.1_Missense_Mutation_p.Q277P	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5	315					centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					GCCCTCTTCCTGCCAGGTGTC	0.463			T	PDGFRB	MPD								58	15	---	---	---	---	PASS
NID2	22795	broad.mit.edu	37	14	52496265	52496265	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52496265C>A	uc001wzo.2	-	10	2635	c.2401G>T	c.(2401-2403)GAT>TAT	p.D801Y	NID2_uc010tqs.1_Missense_Mutation_p.D801Y|NID2_uc010tqt.1_Missense_Mutation_p.D801Y|NID2_uc001wzp.2_Missense_Mutation_p.D801Y	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	801	EGF-like 3; calcium-binding (Potential).					basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)					TGGCTCTTACCCACACAGTTC	0.517													111	40	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58831249	58831249	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58831249G>T	uc001xdp.2	+	20	2696	c.2442G>T	c.(2440-2442)CAG>CAT	p.Q814H	ARID4A_uc001xdo.2_Missense_Mutation_p.Q814H|ARID4A_uc001xdq.2_Missense_Mutation_p.Q814H|ARID4A_uc010apg.1_Missense_Mutation_p.Q492H	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	814					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						CATTTGGCCAGAATGAAGCAG	0.338													99	35	---	---	---	---	PASS
KCNK10	54207	broad.mit.edu	37	14	88652366	88652366	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88652366C>T	uc001xwo.2	-	7	1587	c.1130G>A	c.(1129-1131)CGC>CAC	p.R377H	KCNK10_uc001xwm.2_Missense_Mutation_p.R382H|KCNK10_uc001xwn.2_Missense_Mutation_p.R382H	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	377	Cytoplasmic (Potential).				signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						CAGCCGCCGGCGCTCCATGCT	0.672													20	9	---	---	---	---	PASS
KCNK10	54207	broad.mit.edu	37	14	88654444	88654444	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88654444G>C	uc001xwo.2	-	6	1320	c.863C>G	c.(862-864)GCT>GGT	p.A288G	KCNK10_uc001xwm.2_Missense_Mutation_p.A293G|KCNK10_uc001xwn.2_Missense_Mutation_p.A293G	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	288					signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						ATTGATGCCAGCGTTTCCCCC	0.448													159	47	---	---	---	---	PASS
KCNK10	54207	broad.mit.edu	37	14	88658601	88658601	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88658601G>C	uc001xwo.2	-	5	1277	c.820C>G	c.(820-822)CTG>GTG	p.L274V	KCNK10_uc001xwm.2_Missense_Mutation_p.L279V|KCNK10_uc001xwn.2_Missense_Mutation_p.L279V	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	274					signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						ACCGTGGTCAGAGTGACCACC	0.542													117	34	---	---	---	---	PASS
CATSPERB	79820	broad.mit.edu	37	14	92105570	92105570	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92105570C>T	uc001xzs.1	-	16	1597	c.1457G>A	c.(1456-1458)GGA>GAA	p.G486E	CATSPERB_uc010aub.1_Missense_Mutation_p.G8E	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta	486					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				AGTAACACTTCCGACTGCACT	0.398													78	26	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107083436	107083436	+	RNA	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107083436G>T	uc010tyt.1	-	113		c.5357C>A								Parts of antibodies, mostly variable regions.												0						GGGGCTGCCGGATCCAGCTCC	0.572													38	110	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28096633	28096633	+	Intron	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28096633G>C	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TGTGGAGGAAGAGGACATTGA	0.547									Oculocutaneous_Albinism				3	19	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29390704	29390704	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29390704G>T	uc001zck.2	+	8	1470	c.1263G>T	c.(1261-1263)GGG>GGT	p.G421G	APBA2_uc010azj.2_Silent_p.G409G|APBA2_uc010uat.1_Silent_p.G409G|APBA2_uc001zcl.2_Silent_p.G409G|APBA2_uc001zcm.1_Silent_p.G113G	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	421	PID.				nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		ATTCTGAGGGGGATGCCCAGA	0.358													43	21	---	---	---	---	PASS
EXD1	161829	broad.mit.edu	37	15	41476288	41476288	+	Silent	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41476288T>C	uc001znk.2	-	10	1577	c.1386A>G	c.(1384-1386)ACA>ACG	p.T462T	EXD1_uc001znj.2_Silent_p.T260T|EXD1_uc010ucv.1_Silent_p.T520T	NM_152596	NP_689809	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	462					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding			ovary(1)	1						CAGCCTGTTTTGTGCATTTTA	0.398													147	61	---	---	---	---	PASS
MIR626	693211	broad.mit.edu	37	15	41983842	41983842	+	RNA	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41983842C>G	hsa-mir-626|MI0003640	+			c.60C>G			MGA_uc001zog.1_Intron|MGA_uc010ucy.1_Intron|MGA_uc010ucz.1_Intron																	0						TGAATGATCTCAGCtgtctga	0.045													46	84	---	---	---	---	PASS
UBR1	197131	broad.mit.edu	37	15	43378450	43378450	+	Intron	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43378450G>C	uc001zqq.2	-						UBR1_uc010udk.1_Intron	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TAAAAGAAAAGAAGATGAAAA	0.333													37	65	---	---	---	---	PASS
SLC12A1	6557	broad.mit.edu	37	15	48548078	48548078	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48548078C>A	uc001zwn.3	+	16	2229	c.2013C>A	c.(2011-2013)ACC>ACA	p.T671T	SLC12A1_uc010uew.1_Silent_p.T477T|SLC12A1_uc010bem.2_Silent_p.T671T|SLC12A1_uc001zwq.3_Silent_p.T442T|SLC12A1_uc001zwr.3_Silent_p.T398T	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2	671					potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TGGAATTAACCACAGTGGAAG	0.458													9	9	---	---	---	---	PASS
MYO5A	4644	broad.mit.edu	37	15	52659257	52659257	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52659257C>T	uc002aby.2	-	23	3375	c.3131G>A	c.(3130-3132)CGC>CAC	p.R1044H	MYO5A_uc002abx.3_Missense_Mutation_p.R1044H|MYO5A_uc010uge.1_Missense_Mutation_p.R913H	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1	1044	Potential.				actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		CTGCACGATGCGGTGATTGAG	0.403													4	211	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63132812	63132812	+	3'UTR	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63132812G>T	uc002alb.3	+	56					TLN2_uc002alc.3_3'UTR|TLN2_uc010uic.1_3'UTR	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2						cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						AGGGCTAAAGGTGCGAGCCCA	0.572													30	7	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72192182	72192182	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72192182G>T	uc002atl.3	-	24	3789	c.3316C>A	c.(3316-3318)CAG>AAG	p.Q1106K	MYO9A_uc010biq.2_Missense_Mutation_p.Q726K|MYO9A_uc002atn.1_Missense_Mutation_p.Q1087K|MYO9A_uc002atk.2_5'Flank|MYO9A_uc002atm.1_5'Flank	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	1106	Neck or regulatory domain.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						CTCCATTTCTGCTGGATAACG	0.493													88	26	---	---	---	---	PASS
ARIH1	25820	broad.mit.edu	37	15	72847605	72847605	+	Intron	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72847605C>G	uc002aut.3	+							NM_005744	NP_005735	Q9Y4X5	ARI1_HUMAN	ariadne ubiquitin-conjugating enzyme E2 binding						ubiquitin-dependent protein catabolic process	cytoplasm|ubiquitin ligase complex	ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding				0						TTTTGTTTTTCTTACAGTATT	0.368													33	73	---	---	---	---	PASS
LINGO1	84894	broad.mit.edu	37	15	77907685	77907685	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77907685G>A	uc002bct.1	-	2	616	c.564C>T	c.(562-564)AGC>AGT	p.S188S	LINGO1_uc002bcu.1_Silent_p.S182S	NM_032808	NP_116197	Q96FE5	LIGO1_HUMAN	leucine-rich repeat neuronal 6A	188	Extracellular (Potential).|LRR 5.				negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)|lung(1)	2						TGTTGAGGCCGCTGAAGGCGC	0.582													120	21	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86124126	86124126	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86124126T>C	uc002blv.1	+	7	2997	c.2827T>C	c.(2827-2829)TCT>CCT	p.S943P	AKAP13_uc002blt.1_Missense_Mutation_p.S943P|AKAP13_uc002blu.1_Missense_Mutation_p.S943P|AKAP13_uc010bne.1_5'Flank	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	943					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						AAATGCTCTCTCTTCAGGAAC	0.433													73	178	---	---	---	---	PASS
ACSM2A	123876	broad.mit.edu	37	16	20477012	20477012	+	Silent	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20477012T>A	uc010bwe.2	+	4	590	c.351T>A	c.(349-351)CCT>CCA	p.P117P	ACSM2A_uc010bwd.1_RNA|ACSM2A_uc010vax.1_Silent_p.P38P|ACSM2A_uc002dhf.3_Silent_p.P117P|ACSM2A_uc002dhg.3_Silent_p.P117P|ACSM2A_uc010vay.1_Silent_p.P38P	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	117					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						CCCGAGTGCCTGAGTGGTGGC	0.572													29	14	---	---	---	---	PASS
ACSM2A	123876	broad.mit.edu	37	16	20480823	20480823	+	Intron	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20480823G>A	uc010bwe.2	+						ACSM2A_uc010bwd.1_Intron|ACSM2A_uc010vax.1_Intron|ACSM2A_uc002dhf.3_Intron|ACSM2A_uc002dhg.3_Intron|ACSM2A_uc010vay.1_Intron	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member						fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						CTAAATTGTTGGCTTCTTTAG	0.438													73	32	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20998633	20998633	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20998633T>C	uc010vbe.1	-	47	7020	c.7020A>G	c.(7018-7020)ATA>ATG	p.I2340M	DNAH3_uc010vbd.1_5'Flank	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2340					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TTACCTTCTCTATGGTCTGCT	0.428													185	71	---	---	---	---	PASS
PRSS53	339105	broad.mit.edu	37	16	31100137	31100137	+	5'Flank	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31100137C>G	uc002eaq.2	-						PRSS53_uc002ear.2_Intron	NM_001039503	NP_001034592	Q2L4Q9	PRS53_HUMAN	polyserase 3 precursor						proteolysis	extracellular region	serine-type endopeptidase activity				0						TCATGCTGCCCCGGGCCACTC	0.642													44	12	---	---	---	---	PASS
TOX3	27324	broad.mit.edu	37	16	52484312	52484312	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52484312C>A	uc002egw.2	-	4	726	c.555G>T	c.(553-555)CAG>CAT	p.Q185H	TOX3_uc010vgt.1_Missense_Mutation_p.Q180H|TOX3_uc010vgu.1_Missense_Mutation_p.Q185H	NM_001080430	NP_001073899	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	185					apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity				0						TCAACCCCAACTGGGCGCTGA	0.572													54	183	---	---	---	---	PASS
RBL2	5934	broad.mit.edu	37	16	53515706	53515706	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53515706C>A	uc002ehi.3	+	21	3326	c.3208C>A	c.(3208-3210)CGA>AGA	p.R1070R	RBL2_uc002ehj.2_Silent_p.R780R|RBL2_uc010vgw.1_Silent_p.R449R	NM_005611	NP_005602	Q08999	RBL2_HUMAN	retinoblastoma-like 2 (p130)	1070					cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5						GCTTTCTCCTCGAGAAAAGAT	0.398													93	75	---	---	---	---	PASS
FTO	79068	broad.mit.edu	37	16	53878072	53878072	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53878072G>C	uc002ehr.2	+	4	979	c.757G>C	c.(757-759)GAA>CAA	p.E253Q	FTO_uc010vha.1_5'UTR	NM_001080432	NP_001073901	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	253	Fe2OG dioxygenase domain.				DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GGCAGGCCCTGAAGAGGAAAG	0.343													31	88	---	---	---	---	PASS
AMFR	267	broad.mit.edu	37	16	56403212	56403212	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56403212G>C	uc002eiy.2	-	11	1613	c.1408C>G	c.(1408-1410)CAG>GAG	p.Q470E	AMFR_uc002eix.2_Missense_Mutation_p.Q104E	NM_001144	NP_001135	Q9UKV5	AMFR2_HUMAN	autocrine motility factor receptor	470	CUE.				endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding			breast(2)	2						TATGGAACCTGGGGAAACATC	0.443													80	72	---	---	---	---	PASS
ATP6V0D1	9114	broad.mit.edu	37	16	67472472	67472472	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67472472G>A	uc002ete.1	-	8	1115	c.1015C>T	c.(1015-1017)CGC>TGC	p.R339C	ATP6V0D1_uc010vjo.1_Missense_Mutation_p.R380C|ATP6V0D1_uc010vjn.1_Missense_Mutation_p.R262C	NM_004691	NP_004682	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal, V0 subunit	339					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex					0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		GCGCGGTGGCGCTGGGCGATA	0.458													30	68	---	---	---	---	PASS
MARVELD3	91862	broad.mit.edu	37	16	71674923	71674923	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71674923C>G	uc002fau.2	+	3	1289	c.1226C>G	c.(1225-1227)ACT>AGT	p.T409S	PHLPP2_uc002fav.2_RNA|MARVELD3_uc010cge.2_3'UTR	NM_001017967	NP_001017967	Q96A59	MALD3_HUMAN	MARVEL domain containing 3 isoform 1	Error:Variant_position_missing_in_Q96A59_after_alignment						integral to membrane				skin(1)	1		Ovarian(137;0.125)				TGGTCTGGAACTCTTTGAGAT	0.473													11	46	---	---	---	---	PASS
ANKRD11	29123	broad.mit.edu	37	16	89347559	89347559	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89347559C>A	uc002fmx.1	-	9	5852	c.5391G>T	c.(5389-5391)AGG>AGT	p.R1797S	ANKRD11_uc002fmy.1_Missense_Mutation_p.R1797S|ANKRD11_uc002fnc.1_Missense_Mutation_p.R1797S|ANKRD11_uc002fna.1_5'Flank|ANKRD11_uc002fnb.1_Missense_Mutation_p.R1754S	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1797						nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CCTCGGGGGTCCTCCTAATGT	0.592													32	94	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578271T>A	uc002gim.2	-	6	772	c.578A>T	c.(577-579)CAT>CTT	p.H193L	TP53_uc002gig.1_Missense_Mutation_p.H193L|TP53_uc002gih.2_Missense_Mutation_p.H193L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H61L|TP53_uc010cng.1_Missense_Mutation_p.H61L|TP53_uc002gii.1_Missense_Mutation_p.H61L|TP53_uc010cnh.1_Missense_Mutation_p.H193L|TP53_uc010cni.1_Missense_Mutation_p.H193L|TP53_uc002gij.2_Missense_Mutation_p.H193L|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.H100L|TP53_uc002gio.2_Missense_Mutation_p.H61L|TP53_uc010vug.1_Missense_Mutation_p.H154L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	193	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		H -> D (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H193R(67)|p.H193L(31)|p.H193Y(26)|p.H193P(12)|p.0?(7)|p.H193D(7)|p.H193N(4)|p.A189_V197delAPPQHLIRV(4)|p.H193fs*16(3)|p.H193H(2)|p.P191fs*53(2)|p.K164_P219del(1)|p.P191fs*15(1)|p.P191fs*6(1)|p.H100L(1)|p.H61L(1)|p.H193_I195delHLI(1)|p.H193_I195>AP(1)|p.A189fs*53(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCGGATAAGATGCTGAGGAGG	0.562		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			54	16	---	---	---	---	PASS
KDM6B	23135	broad.mit.edu	37	17	7751547	7751547	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7751547C>T	uc002giw.1	+	11	2317	c.1941C>T	c.(1939-1941)GGC>GGT	p.G647G	KDM6B_uc002gix.2_5'UTR	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	647	Pro-rich.				inflammatory response	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			central_nervous_system(1)|pancreas(1)	2						CACCCCCAGGCCCCCTGAGTA	0.701													15	39	---	---	---	---	PASS
KRBA2	124751	broad.mit.edu	37	17	8274697	8274697	+	Silent	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8274697A>G	uc002glf.1	-	1	162	c.156T>C	c.(154-156)TAT>TAC	p.Y52Y	KRBA2_uc002glg.1_Intron	NM_213597	NP_998762	Q6ZNG9	KRBA2_HUMAN	KRAB-A domain containing 2	52	KRAB.				DNA integration|regulation of transcription, DNA-dependent	intracellular	DNA binding				0						AGCCTTCTAAATAATTCCAAT	0.438													80	154	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10346825	10346825	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10346825T>C	uc002gmn.2	-	40	5798	c.5687A>G	c.(5686-5688)AAC>AGC	p.N1896S	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1896	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						CTTGGCAAGGTTGACATTGGA	0.468													84	42	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10400625	10400625	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10400625G>C	uc002gmo.2	-	32	4604	c.4510C>G	c.(4510-4512)CGG>GGG	p.R1504G	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1504	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TTATTTTCCCGTTTCAAGGTT	0.308													65	28	---	---	---	---	PASS
CRLF3	51379	broad.mit.edu	37	17	29131049	29131049	+	Silent	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29131049G>C	uc002hfr.3	-	2	316	c.207C>G	c.(205-207)CTC>CTG	p.L69L	CRLF3_uc010wbr.1_Intron	NM_015986	NP_057070	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	69					negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				GCTCATCCAGGAGCTTTCCAA	0.413													155	131	---	---	---	---	PASS
RHOT1	55288	broad.mit.edu	37	17	30510218	30510218	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30510218C>T	uc002hgz.2	+	8	706	c.467C>T	c.(466-468)TCA>TTA	p.S156L	RHOT1_uc002hgw.2_Missense_Mutation_p.S156L|RHOT1_uc002hgy.2_Missense_Mutation_p.S156L|RHOT1_uc002hha.2_Missense_Mutation_p.S29L|RHOT1_uc010csv.2_RNA|RHOT1_uc002hgx.2_Missense_Mutation_p.S29L|RHOT1_uc010wby.1_Missense_Mutation_p.S156L|RHOT1_uc002hhb.2_Missense_Mutation_p.S135L|RHOT1_uc002hgv.2_Missense_Mutation_p.S156L	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3	156	Miro 1.|Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				AAGAACATATCAGAGCTCTTT	0.383													114	91	---	---	---	---	PASS
TMEM132E	124842	broad.mit.edu	37	17	32961955	32961955	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32961955C>A	uc002hif.2	+	8	1884	c.1556C>A	c.(1555-1557)ACT>AAT	p.T519N		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	519	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		TCCGAGGGCACTGACCAGGTG	0.632													67	61	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34185444	34185444	+	Missense_Mutation	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34185444A>G	uc002hke.1	-	10	1174	c.1025T>C	c.(1024-1026)GTC>GCC	p.V342A	C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Missense_Mutation_p.V302A|C17orf66_uc010wcm.1_Missense_Mutation_p.V308A	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957	342							binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		TACCTCAAGGACACTGGAAGA	0.547													43	44	---	---	---	---	PASS
ACACA	31	broad.mit.edu	37	17	35549249	35549249	+	Intron	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35549249G>C	uc002hnm.2	-						ACACA_uc002hnk.2_Intron|ACACA_uc002hnl.2_Intron|ACACA_uc002hnn.2_Intron|ACACA_uc002hno.2_Intron|ACACA_uc010cuy.2_Intron	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2						acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TCCTCAAACTGAGTACAAGAA	0.398													22	61	---	---	---	---	PASS
SYNRG	11276	broad.mit.edu	37	17	35931928	35931928	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35931928C>A	uc002hoa.2	-	9	1143	c.1060G>T	c.(1060-1062)GAA>TAA	p.E354*	SYNRG_uc010wde.1_Nonsense_Mutation_p.E276*|SYNRG_uc010wdf.1_Nonsense_Mutation_p.E276*|SYNRG_uc002hoc.2_Nonsense_Mutation_p.E275*|SYNRG_uc002hoe.2_Nonsense_Mutation_p.E276*|SYNRG_uc002hod.2_Nonsense_Mutation_p.E276*|SYNRG_uc010wdg.1_Nonsense_Mutation_p.E276*|SYNRG_uc002hob.2_Nonsense_Mutation_p.E354*|SYNRG_uc002hof.2_Nonsense_Mutation_p.E66*|SYNRG_uc010cvd.1_Nonsense_Mutation_p.E154*|SYNRG_uc002hog.1_Nonsense_Mutation_p.E488*|SYNRG_uc010wdh.1_3'UTR	NM_007247	NP_009178	Q9UMZ2	SYNRG_HUMAN	synergin, gamma isoform 1	354	EH.				endocytosis|intracellular protein transport	AP-1 adaptor complex	calcium ion binding			ovary(2)	2						GTATAAAGTTCTTCTTTTGTA	0.373													84	67	---	---	---	---	PASS
SRCIN1	80725	broad.mit.edu	37	17	36708245	36708245	+	Silent	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36708245C>A	uc002hqd.2	-	14	2829	c.2604G>T	c.(2602-2604)CCG>CCT	p.P868P	SRCIN1_uc002hqf.1_Silent_p.P740P|SRCIN1_uc002hqe.2_Silent_p.P722P|SRCIN1_uc002hqg.2_Silent_p.P174P	NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein	740					exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						GCAGGTTCAGCGGGGGGCTGG	0.617													27	84	---	---	---	---	PASS
KRT20	54474	broad.mit.edu	37	17	39038830	39038830	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39038830C>T	uc002hvl.2	-	2	509	c.467G>A	c.(466-468)AGA>AAA	p.R156K		NM_019010	NP_061883	P35900	K1C20_HUMAN	keratin 20	156	Coil 1B.|Rod.				apoptosis|intermediate filament organization	Golgi apparatus|intermediate filament	protein binding|structural constituent of cytoskeleton			large_intestine(1)|kidney(1)|skin(1)	3		Breast(137;0.000301)|Ovarian(249;0.15)				CTACTTCAGTCTGAAGTCCTC	0.393													83	110	---	---	---	---	PASS
KRT16	3868	broad.mit.edu	37	17	39768815	39768815	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39768815G>T	uc002hxg.3	-	1	265	c.126C>A	c.(124-126)GCC>GCA	p.A42A	JUP_uc010wfs.1_Intron	NM_005557	NP_005548	P08779	K1C16_HUMAN	keratin 16	42	Head.			RAP -> PA (in Ref. 1; AAA59460).	cell proliferation|epidermis development	intermediate filament	protein binding|structural constituent of cytoskeleton			skin(1)	1		Breast(137;0.000307)				AGGTGCTGGGGGCACGGCAGG	0.721													3	6	---	---	---	---	PASS
AOC3	8639	broad.mit.edu	37	17	41004563	41004563	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41004563G>T	uc002ibv.2	+	1	1363	c.1203G>T	c.(1201-1203)GGG>GGT	p.G401G		NM_003734	NP_003725	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3 precursor	401	Extracellular (Potential).				amine metabolic process|cell adhesion|inflammatory response	cell surface|integral to membrane|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|protein homodimerization activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	TGACCCGTGGGGTGGACTGCC	0.567													57	86	---	---	---	---	PASS
DHX8	1659	broad.mit.edu	37	17	41577356	41577356	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41577356G>C	uc002idu.1	+	11	1504	c.1431G>C	c.(1429-1431)ATG>ATC	p.M477I	DHX8_uc010wif.1_Missense_Mutation_p.M386I|DHX8_uc010wig.1_Missense_Mutation_p.M477I	NM_004941	NP_004932	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	477						catalytic step 2 spliceosome	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|pancreas(1)	4		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		AAGCAGCAATGATGCAGAGTG	0.488													168	565	---	---	---	---	PASS
SOST	50964	broad.mit.edu	37	17	41832873	41832873	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41832873C>T	uc002iec.1	-	2	526	c.479G>A	c.(478-480)CGC>CAC	p.R160H		NM_025237	NP_079513	Q9BQB4	SOST_HUMAN	sclerostin precursor	160	CTCK.				negative regulation of BMP signaling pathway|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of ossification|negative regulation of protein complex assembly|negative regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway		heparin binding|protein binding				0		Breast(137;0.00725)		UCEC - Uterine corpus endometrioid carcinoma (308;0.177)|BRCA - Breast invasive adenocarcinoma(366;0.0741)		GGCCACCAGGCGCACCTTGCG	0.721													12	42	---	---	---	---	PASS
TANC2	26115	broad.mit.edu	37	17	61492927	61492927	+	Nonsense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61492927C>A	uc002jal.3	+	23	3830	c.3807C>A	c.(3805-3807)TAC>TAA	p.Y1269*	TANC2_uc010wpe.1_Nonsense_Mutation_p.Y1179*|TANC2_uc002jao.3_Nonsense_Mutation_p.Y380*	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and	1269	TPR 1.						binding			ovary(2)	2						GCTACCAGTACGCCCTGAAGA	0.512													41	42	---	---	---	---	PASS
MAP3K3	4215	broad.mit.edu	37	17	61767648	61767648	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61767648G>T	uc002jbg.2	+	12	1407	c.1088G>T	c.(1087-1089)CGC>CTC	p.R363L	MAP3K3_uc002jbe.2_Missense_Mutation_p.R394L|MAP3K3_uc002jbf.2_Missense_Mutation_p.R394L|MAP3K3_uc002jbh.2_Missense_Mutation_p.R390L|MAP3K3_uc010wpo.1_Missense_Mutation_p.R278L|MAP3K3_uc010wpp.1_Missense_Mutation_p.R359L	NM_002401	NP_002392	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	363	Protein kinase.				MAPKKK cascade|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autophosphorylation	cytosol	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			lung(3)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)	6						ATCAACTGGCGCCGGGGAAAG	0.517													4	233	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67197667	67197667	+	Silent	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67197667T>C	uc010dfa.1	-	11	2028	c.1149A>G	c.(1147-1149)CCA>CCG	p.P383P	ABCA10_uc010wqt.1_RNA|ABCA10_uc010dfb.1_5'UTR|ABCA10_uc010dfc.1_Intron	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	383					transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					CATGGAATTCTGGAGACACCG	0.353													58	60	---	---	---	---	PASS
GPR142	350383	broad.mit.edu	37	17	72368690	72368690	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72368690C>A	uc010wqy.1	+	4	1340	c.1340C>A	c.(1339-1341)GCG>GAG	p.A447E	GPR142_uc010wqx.1_Missense_Mutation_p.A359E	NM_181790	NP_861455	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	447	Cytoplasmic (Potential).					cell junction|cytoplasm|integral to membrane	G-protein coupled receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GGCATGGCGGCGAAGCCTGTG	0.617													5	39	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5394784	5394784	+	Silent	SNP	A	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5394784A>C	uc002kmt.1	-	22	3248	c.3162T>G	c.(3160-3162)GCT>GCG	p.A1054A	EPB41L3_uc010wzh.1_Intron|EPB41L3_uc002kmu.1_Silent_p.A832A|EPB41L3_uc010dkq.1_Silent_p.A723A|EPB41L3_uc002kms.1_Silent_p.A289A|EPB41L3_uc010wze.1_Silent_p.A359A|EPB41L3_uc010wzf.1_Silent_p.A351A|EPB41L3_uc010wzg.1_Silent_p.A326A|EPB41L3_uc010dkr.2_Silent_p.A446A	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	1054	Carboxyl-terminal (CTD).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						TAATTGCCTGAGCCAGCGCCT	0.483													64	32	---	---	---	---	PASS
CEP192	55125	broad.mit.edu	37	18	13049582	13049582	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13049582G>C	uc010xac.1	+	16	2872	c.2792G>C	c.(2791-2793)AGA>ACA	p.R931T	CEP192_uc010dlf.1_RNA|CEP192_uc010xad.1_Missense_Mutation_p.R456T|CEP192_uc002kru.2_RNA|CEP192_uc002krs.1_Missense_Mutation_p.R672T	NM_032142	NP_115518	E9PF99	E9PF99_HUMAN	centrosomal protein 192kDa	931										ovary(4)|pancreas(1)	5						CGAGATAACAGAGAAAATCAG	0.383													123	36	---	---	---	---	PASS
MC2R	4158	broad.mit.edu	37	18	13884819	13884819	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13884819G>T	uc002ksp.1	-	2	876	c.699C>A	c.(697-699)GCC>GCA	p.A233A		NM_000529	NP_000520	Q01718	ACTHR_HUMAN	melanocortin 2 receptor	233	Helical; Name=6; (By similarity).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	corticotropin receptor activity|protein binding			ovary(4)|skin(1)	5					Corticotropin(DB01285)|Cosyntropin(DB01284)	GCACAAAGGGGGCCCAGCAGA	0.547													71	22	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21501541	21501541	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21501541C>T	uc002kuq.2	+	62	8255	c.8169C>T	c.(8167-8169)ATC>ATT	p.I2723I	LAMA3_uc002kur.2_Silent_p.I2667I|LAMA3_uc002kus.3_Silent_p.I1114I|LAMA3_uc002kut.3_Silent_p.I1058I	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1	2723	Laminin G-like 2.				cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CAATTGCAATCAGGGAAAGGT	0.333													68	659	---	---	---	---	PASS
C18orf54	162681	broad.mit.edu	37	18	51888324	51888324	+	Intron	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51888324C>T	uc002lfn.3	+						C18orf54_uc002lfo.3_Silent_p.L199L	NM_173529	NP_775800	Q8IYD9	CR054_HUMAN	hypothetical protein LOC162681 precursor							extracellular region				ovary(1)|skin(1)	2				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		ATGTGGTAGGCTGAAAAACCC	0.373													51	22	---	---	---	---	PASS
CCDC102B	79839	broad.mit.edu	37	18	66504591	66504591	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66504591G>T	uc002lkk.2	+	4	814	c.591G>T	c.(589-591)GAG>GAT	p.E197D	CCDC102B_uc002lki.2_Missense_Mutation_p.E197D|CCDC102B_uc002lkj.1_Missense_Mutation_p.E197D	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	197										ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				CTACAAAGGAGGACACAAATA	0.348													101	42	---	---	---	---	PASS
CCDC102B	79839	broad.mit.edu	37	18	66678241	66678241	+	Missense_Mutation	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66678241C>G	uc002lkk.2	+	9	1557	c.1334C>G	c.(1333-1335)ACT>AGT	p.T445S	CCDC102B_uc002lki.2_Missense_Mutation_p.T445S	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	445	Potential.									ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				GCAGAACTGACTCATGCAAAC	0.348													46	15	---	---	---	---	PASS
ACER1	125981	broad.mit.edu	37	19	6309832	6309832	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6309832G>A	uc002mel.2	-	4	442	c.364C>T	c.(364-366)CGC>TGC	p.R122C		NM_133492	NP_597999	Q8TDN7	ACER1_HUMAN	alkaline ceramidase 1	122	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane	ceramidase activity				0						AAGACCAGGCGGATGAACTGG	0.612													26	60	---	---	---	---	PASS
GPR108	56927	broad.mit.edu	37	19	6732170	6732170	+	Intron	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6732170C>A	uc002mfp.2	-						GPR108_uc010duv.2_5'Flank|GPR108_uc002mfn.2_Intron|GPR108_uc002mfo.3_Intron|GPR108_uc010duw.2_Intron	NM_001080452	NP_001073921	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108 isoform 1							integral to membrane					0						CCAGGACCTGCGCAGGCGGCG	0.677													25	27	---	---	---	---	PASS
LASS4	79603	broad.mit.edu	37	19	8322848	8322848	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8322848G>A	uc002mjg.2	+	10	1147	c.827G>A	c.(826-828)CGA>CAA	p.R276Q	LASS4_uc002mjh.2_Missense_Mutation_p.R225Q|LASS4_uc002mji.2_Missense_Mutation_p.R112Q|LASS4_uc010dvz.2_Intron	NM_024552	NP_078828	Q9HA82	CERS4_HUMAN	LAG1 homolog, ceramide synthase 4	276	TLC.|Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane|nuclear membrane	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sphingosine N-acyltransferase activity			ovary(1)	1						TTCTACACCCGACTGGTCCTC	0.562													64	238	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	8994501	8994501	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8994501G>A	uc002mkp.2	-	64	41595	c.41391C>T	c.(41389-41391)TTC>TTT	p.F13797F	MUC16_uc010dwi.2_RNA|MUC16_uc010dwj.2_Silent_p.F614F|MUC16_uc010xki.1_RNA	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	13799	Extracellular (Potential).|SEA 12.|ANK 1.			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TAGTGATGGTGAAGTTGAGGG	0.483													43	269	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9087854	9087854	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9087854G>C	uc002mkp.2	-	1	4165	c.3961C>G	c.(3961-3963)CCC>GCC	p.P1321A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	1321	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TAGGTGGTGGGGTCCCAGGTA	0.507													68	133	---	---	---	---	PASS
CARM1	10498	broad.mit.edu	37	19	11032100	11032100	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11032100G>C	uc002mpz.2	+	15	1791	c.1665G>C	c.(1663-1665)ATG>ATC	p.M555I	CARM1_uc010dxn.2_RNA|CARM1_uc002mqa.2_Intron	NM_199141	NP_954592	Q86X55	CARM1_HUMAN	coactivator-associated arginine	555	Transactivation domain (By similarity).				cellular lipid metabolic process|histone H3-R2 methylation|interspecies interaction between organisms|pathogenesis|positive regulation of fat cell differentiation|regulation of estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleoplasm	beta-catenin binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-R17 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein-arginine omega-N asymmetric methyltransferase activity|transcription regulatory region DNA binding				0						GCTCCATAATGAGCACGGGGA	0.672													100	228	---	---	---	---	PASS
ZNF653	115950	broad.mit.edu	37	19	11598418	11598418	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11598418G>A	uc002mrz.1	-	4	913	c.860C>T	c.(859-861)GCG>GTG	p.A287V		NM_138783	NP_620138	Q96CK0	ZN653_HUMAN	zinc finger protein 653	287					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCTGGGGCCCGCACCCACTTG	0.687													4	169	---	---	---	---	PASS
ZNF763	284390	broad.mit.edu	37	19	12089587	12089587	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12089587C>T	uc002msw.2	+	4	1003	c.848C>T	c.(847-849)CCA>CTA	p.P283L	ZNF763_uc010xmf.1_Missense_Mutation_p.P303L|ZNF763_uc002msv.2_Missense_Mutation_p.P286L|ZNF763_uc010xmg.1_Missense_Mutation_p.P161L	NM_001012753	NP_001012771	Q0D2J5	ZN763_HUMAN	zinc finger protein 763	283					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						GGGGGAAAGCCATATGAATGT	0.418													97	78	---	---	---	---	PASS
ZNF433	163059	broad.mit.edu	37	19	12126290	12126290	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12126290G>C	uc002msy.1	-	4	1563	c.1392C>G	c.(1390-1392)TTC>TTG	p.F464L	uc002msx.1_Intron|ZNF433_uc002msz.1_Missense_Mutation_p.F429L	NM_001080411	NP_001073880	Q8N7K0	ZN433_HUMAN	zinc finger protein 433	464	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTATTTGAAAGAAAGAGAAAT	0.393													31	141	---	---	---	---	PASS
ZNF44	51710	broad.mit.edu	37	19	12384865	12384865	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12384865C>T	uc010xmj.1	-	5	554	c.349G>A	c.(349-351)GAG>AAG	p.E117K	ZNF44_uc002mtl.2_Intron|ZNF44_uc010dyr.1_Intron|ZNF44_uc010xmi.1_RNA|ZNF44_uc002mtn.3_RNA|ZNF44_uc010dys.2_Missense_Mutation_p.E69K	NM_001164276	NP_001157748	P15621	ZNF44_HUMAN	zinc finger protein 44 isoform 1	117	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		CCAAATCTCTCTACCACATCA	0.313													94	525	---	---	---	---	PASS
EMR3	84658	broad.mit.edu	37	19	14740935	14740935	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14740935G>T	uc002mzi.3	-	14	1876	c.1728C>A	c.(1726-1728)GCC>GCA	p.A576A	EMR3_uc010dzp.2_Silent_p.A524A|EMR3_uc010xnv.1_Silent_p.A450A	NM_032571	NP_115960	Q9BY15	EMR3_HUMAN	egf-like module-containing mucin-like receptor	576	Helical; Name=6; (Potential).				neuropeptide signaling pathway	extracellular space|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(5)|skin(1)	6						CCATGACCTGGGCAGCTGGAC	0.557													74	68	---	---	---	---	PASS
RASAL3	64926	broad.mit.edu	37	19	15564029	15564029	+	Nonsense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15564029C>T	uc002nbe.2	-	15	2645	c.2559G>A	c.(2557-2559)TGG>TGA	p.W853*	RASAL3_uc002nbd.2_Nonsense_Mutation_p.W193*|RASAL3_uc010eaa.1_Nonsense_Mutation_p.W341*	NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	853					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						AGTCCCGGGTCCAAGGCCGGG	0.736													7	20	---	---	---	---	PASS
CIB3	117286	broad.mit.edu	37	19	16280444	16280444	+	Silent	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16280444C>G	uc002nds.2	-	3	195	c.195G>C	c.(193-195)CTG>CTC	p.L65L	CIB3_uc010eae.2_Silent_p.L4L|CIB3_uc010eaf.2_Intron|CIB3_uc010eag.2_Intron	NM_054113	NP_473454	Q96Q77	CIB3_HUMAN	DNA-dependent protein kinase catalytic	65							calcium ion binding			ovary(1)	1						GGCATACCTTCAGCTCGGGCA	0.433													20	54	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17728602	17728602	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17728602C>T	uc002nhd.2	-	40	4731	c.4731G>A	c.(4729-4731)CCG>CCA	p.P1577P		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	1489	MHD2.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						ATTGCAGGTCCGGGCTCTTCT	0.597													42	172	---	---	---	---	PASS
SLC5A5	6528	broad.mit.edu	37	19	18001770	18001770	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18001770C>T	uc002nhr.3	+	14	2074	c.1727C>T	c.(1726-1728)CCC>CTC	p.P576L		NM_000453	NP_000444	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium iodide	576	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4						TCAGTGGCCCCCAAGGAAGAA	0.592													135	211	---	---	---	---	PASS
ZNF626	199777	broad.mit.edu	37	19	20807233	20807233	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20807233C>T	uc002npb.1	-	4	1600	c.1450G>A	c.(1450-1452)GAA>AAA	p.E484K	ZNF626_uc002npc.1_Missense_Mutation_p.E408K	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	484	C2H2-type 12; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						CCACATTCTTCACATTTGTAG	0.388													8	76	---	---	---	---	PASS
ZNF626	199777	broad.mit.edu	37	19	20807401	20807401	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20807401C>T	uc002npb.1	-	4	1432	c.1282G>A	c.(1282-1284)GAA>AAA	p.E428K	ZNF626_uc002npc.1_Missense_Mutation_p.E352K	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	428	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						CCACATTCTTCACATTTGTAG	0.388													52	296	---	---	---	---	PASS
ZNF626	199777	broad.mit.edu	37	19	20807684	20807684	+	Missense_Mutation	SNP	T	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20807684T>A	uc002npb.1	-	4	1149	c.999A>T	c.(997-999)AGA>AGT	p.R333S	ZNF626_uc002npc.1_Missense_Mutation_p.R257S	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	333	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						CAGTATGAATTCTTTTATGTG	0.353													85	432	---	---	---	---	PASS
ZNF85	7639	broad.mit.edu	37	19	21131617	21131617	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21131617G>A	uc002npg.3	+	4	424	c.297G>A	c.(295-297)GTG>GTA	p.V99V	ZNF85_uc010ecn.2_Silent_p.V34V|ZNF85_uc010eco.2_Silent_p.V47V|ZNF85_uc002npi.2_Silent_p.V40V	NM_003429	NP_003420	Q03923	ZNF85_HUMAN	zinc finger protein 85	99						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			central_nervous_system(1)	1						TCCAAAAAGTGACACTGAAAA	0.348													43	259	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22155510	22155510	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22155510G>T	uc002nqp.2	-	5	2175	c.2026C>A	c.(2026-2028)CCC>ACC	p.P676T	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				CATTTGTAGGGTTTCTCTACA	0.363													62	64	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30936483	30936483	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30936483C>T	uc002nsu.1	+	2	2152	c.2014C>T	c.(2014-2016)CGT>TGT	p.R672C	ZNF536_uc010edd.1_Missense_Mutation_p.R672C	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	672					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					GGATGAGCGGCGTGGCTCGGG	0.692													31	91	---	---	---	---	PASS
SLC7A9	11136	broad.mit.edu	37	19	33355641	33355641	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33355641G>A	uc002ntv.3	-	3	246	c.129C>T	c.(127-129)ATC>ATT	p.I43I	SLC7A9_uc002ntt.3_Intron|SLC7A9_uc002ntu.3_Silent_p.I43I|SLC7A9_uc002ntw.3_Intron	NM_001126335	NP_001119807	P82251	BAT1_HUMAN	solute carrier family 7, member 9	43	Helical; (Potential).				blood coagulation|cellular amino acid metabolic process|ion transport|leukocyte migration|protein complex assembly	integral to plasma membrane	L-cystine transmembrane transporter activity|neutral amino acid transmembrane transporter activity|peptide antigen binding			skin(1)	1	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	CAGAGCCAATGATGGTGCCCA	0.627													50	457	---	---	---	---	PASS
LRP3	4037	broad.mit.edu	37	19	33695616	33695616	+	Silent	SNP	A	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33695616A>C	uc010edh.2	+	4	426	c.333A>C	c.(331-333)CCA>CCC	p.P111P	LRP3_uc010xrp.1_5'UTR|LRP3_uc002nuk.3_5'UTR	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	111	Extracellular (Potential).|CUB 1.				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					CAGCAGCCCCACCCCGCCAGG	0.662													12	133	---	---	---	---	PASS
PEPD	5184	broad.mit.edu	37	19	33878385	33878385	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33878385G>A	uc002nur.3	-	15	1482	c.1347C>T	c.(1345-1347)GTC>GTT	p.V449V	PEPD_uc010xrr.1_Silent_p.V408V|PEPD_uc010xrs.1_Silent_p.V385V|PEPD_uc002nuq.3_Silent_p.V128V	NM_000285	NP_000276	P12955	PEPD_HUMAN	prolidase isoform 1	449					cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(2)	2	Esophageal squamous(110;0.137)					CCTCGATGCGGACCTGGGTCA	0.612													43	243	---	---	---	---	PASS
GPI	2821	broad.mit.edu	37	19	34859477	34859477	+	Intron	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34859477G>A	uc002nvg.1	+						GPI_uc002nvf.2_Intron|GPI_uc010xrv.1_Intron|GPI_uc010xrw.1_Intron|GPI_uc010edl.1_Intron|GPI_uc002nvh.1_3'UTR	NM_000175	NP_000166	P06744	G6PI_HUMAN	glucose phosphate isomerase						angiogenesis|gluconeogenesis|glycolysis|hemostasis|humoral immune response	cytosol|extracellular space|nucleus|plasma membrane	cytokine activity|glucose-6-phosphate isomerase activity|growth factor activity			ovary(1)|kidney(1)	2	Esophageal squamous(110;0.162)					TATCCTGACCGTAATCCCCAG	0.612													4	189	---	---	---	---	PASS
PDCD2L	84306	broad.mit.edu	37	19	34895654	34895654	+	Missense_Mutation	SNP	C	G	G	rs143274693		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34895654C>G	uc002nvj.2	+	2	242	c.209C>G	c.(208-210)CCG>CGG	p.P70R		NM_032346	NP_115722	Q9BRP1	PDD2L_HUMAN	programmed cell death 2-like	70						cytoplasm				ovary(1)	1	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			GAAGGCTCCCCGTTTCACCGT	0.706													9	71	---	---	---	---	PASS
TMEM149	79713	broad.mit.edu	37	19	36230925	36230925	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36230925T>C	uc002obc.2	-	4	508	c.407A>G	c.(406-408)CAG>CGG	p.Q136R	TMEM149_uc002obb.2_Intron|TMEM149_uc002obd.3_Missense_Mutation_p.Q136R|TMEM149_uc010xsy.1_RNA|TMEM149_uc010eej.2_Missense_Mutation_p.Q216R	NM_024660	NP_078936	Q9H665	IGFR1_HUMAN	transmembrane protein 149 precursor	136	Extracellular (Potential).					integral to membrane|plasma membrane	protein binding|receptor activity				0	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCTGCGCTCCTGGGAGCTAGG	0.652													114	53	---	---	---	---	PASS
NPHS1	4868	broad.mit.edu	37	19	36339015	36339015	+	Silent	SNP	C	A	A	rs141962470		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36339015C>A	uc002oby.2	-	11	1368	c.1368G>T	c.(1366-1368)CGG>CGT	p.R456R		NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	456	Extracellular (Potential).|Ig-like C2-type 5.				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGGTCCCAGCCCGGAGCTTCT	0.622													75	298	---	---	---	---	PASS
TYROBP	7305	broad.mit.edu	37	19	36398483	36398483	+	Splice_Site	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36398483C>T	uc002ocm.2	-	3	151	c.95_splice	c.e3-1	p.D32_splice	TYROBP_uc002ocn.2_Splice_Site_p.D32_splice	NM_003332	NP_003323	O43914	TYOBP_HUMAN	TYRO protein tyrosine kinase binding protein						axon guidance|cell junction assembly|cellular defense response|intracellular signal transduction|regulation of immune response	integral to plasma membrane|intracellular	identical protein binding|receptor signaling protein activity				0	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAACTGCAATCTGCAGCACAG	0.632													22	121	---	---	---	---	PASS
ZNF790	388536	broad.mit.edu	37	19	37309846	37309846	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37309846C>T	uc002oew.2	-	5	1519	c.1400G>A	c.(1399-1401)CGA>CAA	p.R467Q	uc002oev.1_Intron	NM_206894	NP_996777	Q6PG37	ZN790_HUMAN	zinc finger protein 790	467	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TTTCTGATGTCGATTAAACTC	0.368													6	459	---	---	---	---	PASS
CATSPERG	57828	broad.mit.edu	37	19	38851187	38851187	+	Nonsense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38851187G>A	uc002oih.3	+	15	1754	c.1667G>A	c.(1666-1668)TGG>TAG	p.W556*	CATSPERG_uc002oig.3_Nonsense_Mutation_p.W516*|CATSPERG_uc002oif.3_Nonsense_Mutation_p.W196*|CATSPERG_uc010efw.2_RNA	NM_021185	NP_067008	Q6ZRH7	CTSRG_HUMAN	cation channel, sperm-associated, gamma	556	Extracellular (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)|skin(1)	2						TCCAAGGGCTGGCAGGTGCAC	0.552													310	65	---	---	---	---	PASS
SERTAD3	29946	broad.mit.edu	37	19	40947845	40947845	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40947845C>T	uc002onu.3	-	2	421	c.143G>A	c.(142-144)CGA>CAA	p.R48Q	SERTAD3_uc002onv.3_Missense_Mutation_p.R48Q	NM_013368	NP_037500	Q9UJW9	SRTD3_HUMAN	RPA-binding trans-activator	48	SERTA.				negative regulation of cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding				0			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTGGGTGCTCGGGGGCCCAG	0.672													20	125	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	40993684	40993684	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40993684G>T	uc002ony.2	+	3	336	c.250G>T	c.(250-252)GAC>TAC	p.D84Y	SPTBN4_uc002onx.2_Missense_Mutation_p.D84Y|SPTBN4_uc002onz.2_Missense_Mutation_p.D84Y	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	84	CH 1.|Actin-binding.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCACATCGGGGACCTCTATGT	0.657													34	241	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41060526	41060526	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41060526G>T	uc002ony.2	+	24	5144	c.5058G>T	c.(5056-5058)GCG>GCT	p.A1686A	SPTBN4_uc002onx.2_Silent_p.A1686A|SPTBN4_uc002onz.2_Silent_p.A1686A|SPTBN4_uc010egx.2_Silent_p.A429A|SPTBN4_uc010egy.1_Silent_p.A362A|SPTBN4_uc002ooa.2_Silent_p.A362A	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	1686	Spectrin 14.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGTGCCGGGCGCTGCTGGAGA	0.642													3	62	---	---	---	---	PASS
LTBP4	8425	broad.mit.edu	37	19	41125266	41125266	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41125266G>A	uc002ooh.1	+	26	3286	c.3286G>A	c.(3286-3288)GAA>AAA	p.E1096K	LTBP4_uc002oog.1_Missense_Mutation_p.E1059K|LTBP4_uc002ooi.1_Missense_Mutation_p.E1029K|LTBP4_uc002ooj.1_5'UTR|LTBP4_uc002ook.1_Missense_Mutation_p.E230K|LTBP4_uc002ool.1_Missense_Mutation_p.E108K|LTBP4_uc002oom.1_RNA|LTBP4_uc010xvp.1_5'UTR	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	1096	Cys-rich.				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GAACGAGTGTGAAACACTACA	0.498													178	640	---	---	---	---	PASS
KLK3	354	broad.mit.edu	37	19	51362782	51362782	+	Intron	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51362782A>T	uc002pts.1	+						KLK3_uc010ycj.1_Intron|KLK3_uc002ptr.1_Intron|KLK3_uc010eof.1_Intron	NM_001030047	NP_001025218	P07288	KLK3_HUMAN	prostate specific antigen isoform 3						negative regulation of angiogenesis|proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		CCACCTACCCACAGTGGGTCA	0.617													65	26	---	---	---	---	PASS
FPR3	2359	broad.mit.edu	37	19	52327118	52327118	+	Silent	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52327118C>T	uc002pxt.1	+	2	301	c.117C>T	c.(115-117)TTC>TTT	p.F39F		NM_002030	NP_002021	P25089	FPR3_HUMAN	formyl peptide receptor-like 2	39	Helical; Name=1; (Potential).				cellular component movement|chemotaxis	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(4)|breast(1)|skin(1)	6						CCTTTGTCTTCGGGGTCCTGG	0.552													100	31	---	---	---	---	PASS
MIR1283-1	100302265	broad.mit.edu	37	19	54191728	54191728	+	5'Flank	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54191728A>G	hsa-mir-1283-1|MI0003832	+						MIR520A_hsa-mir-520a|MI0003149_5'Flank																	0						TGCTGGAGCAAGAAGATCTCA	0.413													87	33	---	---	---	---	PASS
SYT5	6861	broad.mit.edu	37	19	55685915	55685915	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55685915G>C	uc002qjm.1	-	7	1990	c.930C>G	c.(928-930)TTC>TTG	p.F310L	SYT5_uc002qjp.2_Missense_Mutation_p.F306L|SYT5_uc002qjn.1_Missense_Mutation_p.F310L|SYT5_uc002qjo.1_Missense_Mutation_p.F309L	NM_003180	NP_003171	O00445	SYT5_HUMAN	synaptotagmin V	310	Cytoplasmic (Potential).|C2 2.				energy reserve metabolic process|regulation of insulin secretion|synaptic transmission	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane	metal ion binding|transporter activity				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CCTCGAAGCTGAAAGCTTCGT	0.532													89	172	---	---	---	---	PASS
BRSK1	84446	broad.mit.edu	37	19	55815139	55815139	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55815139G>A	uc002qkg.2	+	12	1508	c.1231G>A	c.(1231-1233)GGT>AGT	p.G411S	BRSK1_uc002qkf.2_Missense_Mutation_p.G427S|BRSK1_uc002qkh.2_Missense_Mutation_p.G106S	NM_032430	NP_115806	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	411					establishment of cell polarity|G2/M transition DNA damage checkpoint|neuron differentiation|response to UV	cell junction|cytoplasm|nucleus	magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|stomach(1)|lung(1)|breast(1)|skin(1)	6		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		TGCCGGGGGTGGTGGCTCCCC	0.642													62	16	---	---	---	---	PASS
ZNF274	10782	broad.mit.edu	37	19	58723696	58723696	+	Missense_Mutation	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58723696G>C	uc002qrq.1	+	10	1608	c.1149G>C	c.(1147-1149)TTG>TTC	p.L383F	ZNF274_uc002qrr.1_Missense_Mutation_p.L351F|ZNF274_uc002qrs.1_Missense_Mutation_p.L278F|ZNF274_uc010eum.1_Missense_Mutation_p.L142F	NM_133502	NP_598009	Q96GC6	ZN274_HUMAN	zinc finger protein 274 isoform c	383					viral reproduction	centrosome|nucleolus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		ACACAGTGTTGAAGCAGATGG	0.493													106	20	---	---	---	---	PASS
RBCK1	10616	broad.mit.edu	37	20	391053	391053	+	Intron	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:391053C>T	uc002wdp.3	+						RBCK1_uc010zpl.1_Intron|RBCK1_uc010zpm.1_Intron|RBCK1_uc002wdq.3_Intron|RBCK1_uc010fzy.2_Intron|RBCK1_uc002wdr.3_Intron|RBCK1_uc002wdo.2_Intron	NM_031229	NP_112506	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing						interspecies interaction between organisms|negative regulation of NF-kappaB transcription factor activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|proteasomal ubiquitin-dependent protein catabolic process|protein linear polyubiquitination|T cell receptor signaling pathway	LUBAC complex	protein binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding				0		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				cattcattcccagattcctca	0.005													12	71	---	---	---	---	PASS
TASP1	55617	broad.mit.edu	37	20	13604086	13604086	+	Intron	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13604086G>C	uc002woi.2	-						TASP1_uc010zri.1_Intron|TASP1_uc002woh.2_Intron|TASP1_uc010zrj.1_Intron|TASP1_uc010zrk.1_Intron	NM_017714	NP_060184	Q9H6P5	TASP1_HUMAN	taspase 1 precursor						asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0						ACAGAGAAAAGAAATACCTCA	0.368													14	24	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20278961	20278961	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20278961G>T	uc002wru.2	+	25	3429	c.3353G>T	c.(3352-3354)GGC>GTC	p.G1118V	C20orf26_uc002wrw.2_RNA	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	1118										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		CGCTTGTTTGGCCAGCACGAG	0.468													38	11	---	---	---	---	PASS
PLK1S1	55857	broad.mit.edu	37	20	21142511	21142511	+	Splice_Site	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21142511G>C	uc002wsb.2	+	5	539	c.406_splice	c.e5-1	p.V136_splice	PLK1S1_uc010zsh.1_Splice_Site_p.V33_splice|PLK1S1_uc010zsi.1_Splice_Site_p.V3_splice|PLK1S1_uc010zsj.1_Splice_Site|uc002wsc.2_Intron|PLK1S1_uc002wsd.2_5'Flank	NM_018474	NP_060944	Q2M2Z5	KIZ_HUMAN	polo-like kinase 1 substrate 1 isoform 1						spindle organization	centrosome	protein kinase binding				0						TGGTGTTGCAGGTTGCAGTGC	0.408													34	23	---	---	---	---	PASS
C20orf132	140699	broad.mit.edu	37	20	35769624	35769624	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35769624G>T	uc010zvu.1	-	14	1550	c.1459C>A	c.(1459-1461)CGA>AGA	p.R487R	C20orf132_uc002xgk.2_Intron|C20orf132_uc002xgm.2_Silent_p.R487R|C20orf132_uc002xgn.2_Silent_p.R452R	NM_152503	NP_689716	Q9H579	CT132_HUMAN	hypothetical protein LOC140699 isoform 1	362											0		Myeloproliferative disorder(115;0.00878)				CCTGCTGATCGCTGGATGCAG	0.398													12	49	---	---	---	---	PASS
RPRD1B	58490	broad.mit.edu	37	20	36687925	36687925	+	Intron	SNP	G	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36687925G>C	uc002xho.3	+							NM_021215	NP_067038	Q9NQG5	RPR1B_HUMAN	Regulation of nuclear pre-mRNA domain containing											pancreas(1)	1						AATAACAGGTGAGAAGGTAGA	0.453													156	76	---	---	---	---	PASS
SLC32A1	140679	broad.mit.edu	37	20	37357187	37357187	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37357187G>A	uc002xjc.2	+	2	1746	c.1483G>A	c.(1483-1485)GCC>ACC	p.A495T		NM_080552	NP_542119	Q9H598	VIAAT_HUMAN	solute carrier family 32, member 1	495	Helical; (Potential).				neurotransmitter secretion	clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|integral to membrane|plasma membrane|synaptic vesicle membrane	vesicular hydrogen:amino acid antiporter activity				0		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CTTCGACGTCGCCATCTTCGT	0.647													11	50	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61957036	61957036	+	Missense_Mutation	SNP	A	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61957036A>T	uc011aau.1	+	29	3465	c.3365A>T	c.(3364-3366)CAG>CTG	p.Q1122L	COL20A1_uc011aav.1_Missense_Mutation_p.Q943L	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	1122	Collagen-like 1.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					CCCGGCCACCAGGGCATCCCC	0.706													7	13	---	---	---	---	PASS
SRMS	6725	broad.mit.edu	37	20	62173649	62173649	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62173649G>T	uc002yfi.1	-	5	854	c.813C>A	c.(811-813)GCC>GCA	p.A271A		NM_080823	NP_543013	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory	271	Protein kinase.						ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|lung(1)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			GGATCTCCTTGGCGAGGTCAG	0.642													15	20	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10906938	10906938	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10906938C>T	uc002yip.1	-	24	1991	c.1623G>A	c.(1621-1623)ATG>ATA	p.M541I	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.M523I|TPTE_uc002yir.1_Missense_Mutation_p.M503I|TPTE_uc010gkv.1_Missense_Mutation_p.M403I	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	541					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CACTGGAAGTCATTTTCTCGC	0.383													28	38	---	---	---	---	PASS
COL6A1	1291	broad.mit.edu	37	21	47410683	47410683	+	Intron	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47410683C>G	uc002zhu.1	+							NM_001848	NP_001839	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1 precursor						axon guidance|cell adhesion|protein heterotrimerization	collagen type VI|protein complex	platelet-derived growth factor binding			ovary(1)	1	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)	Palifermin(DB00039)	CTTCCTCTTTCCAGGGGGAGA	0.552													73	20	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47855969	47855969	+	Silent	SNP	C	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47855969C>G	uc002zji.3	+	39	9011	c.8904C>G	c.(8902-8904)CTC>CTG	p.L2968L	PCNT_uc002zjj.2_Silent_p.L2771L	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	2968	Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					CGGACCACCTCCGGGAACAGC	0.677													28	56	---	---	---	---	PASS
IL17RA	23765	broad.mit.edu	37	22	17586799	17586799	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17586799G>A	uc002zly.2	+	11	1133	c.1000G>A	c.(1000-1002)GGC>AGC	p.G334S	IL17RA_uc010gqt.2_Intron	NM_014339	NP_055154	Q96F46	I17RA_HUMAN	interleukin 17A receptor precursor	334	Helical; (Potential).				fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity			skin(2)	2		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		CCTGCTGGTGGGCTCCGTCAT	0.448													38	36	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21073008	21073008	+	Missense_Mutation	SNP	T	C	C			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21073008T>C	uc002zsz.3	-	44	5276	c.5045A>G	c.(5044-5046)AAG>AGG	p.K1682R	PI4KA_uc010gsp.2_Missense_Mutation_p.K75R|PI4KA_uc002zsy.3_Missense_Mutation_p.K492R	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	1682	Pleckstrin homology (PH) domain conferring phosphoinositide binding specificity (By similarity).				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GTTGGTGATCTTGTTAAAGAA	0.448													10	697	---	---	---	---	PASS
PRAME	23532	broad.mit.edu	37	22	22892332	22892332	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22892332C>T	uc002zwf.2	-	4	925	c.769G>A	c.(769-771)GGC>AGC	p.G257S	LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Missense_Mutation_p.G241S|PRAME_uc010gtr.2_Missense_Mutation_p.G257S|PRAME_uc002zwg.2_Missense_Mutation_p.G257S|PRAME_uc002zwh.2_Missense_Mutation_p.G257S|PRAME_uc002zwi.2_Missense_Mutation_p.G257S|PRAME_uc002zwj.2_Missense_Mutation_p.G257S|PRAME_uc002zwk.2_Missense_Mutation_p.G257S	NM_206956	NP_996839	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	257					apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding			central_nervous_system(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		ATCATCTGGCCCAGGTAAGGA	0.483													35	117	---	---	---	---	PASS
IGLL1	3543	broad.mit.edu	37	22	23922244	23922244	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23922244G>A	uc002zxd.2	-	1	252	c.134C>T	c.(133-135)TCG>TTG	p.S45L	IGLL1_uc002zxe.2_Missense_Mutation_p.S45L	NM_020070	NP_064455	P15814	IGLL1_HUMAN	immunoglobulin lambda-like polypeptide 1 isoform	45					immune response	extracellular region|membrane					0						CCTGCTCTGCGATGCAGCTGT	0.697													7	1	---	---	---	---	PASS
RGL4	266747	broad.mit.edu	37	22	24034261	24034261	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24034261G>T	uc002zxn.2	+	1	1214	c.44G>T	c.(43-45)AGT>ATT	p.S15I	LOC91316_uc002zxh.3_RNA|LOC91316_uc002zxi.3_RNA|LOC91316_uc002zxk.3_Intron|LOC91316_uc010gua.2_Intron|LOC91316_uc002zxl.3_Intron|LOC91316_uc011aiz.1_Intron|LOC91316_uc002zxm.3_Intron|RGL4_uc002zxo.2_Missense_Mutation_p.S15I|RGL4_uc002zxp.1_5'UTR|RGL4_uc002zxq.2_5'UTR	NM_153615	NP_705843	Q8IZJ4	RGDSR_HUMAN	ral guanine nucleotide dissociation	15					small GTPase mediated signal transduction	cytoplasmic membrane-bounded vesicle	guanyl-nucleotide exchange factor activity			ovary(1)	1						GCAGTCTTGAGTGCCCAGGTG	0.597													40	120	---	---	---	---	PASS
SMARCB1	6598	broad.mit.edu	37	22	24143214	24143214	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24143214C>A	uc002zyb.2	+	4	653	c.446C>A	c.(445-447)ACA>AAA	p.T149K	SMARCB1_uc002zyg.2_Missense_Mutation_p.T149K|SMARCB1_uc011ajb.1_Missense_Mutation_p.T140K|SMARCB1_uc002zya.2_Missense_Mutation_p.T149K|SMARCB1_uc002zyc.2_Missense_Mutation_p.T140K|SMARCB1_uc002zyd.2_Missense_Mutation_p.T140K|SMARCB1_uc002zye.1_Intron|SMARCB1_uc002zyf.1_Intron|SMARCB1_uc010gue.1_Intron	NM_003073	NP_003064	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin	149	DNA-binding (Potential).				cell cycle|chromatin remodeling|DNA integration|interspecies interaction between organisms|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|retroviral genome replication|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleolus|nucleoplasm|SWI/SNF complex	p53 binding	p.?(5)		soft_tissue(193)|central_nervous_system(172)|haematopoietic_and_lymphoid_tissue(23)|meninges(5)|skin(5)|bone(4)|ovary(2)|endometrium(1)|lung(1)|pancreas(1)	407		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				CCATGCTCCACAACCATCAAC	0.567			D|N|F|S		malignant rhabdoid 	malignant rhabdoid			Rhabdoid_Predisposition_syndrome|Schwannomatosis				21	109	---	---	---	---	PASS
PHF21B	112885	broad.mit.edu	37	22	45312219	45312219	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45312219C>T	uc003bfn.2	-	4	656	c.505G>A	c.(505-507)GTG>ATG	p.V169M	PHF21B_uc003bfm.2_Missense_Mutation_p.V7M|PHF21B_uc011aqk.1_Missense_Mutation_p.V157M|PHF21B_uc011aql.1_Missense_Mutation_p.V169M|PHF21B_uc011aqm.1_Missense_Mutation_p.V157M	NM_138415	NP_612424	Q96EK2	PF21B_HUMAN	PHD finger protein 21B isoform 1	169							zinc ion binding			ovary(2)|skin(1)	3		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		ACCACAGACACGGCGGTGCTG	0.677													8	15	---	---	---	---	PASS
SYTL5	94122	broad.mit.edu	37	X	37967889	37967889	+	Silent	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37967889G>A	uc004ddu.2	+	13	1905	c.1371G>A	c.(1369-1371)CGG>CGA	p.R457R	SYTL5_uc004ddv.2_Silent_p.R457R|SYTL5_uc004ddx.2_Silent_p.R479R	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	457	C2 1.				intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						ACAAGTCCCGGAACAACAAGC	0.333													9	1	---	---	---	---	PASS
PHF16	9767	broad.mit.edu	37	X	46913584	46913584	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46913584G>T	uc004dgx.2	+	9	1048	c.997G>T	c.(997-999)GCC>TCC	p.A333S	PHF16_uc004dgy.2_Missense_Mutation_p.A333S	NM_001077445	NP_001070913	Q92613	JADE3_HUMAN	PHD finger protein 16	333					histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding				0						CTGCATCACTGCCTTCCACGT	0.463													25	41	---	---	---	---	PASS
CFP	5199	broad.mit.edu	37	X	47486233	47486233	+	Silent	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47486233G>T	uc004dig.3	-	6	1005	c.879C>A	c.(877-879)GGC>GGA	p.G293G	CFP_uc004dih.2_Silent_p.G293G|CFP_uc004dii.1_Silent_p.G229G|CFP_uc010nhu.2_Silent_p.G293G	NM_001145252	NP_001138724	P27918	PROP_HUMAN	complement factor properdin precursor	293	TSP type-1 4.				complement activation, alternative pathway|defense response to bacterium	extracellular space				breast(2)|lung(1)	3						CACAGAAGGGGCCCCCATGCT	0.647													33	5	---	---	---	---	PASS
AKAP4	8852	broad.mit.edu	37	X	49955644	49955644	+	Missense_Mutation	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49955644C>A	uc004dow.1	-	6	2648	c.2524G>T	c.(2524-2526)GCC>TCC	p.A842S	AKAP4_uc004dov.1_Missense_Mutation_p.A459S|AKAP4_uc010njp.1_Missense_Mutation_p.A664S|AKAP4_uc004dou.1_Missense_Mutation_p.A833S	NM_003886	NP_003877	Q5JQC9	AKAP4_HUMAN	A-kinase anchor protein 4 isoform 1	842					cell projection organization|single fertilization|sperm motility	cAMP-dependent protein kinase complex|cilium|cytoskeleton|microtubule-based flagellum	protein kinase A binding			kidney(3)|central_nervous_system(2)|ovary(1)|lung(1)|skin(1)	8	Ovarian(276;0.236)					TGTTTCCTGGCCACCTTTCCC	0.532													92	25	---	---	---	---	PASS
H2BFWT	158983	broad.mit.edu	37	X	103267276	103267276	+	3'UTR	SNP	C	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103267276C>A	uc004elr.2	-	2						NM_001002916	NP_001002916	Q7Z2G1	H2BWT_HUMAN	H2B histone family, member W, testis-specific						nucleosome assembly	nuclear membrane|nucleosome	DNA binding			ovary(1)	1						Cttcttgtatcagcgtattca	0.204													27	15	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122528859	122528859	+	Missense_Mutation	SNP	G	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122528859G>A	uc004etq.3	+	7	1084	c.791G>A	c.(790-792)GGA>GAA	p.G264E	GRIA3_uc004etr.3_Missense_Mutation_p.G264E|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Missense_Mutation_p.G248E	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	264	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	ATGCATGGGGGAGCCAACATT	0.428													17	165	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123514791	123514791	+	Silent	SNP	A	G	G			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123514791A>G	uc004euj.2	-	31	7837	c.7773T>C	c.(7771-7773)ACT>ACC	p.T2591T	ODZ1_uc011muj.1_Silent_p.T2597T|ODZ1_uc010nqy.2_Silent_p.T2598T	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	2591	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						GCCTCCCCCCAGTGTTACCGA	0.493													106	24	---	---	---	---	PASS
LDOC1	23641	broad.mit.edu	37	X	140271147	140271147	+	Missense_Mutation	SNP	G	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140271147G>T	uc004fbj.2	-	1	164	c.60C>A	c.(58-60)AGC>AGA	p.S20R		NM_012317	NP_036449	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1	20					negative regulation of cell proliferation	nucleus	protein binding				0	Acute lymphoblastic leukemia(192;7.65e-05)					TGTTCTCGATGCTCAGGGCGC	0.672													19	3	---	---	---	---	PASS
LDOC1	23641	broad.mit.edu	37	X	140271148	140271148	+	Missense_Mutation	SNP	C	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140271148C>T	uc004fbj.2	-	1	163	c.59G>A	c.(58-60)AGC>AAC	p.S20N		NM_012317	NP_036449	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1	20					negative regulation of cell proliferation	nucleus	protein binding				0	Acute lymphoblastic leukemia(192;7.65e-05)					GTTCTCGATGCTCAGGGCGCG	0.672													19	3	---	---	---	---	PASS
VAV3	10451	broad.mit.edu	37	1	108145765	108145766	+	Frame_Shift_Ins	INS	-	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108145765_108145766insT	uc001dvk.1	-	23	2089_2090	c.2035_2036insA	c.(2035-2037)AGAfs	p.R679fs	VAV3_uc010ouu.1_Frame_Shift_Ins_p.R83fs|VAV3_uc001dvj.1_Frame_Shift_Ins_p.R119fs|VAV3_uc010ouv.1_Frame_Shift_Ins_p.R83fs|VAV3_uc010ouw.1_Frame_Shift_Ins_p.R679fs	NM_006113	NP_006104	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor isoform	679	SH2.				angiogenesis|apoptosis|B cell receptor signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of B cell proliferation|regulation of Rho protein signal transduction|response to DNA damage stimulus|response to drug|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(5)|lung(2)|breast(2)	9		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TGCTTGCAATCTTTCCATTGCT	0.361													139	68	---	---	---	---	
TRIM67	440730	broad.mit.edu	37	1	231337910	231337911	+	Intron	INS	-	ACA	ACA			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231337910_231337911insACA	uc009xfn.1	+							NM_001004342	NP_001004342	Q6ZTA4	TRI67_HUMAN	tripartite motif-containing 67							cytoplasm|cytoskeleton	zinc ion binding			ovary(2)|breast(1)|kidney(1)	4	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				ggaggaggaggtagtggaggag	0.000													4	2	---	---	---	---	
RYR2	6262	broad.mit.edu	37	1	237806919	237806920	+	Intron	INS	-	T	T	rs113722212		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237806919_237806920insT	uc001hyl.1	+							NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor						cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TAAttttttccttttttttttt	0.119													4	2	---	---	---	---	
HEATR5B	54497	broad.mit.edu	37	2	37260027	37260028	+	Intron	INS	-	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37260027_37260028insT	uc002rpp.1	-							NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				Gttttgttttgttttttttttt	0.094													1	10	---	---	---	---	
RPIA	22934	broad.mit.edu	37	2	89037295	89037296	+	Intron	INS	-	A	A	rs78343484		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89037295_89037296insA	uc002ste.2	+							NM_144563	NP_653164	P49247	RPIA_HUMAN	ribose 5-phosphate isomerase A						pentose-phosphate shunt, non-oxidative branch	cytosol	ribose-5-phosphate isomerase activity			ovary(1)	1		Acute lymphoblastic leukemia(2;0.000456)|all_hematologic(2;0.00287)				CTCTCTCTCTCAAAAAAAAAAA	0.381													4	2	---	---	---	---	
CLASP1	23332	broad.mit.edu	37	2	122135144	122135144	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122135144delC	uc002tnc.2	-	33	3963	c.3573delG	c.(3571-3573)AAGfs	p.K1191fs	CLASP1_uc010yyv.1_Frame_Shift_Del_p.K237fs|CLASP1_uc002tmz.2_Frame_Shift_Del_p.K276fs|CLASP1_uc002tna.2_Frame_Shift_Del_p.K237fs|CLASP1_uc010yyw.1_RNA|CLASP1_uc002tnb.2_RNA|CLASP1_uc010yyx.1_RNA|CLASP1_uc010yyy.1_RNA|CLASP1_uc010yyz.1_Frame_Shift_Del_p.K1132fs|CLASP1_uc010yza.1_Frame_Shift_Del_p.K1124fs|CLASP1_uc010yzb.1_RNA|CLASP1_uc010yzc.1_RNA|CLASP1_uc002tmy.2_Frame_Shift_Del_p.K27fs|CLASP1_uc002tnf.2_Frame_Shift_Del_p.K93fs	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1	1191					axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					GAAAACTAAACTTTTCAATGG	0.363													27	15	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10081718	10081720	+	Intron	DEL	TTT	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10081718_10081720delTTT	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc003buv.2_3'UTR	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		ACATACtttcttttttttttttt	0.158			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				6	3	---	---	---	---	
TBC1D5	9779	broad.mit.edu	37	3	17279463	17279463	+	Intron	DEL	A	-	-	rs3839094		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:17279463delA	uc003cbf.2	-						TBC1D5_uc010heu.2_Intron|TBC1D5_uc010hev.2_Intron|TBC1D5_uc003cbe.2_Intron|TBC1D5_uc010hew.1_Intron	NM_014744	NP_055559	Q92609	TBCD5_HUMAN	TBC1 domain family, member 5 isoform b							intracellular	protein binding|Rab GTPase activator activity			ovary(1)	1						TATAAATGTTAAAAAAAAAAT	0.289													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	20255214	20255215	+	IGR	INS	-	CTTCCTTCCTTCCTTCCTTC	CTTCCTTCCTTCCTTCCTTC	rs144736469	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:20255214_20255215insCTTCCTTCCTTCCTTCCTTC								SGOL1 (27531 upstream) : None (None downstream)																							ttcctttctttcttccttcctt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	88997345	88997346	+	IGR	INS	-	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88997345_88997346insA								C3orf38 (790232 upstream) : EPHA3 (159328 downstream)																							ATATTTTCCCCAAAAATGGCCT	0.386													48	27	---	---	---	---	
SENP7	57337	broad.mit.edu	37	3	101083888	101083889	+	Intron	INS	-	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101083888_101083889insT	uc003dut.2	-						SENP7_uc003duu.2_Intron|SENP7_uc003duv.2_Intron|SENP7_uc003duw.2_Intron|SENP7_uc003dux.2_Intron	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1						proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						ttatttatttatttTTTGAGAC	0.168													7	8	---	---	---	---	
RABL3	285282	broad.mit.edu	37	3	120428430	120428431	+	Intron	INS	-	AGACAAAGCAC	AGACAAAGCAC	rs141684205	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120428430_120428431insAGACAAAGCAC	uc003edx.2	-							NM_173825	NP_776186	Q5HYI8	RABL3_HUMAN	RAB, member of RAS oncogene family-like 3						small GTPase mediated signal transduction		GTP binding				0				GBM - Glioblastoma multiforme(114;0.151)		AGAAACACTTAATGTTTAATGT	0.272													4	5	---	---	---	---	
NPHP3	27031	broad.mit.edu	37	3	132438748	132438749	+	Intron	DEL	AT	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132438748_132438749delAT	uc003epe.1	-						NCRNA00119_uc003epg.1_5'Flank|NPHP3_uc003epf.1_Intron|NCRNA00119_uc010htu.1_5'Flank	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						atatatatacatatatatatat	0.248													4	2	---	---	---	---	
SR140	23350	broad.mit.edu	37	3	142774049	142774049	+	Intron	DEL	T	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142774049delT	uc003evh.1	+						SR140_uc003evi.1_Intron|SR140_uc003evj.1_Intron|SR140_uc003evk.1_Intron	NM_001080415	NP_001073884	O15042	SR140_HUMAN	U2-associated SR140 protein						RNA processing	nucleus	nucleotide binding|RNA binding				0						TTGGCATACATTTTTTTTTTT	0.318													4	2	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188483086	188483087	+	Intron	DEL	AC	-	-	rs113308644		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188483086_188483087delAC	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		GTCTcacacaacacacacacac	0.317			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	2	---	---	---	---	
GRPEL1	80273	broad.mit.edu	37	4	7064235	7064241	+	Intron	DEL	ATATATA	-	-	rs11328818		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7064235_7064241delATATATA	uc003gjy.1	-						GRPEL1_uc003gjz.1_Intron	NM_025196	NP_079472	Q9HAV7	GRPE1_HUMAN	GrpE-like 1, mitochondrial precursor						protein folding|protein import into mitochondrial matrix	mitochondrial matrix	adenyl-nucleotide exchange factor activity|chaperone binding|protein homodimerization activity|unfolded protein binding				0						atatatatatatatatatCtttttttt	0.155													5	5	---	---	---	---	
KLHL5	51088	broad.mit.edu	37	4	39087966	39087967	+	Intron	INS	-	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39087966_39087967insT	uc003gts.2	+						KLHL5_uc003gtp.2_Intron|KLHL5_uc003gtq.2_Intron|KLHL5_uc003gtr.1_Intron|KLHL5_uc003gtt.2_Intron	NM_015990	NP_057074	Q96PQ7	KLHL5_HUMAN	kelch-like 5 isoform 1							cytoplasm|cytoskeleton	actin binding			ovary(1)	1						TTGCAGTTTAATTTTTTTTTCT	0.267													13	12	---	---	---	---	
SPATA18	132671	broad.mit.edu	37	4	52942884	52942885	+	Intron	INS	-	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52942884_52942885insT	uc003gzl.2	+						SPATA18_uc010igl.1_Intron|SPATA18_uc011bzq.1_Intron|SPATA18_uc003gzk.1_Intron	NM_145263	NP_660306	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18 homolog						mitochondrial protein catabolic process|mitochondrion degradation by induced vacuole formation|response to DNA damage stimulus	mitochondrial outer membrane	protein binding			ovary(2)|skin(2)	4			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			accagatgatctttgctttact	0.262													44	43	---	---	---	---	
HERC5	51191	broad.mit.edu	37	4	89425217	89425218	+	Intron	INS	-	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89425217_89425218insA	uc003hrt.2	+						HERC5_uc011cdm.1_Intron	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5						innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		gactccgtctcaaaaaaaaaaa	0.015													6	4	---	---	---	---	
CLGN	1047	broad.mit.edu	37	4	141333957	141333958	+	Intron	INS	-	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141333957_141333958insA	uc011chi.1	-						CLGN_uc003iii.2_Intron	NM_001130675	NP_001124147	O14967	CLGN_HUMAN	calmegin precursor						protein folding	endoplasmic reticulum membrane|integral to membrane	calcium ion binding|unfolded protein binding			ovary(2)|skin(1)	3	all_hematologic(180;0.162)					AAGACACTTAGAAAAAAAATCA	0.302													5	13	---	---	---	---	
IRF2	3660	broad.mit.edu	37	4	185329119	185329120	+	Intron	INS	-	CTAA	CTAA	rs149784271	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185329119_185329120insCTAA	uc003iwf.3	-							NM_002199	NP_002190	P14316	IRF2_HUMAN	interferon regulatory factor 2						blood coagulation|cell proliferation|interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	focal adhesion|nucleoplasm	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		GGCTGACCCGTCTAAGTTCCTT	0.515													4	4	---	---	---	---	
RICTOR	253260	broad.mit.edu	37	5	38943260	38943261	+	Intron	INS	-	T	T	rs138134181	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38943260_38943261insT	uc003jlp.2	-						RICTOR_uc003jlo.2_Intron|RICTOR_uc010ivf.2_Intron	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR						actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					CTGAGTTTGGGTTTTTTTTTAA	0.287													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	136901882	136901882	+	IGR	DEL	C	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136901882delC								SPOCK1 (66864 upstream) : KLHL3 (51308 downstream)																							CTTCTgtccacccacacctcc	0.299													4	2	---	---	---	---	
CD2AP	23607	broad.mit.edu	37	6	47542014	47542016	+	Intron	DEL	ACT	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47542014_47542016delACT	uc003oyw.2	+							NM_012120	NP_036252	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein						cell division|mitosis|protein complex assembly|signal transduction|substrate-dependent cell migration, cell extension	cytoplasm|filamentous actin|nucleolus|plasma membrane|ruffle	SH3 domain binding|structural constituent of cytoskeleton			ovary(1)|skin(1)	2			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			TGTTAGATTAACTCCACTCATTC	0.315													90	85	---	---	---	---	
PPIL4	85313	broad.mit.edu	37	6	149857059	149857068	+	Intron	DEL	GCACTTTGCA	-	-	rs35937167		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:149857059_149857068delGCACTTTGCA	uc003qmo.1	-						PPIL4_uc010kic.2_Intron|PPIL4_uc003qmp.1_Intron	NM_139126	NP_624311	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase-like 4						protein folding	nucleus	nucleotide binding|peptidyl-prolyl cis-trans isomerase activity|RNA binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		tcattttattgcactttgcagatactgcat	0.138													8	5	---	---	---	---	
RAC1	5879	broad.mit.edu	37	7	6442157	6442157	+	3'UTR	DEL	A	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6442157delA	uc003spx.2	+	6					RAC1_uc003spw.2_3'UTR	NM_006908	NP_008839	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1						actin filament polymerization|apoptosis|axon guidance|cell motility|cell-matrix adhesion|induction of apoptosis by extracellular signals|inflammatory response|lamellipodium assembly|localization within membrane|negative regulation of interleukin-23 production|negative regulation of receptor-mediated endocytosis|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of lamellipodium assembly|positive regulation of Rho protein signal transduction|regulation of cell migration|regulation of defense response to virus by virus|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|ruffle organization|small GTPase mediated signal transduction|T cell costimulation|viral reproduction	cytosol|melanosome|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity|thioesterase binding			lung(2)	2		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Pravastatin(DB00175)|Simvastatin(DB00641)	aaaaaaaaacaaaaaaaaaaa	0.338													5	3	---	---	---	---	
DGKB	1607	broad.mit.edu	37	7	14314596	14314597	+	Intron	INS	-	TT	TT	rs76260349		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14314596_14314597insTT	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	gtgtgtgtgtgtgtttgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57659470	57659471	+	IGR	DEL	TA	-	-	rs79867563	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57659470_57659471delTA								ZNF716 (126205 upstream) : None (None downstream)																							GCGTTGATCTTACAGTCTGGTG	0.371													13	7	---	---	---	---	
MLXIPL	51085	broad.mit.edu	37	7	73030242	73030243	+	Intron	INS	-	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73030242_73030243insA	uc003tyn.1	-						MLXIPL_uc003tyk.1_Intron|MLXIPL_uc003tyl.1_Intron|MLXIPL_uc003tym.1_Intron|MLXIPL_uc003tyo.1_Intron|MLXIPL_uc003typ.1_Intron	NM_032951	NP_116569	Q9NP71	WBS14_HUMAN	Williams Beuren syndrome chromosome region 14						anatomical structure morphogenesis|energy reserve metabolic process|glucose mediated signaling pathway|intracellular protein kinase cascade|negative regulation of cell cycle arrest|negative regulation of oxidative phosphorylation|negative regulation of peptidyl-serine phosphorylation|positive regulation of cell proliferation|positive regulation of fatty acid biosynthetic process|positive regulation of glycolysis|positive regulation of transcription from RNA polymerase II promoter|triglyceride homeostasis	cytosol|transcription factor complex	carbohydrate response element binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)	1		Lung NSC(55;0.0659)|all_lung(88;0.152)				gactgtgtctcaaaaaaaaaaa	0.238													4	3	---	---	---	---	
LUC7L2	51631	broad.mit.edu	37	7	139090299	139090301	+	Intron	DEL	AAC	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139090299_139090301delAAC	uc003vux.2	+						LUC7L2_uc011kqs.1_Intron|LUC7L2_uc011kqt.1_Intron|LUC7L2_uc003vuy.2_Intron|LUC7L2_uc003vuz.1_Intron|LUC7L2_uc003vva.2_Intron	NM_016019	NP_057103	Q9Y383	LC7L2_HUMAN	LUC7-like 2								enzyme binding|metal ion binding				0	Melanoma(164;0.242)					TGCCTTAGATAACAAGTTTTTTC	0.350													14	9	---	---	---	---	
JHDM1D	80853	broad.mit.edu	37	7	139802175	139802175	+	Intron	DEL	T	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139802175delT	uc003vvm.2	-						JHDM1D_uc010lng.2_Intron	NM_030647	NP_085150	Q6ZMT4	KDM7_HUMAN	jumonji C domain containing histone demethylase						midbrain development|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K27 specific)|histone demethylase activity (H3-K36 specific)|histone demethylase activity (H3-K9 specific)|histone demethylase activity (H4-K20 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1	Melanoma(164;0.0142)					ACTTCCTTGAttttttttttt	0.169													5	3	---	---	---	---	
OR2A14	135941	broad.mit.edu	37	7	143826045	143826046	+	5'Flank	INS	-	T	T	rs140693974	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143826045_143826046insT	uc011kua.1	+							NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					ATACAATGCGATTTTTTCTCAT	0.193													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155739522	155739525	+	IGR	DEL	TTCC	-	-	rs5888641		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155739522_155739525delTTCC								SHH (134555 upstream) : C7orf4 (593660 downstream)																							ccttccttctttccttccttcctt	0.000													6	4	---	---	---	---	
DLGAP2	9228	broad.mit.edu	37	8	1497416	1497417	+	In_Frame_Ins	INS	-	CCACCACGC	CCACCACGC			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1497416_1497417insCCACCACGC	uc003wpl.2	+	2	654_655	c.557_558insCCACCACGC	c.(556-558)CAC>CACCACCACGCC	p.192_193insHHA	DLGAP2_uc003wpm.2_In_Frame_Ins_p.192_193insHHA	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	271_272					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GCGGACGACCACCACCACGCCC	0.668													10	5	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	2799865	2799865	+	Intron	DEL	A	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2799865delA	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		aagttgatttaaaaaaaaaaa	0.159													4	3	---	---	---	---	
FAM66D	100132923	broad.mit.edu	37	8	12397630	12397631	+	Intron	INS	-	A	A	rs144512072	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12397630_12397631insA	uc011kxp.1	+						uc003wvm.1_Intron|uc003wvv.2_Intron|uc003wvw.1_Intron|uc003wvx.1_Intron|uc003wvy.3_Intron					Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0						ATACTATTATTAATTTTGGGGG	0.208													5	3	---	---	---	---	
TGS1	96764	broad.mit.edu	37	8	56708828	56708828	+	Intron	DEL	T	-	-	rs111385978		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56708828delT	uc003xsj.3	+						TGS1_uc010lyh.2_Intron	NM_024831	NP_079107	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase homolog						cellular lipid metabolic process|ncRNA metabolic process|regulation of transcription, DNA-dependent|RNA capping|spliceosomal snRNP assembly|transcription, DNA-dependent	Cajal body|cytosol	RNA trimethylguanosine synthase activity			ovary(1)|lung(1)|breast(1)	3		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			AGGTACATAATTTTTTTTTTT	0.299													6	4	---	---	---	---	
SNTB1	6641	broad.mit.edu	37	8	121823372	121823372	+	Intron	DEL	C	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121823372delC	uc010mdg.2	-						SNTB1_uc003ype.2_Intron	NM_021021	NP_066301	Q13884	SNTB1_HUMAN	basic beta 1 syntrophin						muscle contraction	cell junction|cytoplasm|cytoskeleton|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|calmodulin binding			skin(5)	5	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			CGCCACCCTTCCCCCCCCCCC	0.622													9	5	---	---	---	---	
HEATR7A	727957	broad.mit.edu	37	8	145246596	145246596	+	Intron	DEL	C	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145246596delC	uc003zbk.3	+						HEATR7A_uc003zbg.2_Intron|HEATR7A_uc003zbh.3_Intron|HEATR7A_uc003zbi.3_Intron|HEATR7A_uc011lla.1_Intron|HEATR7A_uc010mft.2_Intron	NM_032450	NP_115826	Q8NDA8	HTR7A_HUMAN	HEAT repeat containing 7A isoform 1								binding				0						GCGTAAGCTTCCCGCCCACTG	0.627													16	29	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6602378	6602378	+	Intron	DEL	T	-	-	rs10975676		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6602378delT	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	TGATTACTGAttttttttttt	0.174													8	5	---	---	---	---	
HAUS6	54801	broad.mit.edu	37	9	19082749	19082750	+	Intron	INS	-	A	A			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19082749_19082750insA	uc003znk.2	-						HAUS6_uc011lmz.1_Intron|HAUS6_uc003znl.1_Intron|HAUS6_uc003znm.1_Intron	NM_017645	NP_060115	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2						aattctgtctcaaaaaaaaaac	0.099													6	3	---	---	---	---	
ARHGAP12	94134	broad.mit.edu	37	10	32141656	32141657	+	Intron	DEL	TC	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32141656_32141657delTC	uc001ivz.1	-						ARHGAP12_uc001ivy.1_Intron|ARHGAP12_uc009xls.2_Intron|ARHGAP12_uc001iwb.1_Intron|ARHGAP12_uc001iwc.1_Intron|ARHGAP12_uc009xlq.1_Intron|ARHGAP12_uc001iwd.1_Intron|ARHGAP12_uc009xlr.1_Intron	NM_018287	NP_060757	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		Prostate(175;0.0199)				AACAAAAAAttctttttttttt	0.114													21	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42365089	42365090	+	IGR	INS	-	AATGT	AATGT			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42365089_42365090insAATGT								None (None upstream) : LOC441666 (462225 downstream)																							gggttgattccattccattcca	0.000													4	2	---	---	---	---	
AGAP11	119385	broad.mit.edu	37	10	88754812	88754813	+	Intron	INS	-	ATA	ATA	rs35989321		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88754812_88754813insATA	uc001kee.2	+						AGAP11_uc001kef.2_Intron	NM_133447	NP_597704	Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase						regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding				0						AATTGATGATGataataatagt	0.282													8	4	---	---	---	---	
ABLIM1	3983	broad.mit.edu	37	10	116304544	116304544	+	Intron	DEL	T	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116304544delT	uc010qsg.1	-						ABLIM1_uc010qsh.1_Intron|ABLIM1_uc010qsi.1_Intron|ABLIM1_uc010qsk.1_Intron|ABLIM1_uc009xyp.2_Intron|ABLIM1_uc009xyo.2_Intron	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		TTTATCATTCTTTTTTTTTTC	0.363													3	4	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097178	135097195	+	Intron	DEL	TCCCTGCCTCTCCCGCAT	-	-	rs66529543	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097178_135097195delTCCCTGCCTCTCCCGCAT	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ctccctgcactccctgcctctcccgcattccctgcctc	0.193													3	5	---	---	---	---	
LMO1	4004	broad.mit.edu	37	11	8284837	8284837	+	Intron	DEL	C	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8284837delC	uc001mgg.1	-						LMO1_uc009yfo.1_Intron|LMO1_uc001mgh.1_Intron	NM_002315	NP_002306	P25800	RBTN1_HUMAN	LIM domain only 1						cell proliferation|multicellular organismal development|positive regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0				Epithelial(150;1.59e-07)|BRCA - Breast invasive adenocarcinoma(625;0.203)		CGCGCCGCGGCAGGGGGCGAG	0.602			T|A	TRD@	T-ALL|neuroblastoma	neuroblastoma							8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	55234976	55234976	+	IGR	DEL	G	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55234976delG								OR4A15 (98583 upstream) : OR4C15 (86807 downstream)																							GCACATCACCGTGGTTGTCCT	0.413													12	7	---	---	---	---	
GLYATL1	92292	broad.mit.edu	37	11	58722441	58722441	+	Intron	DEL	C	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58722441delC	uc001nnf.2	+						uc001nng.1_Intron|GLYATL1_uc001nnh.1_Intron|GLYATL1_uc001nni.1_Intron|GLYATL1_uc001nnj.1_Intron			Q969I3	GLYL1_HUMAN	SubName: Full=Glycine acyltransferase family-C; SubName: Full=Glycine-N-acyltransferase-like 1, isoform CRA_a;							mitochondrion	glycine N-acyltransferase activity			ovary(1)	1					Glycine(DB00145)	gcattagcatcacctgagggc	0.134													19	16	---	---	---	---	
SMAGP	57228	broad.mit.edu	37	12	51662370	51662371	+	Intron	INS	-	CCTCCCTCCTCCCTC	CCTCCCTCCTCCCTC	rs148755148	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51662370_51662371insCCTCCCTCCTCCCTC	uc001ryc.1	-						SMAGP_uc001ryd.1_Intron|SMAGP_uc001rye.1_Intron|SMAGP_uc001ryf.1_Intron	NM_001033873	NP_001029045	Q0VAQ4	SMAGP_HUMAN	small trans-membrane and glycosylated protein							cytoplasmic vesicle membrane|integral to membrane|plasma membrane					0						tcctttcctttcctccctccct	0.104													4	2	---	---	---	---	
ZCCHC8	55596	broad.mit.edu	37	12	122965021	122965021	+	Intron	DEL	T	-	-	rs63098963		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122965021delT	uc001ucn.2	-						ZCCHC8_uc001ucl.2_5'Flank|ZCCHC8_uc001ucm.2_Intron|ZCCHC8_uc009zxp.2_Intron|ZCCHC8_uc009zxq.2_Intron	NM_017612	NP_060082	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8							catalytic step 2 spliceosome	nucleic acid binding|protein binding|zinc ion binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		AGGACAGAACttttttttttt	0.144													4	2	---	---	---	---	
KNTC1	9735	broad.mit.edu	37	12	123015000	123015001	+	Intron	DEL	TT	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123015000_123015001delTT	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AAAGGATATCtttttttttttt	0.163													4	2	---	---	---	---	
POSTN	10631	broad.mit.edu	37	13	38138674	38138675	+	Frame_Shift_Ins	INS	-	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38138674_38138675insT	uc001uwo.3	-	22	2572_2573	c.2454_2455insA	c.(2452-2457)CAAGCCfs	p.Q818fs	POSTN_uc010tet.1_Frame_Shift_Ins_p.Q319fs|POSTN_uc001uwp.3_Frame_Shift_Ins_p.Q761fs|POSTN_uc001uwr.2_Frame_Shift_Ins_p.Q763fs|POSTN_uc001uwq.2_Frame_Shift_Ins_p.Q733fs|POSTN_uc010teu.1_Frame_Shift_Ins_p.Q791fs|POSTN_uc010tev.1_Frame_Shift_Ins_p.Q731fs|POSTN_uc010tew.1_Frame_Shift_Ins_p.Q703fs	NM_006475	NP_006466	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor isoform 1	818_819					cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding			ovary(2)	2		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TTTTTGTTGGCTTGCAACTTCC	0.342													59	118	---	---	---	---	
COG3	83548	broad.mit.edu	37	13	46099393	46099393	+	Intron	DEL	T	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46099393delT	uc001vak.2	+						COG3_uc010tfv.1_Intron|COG3_uc010aci.2_Intron	NM_031431	NP_113619	Q96JB2	COG3_HUMAN	component of golgi transport complex 3						ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity			breast(1)|skin(1)	2		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		GAAGGAAGAATTTTTTTTTTT	0.358													4	2	---	---	---	---	
DIAPH3	81624	broad.mit.edu	37	13	60348879	60348880	+	Frame_Shift_Ins	INS	-	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60348879_60348880insT	uc001vht.2	-	26	3460_3461	c.3241_3242insA	c.(3241-3243)AGGfs	p.R1081fs	DIAPH3_uc001vhu.2_Frame_Shift_Ins_p.R818fs	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	1081	DAD.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		CATCGGTGTCCTTTTTCTTCTG	0.460													87	76	---	---	---	---	
NIN	51199	broad.mit.edu	37	14	51245402	51245402	+	Intron	DEL	T	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51245402delT	uc001wym.2	-						NIN_uc001wyi.2_Intron|NIN_uc001wyj.2_Intron|NIN_uc001wyk.2_Intron|NIN_uc010tqp.1_Intron|NIN_uc001wyo.2_Intron|NIN_uc001wyp.1_Intron	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5						centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					GCCTGCAGCATAAGAGATCAG	0.458			T	PDGFRB	MPD								23	113	---	---	---	---	
KIAA1409	57578	broad.mit.edu	37	14	93814196	93814196	+	Intron	DEL	A	-	-	rs112422740		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93814196delA	uc001ybs.1	+						COX8C_uc001ybt.1_Intron	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		AAAATGAATTAAAAAAAAAAA	0.403													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106877447	106877448	+	Intron	INS	-	TGATCT	TGATCT	rs144817208	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106877447_106877448insTGATCT	uc010tyt.1	-						uc010tyu.1_In_Frame_Ins_p.168_169insRS					Parts of antibodies, mostly variable regions.												0						GAGGGAGACGACTGAGAAGATG	0.584													4	4	---	---	---	---	
TRPM7	54822	broad.mit.edu	37	15	50906082	50906083	+	Intron	INS	-	CTA	CTA			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50906082_50906083insCTA	uc001zyt.3	-						TRPM7_uc010bew.1_Intron|TRPM7_uc001zyu.2_Intron	NM_017672	NP_060142	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel,						cell death	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein serine/threonine kinase activity			ovary(4)|stomach(3)|breast(1)|central_nervous_system(1)|skin(1)	10				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TAAACGTGCTGACATGTTATAA	0.337													63	48	---	---	---	---	
LRRC49	54839	broad.mit.edu	37	15	71329897	71329897	+	Intron	DEL	A	-	-	rs76629843		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71329897delA	uc002asw.2	+						LRRC49_uc002asu.2_Intron|LRRC49_uc002asx.2_Intron|LRRC49_uc010ukf.1_Intron|LRRC49_uc002asy.2_Intron|LRRC49_uc002asz.2_Intron	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49							cytoplasm|microtubule				ovary(1)	1						ATTTCAGCAGAAAAAAAAAAT	0.398													4	2	---	---	---	---	
CCNF	899	broad.mit.edu	37	16	2487905	2487905	+	Intron	DEL	A	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2487905delA	uc002cqd.1	+						CCNF_uc002cqe.1_Intron	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F						cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				gtttccctttaaaaaaaaaaa	0.254													8	5	---	---	---	---	
IL4R	3566	broad.mit.edu	37	16	27367406	27367406	+	Intron	DEL	T	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27367406delT	uc002don.2	+						IL4R_uc002dop.3_Intron|IL4R_uc010bxy.2_Intron|IL4R_uc002doo.2_Intron	NM_000418	NP_000409	P24394	IL4RA_HUMAN	interleukin 4 receptor alpha chain isoform a						immune response|production of molecular mediator involved in inflammatory response	integral to plasma membrane	identical protein binding|interleukin-4 receptor activity|receptor signaling protein activity			ovary(1)|skin(1)	2						CACttttttcttttttttttt	0.214													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	28649818	28649818	+	Intron	DEL	A	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28649818delA	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		GAGTGCAGACAAGATGGGGCC	0.582													4	5	---	---	---	---	
GLG1	2734	broad.mit.edu	37	16	74526722	74526722	+	Intron	DEL	A	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74526722delA	uc002fcy.3	-						GLG1_uc002fcx.2_Intron|GLG1_uc002fcw.3_Intron|GLG1_uc002fcz.3_Intron	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3							Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						ccgtctcaagaaaaaaaaaaa	0.124													6	3	---	---	---	---	
ZFP3	124961	broad.mit.edu	37	17	4996471	4996472	+	3'UTR	DEL	TT	-	-	rs72184758		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4996471_4996472delTT	uc002gaq.2	+	2						NM_153018	NP_694563	Q96NJ6	ZFP3_HUMAN	zinc finger protein-3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GATGAGGCACtttttttttttt	0.203													4	2	---	---	---	---	
NEURL4	84461	broad.mit.edu	37	17	7222694	7222712	+	Intron	DEL	TTTTTTTTTTTTTTTTTTT	-	-	rs72015561		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7222694_7222712delTTTTTTTTTTTTTTTTTTT	uc002gga.1	-						NEURL4_uc002gfy.1_5'Flank|GPS2_uc002gfz.1_5'Flank|NEURL4_uc002ggb.1_Intron	NM_032442	NP_115818	Q96JN8	NEUL4_HUMAN	neuralized homolog 4 isoform 1								protein binding			upper_aerodigestive_tract(1)|ovary(1)	2						tctttccctcttttttttttttttttttttttttttttt	0.219													4	2	---	---	---	---	
GLP2R	9340	broad.mit.edu	37	17	9729453	9729453	+	Frame_Shift_Del	DEL	C	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9729453delC	uc002gmd.1	+	1	73	c.73delC	c.(73-75)CCCfs	p.P25fs	GLP2R_uc010cog.1_RNA	NM_004246	NP_004237	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor precursor	25	Extracellular (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				lung(2)|ovary(1)	3					Glucagon recombinant(DB00040)	CCACGAGCTGCCCATGGGCAT	0.657													10	19	---	---	---	---	
ATAD5	79915	broad.mit.edu	37	17	29219463	29219463	+	Intron	DEL	G	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29219463delG	uc002hfs.1	+							NM_024857	NP_079133	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5						response to DNA damage stimulus	nucleus	ATP binding|nucleoside-triphosphatase activity			ovary(3)	3		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				aaaaaaaaaagaaTAATGCTT	0.154													8	4	---	---	---	---	
NPEPPS	9520	broad.mit.edu	37	17	45646982	45646982	+	Intron	DEL	T	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45646982delT	uc002ilr.3	+						NPEPPS_uc010wkt.1_Intron|NPEPPS_uc010wku.1_Intron|NPEPPS_uc010dba.1_Intron	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive						proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						TATTAAGAGCttttttttttt	0.169													6	4	---	---	---	---	
SRP68	6730	broad.mit.edu	37	17	74056231	74056232	+	Intron	DEL	AG	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74056231_74056232delAG	uc002jqk.1	-						SRP68_uc010wsu.1_Intron|SRP68_uc002jql.1_Intron	NM_014230	NP_055045	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa						response to drug	cytosol|endoplasmic reticulum|nucleolus|ribosome|signal recognition particle, endoplasmic reticulum targeting	RNA binding|signal recognition particle binding			ovary(1)	1						aaaaaaaaaaagaaaaaGTTTT	0.114													4	2	---	---	---	---	
EXOC7	23265	broad.mit.edu	37	17	74081959	74081960	+	Intron	INS	-	T	T			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74081959_74081960insT	uc002jqs.2	-						EXOC7_uc002jqp.1_5'Flank|EXOC7_uc010dgv.1_Intron|EXOC7_uc002jqq.2_Intron|EXOC7_uc010wsw.1_Intron|EXOC7_uc010wsx.1_Intron|EXOC7_uc002jqr.2_Intron|EXOC7_uc010wsv.1_Intron	NM_001145297	NP_001138769	Q9UPT5	EXOC7_HUMAN	exocyst complex component 7 isoform 4						exocytosis|protein transport	centriolar satellite|cytosol|exocyst|plasma membrane	protein binding				0			LUSC - Lung squamous cell carcinoma(166;0.187)			GAACGCGCTCCTATCCATCGCT	0.589													15	7	---	---	---	---	
C18orf8	29919	broad.mit.edu	37	18	21107554	21107555	+	Intron	DEL	TT	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21107554_21107555delTT	uc010xax.1	+						C18orf8_uc002kul.2_Intron|C18orf8_uc010xay.1_Intron	NM_013326	NP_037458	Q96DM3	MIC1_HUMAN	colon cancer-associated protein Mic1											ovary(1)	1	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					cTGCTATAGCtttttttttttt	0.188													4	2	---	---	---	---	
MRO	83876	broad.mit.edu	37	18	48335515	48335526	+	Intron	DEL	AAAAAAAAAAAA	-	-	rs72245727		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48335515_48335526delAAAAAAAAAAAA	uc002lew.3	-						MRO_uc010xdn.1_Intron|MRO_uc010dpa.2_Intron|MRO_uc010dpb.2_Intron|MRO_uc010dpc.2_Intron|MRO_uc002lex.3_Intron	NM_031939	NP_114145	Q9BYG7	MSTRO_HUMAN	maestro isoform a							nucleolus	binding				0		Colorectal(6;0.0596)		Colorectal(21;0.082)		actccgtctcaaaaaaaaaaaaaaaaaaaaaa	0.156													5	3	---	---	---	---	
CPLX4	339302	broad.mit.edu	37	18	56985301	56985301	+	Intron	DEL	T	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56985301delT	uc002lhy.2	-							NM_181654	NP_857637	Q7Z7G2	CPLX4_HUMAN	complexin 4 precursor						exocytosis|neurotransmitter transport	cell junction|synapse	syntaxin binding			ovary(1)	1		Colorectal(73;0.175)				TATAGATTCATTTATTATTGT	0.328													3	5	---	---	---	---	
EMR2	30817	broad.mit.edu	37	19	14866107	14866108	+	Intron	DEL	AT	-	-	rs141637468	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14866107_14866108delAT	uc002mzp.1	-						EMR2_uc010dzs.1_Intron|EMR2_uc010xnw.1_Intron|EMR2_uc002mzo.1_Intron|EMR2_uc002mzq.1_Intron|EMR2_uc002mzr.1_Intron|EMR2_uc002mzs.1_Intron|EMR2_uc002mzt.1_Intron|EMR2_uc002mzu.1_Intron|EMR2_uc010xnx.1_Intron|EMR2_uc010xny.1_Intron	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone						cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			lung(2)|ovary(1)|skin(1)	4						aaaaaaaaaaatacaaaaatta	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35864933	35864948	+	IGR	DEL	GAAGGAAGGAAGGAAG	-	-	rs147849213		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35864933_35864948delGAAGGAAGGAAGGAAG								FFAR3 (13546 upstream) : FFAR2 (74255 downstream)																							tcaaaaaacagaaggaaggaaggaaggaaggaagga	0.000													7	4	---	---	---	---	
TMC4	147798	broad.mit.edu	37	19	54671789	54671790	+	Intron	INS	-	A	A	rs76608555		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54671789_54671790insA	uc010erf.2	-						TMC4_uc002qdo.2_Intron	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1							integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					aactccgtctcaaaaaaaaaaa	0.292													4	2	---	---	---	---	
CLTCL1	8218	broad.mit.edu	37	22	19174853	19174856	+	Intron	DEL	CAAA	-	-	rs3216369		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19174853_19174856delCAAA	uc002zpb.2	-						CLTCL1_uc011agv.1_Intron|CLTCL1_uc011agw.1_Intron|CLTCL1_uc011agt.1_Intron|CLTCL1_uc011agu.1_Intron	NM_007098	NP_009029	P53675	CLH2_HUMAN	clathrin, heavy polypeptide-like 1 isoform 1						anatomical structure morphogenesis|intracellular protein transport|mitosis|positive regulation of glucose import|receptor-mediated endocytosis	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|spindle|trans-Golgi network	protein binding|signal transducer activity|structural molecule activity			ovary(4)|central_nervous_system(1)	5	Colorectal(54;0.0993)					TCTTTCAATCCAAACAGTTTTTAA	0.422			T	?	ALCL								4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20151725	20151726	+	IGR	INS	-	ACC	ACC	rs138268702	by1000genomes	TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20151725_20151726insACC								ZDHHC8 (16196 upstream) : LOC150197 (42129 downstream)																							ccaccatcactaccaccaccac	0.025													11	7	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22657416	22657419	+	Intron	DEL	ACTA	-	-	rs138873705		TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22657416_22657419delACTA	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0						ATGATGAAATACTAACTGTTTTAC	0.402													4	2	---	---	---	---	
C22orf43	51233	broad.mit.edu	37	22	23958872	23958872	+	Intron	DEL	G	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23958872delG	uc002zxf.2	-							NM_016449	NP_057533	Q6PGQ1	CV043_HUMAN	hypothetical protein LOC51233											skin(1)	1						TTGGTCCTCTGGGTTCACACA	0.458													16	11	---	---	---	---	
IL2RB	3560	broad.mit.edu	37	22	37535167	37535167	+	Frame_Shift_Del	DEL	G	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37535167delG	uc003aqv.1	-	5	509	c.378delC	c.(376-378)CCCfs	p.P126fs		NM_000878	NP_000869	P14784	IL2RB_HUMAN	interleukin 2 receptor beta precursor	126	Extracellular (Potential).				interspecies interaction between organisms|positive regulation of survival gene product expression|protein complex assembly	external side of plasma membrane|integral to plasma membrane	interleukin-2 receptor activity				0					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	GGTTCTCAAAGGGCTTGAAGT	0.607													20	12	---	---	---	---	
TBL1X	6907	broad.mit.edu	37	X	9659476	9659476	+	Intron	DEL	A	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9659476delA	uc010ndq.2	+						TBL1X_uc004csq.3_Intron|TBL1X_uc010ndr.2_Intron|TBL1X_uc004csr.2_Intron|TBL1X_uc004css.2_Intron	NM_001139466	NP_001132938	O60907	TBL1X_HUMAN	transducin beta-like 1X isoform a						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|sensory perception of sound|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein C-terminus binding|protein domain specific binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)	1		Hepatocellular(5;0.000888)				attccgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
PRPS1	5631	broad.mit.edu	37	X	106888657	106888658	+	Intron	INS	-	TTCCTT	TTCCTT			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106888657_106888658insTTCCTT	uc004ene.3	+						PRPS1_uc010npg.2_Intron|PRPS1_uc011msj.1_Intron	NM_002764	NP_002755	P60891	PRPS1_HUMAN	phosphoribosyl pyrophosphate synthetase 1						5-phosphoribose 1-diphosphate biosynthetic process|hypoxanthine biosynthetic process|nervous system development|nucleoside metabolic process|purine nucleotide biosynthetic process|pyrimidine nucleotide biosynthetic process|ribonucleoside monophosphate biosynthetic process|urate biosynthetic process	cytosol	ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity			breast(3)|large_intestine(1)	4						CAGCCTGCTGATTCCTTTTGGA	0.381													28	13	---	---	---	---	
FAM45B	55855	broad.mit.edu	37	X	129629113	129629114	+	5'UTR	DEL	GC	-	-			TCGA-66-2766-01A-01D-1522-08	TCGA-66-2766-11A-01D-1522-08									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129629113_129629114delGC	uc010nrh.2	+	1					uc004evu.2_RNA	NM_207009	NP_996892			hypothetical protein LOC404636											skin(1)	1				all cancers(201;0.0293)		CTTTAGAGCTGCGCGCCGCGGC	0.411													10	46	---	---	---	---	
